Gold nanoparticles functionalized with the crispr / cas system, compositions including them and their uses

EP4766821A1Pending Publication Date: 2026-07-01UNIV DI PISA +1

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
UNIV DI PISA
Filing Date
2024-08-21
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current methods for delivering the CRISPR/Cas system for genome editing, such as using adeno-associated viruses (AAVs), face limitations including limited packaging capacity, potential off-targets, toxicity, and high costs, making them inefficient and expensive for therapeutic applications.

Method used

The development of gold nanoparticles functionalized with the CRISPR/Cas system, which can bind Cas family proteins with high efficiency, are stable in aqueous environments, efficiently internalized by cells, and capable of reaching the nucleus and mitochondria, thereby facilitating genome editing without the need for viral vectors.

Benefits of technology

These gold nanoparticle-based nanocomplexes enable efficient and targeted delivery of the CRISPR/Cas system, reducing off-target effects and costs, while allowing for multitargeting and intravenous administration, making genome editing more accessible and economically sustainable.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IB2024058123_06032025_PF_FP_ABST
    Figure IB2024058123_06032025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to nanocomplexes comprising functionalized gold nanoparticles for the delivery of genome editing systems, genome editing systems, compositions comprising them and their uses. Furthermore, the present invention relates to the process for the functionalization of said nanoparticles and the preparation of said nanocomplexes.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] GOLD NANOPARTICLES FUNCTIONALIZED WITH THE CRISPR / CAS SYSTEM, COMPOSITIONS INCLUDING THEM AND THEIR USES

[0002] The present invention relates to nanocomplexes comprising functionalized gold nanoparticles for the delivery of genome editing systems, genome editing systems, compositions comprising them and their uses. Furthermore, the present invention relates to the process for the functionalization of said nanoparticles and the preparation of said nanocomplexes.

[0003] STATE OF THE TECHNOLOGY

[0004] The CRISPR-Cas system is a genome editing technology based on the use of a nuclease called Cas, transcribed from CAS genes (CRISPR-associated), and a single-stranded RNA molecule, the so-called guide RNA (gRNA), which associate to form the gRNA / Cas ribonucleoprotein. The Cas enzyme is a nuclease, capable of making a double-stranded cut at a specific position in a genomic DNA molecule. Typically, the gRNA guides the Cas protein to the genomic site of interest while the Cas protein is responsible for the helicase activity in order to form a DNA / RNA hybrid between gRNA and the target genomic DNA and nuclease activity, i.e. to make a double-stranded cut. Generally, the gRNA can be designed in such a way as to contain a nucleotide sequence that binds to the Cas nuclease, the so-called “scaffold” sequence, and a sequence that is able to recognize and pair with a specific DNA target sequence. This means that, at least in principle, the gRNA directs the Cas enzyme to cut only the target sequence and not other regions of the genome. Several systems are available in the literature to decrease the frequency of off-target cuts by the Cas endonuclease.

[0005] The CRISPR / Cas system, therefore, includes engineered nucleases used, for example, for genome editing to induce gene knock-out or gene knock-in. Recently, the CRISPR / Cas system has also been used for interference, base editing, prime editing, etc. The ability to directly intervene in the genome of interest (such as the genome of a patient affected by a genetic disease) would enable the development of countless new drugs, as well as the treatment of previously incurable diseases and "hopeless" patients. Currently, there are only 26 ongoing clinical trials testing the use of the Cas9:gRNA system as a new therapeutic modality to perform gene therapy in humans. The actual cost of the CRISPR / Cas drug for the patient is approximately 2.1 M$.

[0006] For therapeutic purposes, drug delivery systems that do not use viral vectors are of course preferable. One of the most widely used strategies for CRISPR / Cas9 delivery is based on the use of adeno-associated viruses (AAV). Although AAVs represent an excellent platform for gene therapy due to their high transduction efficiency and very low immunogenicity, they show important limitations: i) limited packaging capacity, equal to about 4.7 Kb, ii) potential off-targets due to insertional mutagenesis and iii) toxicity due to long-term expression of Cas9 in transduced cells.

