Use of bgh-sv40l tandem polya to enhance transgene expression during unidirectional gene insertion
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- REGENERON PHARMACEUTICALS INC
- Filing Date
- 2024-07-26
- Publication Date
- 2026-06-10
AI Technical Summary
Current gene therapy approaches face challenges with aberrant transcripts due to mis-splicing and transcription read-through, which can lead to inefficient and unstable expression of transgenes.
The use of unidirectional SV40 late polyadenylation signals, either alone or in combination with bovine growth hormone (BGH) polyadenylation signals, in nucleic acid constructs to enhance transgene expression by reducing unintended transcripts during unidirectional gene insertion.
This approach results in improved transgene expression levels and reduced occurrence of unintended transcripts, leading to more stable and efficient gene expression.
Smart Images

Figure US2024039827_06022025_PF_FP_ABST
Abstract
Description
Attorney Docket No. 057766 / 616958 USE OF BGH-SV40L TANDEM POLYA TO ENHANCE TRANSGENE EXPRESSION DURING UNIDIRECTIONAL GENE INSERTION CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of US Application No. 63 / 516,368, filed July 28, 2023, which is herein incorporated by reference in its entirety for all purposes. REFERENCE TO A SEQUENCE LISTING SUBMITTED AS AN XML FILE
[0002] The Sequence Listing written in file 616958SEQLIST.xml is 287,194 bytes, was created on July 23, 2024, and is hereby incorporated by reference. BACKGROUND
[0003] Current gene therapy approaches rely on episomal expression of transgenes and / or insertion in specific genomic loci. Integration in a specific locus allows for sustained expression of a transgene. However, aberrant transcripts can be a problem due to mis-splicing (e.g., from cryptic splice sites) and transcription read-through past the transgene poly(A) sequence for splicing machinery to engage splice sites in the target genomic locus. SUMMARY
[0004] Unidirectional SV40 late polyadenylation signals and combinations of such unidirectional SV40 late polyadenylation signals with other polyadenylation signals such as bovine growth hormone (BGH) polyadenylation signals are provided. Also provided are nucleic acid constructs and compositions that allow insertion of a coding sequence for a polypeptide interest into a target genomic locus and / or expression of the polypeptide interest are also provided. Also provided are methods of inserting a nucleic acid encoding a polypeptide of interest into a target genomic locus in a cell or a population of cells and methods of expressing a polypeptide of interest from a target genomic locus in a cell or a population of cells.
[0005] In one aspect, provided are compositions comprising a nucleic acid construct comprising a coding sequence for a polypeptide of interest, wherein the nucleic acid construct comprises a polyadenylation signal downstream of the coding sequence for the polypeptide ofAttorney Docket No. 057766 / 616958 interest, and wherein the polyadenylation signal comprises a simian virus 40 (SV40) polyadenylation signal. In some such compositions, the SV40 polyadenylation signal is a unidirectional SV40 late polyadenylation signal. In some such compositions, each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal. In some such compositions, the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 180. In some such compositions, the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180.
[0006] In some such compositions, the polyadenylation signal comprises a combination of the simian virus 40 (SV40) polyadenylation signal and a second polyadenylation signal. In some such compositions, the polyadenylation signal comprises a combination of the simian virus 40 (SV40) polyadenylation signal and a bovine growth hormone (BGH) polyadenylation signal. In some such compositions, the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 179. In some such compositions, the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179. In some such compositions, the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179, and wherein the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180. In some such compositions, the combination of the BGH polyadenylation signal and the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 194. In some such compositions, the combination of the BGH polyadenylation signal in tandem with the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 194.
[0007] In some such compositions, the coding sequence for the polypeptide of interest is modified to remove one or more cryptic splice sites. In some such compositions, the nucleic acid construct comprises a splice acceptor upstream of the coding sequence for the polypeptide of interest. In some such compositions, the nucleic acid construct does not comprise a homology arm. In some such compositions, the nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest. In some such compositions, the nucleic acid construct comprises from 5’ to 3’: a splice acceptor, the coding sequence for the polypeptide of interest, and the polyadenylation signal, wherein the nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest, and wherein the nucleic acidAttorney Docket No. 057766 / 616958 construct does not comprise a homology arm. In some such compositions, the nucleic acid construct comprises from 5’ to 3’: a splice acceptor, the coding sequence for the polypeptide of interest, and the polyadenylation signal, wherein the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179, and wherein the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180, or wherein the combination of the BGH polyadenylation signal and the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 194, wherein the nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest, and wherein the nucleic acid construct does not comprise a homology arm.
[0008] In some such compositions, the polypeptide of interest comprises a therapeutic polypeptide. In some such compositions, the polypeptide of interest is a secreted polypeptide. In some such compositions, the polypeptide of interest is a multidomain therapeutic protein comprising a delivery domain and an enzyme domain. In some such compositions, the delivery domain is a TfR-binding delivery domain. In some such compositions, the delivery domain is a CD63-binding delivery domain. In some such compositions, the polypeptide of interest is an intracellular polypeptide.
[0009] In some such compositions, the nucleic acid construct is in a nucleic acid vector or a lipid nanoparticle. In some such compositions, the nucleic acid construct is in the nucleic acid vector, optionally wherein the nucleic acid vector is a viral vector. In some such compositions, the nucleic acid vector is an adeno-associated viral (AAV) vector, optionally wherein the nucleic acid construct is flanked by inverted terminal repeats (ITRs) on each end, optionally wherein the ITR on at least one end comprises, consists essentially of, or consists of SEQ ID NO: 160, and optionally wherein the ITR on each end comprises, consists essentially of, or consists of SEQ ID NO: 160. In some such compositions, the AAV vector is a single-stranded AAV (ssAAV) vector. In some such compositions, the AAV vector is a recombinant AAV8 (rAAV8) vector, optionally wherein the AAV vector is a single-stranded rAAV8 vector.
[0010] In some such compositions, the composition is in combination with a nuclease agent that targets a nuclease target site in a target genomic locus. In some such compositions, the target genomic locus is an albumin gene, optionally wherein the albumin gene is a human albumin gene. In some such compositions, the nuclease target site is in intron 1 of the albumin gene. In some such compositions, the nuclease agent comprises: (a) a zinc finger nuclease (ZFN); (b) aAttorney Docket No. 057766 / 616958 transcription activator-like effector nuclease (TALEN); or (c) (i) a Cas protein or a nucleic acid encoding the Cas protein; and (ii) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence. In some such compositions, the nuclease agent comprises: (a) a Cas protein or a nucleic acid encoding the Cas protein; and (b) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence. In some such compositions, the guide RNA target sequence is in intron 1 of an albumin gene. In some such compositions, the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or the one or more DNAs encoding the guide RNA are associated with a lipid nanoparticle.
[0011] In another aspect, provided is a cell comprising any of the above compositions. In some such cells, the nucleic acid construct or the coding sequence for the polypeptide of interest is integrated into a target genomic locus, and wherein the polypeptide of interest is expressed from the target genomic locus, or wherein the nucleic acid construct or the coding sequence for the polypeptide of interest is integrated into intron 1 of an endogenous albumin locus, and wherein the polypeptide of interest is expressed from the endogenous albumin locus. In some such cells, the percentage of unintended transcripts from the target genomic locus containing comprising the integrated nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%. In some such cells, the cell is a liver cell or a hepatocyte. In some such cells, the cell is a human cell.
[0012] In another aspect, provided are methods of inserting a nucleic acid encoding a polypeptide of interest into a target genomic locus in a cell or a population of cells, comprising administering to the cell or the population of cells any of the above compositions, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, and the nucleic acid construct or the nucleic acid encoding the polypeptide of interest is inserted into the target genomic locus. In some such methods, the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or nucleic acid encodingAttorney Docket No. 057766 / 616958 the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%. In another aspect, provided are methods of expressing a polypeptide of interest from a target genomic locus in a cell or a population of cells, comprising administering to the cell or the population of cells any of the above compositions, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, the nucleic acid construct or the coding sequence for the polypeptide of interest is inserted into the target genomic locus to create a modified target genomic locus, and the polypeptide of interest is expressed from the modified target genomic locus. In some such methods, the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.
[0013] In some such methods, the cell is a liver cell or a hepatocyte or the population of cells is a population of liver cells or hepatocytes. In some such methods, the cell is a human cell or the population of cells is a population of human cells. In some such methods, the cell is in vitro or ex vivo or the population of cells is in vitro or ex vivo. In some such methods, the cell is in vivo in a subject or the population of cells is in vivo in a subject.
[0014] In another aspect, provided are methods of inserting a nucleic acid encoding a polypeptide of interest into a target genomic locus in a cell in a subject, comprising administering to the subject any of the above compositions, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, and the nucleic acid construct or the nucleic acid encoding the polypeptide of interest is inserted into the target genomic locus. In some such methods, the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%. In another aspect, provided are methods of expressing a polypeptide of interest from a target genomic locus in a cell in a subject, comprising administering to the subject any of the above compositions, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, the nucleic acid construct or the coding sequence for the polypeptide of interest isAttorney Docket No. 057766 / 616958 inserted into the target genomic locus to create a modified target genomic locus, and the polypeptide of interest is expressed from the modified target genomic locus. In some such methods, the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.
[0015] In some such methods, the cell is a liver cell or a hepatocyte. In some such methods, the cell is a human cell. In some such methods, the nucleic acid construct is administered simultaneously with the nuclease agent or the one or more nucleic acids encoding the nuclease agent. In some such methods, the nucleic acid construct is not administered simultaneously with the nuclease agent or the one or more nucleic acids encoding the nuclease agent. In some such methods, the nucleic acid construct is administered prior to the nuclease agent or the one or more nucleic acids encoding the nuclease agent. In some such methods, the nucleic acid construct is administered after the nuclease agent or the one or more nucleic acids encoding the nuclease agent.
[0016] In another aspect, provided are nucleic acids comprising a simian virus 40 (SV40) polyadenylation signal, wherein the SV40 polyadenylation signal is a unidirectional SV40 late polyadenylation signal. In some such nucleic acids, each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal. In some such nucleic acids, the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 180. In some such nucleic acids, the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180. In some such nucleic acids, the nucleic acid comprises a combination of the unidirectional SV40 late polyadenylation signal in tandem with a second polyadenylation signal, optionally wherein the second polyadenylation signal is upstream of the unidirectional SV40 late polyadenylation signal. In some such nucleic acids, the nucleic acid comprises a combination of the unidirectional SV40 late polyadenylation signal in tandem with a bovine growth hormone (BGH) polyadenylation signal, optionally wherein the BGH polyadenylation signal is upstream of the unidirectional SV40 late polyadenylation signal. In some such nucleic acids, the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%Attorney Docket No. 057766 / 616958 identical to the sequence set forth in SEQ ID NO: 179. In some such nucleic acids, the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179. In some such nucleic acids, the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179, and wherein the unidirectional SV40 late polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180. In some such nucleic acids, the combination of the BGH polyadenylation signal in tandem with the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 194. In some such nucleic acids, the combination of the BGH polyadenylation signal in tandem with the unidirectional SV40 late polyadenylation signal comprises the sequence set forth in SEQ ID NO: 194. BRIEF DESCRIPTION OF THE FIGURES
[0017] Figure 1 shows GAA activity in supernatants from PXB human hepatocytes treated with LNP-g9860 + AAVs encoding anti-CD63:GAA gene insertion templates with various modifications to cryptic splice sites and polyA sequences as compared to the original anti- CD63:GAA gene insertion template.
[0018] Figure 2 shows GAA activity in supernatants from PXB human hepatocytes treated with LNP-g9860 + AAVs encoding anti-TfR:GAA gene insertion templates with various modifications to cryptic splice sites and polyA sequences as compared to the original anti- TfR:GAA gene insertion template. DEFINITIONS
[0019] The terms “protein,” “polypeptide,” and “peptide,” used interchangeably herein, include polymeric forms of amino acids of any length, including coded and non-coded amino acids and chemically or biochemically modified or derivatized amino acids. The terms also include polymers that have been modified, such as polypeptides having modified peptide backbones. The term “domain” refers to any part of a protein or polypeptide having a particular function or structure.
[0020] Proteins are said to have an “N-terminus” and a “C-terminus.” The term “N- terminus” relates to the start of a protein or polypeptide, terminated by an amino acid with a freeAttorney Docket No. 057766 / 616958 amine group (-NH2). The term “C-terminus” relates to the end of an amino acid chain (protein or polypeptide), terminated by a free carboxyl group (-COOH).
[0021] The terms “nucleic acid” and “polynucleotide,” used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. They include single-, double-, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases.
[0022] Nucleic acids are said to have “5’ ends” and “3’ ends” because mononucleotides are reacted to make oligonucleotides in a manner such that the 5’ phosphate of one mononucleotide pentose ring is attached to the 3’ oxygen of its neighbor in one direction via a phosphodiester linkage. An end of an oligonucleotide is referred to as the “5’ end” if its 5’ phosphate is not linked to the 3’ oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is referred to as the “3’ end” if its 3’ oxygen is not linked to a 5’ phosphate of another mononucleotide pentose ring. A nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5’ and 3’ ends. In either a linear or circular DNA molecule, discrete elements are referred to as being “upstream” or 5’ of the “downstream” or 3’ elements.
[0023] The term “genomically integrated” refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence integrates into the genome of the cell. Any protocol may be used for the stable incorporation of a nucleic acid into the genome of a cell.
[0024] The term “viral vector” refers to a recombinant nucleic acid that includes at least one element of viral origin and includes elements sufficient for or permissive of packaging into a viral vector particle. The vector and / or particle can be utilized for the purpose of transferring DNA, RNA, or other nucleic acids into cells in vitro, ex vivo, or in vivo. Numerous forms of viral vectors are known.
[0025] The term “isolated” with respect to cells, tissues (e.g., liver samples), proteins, and nucleic acids includes cells, tissues (e.g., liver samples), proteins, and nucleic acids that are relatively purified with respect to other bacterial, viral, cellular, or other components that may normally be present in situ, up to and including a substantially pure preparation of the cells, tissues (e.g., liver samples), proteins, and nucleic acids. The term “isolated” also includes cells,Attorney Docket No. 057766 / 616958 tissues (e.g., liver samples), proteins, and nucleic acids that have no naturally occurring counterpart, have been chemically synthesized and are thus substantially uncontaminated by other cells, tissues (e.g., liver samples), proteins, and nucleic acids, or has been separated or purified from most other components (e.g., cellular components) with which they are naturally accompanied (e.g., other cellular proteins, polynucleotides, or cellular components).
[0026] The term “wild type” includes entities having a structure and / or activity as found in a normal (as contrasted with mutant, diseased, altered, or so forth) state or context. Wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).
[0027] The term “endogenous sequence” refers to a nucleic acid sequence that occurs naturally within a cell or animal. For example, an endogenous ALB sequence of a human refers to a native ALB sequence that naturally occurs at the ALB locus in the human.
[0028] “Exogenous” molecules or sequences include molecules or sequences that are not normally present in a cell in that form. Normal presence includes presence with respect to the particular developmental stage and environmental conditions of the cell. An exogenous molecule or sequence, for example, can include a mutated version of a corresponding endogenous sequence within the cell, such as a humanized version of the endogenous sequence, or can include a sequence corresponding to an endogenous sequence within the cell but in a different form (i.e., not within a chromosome). In contrast, endogenous molecules or sequences include molecules or sequences that are normally present in that form in a particular cell at a particular developmental stage under particular environmental conditions.
[0029] The term “heterologous” when used in the context of a nucleic acid or a protein indicates that the nucleic acid or protein comprises at least two segments that do not naturally occur together in the same molecule. For example, the term “heterologous,” when used with reference to segments of a nucleic acid or segments of a protein, indicates that the nucleic acid or protein comprises two or more sub-sequences that are not found in the same relationship to each other (e.g., joined together) in nature. As one example, a “heterologous” region of a nucleic acid vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a nucleic acid vector could include a coding sequence flanked by sequences not found in association with the coding sequence in nature. Likewise, a “heterologous” region of a protein is a segment of amino acids within or attached to another peptide molecule that is not found inAttorney Docket No. 057766 / 616958 association with the other peptide molecule in nature (e.g., a fusion protein, or a protein with a tag). Similarly, a nucleic acid or protein can comprise a heterologous label or a heterologous secretion or localization sequence.
[0030] “Codon optimization” (i.e., “codon optimized” sequences) takes advantage of the degeneracy of codons, as exhibited by the multiplicity of three-base pair codon combinations that specify an amino acid, and generally includes a process of modifying a nucleic acid sequence for enhanced expression in particular host cells by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell while maintaining the native amino acid sequence. For example, a nucleic acid encoding a polypeptide of interest can be modified to substitute codons having a higher frequency of usage in a given prokaryotic or eukaryotic cell, including a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, or any other host cell, as compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, at the “Codon Usage Database.” These tables can be adapted in a number of ways. See Nakamura et al. (2000) Nucleic Acids Res. 28(1):292, herein incorporated by reference in its entirety for all purposes. Computer algorithms for codon optimization of a particular sequence for expression in a particular host are also available (see, e.g., Gene Forge).
[0031] The term “locus” refers to a specific location of a gene (or significant sequence), DNA sequence, polypeptide-encoding sequence, or position on a chromosome of the genome of an organism. For example, an “ALB locus” may refer to the specific location of an ALB gene, ALB DNA sequence, albumin-encoding sequence, or ALB position on a chromosome of the genome of an organism that has been identified as to where such a sequence resides. An “ALB locus” may comprise a regulatory element of an ALB gene, including, for example, an enhancer, a promoter, 5’ and / or 3’ untranslated region (UTR), or a combination thereof.
[0032] The term “gene” refers to DNA sequences in a chromosome that may contain, if naturally present, at least one coding and at least one non-coding region. The DNA sequence in a chromosome that codes for a product (e.g., but not limited to, an RNA product and / or a polypeptide product) can include the coding region interrupted with non-coding introns and sequence located adjacent to the coding region on both the 5’ and 3’ ends such that the gene corresponds to the full-length mRNA (including the 5’ and 3’ untranslated sequences).Attorney Docket No. 057766 / 616958 Additionally, other non-coding sequences including regulatory sequences (e.g., but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequence, and matrix attachment regions may be present in a gene. These sequences may be close to the coding region of the gene (e.g., but not limited to, within 10 kb) or at distant sites, and they influence the level or rate of transcription and translation of the gene.
[0033] The term “allele” refers to a variant form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a chromosome. A diploid organism has two alleles at each genetic locus. Each pair of alleles represents the genotype of a specific genetic locus. Genotypes are described as homozygous if there are two identical alleles at a particular locus and as heterozygous if the two alleles differ.
[0034] A “promoter” is a regulatory region of DNA usually comprising a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular polynucleotide sequence. A promoter may additionally comprise other regions which influence the transcription initiation rate. The promoter sequences disclosed herein modulate transcription of an operably linked polynucleotide. A promoter can be active in one or more of the cell types disclosed herein (e.g., a mouse cell, a rat cell, a pluripotent cell, a one-cell stage embryo, a differentiated cell, or a combination thereof). A promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters can be found, for example, in WO 2013 / 176772, herein incorporated by reference in its entirety for all purposes.
[0035] “Operable linkage” or being “operably linked” includes juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. For example, a promoter can be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage can include such sequences being contiguous with each other or acting in trans (e.g., a regulatory sequence can act at a distance to control transcription of the coding sequence).Attorney Docket No. 057766 / 616958
[0036] The methods and compositions provided herein employ a variety of different components. Some components throughout the description can have active variants and fragments. The term “functional” refers to the innate ability of a protein or nucleic acid (or a fragment or variant thereof) to exhibit a biological activity or function. The biological functions of functional fragments or variants may be the same or may in fact be changed (e.g., with respect to their specificity or selectivity or efficacy) in comparison to the original molecule, but with retention of the molecule’s basic biological function.
[0037] The term “variant” refers to a nucleotide sequence differing from the sequence most prevalent in a population (e.g., by one nucleotide) or a protein sequence different from the sequence most prevalent in a population (e.g., by one amino acid).
[0038] The term “fragment,” when referring to a protein, means a protein that is shorter or has fewer amino acids than the full-length protein. The term “fragment,” when referring to a nucleic acid, means a nucleic acid that is shorter or has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, when referring to a protein fragment, an N- terminal fragment (i.e., removal of a portion of the C-terminal end of the protein), a C-terminal fragment (i.e., removal of a portion of the N-terminal end of the protein), or an internal fragment (i.e., removal of a portion of each of the N-terminal and C-terminal ends of the protein). A fragment can be, for example, when referring to a nucleic acid fragment, a 5’ fragment (i.e., removal of a portion of the 3’ end of the nucleic acid), a 3’ fragment (i.e., removal of a portion of the 5’ end of the nucleic acid), or an internal fragment (i.e., removal of a portion each of the 5’ and 3’ ends of the nucleic acid).
[0039] “Sequence identity” or “identity” in the context of two polynucleotides or polypeptide sequences refers to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins, residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity.” Means for making this adjustment are wellAttorney Docket No. 057766 / 616958 known. Typically, this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).
[0040] “Percentage of sequence identity” includes the value determined by comparing two optimally aligned sequences (greatest number of perfectly matched residues) over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence includes a linked heterologous sequence), the comparison window is the full length of the shorter of the two sequences being compared.
[0041] Unless otherwise stated, sequence identity / similarity values include the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. “Equivalent program” includes any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
[0042] The term “conservative amino acid substitution” refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine, or leucine for another non-polar residue. Likewise, examples of conservative substitutions include the substitution of one polarAttorney Docket No. 057766 / 616958 (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, or between glycine and serine. Additionally, the substitution of a basic residue such as lysine, arginine, or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic residue are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as isoleucine, valine, leucine, alanine, or methionine for a polar (hydrophilic) residue such as cysteine, glutamine, glutamic acid or lysine and / or a polar residue for a non-polar residue. Typical amino acid categorizations are summarized below.
[0043] Table 1. Amino Acid Categorizations. Alanine Ala A Nonpolar Neutral 1.8 Arginine Arg R Polar Positive -4.5 Asparagine Asn N Polar Neutral -3.5 Aspartic acid Asp D Polar Negative -3.5 Cysteine Cys C Nonpolar Neutral 2.5 Glutamic acid Glu E Polar Negative -3.5 Glutamine Gln Q Polar Neutral -3.5 Glycine Gly G Nonpolar Neutral -0.4 Histidine His H Polar Positive -3.2 Isoleucine Ile I Nonpolar Neutral 4.5 Leucine Leu L Nonpolar Neutral 3.8 Lysine Lys K Polar Positive -3.9 Methionine Met M Nonpolar Neutral 1.9 Phenylalanine Phe F Nonpolar Neutral 2.8 Proline Pro P Nonpolar Neutral -1.6 Serine Ser S Polar Neutral -0.8 Threonine Thr T Polar Neutral -0.7 Tryptophan Trp W Nonpolar Neutral -0.9 Tyrosine Tyr Y Polar Neutral -1.3 Valine Val V Nonpolar Neutral 4.2
[0044] A “homologous” sequence (e.g., nucleic acid sequence) includes a sequence that is either identical or substantially similar to a known reference sequence, such that it is, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the known reference sequence. Homologous sequences can include, for example, orthologous sequence and paralogous sequences. Homologous genes, for example, typically descend from a common ancestral DNA sequence, either through a speciationAttorney Docket No. 057766 / 616958 event (orthologous genes) or a genetic duplication event (paralogous genes). “Orthologous” genes include genes in different species that evolved from a common ancestral gene by speciation. Orthologs typically retain the same function in the course of evolution. “Paralogous” genes include genes related by duplication within a genome. Paralogs can evolve new functions in the course of evolution.
[0045] The term “in vitro” includes artificial environments and to processes or reactions that occur within an artificial environment (e.g., a test tube or an isolated cell or cell line). The term “in vivo” includes natural environments (e.g., a cell or organism or body) and to processes or reactions that occur within a natural environment. The term “ex vivo” includes cells that have been removed from the body of an individual and processes or reactions that occur within such cells.
[0046] As used herein, the term “neonatal” in the context of humans covers human subjects up to or under the age of 1 year (52 weeks), preferably up to or under the age of 24 weeks, more preferably up to or under the age of 12 weeks, more preferably up to or under the age of 8 weeks, and even more preferably up to or under the age of 4 weeks. In certain embodiments, a neonatal human subject is up to 4 weeks of age. In certain embodiments, a neonatal human subject is up to 8 weeks of age. In another embodiment, a neonatal human subject is within 3 weeks after birth. In another embodiment, a neonatal human subject is within 2 weeks after birth. In another embodiment, a neonatal human subject is within 1 week after birth. In another embodiment, a neonatal human subject is within 7 days after birth. In another embodiment, a neonatal human subject is within 6 days after birth. In another embodiment, a neonatal human subject is within 5 days after birth. In another embodiment, a neonatal human subject is within 4 days after birth. In another embodiment, a neonatal human subject is within 3 days after birth. In another embodiment, a neonatal human subject is within 2 days after birth. In another embodiment, a neonatal human subject is within 1 day after birth. The time windows disclosed above are for human subjects and are also meant to cover the corresponding developmental time windows for other animals. As used herein, a “neonatal cell” is a cell of a neonatal subject, and a population of neonatal cells is a population of cells of a neonatal subject.
[0047] As used herein, a “control” as in a control sample or a control subject is a comparator for a measurement, e.g., a diagnostic measurement of a sign or symptom of a disease. In certain embodiments, a control can be a subject sample from the same subject an earlier time point, e.g.,Attorney Docket No. 057766 / 616958 before a treatment intervention. In certain embodiments, a control can be a measurement from a normal subject, i.e., a subject not having the disease of the treated subject, to provide a normal control, e.g., an enzyme concentration or activity in a subject sample. In certain embodiments, a normal control can be a population control, i.e., the average of subjects in the general population. In certain embodiments, a control can be an untreated subject with the same disease. In certain embodiments, a control can be a subject treated with a different therapy, e.g., the standard of care. In certain embodiments, a control can be a subject or a population of subjects from a natural history study of subjects with the disease of the subject being compared. In certain embodiments, the control is matched for certain factors to the subject being tested, e.g., age, gender. In certain embodiments, a control may be a control level for a particular lab, e.g., a clinical lab. Selection of an appropriate control is within the ability of those of skill in the art.
