Targeting tlr3 for treatment of hematopoietic stem cell proliferation-associated diseases or disorders
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- CHILDRENS MEDICAL CENT CORP
- Filing Date
- 2024-08-01
- Publication Date
- 2026-06-10
Smart Images

Figure US2024040542_06022025_PF_FP_ABST
Abstract
Description
Attorney Docket No: 701039-000129WOPT TARGETING TLR3 FOR TREATMENT OF HEMATOPOIETIC STEM CELL PROLIFERATION-ASSOCIATED DISEASES OR DISORDERS CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No.63 / 530,358 filed August 2, 2023, the contents of which are incorporated herein by reference in their entirety. GOVERNMENT SUPPORT
[0002] This invention was made with government support under Grant Numbers 5T32HL007574-41 and 5T32HL007574-40, awarded by the National Institutes of Health. The Government has certain rights in the invention. SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on July 31, 2024, is named 701039-000129WOPT_SL.xml and is 62,124 bytes in size. TECHNICAL FIELD
[0004] The technology described herein relates to targeting toll-like receptor 3 (TLR3) for treatment of hematopoietic stem cell proliferation-associated diseases or disorders. BACKGROUND
[0005] Development, tissue integrity, and defense against immunogenic challenges necessitates the effective removal of damaged and impaired cells. Innate immune cells such as macrophages and neutrophils orchestrate the removal or phagocytosis of these dying cells by discriminating between molecules expressed on their surface. Therefore, the phagocytic process needs to be carefully regulated to avoid the unwarranted elimination of healthy cells. Surface molecules, such as complement opsonins, exposed phosphatidylserine (PS), Calreticulin (Calr) and annexin I serve as signals to initiate the phagocytosis (“eat-me” signal) . These surface molecules are not present at high levels on the surface of living healthy cells, except during specific physiological events. On the other hand, surface molecules such as B2m serve as “don’t eat-me” signals to prevent the unwarranted clearance of healthy cells that concurrently present “eat-me” molecules on their surfaces. Hematopoietic stem cells that originate during embryonic development sustain lifelong tissue homeostasis, and phagocytosis by macrophages plays a pivotal role in ensuring the quality of newly formed hematopoietic stem and progenitor cells (HSPCs) within the embryonic niche; see e.g., 1 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Arandjelovic et al. Nat. Immunol.16, 907–917 (2015); Kelley et al. EMBO Rep.22, e52564 (2021); Arosa et al. Journal of Biological 274(24):16917-22 (1999); Bertrand et al. Nature 464, 108–111 (2010); Wattrus et al. Science 377, 1413–1419 (2022); the contents of each of which are incorporated herein by reference in their entireties.
[0006] Hematopoietic stem and progenitor cells (HSPCs) present surface Calreticulin (Calr) as an “eat-me” signal that induces macrophage interaction. During their interaction, a macrophage can completely engulf a HSPC (“dooming”) or sample a small portion of the HSPC cellular material without killing it (“grooming”). While HSPCs dooming eliminates a selected stem cell clone, the HSPCs grooming regulates HSPCs’ proliferation by activating Il-1b-dependent signaling. Grooming- and-dooming is an important quality control step that removes stressed HSPCs during development. Despite the importance of these processes, the mechanism by which macrophages distinguish which HSPCs to doom and which HSPCs to groom remains elusive. There is great need for compositions and methods to regulate the dooming and grooming of HSPCs by macrophages. SUMMARY
[0007] The technology described herein is directed to compositions and methods for treating a disease or disorder associated with hematopoietic stem and progenitor cell (HSPC) proliferation, including using a Toll-like receptor 3 (TLR3) inhibitor.
[0008] Accordingly, in one aspect, described herein is a method of treating a disease or disorder associated with hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof an effective amount of a Toll- like receptor 3 (TLR3) inhibitor.
[0009] In some embodiments of any of the aspects, the TLR3 inhibitor is selected from the group consisting of: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII).
[0010] In some embodiments of any of the aspects, the TLR3 inhibitor is CUCPT4a.
[0011] In some embodiments of any of the aspects, the disease or disorder associated with increased HSPC proliferation is selected from the group consisting of: clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, and a leukemia.
[0012] In some embodiments of any of the aspects, the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL). 2 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0013] In some embodiments of any of the aspects, the TLR3 inhibitor decreases or inhibits TLR3 interaction with double-stranded RNA (dsRNA).
[0014] In some embodiments of any of the aspects, the TLR3 inhibitor decreases or inhibits TLR3-induced Interferon regulatory factor 3 (Irf3) cellular signalling in hematopoietic stem cells (HSPCs).
[0015] In some embodiments of any of the aspects, the decreased or inhibited TLR3-induced cellular signalling decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs.
[0016] In some embodiments of any of the aspects, the decreased or inhibited B2M expression increases macrophage phagocytosis of the HSPCs.
[0017] In some embodiments of any of the aspects, the increased macrophage phagocytosis of the HSPCs decreases the HSPCs proliferating.
[0018] In some embodiments of any of the aspects, the TLR3 inhibitor decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs.
[0019] In some embodiments of any of the aspects, the TLR3 inhibitor increases macrophage phagocytosis of the HSPCs.
[0020] In some embodiments of any of the aspects, the TLR3 inhibitor decreases the HSPCs proliferating.
[0021] In one aspect, described herein is a method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
[0022] In some embodiments of any of the aspects, the TLR3 inhibitor is selected from the group consisting of: CUCPT4a, Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII).
[0023] In some embodiments of any of the aspects, the TLR3 inhibitor is CUCPT4a.
[0024] In some embodiments of any of the aspects, the disease or disorder associated with increased HSPC proliferation is selected from the group consisting of: clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, and a leukemia.
[0025] In some embodiments of any of the aspects, the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL). 3 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0026] In one aspect, described herein is a method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof an effective amount of CUCPT4a.
[0027] In some embodiments of any of the aspects, the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL).
[0028] In one aspect, described herein is a method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
[0029] In one aspect, described herein is a method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
[0030] In one aspect, described herein is a method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
[0031] In one aspect, described herein is a method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
[0032] In one aspect, described herein is a method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: (a) a means of inhibiting Toll-like receptor 3 (TLR3); and (b) a means for diluting or stabilizing the means of inhibiting TLR3.
[0033] In one aspect, described herein is a method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: (a) a means of inhibiting Toll-like receptor 3 (TLR3); and (b) a means for diluting or stabilizing the means of inhibiting TLR3.
[0034] In one aspect, described herein is a method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell 4 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: (a) a means of inhibiting Toll-like receptor 3 (TLR3); and (b) a means for diluting or stabilizing the means of inhibiting TLR3.
[0035] A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation.
[0036] In one aspect, described herein is a method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia.
[0037] In one aspect, described herein is a method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs). BRIEF DESCRIPTION OF THE DRAWINGS
[0038] Fig.1A-1F. Chemical screen identified ROSdependentand ROSIndependentsurface Calr- inducers. (Fig.1A) Representative imaging from 3 independent experiments showing that ROS+Runx1+ cells were preferentially doomed by the macrophages. Green staining: Mpeg; Red staining: Runx1; white: CELLROX probe. (Fig.1B) Reactive oxygen species (ROS) levels in embryonic HSPCs marked by surface Calreticulin (Calr). Data were analyzed by Pearson correlation. MFI, median fluorescence intensity. A.U., arbitrary unit. Data points represent a pool of 100-3003 days post fertilization (dpf) embryos. (Fig.1C) Surface Calr levels on HSPCs following ROS inhibition with diphenylene (DPI) or VAS2870 (Nox inhibitor). Data were analyzed by Kruskall- Wallis test followed by Dunn’s; *P <0.05. DMSO, dimethyl sulfoxide. Data points represent a pool of 100-3003 dpf embryos. Data are means ± SEM. (Fig.1A-1C) were performed in a pool of 100-300 zebrafish embryos in 2 independent experiments. (Fig.1D) A schematic overview of the chemical screen. Two approaches were employed to ensure that the system specifically recorded the surface Calreticulin values: 1) HEK293 cells were transfected with the SPLIT-TURBO ID where the C- Terminus was design to carry Cdh2, a membrane protein, while the N-terminus was carrying Calr, and 2) Anti-Calr was conjugated with a A647 using the ZENON technology. Next, the cells were plated in 384-well plates and treated with a panel of 1200-bioactive small molecules in 3 different concentrations (5uM, 2.5uM, and 0.625 uM). The cells were also labeled with a ubiquitous ROS probe (CELLROX) and DAPI for nuclear staining. After 24 hrs the ZEISS CELL DISCOVERER 7 (CR7) microscope was used to read the plates. Data were analyzed using the CELLPROFILER and R- Sight HTS software. SD, Split-turbo ID. ab, Calreticulin antibody. DMSO, dimethyl sulfoxide. (Fig. 5 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 1E) Numbers and overlap in compounds that induced surface Calreticulin in HEK293 for both systems. Each compound was tested in replicates and 2-4 random fields of view were chosen for acquisition. The same well was used for the SPLIT-Turbo, Ab-Calr and CELLROX acquisition. The indicated subset was then further analyzed (see e.g., Fig.1F). (Fig.1F) First panel: Number of compounds that increased surface Calreticulin in vitro and in vivo (zebrafish embryos). Second panel: Live image microscopy was used to determine the Interaction fraction between macrophage-HSPCs using mpeg-GFP;runx1-mCherry embryos that label macrophage and HSPCs, respectively. Highlighted in dark gray are the ROSindepedentand light gray represent ROSdependentcompounds. Data are means ± SEM. Calr, surface Calreticulin. ROS, Reactive oxygen species. The zebrafish live imaging experiments performed to determine the macrophage-HSPCs interaction were conducted as two independent experiments and a minimum of 5 embryos were imaged.
[0039] Fig.2A-2G. Tlr3 is required for HSPC grooming. (Fig.2A) Stack Plot showing the macrophage interaction behavior in the presence of the Calr-inducers. rGrooming behavior is shown in the black bar, while dooming behavior as the medium gray bar. The imaging was conducted using 3 dpf zebrafish embryos. The exact sample size is indicated in the figure, n=6-16 from 2 independent experiments. Data were analyzed by Wilcoxon matched-pairs signed rank test. *P=0.0156, **P=0.002, ***P=0.001. (Fig.2B) A scheme overview of the GECKO 2.0 CRISPR / Cas9 knockout screen. (Fig.2C) sgRNAs significantly enriched (P<0.05) were identified using the MAGECK software and plotted as cumulative stack based on their Z-Score. The arrows indicate examples of significant enriched sgRNAs and their Z-Score depicted inside the brackets. The screen was conducted using K562 cells. The screen was performed in 3 independent experiments. (Fig.2D) Knock-down of Tlr3 (Tlr3 MO) or iTlr3 treatment reduced the fraction of HSPCs that are groomed and increased the fraction of HSPCs that are doomed in 3 dpf zebrafish embryos. The macrophage behavior percentage outcome was calculated by counting the total number of interacting macrophages and dividing by the total number of dooming or grooming events. Data points represent an image embryo, SD MO n=9, TL3 MO n= 11, DMSO n=4 and iTLR3 n=5. Experiments were performed in 2 independent experiments. Two-way ANOVA followed by Sidak’s multiple comparison. **P=0.0027; ***P=0.00005. (Fig.2E) Representative imaging showing the experimental design of the parabiosis experiment. (Fig.2F) Both macrophages showed higher interaction rates with the HSPCs. *P=0.04, **P=0.0015. Data were analyzed using a two-way ANOVA test. The macrophage- HSPCs interaction percentage was calculated by counting the total number of HSPCs (runx1+ cells) and dividing by the total number HSPCs interacting with a macrophage. (Fig.2G) Bar-plot showing the macrophage behavior outcome fraction. The macrophage behavior percentage outcome was calculated by counting the total number of interacting macrophages and dividing by the total number of dooming or grooming events. *P= 0.01, **P=0.0057. Data were analyzed using an unpaired 6 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Student t-test. (Fig.2F-2G). Data points represent an image embryo, n= 10 from 3 independent experiments.
[0040] Fig.3A-3N. B2m acts as a “don’t eat-me" molecule and prevails unwarranted HSPCs dooming. (Fig.3A) b2m knock-out stable mutants (B2m KO) showed significant reduction in B2M levels. Data were analyzed by unpaired Mann Whitney test. *P=0.028. Data points representing a pool of 100 embryos. (Fig.3B) Bar-plot showing the interaction percentage. b2m KO embryos showed significant lower macrophage-HSPCs interaction with a (Fig.3C-3D) dooming dominance. Data were analyzed by unpaired Mann-Whitney. *P=0.012, **P=0.0021, ****P<0.0001. Data points represent an image embryo. Wildtype n=12 and B2m KO n=14. This data represents 3 independent experiments. The macrophage-HSPCs interaction percentage was calculated by counting the total number of HSPCs (runx1+ cells) and dividing by the total number HSPCs interacting with a macrophage. (Fig.3E) Representative imaging showing the increased dooming behavior observed in the B2m homozygous mutant. n=4 from 2 independent experiments (Fig.3F) Bar-plot showing the interaction rates in wildtype and B2m KO zebrafish embryos, n=4. Data points depict the field of view. (Fig.3G) The macrophage behavior percentage outcome was calculated by counting the total number of interacting macrophages and dividing by the total number of dooming or grooming events. While in the wildtype background, DL-PPMP promotes grooming, in the B2m KO background, it promotes dooming. (Fig.3H) A scheme overview of the murine HSPCs (LSK+) and macrophage co- culture. Left lower panel is a representative imaging showing the sorted murine HSPC-MHC-I+(Green staining) being groomed by a macrophage (magenta staining), while on the right lower panel is a murine HSPC-MHC-I- being doomed by a macrophage. (Fig.3I) MHC-I+HSPCs showed higher grooming rates compared to MHC-I- cells. Data were analyzed using non parametric one-way ANOVA followed by Kruskall Wallis. *P=0.03. Data are means ± SEM. The macrophage behavior percentage outcome was calculated by counting the total number of interacting macrophages and dividing by the total number of dooming or grooming events. (Fig.3J) A schematic overview of the Zebrabow-M system: Animals with 15 to 20 insertions of a multicolor fluorescent cassette were crossed to the draculin:CreERT2 line to permit clonal labeling of lateral plate mesoderm lineages. By treating with 4-hydroxytamoxifen (4-OHT) at 24 hours post fertilization (hpf) just after HSC specification, individual stem cell lineages express specific fluorescent hues that can be quantified in the adult marrow. Families of Zebrabow-M;draculin:CreERT2 animals injected with b2m morpholino with or without clodronate liposomes exhibit (Fig.3K) reduced numbers of HSC clones. (Fig.3L- 3M) Clonal dominance in the adult marrow. Clodronate liposome was injected at 48 hpf. Data points represent an adult kidney marrow. Control n= 22, b2m sgRNA n=21 and clodronate n=3. Experiments were conducted at least 2 times. (Fig.3A, 3B, 3C, 3D, 3F, 3G, 3I, 3K, 3L, 3M) Data are means ± SEM. Experiments were conducted in vivo using zebrafish as a model. (Fig.3N) A schematic overview of the clonal diversity in regards to the “don’t eat-me” signal. 7 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0041] Fig.4A-4Q. Repetitive elements as Erv elicit a virus-like response in HSPCs promoting B2m expression. (Fig.4A) Flow cytometry shows that ~ 20% of runx1+23mCherry+ HSPCs expressed isg15 (gating strategy is shown in Fig.8A). Data points represent a pool of ~200 embryos acquired in 3 independent experiments. Data are means ± SEM. Statistical analysis performed by Mann-Whitney test. P = 0.003. (Fig.4B) Positive correlation between B2m and Isg15 levels. Data were analyzed by Pearson correlation. Data points represent a pool of ~200 embryos acquired in 3 independent experiments. (Fig.4C) Left panel is a representative image of a Isg15+-HSPC interaction. HSPCs, red staining; macrophages, blue staining; isg15, green staining. Right panel: HSPCs-Isg15+ cells showed lower dooming ratios. (Fig.4D) Sorted isg15+HSPCs showed higher b2m and RE expression. Data points represent a pool of ~200 embryos. Experiments were performed 2 times. Y-axis depicts the relative gene expression. (Fig.4E) Uniform manifold and projection (UMAP) of sorted runx1+23-mcherry HSPCs in standard morpholino (dark gray, Control sdM) and irf8 depleted embryos (light gray, irf8 sdKD) (for original data, see e.g., Wattrus et al. Science 377, 1413–1419 (2022)). (Fig.4F) Cluster 2 (C2), enriched for control HSPCs, showed higher expression of RE.808 cells were analyzed for this analysis. (Fig.4G) Treating 2 dpf embryos with CM272 (5 uM) led to higher number of isg15+HSPCs in the 3dpf CHT. Data was quantified by live cell imaging. Data were analyzed by Mann-Whitney test. *P=0.02. Data points represent an embryo. Experiments were performed 2 times. (Fig.4H) EdU staining of runx1+23:mCherry embryos treated with CM272 identified a significant increase in proliferating HSPCs at 3dpf. Data were analyzed by Student’s t-test. Data normality was enquired by the Shapiro-Wilk test. **P=0.0061. Data are means ± SEM. Control n= 5 and CM272 n=7. (Fig.4I) CM272 treated embryos showed lower dooming ratios. Data points represent an embryo. Percentage was calculated by quantification of Edu+ Runx1+ cells divided by the total number of runx1+ cells. The plot depicted 2 independent experiments. Control n=6 and CM272 n=10. (Fig.4J) Gini coefficient in control (DMSO), CM272 and CM272 b2m knockdown zebrafish. Data were analyzed by Kruskall-Wallis test followed by Dunn’s multiple comparison test. **P=0.0043. Data points represent an adult fish. DMSO n=6, CM272 n=5 and b2m sgRNA n=5. The plot depicts 2 independent experiments. (Fig.4K) b2m-TWISTR Zebrabow- M;draculin:CreERT2 treated CM272 exhibited reduced numbers of HSC clones in the adult marrow. Data were analyzed by Kruskall-Wallis test followed by Dunn’s multiple comparison test. *P=0.023. Data points represent an adult fish. DMSO n=6, CM272 n=5 and b2m sgRNA n=5. The plot depicts 2 independent experiments. (Fig.4L) ISG15 expression positively correlates to the transposable elements (TE) expression in human HSCs. Single cell RNA-seq datasets of human bone marrow CD34+ stem and progenitors (for original data, see e.g., Nam et al. Nature 571, 355–360 (2019)), n = 4 samples) were aligned to a TE reference using CELLRANGER v3.2. TE expression was normalized by total RNA counts. Pearson correlation was performed between TE expression and ISG15 gene expression of individual HSCs, represented in each datapoint. (Fig.4M) Human bone marrow HSCs 8 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT from the same dataset as in (Fig.4L) were grouped based on their ISG15 expression, where in the upper quartile was considered the threshold for high and the lower quartile as low. Normalized expression of B2M is shown for individual cells. ISG15 high cells showed higher B2M expression. Only cells with at least one transcript of ISG15 were included in the analysis. High, n = 203 cells , low n = 608 cells, from n = 4 samples; P = 0.02 using a linear mixed model, with sample as a random effects variable. Box plot represents the median, bottom and top quartiles, whiskers correspond to 1.5 × the interquartile range. (Fig.4N) Human Erv overexpression upregulated the B2M levels on human CD34+ cells. Data are means ± SEM. Data points depict a CD34 donor. The data collected from 2 independent experiments. (Fig.4O) EdU staining of MFG+ mice treated with DL-PPMP identified an increase in proliferating HSPCs 24 hrs after the treatment. Percentage was determined by the total number of living cells. Data points depict a mouse. (Fig.4P) DL-PPMP treatment stimulates B2M expression in murine HSPCs. Flow cytometry was performed using the cells from Tibia / Femur (see e.g., gating in Fig.8Q). Data were analyzed by Student’s t-test. *P=0.02. Data are means ± SEM. n mice = 3 per condition. (Fig.4Q) A schematic overview of the proposed molecular pathway resulting in higher surface B2m.