[0007] For all these reasons, AAVs are used for local administration (an interesting example of this application is EDIT-101 , an AAV5-CRISPR / Cas9-directed therapy, administered by subretinal injection for the treatment of Leber congenital amaurosis type 10, NCT03872479) or ex vivo approaches , techniques that consist in the isolation of the patient's cells, their editing and subsequent transfusion to the patient from which they come (autologous transplantation), or to a different patient (heterologous transplantation) (this strategy, for example, has been adopted in the treatment of severe sickle cell anemia (SCD) and immunotherapy with p -thalassemia (TDT) or transfusion-dependent CAR-T cells). Although ex vivo approaches produce important benefits, as they do not directly expose the patient to the gene-editing tool and allow external quality control of the modified cells before their reintroduction, their application is limited to specific cell types and a limited number of diseases.

[0008] Furthermore, the current financial impact of gene therapy has been estimated at $2.1 million per patient (https: / / doi.org / 10.1101 / 2020.10.27.20220871). The high cost is mainly associated with the cost of viral vectors or the cost of cell isolation, manipulation and reimplantation that requires GMP (good manufacturing practice) conditions. Therefore, all those systems that allow the replacement of viral vectors with non-viral alternatives wherein the drug can be optimized for intravenous administration (such as nanoformulations based on lipid nanoparticles, LNP) are of great importance. The development of systems that significantly reduce the costs of drug production will make the use of CRISPR / Cas technology economically sustainable for all national health systems, including developing countries.

[0009] The CRISPR / Cas machinery can be delivered in the form of nucleic acids (plasmid, mRNA) or in the form of ribonucleoprotein (RNP). Although the administration of a plasmid encoding Cas9 and gRNA generally allows for robust and stable expression, the administration of the CRISPR / Cas9 machinery in the form of RNP offers important advantages especially in terms of safety, a key element for medical applications. Indeed, once inside the cell, the already assembled RNP complex allows for rapid action, resulting in high efficiency in genome editing. It is important to highlight that the complex in the form of RNP has a short period of activity of a few hours due to its short half-life that allows for rapid elimination. Conversely, when administered in the form of nucleic acids, the complex will persist as long as it is expressed in target cells: the increased longevity of the gene-editing mechanism is directly associated with a higher incidence of off-target activity, high immunogenicity and cytotoxicity [doi: 10.1002 / jgm.3107], The size of Cas9 together with its sgRNA is about 4.2 Kb. Given the limited content capacity of viral vectors, the simultaneous expression of multiple guides targeting different loci would be impossible. It is of obvious interest to be able to use systems that do not place limits on the number of different guides that would allow for simultaneous targeting of multiple loci.

[0010] The CRISPR / Cas machinery must also be able to cross cellular barriers. The delivery strategy must take into account biological barriers such as the cell membrane and nuclear membrane, as well as the route of drug entry into the cell and its intracellular trafficking (i.e. , endosomes, lysosomes).

[0011] Patent application W02020152573 describes light-activated nanoformulations specifically designed to absorb laser radiation and convert it into heating, enabling the use of the catalytically inactivated Cas9 (dCas9) enzyme, where the heating generated by the nanoformulations can be used to activate a thermophilic nuclease or to induce a double-strand break (DSB) significantly decreasing the off-target activity of the system. Furthermore, in the system described in W02020152573, since the gene-editing activity occurs only after switching on the laser radiation, it is expected that only the irradiated cells will be modified. This increases the safety profile of the drug that is activatable.

[0012] However, the nanoformulations described in W02020152573 have proven to be unstable as they precipitate in an aqueous environment, enter cells with difficulty and when they enter cells they precipitate in the form of clusters and are therefore not efficiently usable by cells.

[0013] SUMMARY OF THE INVENTION

[0014] The present invention provides particular gold nanoparticles, functionalized with the CRISPR / Cas system that are able to bind any protein of the Cas family with an efficiency of at least one enzyme molecule per nanoparticle, are stable for at least three weeks in an aqueous environment, are internalized with very high efficiency by cells, are present in the cells in a mono-disperse state (therefore in the form of single nanoparticles that do not form aggregates) and that are able to reach the nucleus and , optionally, the mitochondria.