[0048] Compositions or methods “comprising” or “including” one or more recited elements may include other elements not specifically recited. For example, a composition that “comprises” or “includes” a protein may contain the protein alone or in combination with other ingredients. The transitional phrase “consisting essentially of” means that the scope of a claim is to be interpreted to encompass the specified elements recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term “consisting essentially of” when used in a claim of this invention is not intended to be interpreted to be equivalent to “comprising.”
[0049] “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur and that the description includes instances in which the event or circumstance occurs and instances in which the event or circumstance does not.
[0050] Designation of a range of values includes all integers within or defining the range, and all subranges defined by integers within the range. For example, 5-10 nucleotides is understood as 5, 6, 7, 8, 9, or 10 nucleotides, whereas 5-10% is understood to contain 5% and all possible values through 10%.
[0051] At least 17 nucleotides of a 20 nucleotide sequence is understood to include 17, 18, 19, or 20 nucleotides of the sequence provided, thereby providing an upper limit even if one is not specifically provided as it would be clearly understood. Similarly, up to 3 nucleotides would be understood to encompass 0, 1, 2, or 3 nucleotides, providing a lower limit even if one is notAttorney Docket No. 057766 / 616958 specifically provided. When “at least,” “up to,” or other similar language modifies a number, it can be understood to modify each number in the series.
[0052] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex region of “no more than 2 nucleotide base pairs” has a 2, 1, or 0 nucleotide base pairs. When “no more than” or “less than” is present before a series of numbers or a range, it is understood that each of the numbers in the series or range is modified.
[0053] As used herein, “loss of function” is understood as an activity not being present, e.g., an enzyme activity not being present, for any reason. In certain embodiments, the absence of activity may be due to the absence of a protein having a function, e.g., protein is not transcribed or translated, protein is translated but not stable or not transported appropriately, either intracellularly or systemically. In certain embodiments, the absence of activity may be due to the presence of a mutation, e.g., point mutation, truncation, abnormal splicing, such that a protein is present, but not functional. A loss of function can be a partial or complete loss of function. In certain embodiments, various degrees of loss of function may be known that result in various conditions, severity of disease, or age of onset. As used herein, a loss of function is preferably not a transient loss of function, e.g., due to a stress response or other response that results in a temporary loss of a functional protein. Therapeutic interventions to correct for a loss of function of a protein may include compensation for the loss of function with the protein that is deficient, or with proteins that compensate for the loss of function, but that have a different sequence or structure than the protein for which the function is lost. It is understood that a loss of function of one protein may be compensated for by providing or altering the activity of another protein in the same biological pathway. In certain embodiments, the protein to compensate for the loss of function includes one or more of a truncation, mutation, or non-native sequence to direct trafficking of the protein, either intracellularly or systemically, to overcome the loss of function of the protein. The therapeutic intervention may or may not correct the loss of function of the protein in all cell types or tissues. The therapeutic intervention may include expression of the protein to compensate for a loss of function at a site remote from where the protein lacking function is typically expressed, e.g., where the deficiency results in dysfunction of a cell or organ. The therapeutic intervention may include expression of the protein in the liver toAttorney Docket No. 057766 / 616958 compensate for a loss of function at a site remote from the liver. A number of genetic mutations have been linked with specific loss of function mutations, in both humans and other species.
[0054] As used herein, “enzyme deficiency” is understood as an insufficient level of an enzyme activity due to a loss of function of the protein. An enzyme deficiency can be partial or total, and may result in differences in time of onset or severity of signs or symptoms of the enzyme deficiency depending on the level and site of the loss of function. As used herein, enzyme deficiency is preferably not a transient enzyme deficiency due to stress or other factors. A number of genetic mutations have been linked with enzyme deficiencies, in both humans and other species. In certain embodiments, enzyme deficiencies result in inborn errors of metabolism. In certain embodiments, enzyme deficiencies result in lysosomal storage diseases. In certain embodiments, enzyme deficiencies result in galactosemia. In certain embodiments, enzyme deficiencies result in bleeding disorders.
[0055] As used herein, it is understood that when the maximum amount of a value is represented by 100% (e.g., 100% inhibition or 100% encapsulation) that the value is limited by the method of detection. For example, 100% inhibition is understood as inhibition to a level below the level of detection of the assay, and 100% encapsulation is understood as no material intended for encapsulation can be detected outside the vesicles.
[0056] Unless otherwise apparent from the context, the term “about” encompasses values ± 5% of a stated value. In certain embodiments, the term “about” is understood to encompass tolerated variation or error within the art, e.g., 2 standard deviations from the mean, or the sensitivity of the method used to take a measurement, or a percent of a value as tolerated in the art, e.g., with age. When “about” is present before the first value of a series, it can be understood to modify each value in the series.
[0057] The term “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).
[0058] The term “or” refers to any one member of a particular list and also includes any combination of members of that list.
[0059] The singular forms of the articles “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a protein” or “at least one protein” can include a plurality of proteins, including mixtures thereof.Attorney Docket No. 057766 / 616958
[0060] Statistically significant means p ≤0.05.
[0061] In the event of a conflict between a sequence in the application and an indicated accession number or position in an accession number, the sequence in the application predominates. DETAILED DESCRIPTION I. Overview
[0062] Unidirectional SV40 late polyadenylation signals and combinations of such unidirectional SV40 late polyadenylation signals with other polyadenylation signals such as bovine growth hormone (BGH) polyadenylation signals are provided. The polyadenylation signals can be used in nucleic acid constructs and compositions that allow insertion of a coding sequence for a polypeptide interest into a target genomic locus and / or expression of the polypeptide interest. The nucleic acid constructs and compositions can be used in methods of integration of a coding sequence for a polypeptide interest into a target genomic locus and methods of expression of a polypeptide interest in a cell.
[0063] Unexpectedly, we observed fold-level increases in the level of activity of a polypeptide of interest encoded by a transgene following insertion into a target genomic locus when using a tandem poly(A) sequence comprising a bovine growth hormone poly(A) and a unidirectional variant of SV40 poly(A) in the “late” orientation (collectively referred to as bGH- SV40Luni). II. Compositions for Inserting Nucleic Acid Constructs Encoding and for Expressing Polypeptides of Interest in Cells
[0064] Unidirectional SV40 late polyadenylation signals and combinations of such unidirectional SV40 late polyadenylation signals with other polyadenylation signals such as bovine growth hormone (BGH) polyadenylation signals are provided. The polyadenylation signals can be used in nucleic acid constructs and compositions that allow insertion of a coding sequence for a polypeptide interest into a target genomic locus and / or expression of the polypeptide interest. Also provided herein are nucleic acid constructs and compositions that allow insertion of a coding sequence for a polypeptide of interest into a target genomic locus such as an endogenous albumin (ALB) locus and / or expression of the coding sequence for theAttorney Docket No. 057766 / 616958 polypeptide of interest. The nucleic acid constructs and compositions can be used in methods for integration into a target genomic locus and / or expression in a cell or a subject. Also provided are nuclease agents (e.g., targeting an endogenous ALB locus) or nucleic acids encoding nuclease agents to facilitate integration of the nucleic acid constructs into a target genomic locus such as an endogenous ALB locus.
[0065] Also provided are compositions or combinations or kits comprising a nucleic acid construct comprising a coding sequence for the polypeptide of interest in combination with a nuclease agent or one or more nucleic acids encoding the nuclease agent, wherein the nuclease agent targets a nuclease target site in a target genomic locus. As used herein, the term “in combination with” means that additional component(s) may be administered prior to, concurrent with, or after the administration of the nucleic acid construct. The different components of the combination can be formulated into a single composition, e.g., for simultaneous delivery, or formulated separately into two or more compositions (e.g., a kit including each component, for example, wherein the further agent is in a separate formulation). A. Polyadenylation Signals and Nucleic Acids Comprising Polyadenylation Signals
[0066] Unidirectional simian virus 40 (SV40) late polyadenylation signals and combinations of such unidirectional SV40 late polyadenylation signals with other polyadenylation signals such as bovine growth hormone (BGH) polyadenylation signals are provided. The polyadenylation signals can be used in nucleic acid constructs and compositions that allow insertion of a coding sequence for a polypeptide interest into a target genomic locus and / or expression of the polypeptide interest.
[0067] Provided herein are unidirectional SV40 late polyadenylation signals. The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. The unidirectional SV40 late polyadenylation signals described herein are positioned in the “late” orientation, with the polyadenylation signals present in the “early” orientation mutated or inactivated. In some embodiments, each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal. For example, the two conserved AATAAA poly(A) signals present in the SV40 “early” poly(A) to AATCAA. In some embodiments, the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%Attorney Docket No. 057766 / 616958 identical to the sequence set forth in SEQ ID NO: 180. In some embodiments, the unidirectional SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 180.
[0068] The unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) one or more additional polyadenylation signals. Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. For example, the unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) a bovine growth hormone (BGH) polyadenylation signal, optionally wherein the BGH polyadenylation signal is upstream of (5’ of) the unidirectional SV40 late polyadenylation signal. In some embodiments, the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 179. In some embodiments, the BGH polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 179. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 194. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 194.
[0069] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0070] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40Attorney Docket No. 057766 / 616958 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4, or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183. B. Nucleic Acid Constructs Encoding a Polypeptide of Interest
[0071] The compositions and methods described herein include the use of a nucleic acid construct that comprises a coding sequence for a polypeptide of interest (e.g., an exogenous polypeptide coding sequence). The compositions and methods described herein can also include the use of a nucleic acid construct that comprises a polypeptide of interest coding sequence or a reverse complement of the polypeptide of interest coding sequence (e.g., an exogenous polypeptide coding sequence or a reverse complement of the exogenous polypeptide coding sequence). Such nucleic acid constructs can be for insertion into a target genomic locus or into a cleavage site created by a nuclease agent or CRISPR / Cas system as disclosed elsewhere herein. The term cleavage site includes a DNA sequence at which a nick or double-strand break is created by a nuclease agent (e.g., a Cas9 protein complexed with a guide RNA). In some embodiments, a double-stranded break is created by a Cas9 protein complexed with a guide RNA, e.g., a Spy Cas9 protein complexed with a Spy Cas9 guide RNA. In some cases, the polypeptide of interest is an exogenous polypeptide as defined herein.
[0072] The constructs disclosed herein comprise a polyadenylation sequence or polyadenylation tail sequence (e.g., downstream or 3’ of a polypeptide of interest coding sequence). In some embodiments, unidirectional SV40 late polyadenylation signals are used. The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. The unidirectional SV40 late polyadenylation signals described herein are positioned in the “late” orientation, with the polyadenylation signals present in the “early” orientation mutated or inactivated. In some embodiments, each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal. For example, the two conserved AATAAA poly(A) signals present in the SV40 “early” poly(A) to AATCAA. In some embodiments, the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 180. In some embodiments, the unidirectionalAttorney Docket No. 057766 / 616958 SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 180.
[0073] The unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) one or more additional polyadenylation signals. Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. For example, the unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) a bovine growth hormone (BGH) polyadenylation signal, optionally wherein the BGH polyadenylation signal is upstream of (5’ of) the unidirectional SV40 late polyadenylation signal. In some embodiments, the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 179. In some embodiments, the BGH polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 179. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 194. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 194.
[0074] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0075] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4,Attorney Docket No. 057766 / 616958 or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183.
[0076] Methods of designing a suitable polyadenylation tail sequence are well-known. The polyadenylation tail sequence can be encoded, for example, as a “poly-A” stretch downstream of the polypeptide of interest coding sequence. A poly-A tail can comprise, for example, at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In a specific example, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. Methods of designing a suitable polyadenylation tail sequence and / or polyadenylation signal sequence are well known. For example, the polyadenylation signal sequence AAUAAA is commonly used in mammalian systems, although variants such as UAUAAA or AU / GUAAA have been identified. See, e.g., Proudfoot (2011) Genes & Dev. 25(17):1770-82, herein incorporated by reference in its entirety for all purposes. The term polyadenylation signal sequence refers to any sequence that directs termination of transcription and addition of a poly-A tail to the mRNA transcript. In eukaryotes, transcription terminators are recognized by protein factors, and termination is followed by polyadenylation, a process of adding a poly(A) tail to the mRNA transcripts in presence of the poly(A) polymerase. The mammalian poly(A) signal typically consists of a core sequence, about 45 nucleotides long, that may be flanked by diverse auxiliary sequences that serve to enhance cleavage and polyadenylation efficiency. The core sequence consists of a highly conserved upstream element (AATAAA or AAUAAA) in the mRNA, referred to as a poly A recognition motif or poly A recognition sequence), recognized by cleavage and polyadenylation- specificity factor (CPSF), and a poorly defined downstream region (rich in Us or Gs and Us), bound by cleavage stimulation factor (CstF). Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. In one example, the polyadenylation signal is a simian virus 40 (SV40) late polyadenylation signal. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 173, 169, or 161. For example, theAttorney Docket No. 057766 / 616958 polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 169 or 161. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 169. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 173. In another example, the polyadenylation signal is a bovine growth hormone (BGH) polyadenylation signal or a CpG depleted BGH polyadenylation signal. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 162.
[0077] In one example, the polyadenylation signal can comprise a BGH polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179. In another example, the polyadenylation signal can comprise an SV40 polyadenylation signal. For example, the SV40 polyadenylation signal can be a unidirectional SV40 late polyadenylation signal. For example, the transcription terminator sequences that are present in the “early” inverse orientation of SV40 can be mutated (e.g., by mutating the reverse strand AAUAAA sequences to AAUCAA). The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. For example, the unidirectional SV40 late polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 180. In another example, a synthetic polyadenylation signal can be used. For example, the synthetic polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 181. In another example, two or more polyadenylation signals can be used in combination. For example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and an SV40 polyadenylation signal (e.g., an SV40 late polyadenylation signal, such as a unidirectional SV40 late polyadenylation signal). For example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and a unidirectional SV40 late polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179, and the unidirectional SV40 late polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 180. In a specific example, the BGH polyadenylation signal can be upstream (5’) of the SV40 polyadenylation signal (e.g., unidirectional SV40 late polyadenylation signal). For example, the combined polyadenylation signal can comprise the sequence set forth in SEQ ID NO: 194. In another example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and aAttorney Docket No. 057766 / 616958 synthetic polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179, and the synthetic polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 181. In some embodiments, the nucleic acid construct is a unidirectional construct.
[0078] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0079] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4, or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183.
[0080] The length of the nucleic acid constructs disclosed herein can vary. The construct can be, for example, from about 1 kb to about 5 kb, such as from about 1 kb to about 4.5 kb or about 1 kb to about 4 kb. An exemplary nucleic acid construct is between about 1 kb to about 5 kb in length or between about 1 kb to about 4 kb in length. Alternatively, a nucleic acid construct can be between about 1 kb to about 1.5 kb, about 1.5 kb to about 2 kb, about 2 kb to about 2.5 kb, about 2.5 kb to about 3 kb, about 3 kb to about 3.5 kb, about 3.5 kb to about 4 kb, about 4 kb to about 4.5 kb, or about 4.5 kb to about 5 kb in length. Alternatively, a nucleic acid construct can be, for example, no more than 5 kb, no more than 4.5 kb, no more than 4 kb, no more than 3.5 kb, no more than 3 kb, or no more than 2.5 kb in length.
[0081] The constructs can comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), can be single-stranded, double-stranded, or partially single-stranded and partially double-stranded, and can be introduced into a host cell in linear or circular (e.g., minicircle) form. See, e.g., US 2010 / 0047805, US 2011 / 0281361, and US 2011 / 0207221, each of which is herein incorporated by reference in their entirety for all purposes. In a specific example, the nucleic acid construct is single-stranded (e.g., single-stranded DNA). If introduced in linearAttorney Docket No. 057766 / 616958 form, the ends of the construct can be protected (e.g., from exonucleolytic degradation) by known methods. For example, one or more dideoxynucleotide residues can be added to the 3′ terminus of a linear molecule and / or self-complementary oligonucleotides can be ligated to one or both ends. See, e.g., Chang et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:4959-4963 and Nehls et al. (1996) Science 272:886-889, each of which is herein incorporated by reference in their entirety for all purposes. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues. A construct can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters, and genes encoding antibiotic resistance. A construct may omit viral elements. Moreover, constructs can be introduced as a naked nucleic acid, can be introduced as a nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, adeno-associated virus (AAV), herpesvirus, retrovirus, or lentivirus).
[0082] The constructs disclosed herein can be modified on either or both ends to include one or more suitable structural features as needed and / or to confer one or more functional benefit. For example, structural modifications can vary depending on the method(s) used to deliver the constructs disclosed herein to a host cell (e.g., use of viral vector delivery or packaging into lipid nanoparticles for delivery). Such modifications include, for example, terminal structures such as inverted terminal repeats (ITR), hairpin, loops, and other structures such as toroids. For example, the constructs disclosed herein can comprise one, two, or three ITRs or can comprise no more than two ITRs. Various methods of structural modifications are known.
[0083] Some constructs may be inserted so that their expression is driven by the endogenous promoter at the insertion site (e.g., the endogenous ALB promoter when the construct is integrated into the host cell’s ALB locus). Such constructs may not comprise a promoter that drives the expression of the polypeptide of interest. For example, the expression of the polypeptide of interest can be driven by a promoter of the host cell (e.g., the endogenous ALB promoter when the transgene is integrated into a host cell’s ALB locus). In such cases, the construct may lack control elements (e.g., promoter and / or enhancer) that drive its expression (e.g., a promoterless construct). In other cases, the construct may comprise a promoter and / or enhancer, for example, a constitutive promoter or an inducible or tissue-specific (e.g., liver- orAttorney Docket No. 057766 / 616958 platelet-specific) promoter that drives expression of the polypeptide of interest in an episome or upon integration. For example, the construct may be a construct for expression (e.g., an episomal construct) but not for insertion. In some embodiments, the construct is not for insertion. Non- limiting exemplary constitutive promoters include cytomegalovirus immediate early promoter (CMV), simian virus (SV40) promoter, adenovirus major late (MLP) promoter, Rous sarcoma virus (RSV) promoter, mouse mammary tumor virus (MMTV) promoter, phosphoglycerate kinase (PGK) promoter, elongation factor-alpha (EF1a) promoter, ubiquitin promoters, actin promoters, tubulin promoters, immunoglobulin promoters, a functional fragment thereof, or a combination of any of the foregoing. For example, the promoter may be a CMV promoter or a truncated CMV promoter. In another example, the promoter may be an EF1a promoter. Non- limiting exemplary inducible promoters include those inducible by heat shock, light, chemicals, peptides, metals, steroids, antibiotics, or alcohol. The inducible promoter may be one that has a low basal (non-induced) expression level, such as the Tet-On®promoter (Clontech). Although not required for expression, the constructs may comprise transcriptional or translational regulatory sequences such as promoters, enhancers, insulators, internal ribosome entry sites, additional sequences encoding peptides, and / or polyadenylation signals. The construct may comprise a sequence encoding a polypeptide of interest downstream of and operably linked to a signal sequence encoding a signal peptide. In some examples, the nucleic acid construct works in homology-independent insertion of a nucleic acid that encodes a polypeptide of interest. Such nucleic acid constructs can work, for example, in non-dividing cells (e.g., cells in which non- homologous end joining (NHEJ), not homologous recombination (HR), is the primary mechanism by which double-stranded DNA breaks are repaired) or dividing cells (e.g., actively dividing cells). Such constructs can be, for example, homology-independent donor constructs. In preferred embodiments, promoters and other regulatory sequences are appropriate for use in humans, e.g., recognized by regulatory factors in human cells, e.g., in human liver cells, and acceptable to regulatory authorities for use in humans. Examples of liver-specific promoters include TTR promoters, such as human or mouse TTR promoters. In one example, the construct may comprise a TTR promoter, such as a mouse TTR promoter or a human TTR promoter (e.g., the coding sequence for the polypeptide of interest is operably linked to the TTR promoter). In one example, the construct may comprise a SERPINA1 enhancer, such as a mouse SERPINA1 enhancer or a human SERPINA1 enhancer (e.g., the coding sequence for the polypeptide ofAttorney Docket No. 057766 / 616958 interest is operably linked to the SERPINA1 enhancer). In one example, the construct may comprise a TTR promoter and a SERPINA1 enhancer, such as a human SERPINA1 enhancer and a mouse TTR promoter (e.g., the coding sequence for the polypeptide of interest is operably linked to the SERPINA1 enhancer and the TTR promoter).
[0084] The constructs disclosed herein can be modified to include or exclude any suitable structural feature as needed for any particular use and / or that confers one or more desired function. For example, some constructs disclosed herein do not comprise a homology arm. Some constructs disclosed herein are capable of insertion into a target genomic locus or a cut site in a target DNA sequence for a nuclease agent (e.g., capable of insertion into a safe harbor gene, such as an ALB locus) by non-homologous end joining. For example, such constructs can be inserted into a blunt end double-strand break following cleavage with a nuclease agent (e.g., CRISPR / Cas system, e.g., a SpyCas9 CRISPR / Cas system) as disclosed herein. In a specific example, the construct can be delivered via AAV and can be capable of insertion by non-homologous end joining (e.g., the construct does not comprise a homology arm).
[0085] In a particular example, the construct can be inserted via homology-independent targeted integration. For example, coding sequence for the polypeptide of interest in the construct can be flanked on each side by a target site for a nuclease agent (e.g., the same target site as in the target DNA sequence for targeted insertion (e.g., in a safe harbor gene), and the same nuclease agent being used to cleave the target DNA sequence for targeted insertion). The nuclease agent can then cleave the target sites flanking the polypeptide of interest coding sequence. In a specific example, the construct is delivered AAV-mediated delivery, and cleavage of the target sites flanking the coding sequence for the polypeptide of interest can remove the inverted terminal repeats (ITRs) of the AAV. In some instances, the target DNA sequence for targeted insertion (e.g., target DNA sequence in a safe harbor locus such as a gRNA target sequence including the flanking protospacer adjacent motif) is no longer present if the polypeptide of interest coding sequence is inserted into the cut site or target DNA sequence in the correct orientation but it is reformed if the coding sequence for the polypeptide of interest is inserted into the cut site or target DNA sequence in the opposite orientation. This can help ensure that the coding sequence for the polypeptide of interest is inserted in the correct orientation for expression.
[0086] The constructs disclosed herein may also comprise splice acceptor sites (e.g.,Attorney Docket No. 057766 / 616958 operably linked to the coding sequence for the polypeptide of interest, such as upstream or 5’ of the coding sequence for the polypeptide of interest). The splice acceptor site can, for example, comprise NAG or consist of NAG. In a specific example, the splice acceptor is an ALB splice acceptor (e.g., an ALB splice acceptor used in the splicing together of exons 1 and 2 of ALB (i.e., ALB exon 2 splice acceptor)). For example, such a splice acceptor can be derived from the human ALB gene. In another example, the splice acceptor can be derived from the mouse Alb gene (e.g., an ALB splice acceptor used in the splicing together of exons 1 and 2 of mouse Alb (i.e., mouse Alb exon 2 splice acceptor)). In another example, the splice acceptor is a splice acceptor from a gene encoding the polypeptide of interest (e.g., a GAA splice acceptor). For example, such a splice acceptor can be derived from the human GAA gene. Alternatively, such a splice acceptor can be derived from the mouse GAA gene. Additional suitable splice acceptor sites useful in eukaryotes, including artificial splice acceptors, are well-known. See, e.g., Shapiro et al. (1987) Nucleic Acids Res. 15:7155-7174 and Burset et al. (2001) Nucleic Acids Res. 29:255-259, each of which is herein incorporated by reference in its entirety for all purposes. In a specific example, the splice acceptor is a mouse Alb exon 2 splice acceptor. In a specific example, the splice acceptor can comprise, consist essentially of, or consist of SEQ ID NO: 163.
[0087] In some examples, the nucleic acid constructs disclosed herein can be bidirectional constructs, which are described in more detail below. In some examples, the nucleic acid constructs disclosed herein can be unidirectional constructs, which are described in more detail below. Likewise, in some examples, the nucleic acid constructs disclosed herein can be in a vector (e.g., viral vector, such as AAV, or rAAV8) and / or a lipid nanoparticle as described in more detail elsewhere herein.
[0088] When specific construct sequences are disclosed herein, they are meant to encompass the sequence disclosed or the reverse complement of the sequence. For example, if a construct disclosed herein consists of the hypothetical sequence 5’-CTGGACCGA-3’, it is also meant to encompass the reverse complement of that sequence (5’-TCGGTCCAG-3’). Likewise, when construct elements are disclosed herein in a specific 5’ to 3’ order, they are also meant to encompass the reverse complement of the order of those elements. One reason for this is that, in many embodiments disclosed herein, the constructs are part of a single-stranded recombinant AAV vector. Single-stranded AAV genomes are packaged as either sense (plus-stranded) or anti- sense (minus-stranded genomes), and single-stranded AAV genomes of + and – polarity areAttorney Docket No. 057766 / 616958 packaged with equal frequency into mature rAAV virions. See, e.g., LING et al. (2015) J. Mol. Genet. Med. 9(3):175, Zhou et al. (2008) Mol. Ther. 16(3):494-499, and Samulski et al. (1987) J. Virol. 61:3096-3101, each of which is herein incorporated by reference in its entirety for all purposes.
[0089] In the nucleic acid constructs, the polypeptide of interest coding sequence can be codon-optimized for expression in a host cell. For example, the polypeptide of interest coding sequence can be codon optimized or may use one or more alternative codons for one or more amino acids of the protein (i.e., same amino acid sequence). An alternative codon as used herein refers to variations in codon usage for a given amino acid, and may or may not be a preferred or optimized codon (codon optimized) for a given expression system. Preferred codon usage, or codons that are well-tolerated in a given system of expression, are known.
[0090] The polypeptide of interest coding sequence coding sequence in the nucleic acid constructs disclosed herein may include one or more modifications such as codon optimization (e.g., to human codons), depletion of CpG dinucleotides, mutation of cryptic splice sites, addition of one or more glycosylation sites, or any combination thereof. CpG dinucleotides in a construct can limit the therapeutic utility of the construct. First, unmethylated CpG dinucleotides can interact with host toll-like receptor-9 (TLR-9) to stimulate innate, proinflammatory immune responses. Second, once the CpG dinucleotides become methylated, they can result in the suppression of transgene expression coordinated by methyl-CpG binding proteins. Cryptic splice sites are sequences in a pre-messenger RNA that are not normally used as splice sites, but that can be activated, for example, by mutations that either inactivate canonical splice sites or create splice sites where one did not exist before. Accurate splice site selection is critical for successful gene expression, and removal of cryptic splice sites can favor use of the normal or intended splice site. In some embodiments, the polypeptide of interest coding sequence is modified to remove one or more cryptic splice sites.