[0042] Fig.5A-5N. Identification of surface Calreticulin inducers. (Fig.5A) Embryonic HSPCs marked by surface Calreticulin (Calr) exhibited higher levels of ROS. Data were analyzed by. MFI, median fluorescence intensity. A.U., arbitrary unit. unpaired Mann-Whitney; ****P<0.0001. (Fig.5B) Representative image of the SPLIT-Turbo ID construct showing the CDH2-CALR (upper left panel, membrane construct) and the Expresses split-TurboID C-terminal fragment targeted to endoplasmic reticulum membrane and N-terminal CALR (lower left panel, ER construct from Deghou et al. (Bioinformatics 32, 2869–2871 (2016))) localization in HEK293 cells. Red staining: Actin, green staining: Streptavidin, and blue staining: DAPI, nuclear staining. StA: Streptavidin. Right panel: Membrane construct positively correlated with the actin signal, while the ER did not. Data were analyzed by unpaired Student’s t-test. **P=0.0018. (Fig.5C) Positive correlation between the CDH2-CALR SPLIT-Turbo ID and immunolabeled Calreticulin. Data were analyzed using the Coloc2 Plugin software in FIJIJ. (Fig.5D) Calr-inducers promoted the Calr expression in vivo (zebrafish embryos). (Fig.5E) Cumulative interaction fraction observed in ROSdependentand ROSindependentcompounds. Data were analyzed using one-way ANOVA. P<0.0001. (Fig.5F) Calr- inducers did not promote apoptosis (in zebrafish embryos), except for the ROSdependentβ-Lapachone. (Fig.5G) calr3b crispant showed lower calr3b expression. (Fig.5H) Macrophage-HSPC interaction induced by the chemicals depends on calr3b. Legend in gray highlights the ROSindependentcompounds. (Fig.5I) Surface CALR on human CD34+ cells upon ROSdependentcompounds treatment with DPI (Lighter right bar in each group) or without DPI (darker left bar in each group), an antioxidant. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison. *P=0.05. Data are means ± SEM. (Fig.5J) JC-1 staining after treatment with ROSdependentcompounds showed impaired 9 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT mitochondrial membrane potential. (Fig.5K) Representative images of human CD34 cells treated with the dooming compounds revealed impaired mitochondrial membrane potential and morphology. (Fig.5L) Quantification of (Fig.5K). (Fig.5M) Representative image showing the accumulation of mitochondrial ROS. (Fig.5N) Quantification of mt-ROS upon macrophage depletion (irf8 - / -) and calr3a knockout in 3 dpf zebrafish embryos. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison. ****P<0.0001. Data are means ± SEM.
[0043] Fig.6A-6K. CRISPR / Cas9 knock out screen identified TLR3 as a surface CALR mediator in the “don’t eat-me” context. (Fig.6A) EdU staining of runx1+23:mCherry embryos treated with either ROSindependentor ROSdependentCalr-inducers identifies a significant increase in proliferation HSPCs at 3 dpf in the ROSindependentgroup. Dark gray bars depict the ROSindependentand medium gray bars represent the ROSdependentand iTLR3. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison. **P=0.0093, ***P<0.0001. (Fig.6B) Live-cell imaging of the macrophage, Raw274 cell line, showing the macrophage phagocytosis capacity against zymosan. The gradient depicts the intracellular zymosan intensity. (Fig.6C) RAW-274 image tracking after ROSindependenttreatment confirmed the normal macrophage function. (Fig.6D) Cumulative plot showing the Z-Score of the enriched sgRNA in the absence of stimulation. (Fig.6E) Up-set Venn diagram showing the number of significant (P<0.05) sgRNA hits. (Fig.6F) Pathway enrichment analysis for sgRNAs significantly enriched in each group. (Fig.6G) CRISPR / Cas-9 knockout of DDX3X, XPB1 and TLR3 confirmed the targets identified in the screen. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison. *P=0.04 (DDX3X), *P=0.03 (XPB1), **P=0.0021. Screen and validation were performed in K652 cells. (Fig.6H) Morpholino TLR3- depleted embryos showed fewer surface Calreticulin HSPCs. Data were analyzed by unpaired Mann Whitney test. *P=0.03. (Fig.6I) 2 dpf embryos were treated with the TLR3 inhibitor (CUCPT4a, iTLR3) showed fewer surface Calreticulin HSPCs. Data were analyzed by unpaired Student’s t-test. **P=0.0034. Shapiro-Wilk test was used in (Fig.6J) and (Fig.6K) to analyze the data normality. (Fig.6J) Representative image of the live cell imaging of murine LSK+ (stained green) co-cultured with autologous murine bone marrow derived macrophage (BMDM; stained red). (Fig.6K) Pretreating HSPCs (LSK+) cells with Poly I:C promoted grooming behavior. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison. **P=0.0013. LPS: Lipopolysaccharides (TLR4 agonist). “+” indicates treatment. Data are means ± SEM.
[0044] Fig.7A-7Q. B2m regulates HSC clonality via the dsRNA-Tlr3, Irf3 network. (Fig. 7A) Representative immunofluorescence image of B2M (orange stained) from DMSO or DL-PPMP treated K562 cells. (Fig.7B) FACS analysis identified a significant decrease in HSPC (runx1+23:mCherry) in TLR3 morpholino depleted embryos. Data were analyzed by Mann Whitney test. **P=0.0017. (Fig.7C-7D) ROSindependentcompounds promoted the surface B2M expression, whereas ROSdependentand iTLR3 failed to do the same. (Fig.7E) ROSindependentfacilitated the dooming 10 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT behavior upon b2m knock down. Data were quantified having the total number of interactions as the denominator. (Fig.7F) B2m levels by FACS of wildtype and B2m stable knockout zebrafish line (b2m KO). (Fig.7G) b2m KO cells from 3 dpf zebrafish embryos showed lower surface Calreticulin. (Fig.7H) FACS analysis showed that b2m KO had fewer HSPCs (runx1+ cells). (Fig.7I) FACS quantification of the kidney marrow cells in wildtype (medium gray) and b2m KO (dark gray) from 4 months old zebrafish. (Fig.7J) TWISTR-b2m zebrafish show fewer lymphoid clones. Data were analyzed by Mann-Whitney test. *P=0.03 (Fig.7K) Ternary diagram and cluster clone size percentage from TWISTR-control and TWISTR-b2m adult zebrafish (first panel). CRISPRVar analysis identified that the dominant clones were composed by wildtype cells that resisted the macrophage dooming, while non-dominant clones harbored b2m CRISPR-editing (second panel). (Fig.7L) 3D Zbow analysis. (Fig.7M) Number of clones found by zbow analysis. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison test. *P=0.03. (Fig.7N) Cluster size percentage measured by the zbow analysis. Data were analyzed by Kruskal-Wallis test followed by Dunn’s multiple comparison test.****P<0.0001. (Fig.7O) CRISPRVar analysis identified that the dominant clones were composed by wildtype cells that resisted the macrophage dooming, while non-dominant clones harbored irf3 CRISPR-editing. (Fig.7P) Number of clones found by zbow analysis after treating 2 dpf embryos with iTLR3. Data were analyzed by Mann- Whitney test. **P=0.0012. (Fig.7Q) Cluster size percentage measured by the zbow analysis after treating 2 dpf embryos with iTLR3. Data were analyzed by Mann-Whitney test. **P=0.003. Data are means ± SEM.
[0045] Fig.8A-8R. Endogenous retrovirus is the TLR3 ligand that regulates B2m expression. (Fig.8A) Representative imaging showing the isg15 levels in runx1+ cells in zebrafish embryos. (Fig.8B) FACS analysis shows that embryos treated with Poly I:C have higher frequency of isg15+ HSPCs. Data were analyzed by unpaired Student t test. *P=0.03. (Fig.8C) Ctlr MO enriched clusters are marked by cdk1. The spectral scale reports z-score. For original dataset, see e.g., Wattrus et al. Science 377, 1413–1419 (2022), where runx1+were sorted into 384 plates followed by SORT- seq library preparation. (Fig.8D) Flow cytometry showed equal cytosolic content of dsRNA (J2 antibody) in wildtype and macrophage-depleted embryos. (Fig.8E) Significantly upregulated TE in runx1+ treated with DL-PPMP. (Fig.8F) Flow cytometry shows LTR5+ HSPCs had higher B2m levels. Data were analyzed by unpaired Student t test. ***P=0.0007. (Fig.8G) RT-qPCR for b2m, repetitive elements, isg15, mxa and mxb in CM2723 dpf zebrafish embryos. Expression was normalized to Rpbl3. (Fig.8H) Flow cytometry showed increased isg15+ HSPCs after CM272 treated 3 dpf zebrafish embryos. (Fig.8I) Flow cytometry showed that CM272 treatment led to higher isg15+HSPCs, (Fig.8J) B2m+HSPCs and (Fig.8K) surface Calr. (Fig.8L) Fraction of HSPCs that divided after interacting with a macrophage. Showing that embryos overexpressing Ltr4 under the runx1+23 enhancer have increased division ratio compared to GFP overexpressing embryos under the 11 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT runx1+23 enhancer. Data were analyzed by Kruskall-Wallis test followed by Dunn’s; P***<0.001. Infusion technology was used to clone the Ltr4. OE: Overexpression. (Fig.8M) Flow cytometry shows that endogenous retrovirus does not influence the ROS levels. (Fig.8N) Representative histogram showing B2M levels in GFP and Erv overexpressing human CD34+ cells. (Fig.8O) Human CD34+ cells treated with CM272 or Poly I:C led to higher B2M levels, which was abrogated in the presence of a TLR3 / dsRNA inhibitor. (Fig.8P) Fold change of other “don’t eat-me” molecules presented upon DL-PPMP treatment. (Fig.8Q) Representative gating strategy for the levels of B2m and Edu in LT-HSC (Mds1+ cells). (Fig.8R) Mpx+ (neutrophils) quantification upon Poly I:C treatment. Data were analyzed by unpaired Student t test. *P=0.05. Data are means ± SEM.
[0046] Fig.9A-9B. Malignant HSPCs from AML patients showed higher B2m and TE expression. (Fig.9A) scRNAseq quantification of B2m expression in HSC / Progenitor cells from normal versus malignant characterization. Each scatter plot represents a patient. For original dataset, see e.g., Kim et al. Blood 128, 204–216 (2016) . Data were analyzed by unpaired Student t test. (Fig. 9B) Pie-chart showing the significant upregulated TE found in AML-Blast cells compared to healthy HSCs. For original dataset, see e.g., Garrido et al. Immunogenetics 70, 647–659 (2018). DETAILED DESCRIPTION
[0047] Embodiments of the technology described herein are directed to compositions and methods for treating a disease or disorder associated with hematopoietic stem and progenitor cell (HSPC) proliferation, including using a Toll-like receptor 3 (TLR3) inhibitor. Live imaging and in vivo cellular barcoding techniques demonstrated that the balance between “eat-me” and “don’t eat- me” signals is provided by reactive oxygen species (ROS) and toll-like receptor 3 (Tlr3) activation, respectively. These signals determine the number of long-lived HSC clones that contribute to the adult blood system through macrophage-mediated quality assurance mechanisms. Treatment Methods
[0048] In multiple aspects, described herein are methods of treating a disease or disorder associated with hematopoietic stem and progenitor cell (HSPC) proliferation. In one aspect, the method comprises administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
[0049] In multiple aspects, described herein are methods of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia. In one aspect, described herein is a method of treating clonal hematopoiesis, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. In one aspect, described herein is a method of treating myelodysplastic syndrome (MDS), the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. In one aspect, described herein is a method of treating myeloma, the method comprising administering to a subject 12 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. In one aspect, described herein is a method of treating a leukemia, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
[0050] In one aspect, described herein is a method of treating clonal hematopoiesis, the method comprising administering to a subject in need thereof an effective amount of CUCPT4a. In one aspect, described herein is a method of treating myelodysplastic syndrome (MDS), the method comprising administering to a subject in need thereof an effective amount of CUCPT4a. In one aspect, described herein is a method of treating myeloma, the method comprising administering to a subject in need thereof an effective amount of CUCPT4a. In one aspect, described herein is a method of treating a leukemia, the method comprising administering to a subject in need thereof an effective amount of CUCPT4a.
[0051] In multiple aspects, described herein are methods of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), including on the cell surface of hematopoietic stem and progenitor cell (HSPCs). In one aspect, described herein is a method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs) by at least 10%, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
[0052] In one aspect of any of the embodiments, described herein is a method of treating a disease or disorder associated with increased HSPC proliferation. In some embodiments of any of the aspects, the result of treatment of such disease or disorder is providing or accomplished by administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
[0053] In one aspect, described herein is a method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
[0054] In one aspect, described herein is a method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
[0055] In one aspect, described herein is a method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3). 13 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0056] In one aspect, described herein is a method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a means of inhibiting Toll-like receptor 3 (TLR3); and a means for diluting or stabilizing the means of inhibiting TLR3.
[0057] In one aspect, described herein is a method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a means of inhibiting Toll-like receptor 3 (TLR3); and a means for diluting or stabilizing the means of inhibiting TLR3.
[0058] In one aspect, described herein is a method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a means of inhibiting Toll-like receptor 3 (TLR3); and a means for diluting or stabilizing the means of inhibiting TLR3.
[0059] In one aspect, described herein is a method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation.
[0060] In one aspect, described herein is a method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia.
[0061] In one aspect, described herein is a method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs).
[0062] Exemplary means of inhibiting Toll-like receptor 3 (TLR3) are known in the art and include: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), TLR7-IN-1 (Formula VIII), and functional derivatives thereof, and equivalents thereof. Equivalent means of means of inhibiting Toll- like receptor 3 (TLR3) can include, but are not limited to, different formulations of any of the means described herein, different salts of any of the means described herein, pro-drugs of any of the means described herein, bioequivalents of any of the means described herein, and any other ingredient which is interchangeable with any of the means of means of inhibiting Toll-like receptor 3 (TLR3) described herein. 14 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0063] Exemplary means of stabilizing or diluting the means of inhibiting TLR3 are known in the art and include the pharmaceutically acceptable carriers described elsewhere herein, pharmaceutically acceptable diluents described elsewhere herein, and / or pharmaceutically acceptable excipients described elsewhere herein, and equivalents thereof. TLR3 Inhibition
[0064] In multiple aspects, described herein is the use of TLR inhibitors. In some embodiments of any of the aspects, wherein the TLR3 inhibitor or means of inhibiting TLR3 is selected from the group consisting of: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII). In some embodiments of any of the aspects, wherein the TLR3 inhibitor or means of inhibiting TLR3 comprises a TLR3-specific inhibitor, e.g., selected from the group consisting of: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), and a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62). In some embodiments of any of the aspects, wherein the TLR3 inhibitor or means of inhibiting TLR3 comprises a TLR3-specific small molecule inhibitor, e.g., selected from the group consisting of: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, and SMU-CX1 (Formula VI).