[0015] As evident from the figures, especially from 9 to 13, even small changes in the functionalization of gold nanoparticles can give surprising technical effects with respect to the internalization into cells by nanocomplexes with said nanoparticles. The inventors surprisingly found that nanoparticles functionalized with a -NH2 background (as described below) are able to be internalized by cells more efficiently than nanoparticles functionalized with a -COOH background, but, even more surprisingly and completely unexpectedly, the nanoparticles functionalized with a -NH2 background , once also complexed with Cas, were internalized by cells with an efficiency of 100% compared to an internalization efficiency of about 20% of the same nanoparticles without Cas.

[0016] In contrast, as shown in Fig. 9, nanoparticles functionalized with a -COOH background are internalized less efficiently and, more importantly, are present in the cell in the form of clusters. Since the clusters are not able to localize in the nuclei or mitochondria, the nanoparticles so functionalized cannot be used for gene editing. Furthermore, the nanoparticles of the invention are able to absorb laser radiation and convert it into heating, thus allowing the activation of thermophilic endonucleases or the generation, when used in specific systems allowing the physical proximity of two nanoparticles, of DSBs at specific DNA sites.

[0017] The invention therefore covers:

[0018] • A nanocomplex comprising a gold nanoparticle whose surface is functionalized with at least one group having the following formula I:

[0019] W- R1-X-NH-Y-Ni2+-Z, wherein:

[0020] -W is a sulfide group (-S-), or an N-heterocyclic carbene group (NHC) R1is a C2 -C18 alkyl chain;

[0021] X is a spacer consisting of a polymeric chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate ;

[0022] Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED)

[0023] Z is selected between a recombinant protein of the Cas family, including dCas or other known Cas variants, fused at the C terminus or N terminus to a histidine tag or

[0024] • a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family, including dCas or other known Cas variants fused at the C terminus or N terminus to a histidine tag, a single-stranded gRNA guide RNA molecule comprising from the 3' end to the 5' end a nucleotide sequence suitable for binding said Cas protein, and a nucleotide sequence suitable for hybridizing to a target genomic sequence.

[0025] • An in vitro genome editing process involving the passage of

[0026] - incubating a target cell with the nanocomplex, genome editing system or composition as described and claimed herein.

[0027] • A process for the preparation of a nanocomplex as defined in the description and claims comprising the following steps: i) add a solution of (W-R1-X-NH2)n , where n is 1 and when n is 1 W is thiol (HS) or N-heterocyclic carbene (NHC) and when n is 2 W is S,

[0028] R1is a C2 -C18 alkyl chain;

[0029] X is a spacer consisting of a polymeric chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate; to a solution of gold nanoparticles in the form of nanorods or spherical and perform dialysis against water thus obtaining a solution of AuNP-W-R1-X-NH2 functionalized nanoparticles where W is -S or N-heterocyclic carbene ii) add to the solution obtained in point i) a) a solution of sulfo-GMBS e b) a solution of HSC3 -Y wherein Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED) and perform dialysis against water thus obtaining a solution of functionalized AuNP-W- R1-X-NH-Y nanoparticles, iii) add to the solution obtained in point ii) a nickel salt solution thus obtaining AuNP-SR1-X-NH-Y-Ni2+functionalized nanoparticles iv) add to the solution obtained in point iii) a solution comprising Z as defined above in the solution in point iii); v) add to the solution obtained in point iv) a suspension of Ni-Y agarose resin, centrifuge and collect the gold nanoparticle solution, obtaining a solution of AuNP-WR1-X-NH-Y- Ni2+-Z; and wherein, when Z does not include the guide RNA, the process comprises a further step vii) adding to the solution obtained in point vi) the guide RNA to obtain a solution of AuNP-W-R1- XNH-Y-Ni2+-Z wherein Z is a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family, including dCas or other known Cas variants, a single-stranded gRNA guide RNA molecule comprising from the 3' end to the 5' end a nucleotide sequence suitable for binding said Cas protein and a nucleotide sequence suitable for hybridising to a target genomic sequence (also indicated as Cas:gRNA);