[0091] In an exemplary nucleic acid construct, the construct comprises a polyadenylation signal sequence located 3’ of the polypeptide of interest coding sequence, the construct comprises a splice acceptor site located 5’ of the polypeptide of interest coding sequence, and the nucleic acid construct does not comprise a promoter that drives expression of the polypeptide of interest, and optionally the nucleic acid construct does not comprise a homology arm.
[0092] In an exemplary nucleic acid construct, the construct comprises a polyadenylationAttorney Docket No. 057766 / 616958 signal sequence located 3’ of the polypeptide of interest coding sequence, the construct comprises a splice acceptor site located 5’ of the polypeptide of interest coding sequence, and the nucleic acid construct comprises a promoter that drives expression of the polypeptide of interest. (1) Polypeptides of Interest
[0093] Any polypeptide of interest may be encoded by the nucleic acid constructs disclosed herein. In one example, the polypeptide of interest is a therapeutic polypeptide (e.g., a polypeptide that is lacking or deficient in a subject). In one example, the polypeptide of interest is an enzyme.
[0094] The polypeptide of interest can be a secreted polypeptide (e.g., a protein that is secreted by the cell and / or is functionally active as a soluble extracellular protein). Alternatively, the polypeptide of interest can be an intracellular polypeptide (e.g., a protein that is not secreted by the cell and is functionally active within the cell, including soluble cytosolic polypeptides).
[0095] The polypeptide of interest can be a wild type polypeptide. Alternatively, the polypeptide of interest can be a variant or mutant polypeptide.
[0096] In one example, the polypeptide of interest is a liver protein (e.g., a protein that is, endogenously produced in the liver and / or functionally active in the liver). In another example, the polypeptide of interest can be a circulating protein that is produced by the liver. In another example, the polypeptide of interest can be a non-liver protein.
[0097] The polypeptide of interest can be an exogenous polypeptide. An “exogenous” polypeptide coding sequence can refer to a coding sequence that has been introduced from an exogenous source to a site within a host cell genome (e.g., at a genomic locus such as a safe harbor locus, including ALB intron 1). That is, the exogenous polypeptide coding sequence is exogenous with respect to its insertion site, and the polypeptide of interest expressed from such an exogenous coding sequence is referred to as an exogenous polypeptide. The exogenous coding sequence can be naturally-occurring or engineered, and can be wild type or a variant. The exogenous coding sequence may include nucleotide sequences other than the sequence that encodes the exogenous polypeptide (e.g., an internal ribosomal entry site). The exogenous coding sequence can be a coding sequence that occurs naturally in the host genome, as a wild type or a variant (e.g., mutant). For example, although the host cell contains the coding sequence of interest (as a wild type or as a variant), the same coding sequence or variant thereof can beAttorney Docket No. 057766 / 616958 introduced as an exogenous source (e.g., for expression at a locus that is highly expressed). The exogenous coding sequence can also be a coding sequence that is not naturally occurring in the host genome, or that expresses an exogenous polypeptide that does not naturally occur in the host genome. An exogenous coding sequence can include an exogenous nucleic acid sequence (e.g., a nucleic acid sequence is not endogenous to the recipient cell), or may be exogenous with respect to its insertion site and / or with respect to its recipient cell.
[0098] In one example, the polypeptide of interest is a polypeptide associated with a genetic enzyme deficiency. In certain embodiments, the genetic enzyme deficiency results in infantile onset of disease. In certain embodiments, the genetic enzyme deficiency can be, or routinely is, diagnosed with newborn screening. In certain embodiments, the enzyme deficiency may manifest in various severity of disease such that the age of onset may include an infantile onset form of the disease and a later onset form of the disease (e.g., childhood, adolescent, or adult form of onset).
[0099] In one example, the polypeptide of interest is a polypeptide associated with a bleeding disorder, e.g., hemophilia, e.g., hemophilia A or hemophilia B, or von Willebrands disease. In one example, the polypeptide of interest is an enzyme related to inborn errors of metabolism.
[0100] In another example, the polypeptide of interest is a multidomain therapeutic protein. A multidomain therapeutic protein as described herein includes an enzyme domain (e.g., a lysosomal alpha-glucosidase (GAA) polypeptide or a biologically active portion thereof, to provide GAA enzyme replacement activity) linked to or fused to a delivery domain that provides binding to an internalization effector (a protein that is capable of being internalized into a cell or that otherwise participates in or contributes to retrograde membrane trafficking). Examples of multidomain therapeutic proteins can be found in WO 2013 / 138400, WO 2017 / 007796, WO 2017 / 190079, WO 2017 / 100467, WO 2018 / 226861, WO 2019 / 157224, and WO 2019 / 222663, each of which is herein incorporated by reference in its entirety for all purposes. In some multidomain therapeutic proteins, the delivery domain is covalently linked to the enzyme domain. The covalent linkage may be any type of covalent bond (i.e., any bond that involved sharing of electrons). In some cases, the covalent bond is a peptide bond between two amino acids, such that the enzyme domain and the delivery domain in whole or in part form a continuous polypeptide chain, as in a fusion protein. In some cases, the enzyme domain portion and the delivery domain portion are directly linked. In other cases, a linker, such as a peptideAttorney Docket No. 057766 / 616958 linker, is used to tether the two portions. Any suitable linker can be used. See Chen et al., “Fusion protein linkers: property, design and functionality,” 65(10) Adv Drug Deliv Rev. 1357- 69 (2013). In some cases, a cleavable linker is used. For example, a cathepsin cleavable linker can be inserted between the delivery domain and the enzyme domain to facilitate removal of the delivery domain in the lysosome. In another example, the linker can comprise an amino acid sequence, e.g., about 10 amino acids in length, for example, 1, 2, 3, 4, 5, 6, 7, 8, 8, or 10 repeats of Gly4Ser (SEQ ID NO: 170).
[0101] For example, the multidomain therapeutic proteins described herein can comprise a CD63-binding delivery domain linked to or fused to an enzyme domain. The CD63-binding domain provides binding to the internalization factor CD63 (UniProt Ref. P08962-1). CD63 (also known as CD63 antigen, granulophysin, lysosomal-associated membrane protein 3, LAMP-3, lysosome integral membrane protein 1, Limp1, melanoma-associated antigen ME491, OMA81H, ocular melanoma-associated antigen, tetraspanin-30, or Tspan-30) is a member of the tetraspanin superfamily of cell surface proteins that span the cell membrane four times. It is encoded by the CD63 gene (also known as MLA1 or TSPAN30). CD63 is expressed in virtually all tissues and is thought to be involved in forming and stabilizing signaling complexes. CD63 localizes to the cell membrane, lysosomal membrane, and late endosomal membrane. CD63 is known to associate with integrins and may be involved in epithelial-mesenchymal transitioning. The CD63-binding domain provides binding to the internalization factor CD63. The multidomain therapeutic protein is targeted to the muscle by targeting CD63, which is a rapidly internalizing protein highly expressed in the muscle.
[0102] As another example, the multidomain therapeutic proteins described herein can comprise a TfR-binding delivery domain linked to or fused to an enzyme domain. The TfR- binding domain provides binding to the internalization factor transferrin receptor protein 1(TfR; UniProt Ref. P02786). TfR (also known as TR, TfR1, and Trfr) is encoded by the TFRC gene. TfR is expressed in muscle and on brain endothelial cells. Transcytosis of TfR in these cells enables blood-brain-barrier crossing. Transferrin receptor 1 (TfR) is a membrane receptor involved in the control of iron supply to the cell through the binding of transferrin, the major iron-carrier protein. Transferrin receptor 1 is expressed from the TFRC gene. Transferrin receptor 1 may be referred to, herein, at TFRC. This receptor plays a key role in the control of cell proliferation because iron is essential for sustaining ribonucleotide reductase activity, and isAttorney Docket No. 057766 / 616958 the only enzyme that catalyzes the conversion of ribonucleotides to deoxyribonucleotides. Preferably, the TfR is human TfR (hTfR). See e.g., Accession numbers NP_001121620.1; BAD92491.1; and NP_001300894.1.; and e!Ensembl entry: ENSG00000072274. The human transferrin receptor 1 is expressed in several tissues, including but not limited to: cerebral cortex; cerebellum; hippocampus; caudate; parathyroid gland; adrenal gland; bronchus; lung; oral mucosa; esophagus; stomach; duodenum; small intestine; colon; rectum; liver; gallbladder; pancreas; kidney; urinary bladder; testis; epididymis; prostate; vagina; ovary; fallopian tube; endometrium; cervix; placenta; breast; heart muscle; smooth muscle; soft tissue; skin; appendix; lymph node; tonsil; and bone marrow. A related transferrin receptor is transferrin receptor 2 (TfR2). Human transferrin receptor 2 bears about 45% sequence identity to human transferrin receptor 1. Trinder & Baker, Transferrin receptor 2: a new molecule in iron metabolism. Int J Biochem Cell Biol. 2003 Mar;35(3):292-6. Unless otherwise stated, transferrin receptor as used herein generally refers to transferrin receptor 1 (e.g., human transferrin receptor 1). Human Transferrin (Tf) is a single chain, 80 kDa member of the anion-binding superfamily of proteins. Transferrin is a 698 amino acid precursor that is divided into a 19 aa signal sequence plus a 679 aa mature segment that typically contains 19 intrachain disulfide bonds. The N- and C-terminal flanking regions (or domains) bind ferric iron through the interaction of an obligate anion (e.g., bicarbonate) and four amino acids (His, Asp, and two Tyr). Apotransferrin (or iron-free) will initially bind one atom of iron at the C-terminus, and this is followed by subsequent iron binding by the N-terminus to form holotransferrin (diferric Tf, Holo-Tf). Through its C-terminal iron-binding domain, holotransferrin will interact with the TfR on the surface of cells where it is internalized into acidified endosomes. Iron dissociates from the Tf molecule within these endosomes, and is transported into the cytosol as ferrous iron. In addition to TfR, transferrin is reported to bind to cubulin, IGFBP3, microbial iron-binding proteins and liver-specific TfR2. The blood-brain barrier (BBB) is located within the microvasculature of the brain, and it regulates passage of molecules from the blood to the brain. Burkhart et al., Accessing targeted nanoparticles to the brain: the vascular route. Curr Med Chem. 2014;21(36):4092-9. The transcellular passage through the brain capillary endothelial cells can take place via 1) cell entry by leukocytes; 2) carrier-mediated influx of e.g., glucose by glucose transporter 1 (GLUT-1), amino acids by e.g., the L- type amino acid transporter 1 (LAT-1) and small peptides by e.g., organic anion-transporting peptide-B (OATP-B); 3) paracellular passage of small hydrophobicAttorney Docket No. 057766 / 616958 molecules; 4) adsorption-mediated transcytosis of e.g., albumin and cationized molecules; 5) passive diffusion of lipid soluble, non-polar solutes, including CO2 and O2; and 5) receptor- mediated transcytosis of, e.g., insulin by the insulin receptor and Tf by the TfR. Johnsen et al., Targeting the transferrin receptor for brain drug delivery, Prog Neurobiol. 2019 Oct;181:101665. The TfR-binding domain provides binding to the internalization factor TfR. The multidomain therapeutic protein produced by the liver is targeted the muscle and CNS by targeting TfR, which is expressed in muscle and on brain endothelial cells. Transcytosis of TfR in these cells enables blood-brain-barrier crossing.
[0103] In a particular multidomain therapeutic protein, the enzyme domain (e.g., N-terminus) is covalently linked to the C-terminus of the heavy chain of an anti-TfR or anti-CD63 antibody or to the C-terminus of the light chain (i.e., the multidomain therapeutic protein is in the format of anti-TfR:enzyme or anti-CD63:enzyme from N-terminus to C-terminus). In another particular multidomain therapeutic protein, the enzyme domain is covalently linked to the N-terminus of the heavy chain of an anti-TfR or anti-CD63 antibody or to the N-terminus of the light chain (i.e., the multidomain therapeutic protein is in the format of enzyme:anti-TfR or enzyme:anti- CD63 from N-terminus to C-terminus). In another particular embodiment, the enzyme domain (e.g., N-terminus) is linked to the C-terminus of an anti-TfR or anti-CD63 scFv domain (i.e., the multidomain therapeutic protein is in the format of anti-TfR-scFv:enzyme or anti-CD63- scFv:enzyme, such as anti-TfR-scFv(VLVH):enzyme or anti-CD63-scFv(VLVH):enzyme, from N- terminus to C-terminus). In another particular embodiment, the enzyme domain (e.g., N- terminus) is linked to the C-terminus of an anti-TfR or anti-CD63 Fab heavy chain (i.e., the multi domain therapeutic protein is in the format of anti-TfR-Fab(LightHeavy):enzyme or anti-CD63- Fab(LightHeavy):enzyme from N-terminus to C-terminus). In another particular embodiment, the enzyme domain (e.g., N-terminus) is linked to the C-terminus of an anti-TfR or anti-CD63 Fab light chain (i.e., the multi domain therapeutic protein is in the format of anti-TfR- Fab(HeavyLight):enzyme or anti-CD63-Fab(HeavyLight):enzyme from N-terminus to C- terminus). (2) Bidirectional Constructs
[0104] The nucleic acid constructs disclosed herein can be bidirectional constructs. Such bidirectional constructs can allow for enhanced insertion and expression of encoded polypeptideAttorney Docket No. 057766 / 616958 of interest. When used in combination with a nuclease agent (e.g., CRISPR / Cas system, zinc finger nuclease (ZFN) system; transcription activator-like effector nuclease (TALEN) system) as described herein, the bidirectionality of the nucleic acid construct allows the construct to be inserted in either direction (i.e., is not limited to insertion in one direction) within a target genomic locus or a cleavage site or target insertion site, allowing the expression of the polypeptide of interest when inserted in either orientation, thereby enhancing expression efficiency.
[0105] A bidirectional construct as disclosed herein can comprise at least two nucleic acid segments, wherein a first segment comprises a first coding sequence for the polypeptide of interest, and a second segment comprises the reverse complement of a second coding sequence for the polypeptide of interest, or vice versa. However, other bidirectional constructs disclosed herein can comprise at least two nucleic acid segments, wherein the first segment comprises a coding sequence for a polypeptide of interest, and the second segment comprises the reverse complement of a coding sequence for another protein, or vice versa. A reverse complement refers to a sequence that is a complement sequence of a reference sequence, wherein the complement sequence is written in the reverse orientation. For example, for a hypothetical sequence 5’-CTGGACCGA-3’, the perfect complement sequence is 3’-GACCTGGCT-5’, and the perfect reverse complement is written 5’-TCGGTCCAG-3’. A reverse complement sequence need not be perfect and may still encode the same polypeptide or a similar polypeptide as the reference sequence. Due to codon usage redundancy, a reverse complement can diverge from a reference sequence that encodes the same polypeptide. The coding sequences can optionally comprise one or more additional sequences, such as sequences encoding amino- or carboxy- terminal amino acid sequences such as a signal sequence, label sequence (e.g., HiBit), or heterologous functional sequence (e.g., nuclear localization sequence (NLS) or self-cleaving peptide) linked to the polypeptide of interest or other protein.
[0106] When specific bidirectional construct sequences are disclosed herein, they are meant to encompass the sequence disclosed or the reverse complement of the sequence. For example, if a bidirectional construct disclosed herein consists of the hypothetical sequence 5’- CTGGACCGA-3’, it is also meant to encompass the reverse complement of that sequence (5’- TCGGTCCAG-3’). Likewise, when bidirectional construct elements are disclosed herein in a specific 5’ to 3’ order, they are also meant to encompass the reverse complement of the order ofAttorney Docket No. 057766 / 616958 those elements. For example, if a bidirectional construct is disclosed herein that comprises from 5’ to 3’ a first splice acceptor, a first coding sequence, a first terminator, a reverse complement of a second terminator, a reverse complement of a second coding sequence, and a reverse complement of a second splice acceptor, it is also meant to encompass a construct comprising from 5’ to 3’ the second splice acceptor, the second coding sequence, the second terminator, a reverse complement of the first terminator, a reverse complement of the first coding sequence, and a reverse complement of the first splice acceptor. One reason for this is that, in many embodiments disclosed herein, the bidirectional constructs are part of a single-stranded recombinant AAV vector. Single-stranded AAV genomes are packaged as either sense (plus- stranded) or anti-sense (minus-stranded genomes), and single-stranded AAV genomes of + and – polarity are packaged with equal frequency into mature rAAV virions. See, e.g., LING et al. (2015) J. Mol. Genet. Med. 9(3):175, Zhou et al. (2008) Mol. Ther. 16(3):494-499, and Samulski et al. (1987) J. Virol. 61:3096-3101, each of which is herein incorporated by reference in its entirety for all purposes.
[0107] When the at least two segments both encode a polypeptide of interest, the at least two segments can encode the same polypeptide of interest or different polypeptides of interest. The different polypeptides of interest can be at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% identical. Preferably, the two segments encode the same polypeptide of interest (i.e., 100% identical).
[0108] Even when the two segments encode the same polypeptide of interest, the coding sequence for the polypeptide of interest in the first segment can differ from the coding sequence for the polypeptide of interest in the second segment. In some bidirectional constructs, the codon usage in the first coding sequence is the same as the codon usage in the second coding sequence. In other bidirectional constructs, the second coding sequence adopts a different codon usage from the codon usage of the first coding sequence in order to reduce hairpin formation. One or both of the coding sequences can be codon-optimized for expression in a host cell. In some bidirectional constructs, only one of the coding sequences is codon-optimized. In some bidirectional constructs, the first coding sequence is codon-optimized. In some bidirectional constructs, the second coding sequence is codon-optimized. In some bidirectional constructs, both coding sequences are codon-optimized. For example, the second polypeptide of interestAttorney Docket No. 057766 / 616958 coding sequence can be codon optimized or may use one or more alternative codons for one or more amino acids of the same polypeptide of interest (i.e., same amino acid sequence) encoded by the coding sequence for the polypeptide of interest in the first segment. An alternative codon as used herein refers to variations in codon usage for a given amino acid, and may or may not be a preferred or optimized codon (codon optimized) for a given expression system. Preferred codon usage, or codons that are well-tolerated in a given system of expression are known.
[0109] In one example, the second segment comprises a reverse complement of a coding sequence for the polypeptide of interest that adopts different codon usage from that of the coding sequence for the polypeptide of interest in the first segment in order to reduce hairpin formation. Such a reverse complement forms base pairs with fewer than all nucleotides of the coding sequence in the first segment, yet it optionally encodes the same polypeptide. In one example, the reverse complement sequence in the second segment is not substantially complementary (e.g., not more than 70% complementary) to the coding sequence in the first segment. In other cases, however, the second segment comprises a reverse complement sequence that is highly complementary (e.g., at least 90% complementary) to the coding sequence in the first segment.
[0110] The second segment can have any percentage of complementarity to the first segment. For example, the second segment sequence can have at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% complementarity to the first segment. As another example, the second segment sequence can have less than about 30%, less than about 35%, less than about 40%, less than about 45%, less than about 50%, less than about 55%, less than about 60%, less than about 65%, less than about 70%, less than about 75%, less than about 80%, less than about 85%, less than about 90%, less than about 95%, less than about 97%, or less than about 99% complementarity to the first segment. The reverse complement of the second coding sequence can be, in some nucleic acid constructs, not substantially complementary (e.g., not more than 70% complementary) to the first coding sequence, not substantially complementary to a fragment of the first coding sequence, highly complementary (e.g., at least 90% complementary) to the first coding sequence, highly complementary to a fragment of the first coding sequence, about 50% to about 80% identical to the reverse complement of the first coding sequence, or about 60% to about 100% identical toAttorney Docket No. 057766 / 616958 the reverse complement of the first coding sequence.
[0111] The bidirectional constructs disclosed herein can be modified to include any suitable structural feature as needed for any particular use and / or that confers one or more desired function. For example, the bidirectional nucleic acid constructs disclosed herein need not comprise a homology arm and / or can be, for example, homology-independent donor constructs. Owing in part to the bidirectional function of the nucleic acid constructs, the bidirectional constructs can be inserted into a genomic locus in either direction as described herein to allow for efficient insertion and / or expression of the polypeptide of interest.
[0112] In some cases, the bidirectional nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest. For example, the expression of the polypeptide of interest can be driven by a promoter of the host cell (e.g., the endogenous ALB promoter when the transgene is integrated into a host cell’s ALB locus). In other cases, the bidirectional nucleic acid construct can comprise one or more promoters operably linked to the coding sequences for the polypeptide of interest. That is, although not required for expression, the constructs disclosed herein may also include transcriptional or translational regulatory sequences such as promoters, enhancers, insulators, internal ribosome entry sites, additional sequences encoding peptides, and / or polyadenylation signals. Some bidirectional constructs can comprise a promoter that drives expression of the first polypeptide of interest coding sequence and / or the reverse complement of a promoter that drives expression of the reverse complement of the second polypeptide of interest coding sequence.
[0113] The bidirectional constructs disclosed herein can be modified to include or exclude any suitable structural feature as needed for any particular use and / or that confers one or more desired functions. For example, some bidirectional nucleic acid constructs disclosed herein do not comprise a homology arm. Owing in part to the bidirectional function of the nucleic acid construct, the bidirectional construct can be inserted into a genomic locus in either direction (orientation) as described herein to allow for efficient insertion and / or expression of a polypeptide of interest.
[0114] The constructs disclosed herein comprise a polyadenylation sequence or polyadenylation tail sequence (e.g., downstream or 3’ of a polypeptide of interest coding sequence). The bidirectional constructs can, in some cases, comprise one or more (e.g., two) polyadenylation tail sequences or polyadenylation signal sequences. In some bidirectionalAttorney Docket No. 057766 / 616958 constructs, the first segment can comprise a polyadenylation signal sequence. In some bidirectional constructs, the second segment can comprise a polyadenylation signal sequence. In some bidirectional constructs, the first segment can comprise a first polyadenylation signal sequence, and the second segment can comprise a second polyadenylation signal sequence (e.g., a reverse complement of a polyadenylation signal sequence). In some bidirectional constructs, the first segment can comprise a first polyadenylation signal sequence located 3’ of the first coding sequence. In some bidirectional constructs, the second segment can comprise a reverse complement of a second polyadenylation signal sequence located 5’ of the reverse complement of the second coding sequence. In some bidirectional constructs, the first segment can comprise a first polyadenylation signal sequence located 3’ of the first coding sequence, and the second segment can comprise a reverse complement of a second polyadenylation signal sequence located 5’ of the reverse complement of the second coding sequence. The first and second polyadenylation signal sequences can be the same or different. In one example, the first and second polyadenylation signals are different. In a specific example, the first polyadenylation signal is a simian virus 40 (SV40) late polyadenylation signal (or a variant thereof), and the second polyadenylation signal is a bovine growth hormone (BGH) polyadenylation signal (or a variant thereof), or vice versa. For example, one polyadenylation signal can be an SV40 polyadenylation signal, and the other polyadenylation signal can be a BGH polyadenylation signal. In a specific example, one polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 161, and the other polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 162.
[0115] In some embodiments, unidirectional SV40 late polyadenylation signals are used. The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. The unidirectional SV40 late polyadenylation signals described herein are positioned in the “late” orientation, with the polyadenylation signals present in the “early” orientation mutated or inactivated. In some embodiments, each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal. For example, the two conserved AATAAA poly(A) signals present in the SV40 “early” poly(A) to AATCAA. In some embodiments, the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 180. In some embodiments, the unidirectionalAttorney Docket No. 057766 / 616958 SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 180.
[0116] The unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) one or more additional polyadenylation signals. Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. For example, the unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) a bovine growth hormone (BGH) polyadenylation signal, optionally wherein the BGH polyadenylation signal is upstream of (5’ of) the unidirectional SV40 late polyadenylation signal. In some embodiments, the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 179. In some embodiments, the BGH polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 179. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 194. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 194.
[0117] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0118] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4,Attorney Docket No. 057766 / 616958 or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183.
[0119] Methods of designing a suitable polyadenylation tail sequence are well-known. The polyadenylation tail sequence can be encoded, for example, as a “poly-A” stretch downstream of the polypeptide of interest coding sequence. A poly-A tail can comprise, for example, at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In a specific example, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. Methods of designing a suitable polyadenylation tail sequence and / or polyadenylation signal sequence are well known. For example, the polyadenylation signal sequence AAUAAA is commonly used in mammalian systems, although variants such as UAUAAA or AU / GUAAA have been identified. See, e.g., Proudfoot (2011) Genes & Dev. 25(17):1770-82, herein incorporated by reference in its entirety for all purposes. The term polyadenylation signal sequence refers to any sequence that directs termination of transcription and addition of a poly-A tail to the mRNA transcript. In eukaryotes, transcription terminators are recognized by protein factors, and termination is followed by polyadenylation, a process of adding a poly(A) tail to the mRNA transcripts in presence of the poly(A) polymerase. The mammalian poly(A) signal typically consists of a core sequence, about 45 nucleotides long, that may be flanked by diverse auxiliary sequences that serve to enhance cleavage and polyadenylation efficiency. The core sequence consists of a highly conserved upstream element (AATAAA or AAUAAA) in the mRNA, referred to as a poly A recognition motif or poly A recognition sequence), recognized by cleavage and polyadenylation- specificity factor (CPSF), and a poorly defined downstream region (rich in Us or Gs and Us), bound by cleavage stimulation factor (CstF). Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. In one example, the polyadenylation signal is a simian virus 40 (SV40) late polyadenylation signal. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 173, 169, or 161. For example, theAttorney Docket No. 057766 / 616958 polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 169 or 161. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 169. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 173. In another example, the polyadenylation signal is a bovine growth hormone (BGH) polyadenylation signal or a CpG depleted BGH polyadenylation signal. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 162.