[0065] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises CUCPT4a or a functional derivative thereof, which can also be referred to as (R)-2-(3-Chloro-6- fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid, C18H13ClFNO3S (see e.g., Formula I; see e.g., Cheng et al. Chem. Soc.133, 3764–3767 (2011), the contents of which are incorporated herein by reference in their entirety, e.g., compound 4A in Cheng et al.). 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0066] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises T5260630 or a functional derivative thereof (see e.g., Formula II; see e.g., Cheng et al. Chem. Soc. 133, 3764–3767 (2011)).Formula II: T5260630
[0067] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises T5626448 or a functional derivative thereof (see e.g., Formula III; see e.g., Cheng et al. Chem. Soc. 133, 3764–3767 (2011)).Formula III: T5626448
[0068] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a derivative of D-phenylalanine. In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a small molecule inhibitor disclosed in Cheng et al. Chem. Soc.133, 3764–3767 (2011), for example a small molecule indicated in Formula IV or Formula V or a functional derivative thereof. In Formula IV or Formula V, the “*” asterisks indicates that the small molecule can be the (R)-enantiomer or the (S)-enantiomer. In Formula IV or Formula V, R1, R2, R3, R4, R5, and / or R6include but are not limited to: a fluoro (F) group, a chloro (Cl) group, a hydroxy (OH) 16 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT group, a hydrogen (H) group, a methyl (Me, CH3) group, a trifluoromethyl (CF3), or methoxy (MeO, OCH3)
[0069] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a small molecule of Formula IV, non-limiting examples of which include: (R)-2-(benzo[b]thiophene-2- carboxamido)-3-phenylpropanoic acid (1a); (S)-2-(benzo[b]thiophene-2-carboxamido)-3- phenylpropanoic acid (1b); (R)-2-(3-chloro-6-methylbenzo[b]thiophene-2-carboxamido)-3- phenylpropanoic acid (2a); (S)-2-(3-chloro-6-methylbenzo[b]thiophene-2-carboxamido)-3- phenylpropanoic acid (2b); (R)-2-(3,6-dichlorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (3a); (S)-2-(3,6-dichlorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (3b); (R)-2- (3-chloro-6-fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (4a); (S)-2-(3-chloro-6- fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (4b); (R)-2-(3-chloro-6- (trifluoromethyl)benzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (5a); (S)-2-(3-chloro-6- (trifluoromethyl)benzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (5b); (R)-2-(3-chloro-6- methoxybenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (6a); (S)-2-(3-chloro-6- methoxybenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (6b); (R)-2-(3-chloro-6- fluorobenzo[b]thiophene-2-carboxamido)-3-(4-hydroxyphenyl)propanoic acid (7a); (S)-2-(3-chloro-6- 17 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT fluorobenzo[b]thiophene-2-carboxamido)-3-(4-hydroxyphenyl)propanoic acid (7b); (R)-2-(3-chloro- 5,6-difluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (8a); (S)-2-(3-chloro-5,6- difluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (8b); (R)-2-(benzo[b]thiophene- 2-carboxamido)-3-(4-hydroxyphenyl)propanoic acid (9a); (S)-tert-butyl 2-(benzo[b]thiophene-2- carboxamido)-3-(4-hydroxyphenyl)propanoate (9b); (R)-2-(5-fluorobenzo[b]thiophene-2- carboxamido)-3-phenylpropanoic acid (10a); (R)-2-(5-fluorobenzo[b]thiophene-2-carboxamido)-3- phenylpropanoic acid; (S)-2-(5-fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (10b); (R)-2-(3-chlorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (11a); (S)-2-(3- chlorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (11b); (R)-2-(3-chloro-5- fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (12a); (S)-2-(3-chloro-5- fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (12b); (R)-2-(6- fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (13a); or (S)-2-(6- fluorobenzo[b]thiophene-2-carboxamido)-3-phenylpropanoic acid (13b).
[0070] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a small molecule of Formula V, non-limiting examples of which include: (R)-2-(2- fluorophenylsulfonamido)-3-phenylpropanoic acid (14a); or (S)-2-(2-fluorophenylsulfonamido)-3- phenylpropanoic acid (14b); (R)-2-(3-fluorophenylsulfonamido)-3-phenylpropanoic acid (15a); (S)-2- (3-fluorophenylsulfonamido)-3-phenylpropanoic acid (15b); (R)-2-(4-fluorophenylsulfonamido)-3- phenylpropanoic acid (16a); (S)-2-(4-fluorophenylsulfonamido)-3-phenylpropanoic acid (16b); (R)-2- (2-fluorophenylsulfonamido)-3-(4-hydroxyphenyl)propanoic acid (17a); (S)-2-(2- fluorophenylsulfonamido)-3-(4-hydroxyphenyl)propanoic acid (17b); (R)-2-(3- fluorophenylsulfonamido)-3-(4-hydroxyphenyl)propanoic acid (18a); (S)-2-(3- fluorophenylsulfonamido)-3-(4-hydroxyphenyl)propanoic acid (18b); (R)-2-(4- fluorophenylsulfonamido)-3-(4-hydroxyphenyl)propanoic acid (19a); or (S)-2-(4- fluorophenylsulfonamido)-3-(4-hydroxyphenyl)propanoic acid (19b).
[0071] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a non- specific inhibitor, such as a TLR7-specific inhibitor that inhibits IRF3 signalling and thus inhibits TLR3 in a non-specific manner. Non-limiting examples of such a non-specific TLR3 inhibitor or means of inhibiting TLR3 comprises Enpatoran (Formula VII) or TLR7-IN-1 (Formula VIII).
[0072] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises SMU- CX1 or a functional derivative thereof (see e.g., Formula VI). 18 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0073] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises Enpatoran (M5049), Enpatoran hydrochloride, or a functional derivative thereof (see e.g., Formula VII).
[0074] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises TLR7- IN-1 (compound 16-A) or a functional derivative thereof (see e.g., Formula VIII). 19 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0075] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises an inhibitory nucleic acid. In some embodiments, inhibitors of the expression of the TLR3 gene can comprise an inhibitory nucleic acid. As used herein, “inhibitory nucleic acid” refers to a nucleic acid molecule which can inhibit the expression of a target (e.g., TLR3), e.g., double-stranded RNAs (dsRNAs), inhibitory RNAs (iRNAs), morpholinos, CRISPR, and the like.
[0076] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a TLR3 morpholino. Morpholinos contain DNA bases on a methylene morpholine backbone and are chemically modified to be more stable than RNA. The bases are bound to morpholine rings instead of deoxyribose rings and linked through phosphorodiamidate groups instead of phosphates. This backbone makes morpholinos highly resistant to degradation by nucleases. In some embodiments, the TLR3 morpholino comprises SEQ ID NO: 26 or a nucleic acid (e.g., morpholino backbone) at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to SEQ ID NO: 26 that maintains its function (e.g., TLR3 inhibition).
[0077] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises SEQ ID NO: 26 (e.g., with or without a morpholino backbone) or a nucleic acid (e.g., with or without a morpholino backbone) at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to SEQ ID NO: 26 that maintains its function (e.g., TLR3 inhibition).
[0078] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 comprises a TLR3 CRISPR guide RNA. In some embodiments, the TLR3 CRISPR guide RNA comprises SEQ ID NO: 62 or an RNA equivalent or a nucleic acid at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to SEQ ID NO: 62 that maintains its function (e.g., TLR3 inhibition).
[0079] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 decreases or inhibits TLR3 interaction with double-stranded RNA (dsRNA), e.g., by at least about 10%, at least 20 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more as compared to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0080] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 decreases or inhibits TLR3-induced cellular signalling in hematopoietic stem cells (HSPCs). In some embodiments, the TLR3-induced cellular signalling is Interferon regulatory factor 3 (Irf3) cellular signalling. In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 decreases TLR3- induced cellular signalling (e.g., IRf3 signalling) in hematopoietic stem cells (HSPCs), e.g., by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more as compared to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0081] In some embodiments, the decreased or inhibited TLR3-induced cellular signalling decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs, e.g., by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more as compared to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0082] In some embodiments, the decreased or inhibited B2M expression increases macrophage phagocytosis of the HSPCs, e.g., by at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10%-100%, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0083] In some embodiments, the increased macrophage phagocytosis of the HSPCs decreases the HSPCs proliferating. In some embodiments, the increased macrophage phagocytosis of the HSPCs decreases the HSPCs proliferating, e.g., by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at 21 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT least about 99%, or more as compared to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0084] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs, e.g., by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more as compared to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0085] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 increases macrophage phagocytosis of the HSPCs, e.g., by at least about 10%, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10%-100%, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3.
[0086] In some embodiments, the TLR3 inhibitor or means of inhibiting TLR3 decreases the HSPCs proliferating, e.g., by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more as compared to an HSPC not contacted with the TLR3 inhibitor or means of inhibiting TLR3. Exemplary Diseases and Disorders
[0087] In multiple aspects, described herein are disease or disorder associated with hematopoietic stem and progenitor cells (HSPCs), including their increased proliferation. The term “hematopoietic stem and progenitor cells (HSPCs)” includes subsets of “hematopoietic stem cells (HSCs)” and “hematopoietic progenitor cells (HPCs)”, and thus the terms HSPC, HSC, or HPC can be used interchangeably, depending on the context. The term HSPC refers to a stem cell that has self- renewal capacity and also gives rise to all the blood cell types of the three hematopoietic lineages, erythroid, lymphoid, and myeloid. These hematopoietic cell types include the lymphoid lineages (T- cells, B-cells, NK-cells) and the myeloid lineages, which include dendritic cell lineages, granulocyte– monocyte lineages (e.g., monocytes, macrophages, neutrophils, basophils, eosinophils) and megakaryocyte–erythroid lineages (e.g., erythrocytes, megakaryocytes / platelets). Human HSPCs can express a combination of the following markers: CD34+, CD59+, CD90 / Thy1+, CD38low / -, c- 22 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT kit / CD117- / low, and / or Lin-. Mouse HSPCs are considered CD34low / -, SCA-1+, CD90 / Thy1+ / low, CD38+, c-Kit / CD117+, and Lin-. Detecting the expression of these marker panels allows separation of specific cell populations via techniques like fluorescence-activated cell sorting (FACS). In one embodiment, the term “hematopoietic stem and progenitor cell (HSPC)” or “hematopoietic stem cell (HSC)” refers to a stem cell that has self-renewal capacity and that has the following cell surface markers: CD34+, CD59+, Thy1 / CD90+, CD38lo / -, CD133+, c-Kit / CD117- / lo, and Lin-. In one embodiment, the term “hematopoietic stem and progenitor cell (HSPC)” or “hematopoietic stem cell (HSC)” refers to a stem cell that is at least CD34+. In one embodiment, the term “hematopoietic stem and progenitor cell (HSPC)” or “hematopoietic stem cell (HSC)” refers to a stem cell that has self-renewal capacity and that is at least CD34+and c-kit / CD117lo / -. In one embodiment, the term “hematopoietic stem and progenitor cell (HSPC)” or “hematopoietic stem cell (HSC)” refers to a stem cell that has self-renewal capacity and that is at least CD38low / -, c-kit / CD117- / low.
[0088] Described herein are diseases and disorders associated with increased HSPC proliferation. As used herein, the term “proliferation” refers to increase in the number of cells (e.g., HSPCs) through cell division. In some embodiments, the disease or disorder described herein has HSPC proliferation that is increased by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10%- 100%, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to the level or rate of HSPC proliferation in a healthy subject.
[0089] In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having clonal hematopoiesis (CH), which occurs when a single hematopoietic stem cell lineage contributes disproportionately to the population of mature blood cells. Clonal hematopoiesis can be an aging-related phenomenon. The establishment of a clonal population can occur when an HSPC acquires one or more somatic mutations that give it a competitive advantage in hematopoiesis over the HSPCs without these mutations. For example, clonal hematopoiesis can occur when HSPC clones and their progeny expand in the circulating blood cell population, which can happen after the acquisition of somatic driver mutations, which can cause some blood stem cells to multiply faster than others, forming their own distinct populations or “clones”. If this “rogue” clone acquires more mutations, it can lead to myelodysplasia and eventually to leukemia. Alternatively, clonal hematopoiesis can arise without a driving mutation. The clonal population can vary in size depending on the person, where it can be less than 2% of the blood or, at the other end, can sometimes grow close to 100%.
[0090] Subjects having clonal hematopoiesis can be identified by a physician using current methods of diagnosing clonal hematopoiesis (e.g., a blood test). Clonal hematopoiesis typically does 23 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT not cause noticeable symptoms (beyond the increased numbers and / or percentages of mutated blood cells), but it can increase the likelihood of developing other disorders, such as a blood cancer (e.g., myelodysplasia, leukemia including acute myeloid leukemia) or cardiovascular disease (e.g., heart attacks). Patients with solid tumors or lymphoma and clonal hematopoiesis have been shown to have an inferior outcome. Tests that may aid in a diagnosis of clonal hematopoiesis include, but are not limited to, a blood test (e.g., a complete blood count (CBC); genetic tests of blood cells). A family history of clonal hematopoiesis (e.g., POT1 mutations associated with long telomere length can increase the risk of a familial CH syndrome), or exposure to risk factors for clonal hematopoiesis (e.g., increased age) can also aid in determining if a subject is likely to have clonal hematopoiesis or in making a diagnosis of clonal hematopoiesis.
[0091] The compositions described herein can be administered to a subject having or diagnosed as having clonal hematopoiesis. In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein, e.g., a TLR3 inhibitor or means of inhibiting TLR3 as described herein, to a subject in order to alleviate a symptom of a clonal hematopoiesis. As used herein, "alleviating a symptom of a clonal hematopoiesis" is ameliorating any condition or symptom associated with the clonal hematopoiesis. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique.
[0092] In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having myelodysplastic syndrome (MDS), which is a group of cancers in which immature blood cells in the bone marrow (e.g., HSPCs) do not mature, and as a result, do not develop into healthy blood cells. MDS is thought to arise from mutations in HSPCs. Differentiation of blood precursor cells is impaired in MDS, and a significant increase in levels of apoptotic cell death occurs in bone-marrow cells. Clonal expansion of the abnormal HSPCs results in the production of cells that have lost the ability to differentiate.
[0093] Subjects having MDS can be identified by a physician using current methods of diagnosing MDS. Symptoms and / or complications of MDS which characterize these conditions and aid in diagnosis are well known in the art and include but are not limited to, fatigue, shortness of breath, bleeding disorders, anemia, or frequent infections. Tests that can aid in a diagnosis of MDS include, but are not limited to, CBC, genetic blood tests, bone marrow biopsy examination, and / or cytogenetics or chromosomal studies. A family history of MDS (e.g., GATA2 deficiency and SAMD9 / 9L syndromes), or exposure to risk factors for MDS (e.g., previous chemotherapy or radiation, exposure to certain chemicals such as tobacco smoke, pesticides, and benzene, or exposure to heavy metals such as mercury or lead; increased age; children with Down syndrome) can also aid in determining if a subject is likely to have MDS or in making a diagnosis of MDS. 24 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0094] The compositions described herein can be administered to a subject having or diagnosed as having MDS. In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein, e.g., a TLR3 inhibitor or means of inhibiting TLR3 as described herein, to a subject in order to alleviate a symptom of an MDS. As used herein, "alleviating a symptom of an MDS " is ameliorating any condition or symptom associated with the MDS. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique.
[0095] In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having myeloma, also referred to as Multiple myeloma (MM). Myeloma is a stem cell disease and is a cancer of plasma cells, a type of white blood cell that normally produces antibodies. The abnormal plasma cells produce abnormal antibodies, which can cause kidney problems and overly thick blood. The abnormal plasma cells can also form a mass in the bone marrow or soft tissue. HSPCs, in particular megakaryocyte-erythrocyte progenitors, can be diminished in the bone marrow of Multiple myeloma patients.
[0096] Symptoms and / or complications of myeloma which characterize these conditions and aid in diagnosis are well known in the art and include but are not limited to, bone pain, anemia, renal insufficiency, infections, hypercalcemia, and / or amyloidosis. Tests that can aid in a diagnosis of myeloma include, but are not limited to, blood or urine tests finding abnormal antibody proteins (e.g., using electrophoretic techniques revealing the presence of a monoclonal spike in the results, termed an m-spike), bone marrow biopsy finding cancerous plasma cells, medical imaging finding bone lesions, and / or tests for high blood calcium levels. A family history of myeloma, or exposure to risk factors for myeloma (e.g., obesity, radiation exposure, increased age, exposure to certain chemicals, e.g., aromatic hydrocarbon solvents) can also aid in determining if a subject is likely to have myeloma or in making a diagnosis of myeloma.
[0097] The compositions described herein can be administered to a subject having or diagnosed as having myeloma. In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein, e.g., a TLR3 inhibitor or means of inhibiting TLR3 as described herein, to a subject in order to alleviate a symptom of a myeloma. As used herein, "alleviating a symptom of a myeloma" is ameliorating any condition or symptom associated with the myeloma. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique.
[0098] In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having leukemia. Leukemia is a group of blood cancers that usually begin in the bone marrow and produce high numbers of abnormal blood cells. These blood cells are not fully developed and are called blasts or leukemia cells. Leukemic stem cells (LSCs) are responsible for the initiation and maintenance of leukemia. LSCs share many characteristics with HSCs, including self-renewal, 25 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT quiescence, multipotency, and dependence on signals from the bone marrow microenvironment. However, LSCs can acquire genetic and epigenetic aberrations that reprogram and transform the healthy hematopoietic system. This malignant transformation can block the differentiation of HSCs, causing dysfunctional leukemic progenitors to accumulate in the bone marrow or other hematopoietic organs.
[0099] In some embodiments, the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL). In some embodiments, the leukemia is Acute myeloid leukemia (AML).
[0100] Symptoms and / or complications of leukemia which characterize these conditions and aid in diagnosis are well known in the art and include but are not limited to, bleeding, bruising, bone pain, fatigue, fever, enlarged spleen or liver, and / or an increased risk of infections. Tests that can aid in a diagnosis of leukemia include, but are not limited to, complete blood counts, a bone marrow examination, or a lymph node biopsy. A family history of leukemia, or exposure to risk factors for leukemia (e.g., smoking, ionizing radiation, petrochemicals (such as benzene), prior chemotherapy, or Down syndrome) can also aid in determining if a subject is likely to have leukemia or in making a diagnosis of leukemia.
[0101] The compositions described herein can be administered to a subject having or diagnosed as having leukemia. In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein, e.g., a TLR3 inhibitor or means of inhibiting TLR3 as described herein, to a subject in order to alleviate a symptom of a leukemia. As used herein, "alleviating a symptom of a leukemia " is ameliorating any condition or symptom associated with the leukemia. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique. Pharmaceutical Compositions and Administration
[0102] The TLR3 inhibitor or means of inhibiting TLR3 described herein can be comprised by compositions, such as pharmaceutical compositions, as described further herein. In one aspect described herein is a pharmaceutical composition comprising a TLR3 inhibitor as described herein and a pharmaceutically acceptable carrier. In one aspect described herein is a pharmaceutical composition comprising means of inhibiting TLR3 as described herein and a pharmaceutically acceptable carrier. Formulations 26 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0103] In some embodiments, the technology described herein relates to a pharmaceutical composition comprising a TLR3 inhibitor or means of inhibiting TLR3 as described herein, and optionally a pharmaceutically acceptable carrier. In some embodiments, the active ingredients of the pharmaceutical composition comprise the TLR3 inhibitor or means of inhibiting TLR3 as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist essentially of the TLR3 inhibitor or means of inhibiting TLR3 as described herein. In some embodiments, the active ingredients of the pharmaceutical composition consist of the TLR3 inhibitor or means of inhibiting TLR3 as described herein.