[0030] • A genome editing system comprising nanocomplexes as described and claimed herein;

[0031] • A pharmaceutical composition comprising nanocomplexes or the genome editing system as described and claimed herein;

[0032] • A genome editing system comprising at least two nanocomplexes as described above which differ from each other in the nucleotide sequence capable of hybridizing to a target genomic sequence of said gRNA, said complexes being capable of forming a dimer whose gold nanoparticles are capable of sustaining a surface plasmon resonance capable of generating a temperature increase of at least 80°C on their surface when the dimer composed of said at least two nanocomplexes is exposed to electromagnetic radiation resonant with said dimer at a wavelength in the range between 300 nm and 2 pm ;

[0033] • A pharmaceutical formulation comprising nanocomplexes as described and defined in the description and claims and at least one pharmaceutically acceptable carrier or excipient or genome editing system as described and claimed for use as a medicament or for use in the therapeutic treatment of a patient in need thereof.

[0034] • A therapeutic method by genome editing comprising the administration by injection of a pharmaceutical composition comprising the nanocomplex, editing system or formulation as described and claimed to a patient in need of genome editing therapy. viii) optionally add 50% glycerol. Adding glycerol is advantageous for storage.

[0035] The nanocomplexes of the invention therefore allow an advantageous administration strategy of the CRISPR / Cas system for genome editing without the use of viral vectors, with a consequent possible reduction in therapeutic costs. Furthermore, advantageously, the enzyme is administered in the form of ribonucleoprotein and is not synthesized in the target cell. The absence of viral vectors also allows for a multitargeting approach (gRNA with different nucleotide sequences capable of hybridizing to more than one target genomic sequence) without the load limitations associated with viral vectors. Finally, the nanocomplexes of the invention are able to spontaneously cross the cell membrane and localize in the nucleus and mitochondria without the need for particular drug delivery systems, thus also paving the way for the therapeutic treatment of genetic diseases, including mitochondrial diseases, and cancer.

[0036] GLOSSARY

[0037] In the present description, the term “nanocomplex” refers to a complex consisting of gold nanoparticles functionalized with alkyl or polymer chains and a Cas enzyme, optionally linked to gRNA and / or other molecules, e.g. a preferably thermophilic endonuclease.

[0038] In this specification, the term “gold nanoparticle”, or “AuNP” means a nanosized gold particle, in the form of a sphere or nanorod, where at least one dimension is smaller than 100 nm, preferably wherein the spherical shaped nanoparticle has a diameter between 2 and 40 nm and the nanorod shaped nanoparticle has one, preferably two, dimensions between 2 and 60 nm.

[0039] In the present description, the term “nanorod” refers to a particular form of gold nanoparticles characterized by a length greater than their diameter, which gives them an elongated shape similar to that of a rod or a nanotube.

[0040] In the present description, the term “functionalized surface” means a gold nanoparticle surface covalently linked to at least one specific functional group.

[0041] In the present description, the term “alkyl chain” has the meaning commonly used in the art and means a chain of carbon atoms linked together by single, saturated covalent bonds with hydrogen atoms.

[0042] In the present description, the term “polymer chain” has the meaning commonly used in the sector and refers to a molecule consisting of a repetition of structural units (monomeric units).

[0043] In the present description, the term “degree of polymerization” refers to the number (n) of repeating monomer units present in a polymer chain.

[0044] In this specification, the term “recombinant Cas protein” has the meaning commonly used in the industry and means any protein of the Cas family (CRISPR associated protein) produced by genetic engineering including dCas proteins.

[0045] In the present description, the term “recombinant dCas protein” has the meaning commonly used in the field and is intended to mean any protein of the Cas family deprived of the ability to cut DNA, produced by genetic engineering. In this specification, the term “histidine tag” has the meaning commonly used in the art and means a peptide consisting of an oligomerization of amino acid residues containing a histidine sequence, used for the purification of proteins by affinity chromatography.

[0046] In the present description, the expression “said Cas protein is conjugated to a histidine tag” means that the Cas protein is covalently linked to the histidine tag.