[0120] In one example, the polyadenylation signal can comprise a BGH polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179. In another example, the polyadenylation signal can comprise an SV40 polyadenylation signal. For example, the SV40 polyadenylation signal can be a unidirectional SV40 late polyadenylation signal. For example, the transcription terminator sequences that are present in the “early” inverse orientation of SV40 can be mutated (e.g., by mutating the reverse strand AAUAAA sequences to AAUCAA). The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. For example, the unidirectional SV40 late polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 180. In another example, a synthetic polyadenylation signal can be used. For example, the synthetic polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 181. In another example, two or more polyadenylation signals can be used in combination. For example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and an SV40 polyadenylation signal (e.g., an SV40 late polyadenylation signal, such as a unidirectional SV40 late polyadenylation signal). For example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and a unidirectional SV40 late polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179, and the unidirectional SV40 late polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 180. In a specific example, the BGH polyadenylation signal can be upstream (5’) of the SV40 polyadenylation signal (e.g., unidirectional SV40 late polyadenylation signal). For example, the combined polyadenylation signal can comprise the sequence set forth in SEQ ID NO: 194. In another example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and aAttorney Docket No. 057766 / 616958 synthetic polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179, and the synthetic polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 181. In some embodiments, the nucleic acid construct is a unidirectional construct.
[0121] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0122] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4, or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183.
[0123] The bidirectional constructs can, in some cases, comprise one or more (e.g., two) splice acceptor sites. In some bidirectional constructs, the first segment can comprise a splice acceptor site. In some bidirectional constructs, the second segment can comprise a splice acceptor site. In some bidirectional constructs, the first segment can comprise a first splice acceptor site, and the second segment can comprise a second splice acceptor site (e.g., a reverse complement of a splice acceptor site). In some bidirectional constructs, the first segment comprises a first splice acceptor site located 5’ of the first coding sequence. In some bidirectional constructs, the second segment comprises a reverse complement of a second splice acceptor site located 3’ of the reverse complement of the second coding sequence. In some bidirectional constructs, the first segment comprises a first splice acceptor site located 5’ of the first coding sequence, and the second segment comprises a reverse complement of a second splice acceptor site located 3’ of the reverse complement of the second coding sequence. The first and second splice acceptor sites can be the same or different. In a specific example, both splice acceptors are mouse Alb exon 2 splice acceptors. In a specific example, both splice acceptors can comprise, consist essentially of, or consist of SEQ ID NO: 163.Attorney Docket No. 057766 / 616958
[0124] A bidirectional construct may comprise a first coding sequence that encodes a first coding sequence linked to a splice acceptor and a reverse complement of a second coding sequence operably linked to the reverse complement of a splice acceptor. The bidirectional constructs disclosed herein can also comprise a splice acceptor site on either or both ends of the construct, or splice acceptor sites in both the first segment and the second segment (e.g., a splice acceptor site 5’ of a coding sequence, or a reverse complement of a splice acceptor 3’ of a reverse complement of a coding sequence). The splice acceptor site can, for example, comprise NAG or consist of NAG. In a specific example, the splice acceptor is an ALB splice acceptor (e.g., an ALB splice acceptor used in the splicing together of exons 1 and 2 of ALB (i.e., ALB exon 2 splice acceptor)). For example, such a splice acceptor can be derived from the human ALB gene. In another example, the splice acceptor can be derived from the mouse Alb gene (e.g., an ALB splice acceptor used in the splicing together of exons 1 and 2 of mouse Alb (i.e., mouse Alb exon 2 splice acceptor)). In another example, the splice acceptor is a splice acceptor from a gene encoding the polypeptide of interest. Additional suitable splice acceptor sites useful in eukaryotes, including artificial splice acceptors, are known. See, e.g., Shapiro et al. (1987) Nucleic Acids Res. 15:7155-7174 and Burset et al. (2001) Nucleic Acids Res. 29:255-259, each of which is herein incorporated by reference in its entirety for all purposes. The splice acceptors used in a bidirectional construct may be the same or different. In a specific example, both splice acceptors are mouse Alb exon 2 splice acceptors.
[0125] The bidirectional constructs can be circular or linear. For example, a bidirectional construct can be linear. The first and second segments can be joined in a linear manner through a linker sequence. For example, the 5’ end of the second segment that comprises a reverse complement sequence can be linked to the 3’ end of the first segment. Alternatively, the 5’ end of the first segment can be linked to the 3’ end of the second segment that comprises a reverse complement sequence. The linker can be any suitable length. For example, the linker can be between about 5 to about 2000 nucleotides in length. As an example, the linker sequence can be about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 150, about 200, about 250, about 300, about 500, about 1000, about 1500, about 2000, or more nucleotides in length. OtherAttorney Docket No. 057766 / 616958 structural elements in addition to, or instead of, a linker sequence, can also be inserted between the first and second segments.
[0126] The bidirectional constructs disclosed herein can be DNA or RNA, single-stranded, double-stranded, or partially single-stranded and partially double-stranded. For example, the constructs can be single- or double-stranded DNA. In some embodiments, the nucleic acid can be modified (e.g., using nucleoside analogs), as described herein. In a specific example, the bidirectional construct is single-stranded (e.g., single-stranded DNA).
[0127] The bidirectional constructs disclosed herein can be modified on either or both ends to include one or more suitable structural features as needed and / or to confer one or more functional benefit. For example, structural modifications can vary depending on the method(s) used to deliver the constructs disclosed herein to a host cell (e.g., use of viral vector delivery or packaging into lipid nanoparticles for delivery). Such modifications include, for example, terminal structures such as inverted terminal repeats (ITR), hairpin, loops, and other structures such as toroids. For example, the constructs disclosed herein can comprise one, two, or three ITRs or can comprise no more than two ITRs. Various methods of structural modifications are known.
[0128] Similarly, one or both ends of the construct can be protected (e.g., from exonucleolytic degradation) by known methods. For example, one or more dideoxynucleotide residues can be added to the 3′ terminus of a linear molecule and / or self-complementary oligonucleotides can be ligated to one or both ends. See, e.g., Chang et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:4959-4963 and Nehls et al. (1996) Science 272:886-889, each of which is herein incorporated by reference in its entirety for all purposes. Additional methods for protecting the constructs from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
[0129] As disclosed in more detail herein, the bidirectional constructs disclosed herein can be introduced into a cell as part of a vector having additional sequences such as, for example, replication origins, promoters, and genes encoding antibiotic resistance. The constructs can be introduced as a naked nucleic acid, can be introduced as a nucleic acid complexed with an agent such as a liposome, polymer, or poloxamer, or can be delivered by viral vectors (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus).Attorney Docket No. 057766 / 616958
[0130] In an exemplary bidirectional construct, the second segment is located 3’ of the first segment, the first polypeptide of interest coding sequence and the second polypeptide of interest coding sequence both encode the same polypeptide of interest, the second polypeptide of interest coding sequence adopts a different codon usage from the codon usage of the first polypeptide of interest coding sequence, the first segment comprises a first polyadenylation signal sequence located 3’ of the first polypeptide of interest coding sequence, the second segment comprises a reverse complement of a second polyadenylation signal sequence located 5’ of the reverse complement of the second polypeptide of interest coding sequence, the first segment comprises a first splice acceptor site located 5’ of the first polypeptide of interest coding sequence, the second segment comprises a reverse complement of a second splice acceptor site located 3’ of the reverse complement of the second polypeptide of interest coding sequence, the nucleic acid construct does not comprise a promoter that drives expression of the first polypeptide of interest or the second polypeptide of interest, and optionally the nucleic acid construct does not comprise a homology arm. (3) Unidirectional Constructs
[0131] The nucleic acid constructs disclosed herein can be unidirectional constructs. When specific unidirectional construct sequences are disclosed herein, they are meant to encompass the sequence disclosed or the reverse complement of the sequence. For example, if a unidirectional construct disclosed herein consists of the hypothetical sequence 5’-CTGGACCGA-3’, it is also meant to encompass the reverse complement of that sequence (5’-TCGGTCCAG-3’). Likewise, when unidirectional construct elements are disclosed herein in a specific 5’ to 3’ order, they are also meant to encompass the reverse complement of the order of those elements. One reason for this is that, in many embodiments disclosed herein, the unidirectional constructs are part of a single-stranded recombinant AAV vector. Single-stranded AAV genomes are packaged as either sense (plus-stranded) or anti-sense (minus-stranded genomes), and single-stranded AAV genomes of + and – polarity are packaged with equal frequency into mature rAAV virions. See, e.g., LING et al. (2015) J. Mol. Genet. Med. 9(3):175, Zhou et al. (2008) Mol. Ther. 16(3):494- 499, and Samulski et al. (1987) J. Virol. 61:3096-3101, each of which is herein incorporated by reference in its entirety for all purposes.
[0132] In the unidirectional constructs, the coding sequence for the polypeptide of interestAttorney Docket No. 057766 / 616958 can be codon-optimized for expression in a host cell. For example, the coding sequence can be codon optimized or may use one or more alternative codons for one or more amino acids of the polypeptide of interest (i.e., same amino acid sequence). An alternative codon as used herein refers to variations in codon usage for a given amino acid, and may or may not be a preferred or optimized codon (codon optimized) for a given expression system. Preferred codon usage, or codons that are well-tolerated in a given system of expression, are known.
[0133] The unidirectional constructs disclosed herein can be modified to include any suitable structural feature as needed for any particular use and / or that confers one or more desired functions. For example, the unidirectional nucleic acid constructs disclosed herein need not comprise a homology arm and / or can be, for example, homology-independent donor constructs.
[0134] In some cases, the unidirectional nucleic acid construct does not comprise a promoter that drives the expression of polypeptide of interest. For example, the expression of the polypeptide of interest can be driven by a promoter of the host cell (e.g., the endogenous ALB promoter when the transgene is integrated into a host cell’s ALB locus). In other cases, the unidirectional nucleic acid construct can comprise one or more promoters operably linked to the coding sequence for the polypeptide of interest. That is, although not required for expression, the constructs disclosed herein may also include transcriptional or translational regulatory sequences such as promoters, enhancers, insulators, internal ribosome entry sites, additional sequences encoding peptides, and / or polyadenylation signals. Some unidirectional constructs can comprise a promoter that drives expression of the coding sequence for the polypeptide of interest.
[0135] The constructs disclosed herein comprise a polyadenylation sequence or polyadenylation tail sequence (e.g., downstream or 3’ of a polypeptide of interest coding sequence). In some embodiments, unidirectional SV40 late polyadenylation signals are used. The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. The unidirectional SV40 late polyadenylation signals described herein are positioned in the “late” orientation, with the polyadenylation signals present in the “early” orientation mutated or inactivated. In some embodiments, each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal. For example, the two conserved AATAAA poly(A) signals present in the SV40 “early” poly(A) to AATCAA. In some embodiments, the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%Attorney Docket No. 057766 / 616958 identical to the sequence set forth in SEQ ID NO: 180. In some embodiments, the unidirectional SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 180.
[0136] The unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) one or more additional polyadenylation signals. Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. For example, the unidirectional SV40 late polyadenylation signals can be used in combination with (e.g., in tandem with) a bovine growth hormone (BGH) polyadenylation signal, optionally wherein the BGH polyadenylation signal is upstream of (5’ of) the unidirectional SV40 late polyadenylation signal. In some embodiments, the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 179. In some embodiments, the BGH polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 179. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 194. In some embodiments, the combination of the BGH polyadenylation signal and the unidirectional SV40 late polyadenylation signal comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 194.
[0137] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0138] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40Attorney Docket No. 057766 / 616958 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4, or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183.
[0139] Methods of designing a suitable polyadenylation tail sequence are well-known. The polyadenylation tail sequence can be encoded, for example, as a “poly-A” stretch downstream of the polypeptide of interest coding sequence. A poly-A tail can comprise, for example, at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In a specific example, the poly-A tail comprises 95, 96, 97, 98, 99, or 100 adenine nucleotides. Methods of designing a suitable polyadenylation tail sequence and / or polyadenylation signal sequence are well known. For example, the polyadenylation signal sequence AAUAAA is commonly used in mammalian systems, although variants such as UAUAAA or AU / GUAAA have been identified. See, e.g., Proudfoot (2011) Genes & Dev. 25(17):1770-82, herein incorporated by reference in its entirety for all purposes. The term polyadenylation signal sequence refers to any sequence that directs termination of transcription and addition of a poly-A tail to the mRNA transcript. In eukaryotes, transcription terminators are recognized by protein factors, and termination is followed by polyadenylation, a process of adding a poly(A) tail to the mRNA transcripts in presence of the poly(A) polymerase. The mammalian poly(A) signal typically consists of a core sequence, about 45 nucleotides long, that may be flanked by diverse auxiliary sequences that serve to enhance cleavage and polyadenylation efficiency. The core sequence consists of a highly conserved upstream element (AATAAA or AAUAAA) in the mRNA, referred to as a poly A recognition motif or poly A recognition sequence), recognized by cleavage and polyadenylation- specificity factor (CPSF), and a poorly defined downstream region (rich in Us or Gs and Us), bound by cleavage stimulation factor (CstF). Examples of transcription terminators that can be used include, for example, the human growth hormone (HGH) polyadenylation signal, the simian virus 40 (SV40) late polyadenylation signal, the rabbit beta-globin polyadenylation signal, the bovine growth hormone (BGH) polyadenylation signal, the phosphoglycerate kinase (PGK) polyadenylation signal, an AOX1 transcription termination sequence, a CYC1 transcription termination sequence, or any transcription termination sequence known to be suitable for regulating gene expression in eukaryotic cells. In one example, the polyadenylation signal is a simian virus 40 (SV40) late polyadenylation signal. For example, the polyadenylation signal canAttorney Docket No. 057766 / 616958 comprise, consist essentially of, or consist of SEQ ID NO: 173, 169, or 161. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 169 or 161. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 169. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 173. In another example, the polyadenylation signal is a bovine growth hormone (BGH) polyadenylation signal or a CpG depleted BGH polyadenylation signal. For example, the polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 162.
[0140] In one example, the polyadenylation signal can comprise a BGH polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179. In another example, the polyadenylation signal can comprise an SV40 polyadenylation signal. For example, the SV40 polyadenylation signal can be a unidirectional SV40 late polyadenylation signal. For example, the transcription terminator sequences that are present in the “early” inverse orientation of SV40 can be mutated (e.g., by mutating the reverse strand AAUAAA sequences to AAUCAA). The SV40 polyA is bidirectional, but the polyadenylation in the “late” orientation is more efficient than the polyadenylation in the “early” orientation. For example, the unidirectional SV40 late polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 180. In another example, a synthetic polyadenylation signal can be used. For example, the synthetic polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 181. In another example, two or more polyadenylation signals can be used in combination. For example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and an SV40 polyadenylation signal (e.g., an SV40 late polyadenylation signal, such as a unidirectional SV40 late polyadenylation signal). For example, the polyadenylation signal can comprise a combination of a BGH polyadenylation signal and a unidirectional SV40 late polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179, and the unidirectional SV40 late polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 180. In a specific example, the BGH polyadenylation signal can be upstream (5’) of the SV40 polyadenylation signal (e.g., unidirectional SV40 late polyadenylation signal). For example, the combined polyadenylation signal can comprise the sequence set forth in SEQ ID NO: 194. In another example, theAttorney Docket No. 057766 / 616958 polyadenylation signal can comprise a combination of a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the BGH polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 179, and the synthetic polyadenylation signal can comprise, consist essentially of, or consist of SEQ ID NO: 181. In some embodiments, the nucleic acid construct is a unidirectional construct.
[0141] In some embodiments, a stuffer sequence can be used to increase the time between when RNA polymerase transcribes the polyA to the time when it transcribes the next splice acceptor. For example, the stuffer sequence can be used between two different polyadenylation signals (e.g., between a BGH polyadenylation signal and a synthetic polyadenylation signal. For example, the stuffer sequence can comprise, consist essentially of, or consist of SEQ ID NO: 182.
[0142] In some embodiments, MAZ elements that cause polymerase pausing are used in combination with a polyadenylation signal (e.g., a BGH polyadenylation signal or an SV40 polyadenylation signal). For example, one or more (e.g., at least 1, at least 2, at least 3, at least 4, or about 1 to about 4, about 2 to about 4, about 3 to about 4, or 1, 2, 3, or 4) MAZ elements can be used in combination with a polyadenylation signal. For example, the MAZ element can comprise, consist essentially of, or consist of SEQ ID NO: 183.
[0143] The unidirectional constructs can, in some cases, comprise one or more splice acceptor sites. Some unidirectional constructs comprise a splice acceptor site located 5’ of the coding sequence for the polypeptide of interest. In a specific example, the splice acceptor is a mouse Alb exon 2 splice acceptor. In a specific example, the splice acceptor can comprise, consist essentially of, or consist of SEQ ID NO: 163.
[0144] The splice acceptor site can, for example, comprise NAG or consist of NAG. In a specific example, the splice acceptor is an ALB splice acceptor (e.g., an ALB splice acceptor used in the splicing together of exons 1 and 2(i.e., ALB exon 2 splice acceptor)). For example, such a splice acceptor can be derived from the human ALB gene. In another example, the splice acceptor can be derived from the mouse Alb gene (e.g., an ALB splice acceptor used in the splicing together of exons 1 and 2 of mouse Alb (i.e., mouse Alb exon 2 splice acceptor)). In another example, the splice acceptor is a splice acceptor from the gene encoding the polypeptide of interest. Additional suitable splice acceptor sites useful in eukaryotes, including artificial splice acceptors, are known. See, e.g., Shapiro et al. (1987) Nucleic Acids Res. 15:7155-7174 andAttorney Docket No. 057766 / 616958 Burset et al. (2001) Nucleic Acids Res. 29:255-259, each of which is herein incorporated by reference in its entirety for all purposes.
[0145] The unidirectional constructs can be circular or linear. For example, a unidirectional construct can be linear.
[0146] The unidirectional constructs disclosed herein can be DNA or RNA, single-stranded, double-stranded, or partially single-stranded and partially double-stranded. For example, the constructs can be single- or double-stranded DNA. In some embodiments, the nucleic acid can be modified (e.g., using nucleoside analogs), as described herein. In a specific example, the unidirectional construct is single-stranded (e.g., single-stranded DNA).
[0147] The unidirectional constructs disclosed herein can be modified on either or both ends to include one or more suitable structural features as needed and / or to confer one or more functional benefit. For example, structural modifications can vary depending on the method(s) used to deliver the constructs disclosed herein to a host cell (e.g., use of viral vector delivery or packaging into lipid nanoparticles for delivery). Such modifications include, for example, terminal structures such as inverted terminal repeats (ITR), hairpin, loops, and other structures such as toroids. For example, the constructs disclosed herein can comprise one, two, or three ITRs or can comprise no more than two ITRs. Various methods of structural modifications are known.
[0148] Similarly, one or both ends of the construct can be protected (e.g., from exonucleolytic degradation) by known methods. For example, one or more dideoxynucleotide residues can be added to the 3′ terminus of a linear molecule and / or self-complementary oligonucleotides can be ligated to one or both ends. See, e.g., Chang et al. (1987) Proc. Natl. Acad. Sci. U.S.A. 84:4959-4963 and Nehls et al. (1996) Science 272:886-889, each of which is herein incorporated by reference in its entirety for all purposes. Additional methods for protecting the constructs from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues.
[0149] As disclosed in more detail herein, the unidirectional constructs disclosed herein can be introduced into a cell as part of a vector having additional sequences such as, for example, replication origins, promoters, and genes encoding antibiotic resistance. The constructs can be introduced as a naked nucleic acid, can be introduced as a nucleic acid complexed with an agentAttorney Docket No. 057766 / 616958 such as a liposome, polymer, or poloxamer, or can be delivered by viral vectors (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus).
[0150] In an exemplary unidirectional construct, the construct comprises a polyadenylation signal sequence located 3’ of the coding sequence for the polypeptide of interest, the construct comprises a splice acceptor site located 5’ of the coding sequence for the polypeptide of interest, and the nucleic acid construct does not comprise a promoter that drives expression of the polypeptide of interest, and optionally the nucleic acid construct does not comprise a homology arm. (4) Vectors
[0151] The nucleic acid constructs disclosed herein can be provided in a vector for expression or for integration into and expression from a target genomic locus. A vector can comprise additional sequences such as, for example, replication origins, promoters, and genes encoding antibiotic resistance. A vector can also comprise nuclease agent components as disclosed elsewhere herein. For example, a vector can comprise a nucleic acid construct encoding a polypeptide of interest, a CRISPR / Cas system (nucleic acids encoding Cas protein and gRNA), one or more components of a CRISPR / Cas system, or a combination thereof (e.g., a nucleic acid construct and a gRNA). In some cases, a vector comprising a nucleic acid construct encoding a polypeptide of interest does not comprise any components of the nuclease agents described herein (e.g., does not comprise a nucleic acid encoding a Cas protein and does not comprise a nucleic acid encoding a gRNA). Some such vectors comprise homology arms corresponding to target sites in the target genomic locus. Other such vectors do not comprise any homology arms.
[0152] Some vectors may be circular. Alternatively, the vector may be linear. The vector can be packaged for delivered via a lipid nanoparticle, liposome, non-lipid nanoparticle, or viral capsid. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.
[0153] The vectors can be, for example, viral vectors such as adeno-associated virus (AAV) vectors. The AAV may be any suitable serotype and may be a single-stranded AAV (ssAAV) or a self-complementary AAV (scAAV). Other exemplary viruses / viral vectors include retroviruses, lentiviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses.Attorney Docket No. 057766 / 616958 The viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. The viruses can integrate into the host genome or alternatively do not integrate into the host genome. Such viruses can also be engineered to have reduced immunity. The viruses can be replication-competent or can be replication-defective (e.g., defective in one or more genes necessary for additional rounds of virion replication and / or packaging). Viruses can cause transient expression or longer-lasting expression. Viral vector may be genetically modified from their wild type counterparts. For example, the viral vector may comprise an insertion, deletion, or substitution of one or more nucleotides to facilitate cloning or such that one or more properties of the vector is changed. Such properties may include packaging capacity, transduction efficiency, immunogenicity, genome integration, replication, transcription, and translation. In some examples, a portion of the viral genome may be deleted such that the virus is capable of packaging exogenous sequences having a larger size. In some examples, the viral vector may have an enhanced transduction efficiency. In some examples, the immune response induced by the virus in a host may be reduced. In some examples, viral genes (such as integrase) that promote integration of the viral sequence into a host genome may be mutated such that the virus becomes non-integrating. In some examples, the viral vector may be replication defective. In some examples, the viral vector may comprise exogenous transcriptional or translational control sequences to drive expression of coding sequences on the vector. In some examples, the virus may be helper-dependent. For example, the virus may need one or more helper virus to supply viral components (such as viral proteins) required to amplify and package the vectors into viral particles. In such a case, one or more helper components, including one or more vectors encoding the viral components, may be introduced into a host cell or population of host cells along with the vector system described herein. In other examples, the virus may be helper-free. For example, the virus may be capable of amplifying and packaging the vectors without a helper virus. In some examples, the vector system described herein may also encode the viral components required for virus amplification and packaging.
[0154] Exemplary viral titers (e.g., AAV titers) include about 1012to about 1016vg / mL. Other exemplary viral titers (e.g., AAV titers) include about 1012to about 1016vg / kg of body weight.
[0155] Adeno-associated viruses (AAVs) are endemic in multiple species including human and non-human primates (NHPs). At least 12 natural serotypes and hundreds of natural variantsAttorney Docket No. 057766 / 616958 have been isolated and characterized to date. See, e.g., Li et al. (2020) Nat. Rev. Genet.21:255- 272, herein incorporated by reference in its entirety for all purposes. AAV particles are naturally composed of a non-enveloped icosahedral protein capsid containing a single-stranded DNA (ssDNA) genome. The DNA genome is flanked by two inverted terminal repeats (ITRs) which serve as the viral origins of replication and packaging signals. The rep gene encodes four proteins required for viral replication and packaging whilst the cap gene encodes the three structural capsid subunits which dictate the AAV serotype, and the Assembly Activating Protein (AAP) which promotes virion assembly in some serotypes.
[0156] Recombinant AAV (rAAV) is currently one of the most commonly used viral vectors used in gene therapy to treat human diseases by delivering therapeutic transgenes to target cells in vivo. Indeed, rAAV vectors are composed of icosahedral capsids similar to natural AAVs, but rAAV virions do not encapsidate AAV protein-coding or AAV replicating sequences. These viral vectors are non-replicating. The only viral sequences required in rAAV vectors are the two ITRs, which are needed to guide genome replication and packaging during manufacturing of the rAAV vector. rAAV genomes are devoid of AAV rep and cap genes, rendering them non- replicating in vivo. rAAV vectors are produced by expressing rep and cap genes along with additional viral helper proteins in trans, in combination with the intended transgene cassette flanked by AAV ITRs.
[0157] In therapeutic rAAV genomes, a gene expression cassette is placed between ITR sequences. Typically, rAAV genome cassettes comprise of a promoter to drive expression of a therapeutic transgene, followed by polyadenylation sequence. The ITRs flanking a rAAV expression cassette are usually derived from AAV2, the first serotype to be isolated and converted into a recombinant viral vector. Since then, most rAAV production methods rely on AAV2 Rep-based packaging systems. See, e.g., Colella et al. (2017) Mol. Ther. Methods Clin. Dev. 8:87-104, herein incorporated by reference in its entirety for all purposes.
[0158] Some non-limiting examples of ITRs that can be used include ITRs comprising, consisting essentially of, or consisting of SEQ ID NO: 158, SEQ ID NO: 159, or SEQ ID NO: 160. Other examples of ITRs comprise one or more mutations compared to SEQ ID NO: 158, SEQ ID NO: 159, or SEQ ID NO: 160 and can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 158, SEQ ID NO: 159, or SEQ ID NO: 160. In some rAAV genomesAttorney Docket No. 057766 / 616958 disclosed herein, the nucleic acid construct is flanked on both sides by the same ITR (i.e., the ITR on the 5’ end, and the reverse complement of the ITR on the 3’ end, such as SEQ ID NO: 158 on the 5’ end and SEQ ID NO: 168 on the 3’ end, or SEQ ID NO: 159 on the 5’ end and SEQ ID NO: 171 on the 3’ end, or SEQ ID NO: 160 on the 5’ end and SEQ ID NO: 172 on the 3’ end). In one example, the ITR on each end can comprise, consist essentially of, or consist of SEQ ID NO: 158 (i.e., SEQ ID NO: 158 on the 5’ end, and the reverse complement on the 3’ end). In another example, the ITR on each end can comprise, consist essentially of, or consist of SEQ ID NO: 159 (i.e., SEQ ID NO: 159 on the 5’ end, and the reverse complement on the 3’ end). In one example, the ITR on at least one end comprises, consists essentially of, or consists of SEQ ID NO: 160. In one example, the ITR on the 5’ end comprises, consists essentially of, or consists of SEQ ID NO: 160. In one example, the ITR on the 3’ end comprises, consists essentially of, or consists of SEQ ID NO: 160. In one example, the ITR on each end can comprise, consist essentially of, or consist of SEQ ID NO: 160 (i.e., SEQ ID NO: 160 on the 5’ end, and the reverse complement on the 3’ end). In other rAAV genomes disclosed herein, the nucleic acid construct is flanked by different ITRs on each end. In one example, the ITR on one end comprises, consists essentially of, or consists of SEQ ID NO: 158, and the ITR on the other end comprises, consists essentially of, or consists of SEQ ID NO: 159. In another example, the ITR on one end comprises, consists essentially of, or consists of SEQ ID NO: 158, and the ITR on the other end comprises, consists essentially of, or consists of SEQ ID NO: 160. In one example, the ITR on one end comprises, consists essentially of, or consists of SEQ ID NO: 159, and the ITR on the other end comprises, consists essentially of, or consists of SEQ ID NO: 160.