[0104] Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and / or dispersion media. The use of such carriers and diluents is well known in the art. Such pharmaceutically acceptable carriers can serve as the means of stabilizing or diluting the means of inhibiting TLR3. Some non-limiting examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids; (23) serum component, such as serum albumin, HDL and LDL; (24) C2-C12alcohols; and (25) other non-toxic compatible substances employed in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweetening agents, flavoring agents, perfuming agents, preservative and antioxidants can also be present in the formulation. The terms such as "excipient", "carrier", "pharmaceutically acceptable carrier", “means of stabilizing or diluting” or the like are used interchangeably herein. In some embodiments, the carrier inhibits the degradation of the active agent, e.g., the TLR3 inhibitor or means of inhibiting TLR3 as described herein.
[0105] In some embodiments, the pharmaceutical composition comprising the TLR3 inhibitor or means of inhibiting TLR3 as described herein can be a parenteral dose form (i.e., administered or occurring elsewhere in the body than the mouth and alimentary canal). Since administration of parenteral dosage forms typically bypasses the patient's natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a 27 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration of a patient, including, but not limited to, DUROS®- type dosage forms and dose-dumping.
[0106] Suitable vehicles that can be used to provide parenteral dosage forms of the TLR3 inhibitor or means of inhibiting TLR3 as disclosed within are well known to those skilled in the art. Non- limiting examples include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate. Compounds that alter or modify the solubility of a pharmaceutically acceptable salt of the TLR3 inhibitor or means of inhibiting TLR3 as disclosed herein can also be incorporated into the parenteral dosage forms of the disclosure, including conventional and controlled-release parenteral dosage forms.
[0107] Pharmaceutical compositions comprising the TLR3 inhibitor or means of inhibiting TLR3 can also be formulated to be suitable for oral administration, for example as discrete dosage forms, such as, but not limited to, tablets (including without limitation scored or coated tablets), pills, caplets, capsules, chewable tablets, powder packets, cachets, troches, wafers, aerosol sprays, or liquids, such as but not limited to, syrups, elixirs, solutions or suspensions in an aqueous liquid, a non- aqueous liquid, an oil-in-water emulsion, or a water-in-oil emulsion. Such compositions contain a predetermined amount of the pharmaceutically acceptable salt of the disclosed compounds, and may be prepared by methods of pharmacy well known to those skilled in the art. See generally, Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams, and Wilkins, Philadelphia PA. (2005). Dosing
[0108] In some embodiments, the methods described herein comprise administering an effective amount of compositions described herein, e.g., the TLR3 inhibitor or means of inhibiting TLR3 to a subject in order to alleviate a symptom of a disease or disorder associated HSPC proliferation. As used herein, "alleviating a symptom of a disease or disorder associated HSPC proliferation " is ameliorating any condition or symptom associated with the disease or disorder associated HSPC proliferation. As compared with an equivalent untreated control, such reduction is by at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, 99% or more as measured by any standard technique. 28 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT A variety of means for administering the compositions described herein to subjects are known to those of skill in the art.
[0109] In some embodiments of any of the aspects, the TLR3 inhibitor or means of inhibiting TLR3 is formulated at a dose of about 50 μM. In some embodiments of any of the aspects, the TLR3 inhibitor or means of inhibiting TLR3 is formulated at a dose of at least 1 μM, at least 5 μM, at least 10 μM, at least 20 μM, at least 30 μM, at least 40 μM, at least 50 μM, at least 60 μM, at least 70 μM, at least 80 μM, at least 90 μM, at least 100 μM, at least 200 μM, at least 300 μM, at least 400 μM, at least 500 μM, at least 600 μM, at least 700 μM, at least 800 μM, at least 900 μM, at least 1000 μM, or more.
[0110] In some embodiments of any of the aspects, the TLR3 inhibitor or means of inhibiting TLR3 is formulated at a dose of at most 1 μM, at most 5 μM, at most 10 μM, at most 20 μM, at most 30 μM, at most 40 μM, at most 50 μM, at most 60 μM, at most 70 μM, at most 80 μM, at most 90 μM, at most 100 μM, at most 200 μM, at most 300 μM, at most 400 μM, at most 500 μM, at most 600 μM, at most 700 μM, at most 800 μM, at most 900 μM, or at most 1000 μM.
[0111] In some embodiments of any of the aspects, the TLR3 inhibitor or means of inhibiting TLR3 is formulated at a dose of about 1 μM, about 5 μM, about 10 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM, about 60 μM, about 70 μM, about 80 μM, about 90 μM, about 100 μM, about 200 μM, about 300 μM, about 400 μM, about 500 μM, about 600 μM, about 700 μM, about 800 μM, about 900 μM, about 1000 μM, 1 μM – 5 μM, 1 μM – 10 μM, 10 μM – 50 μM, 10 μM – 100 μM, 100 μM – 500 μM, or 100 μM – 1000 μM.
[0112] For systemic administration, subjects can be administered a therapeutic amount of a composition comprising the TLR3 inhibitor or means of inhibiting TLR3, such as, e.g., 0.1 mg / kg, 0.5 mg / kg, 1.0 mg / kg, 2.0 mg / kg, 2.5 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 40 mg / kg, 50 mg / kg, or more.
[0113] The term “effective amount" as used herein refers to the amount of the TLR3 inhibitor or means of inhibiting TLR3 needed to alleviate at least one or more symptom of the disease or disorder, and relates to a sufficient amount of pharmacological composition to provide the desired effect. The term "therapeutically effective amount" therefore refers to an amount of the TLR3 inhibitor or means of inhibiting TLR3 that is sufficient to provide a particular effect (e.g., decreased HSPC proliferation) when administered to a typical subject. An effective amount as used herein, in various contexts, would also include an amount sufficient to delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slowing the progression of a symptom of the disease), or reverse a symptom of the disease. Thus, it is not generally practicable to specify an exact “effective amount". However, for any given case, an appropriate “effective amount" can be determined by one of ordinary skill in the art using only routine experimentation. 29 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0114] Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the ED50 (the dose therapeutically effective in 50% of the population). The dosage can vary depending upon the dosage form employed and the route of administration utilized. A therapeutically effective dose can be estimated initially from cell culture assays. Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the TLR3 inhibitor or means of inhibiting TLR3, which achieves a half-maximal inhibition of symptoms) as determined in cell culture, or in an appropriate animal model. Levels in plasma can be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
[0115] The dosage ranges for the administration of the TLR3 inhibitor or means of inhibiting TLR3, according to the methods described herein depend upon, for example, the form of the TLR3 inhibitor or means of inhibiting TLR3, its potency, and the extent to which symptoms, markers, or indicators of a condition described herein are desired to be reduced, for example the percentage reduction desired for HSPC proliferation. The dosage should not be so large as to cause adverse side effects, such as insufficient bone marrow production of blood cells, including aplastic anemia. Generally, the dosage will vary with the age, condition, and sex of the patient and can be determined by one of skill in the art. The dosage can also be adjusted by the individual physician in the event of any complication.
[0116] The efficacy of the TLR3 inhibitor or means of inhibiting TLR3 in, e.g., the treatment of a condition described herein, or to induce a response as described herein (e.g., decreased HSPC proliferation) can be determined by the skilled clinician. However, a treatment is considered “effective treatment," as the term is used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and / or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate. Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (i.e., progression of the disease is halted). Methods of measuring these indicators are known to those of skill in the art and / or are described herein. Treatment includes any treatment of a disease in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease, e.g., preventing a worsening of symptoms; or (2) relieving the severity of the disease, e.g., causing regression of symptoms. An effective amount for the treatment of a disease means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that 30 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT term is defined herein, for that disease. Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response. It is well within the ability of one skilled in the art to monitor efficacy of administration and / or treatment by measuring any one of such parameters, or any combination of parameters. Efficacy can be assessed in animal models of a condition described herein, for example treatment of clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia. When using an experimental animal model, efficacy of treatment is evidenced when a statistically significant change in a marker is observed. Administration
[0117] A variety of means for administering the compositions described herein to subjects are known to those of skill in the art. Such methods can include, but are not limited to oral, parenteral, intravenous (IV), intramuscular (IM), subcutaneous (SC), transdermal, airway (aerosol), pulmonary, cutaneous, topical, injection, intraosseous (IO), intraperitoneal (IP), intrarectal, intravaginal, intraarticular (IA), or intratumoral administration. Administration can be local or systemic.
[0118] With respect to duration and frequency of treatment, it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment, or make other alterations to the treatment regimen.
[0119] In certain embodiments, an effective dose of a composition comprising a TLR3 inhibitor or means of inhibiting TLR3 as described herein can be administered to a patient once. In certain embodiments, an effective dose of a composition comprising a TLR3 inhibitor or means of inhibiting TLR3 as described herein can be administered to a patient repeatedly.
[0120] The dosing schedule can vary from once a week to daily depending on a number of clinical factors, such as the subject's sensitivity to the TLR3 inhibitor or means of inhibiting TLR3 as described herein. The desired dose or amount can be administered at one time or divided into subdoses, e.g., 2-4 subdoses and administered over a period of time, e.g., at appropriate intervals through the day or other appropriate schedule. In some embodiments, administration can be one or more doses and / or treatments daily over a period of weeks or months. Examples of dosing and / or treatment schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. A composition comprising a TLR3 inhibitor or means of inhibiting TLR3 as described herein can be administered over a period of time, such as over a 5 minute, 10 minute, 15 minute, 20 minute, or 25 minute period.
[0121] In some embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after treatment biweekly for three months, treatment can be repeated once per month, for six months or a year or longer. 31 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0122] In some embodiments of any of the aspects, the TLR3 inhibitor or means of inhibiting TLR3 as described herein described herein is administered as a monotherapy, e.g., another treatment for the disease or disorder associated with HSPC proliferation is not administered to the subject.
[0123] In some embodiments of any of the aspects, the methods described herein can further comprise administering a second agent and / or treatment to the subject, e.g., as part of a combinatorial therapy. Non-limiting examples of a second agent and / or treatment can include a cancer therapy selected from the group consisting of: radiation therapy, surgery, gemcitabine, cisplatin, paclitaxel, carboplatin, bortezomib, AMG479, vorinostat, rituximab, temozolomide, rapamycin, ABT-737, PI- 103; alkylating agents such as thiotepa and CYTOXAN ^ cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylmelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethylenethiophosphoramide and trimethylol melamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gamma1I and calicheamicin omegaI1 (see, e.g., Agnew, Chem. Intl. Ed. Engl., 33: 183-186 (1994)); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomycins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo- L-norleucine, ADRIAMYCIN ^ doxorubicin (including morpholino-doxorubicin, cyanomorpholino- doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such 32 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK ^ polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2''-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids, e.g., TAXOL ^ paclitaxel (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE ^ Cremophor-free, albumin-engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.), and TAXOTERE ^ doxetaxel (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR ^ gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (Camptosar, CPT-11) (including the treatment regimen of irinotecan with 5-FU and leucovorin); topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; combretastatin; leucovorin (LV); oxaliplatin, including the oxaliplatin treatment regimen (FOLFOX); lapatinib (Tykerb®); inhibitors of PKC-alpha, Raf, H-Ras, EGFR (e.g., erlotinib (Tarceva ^)) and VEGF-A that reduce cell proliferation (e.g., pazopanib, sunitinib, sorafenib, regorafenib, cabozantinib, lenvatinib, ponatinib, ziv-aflibercept, axitinib, tivozanib, vandetanib, ramucirumab); and pharmaceutically acceptable salts, acids or derivatives of any of the above.
[0124] In some embodiments of any of the aspects, the cancer treatment method further comprises administering an immune checkpoint inhibitor. In some embodiments of any of the aspects, the immune checkpoint inhibitor comprises an immune checkpoint inhibitor antibody. In some embodiments of any of the aspects, the checkpoint inhibitor immunotherapy is an inhibitor of a checkpoint molecule selected from the group consisting of: programmed cell death 1 (PD-l), programmed death-ligand 1 (PD-L1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), Adenosine A2A receptor (A2AR), CD276, CD39, CD73, B7 family immune checkpoint molecules, V-set domain-containing T-cell activation inhibitor 1 (B7H4), B and T Lymphocyte Attenuator (BTLA), Indoleamine 2,3-dioxygenase (IDO), Killer-cell Immunoglobulin-like Receptor (KIR), Lymphocyte Activation Gene-3 (LAG-3), nicotinamide adenine dinucleotide phosphate NADPH oxidase isoform 2 (NOX2), T-cell Immunoglobulin domain and Mucin domain 3 (TIM-3), T cell 33 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT immunoreceptor with Ig and ITIM domains (TIGIT), V-domain Ig suppressor of T cell activation (VISTA), and Sialic acid-binding immunoglobulin-type lectin 7 (SIGLEC7).
[0125] Non-limiting examples of immune checkpoint inhibitors (ICIs) include: pembrolizumab (Keytruda®), nivolumab (Opdivo®), cemiplimab (Libtayo®), spartalizumab, camrelizumab (AiRuiKa™), sintilimab (TYVYT®), tislelizumab, toripalimab (Tuoyi™), dostarlimab (JEMPERLI), INCMGA00012, AMP-224, AMP-514 (MEDI0608), atezolizumab (Tecentriq®), avelumab (Bavencio®), envafolimab (KN035), cosibelimab (CK-301), AUNP12, CA-170, BMS-986189, BMS- 936559 (MDX-1105), durvalumab (IMFINZI®), tremelimumab, and ipilimumab (Yervoy®). See e.g., US Patents US5811097, US5855887, US6051227, US6682736, US6984720, US7595048, US7605238, US7943743, US8008449, US8217149, US8354509, US8383796, US8728474, US8735553, US8779105, US8779108, US8907053, US8900587, US8952136, US9067999, US9073994, US9683048, US9987500, US10160736, US10316089, US10441655, US10590199, US11225522, US Patent Publication US2014341917; Storz et al., MAbs.2016 Jan; 8(1): 10–26; the contents of each of which are incorporated herein by reference in their entireties.
[0126] One of skill in the art can readily identify a chemotherapeutic agent of use (e.g., see Physicians' Cancer Chemotherapy Drug Manual 2014, Edward Chu, Vincent T. DeVita Jr., Jones & Bartlett Learning; Principles of Cancer Therapy, Chapter 85 in Harrison's Principles of Internal Medicine, 18th edition; Therapeutic Targeting of Cancer Cells: Era of Molecularly Targeted Agents and Cancer Pharmacology, Chs.28-29 in Abeloff’s Clinical Oncology, 2013 Elsevier; and Fischer D S (ed): The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book, 2003).
[0127] In addition, the methods of treatment can further include the use of radiation or radiation therapy. Further, the methods of treatment can further include the use of surgical treatments.
[0128] The methods described herein can further comprise administering a second agent and / or treatment to the subject, e.g., as part of a combinatorial therapy. By way of non-limiting example, if a subject is to be treated for pain or inflammation according to the methods described herein, the subject can also be administered a second agent and / or treatment known to be beneficial for subjects suffering from pain or inflammation. Examples of such agents and / or treatments include, but are not limited to, non-steroidal anti-inflammatory drugs (NSAIDs - such as aspirin, ibuprofen, or naproxen); corticosteroids, including glucocorticoids (e.g., cortisol, prednisone, prednisolone, methylprednisolone, dexamethasone, betamethasone, triamcinolone, and beclometasone); methotrexate; sulfasalazine; leflunomide; anti-TNF medications; cyclophosphamide; pro-resolving drugs; mycophenolate; or opiates (e.g., endorphins, enkephalins, and dynorphin), steroids, analgesics, barbiturates, oxycodone, morphine, lidocaine, and the like. Definitions 34 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0129] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.
[0130] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g., the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal, e.g., for an individual without a given disorder.
[0131] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10%-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an “increase” is a statistically significant increase in such level.
[0132] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian 35 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.
[0133] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of a disease or disorder associated with HSPC proliferation. A subject can be male or female.
[0134] A subject can be one who has been previously diagnosed with or identified as suffering from or having a disease or disorder associated with HSPC proliferation (e.g., clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia) or one or more complications related to such a condition, and optionally, have already undergone treatment for a disease or disorder associated with HSPC proliferation or the one or more complications related to a disease or disorder associated with HSPC proliferation. Alternatively, a subject can also be one who has not been previously diagnosed as having a disease or disorder associated with HSPC proliferation or one or more complications related to a disease or disorder associated with HSPC proliferation. For example, a subject can be one who exhibits one or more risk factors for a disease or disorder associated with HSPC proliferation or one or more complications related to a disease or disorder associated with HSPC proliferation or a subject who does not exhibit risk factors.
[0135] A “subject in need” of treatment for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.
[0136] A variant amino acid or DNA sequence can be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g., BLASTp or BLASTn with default settings).
[0137] As used herein, the terms "treat,” "treatment," "treating,” or “amelioration” refer to therapeutic treatments, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder, e.g., a disease or disorder associated with HSPC proliferation (e.g., clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia). The term “treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with a disease or disorder associated with HSPC proliferation. Treatment is generally “effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective" if the progression of a disease is reduced or halted. That is, “treatment" includes not just the improvement of symptoms or markers, but also a cessation of, or at least slowing of, progress or worsening of symptoms compared to what 36 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptom(s), diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, remission (whether partial or total), and / or decreased mortality, whether detectable or undetectable. The term "treatment" of a disease also includes providing relief from the symptoms or side-effects of the disease (including palliative treatment).