[0047] In the present description, the term “inorganic core” refers to the core of the gold nanoparticle, i.e. the part not exposed to functionalization with other molecules.

[0048] In the present description, the term “gRNA” has the meaning commonly used in the field and refers to a single-stranded RNA molecule, the so-called guide RNA, which associates to form the gRNA / Cas ribonucleoprotein and which typically guides the nuclease to the genomic site of interest.

[0049] In the present description, the term “genome editing” has the meaning commonly used in the field and refers to the controlled modification of DNA within an organism, using tools such as the CRISPR-Cas system.

[0050] In the present description, the term “dialysis against water” refers to a purification process of gold nanoparticles (optionally functionalized) by removing salts and buffers present in the synthesis solution using a dialysis membrane and using water as a solvent. In the present description, the term “sulfo-NHS” refers to the compound “N- hydroxysulfosuccinimide”, having the formula:

[0051] In the present description, the term “sulfo-GMBS” refers to the compound “N-y- maleimidobutyryl-oxysulfosuccinimide ester” having the formula:

[0052] In the present description, the term “HSC3-NTA” or “NTA thiolated ligand” refers to a thiol (HS-) ending with NTA (nitrilotriacetic acid), i.e. the final product obtained from the reaction:

[0053]

[0054] In the present description, the term “Ni-Y agarose resin” wherein Y is as defined above, means an agarose resin capable of binding proteins that have a histidine tail (e.g. ThermoFisher Scientific resin, 88221).

[0055] In the present description, the term “MWCO” or “Molecular weight cut-off’ refers to a physical characteristic of dialysis membranes used to separate molecules based on their molecular weight. The MWCO indicates the maximum size of molecules that can pass through the membrane, with molecules of a higher molecular weight being retained. For example, if a membrane has a MWCO of 10 kDa (kilodaltons), molecules with a molecular weight greater than 10 kDa will be retained, while molecules less than 10 kDa will be allowed to pass through the membrane.

[0056] In the present description, the term “gold grains” refers to gold particles of nanometer size. In the present description, the term “HS-R1-PEG-NH2 ” refers to a thiolated peg chain, having a terminal NH 2 group.

[0057] In the present description, the term “AuNP-S-R1-PEG-NH2” refers to a gold nanoparticle (spherical or nanorod) functionalized through a disulfide bridge with a thiolated peg chain having a terminal NH2 group. In the present description, the term “AuNP-S-R1-PEG-NH-NTA” refers to a gold nanoparticle (spherical or nanorod) functionalized through a disulfide bridge with a thiolated PEG chain having a terminal NH2group, wherein a fraction of the terminal NH2 groups is further functionalized with NTA, while the term “AU_12_PEG3000NTA_N” always refers to the molecule “AuNP-S-R1-PEG-NH-NTA”, wherein the PEG specifically has a molecular weight of about 2800-3300 Da and the gold nanoparticles have a diameter of about 12 nm, and the term “AU_NR_PEG3000NTA_N” always refers to the molecule “AuNP-S-R1-PEG-NH-NTA”, wherein the PEG specifically has a molecular weight of about 2800-3300 Da and the gold nanoparticles have a diameter of about 12 nm. of gold they are nanorods.

[0058] In the present description, the term “AuNP-S-R1-PEG-NH-NTA Ni2+” refers to a gold nanoparticle functionalized through a disulfide bridge with a thiolated PEG chain having a terminal NH2group, wherein a fraction of the terminal NH2group is further functionalized with NTA and Ni2+wherein Ni2+is bonded to NTA while the term “AU_12_PEG3000NTA_N Ni2+” always refers to the molecule “AuNP-S-R1-PEG-NH- NTA Ni2+”, wherein the PEG specifically has a molecular weight of about 2800-3300 Da and the gold nanoparticles have a diameter of about 12 nm and the term “AU_NR_PEG3000NTA_N Ni2+” always refers to the molecule “AuNP-SR1-PEG-NH- NTA Ni2+”, wherein PEG specifically has a molecular weight of around 2800-3300 Da and the gold nanoparticles are nanorods.