[0159] The specific serotype of a recombinant AAV vector influences its in vivo tropism to specific tissues. AAV capsid proteins are responsible for mediating attachment and entry into target cells, followed by endosomal escape and trafficking to the nucleus. Thus, the choice of serotype when developing a rAAV vector will influence what cell types and tissues the vector is most likely to bind to and transduce when injected in vivo. Several serotypes of rAAVs, including rAAV8, are capable of transducing the liver when delivered systemically in mice, NHPs and humans. See, e.g., Li et al. (2020) Nat. Rev. Genet. 21:255-272, herein incorporated by reference in its entirety for all purposes.
[0160] Once in the nucleus, the ssDNA genome is released from the virion and a complementary DNA strand is synthesized to generate a double-stranded DNA (dsDNA)Attorney Docket No. 057766 / 616958 molecule. Double-stranded AAV genomes naturally circularize via their ITRs and become episomes which will persist extrachromosomally in the nucleus. Therefore, for episomal gene therapy programs, rAAV-delivered rAAV episomes provide long-term, promoter-driven gene expression in non-dividing cells. However, this rAAV-delivered episomal DNA is diluted out as cells divide. In contrast, the gene therapy described herein is based on gene insertion to allow long-term gene expression.
[0161] When specific rAAVs comprising specific sequences (e.g., specific bidirectional construct sequences or specific unidirectional construct sequences) are disclosed herein, they are meant to encompass the sequence disclosed or the reverse complement of the sequence. For example, if a bidirectional or unidirectional construct disclosed herein consists of the hypothetical sequence 5’-CTGGACCGA-3’, it is also meant to encompass the reverse complement of that sequence (5’-TCGGTCCAG-3’). Likewise, when rAAVs comprising bidirectional or unidirectional construct elements in a specific 5’ to 3’ order are disclosed herein, they are also meant to encompass the reverse complement of the order of those elements. For example, if an rAAV is disclosed herein that comprises a bidirectional construct that comprises from 5’ to 3’ a first splice acceptor, a first coding sequence, a first terminator, a reverse complement of a second terminator, a reverse complement of a second coding sequence, and a reverse complement of a second splice acceptor, it is also meant to encompass a construct comprising from 5’ to 3’ the second splice acceptor, the second coding sequence, the second terminator, a reverse complement of the first terminator, a reverse complement of the first coding sequence, and a reverse complement of the first splice acceptor. Single-stranded AAV genomes are packaged as either sense (plus-stranded) or anti-sense (minus-stranded genomes), and single- stranded AAV genomes of + and – polarity are packaged with equal frequency into mature rAAV virions. See, e.g., LING et al. (2015) J. Mol. Genet. Med.9(3):175, Zhou et al. (2008) Mol. Ther. 16(3):494-499, and Samulski et al. (1987) J. Virol. 61:3096-3101, each of which is herein incorporated by reference in its entirety for all purposes.
[0162] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, flanked by two inverted terminal repeats that allow for synthesis of the complementary DNA strand. When constructing an AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be supplied in trans. In addition to Rep and Cap, AAV can require a helper plasmid containing genes from adenovirus. These genes (E4, E2a, and VA) mediate AAVAttorney Docket No. 057766 / 616958 replication. For example, the transfer plasmid, Rep / Cap, and the helper plasmid can be transfected into HEK293 cells containing the adenovirus gene E1+ to produce infectious AAV particles. Alternatively, the Rep, Cap, and adenovirus helper genes may be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.
[0163] Multiple serotypes of AAV have been identified. These serotypes differ in the types of cells they infect (i.e., their tropism), allowing preferential transduction of specific cell types. The term AAV includes, for example, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and hybrids thereof, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. The genomic sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank. An “AAV vector” as used herein refers to an AAV vector comprising a heterologous sequence not of AAV origin (i.e., a nucleic acid sequence heterologous to AAV), typically comprising a sequence encoding an exogenous polypeptide of interest. The construct may comprise an AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and hybrids thereof, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV capsid sequence. In general, the heterologous nucleic acid sequence (the transgene) is flanked by at least one, and generally by two, AAV inverted terminal repeat sequences (ITRs). An AAV vector may either be single-stranded (ssAAV) or self-complementary (scAAV). Examples of serotypes for liver tissue include AAV3B, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.74, and AAVhu.37, and particularly AAV8. In a specific example, the AAV vector comprising the nucleic acid construct can be recombinant AAV8 (rAAV8). A rAAV8 vector as described herein is one in which the capsid is from AAV8. For example, an AAV vector using ITRs from AAV2 and a capsid of AAV8 is considered herein to be a rAAV8 vector.
[0164] Tropism can be further refined through pseudotyping, which is the mixing of a capsid and a genome from different viral serotypes. For example, AAV2 / 5 indicates a virus containingAttorney Docket No. 057766 / 616958 the genome of serotype 2 packaged in the capsid from serotype 5. Use of pseudotyped viruses can improve transduction efficiency, as well as alter tropism. Hybrid capsids derived from different serotypes can also be used to alter viral tropism. For example, AAV-DJ contains a hybrid capsid from eight serotypes and displays high infectivity across a broad range of cell types in vivo. AAV-DJ8 is another example that displays the properties of AAV-DJ but with enhanced brain uptake. AAV serotypes can also be modified through mutations. Examples of mutational modifications of AAV2 include Y444F, Y500F, Y730F, and S662V. Examples of mutational modifications of AAV3 include Y705F, Y731F, and T492V. Examples of mutational modifications of AAV6 include S663V and T492V. Other pseudotyped / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.
[0165] To accelerate transgene expression, self-complementary AAV (scAAV) variants can be used. Because AAV depends on the cell’s DNA replication machinery to synthesize the complementary strand of the AAV’s single-stranded DNA genome, transgene expression may be delayed. To address this delay, scAAV containing complementary sequences that are capable of spontaneously annealing upon infection can be used, eliminating the requirement for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.
[0166] To increase packaging capacity, longer transgenes may be split between two AAV transfer plasmids, the first with a 3’ splice donor and the second with a 5’ splice acceptor. Upon co-infection of a cell, these viruses form concatemers, are spliced together, and the full-length transgene can be expressed. Although this allows for longer transgene expression, expression is less efficient. Similar methods for increasing capacity utilize homologous recombination. For example, a transgene can be divided between two transfer plasmids but with substantial sequence overlap such that co-expression induces homologous recombination and expression of the full- length transgene. C. Nuclease Agents and CRISPR / Cas Systems
[0167] The methods and compositions disclosed herein can utilize nuclease agents such as Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) / CRISPR-associated (Cas) systems, zinc finger nuclease (ZFN) systems, or Transcription Activator-Like Effector Nuclease (TALEN) systems or components of such systems to modify a target genomic locus in a target gene such as a safe harbor gene (e.g., ALB) for insertion of a nucleic acid construct asAttorney Docket No. 057766 / 616958 disclosed herein. Generally, the nuclease agents involve the use of engineered cleavage systems to induce a double strand break or a nick (i.e., a single strand break) in a nuclease target site. Cleavage or nicking can occur through the use of specific nucleases such as engineered ZFNs, TALENs, or CRISPR / Cas systems with an engineered guide RNA to guide specific cleavage or nicking of the nuclease target site. Any nuclease agent that induces a nick or double-strand break at a desired target sequence can be used in the methods and compositions disclosed herein. The nuclease agent can be used to create a site of insertion at a desired locus (target gene) within a host genome, at which site the nucleic acid construct is inserted to express the polypeptide of interest.
[0168] In one example, the nuclease agent is a CRISPR / Cas system. In another example, the nuclease agent comprises one or more ZFNs. In yet another example, the nuclease agent comprises one or more TALENs. In a specific example, the CRISPR / Cas systems or components of such systems target an ALB gene or locus (e.g., ALB genomic locus) within a cell, or intron 1 of an ALB gene or locus within a cell. In a more specific example, the CRISPR / Cas systems or components of such systems target a human ALB gene or locus or intron 1 of a human ALB gene or locus within a cell.
[0169] CRISPR / Cas systems include transcripts and other elements involved in the expression of, or directing the activity of, Cas genes. A CRISPR / Cas system can be, for example, a type I, a type II, a type III system, or a type V system (e.g., subtype V-A or subtype V-B). The methods and compositions disclosed herein can employ CRISPR / Cas systems by utilizing CRISPR complexes (comprising a guide RNA (gRNA) complexed with a Cas protein) for site- directed binding or cleavage of nucleic acids. A CRISPR / Cas system targeting an ALB gene or locus comprises a Cas protein (or a nucleic acid encoding the Cas protein) and one or more guide RNAs (or DNAs encoding the one or more guide RNAs), with each of the one or more guide RNAs targeting a different guide RNA target sequence in the target genomic locus (e.g., ALB gene or locus).
[0170] CRISPR / Cas systems used in the compositions and methods disclosed herein can be non-naturally occurring. A non-naturally occurring system includes anything indicating the involvement of the hand of man, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free from at least one other component with which they are naturally associated in nature, or being associated with atAttorney Docket No. 057766 / 616958 least one other component with which they are not naturally associated. For example, some CRISPR / Cas systems employ non-naturally occurring CRISPR complexes comprising a gRNA and a Cas protein that do not naturally occur together, employ a Cas protein that does not occur naturally, or employ a gRNA that does not occur naturally. (1) Target Genomic Loci and Albumin (ALB)
[0171] Any target genomic locus capable of expressing a gene can be used, such as a safe harbor locus (safe harbor gene, such as ALB). The nucleic acid construct can be integrated into any part of the target genomic locus. For example, the nucleic acid construct can be inserted into an intron or an exon of a target genomic locus or can replace one or more introns and / or exons of a target genomic locus. In a specific example, the nucleic acid construct can be integrated into an intron of the target genomic locus, such as the first intron of the target genomic locus (e.g., ALB intron 1). See, e.g., WO 2020 / 082042, US 2020 / 0270617, WO 2020 / 082041, US 2020 / 0268906, WO 2020 / 082046, and US 2020 / 0289628, each of which is herein incorporated by reference in its entirety for all purposes. Constructs integrated into a target genomic locus can be operably linked to an endogenous promoter at the target genomic locus (e.g., the endogenous ALB promoter).
[0172] Interactions between integrated exogenous DNA and a host genome can limit the reliability and safety of integration and can lead to overt phenotypic effects that are not due to the targeted genetic modification but are instead due to unintended effects of the integration on surrounding endogenous genes. For example, randomly inserted transgenes can be subject to position effects and silencing, making their expression unreliable and unpredictable. Likewise, integration of exogenous DNA into a chromosomal locus can affect surrounding endogenous genes and chromatin, thereby altering cell behavior and phenotypes. Safe harbor loci include chromosomal loci where transgenes or other exogenous nucleic acid inserts can be stably and reliably expressed in all tissues of interest without overtly altering cell behavior or phenotype (i.e., without any deleterious effects on the host cell). See, e.g., Sadelain et al. (2012) Nat. Rev. Cancer 12:51-58, herein incorporated by reference in its entirety for all purposes. For example, the safe harbor locus can be one in which expression of the inserted gene sequence is not perturbed by any read-through expression from neighboring genes. For example, safe harbor loci can include chromosomal loci where exogenous DNA can integrate and function in a predictableAttorney Docket No. 057766 / 616958 manner without adversely affecting endogenous gene structure or expression. Safe harbor loci can include extragenic regions or intragenic regions such as, for example, loci within genes that are non-essential, dispensable, or able to be disrupted without overt phenotypic consequences.
[0173] Such safe harbor loci can offer an open chromatin configuration in all tissues and can be ubiquitously expressed during embryonic development and in adults. See, e.g., Zambrowicz et al. (1997) Proc. Natl. Acad. Sci. U.S.A. 94:3789-3794, herein incorporated by reference in its entirety for all purposes. In addition, the safe harbor loci can be targeted with high efficiency, and safe harbor loci can be disrupted with no overt phenotype. Examples of safe harbor loci include ALB, CCR5, HPRT, AAVS1, and Rosa26. See, e.g., US Patent Nos. 7,888,121; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; 8,586,526; and US Patent Publication Nos. 2003 / 0232410; 2005 / 0208489; 2005 / 0026157; 2006 / 0063231; 2008 / 0159996; 2010 / 00218264; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983; 2013 / 0177960; and 2013 / 0122591, each of which is herein incorporated by reference in its entirety for all purposes. Other examples of target genomic loci include an ALB locus, a EESYR locus, a SARS locus, position 188,083,272 of human chromosome 1 or its non-human mammalian orthologue, position 3,046,320 of human chromosome 10 or its non-human mammalian orthologue, position 67, 328,980 of human chromosome 17 or its non-human mammalian orthologue, an adeno- associated virus site 1 (AAVS1) on chromosome, a naturally occurring site of integration of AAV virus on human chromosome 19 or its non-human mammalian orthologue, a chemokine receptor 5 (CCR5) gene, a chemokine receptor gene encoding an HIV-1 coreceptor, or a mouse Rosa26 locus or its non-murine mammalian orthologue.
[0174] In a specific example, a safe harbor locus is a locus within the genome wherein a gene may be inserted without significant deleterious effects on the host cell such as a hepatocyte (e.g., without causing apoptosis, necrosis, and / or senescence, or without causing more than 5%, 10%, 15%, 20%, 25%, 30%, or 40% apoptosis, necrosis, and / or senescence as compared to a control population of cells). The safe harbor locus can allow overexpression of an exogenous gene without significant deleterious effects on the host cell such as a hepatocyte (e.g., without causing apoptosis, necrosis, and / or senescence, or without causing more than 5%, 10%, 15%, 20%, 25%, 30%, or 40% apoptosis, necrosis, and / or senescence as compared to a control population of cells). A desirable safe harbor locus may be one in which expression of the inserted gene sequence is not perturbed by read-through expression from neighboring genes. TheAttorney Docket No. 057766 / 616958 safe harbor may be a human safe harbor (e.g., for a liver tissue or hepatocyte host cell).
[0175] In a specific example, the target genomic locus is an ALB locus, such as intron 1 of an ALB locus. In a more specific example, the target genomic locus is a human ALB locus, such as intron 1 of a human ALB locus (e.g., SEQ ID NO: 4). (2) Cas Proteins
[0176] Cas proteins generally comprise at least one RNA recognition or binding domain that can interact with guide RNAs. Cas proteins can also comprise nuclease domains (e.g., DNase domains or RNase domains), DNA-binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. Some such domains (e.g., DNase domains) can be from a native Cas protein. Other such domains can be added to make a modified Cas protein. A nuclease domain possesses catalytic activity for nucleic acid cleavage, which includes the breakage of the covalent bonds of a nucleic acid molecule. Cleavage can produce blunt ends or staggered ends, and it can be single-stranded or double-stranded. For example, a wild type Cas9 protein will typically create a blunt cleavage product. Alternatively, a wild type Cpf1 protein (e.g., FnCpf1) can result in a cleavage product with a 5-nucleotide 5’ overhang, with the cleavage occurring after the 18th base pair from the PAM sequence on the non-targeted strand and after the 23rd base on the targeted strand. A Cas protein can have full cleavage activity to create a double-strand break at a target genomic locus (e.g., a double-strand break with blunt ends), or it can be a nickase that creates a single-strand break at a target genomic locus.
[0177] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, and homologs or modified versions thereof.
[0178] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. Cas9 proteins are from a type II CRISPR / Cas system and typically share four key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus,Attorney Docket No. 057766 / 616958 Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of the Cas9 family members are described in WO 2014 / 131833, herein incorporated by reference in its entirety for all purposes. Cas9 from S. pyogenes (SpCas9) (e.g., assigned UniProt accession number Q99ZW2) is an exemplary Cas9 protein. An exemplary SpCas9 protein sequence is set forth in SEQ ID NO: 8 (encoded by the DNA sequence set forth in SEQ ID NO: 9). An exemplary SpCas9 mRNA (cDNA) sequence is set forth in SEQ ID NO: 10. Smaller Cas9 proteins (e.g., Cas9 proteins whose coding sequences are compatible with the maximum AAV packaging capacity when combined with a guide RNA coding sequence and regulatory elements for the Cas9 and guide RNA, such as SaCas9 and CjCas9 and Nme2Cas9) are other exemplary Cas9 proteins. For example, Cas9 from S. aureus (SaCas9) (e.g., assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Likewise, Cas9 from Campylobacter jejuni (CjCas9) (e.g., assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. See, e.g., Kim et al. (2017) Nat. Commun. 8:14500, herein incorporated by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 from Neisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, e.g., Edraki et al. (2019) Mol. Cell 73(4):714-726, herein incorporated by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., StreptococcusAttorney Docket No. 057766 / 616958 thermophilus LMD-9 Cas9 encoded by the CRISPR1 locus (St1Cas9) or Streptococcus thermophilus Cas9 from the CRISPR3 locus (St3Cas9)) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 variant that recognizes an alternative PAM (E1369R / E1449H / R1556A substitutions) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed, e.g., in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, herein incorporated by reference in its entirety for all purposes. Examples of Cas9 coding sequences, Cas9 mRNAs, and Cas9 protein sequences are provided in WO 2013 / 176772, WO 2014 / 065596, WO 2016 / 106121, WO 2019 / 067910, WO 2020 / 082042, US 2020 / 0270617, WO 2020 / 082041, US 2020 / 0268906, WO 2020 / 082046, and US 2020 / 0289628, each of which is herein incorporated by reference in its entirety for all purposes. Specific examples of ORFs and Cas9 amino acid sequences are provided in Table 30 at paragraph
[0449] WO 2019 / 067910, and specific examples of Cas9 mRNAs and ORFs are provided in paragraphs
[0214] -
[0234] of WO 2019 / 067910. See also WO 2020 / 082046 A2 (pp. 84-85) and Table 24 in WO 2020 / 069296, each of which is herein incorporated by reference in its entirety for all purposes. An exemplary SpCas9 protein sequence comprises, consists essentially of, or consists of SEQ ID NO: 11. An exemplary SpCas9 mRNA sequence encoding that SpCas9 protein sequence comprises, consists essentially of, or consists of SEQ ID NO: 12. Another exemplary SpCas9 mRNA sequence encoding that SpCas9 protein sequence comprises, consists essentially of, or consists of SEQ ID NO: 1. Another exemplary SpCas9 mRNA sequence encoding that SpCas9 protein sequence comprises SEQ ID NO: 2. An exemplary SpCas9 coding sequence comprises, consists essentially of, or consists of SEQ ID NO: 3.
[0179] Another example of a Cas protein is a Cpf1 (CRISPR from Prevotella and Francisella 1) protein. Cpf1 is a large protein (about 1300 amino acids) that contains a RuvC- like nuclease domain homologous to the corresponding domain of Cas9 along with a counterpart to the characteristic arginine-rich cluster of Cas9. However, Cpf1 lacks the HNH nuclease domain that is present in Cas9 proteins, and the RuvC-like domain is contiguous in the Cpf1 sequence, in contrast to Cas9 where it contains long inserts including the HNH domain. See, e.g., Zetsche et al. (2015) Cell 163(3):759-771, herein incorporated by reference in its entirety for all purposes. Exemplary Cpf1 proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC20171, ButyrivibrioAttorney Docket No. 057766 / 616958 proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. Cpf1 from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.
[0180] Another example of a Cas protein is CasX (Cas12e). CasX is an RNA-guided DNA endonuclease that generates a staggered double-strand break in DNA. CasX is less than 1000 amino acids in size. Exemplary CasX proteins are from Deltaproteobacteria (DpbCasX or DpbCas12e) and Planctomycetes (PlmCasX or PlmCas12e). Like Cpf1, CasX uses a single RuvC active site for DNA cleavage. See, e.g., Liu et al. (2019) Nature 566(7743):218-223, herein incorporated by reference in its entirety for all purposes.
[0181] Another example of a Cas protein is CasΦ (CasPhi or Cas12j), which is uniquely found in bacteriophages. CasΦ is less than 1000 amino acids in size (e.g., 700-800 amino acids). CasΦ cleavage generates staggered 5’ overhangs. A single RuvC active site in CasΦ is capable of crRNA processing and DNA cutting. See, e.g., Pausch et al. (2020) Science 369(6501):333- 337, herein incorporated by reference in its entirety for all purposes.
[0182] Cas proteins can be wild type proteins (i.e., those that occur in nature), modified Cas proteins (i.e., Cas protein variants), or fragments of wild type or modified Cas proteins. Cas proteins can also be active variants or fragments with respect to catalytic activity of wild type or modified Cas proteins. Active variants or fragments with respect to catalytic activity can comprise at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the wild type or modified Cas protein or a portion thereof, wherein the active variants retain the ability to cut at a desired cleavage site and hence retain nick-inducing or double-strand-break-inducing activity. Assays for nick-inducing or double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the Cas protein on DNA substrates containing the cleavage site.
[0183] One example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 harboring alterations (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, e.g.,Attorney Docket No. 057766 / 616958 Kleinstiver et al. (2016) Nature 529(7587):490-495, herein incorporated by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, e.g., Slaymaker et al. (2016) Science 351(6268):84-88, herein incorporated by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed, e.g., in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, herein incorporated by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, e.g., Hu et al. (2018) Nature 556:57-63, herein incorporated by reference in its entirety for all purposes.
[0184] Cas proteins can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to change any other activity or property of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or a Cas protein can be truncated to remove domains that are not essential for the function of the protein or to optimize (e.g., enhance or reduce) the activity of or a property of the Cas protein.
[0185] Cas proteins can comprise at least one nuclease domain, such as a DNase domain. For example, a wild type Cpf1 protein generally comprises a RuvC-like domain that cleaves both strands of target DNA, perhaps in a dimeric configuration. Likewise, CasX and CasΦ generally comprise a single RuvC-like domain that cleaves both strands of a target DNA. Cas proteins can also comprise at least two nuclease domains, such as DNase domains. For example, a wild type Cas9 protein generally comprises a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains can each cut a different strand of double-stranded DNA to make a double-stranded break in the DNA. See, e.g., Jinek et al. (2012) Science 337(6096):816- 821, herein incorporated by reference in its entirety for all purposes.
[0186] One or more of the nuclease domains can be deleted or mutated so that they are no longer functional or have reduced nuclease activity. For example, if one of the nuclease domains is deleted or mutated in a Cas9 protein, the resulting Cas9 protein can be referred to as a nickase and can generate a single-strand break within a double-stranded target DNA but not a double- strand break (i.e., it can cleave the complementary strand or the non-complementary strand, but not both). If none of the nuclease domains is deleted or mutated in a Cas9 protein, the Cas9Attorney Docket No. 057766 / 616958 protein will retain double-strand-break-inducing activity. An example of a mutation that converts Cas9 into a nickase is a D10A (aspartate to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from S. pyogenes. Likewise, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes can convert the Cas9 into a nickase. Other examples of mutations that convert Cas9 into a nickase include the corresponding mutations to Cas9 from S. thermophilus. See, e.g., Sapranauskas et al. (2011) Nucleic Acids Res. 39(21):9275-9282 and WO 2013 / 141680, each of which is herein incorporated by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Examples of other mutations creating nickases can be found, for example, in WO 2013 / 176772 and WO 2013 / 142578, each of which is herein incorporated by reference in its entirety for all purposes.
[0187] Examples of inactivating mutations in the catalytic domains of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domains of Staphylococcus aureus Cas9 proteins are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) may comprise a substitution at position N580 (e.g., N580A substitution) or a substitution at position D10 (e.g., D10A substitution) to generate a Cas nickase. See, e.g., WO 2016 / 106236, herein incorporated by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domains of Nme2Cas9 are also known (e.g., D16A or H588A). Examples of inactivating mutations in the catalytic domains of St1Cas9 are also known (e.g., D9A, D598A, H599A, or N622A). Examples of inactivating mutations in the catalytic domains of St3Cas9 are also known (e.g., D10A or N870A). Examples of inactivating mutations in the catalytic domains of CjCas9 are also known (e.g., combination of D8A or H559A). Examples of inactivating mutations in the catalytic domains of FnCas9 and RHA FnCas9 are also known (e.g., N995A).
[0188] Examples of inactivating mutations in the catalytic domains of Cpf1 proteins are also known. With reference to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations can include mutations at positions 908, 993, or 1263 of AsCpf1 or corresponding positions in Cpf1 orthologs, or positions 832, 925, 947,Attorney Docket No. 057766 / 616958 or 1180 of LbCpf1 or corresponding positions in Cpf1 orthologs. Such mutations can include, for example, one or more of mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, e.g., US 2016 / 0208243, herein incorporated by reference in its entirety for all purposes.
[0189] Examples of inactivating mutations in the catalytic domains of CasX proteins are also known. With reference to CasX proteins from Deltaproteobacteria, D672A, E769A, and D935A (individually or in combination) or corresponding positions in other CasX orthologs are inactivating. See, e.g., Liu et al. (2019) Nature 566(7743):218-223, herein incorporated by reference in its entirety for all purposes.
[0190] Examples of inactivating mutations in the catalytic domains of CasΦ proteins are also known. For example, D371A and D394A, alone or in combination, are inactivating mutations. See, e.g., Pausch et al. (2020) Science 369(6501):333-337, herein incorporated by reference in its entirety for all purposes.
[0191] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. For example, a Cas protein can be fused to a cleavage domain. See WO 2014 / 089290, herein incorporated by reference in its entirety for all purposesCas proteins can also be fused to a heterologous polypeptide providing increased or decreased stability. The fused domain or heterologous polypeptide can be located at the N-terminus, the C-terminus, or internally within the Cas protein.