[0138] As used herein, the term “pharmaceutical composition” refers to the active agent in combination with a pharmaceutically acceptable carrier e.g., a carrier commonly used in the pharmaceutical industry. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any of the aspects, a pharmaceutically acceptable carrier can be an artificial or engineered carrier, e.g., a carrier that the active ingredient would not be found to occur in or within nature.
[0139] As used herein, the term "administering," refers to the placement of a composition or compound as disclosed herein into a subject by a method or route which results in at least partial delivery of the composition, compound, or metabolite thereof at a desired site. Pharmaceutical compositions comprising the compounds disclosed herein can be administered by any appropriate route which results in an effective treatment in the subject. In some embodiments, administration comprises physical human activity, e.g., an injection, act of ingestion, an act of application, and / or manipulation of a delivery device or machine. Such activity can be performed, e.g., by a medical professional and / or the subject being treated.
[0140] As used herein, “contacting" refers to any suitable means for delivering, or exposing, an agent to at least one cell. Exemplary delivery methods include, but are not limited to, direct delivery to cell culture medium, transfection, transduction, perfusion, injection, or other delivery method known to one skilled in the art. In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and / or decanting; and / or manipulation of a delivery device or machine. A cell in a subject can be contacted with any of the TLR3 inhibitors or means of inhibiting TLR3 described herein following administration of a composition as described herein to the subject. “Contacting” of a cell can be performed in vitro, ex vivo, or in vivo. 37 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0141] As used herein, the term “functional derivative” refers to an analog or derivative of an indicated molecule that retains the function of the original molecule or at least 50% of the function of the original molecule.
[0142] As used herein, the term “analog” refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an “analog” shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog is a substance that can be generated from the reference substance, e.g., by chemical manipulation of the reference substance.
[0143] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2SD) or greater difference or a p-value of less than 0.05.
[0144] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.
[0145] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.
[0146] The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[0147] As used herein the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[0148] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."
[0149] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to 38 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
[0150] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in cell biology, immunology, and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.
[0151] Other terms are defined herein within the description of the various aspects of the invention.
[0152] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other 39 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[0153] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.
[0154] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.
[0155] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs: 1. A method of treating a disease or disorder associated with hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. 2. The method of paragraph 1, wherein the TLR3 inhibitor is selected from the group consisting of: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII). 3. The method of paragraph 1 or 2, wherein the TLR3 inhibitor is CUCPT4a. 4. The method of paragraph 1 or 2, wherein the disease or disorder associated with increased HSPC proliferation is selected from the group consisting of: clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, and a leukemia. 40 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 5. The method of paragraph 4, wherein the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL). 6. The method of any one of paragraphs 1-5, wherein the TLR3 inhibitor decreases or inhibits TLR3 interaction with double-stranded RNA (dsRNA). 7. The method of any one of paragraphs 1-6, wherein the TLR3 inhibitor decreases or inhibits TLR3-induced Interferon regulatory factor 3 (Irf3) cellular signalling in hematopoietic stem cells (HSPCs). 8. The method of paragraph 7, wherein the decreased or inhibited TLR3-induced cellular signalling decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs. 9. The method of paragraph 8, wherein the decreased or inhibited B2M expression increases macrophage phagocytosis of the HSPCs. 10. The method of paragraph 9, wherein the increased macrophage phagocytosis of the HSPCs decreases the HSPCs proliferating. 11. The method of any one of paragraphs 1-10, wherein the TLR3 inhibitor decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs. 12. The method of any one of paragraphs 1-11, wherein the TLR3 inhibitor increases macrophage phagocytosis of the HSPCs. 13. The method of any one of paragraphs 1-12, wherein the TLR3 inhibitor decreases the HSPCs proliferating. 14. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. 15. The method of paragraph 14, wherein the TLR3 inhibitor is selected from the group consisting of: CUCPT4a, Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII). 16. The method of paragraph 14 or 15, wherein the TLR3 inhibitor is CUCPT4a. 17. The method of any one of paragraphs 14-16, wherein the disease or disorder associated with increased HSPC proliferation is selected from the group consisting of: clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, and a leukemia. 41 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 18. The method of paragraph 17, wherein the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL). 19. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof an effective amount of CUCPT4a. 20. The method of paragraph 19, wherein the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL). 21. A method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. 22. A method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3). 23. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3). 24. A method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3). 25. A method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a) a means of inhibiting Toll-like receptor 3 (TLR3); and b) a means for diluting or stabilizing the means of inhibiting TLR3. 42 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 26. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a) a means of inhibiting Toll-like receptor 3 (TLR3); and b) a means for diluting or stabilizing the means of inhibiting TLR3. 27. A method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a) a means of inhibiting Toll-like receptor 3 (TLR3); and b) a means for diluting or stabilizing the means of inhibiting TLR3. 28. A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation. 29. A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia. 30. A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs).
[0156] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting. EXAMPLES Example 1: ROS and TLR signaling balance eat me and don't eat signals to determine stem cell clonal selection by macrophages.
[0157] Macrophages quality assure normal blood stem cells and determine the number of hematopoietic clones that participate in adult hematopoiesis. Macrophages either engulf a stem cell completely (referred to as dooming) or capture portions of the stem cell's cellular material (referred to as grooming). In the latter case, the stem cell continues to divide. This interaction is mediated by a signal called calreticulin (CALR) on the surface of hematopoietic stem and progenitor cells (HSPCs), known as an eat-me signal. Surface CALR levels are increased in stem cells with higher levels of reactive oxygen species (ROS), but the specific molecular cues that regulate the dooming versus grooming behavior are still unknown. To investigate this, a panel of 1200 bioactive small molecules 43 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT was screened in human cells, and 93 compounds were identified that robustly increased surface CALR in a dose-dependent manner. Of these compounds, 22 also facilitated interactions between macrophages and stem cells in zebrafish (mean control: 0.31; ROSdependent: 0.56; p<0.0001 and ROSindependent: 0.52; p=0.0006). The behavior of macrophages was examined after CALR-inducer treatment. Compounds that depended on ROS to increase CALR showed higher dooming ratios, indicating an effective quality control mechanism. Conversely, animals treated with ROSindependentcompounds exhibited a higher probability of grooming events (chi-test: 0.0072), despite increased CALR and increased macrophage-stem cell interactions. To investigate the signals involved in interactions under ROSindependentconditions, the levels of canonical don't eat me signals were assessed after treatment with ROSindependentcompounds. This analysis revealed an enrichment upon treatment of b2-microglobulin (B2M), an essential component of the major histocompatibility complex class I. Antibody staining, and knockout experiments in a new zebrafish mutant in b2m confirmed its importance in preventing the dooming phenotype. To evaluate if the increased dooming observed in the B2m mutant affected clonal dominance, mosaic deletions were generated using the zebrabow color barcoding system (TWISTR) as a lineage tracer. Mosaic deletion of b2m significantly reduced the number of myeloid clones (22 versus 8, p=0.0016), but increased clonal dominance (Gini coefficient: 0.36 versus 0.6792). These dominant clones in these fish were wild-type for B2M that were resistant to dooming and overtook the adult marrow. IRF3 and TLR3 are upstream of MHC-I expression. Knockdown of irf3 or tlr3 in zebrabow embryos also reduced the number of myeloid clones (15 vs 8 and 7 clones, p<0.0001) while increased clonal dominance. Preliminary analysis for irf3 mutations showed wild-type clonal dominance showing a competitive disadvantage of the IRF3 targeted stem cells, similar to the B2M mutant stem cells. B2m levels positively correlated with isg15 reporter expression that is a reporter for type I interferon signaling. Treatment with PolyI:C, a dsRNA mimic, facilitated grooming (p=0.0013), indicating that dsRNA promotes the grooming behavior. Forced expression of endogenous retroviruses and transposable elements typically activated by interferon also elevated b2-microglobulin levels and promoted grooming. This indicates that homeostatic endogenous retrovirus stimulation mediates B2m expression. To complement these studies, a CRISPR-Cas9 knockout screen was performed in K562 cells to find the molecular cues modulating surface CALR under a don’t eat me context. The DL-threo-PPMP, a glucosylceramide synthase inhibitor, was used to stimulate CALR independent of ROS, causing the grooming outcome. 3169 sgRNAs were enriched (p<0.05) specifically under the don't eat me context. Among the targets, a significant enrichment of genes was associated with cytosolic DNA / RNA sensing and viral immune response, such as TLR3 (b=0.76) and HLA-F (b=0.9). Knockdown of tlr3 using morpholino reduced CALR and b2-microglobulin levels in vivo and facilitated dooming, showing the balance of cellular behaviors between the eat-me and don't eat-me signals. These findings demonstrate that endogenous TLR3 ligands causes expression of b2-microglobulin, thereby providing a blockade against 44 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT macrophage-induced dooming and determining hematopoietic stem cell clonality by monitoring stem cell quality with macrophages.
[0158] Non-limiting examples of compounds that up regulate B2m are provided below: 1. DL-Ppmp (also referred to as N-[(1R,2R)-1-hydroxy-3-morpholin-4-yl-1-phenylpropan-2- yl]hexadecanamide; see e.g., pubchem.ncbi.nlm.nih.gov / compound / DL-Ppmp); 2. CM-272 (also referred to as 6-Methoxy-2-(5-methylfuran-2-yl)-N-(1-methylpiperidin-4-yl)-7- (3-(pyrrolidin-1-yl)propoxy)quinolin-4-amine, C28H38N4O3; see e.g., CID 118607432 PubChem, pubchem.ncbi.nlm.nih.gov / compound / cm-272); 3. Polyinosinic–polycytidylic acid (Poly (I:C); CAS number 31852-29-6); 4. Arvanil (C28H41NO3CID 6449767 - PubChem; see e.g., pubchem.ncbi.nlm.nih.gov / compound / Arvanil#section=2D-Structure); or 5. Cambinol(C21H16N2O2S; CID 3246390 - PubChem; see e.g., pubchem.ncbi.nlm.nih.gov / compound / Cambinol). Example 2: Transcripts of repetitive DNA elements signal to block phagocytosis of hematopoietic stem cells
[0159] Macrophages maintain hematopoietic stem cell (HSC) quality by assessing cell surface Calreticulin (Calr), an "eat-me" signal induced by reactive oxygen species (ROS). Using zebrafish genetics, Beta-2-microglobulin (B2m) was identified as a crucial "don't eat-me" signal on blood stem cells. A chemical screen revealed inducers of surface Calr that promoted HSC proliferation without triggering ROS or macrophage clearance. Whole genome CRISPR-Cas9 screening showed that Tlr3 signaling regulated b2m expression. Targeting b2m or Tlr3 reduced the HSC clonality. Elevated B2m levels correlated with high expression of repetitive elements (RE) transcripts. Overall, RE-associated dsRNA can interact with TLR3 to stimulate surface expression of B2m on HSPCs. These findings indicate that the balance of Calr and B2m regulates macrophage-HSC interactions and defines hematopoietic clonality. Results Calr expression was induced by processes associated with and without reactive oxygen species
[0160] Stress associated with reactive oxygen species (ROS) within HSPCs mediates the surface presentation of “eat-me” molecules as Calreticulin (Calr) . This stress in HSPCs correlates with FoxO signaling, known to mediate cellular detoxification from spurious ROS. Similar to the proposed quality control mechanism, HSPCs with high ROS were removed (doomed) by macrophages, while low ROS HSPCs were not doomed, but rather prompted to continue dividing after interacting with macrophages (see e.g., Fig.1A). ROS levels were evaluated in zebrafish HSPCs, and increased levels of ROS correlated with surface presentation of the “eat-me” signal, Calr (see e.g., Fig.1B, Fig.5A). 45 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Conversely, when ROS was reduced in HSPCs by treating zebrafish embryos with the ROS scavengers diphenyleneiodonium (DPI) or VAS2738 (VAS), low levels of surface Calr were observed (see e.g., Fig.1C), and reduced macrophage interactions with stem cells were observed. This showed that ROS levels were indicative of higher surface Calr and macrophage-HSPCs interaction.
[0161] Nonetheless, the intrinsic mechanism regulating surface Calr in a ROSindependentmanner remained unknown. To evaluate the pathways in HSPCs that trigger surface Calr presentation systematically, a myriad of signaling pathways were targeted in HEK293 cells by screening a panel of 1,200 bioactive small molecules (see e.g., Fig.1D). Calr is an abundant chaperone in the endoplasmic reticulum. Thus, to evaluate only Calr on the cell surface, a SPLIT-TURBO ID construct was designed, targeting the association of Calr and a membrane protein, Cadherin 2 (CDH2). Calr surface presentation was orthogonally evaluated with a fluorescent Calr antibody (ZENON-TECHNOLOGY). Through these two independent approaches, compounds were identified that robustly increase surface Calr presentation. Concurrently, cells were also labeled with a ubiquitous ROS probe (CELLROX) to identify compounds that induce surface Calr in a ROS-associated manner (see e.g., Fig.1D and Fig. 5B and 5C).93 compounds were found that increased surface Calr with a robust dose-dependent response in cells (see e.g., Fig.1E), hereafter referred to as “Calr-inducers”. Among the 93 Calr- inducers, 54 were associated with increase of ROS (ROSdependent), while 39 did not affect ROS levels (ROSindependent) (see e.g., Tables 1A-1D). DMSO was used as the vehicle control, while DPI and H2O2were used as internal negative and positive controls, respectively. Using the Chemical Annotation Toolkit, the known biological function of ROSdependentcompounds were analyzed. There was a strong positive correlation with cellular stress pathways, such as oxidation by cytochrome P450 and DNA damage, while ROSindependentchemicals were not enriched in a given pathway (see e.g., Tables 1A- 1D).
[0162] To test the effect of the 93 Calr-inducers on macrophage-HSPC interaction outcomes, the following were used: runx1+23:mCherry and mpeg1.1:EGFP zebrafish embryos, expressing fluorescent reporters in HSPCs and macrophages, respectively. At 48 hours postfertilization (hpf), embryos were exposed to the 93 Calr-inducers (see e.g., Fig.1F). After 24 hrs of exposure, macrophage-HSPC interactions were evaluated by live cell imaging. Twenty-two of 93 Calr inducers facilitated macrophage-HSPC interactions above baseline levels (see e.g., Fig.1F; see e.g., Tables 1A-1D). Increased surface Calr presentation by these compounds was confirmed (see e.g., Fig.5D).
[0163] Both ROSdependentand ROSindependentcompounds increased macrophage-HSPC interaction ratios by a similar level (see e.g., Fig.5E). Apoptosis was evaluated by ANNEXIN-V staining on cells from wildtype 72 hpf embryos. The 22 compounds did not change apoptosis levels compared to DMSO treated embryos, except for the ROSdependentβ-Lapachone (see e.g., Fig.1G and Fig.5F). Thus, Calr-inducers triggered surface Calr independently of an apoptotic / cell death pathway (see e.g., Fig.5D-5F). Next, to validate the dependence of Calr in mediating the increased macrophage-HSPCs 46 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT interaction observed upon the 22-Calr-inducers treatment (see e.g., Fig.1G), mosaic deletions (crispants) were generated of a Calr isoform in zebrafish that regulates macrophage-HSPC interactions, Calr3b. The 22 Calr-inducers facilitated the interaction in a Calr3b-dependent manner (see e.g., Fig. S5G-5H). Collectively, these results demonstrate that surface Calr level determines macrophage-HSPC interaction. Both ROS-dependent and ROS-independent pathways increased surface Calr presentation, indicating that various sources of stress lead to the presentation of “eat-me” signals. Macrophage “dooming” or “grooming” behavior is determined by HSPC ROS levels
[0164] Since antioxidant treatment hindered the surface Calr levels of human HSPCs exposed to ROSdependentcompounds (see e.g., Fig.5I), it was contemplated that compounds that promoted dooming would be associated with higher ROS levels due to mitochondrial dysfunction. Supporting this hypothesis, ROSdependentcompounds that promoted only dooming (see e.g., Fig.2A) also impaired mitochondrial membrane potential (see e.g., Fig.5J-5L) and absence of macrophage-HSPCs interactions induced higher accumulation of mitochondrial ROS (see e.g., Fig.5M-5N), thus supporting quality control ensured by macrophages.
[0165] In contrast, ROSindependentcompounds increased HSPC proliferation, which was in line with increased grooming behavior (see e.g., Fig.2A, Fig.6A). Taken together, these results indicated that surface Calr presentation on HSPCs induce macrophage interaction, but the outcome of that interaction was determined by HSPC cellular ROS levels. ROSdependentcompounds stimulated dooming behavior and HSPC death. ROSindependentcompounds stimulated grooming behavior and HSPC proliferation.
[0166] The pro-proliferative effect of Calr-inducing compounds on HSPCs can be an indirect consequence of impaired intrinsic macrophage behavior. Therefore, the chemotaxis and phagocytic activity of macrophages treated with ROSindependentcompounds was tested in vitro. To evaluate phagocytosis, RAW-274 macrophages were treated with the Calr-inducers. After exposure for 24 hrs, GFP-rhodo zymosan, a pathogen particle that promotes phagocytosis, was added to the culture, and the number of zymosan-GFP+ macrophages was measured by live cell imaging. There was not impaired zymosan phagocytosis in the treated cells. LPS was used as a positive macrophage stimulator (see e.g., Fig.6B). Macrophage chemotaxis was evaluated with an agarose-chemotaxis assay; see e.g., Heit et al. Sci. STKE 2003, PL5 (2003). RAW-274 cells were treated with DMSO (negative control), LPS (positive control), or the ROSindependentcompound. The chemoattractant spot was filled with a medium containing LPS as bait for macrophage chemotaxis, which was not affected by this treatment (see e.g., Fig.6C). These results indicated ROSindependentCalr-inducers did not alter intrinsic macrophage function. Thus, ROSindependentcompounds drove macrophage-mediated HSPC grooming without inducing macrophage autonomous effects (see e.g., Fig.2A). 47 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Toll-like receptor 3 induces surface Calr in a pro-grooming context
[0167] In order to determine how ROSindependentcompounds induced surface Calr presentation to promote macrophage grooming, rather than dooming, a genome-wide CRISPR screen was conducted. The ROSindependentcompound DL-PPMP was chose as the Calr-inducer, as it led to high surface Calr (see e.g., Fig.5C), macrophage-HSPC interactions (see e.g., Fig.1F), HSPC proliferation (see e.g., Fig.6A), and increased the macrophage grooming ratio (see e.g., Fig.2A). To define the intricate network required for surface Calr expression, lentiviral delivery of a knockout library that targeted 18,080 genes with 64,751 unique guide sequences was used; see e.g., Shalem et al. Science 343, 84– 87 (2014). K562 human leukemia cells were treated with DL-PPMP or DMSO (control) and were flow cytometry sorted for Calr-negative cells (see e.g., Fig.2B). Here, by sorting for Calr-negative cells and enriching for the sgRNA in those cells, it was determined which genes regulated surface Calr presentation in response to the Calr-inducer in the “don’t eat-me” context.