[0059] In the present description, the term “AuNP-S-R1-PEG-NH-NTA Ni2+-Cas” refers to a gold nanoparticle functionalized through a disulfide bridge with a thiolated peg chain having a terminal NH2group , wherein a fraction of terminal NH2groups is further functionalized with NTA and Ni2+and Cas, wherein Ni2+is linked to NTA and Cas is linked via the histidine tag to Ni2+while the term “AU_12_PEG3000NTA_N Ni2+Cas9” or AU_12_PEG3000NTA_N-Cas9” refers to the same complex but with gold nanoparticles of 12nm diameter and PEG with MW of about 2800-3300 Da and the term “AU_NR_PEG3000NTA_N Ni2+Cas9” or “AU_NR_PEG3000NTA_N-Cas9” refers to the same complex but with nanorods and PEG with MW of about 2800-3300 Da.

[0060] In the present invention, the term “AU_12_PEG3000NTA_C” refers to gold nanoparticles functionalized through a disulfide bridge with a thiolated PEG chain having a terminal COOH group, wherein a fraction of terminal COOH groups is further functionalized with NTA, and are gold nanoparticles having a diameter of 12 nm and with PEG with MW of about 2800-3300 Da, while the term AU_12_PEG3000NTA_C Ni2+Cas9 refers to the same complex wherein Ni2+is linked to NTA and Cas is linked via the histidine tag to Ni2+In the present description, the abbreviation “AuNP:NTA.N-Cas9” refers to

[0061] AU_12_PEG3000NTA_N Ni2+Cas9

[0062] In the present description, the abbreviation “AuNP:NTA.C-Cas9” refers to

[0063] AU_12_PEG3000NTA_C Ni2+Cas9

[0064] In the present description, the abbreviation “AuNP:NTA.N-Cas9:gRNA” refers to AU_12_PEG3000NTA_N Ni2+Cas9 complexed with the guide RNA. In the present description, the abbreviation “AuNR-Cas9:gRNA5” refers to

[0065] AU_NR_PEG3000NTA_N-Cas9 complexed with gRNA which has SEQ ID NO 3

[0066] In the present description, the abbreviation “AuNR-Cas9:gRNA1” refers to

[0067] AU_NR_PEG3000NTA_N-Cas9 complexed with the gRNA having SEQ ID NO 2

[0068] In the present description, the term “background-NH2” refers to the gold nanoparticle functionalized with HS-R1-PEG-NH2

[0069] In the present description, the term “background-COOH” refers to the gold nanoparticle functionalized with HS-R1-PEG-COOH

[0070] DETAILED DESCRIPTION OF THE FIGURES

[0071] Figure 1 shows a scheme of the conjugated nanoparticles according to the invention.

[0072] Figure 2 shows the size distribution of the spherical nanoparticle AU_12_PEG3000NTA_N.

[0073] Figure 3 shows the UV-Visible spectra of the spherical nanoparticles AU_12_PEG3000NTA_N.

[0074] Figure 4 shows the TEM image of AU_12_PEG3000NTA_N spherical nanoparticles.

[0075] Figure 5 shows the size distribution of the spherical nanoparticle AU_12_PEG3000NTA_C.

[0076] Figure 6 shows the TEM image of AU_NR_PEG3000NTA_N nanorods.

[0077] Figure 7 shows the result of endonuclease activity analysis of AU_12_PEG3000NTA_N and AU_12_PEG3000NTA_C nanoparticles functionalized with Cas9:gRNA2 (indicated in the figure as AuNP:NTA.N-Cas9:gRNA2 and AuNP:NTA.C-Cas9:gRNA2, respectively) and the cleavage efficiency of AuNPs (spherical) with NTA ligand: COOH vs NH2 background.