[0192] As one example, a Cas protein can be fused to one or more heterologous polypeptides that provide for subcellular localization. Such heterologous polypeptides can include, for example, one or more nuclear localization signals (NLS) such as the monopartite SV40 NLS and / or a bipartite alpha-importin NLS for targeting to the nucleus, a mitochondrial localization signal for targeting to the mitochondria, an ER retention signal, and the like. See, e.g., Lange et al. (2007) J. Biol. Chem. 282(8):5101-5105, herein incorporated by reference in its entirety for all purposes. Such subcellular localization signals can be located at the N-terminus, the C- terminus, or anywhere within the Cas protein. An NLS can comprise a stretch of basic amino acids, and can be a monopartite sequence or a bipartite sequence. Optionally, a Cas protein can comprise two or more NLSs, including an NLS (e.g., an alpha-importin NLS or a monopartite NLS) at the N-terminus and an NLS (e.g., an SV40 NLS or a bipartite NLS) at the C-terminus. AAttorney Docket No. 057766 / 616958 Cas protein can also comprise two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.
[0193] A Cas protein may, for example, be fused with 1-10 NLSs (e.g., fused with 1-5 NLSs or fused with one NLS. Where one NLS is used, the NLS may be linked at the N-terminus or the C-terminus of the Cas protein sequence. It may also be inserted within the Cas protein sequence. Alternatively, the Cas protein may be fused with more than one NLS. For example, the Cas protein may be fused with 2, 3, 4, or 5 NLSs. In a specific example, the Cas protein may be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. For example, the Cas protein can be fused to two SV40 NLS sequences linked at the carboxy terminus. Alternatively, the Cas protein may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In other examples, the Cas protein may be fused with 3 NLSs or with no NLS. The NLS may be a monopartite sequence, such as, e.g., the SV40 NLS, PKKKRKV (SEQ ID NO: 13) or PKKKRRV (SEQ ID NO: 14). The NLS may be a bipartite sequence, such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 15). In a specific example, a single PKKKRKV (SEQ ID NO: 13) NLS may be linked at the C-terminus of the Cas protein. One or more linkers are optionally included at the fusion site.
[0194] Cas proteins can also be operably linked to a cell-penetrating domain or protein transduction domain. For example, the cell-penetrating domain can be derived from the HIV-1 TAT protein, the TLM cell-penetrating motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell penetrating peptide from Herpes simplex virus, or a polyarginine peptide sequence. See, e.g., WO 2014 / 089290 and WO 2013 / 176772, each of which is herein incorporated by reference in its entirety for all purposes. The cell-penetrating domain can be located at the N-terminus, the C-terminus, or anywhere within the Cas protein.
[0195] Cas proteins can also be operably linked to a heterologous polypeptide for ease of tracking or purification, such as a fluorescent protein, a purification tag, or an epitope tag. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi- Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry,Attorney Docket No. 057766 / 616958 mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.
[0196] Cas proteins can also be tethered to labeled nucleic acids. Such tethering (i.e., physical linking) can be achieved through covalent interactions or noncovalent interactions, and the tethering can be direct (e.g., through direct fusion or chemical conjugation, which can be achieved by modification of cysteine or lysine residues on the protein or intein modification), or can be achieved through one or more intervening linkers or adapter molecules such as streptavidin or aptamers. See, e.g., Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55; Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332; Goodman et al. (2009) Chembiochem. 10(9):1551-1557; and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is herein incorporated by reference in its entirety for all purposes. Noncovalent strategies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using a wide variety of chemistries. Some of these chemistries involve direct attachment of the oligonucleotide to an amino acid residue on the protein surface (e.g., a lysine amine or a cysteine thiol), while other more complex schemes require post-translational modification of the protein or the involvement of a catalytic or reactive protein domain. Methods for covalent attachment of proteins to nucleic acids can include, for example, chemical cross-linking of oligonucleotides to protein lysine or cysteine residues, expressed protein-ligation, chemoenzymatic methods, and the use of photoaptamers. The labeled nucleic acid can be tethered to the C-terminus, the N-terminus, or to an internal region within the Cas protein. In one example, the labeled nucleic acid is tethered to the C-terminus or the N- terminus of the Cas protein. Likewise, the Cas protein can be tethered to the 5’ end, the 3’ end, or to an internal region within the labeled nucleic acid. That is, the labeled nucleic acid can beAttorney Docket No. 057766 / 616958 tethered in any orientation and polarity. For example, the Cas protein can be tethered to the 5’ end or the 3’ end of the labeled nucleic acid.
[0197] Cas proteins can be provided in any form. For example, a Cas protein can be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, a Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon optimized for efficient translation into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to substitute codons having a higher frequency of usage in a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, or any other host cell of interest, as compared to the naturally occurring polynucleotide sequence. When a nucleic acid encoding the Cas protein is introduced into the cell, the Cas protein can be transiently, conditionally, or constitutively expressed in the cell.
[0198] Nucleic acids encoding Cas proteins can be stably integrated in the genome of a cell and operably linked to a promoter active in the cell. Alternatively, nucleic acids encoding Cas proteins can be operably linked to a promoter in an expression construct. Expression constructs include any nucleic acid constructs capable of directing expression of a gene or other nucleic acid sequence of interest (e.g., a Cas gene) and which can transfer such a nucleic acid sequence of interest to a target cell. For example, the nucleic acid encoding the Cas protein can be in a vector comprising a DNA encoding a gRNA. Alternatively, it can be in a vector or plasmid that is separate from the vector comprising the DNA encoding the gRNA. Promoters that can be used in an expression construct include promoters active, for example, in one or more of a eukaryotic cell, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a pluripotent cell, an embryonic stem (ES) cell, an adult stem cell, a developmentally restricted progenitor cell, an induced pluripotent stem (iPS) cell, or a one-cell stage embryo. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter driving expression of both a Cas protein in one direction and a guide RNA in the other direction. Such bidirectional promoters can consist of (1) a complete, conventional, unidirectional Pol III promoter that contains 3 external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; and (2) aAttorney Docket No. 057766 / 616958 second basic Pol III promoter that includes a PSE and a TATA box fused to the 5’ terminus of the DSE in reverse orientation. For example, in the H1 promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be rendered bidirectional by creating a hybrid promoter in which transcription in the reverse direction is controlled by appending a PSE and TATA box derived from the U6 promoter. See, e.g., US 2016 / 0074535, herein incorporated by references in its entirety for all purposes. Use of a bidirectional promoter to express genes encoding a Cas protein and a guide RNA simultaneously allow for the generation of compact expression cassettes to facilitate delivery. In preferred embodiments, promotors are accepted by regulatory authorities for use in humans. In certain embodiments, promotors drive expression in a liver cell.
[0199] Different promoters can be used to drive Cas expression or Cas9 expression. In some methods, small promoters are used so that the Cas or Cas9 coding sequence can fit into an AAV construct. For example, Cas or Cas9 and one or more gRNAs (e.g., 1 gRNA or 2 gRNAs or 3 gRNAs or 4 gRNAs) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery (e.g., AAV2-mediated delivery, AAV5- mediated delivery, AAV8-mediated delivery, or AAV7m8-mediated delivery). For example, the nuclease agent can be CRISPR / Cas9, and a Cas9 mRNA and a gRNA targeting an intron 1 of an endogenous human ALB locus can be delivered via LNP-mediated delivery or AAV-mediated delivery. The Cas or Cas9 and the gRNA(s) can be delivered in a single AAV or via two separate AAVs. For example, a first AAV can carry a Cas or Cas9 expression cassette, and a second AAV can carry a gRNA expression cassette. Similarly, a first AAV can carry a Cas or Cas9 expression cassette, and a second AAV can carry two or more gRNA expression cassettes. Alternatively, a single AAV can carry a Cas or Cas9 expression cassette (e.g., Cas or Cas9 coding sequence operably linked to a promoter) and a gRNA expression cassette (e.g., gRNA coding sequence operably linked to a promoter). Similarly, a single AAV can carry a Cas or Cas9 expression cassette (e.g., Cas or Cas9 coding sequence operably linked to a promoter) and two or more gRNA expression cassettes (e.g., gRNA coding sequences operably linked to promoters). Different promoters can be used to drive expression of the gRNA, such as a U6 promoter or the small tRNA Gln. Likewise, different promoters can be used to drive Cas9 expression. For example, small promoters are used so that the Cas9 coding sequence can fit into an AAV construct. Similarly, small Cas9 proteins (e.g., SaCas9 or CjCas9 are used to maximize the AAV packaging capacity).Attorney Docket No. 057766 / 616958
[0200] Cas proteins provided as mRNAs can be modified for improved stability and / or immunogenicity properties. The modifications may be made to one or more nucleosides within the mRNA. Examples of chemical modifications to mRNA nucleobases include pseudouridine, 1-methyl-pseudouridine, and 5-methyl-cytidine. mRNA encoding Cas proteins can also be capped. The cap can be, for example, a cap 1 structure in which the +1 ribonucleotide is methylated at the 2’O position of the ribose. The capping can, for example, give superior activity in vivo (e.g., by mimicking a natural cap), can result in a natural structure that reduce stimulation of the innate immune system of the host (e.g., can reduce activation of pattern recognition receptors in the innate immune system). mRNA encoding Cas proteins can also be polyadenylated (to comprise a poly(A) tail). mRNA encoding Cas proteins can also be modified to include pseudouridine (e.g., can be fully substituted with pseudouridine). As another example, capped and polyadenylated Cas mRNA containing N1-methyl-pseudouridine can be used. mRNA encoding Cas proteins can also be modified to include N1-methyl-pseudouridine (e.g., can be fully substituted with N1-methyl-pseudouridine). As another example, Cas mRNA fully substituted with pseudouridine can be used (i.e., all standard uracil residues are replaced with pseudouridine, a uridine isomer in which the uracil is attached with a carbon-carbon bond rather than nitrogen-carbon). As another example, Cas mRNA fully substituted with N1-methyl- pseudouridine can be used (i.e., all standard uracil residues are replaced with N1-methyl- pseudouridine). Likewise, Cas mRNAs can be modified by depletion of uridine using synonymous codons. For example, capped and polyadenylated Cas mRNA fully substituted with pseudouridine can be used. For example, capped and polyadenylated Cas mRNA fully substituted with N1-methyl-pseudouridine can be used.
[0201] Cas mRNAs can comprise a modified uridine at least at one, a plurality of, or all uridine positions. The modified uridine can be a uridine modified at the 5 position (e.g., with a halogen, methyl, or ethyl). The modified uridine can be a pseudouridine modified at the 1 position (e.g., with a halogen, methyl, or ethyl). The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some examples, the modified uridine is 5-methoxyuridine. In some examples, the modified uridine is 5-iodouridine. In some examples, the modified uridine is pseudouridine. In some examples, the modified uridine is N1-methyl-pseudouridine. In some examples, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In someAttorney Docket No. 057766 / 616958 examples, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some examples, the modified uridine is a combination of N1-methyl pseudouridine and 5- methoxyuridine. In some examples, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some examples, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some examples, the modified uridine is a combination of 5- iodouridine and 5-methoxyuridine.
[0202] Cas mRNAs disclosed herein can also comprise a 5’ cap, such as a Cap0, Cap1, or Cap2. A 5’ cap is generally a 7-methylguanine ribonucleotide (which may be further modified, e.g., with respect to ARCA) linked through a 5’-triphosphate to the 5’ position of the first nucleotide of the 5’-to-3’ chain of the mRNA (i.e., the first cap-proximal nucleotide). In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’- hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA comprise a 2’-methoxy and a 2’-hydroxyl, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise a 2’-methoxy. See, e.g., Katibah et al. (2014) Proc. Natl. Acad. Sci. U.S.A. 111(33):12025-30 and Abbas et al. (2017) Proc. Natl. Acad. Sci. U.S.A. 114(11):E2106-E2115, each of which is herein incorporated by reference in its entirety for all purposes. Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNAs, comprise Cap1 or Cap2. Cap0 and other cap structures differing from Cap1 and Cap2 may be immunogenic in mammals, such as humans, due to recognition as non-self by components of the innate immune system such as IFIT-1 and IFIT-5, which can result in elevated cytokine levels including type I interferon. Components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for binding of an mRNA with a cap other than Cap1 or Cap2, potentially inhibiting translation of the mRNA.
[0203] A cap can be included co-transcriptionally. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific Cat. No. AM8045) is a cap analog comprising a 7- methylguanine 3’-methoxy-5’-triphosphate linked to the 5’ position of a guanine ribonucleotide which can be incorporated in vitro into a transcript at initiation. ARCA results in a Cap0 cap in which the 2’ position of the first cap-proximal nucleotide is hydroxyl. See, e.g., Stepinski et al. (2001) RNA 7:1486-1495, herein incorporated by reference in its entirety for all purposes.
[0204] CleanCapTMAG (m7G(5’)ppp(5’)(2’OMeA)pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCapTMGG (m7G(5’)ppp(5’)(2’OMeG)pG; TriLink Biotechnologies Cat. No.Attorney Docket No. 057766 / 616958 N-7133) can be used to provide a Cap1 structure co-transcriptionally. 3’-O-methylated versions of CleanCapTMAG and CleanCapTMGG are also available from TriLink Biotechnologies as Cat. Nos. N-7413 and N-7433, respectively.
[0205] Alternatively, a cap can be added to an RNA post-transcriptionally. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Cat. No. M2080S) and has RNA triphosphatase and guanylyltransferase activities, provided by its D1 subunit, and guanine methyltransferase, provided by its D12 subunit. As such, it can add a 7-methylguanine to an RNA, so as to give Cap0, in the presence of S-adenosyl methionine and GTP. See, e.g., Guo and Moss (1990) Proc. Natl. Acad. Sci. U.S.A. 87:4023-4027 and Mao and Shuman (1994) J. Biol. Chem. 269:24472-24479, each of which is herein incorporated by reference in its entirety for all purposes.
[0206] Cas mRNAs can further comprise a poly-adenylated (poly-A or poly(A) or poly- adenine) tail. The poly-A tail can, for example, comprise at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 adenines, and optionally up to 300 adenines. For example, the poly-A tail can comprise 95, 96, 97, 98, 99, or 100 adenine nucleotides. (3) Guide RNAs
[0207] A “guide RNA” or “gRNA” is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within a target DNA. Guide RNAs can comprise two segments: a “DNA-targeting segment” (also called “guide sequence”) and a “protein-binding segment.” “Segment” includes a section or region of a molecule, such as a contiguous stretch of nucleotides in an RNA. Some gRNAs, such as those for Cas9, can comprise two separate RNA molecules: an “activator-RNA” (e.g., tracrRNA) and a “targeter- RNA” (e.g., CRISPR RNA or crRNA). Other gRNAs are a single RNA molecule (single RNA polynucleotide), which can also be called a “single-molecule gRNA,” a “single-guide RNA,” or an “sgRNA.” See, e.g., WO 2013 / 176772, WO 2014 / 065596, WO 2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is herein incorporated by reference in its entirety for all purposes. A guide RNA can refer to either a CRISPR RNA (crRNA) or the combination of a crRNA and a trans-activating CRISPR RNA (tracrRNA). The crRNA and tracrRNA can be associated as a single RNA molecule (singleAttorney Docket No. 057766 / 616958 guide RNA or sgRNA) or in two separate RNA molecules (dual guide RNA or dgRNA). For Cas9, for example, a single-guide RNA can comprise a crRNA fused to a tracrRNA (e.g., via a linker). For Cpf1 and CasΦ, for example, only a crRNA is needed to achieve binding to a target sequence. The terms “guide RNA” and “gRNA” include both double-molecule (i.e., modular) gRNAs and single-molecule gRNAs. In some of the methods and compositions disclosed herein, a gRNA is a S. pyogenes Cas9 gRNA or an equivalent thereof. In some of the methods and compositions disclosed herein, a gRNA is a S. aureus Cas9 gRNA or an equivalent thereof.
[0208] An exemplary two-molecule gRNA comprises a crRNA-like (“CRISPR RNA” or “targeter-RNA” or “crRNA” or “crRNA repeat”) molecule and a corresponding tracrRNA-like (“trans-activating CRISPR RNA” or “activator-RNA” or “tracrRNA”) molecule. A crRNA comprises both the DNA-targeting segment (single-stranded) of the gRNA and a stretch of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. An example of a crRNA tail (e.g., for use with S. pyogenes Cas9), located downstream (3’) of the DNA-targeting segment, comprises, consists essentially of, or consists of GUUUUAGAGCUAUGCU (SEQ ID NO: 16) or GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 17). Any of the DNA-targeting segments disclosed herein can be joined to the 5’ end of SEQ ID NO: 16 or 17 to form a crRNA.
[0209] A corresponding tracrRNA (activator-RNA) comprises a stretch of nucleotides that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. A stretch of nucleotides of a crRNA are complementary to and hybridize with a stretch of nucleotides of a tracrRNA to form the dsRNA duplex of the protein-binding domain of the gRNA. As such, each crRNA can be said to have a corresponding tracrRNA. Examples of tracrRNA sequences (e.g., for use with S. pyogenes Cas9) comprise, consist essentially of, or consist of any one of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUU (SEQ ID NO: 18), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU (SEQ ID NO: 19), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 20).
[0210] In systems in which both a crRNA and a tracrRNA are needed, the crRNA and the corresponding tracrRNA hybridize to form a gRNA. In systems in which only a crRNA isAttorney Docket No. 057766 / 616958 needed, the crRNA can be the gRNA. The crRNA additionally provides the single-stranded DNA-targeting segment that hybridizes to the complementary strand of a target DNA. If used for modification within a cell, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecules will be used. See, e.g., Mali et al. (2013) Science 339(6121):823-826; Jinek et al. (2012) Science 337(6096):816-821; Hwang et al. (2013) Nat. Biotechnol. 31(3):227-229; Jiang et al. (2013) Nat. Biotechnol. 31(3):233-239; and Cong et al. (2013) Science 339(6121):819-823, each of which is herein incorporated by reference in its entirety for all purposes.
[0211] The DNA-targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence that is complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA-targeting segment of a gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of the DNA-targeting segment may vary and determines the location within the target DNA with which the gRNA and the target DNA will interact. The DNA-targeting segment of a subject gRNA can be modified to hybridize to any desired sequence within a target DNA. Naturally occurring crRNAs differ depending on the CRISPR / Cas system and organism but often contain a targeting segment of between 21 to 72 nucleotides length, flanked by two direct repeats (DR) of a length of between 21 to 46 nucleotides (see, e.g., WO 2014 / 131833, herein incorporated by reference in its entirety for all purposes). In the case of S. pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3’ located DR is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas protein.
[0212] The DNA-targeting segment can have, for example, a length of at least about 12, at least about 15, at least about 17, at least about 18, at least about 19, at least about 20, at least about 25, at least about 30, at least about 35, or at least about 40 nucleotides. Such DNA- targeting segments can have, for example, a length from about 12 to about 100, from about 12 to about 80, from about 12 to about 50, from about 12 to about 40, from about 12 to about 30, from about 12 to about 25, or from about 12 to about 20 nucleotides. For example, the DNA targeting segment can be from about 15 to about 25 nucleotides (e.g., from about 17 to about 20 nucleotides, or about 17, 18, 19, or 20 nucleotides). See, e.g., US 2016 / 0024523, herein incorporated by reference in its entirety for all purposes. For Cas9 from S. pyogenes, a typicalAttorney Docket No. 057766 / 616958 DNA-targeting segment is between 16 and 20 nucleotides in length or between 17 and 20 nucleotides in length. For Cas9 from S. aureus, a typical DNA-targeting segment is between 21 and 23 nucleotides in length. For Cpf1, a typical DNA-targeting segment is at least 16 nucleotides in length or at least 18 nucleotides in length.
[0213] In one example, the DNA-targeting segment can be about 20 nucleotides in length. However, shorter and longer sequences can also be used for the targeting segment (e.g., 15-25 nucleotides in length, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length). The degree of identity between the DNA-targeting segment and the corresponding guide RNA target sequence (or degree of complementarity between the DNA-targeting segment and the other strand of the guide RNA target sequence) can be, for example, about 75%, about 80%, about 85%, about 90%, about 95%, or 100%. The DNA-targeting segment and the corresponding guide RNA target sequence can contain one or more mismatches. For example, the DNA- targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches (e.g., where the total length of the guide RNA target sequence is at least 17, at least 18, at least 19, or at least 20 or more nucleotides). For example, the DNA-targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches where the total length of the guide RNA target sequence 20 nucleotides.
[0214] As one example, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment (i.e., guide sequence) comprising, consisting essentially of, or consisting of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 90% or at least 95% identical to the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment thatAttorney Docket No. 057766 / 616958 is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence (DNA- targeting segment) set forth in any one of SEQ ID NOS: 30-61. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 30- 61.
[0215] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment (i.e., guide sequence) comprising, consisting essentially of, or consisting of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA- targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 90% or at least 95% identical to the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQAttorney Docket No. 057766 / 616958 ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in any one of SEQ ID NOS: 36, 30, 33, and 41.
[0216] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment (i.e., guide sequence) comprising, consisting essentially of, or consisting of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene canAttorney Docket No. 057766 / 616958 comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 36.
[0217] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment (i.e., guide sequence) comprising, consisting essentially of, or consisting of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more thanAttorney Docket No. 057766 / 616958 2, or no more than 1 nucleotide from at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 30.
[0218] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment (i.e., guide sequence) comprising, consisting essentially of, or consisting of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 33.
[0219] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment (i.e., guide sequence) comprising, consisting essentially of, or consisting of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41.Attorney Docket No. 057766 / 616958 Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA- targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise a DNA-targeting segment comprising, consisting essentially of, or consisting of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence (DNA-targeting segment) set forth in SEQ ID NO: 41.Attorney Docket No. 057766 / 616958
[0220] Table 2. Human ALB Intron 1 Guide Sequences. Guide Sequence SEQ ID NO: GAGCAACCUCACUCUUGUCU 30 AUGCAUUUGUUUCAAAAUAU 31
[0221] Table 3. Human ALB Intron 1 sgRNA Sequences. Full Sequence Full Sequence Modified GAGCAACCUCACUCUUGUCUGUUU mG*mA*mG*CAACCUCACUCUUGUCUGUUUUAGAmGmC C CAttorney Docket No. 057766 / 616958 Full Sequence Full Sequence Modified AUUUAUGAGAUCAACAGCACGUUU mA*mU*mU*UAUGAGAUCAACAGCACGUUUUAGAmGmC UAGAGCUAGAAAUAGCAAGUUAAA mUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCU C C C C C C C C C CAttorney Docket No. 057766 / 616958 Full Sequence Full Sequence Modified GAAAAAGUGGCACCGAGUCGGUGC mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*m UUUU (SEQ ID NO: 75) U*mU*mU (SEQ ID NO: 107) C C C C C C C C C C CAttorney Docket No. 057766 / 616958 Full Sequence Full Sequence Modified AUAAGGCUAGUCCGUUAUCAACUU AGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmU GAAAAAGUGGCACCGAGUCGGUGC mGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*m C C C C C C C
[0222] Table 4. Mouse Alb Intron 1 Guide Sequences. Guide Sequence SEQ ID NO: CACUCUUGUCUGUGGAAACA 164
[0223] Table 5. Mouse Alb Intron 1 sgRNA Sequences. Full Sequence Full Sequence Modified CACUCUUGUCUGUGGAAACAGUUU C* A* C*UCUUGUCUGUGGAAACAGUUUUAGA G CAttorney Docket No. 057766 / 616958
[0224] TracrRNAs can be in any form (e.g., full-length tracrRNAs or active partial tracrRNAs) and of varying lengths. They can include primary transcripts or processed forms. For example, tracrRNAs (as part of a single-guide RNA or as a separate molecule as part of a two- molecule gRNA) may comprise, consist essentially of, or consist of all or a portion of a wild type tracrRNA sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild type tracrRNA sequence). Examples of wild type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, e.g., Deltcheva et al. (2011) Nature 471(7340):602-607; WO 2014 / 093661, each of which is herein incorporated by reference in its entirety for all purposes. Examples of tracrRNAs within single-guide RNAs (sgRNAs) include the tracrRNA segments found within +48, +54, +67, and +85 versions of sgRNAs, where “+n” indicates that up to the +n nucleotide of wild type tracrRNA is included in the sgRNA. See US 8,697,359, herein incorporated by reference in its entirety for all purposes.
[0225] The percent complementarity between the DNA-targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%). The percent complementarity between the DNA-targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 contiguous nucleotides. As an example, the percent complementarity between the DNA-targeting segment and the complementary strand of the target DNA can be 100% over the 14 contiguous nucleotides at the 5’ end of the complementary strand of the target DNA and as low as 0% over the remainder. In such a case, the DNA-targeting segment can be considered to be 14 nucleotides in length. As another example, the percent complementarity between the DNA-targeting segment and the complementary strand of the target DNA can be 100% over the seven contiguous nucleotides at the 5’ end of the complementary strand of the target DNA and as low as 0% over the remainder. In such a case, the DNA-targeting segment can be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides within the DNA-targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA-targeting segment can be 20 nucleotides in length and can comprise 1, 2, or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatches are not adjacent to the region of the complementary strand corresponding to the protospacer adjacent motif (PAM) sequence (i.e., theAttorney Docket No. 057766 / 616958 reverse complement of the PAM sequence) (e.g., the mismatches are in the 5’ end of the DNA- targeting segment of the guide RNA, or the mismatches are at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).
[0226] The protein-binding segment of a gRNA can comprise two stretches of nucleotides that are complementary to one another. The complementary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein-binding segment of a subject gRNA interacts with a Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within target DNA via the DNA-targeting segment.
[0227] Single-guide RNAs can comprise a DNA-targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequence of the guide RNA). For example, such guide RNAs can have a 5’ DNA-targeting segment joined to a 3’ scaffold sequence. Exemplary scaffold sequences (e.g., for use with S. pyogenes Cas9) comprise, consist essentially of, or consist of: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCU (version 1; SEQ ID NO: 21); GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2; SEQ ID NO: 22); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (version 3; SEQ ID NO: 23); and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 4; SEQ ID NO: 24); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUUUUU (version 5; SEQ ID NO: 25); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (version 6; SEQ ID NO: 26); GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (version 7; SEQ ID NO: 27); or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGG CACCGAGUCGGUGC (version 8; SEQ ID NO: 28). In some guide sgRNAs, the four terminalAttorney Docket No. 057766 / 616958 U residues of version 6 are not present. In some sgRNAs, only 1, 2, or 3 of the four terminal U residues of version 6 are present. Guide RNAs targeting any of the guide RNA target sequences disclosed herein can include, for example, a DNA-targeting segment on the 5’ end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences on the 3’ end of the guide RNA. That is, any of the DNA-targeting segments disclosed herein can be joined to the 5’ end of any one of the above scaffold sequences to form a single guide RNA (chimeric guide RNA).