[0168] The focus was on the genes that were specifically enriched in the DL-PPMP stimulated cells (see e.g., Fig.2C; see e.g., Table 2). Amongst the targets, there was enrichment of genes that upregulated Calr presentation, associated with cytosolic DNA / RNA sensing and viral immune responses, namely, Tlr3 (a dsRNA sensor), DDX3X (a RNA helicase), and XBP1 (a protein that among other terms regulates MHC class II genes and is a key transcription factor regulator of ER stress). In validation experiments, Tlr3 depletion reduced surface Calr in K562 cells (see e.g., Fig. 6G), indicating that cytosolic DNA / RNA can mediate the increase in surface Calr.
[0169] In parallel, a whole genome CRISPR-Cas9 screen was performed of K562 cells treated with a ROSdependentcompound that promoted HSPC dooming, Bongkrekic acid. While there was enrichment of Calr, confirming the targeting efficiency of the screen, there was not enrichment of Tlr3 in this dataset (see e.g., Table 2). This data supported the hypothesis that a pro-grooming surface Calr presentation is mediated by Tlr3. Tlr3 signaling in HSPCs is required for macrophage-mediated grooming.
[0170] The biological relevance of Tlr3 in HSPCs for controlling dooming versus grooming by macrophages was evaluated. This was tested with two orthogonal approaches. Tlr3 was depleted by injecting a morpholino in single-cell zebrafish embryos (termed “morphants”, see e.g., Fig.6H) or Tlr3 was pharmacologically inhibited by treating zebrafish embryos with the dsRNA / Tlr3 inhibitor (see e.g., Fig.6I), CUCPT4a (iTlr3), see e.g., Cheng et al. Chem. Soc.133, 3764–3767 (2011). Treatment or depletion was after 48 hours since the emerging / budding of HSPCs from the ventral wall of the dorsal aorta (VDA) reliably occurs during the first 48 hpf. In both approaches, a reduced number of HSPCs was observed presenting surface Calr in vivo by flow cytometry (see e.g., Fig.6H- 6I). These data confirmed that Tlr3 is required for surface Calr presentation on the surface of HSPCs in vivo. 48 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0171] It was then tested if morpholino-depletion of Tlr3 or iTlr3 inhibition modulated macrophage-HSPC interactions and interaction outcomes. Despite a reduction in Calr+ HSPCs, Tlr3 depletion by morpholino or iTlr3 increased dooming and decreased grooming (see e.g., Fig.2D). To address potential cell autonomous defects in macrophage behavior, parabiosis experiments were performed where standard or Tlr3 morpholino-injected embryos from the runx1+23mCherry;mpeg1:BFP were fused to a mpeg.1:EGFP wild type zebrafish (see e.g., Fig.2E). Macrophages of both origins, wild type and Tlr3-morphants, equally showed increased engagement to HSPCs followed by increased dooming behavior. This demonstrated that Tlr3 acts in a HSPC- autonomous manner to prevent dooming behavior (see e.g., Fig.2F, 2G). To investigate if Tlr3 was sufficient to promote grooming, murine Lineage-Sca1+cKit+(HSPCs, LSK+) cells were sorted, pretreated with either Poly I:C, a dsRNA mimic (Tlr3 agonist), or DMSO, and cocultured with their autologous bone marrow-derived macrophages (BMDM). Poly I:C-pretreated HSPCs cells showed higher grooming ratios (see e.g., Fig.6J-6K), ergo indicating that Tlr3 / dsRNA signaling in HSPC promoted grooming behavior. Tlr3 signaling directs HSPC surface presentation of B2m
[0172] To gain insight into the molecular mechanism triggered by the “don’t eat-me” compound, DL-PPMP, bulk RNA-seq data from a DL-PPMP-treated human cancer cell line was analyzed; see e.g., Lamb et al. Science 313, 1929–1935 (2006).2,285 upregulated genes were identified in treated cells, enriched for pathways associated with the viral immune response, such as regulation of interferon-alpha production, antigen processing, and presentation of endogenous peptides via MHC class I. Consistent with the data herein, K562 cells treated with DL-PMPP expressed higher levels of Beta 2 microglobulin (B2M), a molecule required for the MHC-I stabilization on the cell surface (see e.g., Fig.7A). Although MHC-I is required for antigen presentation and CD8+T cell activation, it can also prompt a “don’t eat-me” signal. For example, MHC class I-B2M expression protects cancer cells from phagocytosis via engagement of LILRB1 / LILRB2 expressed in immunosuppression-related cells, such as tolerogenic dendritic cells (DCs) and M2-type macrophages; see e.g., Barkal et al. Nat. Immunol.19, 76–84 (2018), Chang et al. Nat. Immunol.3, 237–243 (2002), Liu et al. Signal Transduct Target Ther 8, 104 (2023).
[0173] Evolutionary, this mechanism could be conserved because based on data from Actinopterygii, the LILR system originated 450 million years ago, in which the leukocyte immune- type receptor (LITR) shows orthologous relationship to human LILR receptor. Based on the CRISPR-screen to identify the molecular cues of surface Calr inducers in the “don’t eat-me” context (see e.g., Fig.2C) and results showing that Tlr3 facilitated grooming (see e.g., Fig.6J-6K), it was hypothesized that HSPCs would display more B2m in response to Tlr3 signaling, thereby suppressing macrophage phagocytosis and preventing dooming behavior. To test this hypothesis, surface levels of 49 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT B2m were evaluated on HSPCs in Tlr3 zebrafish morphants. Depleting tlr3 in zebrafish embryos resulted in fewer B2m+HSPCs (see e.g., Fig.7B). Considering that Tlr3 zebrafish morphants showed higher dooming events (see e.g., Fig.2D), these results indicated that the lower B2m expression, resulting from lower Tlr3 expression, biased the HSPCs to be doomed by the macrophages. Surface B2m determines the outcome of macrophage-HSPC interactions mediated by Calr
[0174] 48 hpf zebrafish embryos were treated with the ROSindependentcompounds and the surface B2m on HSPCs was evaluated by FACS. ROSindependentcompounds increased B2m levels (see e.g., Fig.7C, 7D), while “eat-me” or iTlr3 treatments decreased surface B2m levels (see e.g., Fig.7C, 7D). To validate whether the signal input provided by Calr and B2m influenced the outcome of macrophage-HSPC interactions, CRISPR / Cas9 was used to generate zebrafish crispant embryos with mosaic deletions of b2m, and they were treated with ROSindependentCalr inducers. DMSO was used as the vehicle control in the embryos injected with control sgRNA and b2m sgRNA. Upon b2m depletion, ROSindependentCalr inducers promoted dooming, rather than grooming (see e.g., Fig. 7E). Together, these data supported the hypothesis that ROSindependentCalr-inducers promoted grooming via both Calr and B2m surface presentation, in which Calr promotes the macrophage-HSPC interaction and B2m provides the “don’t eat-me” signal hindering HSPCs from being fully engulfed by macrophages.
[0175] Mosaic crispants are limited by editing efficiency. Thus, to confirm the role of B2m in macrophage-mediated HSPC grooming, b2m stable knockout zebrafish were generated. CRISPR / Cas9 was used to cause a frameshift mutation in the 3-exon of the b2m gene in zebrafish with a runx1+23:mCherry;mpeg1-EGFP background. The outcome of macrophage-HSPC interactions in these homozygous mutants was investigated by live cell imaging at 72 hpf. B2m depletion promoted HSPC-dooming and decreased HSPC-grooming (see e.g., Fig.3A-3E and Fig.7D), which further supported the role of surface B2m as a “don’t eat-me” signal on HSPCs. This increase in dooming was not associated with increased numbers of Calr+HSPCs (see e.g., Fig.7G). Also, despite the low surface Calr on HSPCs surface fewer Runx1+cells were observed in the caudal hematopoietic tissue (CHT) (see e.g., Fig.7H), indicating enhanced HSPCs dooming.
[0176] Next, to validate the role of B2m as a “don’t eat-me” signal, the b2m knockout embryos were treated with the ROSindependentcompound, DL-PPMP. It was rationalized that DL-PPMP would increase surface Calr (increasing macrophage-HSPC interactions), but in the absence of B2m, the interactions would lead to dooming. DL-PPMP stimulated interactions in both wild type and b2m knockout embryos. B2m knockout HSPCs were doomed, while wild-type HSPCs were groomed (see e.g., Fig.3F-3G). These results supported the importance of surface B2m to instruct grooming behavior by the macrophages. 50 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0177] It was then evaluated whether the “don’t eat-me” signal mediated by B2m was conserved throughout evolution. Thus, murine HSPCs (LSK+) that were MHC-I+or MHC-I- were sorted and co- cultured with bone marrow derived macrophage (BMDM) for 4 hours (see e.g., Fig.3H). Class I MHC was sorted because its surface expression is dependent on the presence of B2M. Murine MHC- I+HSPCs promoted macrophage grooming (see e.g., Fig.3I). Overall, these results showed that B2m decorates the surface of HSPCs and promotes the “don’t eat-me” signal during the macrophage- HSPCs interactions. B2m is required for safeguarding HSC clonal complexity
[0178] As in B2m germline mutations in mammals, there were not major changes in development following B2m knockout in adult zebrafish, except for a decrease in lymphoid cells (see e.g., Fig.7I), reflecting impaired CD8+differentiation.
[0179] HSC clonal complexity is essential for maintaining a functional and resilient immune system, supporting long-term hematopoietic function, and reducing the risk of hematological diseases. Since grooming and dooming regulates HSC clonal complexity, it was investigated if B2m depletion can impact the HSC clonal landscape. It was hypothesized that increased dooming in b2m mutants reduces the number of HSC clones in adulthood. To test this, mosaic deletions were generated using tissue editing with inducible stem cell tagging via recombination (TWISTR) to combine CRISPR / Cas9-mediated gene editing with Zebrabow (zbow) HSC color labeling. This system allows mutant and wild type stem cells to compete in vivo. Zebrabow-M;draculin:CreERT2 embryos permit unique lineage labeling of individual HSC clones at 24 hpf (see e.g., Fig.3J). Mosaic deletion of b2m reduced the number of myeloid and lymphoid / progenitor clones (see e.g., Fig.7J) and promoted clonal dominance (see e.g., Fig.3K–3M, Fig.7K). Additionally, macrophage ablation before HSPC lodgment in CHT rescued clonal dominance in b2m crispants (see e.g., Fig.3K-3M), but did not rescue clone numbers (see e.g., Fig.3M). The decrease in clone numbers could reflect the impairment of interleukin 1β (Il-1β)-driven proliferation, therefore limiting the number of HSC clones (see e.g., Fig.3N). Considering the mosaic nature of TWISTR, it was hypothesized that the more abundant (or dominant) clones found in the b2m mutation condition are wild type cells that do not carry b2m mutation. Therefore, dominant and non-dominant clones were sorted and evaluated for their b2m editing efficiency. Indeed, dominant clones were wild type for b2m, indicating that b2m mutant clones were doomed and led dooming-resistant wildtype clones to overtake the adult marrow (see e.g., Fig. 7K). These results indicate that B2m decorates the surface of HSPCs and protects them against macrophage removal, thus affecting the HSPCs clonality in adulthood.
[0180] Irf3 mediates a Tlr3 / Tlr4-specific antivirus gene program upstream of b2m expression. Therefore, the TWISTR system was used to generate TWISTR-Irf3 mutants to elucidate the molecular pathways that regulate HSC clonality via B2m. TWISTR-Tlr3 mutants were also generated, 51 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT and zebrafish embryos were treated with iTlr3 to suppress Tlr3 / dsRNA downstream signaling at 48 hpf. Like b2m-mutants, mosaic depletion of Irf3 and Tlr3, as well as inhibition of Tlr3 signaling, collectively reduced the number of myeloid clones while increasing clonal dominance (see e.g., Fig. 7L–7Q). The TWISTR-Irf3 mutants similarly showed wild-type clonal dominance, indicating a competitive disadvantage of Irf3-depleted stem cells (see e.g., Fig.7L-7N). Collectively with the imaging results, this shows that both B2m mutant HSCs, and also Irf3 mutant HSCs, are removed by macrophages because the cells no longer present the “don’t eat-me” signal. These data indicate an operative molecular network of Tlr3 activation cascades that promote Irf3 activation, which could promote the transcription of b2m. Cytosolic dsRNAs promote B2m expression and protection from dooming
[0181] Increased expression of b2m is a classic response against viral infection and a cellular response to type I IFN; see e.g., Perng and Lenschow, Nat. Rev. Microbiol.16, 423–439 (2018); Langevin et al. J. Virol.87, 10025–10036 (2013); Balla et al. Curr. Biol.30, 2092–2103.e5 (2020) . To investigate the intrinsic heterogeneity of the HSPC population, the IFN-stimulated gene 15 (isg15) was used as a reporter for the Tlr3-mediated Irf3 response. Flow cytometry revealed that 27% of Runx1+HSPCs were positive for isg15 (see e.g., Fig.4A, Fig.8A) and positively correlated with B2m surface presentation (see e.g., Fig.4B). Isg15+HSPC were less likely to be doomed by macrophages (see e.g., Fig.4C). The associated enrichment of isg15 activity and B2m within select HSPCs indicated a viral mimicry response in these cells. To test this, 72 hpf embryos were injected with a Tlr3 agonist, Poly I:C, and the fraction of Isg15+HSPCs was measured. Poly I:C increased the fraction of Isg15+ HSPCs (see e.g., Fig.8B). Collectively, these data demonstrate an endogenous, viral mimetic response trigger the type I IFN pathway, leading to high B2m levels on the HSPCs surface, and consequently protecting the HSPCs from dooming.
[0182] Repetitive elements (REs), including endogenous retrovirus (Erv) have roles in regulating HSPC formation and regeneration. Therefore, it was hypothesized that REs could be the endogenous Tlr3 ligand mediating b2m expression. qPCR analysis of Runx1+Isg15+cells revealed a consistent increase in endogenous retroviral and B2m expression (see e.g., Fig.4D). Together, these data indicated that HSPCs with higher levels of REs transcripts also present elevated levels of B2m.
[0183] To gain insight into the REs’ status in macrophage-interacting HSPCs, scRNAseq data of sorted runx1+23:mCherry HSPCs from macrophage-depleted and control embryos was re-analyzed (see e.g., Wattrus et al. Science 377, 1413–1419 (2022)), and the mapping was modified to include the expression of REs, including long terminal repeats (LTRs), at the single-cell level. The cluster of cells enriched for cell cycle gene expression (Cluster 2) had elevated RE expression compared to the cluster enriched for non-cycling cells (see e.g., Fig.4E, Fig.4F, Fig.8C, Fig.8C). This indicated that HSPCs that are primed to proliferate have higher RE expression. Additionally, bulk-RNAseq of 52 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Runx1+cells from the CHT of embryos treated with DL-PPMP (pro-grooming, B2m-dependent compound), showed an upregulation of REs, including transcripts for Ltrs (see e.g., Fig.8D).
[0184] To evaluate B2m expression in HSPCs carrying high or low content of Erv transcripts, a zebrafish reporter line for a zfERV (LTR5) was crossed with runx1+23:mCherry zebrafish. LTR5+HSPCs exhibited higher B2m levels by FACS (see e.g., Fig.8E). It was next determined if RE levels were dependent on macrophage-HSPC interactions. To test this, the levels of cytosolic dsRNA was quantified in Runx1+ cells from wild-type or macrophage-depleted embryos at 48 hpf. Macrophage depletion did not change the dsRNA content in Runx1+cells (see e.g., Fig.8F), indicating the endogenous content of REs in HSPCs is independent of macrophage interaction.
[0185] Overall, these data demonstrated that elevated cytosolic REs, including Ltrs, correlated with higher B2m levels, demonstrating that a viral mimicry program can protect HSPCs from macrophage dooming.
[0186] To determine whether inducing the expression of RE in HSC can regulate macrophage behavior, 48 hpf zebrafish embryos were treated with the G9a / DNMT inhibitor, CM272. It was reasoned that inhibiting DNA methylation would enhance RE expression, including Erv. Indeed, after 24 hrs, HSPCs from embryos treated with CM272 increased expression of endogenous retrovirus and virus-like response genes (see e.g., Fig.8G). Additionally, CM272 increased the proportion of Isg15+and B2m+HSPCs and increased the level of Calr on HSPCs (see e.g., Fig.8H-8K). This indicated that CM272 can promote HPSC-grooming by macrophages.72 hpf embryos were treated with CM272. CM272 increased the number of Isg15+ HSPCs, HSPC proliferation, and reduced HSPC- dooming in live imaging experiments (see e.g., Fig.4G-4I).
[0187] As CM272 can regulate dooming and grooming via a number of gene expression changes beyond upregulation of REs, the zebrafish ltr4 was cloned downstream the runx1+23 enhancer-GFP to promote the overexpression of a RE in the HSPCs. HSPCs from embryos overexpressing ltr4 (ltr4- OE) showed higher proliferation compared to embryos overexpressing the runx1+23 enhancer-GFP (see e.g., Fig.8L). Considering that macrophage grooming and longer interactions correlate with higher HSPC proliferation, the increased proliferation observed in the ltr4-OE reflected higher grooming behavior. Thus, increasing global RE expression (by CM272) or overexpression of a specific RE, Ltr4, protected against macrophage dooming.