[0078] Panel A shows the cleavage scheme showing the size of the bands obtainable from the digestion of gRNA2 (SEQ ID NO 2), 315 and 929 base pairs, respectively. Panel B shows agarose gels obtained following the incubation of DNA with gRNA2 (SEQ ID NO 2) (and its complementary strand) incubated respectively: in the left panel with decreasing amounts of Cas9:gRNA2 and with decreasing amounts of AuNP:NTA.N-Cas9:gRNA2 and in the right panel with increasing amounts of Cas9:gRNA2 and AuNP:NTA.C-Cas9:gRNA2. As evident from the figure, the AuNP:NTA.N-Cas9:gRNA2 nanoparticles show, at the highest concentrations (150 and 100 nM) the same efficiency as Cas9:gRNA2 while the AuNP:NTA.C-Cas9:gRNA2 nanoparticles were less efficient even at the highest concentrations. In each gel there is also a control band with untreated DNA (CTRL).

[0079] Panel C shows the histogram representation (the histograms show the intensity of the uncleaved DNA bands of the panel, normalized with respect to the CTRL group) B) and the relative statistical significance. Statistical analysis was performed with 2-way ANOVA (Tukey test: For the analysis, the uncleaved DNA of all samples is considered (DNA band corresponding to 1274 bp). All treatments are compared with the untreated DNA corresponding to the CTRL signal in the agarose gels. In particular, the Rel. intensities shown in graph C are the values obtained when the CTRL intensity corresponds to 1 .

[0080] As evident from the graph, the difference between the cleavage efficiency of Cas9:gRNA2 and AuNP:NTA.N-Cas9:gRNA2 at 150 and 100 nM each was not significant, while the cleavage efficiency of Cas9:gRNA2 and AuNP:NTA.C-Cas9:gRNA2 was significantly less efficient at any concentration tested.

[0081] Figure 8 shows a TEM image of A375 human melanoma cells incubated with AU_12_PEG3000NTA_C 7x1011NPs / ml for 2 hours. As can be seen from the figure, the nanoparticles showed a low tendency to enter the cells wherein, moreover, they were visualized as nanoparticle agglomerates in the cytoplasm. Similar results (not shown) were obtained with the same nanoparticles functionalized with Cas9:gRNA4 (AuNP:NTA.C-Cas9:gRNA4) (SEQ ID NO 4). In the enlarged inset at the bottom right, the nanoparticles in agglomerate are visible.

[0082] Figure 9 A-C shows TEM images of human melanoma A375 cells incubated with AU_12_PEG3000NTA_N 7x1011NPs / ml for 5 h, the nanoparticles are visible inside the cells as monodispersed particles in vesicles (A), in the cytoplasm (B) and (B1), and in the nucleus (C). Only 20% of the cells were positive for nanoparticle internalization.

[0083] Figure 10 (both panels) shows TEM images following incubation of A357 melanoma cells incubated with Cas9-functionalized AU_12_PEG3000NTA_N nanoparticles (AuNP:NTA.N-Cas9: gRNA4, 7x1011NPs / ml) for 5 hours leading to 100% internalization of the cells. The nanoparticles were found to be monodisperse in the extracellular space wherein they interact with the cell membrane.

[0084] Figure 11 (both panels) shows (TEM images) that AuNP:NTA.N-Cas9:gRNA4 nanoparticles incubated as reported for Figure 11 , localize in the intracellular space and that they do not form clusters even when confined in vesicles such as endosomes, endolysosomes or autophagosomes. Figure 12 shows (TEM image) that the AuNP:NTA.N-Cas9:gRNA4 nanoparticles incubated as reported in Figures 11 and 12 are localizable in vesicles or free in the cytoplasm where they can interact with the endoplasmic reticulum or mitochondria.

[0085] Figure 13 A shows confocal fluorescence microscopy images showing the localization of Cas9 in A357 melanoma cells incubated with AuNP:NTA.N-Cas9:gRNA4a compared with the localization of Cas9 in A357 melanoma cells.

[0086] - treated with Cas9:gRNA4 and transfected with Thermofisher's RNAiMAX (gold standard of lipofection),

[0087] - treated with Cas9:gRNA4 alone

[0088] - not treated (CTRL).

[0089] The figure shows that AuNP:NTA.N-Cas9:gRNA4 nanoparticles are able to enter the nucleus of A375 cells with similar or even better efficiency than that achieved with the gold standard RNAiMAX from Thermofisher.