[0228] Guide RNAs can include modifications or sequences that provide for additional desirable features (e.g., modified or regulated stability; subcellular targeting; tracking with a fluorescent label; a binding site for a protein or protein complex; and the like). That is, guide RNAs can include one or more modified nucleosides or nucleotides, or one or more non- naturally and / or naturally occurring components or configurations that are used instead of or in addition to the canonical A, G, C, and U residues. Examples of such modifications include, for example, a 5’ cap (e.g., a 7-methylguanylate cap (m7G)); a 3’ polyadenylated tail (i.e., a 3’ poly(A) tail); a riboswitch sequence (e.g., to allow for regulated stability and / or regulated accessibility by proteins and / or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, and so forth); a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like); and combinations thereof. Other examples of modifications include engineered stem loop duplex structures, engineered bulge regions, engineered hairpins 3’ of the stem loop duplex structure, or any combination thereof. See, e.g., US 2015 / 0376586, herein incorporated by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides within the duplex made up of the crRNA-like region and the minimum tracrRNA- like region. A bulge can comprise, on one side of the duplex, an unpaired 5′-XXXY-3′ where X is any purine and Y can be a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex.Attorney Docket No. 057766 / 616958
[0229] Guide RNAs can comprise modified nucleosides and modified nucleotides including, for example, one or more of the following: (1) alteration or replacement of one or both of the non-linking phosphate oxygens and / or of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage (an exemplary backbone modification); (2) alteration or replacement of a constituent of the ribose sugar such as alteration or replacement of the 2’ hydroxyl on the ribose sugar (an exemplary sugar modification); (3) replacement (e.g., wholesale replacement) of the phosphate moiety with dephospho linkers (an exemplary backbone modification); (4) modification or replacement of a naturally occurring nucleobase, including with a non-canonical nucleobase (an exemplary base modification); (5) replacement or modification of the ribose-phosphate backbone (an exemplary backbone modification); (6) modification of the 3’ end or 5’ end of the oligonucleotide (e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety, cap, or linker (such 3’ or 5’ cap modifications may comprise a sugar and / or backbone modification); and (7) modification or replacement of the sugar (an exemplary sugar modification). Other possible guide RNA modifications include modifications of or replacement of uracils or poly-uracil tracts. See, e.g., WO 2015 / 048577 and US 2016 / 0237455, each of which is herein incorporated by reference in its entirety for all purposes. Similar modifications can be made to Cas-encoding nucleic acids, such as Cas mRNAs. For example, Cas mRNAs can be modified by depletion of uridine using synonymous codons.
[0230] Chemical modifications such at hose listed above can be combined to provide modified gRNAs and / or mRNAs comprising residues (nucleosides and nucleotides) that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In one example, every base of a gRNA is modified (e.g., all bases have a modified phosphate group, such as a phosphorothioate group). For example, all or substantially all of the phosphate groups of a gRNA can be replaced with phosphorothioate groups. Alternatively, or additionally, a modified gRNA can comprise at least one modified residue at or near the 5’ end. Alternatively, or additionally, a modified gRNA can comprise at least one modified residue at or near the 3’ end.
[0231] Some gRNAs comprise one, two, three or more modified residues. For example, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, atAttorney Docket No. 057766 / 616958 least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the positions in a modified gRNA can be modified nucleosides or nucleotides.
[0232] Unmodified nucleic acids can be prone to degradation. Exogenous nucleic acids can also induce an innate immune response. Modifications can help introduce stability and reduce immunogenicity. Some gRNAs described herein can contain one or more modified nucleosides or nucleotides to introduce stability toward intracellular or serum-based nucleases. Some modified gRNAs described herein can exhibit a reduced innate immune response when introduced into a population of cells.
[0233] The gRNAs disclosed herein can comprise a backbone modification in which the phosphate group of a modified residue can be modified by replacing one or more of the oxygens with a different substituent. The modification can include the wholesale replacement of an unmodified phosphate moiety with a modified phosphate group as described herein. Backbone modifications of the phosphate backbone can also include alterations that result in either an uncharged linker or a charged linker with unsymmetrical charge distribution.
[0234] Examples of modified phosphate groups include, phosphorothioate, phosphoroselenates, borano phosphates, borano phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates and phosphotriesters. The phosphorous atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorous atom chiral. The stereogenic phosphorous atom can possess either the “R” configuration (Rp) or the “S” configuration (Sp). The backbone can also be modified by replacement of a bridging oxygen, (i.e., the oxygen that links the phosphate to the nucleoside), with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylenephosphonates). The replacement can occur at either linking oxygen or at both of the linking oxygens.
[0235] The phosphate group can be replaced by non-phosphorus containing connectors in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties which can replace the phosphate group can include, without limitation, e.g., methyl phosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide,Attorney Docket No. 057766 / 616958 thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino.
[0236] Scaffolds that can mimic nucleic acids can also be constructed wherein the phosphate linker and ribose sugar are replaced by nuclease resistant nucleoside or nucleotide surrogates. Such modifications may comprise backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by a surrogate backbone. Examples can include, without limitation, the morpholino, cyclobutyl, pyrrolidine and peptide nucleic acid (PNA) nucleoside surrogates.
[0237] The modified nucleosides and modified nucleotides can include one or more modifications to the sugar group (a sugar modification). For example, the 2’ hydroxyl group (OH) can be modified (e.g., replaced with a number of different oxy or deoxy substituents. Modifications to the 2’ hydroxyl group can enhance the stability of the nucleic acid since the hydroxyl can no longer be deprotonated to form a 2’-alkoxide ion.
[0238] Examples of 2’ hydroxyl group modifications can include alkoxy or aryloxy (OR, wherein “R” can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or a sugar); polyethyleneglycols (PEG), O(CH2CH2O)nCH2CH2OR wherein R can be, e.g., H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20). The 2’ hydroxyl group modification can be 2’-O-Me. Likewise, the 2’ hydroxyl group modification can be a 2’-fluoro modification, which replaces the 2’ hydroxyl group with a fluoride. The 2’ hydroxyl group modification can include locked nucleic acids (LNA) in which the 2’ hydroxyl can be connected, e.g., by a C1-6alkylene or C1-6heteroalkylene bridge, to the 4’ carbon of the same ribose sugar, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy, O(CH2)n-amino, (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). The 2’ hydroxyl group modification can include unlocked nucleic acids (UNA) in which the ribose ring lacks the C2’-C3’ bond. The 2’ hydroxyl group modification can include the methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).Attorney Docket No. 057766 / 616958
[0239] Deoxy 2’ modifications can include hydrogen (i.e. deoxyribose sugars, e.g., at the overhang portions of partially dsRNA); halo (e.g., bromo, chloro, fluoro, or iodo); amino (wherein amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH)nCH2CH2- amino (wherein amino can be, e.g., as described herein), -NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted with e.g., an amino as described herein.
[0240] The sugar modification can comprise a sugar group which may also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a modified nucleic acid can include nucleotides containing e.g., arabinose, as the sugar. The modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. The modified nucleic acids can also include one or more sugars that are in the L form (e.g., L- nucleosides).
[0241] The modified nucleosides and modified nucleotides described herein, which can be incorporated into a modified nucleic acid, can include a modified base, also called a nucleobase. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or wholly replaced to provide modified residues that can be incorporated into modified nucleic acids. The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine analog, or pyrimidine analog. In some embodiments, the nucleobase can include, for example, naturally-occurring and synthetic derivatives of a base.
[0242] In a dual guide RNA, each of the crRNA and the tracrRNA can contain modifications. Such modifications may be at one or both ends of the crRNA and / or tracrRNA. In a sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, and / or internal nucleosides may be modified, and / or the entire sgRNA may be chemically modified. Some gRNAs comprise a 5’ end modification. Some gRNAs comprise a 3’ end modification.
[0243] The guide RNAs disclosed herein can comprise one of the modification patterns disclosed in WO 2018 / 107028 A1, herein incorporated by reference in its entirety for allAttorney Docket No. 057766 / 616958 purposes. The guide RNAs disclosed herein can also comprise one of the structures / modification patterns disclosed in US 2017 / 0114334, herein incorporated by reference in its entirety for all purposes. The guide RNAs disclosed herein can also comprise one of the structures / modification patterns disclosed in WO 2017 / 136794, WO 2017 / 004279, US 2018 / 0187186, or US 2019 / 0048338, each of which is herein incorporated by reference in its entirety for all purposes.
[0244] As one example, nucleotides at the 5’ or 3’ end of a guide RNA can include phosphorothioate linkages (e.g., the bases can have a modified phosphate group that is a phosphorothioate group). For example, a guide RNA can include phosphorothioate linkages between the 2, 3, or 4 terminal nucleotides at the 5’ or 3’ end of the guide RNA. As another example, nucleotides at the 5’ and / or 3’ end of a guide RNA can have 2’-O-methyl modifications. For example, a guide RNA can include 2’-O-methyl modifications at the 2, 3, or 4 terminal nucleotides at the 5’ and / or 3’ end of the guide RNA (e.g., the 5’ end). See, e.g., WO 2017 / 173054 A1 and Finn et al. (2018) Cell Rep. 22(9):2227-2235, each of which is herein incorporated by reference in its entirety for all purposes. Other possible modifications are described in more detail elsewhere herein. In a specific example, a guide RNA includes 2’-O- methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues. Such chemical modifications can, for example, provide greater stability and protection from exonucleases to guide RNAs, allowing them to persist within cells for longer than unmodified guide RNAs. Such chemical modifications can also, for example, protect against innate intracellular immune responses that can actively degrade RNA or trigger immune cascades that lead to cell death.
[0245] As one example, any of the guide RNAs described herein can comprise at least one modification. In one example, the at least one modification comprises a 2’-O-methyl (2’-O-Me) modified nucleotide, a phosphorothioate (PS) bond between nucleotides, a 2’-fluoro (2’-F) modified nucleotide, or a combination thereof. For example, the at least one modification can comprise a 2’-O-methyl (2’-O-Me) modified nucleotide. Alternatively, or additionally, the at least one modification can comprise a phosphorothioate (PS) bond between nucleotides. Alternatively, or additionally, the at least one modification can comprise a 2’-fluoro (2’-F) modified nucleotide. In one example, a guide RNA described herein comprises one or more 2’- O-methyl (2’-O-Me) modified nucleotides and one or more phosphorothioate (PS) bonds between nucleotides.Attorney Docket No. 057766 / 616958
[0246] The modifications can occur anywhere in the guide RNA. As one example, the guide RNA comprises a modification at one or more of the first five nucleotides at the 5’ end of the guide RNA, the guide RNA comprises a modification at one or more of the last five nucleotides of the 3’ end of the guide RNA, or a combination thereof. For example, the guide RNA can comprise phosphorothioate bonds between the first four nucleotides of the guide RNA, phosphorothioate bonds between the last four nucleotides of the guide RNA, or a combination thereof. Alternatively, or additionally, the guide RNA can comprise 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end of the guide RNA, can comprise 2’-O-Me modified nucleotides at the last three nucleotides at the 3’ end of the guide RNA, or a combination thereof.
[0247] In one example, a modified gRNA can comprise the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAm GmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 29), where “N” may be any natural or non-natural nucleotide. For example, the totality of N residues comprise a human ALB intron 1 DNA-targeting segment as described herein (e.g., the sequence set forth in SEQ ID NO: 29, wherein the N residues are replaced with the DNA- targeting segment of any one of SEQ ID NOS: 30-61, the DNA-targeting segment of any one of SEQ ID NOS: 36, 30, 33, and 41, or the DNA-targeting segment of SEQ ID NO: 36. For example, a modified gRNA can comprise the sequence set forth in any one of SEQ ID NOS: 94- 125, the sequence set forth in any one of SEQ ID NOS: 100, 94, 97, and 105, or the sequence set forth in SEQ ID NO: 100 in Table 3. The terms “mA,” “mC,” “mU,” and “mG” denote a nucleotide (A, C, U, and G, respectively) that has been modified with 2’-O-Me. The symbol “*” depicts a phosphorothioate modification. In certain embodiments, A, C, G, U, and N independently denote a ribose sugar, i.e., 2’-OH. In certain embodiments in the context of a modified sequence, A, C, G, U, and N denote a ribose sugar, i.e., 2’-OH. A phosphorothioate linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example, in the bonds between nucleotides bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos. The terms A*, C*, U*, or G* denote a nucleotide that is linked to the next (e.g., 3’) nucleotide with a phosphorothioate bond. The terms “mA*,” “mC*,” “mU*,” andAttorney Docket No. 057766 / 616958 “mG*” denote a nucleotide (A, C, U, and G, respectively) that has been substituted with 2’-O- Me and that is linked to the next (e.g., 3’) nucleotide with a phosphorothioate bond.
[0248] Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2’-fluoro (2’-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability. Abasic nucleotides refer to those which lack nitrogenous bases. Inverted bases refer to those with linkages that are inverted from the normal 5’ to 3' linkage (i.e., either a 5’ to 5’ linkage or a 3’ to 3’ linkage).
[0249] An abasic nucleotide can be attached with an inverted linkage. For example, an abasic nucleotide may be attached to the terminal 5’ nucleotide via a 5’ to 5’ linkage, or an abasic nucleotide may be attached to the terminal 3’ nucleotide via a 3’ to 3’ linkage. An inverted abasic nucleotide at either the terminal 5’ or 3’ nucleotide may also be called an inverted abasic end cap.
[0250] In one example, one or more of the first three, four, or five nucleotides at the 5’ terminus, and one or more of the last three, four, or five nucleotides at the 3’ terminus are modified. The modification can be, for example, a 2’-O-Me, 2’-F, inverted abasic nucleotide, phosphorothioate bond, or other nucleotide modification well known to increase stability and / or performance.
[0251] In another example, the first four nucleotides at the 5’ terminus, and the last four nucleotides at the 3’ terminus can be linked with phosphorothioate bonds.
[0252] In another example, the first three nucleotides at the 5’ terminus, and the last three nucleotides at the 3’ terminus can comprise a 2’-O-methyl (2’-O-Me) modified nucleotide. In another example, the first three nucleotides at the 5’ terminus, and the last three nucleotides at the 3’ terminus comprise a 2’-fluoro (2’-F) modified nucleotide. In another example, the first three nucleotides at the 5’ terminus, and the last three nucleotides at the 3’ terminus comprise an inverted abasic nucleotide.
[0253] Guide RNAs can be provided in any form. For example, the gRNA can be provided in the form of RNA, either as two molecules (separate crRNA and tracrRNA) or as one molecule (sgRNA), and optionally in the form of a complex with a Cas protein. The gRNA can also be provided in the form of DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA andAttorney Docket No. 057766 / 616958 tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as one DNA molecule or as separate DNA molecules encoding the crRNA and tracrRNA, respectively.
[0254] When a gRNA is provided in the form of DNA, the gRNA can be transiently, conditionally, or constitutively expressed in the cell. DNAs encoding gRNAs can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell. Alternatively, DNAs encoding gRNAs can be operably linked to a promoter in an expression construct. For example, the DNA encoding the gRNA can be in a vector comprising a heterologous nucleic acid, such as a nucleic acid encoding a Cas protein. Alternatively, it can be in a vector or a plasmid that is separate from the vector comprising the nucleic acid encoding the Cas protein. Promoters that can be used in such expression constructs include promoters active, for example, in one or more of a eukaryotic cell, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a pluripotent cell, an embryonic stem (ES) cell, an adult stem cell, a developmentally restricted progenitor cell, an induced pluripotent stem (iPS) cell, or a one-cell stage embryo. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include an RNA polymerase III promoter, such as a human U6 promoter, a rat U6 polymerase III promoter, or a mouse U6 polymerase III promoter.
[0255] Alternatively, gRNAs can be prepared by various other methods. For example, gRNAs can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, e.g., WO 2014 / 089290 and WO 2014 / 065596, each of which is herein incorporated by reference in its entirety for all purposes). Guide RNAs can also be a synthetically produced molecule prepared by chemical synthesis. For example, a guide RNA can be chemically synthesized to include 2’-O-methyl analogs and 3’ phosphorothioate internucleotide linkages at the first three 5’ and 3’ terminal RNA residues.
[0256] Guide RNAs (or nucleic acids encoding guide RNAs) can be in compositions comprising one or more guide RNAs (e.g., 1, 2, 3, 4, or more guide RNAs) and a carrier increasing the stability of the guide RNA (e.g., prolonging the period under given conditions of storage (e.g., -20°C, 4°C, or ambient temperature) for which degradation products remain below a threshold, such below 0.5% by weight of the starting nucleic acid or protein; or increasing the stability in vivo). Non-limiting examples of such carriers include poly(lactic acid) (PLA)Attorney Docket No. 057766 / 616958 microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid cochleates, and lipid microtubules. Such compositions can further comprise a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein.
[0257] As one example, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of the sequence set forth in any one of SEQ ID NOS: 62-125. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the DNA-targeting segment set forth in any one of SEQ ID NOS: 62-125. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 90% or at least 95% identical to the DNA-targeting segment set forth in any one of SEQ ID NOS: 62-125. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence set forth in any one of SEQ ID NOS: 62-125.
[0258] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of the sequence set forth in any one of SEQ ID NOS: 68, 100, 62, 94, 65, 97, 73, and 105. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the DNA-targeting segment set forth in any one of SEQ ID NOS: 68, 100, 62, 94, 65, 97, 73, and 105. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 90% or at least 95% identical to the DNA-targeting segment set forth in any one of SEQ ID NOS: 68, 100, 62, 94, 65, 97, 73, and 105. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence set forth in any one of SEQ ID NOS: 68, 100, 62, 94, 65, 97, 73, and 105.
[0259] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of the sequence set forth in SEQ ID NO: 68 or 100. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the DNA-targeting segment set forth in SEQ ID NO: 68 or 100.Attorney Docket No. 057766 / 616958 Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 90% or at least 95% identical to the DNA- targeting segment set forth in SEQ ID NO: 68 or 100. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence set forth in SEQ ID NO: 68 or 100.
[0260] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of the sequence set forth in SEQ ID NO: 62 or 94. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the DNA-targeting segment set forth in SEQ ID NO: 62 or 94. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 90% or at least 95% identical to the DNA- targeting segment set forth in SEQ ID NO: 62 or 94. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence set forth in SEQ ID NO: 62 or 94.
[0261] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of the sequence set forth in SEQ ID NO: 65 or 97. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the DNA-targeting segment set forth in SEQ ID NO: 65 or 97. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 90% or at least 95% identical to the DNA- targeting segment set forth in SEQ ID NO: 65 or 97. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence set forth in SEQ ID NO: 65 or 97.
[0262] As another example, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of the sequence set forth in SEQ ID NO: 73 or 105. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consistAttorney Docket No. 057766 / 616958 essentially of, or consist of a sequence that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the DNA-targeting segment set forth in SEQ ID NO: 73 or 105. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that is at least 90% or at least 95% identical to the DNA- targeting segment set forth in SEQ ID NO: 73 or 105. Alternatively, a guide RNA targeting intron 1 of a human ALB gene can comprise, consist essentially of, or consist of a sequence that differs by no more than 3, no more than 2, or no more than 1 nucleotide from the sequence set forth in SEQ ID NO: 73 or 105. (4) Guide RNA Target Sequences
[0263] Target DNAs for guide RNAs include nucleic acid sequences present in a DNA to which a DNA-targeting segment of a gRNA will bind, provided sufficient conditions for binding exist. Suitable DNA / RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA / RNA binding conditions (e.g., conditions in a cell-free system) are known in the art (see, e.g., Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), herein incorporated by reference in its entirety for all purposes). The strand of the target DNA that is complementary to and hybridizes with the gRNA can be called the “complementary strand,” and the strand of the target DNA that is complementary to the “complementary strand” (and is therefore not complementary to the Cas protein or gRNA) can be called “noncomplementary strand” or “template strand.”
[0264] The target DNA includes both the sequence on the complementary strand to which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). The term “guide RNA target sequence” as used herein refers specifically to the sequence on the non-complementary strand corresponding to (i.e., the reverse complement of) the sequence to which the guide RNA hybridizes on the complementary strand. That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to the PAM (e.g., upstream or 5’ of the PAM in the case of Cas9). A guide RNA target sequence is equivalent to the DNA-targeting segment of a guide RNA, but with thymines instead of uracils. As one example, a guide RNA target sequence for an SpCas9 enzyme can refer to the sequence upstream of the 5’-NGG-3’ PAM on the non-complementary strand. A guide RNA is designed to have complementarity toAttorney Docket No. 057766 / 616958 the complementary strand of a target DNA, where hybridization between the DNA-targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. If a guide RNA is referred to herein as targeting a guide RNA target sequence, what is meant is that the guide RNA hybridizes to the complementary strand sequence of the target DNA that is the reverse complement of the guide RNA target sequence on the non-complementary strand.
[0265] A target DNA or guide RNA target sequence can comprise any polynucleotide, and can be located, for example, in the nucleus or cytoplasm of a cell or within an organelle of a cell, such as a mitochondrion or chloroplast. A target DNA or guide RNA target sequence can be any nucleic acid sequence endogenous or exogenous to a cell. The guide RNA target sequence can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can include both.
[0266] Site-specific binding and cleavage of a target DNA by a Cas protein can occur at locations determined by both (i) base-pairing complementarity between the guide RNA and the complementary strand of the target DNA and (ii) a short motif, called the protospacer adjacent motif (PAM), in the non-complementary strand of the target DNA. The PAM can flank the guide RNA target sequence. Optionally, the guide RNA target sequence can be flanked on the 3’ end by the PAM (e.g., for Cas9). Alternatively, the guide RNA target sequence can be flanked on the 5’ end by the PAM (e.g., for Cpf1). For example, the cleavage site of Cas proteins can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5’-N1GG-3’, where N1 is any DNA nucleotide, and where the PAM is immediately 3’ of the guide RNA target sequence on the non- complementary strand of the target DNA. As such, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complement) would be 5’-CCN2-3’, where N2 is any DNA nucleotide and is immediately 5’ of the sequence to which the DNA-targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1and N2can be complementary and the N1- N2base pair can be any base pair (e.g., N1=C and N2=G; N1=G and N2=C; N1=A and N2=T; or N1=T, and N2=A). In the case of Cas9 from S.Attorney Docket No. 057766 / 616958 aureus, the PAM can be NNGRRT or NNGRR, where N can A, G, C, or T, and R can be G or A. In the case of Cas9 from C. jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (e.g., for FnCpf1), the PAM sequence can be upstream of the 5’ end and have the sequence 5’-TTN-3’. In the case of DpbCasX, the PAM can have the sequence 5’-TTCN-3’. In the case of CasΦ, the PAM can have the sequence 5’-TBN-3’, wherein B is G, T, or C.
[0267] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding an NGG motif recognized by an SpCas9 protein. For example, two examples of guide RNA target sequences plus PAMs are GN19NGG (SEQ ID NO: 5) or N20NGG (SEQ ID NO: 6). See, e.g., WO 2014 / 165825, herein incorporated by reference in its entirety for all purposes. The guanine at the 5’ end can facilitate transcription by RNA polymerase in cells. Other examples of guide RNA target sequences plus PAMs can include two guanine nucleotides at the 5’ end (e.g., GGN20NGG; SEQ ID NO: 7) to facilitate efficient transcription by T7 polymerase in vitro. See, e.g., WO 2014 / 065596, herein incorporated by reference in its entirety for all purposes. Other guide RNA target sequences plus PAMs can have between 4-22 nucleotides in length of SEQ ID NOS: 5-7, including the 5’ G or GG and the 3’ GG or NGG. Yet other guide RNA target sequences plus PAMs can have between 14 and 20 nucleotides in length of SEQ ID NOS: 5-7.
[0268] Formation of a CRISPR complex hybridized to a target DNA can result in cleavage of one or both strands of the target DNA within or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the reverse complement on the complementary strand to which the guide RNA hybridizes). For example, the cleavage site can be within the guide RNA target sequence (e.g., at a defined location relative to the PAM sequence). The “cleavage site” includes the position of a target DNA at which a Cas protein produces a single-strand break or a double-strand break. The cleavage site can be on only one strand (e.g., when a nickase is used) or on both strands of a double-stranded DNA. Cleavage sites can be at the same position on both strands (producing blunt ends; e.g., Cas9)) or can be at different sites on each strand (producing staggered ends (i.e., overhangs); e.g., Cpf1). Staggered ends can be produced, for example, by using two Cas proteins, each of which produces a single-strand break at a different cleavage site on a different strand, thereby producing a double-strand break. For example, a first nickase can create a single-Attorney Docket No. 057766 / 616958 strand break on the first strand of double-stranded DNA (dsDNA), and a second nickase can create a single-strand break on the second strand of dsDNA such that overhanging sequences are created. In some cases, the guide RNA target sequence or cleavage site of the nickase on the first strand is separated from the guide RNA target sequence or cleavage site of the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.
[0269] The guide RNA target sequence can also be selected to minimize off-target modification or avoid off-target effects (e.g., by avoiding two or fewer mismatches to off-target genomic sequences).
[0270] As one example, a guide RNA targeting intron 1 of a human ALB gene can target the guide RNA target sequence set forth in any one of SEQ ID NOS: 126-157. As another example, a guide RNA targeting intron 1 of a human ALB gene can target at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the guide RNA target sequence set forth in any one of SEQ ID NOS: 126-157.
[0271] As another example, a guide RNA targeting intron 1 of a human ALB gene can target the guide RNA target sequence set forth in any one of SEQ ID NOS: 132, 126, 129, and 137. As another example, a guide RNA targeting intron 1 of a human ALB gene can target at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the guide RNA target sequence set forth in any one of SEQ ID NOS: 132, 126, 129, and 137.
[0272] As another example, a guide RNA targeting intron 1 of a human ALB gene can target the guide RNA target sequence set forth in SEQ ID NO: 132. As another example, a guide RNA targeting intron 1 of a human ALB gene can target at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 132.