[0188] The consequences of RE-mediated protection from reduced dooming events on HSPC clonality was investigated. CM272 treatment was used as a tool to increase the “don’t eat-me” signal on HSPCs, as it permitted focus on the events after HSPCs budding (which occurs at 24-48 hpf). It was reasoned that the de-repression of retroviral elements would increase the proliferation of HSPCs. Indeed, CHT imaging confirmed higher proliferation rates of HSPCs, as depicted by EdU incorporation (see e.g., Fig.4H). However, zebrabow analysis showed virtually no difference in clonality (see e.g., Fig.4J-4K), indicating that CM272 promotes the amplification of already 53 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT established clones. There was not a rescue in clonal dominance when TWISTR-b2m mutants were treated with CM272, confirming that dsRNA sensing occurs upstream of B2m presentation. (see e.g., Fig.4J-4K).
[0189] Together, these data showed that REs positively correlated with B2m+HSPCs and that upregulating endogenous retroviral levels can provide protection against HSPC dooming. B2M induction via endogenous retrovirus is conserved throughout evolution
[0190] The sequence of amino acids for B2m is highly conserved. Thus, it was examined whether ERV-driven B2M expression is conserved in mammals. Consistent with the observation in zebrafish, human ISG15+HSPCs had higher B2M expression and positively correlated to the expression of REs (see e.g., Fig.4L-4M).
[0191] Human Erv or GFP (as control) was overexpressed in CD34 cells to validate a causal relationship between B2M levels and REs expression. Overexpression of Erv, but not control GFP, led to an increase in B2M on the surface of HSPCs (see e.g., Fig.4N, Fig.8M-8N). In contrast, ROS levels were not elevated following Erv overexpression (see e.g., Fig.8M). The surface B2m increase was observed in CM272-and Poly I:C-treated human CD34 cells, which could be abrogated by blocking Tlr3 signaling (see e.g., Fig.8O). This data from human cells and zebrafish indicated the regulation of B2M via dsRNA / Tlr3 signaling is conserved throughout evolution.
[0192] To understand the functional relevance of the “don’t eat-me” signal in the mammalian system, myelodysplastic syndrome 1 (Mds1)-GFP+ / Flt3Cre(MFG) stem cell reporter mice were treated (see e.g., Christodoulou et al. Nature 578, 278–283 (2020) ) with DL-PPMP as it promoted the presentation of B2M, but not other “don’t eat-me” molecules, such as CD47 (see e.g., Fig.8P). This reporter model was chosen because Mds1 is a gene highly enriched in long term HSCs (LT-HSCs) that are capable of self-renewing. DL-PPMP treatment increased HSPC proliferation (see e.g., Fig. 4O, Fig.8Q) and increased MHC-I levels (see e.g., Fig.4P, Fig.8Q). This indicated that the HSPCs were protected from the macrophage dooming and proliferated as a consequence of grooming. B2m expression in response to repetitive elements alters HSPCs fate
[0193] Endogenous retroviral proteins and genetic material have been shown to regulate innate immune response. ERV-derived enhancers and promoters appear to be activated upon pathogen infections, indicating for a cooperative activation in responding to pathogens, or the existence of a trained immunity , there is function between innate immune response and ERVs.
[0194] Given the evolutionary conservation of RE and B2m, the relevance of this finding was investigated in the context of pathogen infection, which is an evolutionarily conserved process. The role of Tlr3 signaling was evaluated in mediating “emergency granulopoiesis”. This is a distinctive, protective, program of accelerated de novo production of neutrophils from amplification of progenitor cells in response to fatal infection. Therefore, to explore if Poly I:C can induce emergency 54 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT granulopoiesis, zebrafish embryos were treated with Poly I:C, and the numbers of neutrophils were assessed as a proxy of myeloid emergency response. Upon Poly I:C stimulation, the population of neutrophils increased (see e.g., Fig.8R). Similarly, humanized NOG mice showed higher granulopoiesis and GM-CSF levels upon infection. These results indicated that the viral stimulation can confer a better fit against opportunistic pathogens by promoting the granulocyte differentiation.
[0195] Besides the pathogenic aspects, there was also higher B2m expression in AML-malignant HSPCs and higher TE expression in human AML blast cells (see e.g., Fig.9A-9B). This indicated that AML cells can hijack the “don’t eat-me” signal to avoid macrophage elimination.
[0196] Taken together, these data demonstrate that viral-mimetic signaling of RE-Tlr3 mediates the levels surface B2m on HSPC to promote macrophage-mediated grooming and protect against macrophage-dooming in an evolutionary conserved manner that shapes HSCs fate determination and clonal proliferation (see e.g., Fig.4Q). Discussion
[0197] These data support a model in which macrophages vet the quality of newly formed HSPCs through a balance between “eat-me” and “don’t eat-me” signals. This process is mediated by the inputs provided by surface Calr (“eat-me”) and B2m (“don’t eat-me”), which are driven by ROS and dsRNA-Tlr3 signaling, respectively. In this model, surface Calr governs the macrophage-HSPC interaction, while B2m, a “don’t eat me” signal dictates macrophage’s grooming or dooming behavior.
[0198] B2m is an evolutionarily conserved molecule that positively responds to type I IFN. The interferon family has been reported to break stem cell quiescence and promote asymmetric division (see e.g., Essers et al. Nature 458, 904–908 (2009); Pietras et al. J. Exp. Med.211, 245–262 (2014)) and stimulate embryonic HSC maturation (see e.g., Kim et al. Blood 128, 204–216 (2016)). Type I IFN regulates the Jak-Stat pathway, mediated by STAT1 phosphorylation, resulting in HSCs proliferation and activation. This work expanded the implications of type I IFN as it shows that Tlr3 / dsRNA cascade triggers an interferon (Irf3) response that stimulates the expression of B2m on HSPCs. B2m acts as a “don’t eat-me” signal thereby inhibiting macrophage dooming of HSPCs. It is contemplated herein that these findings on influence of B2m extend beyond the hematopoietic system, impacting tumor-associated macrophages (TAMs) and anti-CD47 treatment efficacy in tumors with high MHC-I. As species like zebrafish that lack CD47 orthologs, this work indicates that B2m as a primitive signal on stem cells for mediating the "don't eat-me" signal in macrophages.
[0199] Described herein is the role of RNA repetitive elements (RE) in regulating stem cell clonality by triggering Tlr3, mimicking a virus response that results in the expression of B2m, a “don’t eat-me” molecule. Other TLRs responses can mediate Calr externalization. For instance, viruses such as flaviviruses (ssRNA, TLR7 / 8) can promote the externalization of Calr, which, in turn, 55 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT is recognized by natural killer (NK) cells. B2m, which curtails macrophage-mediated engulfment, could also attenuate NK cell activity. ERV activation can accelerate the differentiation of HSPCs to immune cells that would help fight infection, providing an evolutionary selection to maintain HSPCs that have endogenous ERV activation. These experiments using the demethylating agent, CM272, demonstrate that de-repression of RE triggers B2m and this is associated with clonal persistence. Patients with myelodysplasia and leukemia are often successfully treated with demethylating agents. It is possible that the therapeutic response is due to RE activation and survival of normal or mutant clones associated with adequate differentiation by the don’t eat-me signal.
[0200] In the development context, REs have been shown to increase expression of RE RNA during endothelial-to-hematopoietic (ETH) transition, where they mediate HSPC formation. isg15+ HSPCs could be responding to REs reminiscent of the ETH process. In this scenario, the RE- harboring HSPCs from ETH would respond to the IFN program permitting the expression of B2m and competition for marrow colonization. This protective mechanism can also operate in adulthood in response to environmental stress, such as during infections or in clonal stem cell disorders, as leukemia. Supporting this hypothesis, the transposable elements expression have been used to accurately predict acute myeloid leukemia (AML) prognosis. B2m could confer protection of myelodysplastic or leukemic clones resulting in the establishment of the diseases. Manipulating the levels of “don’t eat-me” and “eat-me” signals can have therapeutic implications for immune therapy by harnessing the macrophage selective removal of a mutated stem cell clone. Materials and Methods Animal models
[0201] Wildtype zebrafish AB, casper or casper-EKK, and transgenic lines, runx1+23:mCherry, Zebrabow-M draculin:CreERT2, mpeg1:BFP, mpeg1:EGFP, ltr5-EGFP, isg15-EGFP, Calr3a knockout (from ZIRC), irf8 knockout. For the embryonic experiments 3 dpf embryos were used, while the adult experiments were conducted in 4-6 months old fish. Both genders were used for the experiments.
[0202] Wildtype 8-12 weeks old male and female C57BL / 6J mice (JACKSON LABS stock #000664) were also used in this study. All mice were housed in an Animal Facility , and all the experiments and protocols were performed in compliance with institutional guidelines. The animals were kept under ad libitum food and water and euthanized by CO2asphyxiation.
[0203] All animals were housed and handled according to approved Institutional Animal Care and Use Committee (IACUC) protocols. Chemical Screen 56 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0204] HEK293 cells transfected with the SPLIT-Turbo ID constructs were treated with the Sigma Lopac®1280 chemical library and BIOMOL / ICCB bioactive. Chemical libraries were in a 384-well format and were diluted into the 384-well format using robots. The final chemical compound concentration was 5 μM, 2.5 μM and 0.625 μM, in a final treatment volume of 50 μl RPMI supplemented with 10% Fetal Bovine Serum, 1% Glutamine, 1% Pen / Strep and 100 μM Biotin. After 24 hrs, the cells were manually stained with Streptavidin (#405235, BIOLEGEND), A647-ZENON (THERMOFISHER, #Z-25408) conjugated Calreticulin (THERMOFISHER, #PA3-900) and Hoechst (INVITROGEN, #H3570). Screening of inducers and in vivo was performed using a ZEISS CELL DISCOVERER 7 Live / High content equipped with the PRIME 95B camera with control CO2and temperature. CELL PROFILER objected to identification and the R package R sight was used to identify the chemical hits inducing surface Calreticulin. The wells treated with DMSO were used as control. Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells
[0205] The human GeCKO v2 one-plasmid system library was obtained from ADDGENE (cat. number: 52962). This one-plasmid system contains a lenti / Cas9-blast plasmid. The amplification of these plasmids and lentiviral production was performed following the protocol described by Shalem et al. Science 343, 84–87 (2014).
[0206] K562 cells were cultured until 80% confluence and transduced using a spintransfection, in which 100 x 106cells were transferred to a 1.5 mL microtube containing 8 mg / ml polybrene (MILLIPORE, #TR-1003-G) and the lentiviral library. The MOI used for the CRISPR library transduction was of 0.3 to limit multiple lentiviral integration. Then, samples were centrifuged at 1000g for 2h at 34oC. After infection the cells were resuspended in IMDM-10% FBS (Fetal bovine serum Premium, Cat. No #S11150H, Lot. No #F22100) and 1% Glutamine to remove the remaining polybrene and non-transfected virus. After 24 h recovery, puromycin (1 µg / mL) was added to the culture to select the cells carrying the constructs. The cells were kept for 5 days under these conditions.
[0207] After the puromycin selection the cells were centrifuged at 500g for 5 min and resuspended in IMDM-10% supplemented with DMSO (vehicle control) or DL-PPMP (5μM). The cells were stimulated for 24 hrs and 106were kept for baseline correction (Day 0). Then labeled with ZENON-conjugated Calreticulin (A647). The Calr- cells were sorted in the FACSARIA cell sorter (BD BIOSCIENCES). Before FACS sorting, cells were treated with the ZOMBIEDYE (BIOLEGEND) for cell viability. Gecko library preparation
[0208] At the end of the screen, the library preparation was generated by deep sequencing of nested PCR amplicons. In brief, genomic DNA from Calr- sorted cells was extracted with DNEASY 57 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT blood and tissue kit (QIAGEN, 69506). The next-generation sequencing of the amplified sgRNA library was described in Joung et al. Nat. Protoc.12, 828–863 (2017) . Amplification was performed using Phusion® HIGH-FIDELITY PCR Master Mix with HF Buffer (NEB, M0530), with the following conditions: 95°C 5 min, [98°C 20 seconds, 60°C 15 seconds, 72°C 15 seconds] x 18 cycles, followed by 72°C 1 minutes for extension. Then, PCR amplicons were purified on AMPURE beads (BECKMAN COULTER). Mageck Analysis
[0209] The sgRNA read count data from the CRISPR screen experiments were analyzed with MAGeCK package. The mageck count command was employed to preprocess and normalize the data for control and different treatment groups. Then mageck mle command to perform gene essentiality analysis based on the design matrix of treatment vs control, and taking into account for non-Targeting Control Guide. The MAGeCK output file lists the gene summary including ranking of enriched genes. Metascape was used for pathway analysis. Microscopy and image analysis
[0210] Time-lapse microscopy was performed using a YOKOGAWA CSU-X1 spinning disk mounted on an inverted NIKON ECLIPSE TI microscope equipped with dual ANDOR IXON EMCCD cameras and a climate controlled motorized x-y or with the ZEISS CR7 Live / High content equipped with the PRIME 95B camera with control CO2and temperature. Animals were only included for imaging and analysis if expression of all transgenes could be identified. Images were acquired using NIS-ELEMENTS (NIKON) or ZEN BLUE software, blinded, and processed using IMARIS (BITPLANE). Specimens were mounted in 0.4% low melting agarose with tricaine (0.16 mg / ml) in glass bottom and covered with E3 media containing tricaine (0.16 mg / ml). Flow cytometry
[0211] For embryonic stainings 3 dpf tails were chopped with a razor blade in cold PBS and then incubated in LIBERASE (ROCHE) for 30 minutes at 37C̊ before filtering the dissociated cells through a 40 μm filter and transferring to PBS-1% FBS solution.
[0212] To collect adult kidney marrow, adult zebrafish (4-months-old to 6-months-old) were anesthetized with fresh tricaine (0.02%) in E3 fish water and dissected under a LEICA MZ75 light microscope. The kidney marrow was transferred into 1.5 mL microtube containing cold PBS (GIBCO) supplemented with 2% fetal bovine serum (FBS, GEMINI BIO-PRODUCTS) and 1 USP units / mL heparin (SIGMA), and then mechanically dissociated by pipetting. After single cell suspension the sample was passed through a 40-μm nylon mesh 5-10 minutes before FACS acquisition and stained with the ZOMBIE DYE (BIOLEGEND) for cell viability detection. 58 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0213] The CELLROX DEEP RED (INVITROGEN C10422), Annexin V-FITC (BD BIOSCIENCES), JC-1 (BIOTIUM, #30001), MITOTRACKER CMX and zymosan staining were performed according to manufacturer instructions.
[0214] The following antibodies were used for flow cytometry: anti-human B2M (APC / FireTM750, BIOLEGEND, clone 2M2, #A17082A), anti-mouse F480 (AF594, BIOLEGEND, clone BM8, #123140), anti-human CD34 (PeCy7, BD BIOSCIENCE, clone 8G12, #348791), Lineage selection kit (Pacific Blue, BIOLEGEND, CD3, clone 17A2; anti-mouse Ly-6G / Ly-6C, clone RB6- 8C5; anti-mouse CD11b, clone M1 / 70; anti-mouse CD45R / B220, clone RA3-6B2; anti-mouse TER- 119 / Erythroid cells, #133310), anti-mouse CD117 (APC, clone 104D2, BIOLEGEND, S18020A), Sca-1 (PeCy7, BIOLEGEND, clone D7, #108113).
[0215] Flow cytometric analysis was performed on a BD FACSFORTESSA or BD FACS SYMPHONY. Data were analyzed with FLOWJO software version 10. Embryos generation for the chemical screen validation
[0216] For the chemical screen validation, Casper fish were spawned in iSpawns for 15 min, embryos collected into embryo medium (E3) and cleaned using a water gradient for 48 hrs. At 2 dpf the viable embryos were sorted and kept at 25-30 embryos per well into 6-well plates and treated with the 22 Calr-inducers candidates. Zebrabow color labeling
[0217] At 24 hours post-fertilization (hpf), embryos were transferred to 6-well plates at a density of 25-35 embryos per well and treated with 15 μM 4-hydroxytamoxifen (4-OHT) for 3-5 hours in the dark at 28.5°C. Zebrabow analysis was conducted using the zbow software. Only zebrafish with greater than 75% recombination efficiency were processed. Drug treatment
[0218] Drugs were added to embryo E3 media in 6-well plates with 20-30 embryos per well at 48 hpf and incubated for 24 hours. Inducers (see e.g., Tables 1A-1D) were added at a concentration of 50 μM. Diphenylene iodonium (DPI, SIGMA) was added to embryos at a concentration of 100 μM. VAS2870 (SIGMA) was added at a concentration of 20 μM. CM272 (CAYMAN CHEMICALS, #25948) was added at a concentration of 2 μM. Poly I:C (SIGMA) and CU-CPT4a (CAYMAN CHEMICALS, #30951) at a concentration of 50 μM. Morpholino injections
[0219] Tlr3 Morpholino was selected from the zfin database and obtained GENETOOLS. It was resuspended to 300 μM in nuclease free water, heated to 65°C for 5 minutes, and kept at room temperature. Embryos were injected into the yolk at the 1 cell stage with 10 ng of morpholino. Morpholino sequences are listed in Table 3. 59 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Liposome injection
[0220] Zebrafish embryos were dechorionated and anesthetized with tricaine (0.16 mg / ml) on flat agarose disks. Approximately 1.5 nanoliters of liposomes loaded with either clodronate or PBS. Zebrafish EdU Labeling
[0221] Embryonic circulation was injected at 3 dpf with 1 nanoliter of 500μM EdU. Embryos were kept at 4°C for 1 hour, fixed in 4% paraformaldehyde for 1 hour, permeabilized with 0.1% TRITON (2-[4-(2,4,4-trimethylpentan-2-yl)phenoxy]ethanol) for 20 minutes at room temperature, and labeled with ALEXA FLUOR 647 using the CLICK-IT reaction (THERMO FISHER) for 30 minutes according to manufacturer instructions. Embryos were washed with PBS+0.5% TRITON and blocked for 1 hour in 10% Normal Goat Serum, 0.5% Bovine Serum Albumin, 0.5% TRITON. Samples were incubated in Rat anti-mCherry ALEXA FLUOR 594 (INVITROGEN M11240, 1:200, RRID:AB_2536614) for 1 hour at room temperature and washed 5 times with PBS+0.5% TRITON. Double stranded RNA (dsRNA) staining
[0222] Embryos were dissociated in 0.5 mg / mL LIBERASE TM (ROCHE) solution for 30 min at 37 C, then dissociated by pipetting and resuspended in FACS buffer (PBS-1%FBS-1mM EDTA). Cells were then fixed in PFA 4% at 4oC and permeabilized in PBS-0.1 TWEEN (Polysorbate; PBS-T) for 30 min on ice. Cells were washed twice with FACS buffer and incubated overnight with dsRNA anti-mouse J2 mAb (MILLIPORE, #MABE1134) at a concentration of 1 / 100. The next day, three washes were performed in the FACS buffer, following incubation with a secondary antibody (goat anti-mouse IgG1 AF488) 30 min at room temperature. CRISPR-Cas9 mutagenesis
[0223] Target selection for CRISPR / Cas9-mediated mutagenesis was performed using CHOPCHOP) . The selected sgRNA (see e.g., Table 3) having GC-content lower than 55%, self- complementarity=0,MM0=<1, MM1=<1, MM2=<1, MM3<1. The sgRNA templates were generated using the protocol described by Gagnon et al. (“Efficient Mutagenesis by Cas9 Protein-Mediated Oligonucleotide Insertion and Large-Scale Assessment of Single-Guide RNAs” (Preprint 2014), available on the world wide web at doi.org / 10.1371 / journal.pone.0098186) using the mMESSAGE mMACHINETM SP6 Transcription Kit (INVITROGEN, AM1340). The gRNAs were validated using T7 endonuclease I assay in 72 hpf embryos.
[0224] The editing efficiency was further validated by deep sequencing of PCR amplicons. In brief, genomic DNA from zebrafish tissue was extracted with DNEASY blood and tissue kit (QIAGEN, 69506). The CRISPR loci of the targeted genes were amplified using the primers above and barcoded with the ILLUMINA NGS adaptor. Amplification was performed using Phusion® HIGH-FIDELITY PCR Master Mix with HF Buffer (NEB, M0530), with the following conditions: 60 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 98°C 3 minutes, [98°C 10 seconds, T annealing 10 seconds, 72°C 10 seconds] x 35 cycles, 72°C 5 minutes. T annealing was 63°C]. Then, PCR amplicons were purified on PCR purification kit columns prior to sequencing. sgRNA and Cas9 injections
[0225] The gRNAs were resuspended to 1 ng / uL in nuclease free water, protein TRUECUT Cas9 protein (THERMOFISHER, #A36498) was added to the solution and kept at room temperature for 5 minutes. Embryos were injected into the 1 cell stage with 0.2 ng of gRNA. Mutagenesis analysis
[0226] For the analysis the sequencing reads were first trimmed for quality and aligned to the GRCz11 / danRer11 assembly using Bowtie2 with the --very-sensitive setting. Mutations were quantified by the R software CrispRVariants-version 1.20 using a minimum read count of 20. The R version in this analysis was 4.1.0 (2021-05-18). Single-cell RNA-seq analysis
[0227] Repetitive elements sequences from Danio rerio were obtained from RepBase. Sequencing data from Wattrus et al. (Science 377, 1413–1419 (2022)) were then aligned to the repetitive element library using Bowtie2. Reads that are uniquely aligned to the RE were then identified by filtering for mapping qualities greater than 5, and the number of reads aligning to each RE was counted using count features. To identify differentially expressed REs, DESeq2 R package was used. mRNA synthesis and CD34 overexpression
[0228] For the overexpression of human Erv, the respective cDNA was amplified from CD34 cells with PCR and cloned into pJET1.2 / blunt cloning vector (CLONEJET PCR Cloning Kit, THERMOSCIENTIFIC, K1232). The constructs were linearized and used as templates for in vitro mRNA synthesis (T7 mMESSAGE mMACHINE kit, AMBION, AM1344). Cells were electroporated with the LONZA P3 primary solution using the DZ100 program. The Erv genomic location was retrieved from the Dfam database. RNA extraction
[0229] 3 dpf embryos were lysed in TRIZOL (INVITROGEN, #15596026) by mechanical force. To isolate RNA, chloroform was added followed by extraction and precipitation of the aqueous phase using 5 μg of ribonuclease (RNase)–free glycogen and 0.25 ml of isopropanol. The supernatant was discarded and the pellet was washed twice in 80% ethanol and lastly dissolved in 10 μl of H2O. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) 61 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT
[0230] RNA (500 ng) was reversely transcribed into complementary DNA using SUPERSCRIPT VILO RT (THERMO FISHER SCIENTIFIC). RT-qPCR reactions were performed using SYBR Green Master Mix (ROCHE, #4309155); the mix contained 6.25 μl of SYBR, 0.75 μl of primers (forward and reverse, 300 nM), and 4.5 μl of H2O. Mouse cell culture
[0231] Mouse bone marrow derived macrophages (BMDMs) were generated from bone marrow precursors by standard M-CSF culture. The tibia and femora where marrow content was fluxed flushed with cold PBS. The bone marrow suspension was passed through a 40 µm filter and pelted in a centrifuge at 500× g for 5 min. Cells were counted and re-suspended at 2 x 106cells / ml with 10%- FBS, 1% PenStrep-IMDM and 20 ng / ml M-CSF (PEPROTECH). The cell suspension was plated on a 6-well plate and incubated at 37°C, 5% CO2(day 0). On day 3, 5 ml of fresh medium containing 20 ng / ml M-CSF was added on top of the pre-existing medium. Cells were harvested with cold PBS supplemented with 1 mM EDTA at day 5 of differentiation.
[0232] For 3D co-culture, BMDMs were seeded at a concentration of 1 x 105cells / ml with autologous sorted HSPCs (Lineage-Sca1+cKit+, LSK+) in 40% MATRIGEL in a 96-well glass bottom plate. After adding the cells into the MATRIGEL solution the plates were centrifuged for 3 min at 75× g and 4°C to bring the macrophages and HSPCs into the same focal plane for imaging. Plates were then incubated at 37°C for 30 min to ensure complete polymerization of the gel. Samples were then left at room temperature for 10 min before 200 µl of 10%-IMDM medium were added on top of the MATRIGEL. Each well was imaged in 10 min intervals for 2 hr using the ZEISS AIRYSCAN confocal. Macrophage line RAW-274 chemotaxis
[0233] To analyze the -inducers-driven macrophage migration toward chemoattractant, LPS (50 ng / µL), under-agarose chemotaxis assays were used. In brief, agarose gels were cast into 35 × 10-mm tissue culture dishes (CORNING). After gel polymerization, wells with a diameter of 4 mm were punched into the gel in ~3-mm distances using a cartoon template.12 wells were punched in the agarose gel per dish: the left one was loaded with the -inducer treated Raw274 or LPS treated Raw274. The right well was loaded with the chemoattractant. The cells were previously labeled with CELLTRACKER RED following the manufacturer recommendation. Human CD34+ RNAseq analysis
[0234] Human bone marrow single-cell RNA-seq data was downloaded from the Disco database. The cells annotated as HSCs were analyzed for the expression of ISG15. HSCs with expression of at least one UMI of ISG15 were divided into ISG15-low and ISG15-high (i.e. upper quartile of normalized ISG15 expression) cells and analyzed for B2M expression. The gene expressions were 62 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT normalized by total UMI per cell, multiplied by a scale factor of 10,000 and log transformed. Linear mixed effects analysis was performed using the lme4 package (v.1.2-1). ISG15 status was entered as the fixed effect and subjects as random effects. P-values were obtained by likelihood ratio tests of the full model with the fixed effect against the model without the fixed effect. For the correlation of ISG15 expression and TE transcripts, single cell RNA-seq fastq files of bone marrow CD34+ cells from individuals with Calr-mutated essential thrombocythemia were processed using CELL RANGER (v.7.1.0) using chm13v2.0.fa and T2T_CHM13_v2_rmsk_TE.gtf files from T2T- CHM13v2.0 to annotate the aligned reads for TE. HSCs with at least one transcript expression of ISG15 were included to determine the correlation of ISG15 expression versus TE expression (normalized by total UMI per cell; Pearson’s correlation). In vivo Edu staining
[0235] Mice were retro-orbitally injected with 1x EdU (500μM) and DL-PPMP (0.8 mg / kg, CAYMAN CHEMICALS, #17236) or DMSO. After 24 hrs they were anesthetized by vaporized isoflurane (3-4% for induction and 1-2% for maintenance) and sacrificed by cervical dislocation. The bone marrow was isolated from pooled femora and tibia by flushing them with cold phosphate- buffered saline (PBS) containing 2% FCS. Lysis of erythrocytes was performed using ACK Lysing Buffer and the remaining cells were stained with ZOMBIE DYE for viability, anti-Edu as described above anti-B2M (APC-Fire700, 2M2). Data were acquired using an ARIA FACS FUSION II cytometer (BD). Statistical analysis
[0236] Graphs and statistical analyses were done with PRISM (GRAPHPAD) and RSTUDIO. For all graphs, error bars indicate mean + / - standard error (SEM). P values were obtained with two- tailed Student’s t-test, Mann Whitney U-test or One-way ANOVAs for all analyses as indicated. Sample sizes were chosen based on sample availability and power calculations determined from preliminary observations to detect a change of at least 33% with an α of 0.05 and a β of 0.8. For all experiments except Zebrabow color labeling, a randomized set of embryos from a mixture of clutches was split into control and perturbation conditions. All experiments were repeated at least once. Data and materials availability
[0237] The RNAseq data were deposited at Sequence Read Archive (SRA) submission numbers: SRR28470429, SRR28470426, SRR28470427, SRR28470424, SRR28470428, SRR28470425 (PRJNA1092543), the contents of which are incorporated herein by reference in their entireties. Tables
[0238] Tables 1A-1D: 93 Calr inducers (see e.g., Table 1A), the compounds that also promote higher interaction ratios of macrophage-HSPCs (see e.g., Table 1B) and the statistical analysis for the 63 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT macrophage-HSPCs interaction evaluation (see e.g., Tables 1C-1D). Table 2: MAGECK result for the CRISPR-Cas9 screen, guides found in the DMSO group (data not shown); DL-PPMP treated cells (Tab2) and CALR / TLR3 enrichment values for DL-PPMP and Bongkreic acid (data not shown); CALR / TLR3 enrichment values for DL-PPMP and Bongkreic acid.. Table 3: Reagents, primers, sgRNAs and oligos used in this Example. Table 1A: Exemplary Calr inducers Calr inducer Description (¬±)-8-Hydroxy-DPAT6 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Dihydrosphingosine Sphingolipid pathway intermediate DL-threo-PPMP is a ceramide analog and an inhibitor of l er65 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT m-Iodobenzylguanidine hemisulfate A norepinephrine analogue with anticancer activityTable 1B: Compounds that significantly promoted higher interaction ratios of macrophage-HSPCs Dunnett's Cm nd Offiil m lti l M n 95.00 Below Si Adjust Ann e O C( N C O66 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 0.0177 0 - C (C O) C) (C C( = 1 ( 2= C C 3) O C C = O = = C C C( C C 1) C( 2C )( O C C( O C (C ) C 2 = 3 O C C O) (F67 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Fenspirid - C1CN(CCC ROSdepend e control vs. - 0.5231 A hi 12CNC(=O) h hl F 1 to -Yes***0.0006stamine H1 O2)CCC3= 3 (C = C = P( O C C C (C = = C) C 1) 2) = l) C C C O) C O) O68 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Due to PPMP’s ability to C C C( C C 2) ( C C( 3 4= 469 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Acyclovir is a guanosine C( O N C C N O)70 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Docosahex aenoic acid (DHA) = = = )71 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Flufenamic acid is a f ( = = C FTable 1C: Statistical analysis for the macrophage-HSPCs interaction evaluation Dunnett's 95.00% Offi i l multiple Mean CI f BelowS ry72 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT -0.2216 Actinomycin D -0.04361 to No ns 0.999 0134473 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT -0.3187 CP-471474 -0.09629 to No ns 0.9912 0126174 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Guanfacine -0.2793 hydrochloride0.01587to No ns 0.9998 0311075 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT -0.5105 MG-132 -0.2565 to - Yes * 0.0452 000251476 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT -0.3155 U-74389G -0.1187 to No ns 0.8005 007800Table 1D: Significant enriched pathways for ROS+ compounds -Log(p- KEGG pathways value) 7 2 5 5 5 8 2Table 2: CALR / TLR3 enrichment values for DL-PPMP and Bongkreic acid. Gene sgRNA beta z p-value 4 14886-7841-5570.5Attorney Docket No: 701039-000129WOPT Bongkreic acid CALR 6 0.81953 2.2542 0.028944 3Table 3: Reagents, primers, sgRNAs and oligos used in this Example. Name Sequence SEQID NOT ID78 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT tlr3_R AACTCAGAGAAGCCACGAAAAG 18 CCTCCATACGATTTAGGTGACACTATAGGCATTGA4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Zebrafish_ERV1-10_DR- LTR#LTR / ERV1_FTGAGGTGGATTTTGTGCTCTTTGG 4080 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Zebrafish_ERV1-10_DR- LTR#LTR / ERV1_RTGTAAGATTTCCCCTATATTAGGCACCAGA 2781 4886-7841-5570.5
Claims
Attorney Docket No: 701039-000129WOPT CLAIMS What is claimed herein is:
1. A method of treating a disease or disorder associated with hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
2. The method of claim 1, wherein the TLR3 inhibitor is selected from the group consisting of: CUCPT4a (Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII).
3. The method of claim 1 or 2, wherein the TLR3 inhibitor is CUCPT4a.
4. The method of claim 1 or 2, wherein the disease or disorder associated with increased HSPC proliferation is selected from the group consisting of: clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, and a leukemia.
5. The method of claim 4, wherein the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL).
6. The method of any one of claims 1-5, wherein the TLR3 inhibitor decreases or inhibits TLR3 interaction with double-stranded RNA (dsRNA).
7. The method of any one of claims 1-6, wherein the TLR3 inhibitor decreases or inhibits TLR3- induced Interferon regulatory factor 3 (Irf3) cellular signalling in hematopoietic stem cells (HSPCs).
8. The method of claim 7, wherein the decreased or inhibited TLR3-induced cellular signalling decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs.
9. The method of claim 8, wherein the decreased or inhibited B2M expression increases macrophage phagocytosis of the HSPCs.
10. The method of claim 9, wherein the increased macrophage phagocytosis of the HSPCs decreases the HSPCs proliferating.
11. The method of any one of claims 1-10, wherein the TLR3 inhibitor decreases or inhibits Beta 2 Microglobulin (B2M) expression on the cell surface of the HSPCs. 82 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 12. The method of any one of claims 1-11, wherein the TLR3 inhibitor increases macrophage phagocytosis of the HSPCs.
13. The method of any one of claims 1-12, wherein the TLR3 inhibitor decreases the HSPCs proliferating.
14. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor.
15. The method of claim 14, wherein the TLR3 inhibitor is selected from the group consisting of: CUCPT4a, Formula I), T5260630 (Formula II), T5626448 (Formula III), Formula IV, Formula V, SMU-CX1 (Formula VI), a TLR3 morpholino (e.g., SEQ ID NO: 26), a TLR3 CRISPR guide RNA (e.g., SEQ ID NO: 62), Enpatoran (Formula VII), and TLR7-IN-1 (Formula VIII).
16. The method of claim 14 or 15, wherein the TLR3 inhibitor is CUCPT4a.
17. The method of any one of claims 14-16, wherein the disease or disorder associated with increased HSPC proliferation is selected from the group consisting of: clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, and a leukemia.
18. The method of claim 17, wherein the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL).
19. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof an effective amount of CUCPT4a.
20. The method of claim 19, wherein the leukemia is selected from the group consisting of: Acute myeloid leukemia (AML), Chronic lymphocytic leukemia (CLL), Chronic myeloid leukemia (CML), B-Cell prolymphocytic leukemia (B-PLL), Blastic plasmacytoid dendritic cell neoplasm (BPDCN), Chronic myelomonocytic leukemia (CMML), Hairy cell leukemia, Juvenile myelomonocytic leukemia (JMML), Large granular lymphocytic leukemia (LGLL), and T-cell prolymphocytic leukemia (T-PLL).
21. A method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof an effective amount of a Toll-like receptor 3 (TLR3) inhibitor. 83 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT 22. A method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
23. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
24. A method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3).
25. A method of treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a) a means of inhibiting Toll-like receptor 3 (TLR3); and b) a means for diluting or stabilizing the means of inhibiting TLR3.
26. A method of treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia, the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a) a means of inhibiting Toll-like receptor 3 (TLR3); and b) a means for diluting or stabilizing the means of inhibiting TLR3.
27. A method of decreasing or inhibiting Beta 2 Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs), the method comprising administering to a subject in need thereof a pharmaceutical composition comprising: a) a means of inhibiting Toll-like receptor 3 (TLR3); and b) a means for diluting or stabilizing the means of inhibiting TLR3.
28. A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating a disease or disorder associated with increased hematopoietic stem and progenitor cell (HSPC) proliferation.
29. A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of treatment for treating clonal hematopoiesis, myelodysplastic syndrome (MDS), myeloma, or a leukemia.
30. A method comprising administering a pharmaceutical composition comprising a means of inhibiting Toll-like receptor 3 (TLR3) to a subject in need of decreasing or inhibiting Beta 2 84 4886-7841-5570.5Attorney Docket No: 701039-000129WOPT Microglobulin (B2M) expression on the cell surface of hematopoietic stem and progenitor cell (HSPCs). 85 4886-7841-5570.5