[0273] As another example, a guide RNA targeting intron 1 of a human ALB gene can target the guide RNA target sequence set forth in SEQ ID NO: 126. As another example, a guide RNA targeting intron 1 of a human ALB gene can target at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 126.
[0274] As another example, a guide RNA targeting intron 1 of a human ALB gene can target the guide RNA target sequence set forth in SEQ ID NO: 129. As another example, a guide RNA targeting intron 1 of a human ALB gene can target at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 129.Attorney Docket No. 057766 / 616958
[0275] As another example, a guide RNA targeting intron 1 of a human ALB gene can target the guide RNA target sequence set forth in SEQ ID NO: 137. As another example, a guide RNA targeting intron 1 of a human ALB gene can target at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 137.
[0276] Table 6. Human ALB Intron 1 Guide RNA Target Sequences. Guide RNA Target Sequence SEQ ID NO: GAGCAACCTCACTCTTGTCT 126 ATGCATTTGTTTCAAAATAT 127
[0277] Table 7. Mouse Alb Intron 1 Guide RNA Target Sequences. Guide RNA Target Sequence SEQ ID NO: CACTCTTGTCTGTGGAAACA 165(5) Lipid Nanoparticles Comprising Nuclease Agents
[0278] Lipid nanoparticles comprising the nuclease agents (e.g., CRISPR / Cas systems) are also provided. The lipid nanoparticles can alternatively or additionally comprise a nucleic acidAttorney Docket No. 057766 / 616958 construct encoding a polypeptide of interest as disclosed herein. For example, the lipid nanoparticles can comprise a nuclease agent (e.g., CRISPR / Cas system), can comprise a nucleic acid construct encoding a polypeptide of interest, or can comprise both a nuclease agent (e.g., a CRISPR / Cas system) and a nucleic acid construct encoding a polypeptide of interest. Regarding CRISPR / Cas systems, the lipid nanoparticles can comprise the Cas protein in any form (e.g., protein, DNA, or mRNA) and / or can comprise the guide RNA(s) in any form (e.g., DNA or RNA). In one example, the lipid nanoparticles comprise the Cas protein in the form of mRNA (e.g., a modified RNA as described herein) and the guide RNA(s) in the form of RNA (e.g., a modified guide RNA as disclosed herein). As another example, the lipid nanoparticles can comprise the Cas protein in the form of protein and the guide RNA(s) in the form of RNA). In a specific example, the guide RNA and the Cas protein are each introduced in the form of RNA via LNP-mediated delivery in the same LNP. As discussed in more detail elsewhere herein, one or more of the RNAs can be modified. For example, guide RNAs can be modified to comprise one or more stabilizing end modifications at the 5’ end and / or the 3’ end. Such modifications can include, for example, one or more phosphorothioate linkages at the 5’ end and / or the 3’ end and / or one or more 2’-O-methyl modifications at the 5’ end and / or the 3’ end. As another example, Cas mRNA modifications can include substitution with pseudouridine (e.g., fully substituted with pseudouridine), 5’ caps, and polyadenylation. As another example, Cas mRNA modifications can include substitution with N1-methyl-pseudouridine (e.g., fully substituted with N1-methyl-pseudouridine), 5’ caps, and polyadenylation. Other modifications are also contemplated as disclosed elsewhere herein. Delivery through such methods can result in transient Cas expression and / or transient presence of the guide RNA, and the biodegradable lipids improve clearance, improve tolerability, and decrease immunogenicity. Lipid formulations can protect biological molecules from degradation while improving their cellular uptake. Lipid nanoparticles are particles comprising a plurality of lipid molecules physically associated with each other by intermolecular forces. These include microspheres (including unilamellar and multilamellar vesicles, e.g., liposomes), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations which contain cationic lipids are useful for delivering polyanions such as nucleic acids. Other lipids that can be included are neutral lipids (i.e., uncharged or zwitterionic lipids), anionic lipids, helper lipids that enhance transfection, andAttorney Docket No. 057766 / 616958 stealth lipids that increase the length of time for which nanoparticles can exist in vivo. Examples of suitable cationic lipids, neutral lipids, anionic lipids, helper lipids, and stealth lipids can be found in WO 2016 / 010840 A1 and WO 2017 / 173054 A1, each of which is herein incorporated by reference in its entirety for all purposes. An exemplary lipid nanoparticle can comprise a cationic lipid and one or more other components. In one example, the other component can comprise a helper lipid such as cholesterol. In another example, the other components can comprise a helper lipid such as cholesterol and a neutral lipid such as distearoylphosphatidylcholine or 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In another example, the other components can comprise a helper lipid such as cholesterol, an optional neutral lipid such as DSPC, and a stealth lipid such as S010, S024, S027, S031, or S033.
[0279] The LNP may contain one or more or all of the following: (i) a lipid for encapsulation and for endosomal escape; (ii) a neutral lipid for stabilization; (iii) a helper lipid for stabilization; and (iv) a stealth lipid. See, e.g., Finn et al. (2018) Cell Rep. 22(9):2227-2235 and WO 2017 / 173054 A1, each of which is herein incorporated by reference in its entirety for all purposes. In certain LNPs, the cargo can include a guide RNA or a nucleic acid encoding a guide RNA. In certain LNPs, the cargo can include an mRNA encoding a Cas nuclease, such as Cas9, and a guide RNA or a nucleic acid encoding a guide RNA. In certain LNPs, the cargo can include a nucleic acid construct encoding a polypeptide of interest as described elsewhere herein. In certain LNPs, the cargo can include an mRNA encoding a Cas nuclease, such as Cas9, a guide RNA or a nucleic acid encoding a guide RNA, and a nucleic acid construct encoding a polypeptide of interest. In some LNPs, the lipid component comprises an amine lipid such as a biodegradable, ionizable lipid. In some instances, the lipid component comprises biodegradable, ionizable lipid, cholesterol, DSPC, and PEG-DMG. For example, Cas9 mRNA and gRNA can be delivered to cells and animals utilizing lipid formulations comprising ionizable lipid ((9Z,12Z)- 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadeca-9,12-dienoate), cholesterol, DSPC, and PEG2k-DMG.
[0280] In some examples, the LNPs comprise cationic lipids. In some examples, the LNPs comprise (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4-Attorney Docket No. 057766 / 616958 bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate) or another ionizable lipid. See, e.g., WO 2019 / 067992, WO 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086, each of which is herein incorporated by reference in its entirety for all purposes. In some examples, the LNPs comprise molar ratios of a cationic lipid amine to RNA phosphate (N:P) of about 4.5, about 5.0, about 5.5, about 6.0, or about 6.5. In some examples, the terms cationic and ionizable in the context of LNP lipids are interchangeable (e.g., wherein ionizable lipids are cationic depending on the pH).
[0281] The lipid for encapsulation and endosomal escape can be a cationic lipid. The lipid can also be a biodegradable lipid, such as a biodegradable ionizable lipid. One example of a suitable lipid is Lipid A or LP01, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate. See, e.g., Finn et al. (2018) Cell Rep. 22(9):2227-2235 and WO 2017 / 173054 A1, each of which is herein incorporated by reference in its entirety for all purposes. Another example of a suitable lipid is Lipid B, which is ((5-((dimethylamino)methyl)- 1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate), also called ((5- ((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate). Another example of a suitable lipid is Lipid C, which is 2-((4-(((3- (dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,3-diyl(9Z,9'Z,12Z,12'Z)- bis(octadeca-9,12-dienoate). Another example of a suitable lipid is Lipid D, which is 3-(((3- (dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octylundecanoate. Other suitable lipids include heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (also known as [(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl] 4-(dimethylamino)butanoate or Dlin-MC3-DMA (MC3))).
[0282] Some such lipids suitable for use in the LNPs described herein are biodegradable in vivo.
[0283] Such lipids may be ionizable depending upon the pH of the medium they are in. For example, in a slightly acidic medium, the lipids may be protonated and thus bear a positive charge. Conversely, in a slightly basic medium, such as, for example, blood where pH is approximately 7.35, the lipids may not be protonated and thus bear no charge. In some embodiments, the lipids may be protonated at a pH of at least about 9, 9.5, or 10. The ability ofAttorney Docket No. 057766 / 616958 such a lipid to bear a charge is related to its intrinsic pKa. For example, the lipid may, independently, have a pKa in the range of from about 5.8 to about 6.2.
[0284] Neutral lipids function to stabilize and improve processing of the LNPs. Examples of suitable neutral lipids include a variety of neutral, uncharged or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include, but are not limited to, 5- heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine or 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), phosphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-diarachidonoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoyl phosphatidylcholine (MPPC), 1-palmitoyl-2-myristoyl phosphatidylcholine (PMPC), 1-palmitoyl-2-stearoyl phosphatidylcholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl- 2-palmitoyl phosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoyl phosphatidylcholine (POPC), lysophosphatidyl choline, dioleoyl phosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine distearoylphosphatidylethanolamine (DSPE), dimyristoyl phosphatidylethanolamine (DMPE), dipalmitoyl phosphatidylethanolamine (DPPE), palmitoyloleoyl phosphatidylethanolamine (POPE), lysophosphatidylethanolamine, 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), and combinations thereof. For example, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoyl phosphatidyl ethanolamine (DMPE).
[0285] Helper lipids include lipids that enhance transfection. The mechanism by which the helper lipid enhances transfection can include enhancing particle stability. In certain cases, the helper lipid can enhance membrane fusogenicity. Helper lipids include steroids, sterols, and alkyl resorcinols. Examples of suitable helper lipids suitable include cholesterol, 5- heptadecylresorcinol, and cholesterol hemisuccinate. In one example, the helper lipid may be cholesterol or cholesterol hemisuccinate.
[0286] Stealth lipids include lipids that alter the length of time the nanoparticles can exist in vivo. Stealth lipids may assist in the formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipids may modulate pharmacokinetic propertiesAttorney Docket No. 057766 / 616958 of the LNP. Suitable stealth lipids include lipids having a hydrophilic head group linked to a lipid moiety.
[0287] The hydrophilic head group of a stealth lipid can comprise, for example, a polymer moiety selected from polymers based on PEG (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N- vinylpyrrolidone), polyaminoacids, and poly N-(2-hydroxypropyl)methacrylamide. The term PEG means any polyethylene glycol or other polyalkylene ether polymer. In certain LNP formulations, the PEG, is a PEG-2K, also termed PEG 2000, which has an average molecular weight of about 2,000 daltons. See, e.g., WO 2017 / 173054 A1, herein incorporated by reference in its entirety for all purposes.
[0288] The lipid moiety of the stealth lipid may be derived, for example, from diacylglycerol or diacylglycamide, including those comprising a dialkylglycerol or dialkylglycamide group having alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, wherein the chain may comprise one or more functional groups such as, for example, an amide or ester. The dialkylglycerol or dialkylglycamide group can further comprise one or more substituted alkyl groups.
[0289] As one example, the stealth lipid may be selected from PEG-dilauroylglycerol, PEG- dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG- DSPE), PEG-dilaurylglycamide, PEG- dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG- cholesterol (l-[8'-(Cholest-5-en-3[beta]-oxy)carboxamido-3',6'- dioxaoctanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4- ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol)ether), 1,2-dimyristoyl-sn- glycero- 3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k- DMPE),or 1,2- dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol-2000 (PEG2k-DMG), 1,2- distearoyl- sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE), 1,2-distearoyl-sn-glycerol, methoxypoly ethylene glycol (PEG2k-DSG), poly(ethylene glycol)- 2000-dimethacrylate (PEG2k-DMA), and 1,2- distearyloxypropyl-3-amine-N- [methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one particular example, the stealth lipid may be PEG2k-DMG.
[0290] In some embodiments, the PEG lipid includes a glycerol group. In some embodiments, the PEG lipid includes a dimyristoylglycerol (DMG) group. In some embodiments, the PEG lipid comprises PEG2k. In some embodiments, the PEG lipid is a PEG-Attorney Docket No. 057766 / 616958 DMG. In some embodiments, the PEG lipid is a PEG2k-DMG. In some embodiments, the PEG lipid is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000. In some embodiments, the PEG2k-DMG is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000.
[0291] The LNPs can comprise different respective molar ratios of the component lipids in the formulation. The mol-% of the CCD lipid may be, for example, from about 30 mol-% to about 60 mol-%. The mol-% of the helper lipid may be, for example, from about 30 mol-% to about 60 mol-%. The mol-% of the neutral lipid may be, for example, from about 1 mol-% to about 20 mol-%. The mol-% of the stealth lipid may be, for example, from about 1 mol-% to about 10 mol-%
[0292] The LNPs can have different ratios between the positively charged amine groups of the biodegradable lipid (N) and the negatively charged phosphate groups (P) of the nucleic acid to be encapsulated. This may be mathematically represented by the equation N / P. For example, the N / P ratio may be from about 0.5 to about 100. The N / P ratio can also be from about 4 to about 6.
[0293] In some LNPs, the cargo can comprise Cas mRNA (e.g., Cas9 mRNA) and gRNA. The Cas mRNA and gRNAs can be in different ratios. For example, the LNP formulation can include a ratio of Cas mRNA to gRNA nucleic acid ranging from about 25:1 to about 1:25. Alternatively, the LNP formulation can include a ratio of Cas mRNA to gRNA nucleic acid of from about 2:1 to about 1:2. In specific examples, the ratio of Cas mRNA to gRNA can be about 2:1.
[0294] In some LNPs, the cargo can comprise a nucleic acid construct encoding a polypeptide of interest and gRNA. The nucleic acid construct encoding a polypeptide of interest and gRNAs can be in different ratios. For example, the LNP formulation can include a ratio of nucleic acid construct to gRNA nucleic acid ranging from about 25:1 to about 1:25.
[0295] A specific example of a suitable LNP has a nitrogen-to-phosphate (N / P) ratio of about 4.5 and contains biodegradable cationic lipid, cholesterol, DSPC, and PEG2k-DMG in an about 45:44:9:2 molar ratio (about 45:about 44:about 9:about 2). The biodegradable cationic lipid can be (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate. See, e.g., Finn et al. (2018) Cell Rep. 22(9):2227-2235, hereinAttorney Docket No. 057766 / 616958 incorporated by reference in its entirety for all purposes. The Cas9 mRNA can be in an about 1:1 (about 1:about 1) ratio by weight to the guide RNA. Another specific example of a suitable LNP contains Dlin-MC3-DMA (MC3), cholesterol, DSPC, and PEG-DMG in an about 50:38.5:10:1.5 molar ratio (about 50:about 38.5:about 10:about 1.5). The Cas9 mRNA can be in an about 1:2 ratio (about 1:about 2)by weight to the guide RNA. The Cas9 mRNA can be in an about 1:1 ratio (about 1:about 1) by weight to the guide RNA. The Cas9 mRNA can be in an about 2:1 ratio (about 2:about 1) by weight to the guide RNA.
[0296] Another specific example of a suitable LNP has a nitrogen-to-phosphate (N / P) ratio of about 6 and contains biodegradable cationic lipid, cholesterol, DSPC, and PEG2k-DMG in an about 50:38:9:3 molar ratio (about 50:about 38:about 9:about 3). The biodegradable cationic lipid can be Lipid A ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3- (diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also called 3-((4,4- bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadeca-9,12-dienoate). The Cas9 mRNA can be in an...
Claims
Attorney Docket No. 057766 / 616958 We claim:
1. A composition comprising a nucleic acid construct comprising a coding sequence for a polypeptide of interest, wherein the nucleic acid construct comprises a polyadenylation signal downstream of the coding sequence for the polypeptide of interest, and wherein the polyadenylation signal comprises a simian virus 40 (SV40) polyadenylation signal.
2. The composition of claim 1, wherein the SV40 polyadenylation signal is a unidirectional SV40 late polyadenylation signal.
3. The composition of claim 1, wherein each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal.
4. The composition of any one of claims 1-3, wherein the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
180.
5. The composition of any one of claims 1-4, wherein the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO:
180.
6. The composition of any one of claims 1-5, wherein the polyadenylation signal comprises a combination of the simian virus 40 (SV40) polyadenylation signal and a second polyadenylation signal.
7. The composition of any one of claims 1-6, wherein the polyadenylation signal comprises a combination of the simian virus 40 (SV40) polyadenylation signal and a bovine growth hormone (BGH) polyadenylation signal.
8. The composition of claim 7, wherein the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
179.
9. The composition of claim 7 or 8, wherein the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179.Attorney Docket No. 057766 / 616958 10. The composition of any one of claims 7-9, wherein the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179, and wherein the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO:
180.
11. The composition of any one of claims 7-10, wherein the combination of the BGH polyadenylation signal and the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
194.
12. The composition of any one of claims 7-11, wherein the combination of the BGH polyadenylation signal in tandem with the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO:
194.
13. The composition of any one of claims 1-12, wherein the coding sequence for the polypeptide of interest is modified to remove one or more cryptic splice sites.
14. The composition of any one of claims 1-13, wherein the nucleic acid construct comprises a splice acceptor upstream of the coding sequence for the polypeptide of interest.
15. The composition of any one of claims 1-14, wherein the nucleic acid construct does not comprise a homology arm.
16. The composition of any one of claims 1-15, wherein the nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest.
17. The composition of any one of claims 1-16, wherein the nucleic acid construct comprises from 5’ to 3’: a splice acceptor, the coding sequence for the polypeptide of interest, and the polyadenylation signal, wherein the nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest, and wherein the nucleic acid construct does not comprise a homology arm.Attorney Docket No. 057766 / 616958 18. The composition of any one of claims 1-17, wherein the nucleic acid construct comprises from 5’ to 3’: a splice acceptor, the coding sequence for the polypeptide of interest, and the polyadenylation signal, wherein the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179, and wherein the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180, or wherein the combination of the BGH polyadenylation signal and the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 194, wherein the nucleic acid construct does not comprise a promoter that drives the expression of the polypeptide of interest, and wherein the nucleic acid construct does not comprise a homology arm.
19. The composition of any one of claims 1-18, wherein the polypeptide of interest comprises a therapeutic polypeptide.
20. The composition of any one of claims 1-19, wherein the polypeptide of interest is a secreted polypeptide.
21. The composition of any one of claims 1-20, wherein the polypeptide of interest is a multidomain therapeutic protein comprising a delivery domain and an enzyme domain.
22. The composition of claim 21, wherein the delivery domain is a TfR- binding delivery domain.
23. The composition of claim 21, wherein the delivery domain is a CD63- binding delivery domain.
24. The composition of any one of claims 1-19, wherein the polypeptide of interest is an intracellular polypeptide.
25. The composition of any one of claims 1-24, wherein the nucleic acid construct is in a nucleic acid vector or a lipid nanoparticle.
26. The composition of claim 25, wherein the nucleic acid construct is in the nucleic acid vector, optionally wherein the nucleic acid vector is a viral vector.Attorney Docket No. 057766 / 616958 27. The composition of claim 25 or 26, wherein the nucleic acid vector is an adeno-associated viral (AAV) vector, optionally wherein the nucleic acid construct is flanked by inverted terminal repeats (ITRs) on each end, optionally wherein the ITR on at least one end comprises, consists essentially of, or consists of SEQ ID NO: 160, and optionally wherein the ITR on each end comprises, consists essentially of, or consists of SEQ ID NO:
160.
28. The composition of claim 27, wherein the AAV vector is a single-stranded AAV (ssAAV) vector.
29. The composition of claim 27 or 28, wherein the AAV vector is a recombinant AAV8 (rAAV8) vector, optionally wherein the AAV vector is a single-stranded rAAV8 vector.
30. The composition of any one of claims 1-29 in combination with a nuclease agent that targets a nuclease target site in a target genomic locus.
31. The composition of claim 30, wherein the target genomic locus is an albumin gene, optionally wherein the albumin gene is a human albumin gene.
32. The composition of claim 31, wherein the nuclease target site is in intron 1 of the albumin gene.
33. The composition of any one of claims 30-32, wherein the nuclease agent comprises: (a) a zinc finger nuclease (ZFN); (b) a transcription activator-like effector nuclease (TALEN); or (c) (i) a Cas protein or a nucleic acid encoding the Cas protein; and (ii) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.Attorney Docket No. 057766 / 616958 34. The composition of any one of claims 30-32, wherein the nuclease agent comprises: (a) a Cas protein or a nucleic acid encoding the Cas protein; and (b) a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence, and wherein the guide RNA binds to the Cas protein and targets the Cas protein to the guide RNA target sequence.
35. The composition of claim 34, wherein the guide RNA target sequence is in intron 1 of an albumin gene.
36. The composition of claim 34 or 35, wherein the Cas protein or the nucleic acid encoding the Cas protein and the guide RNA or the one or more DNAs encoding the guide RNA are associated with a lipid nanoparticle.
37. A cell comprising the composition of any one of claims 1-36.
38. The cell of claim 37, wherein the nucleic acid construct or the coding sequence for the polypeptide of interest is integrated into a target genomic locus, and wherein the polypeptide of interest is expressed from the target genomic locus, or wherein the nucleic acid construct or the coding sequence for the polypeptide of interest is integrated into intron 1 of an endogenous albumin locus, and wherein the polypeptide of interest is expressed from the endogenous albumin locus.
39. The cell of claim 38, wherein the percentage of unintended transcripts from the target genomic locus containing comprising the integrated nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.
40. The cell of claim any one of claims 37-39, wherein the cell is a liver cell or a hepatocyte.
41. The cell of any one of claims 37-40, wherein the cell is a human cell.Attorney Docket No. 057766 / 616958 42. A method of inserting a nucleic acid encoding a polypeptide of interest into a target genomic locus in a cell or a population of cells, comprising administering to the cell or the population of cells the composition of any one of claims 30-36, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, and the nucleic acid construct or the nucleic acid encoding the polypeptide of interest is inserted into the target genomic locus.
43. The method of claim 42, wherein the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or nucleic acid encoding the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.
44. A method of expressing a polypeptide of interest from a target genomic locus in a cell or a population of cells, comprising administering to the cell or the population of cells the composition of any one of claims 30-36, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, the nucleic acid construct or the coding sequence for the polypeptide of interest is inserted into the target genomic locus to create a modified target genomic locus, and the polypeptide of interest is expressed from the modified target genomic locus.
45. The method of claim 44, wherein the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.
46. The method of any one of claims 42-45, wherein the cell is a liver cell or a hepatocyte or the population of cells is a population of liver cells or hepatocytes.
47. The method of any one of claims 42-46, wherein the cell is a human cell or the population of cells is a population of human cells.Attorney Docket No. 057766 / 616958 48. The method of any one of claims 42-47, wherein the cell is in vitro or ex vivo or the population of cells is in vitro or ex vivo.
49. The method of any one of claims 42-47, wherein the cell is in vivo in a subject or the population of cells is in vivo in a subject.
50. A method of inserting a nucleic acid encoding a polypeptide of interest into a target genomic locus in a cell in a subject, comprising administering to the subject the composition of any one of claims 30-36, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, and the nucleic acid construct or the nucleic acid encoding the polypeptide of interest is inserted into the target genomic locus.
51. The method of claim 50, wherein the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.
52. A method of expressing a polypeptide of interest from a target genomic locus in a cell in a subject, comprising administering to the subject the composition of any one of claims 30-36, wherein the nuclease agent cleaves the nuclease target site in the target genomic locus, the nucleic acid construct or the coding sequence for the polypeptide of interest is inserted into the target genomic locus to create a modified target genomic locus, and the polypeptide of interest is expressed from the modified target genomic locus.
53. The method of claim 52, wherein the percentage of unintended transcripts from the target genomic locus containing comprising the inserted nucleic acid construct or coding sequence for the polypeptide of interest is less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1%.Attorney Docket No. 057766 / 616958 54. The method of any one of claims 50-53, wherein the cell is a liver cell or a hepatocyte.
55. The method of any one of claims 50-54, wherein the cell is a human cell.
56. The method of any one of claims 42-55, wherein the nucleic acid construct is administered simultaneously with the nuclease agent or the one or more nucleic acids encoding the nuclease agent.
57. The method of any one of claims 42-55, wherein the nucleic acid construct is not administered simultaneously with the nuclease agent or the one or more nucleic acids encoding the nuclease agent.
58. The method of claim 57, wherein the nucleic acid construct is administered prior to the nuclease agent or the one or more nucleic acids encoding the nuclease agent.
59. The method of claim 57, wherein the nucleic acid construct is administered after the nuclease agent or the one or more nucleic acids encoding the nuclease agent.
60. A nucleic acid comprising a simian virus 40 (SV40) polyadenylation signal, wherein the SV40 polyadenylation signal is a unidirectional SV40 late polyadenylation signal.
61. The nucleic acid of claim 60, wherein each instance of the sequence AATAAA in the reverse strand is mutated in the unidirectional SV40 late polyadenylation signal.
62. The nucleic acid of claim 60 or 61, wherein the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
180.
63. The nucleic acid of any one of claims 60-62, wherein the SV40 polyadenylation signal comprises the sequence set forth in SEQ ID NO: 180.Attorney Docket No. 057766 / 616958 64. The nucleic acid of any one of claims 60-63, wherein the nucleic acid comprises a combination of the unidirectional SV40 late polyadenylation signal in tandem with a second polyadenylation signal, optionally wherein the second polyadenylation signal is upstream of the unidirectional SV40 late polyadenylation signal.
65. The nucleic acid of any one of claims 60-64, wherein the nucleic acid comprises a combination of the unidirectional SV40 late polyadenylation signal in tandem with a bovine growth hormone (BGH) polyadenylation signal, optionally wherein the BGH polyadenylation signal is upstream of the unidirectional SV40 late polyadenylation signal.
66. The nucleic acid of claim 65, wherein the BGH polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
179.
67. The nucleic acid of claim 65 or 66, wherein the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO:
179.
68. The nucleic acid of any one of claims 65-67, wherein the BGH polyadenylation signal comprises the sequence set forth in SEQ ID NO: 179, and wherein the unidirectional SV40 late polyadenylation signal comprises the sequence set forth in SEQ ID NO:
180.
69. The nucleic acid of any one of claims 65-68, wherein the combination of the BGH polyadenylation signal in tandem with the SV40 polyadenylation signal is at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO:
194.
70. The nucleic acid of any one of claims 65-69, wherein the combination of the BGH polyadenylation signal in tandem with the unidirectional SV40 late polyadenylation signal comprises the sequence set forth in SEQ ID NO: 194.