[0090] Figure 13 B shows the histograms related to Figure 14 A. Statistical analysis was performed with the Krusal-Wallis test p<0.0001. N>88 per treatment group for both nuclear and total cell fluorescence.

[0091] As evident from the histogram, the fluorescence of cells treated with AuNP:NTA.N- Cas9:gRNA4 and Cas9:gRNA4 and transfected with Thermofisher RNAiMAX shows no significant differences while both are significantly more fluorescent than cells treated with Cas9:gRNA4 alone or untreated.

[0092] Figure 14 shows the High Resolution Melting (HRM) results of the ASAH1 gene amplicon obtained from the genome editing experiment. AuNP:NTA.N-Cas9:gRNA6 nanoparticles were functionalized with gRNA6 SEQ ID NO 6 targeting the second exon of the ASAH1 gene encoding the enzyme Acid Ceramidase involved in drug resistance and tumor recurrence in invasive melanoma lesions. The control is represented by A375 cells treated with RNAiMAX standards from Thermofisher and Cas9:gRNA6 at 10nM concentration. In parallel, the cells were treated with AuNP:NTA.N-Cas9:gRNA6, at concentrations of 10 and 70.8 nM of Cas9, directly in the culture medium without any transfection reagent.

[0093] Genomic DNA was then extracted and amplified and analyzed by HRM with primers having SEQ ID NO 7 and SEQ ID NO 8. Figure 14 shows HRM plotted against different treatments: The “Aligned Melt Curves” panel groups samples based on mean fluorescence and temperature, the “Difference Plot” panel plots samples against the difference with untreated A375 cells.

[0094] Figure 15 Dimerization of AU_NR_PEG3000NTA_N:dCas9:gRNA nanorods on

[0095] DNA. Figure 16 Result of HRM analysis with AU_NR_PEG3000NTA_N-dCas9 nanorods optimized to induce a DSB as described in PCT / IB2020 / 050432. AuNR- dCas9:gRNA1 (SEQ ID NO 3) and AuNR-dCas9:gRNA5 (SEQ ID NO 5) were injected into zebrafish embryos at the 1-cell stage. At the 2-4-cell stage, embryos were irradiated (laser A=870 nm, 1 min per embryo, laser intensity 8x10A14 W / m2, pulse duration 200 fs, repetition rate 80 MHz). By performing HRM, using primers SEQ ID NO 9 and 10, with zebrafish embryos treated with the dimer, with and without irradiation, we noticed lower melting temperatures in the irradiated samples indicating probable gene editing.

[0096] Figure 17A: AuNP resuspended in Cas9 buffer

[0097] Figure 17B: AuNP resuspended in cell culture medium

[0098] Figure 18: Temporal stability experiment of AuNPCas9 under storage conditions: 30 mM HEPES pH 8.0, 400 mM KOI, 50% glycerol, storage temperature -20 °C.

[0099] Figure 19: AuNR-based nanotransducers functionalized with Cas 9 via freeze- drying process.

[0100] Figure 20. Confirmation of the presence of proteins in a freeze-dried sample of AuNPs with Cas9 bound on the surface.

[0101] DETAILED DESCRIPTION

[0102] The present invention relates to a nanocomplex comprising a gold nanoparticle whose surface is functionalized with at least one group having the following formula I: -W- R1-X-NH-Y-Ni2+-Z, wherein:

[0103] -W is a sulfide group or an N-heterocyclic carbene group (NHC)

[0104] R1is a C2-C is alkyl chain;

[0105] X is a spacer consisting of a polymer chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate;

[0106] Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED),

[0107] Z is selected between a recombinant protein of the Cas family fused at the C terminus or N terminus to a histidine tag that binds the Y group via the Ni2+ion, a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family, fused at the C terminus or N terminus to a histidine tag, a single-stranded gRNA guide RNA molecule comprising from the 3' end to the 5' end a nucleotide sequence suitable for binding said Cas protein and a nucleotide sequence suitable for hybridizing to a target genomic sequence.

[0108] According to the invention, said recombinant protein of the Cas family can be chosen from Cas9, Cas13, Cas12, Cpf1 , evoCas9 and said dCas protein (wherein the nuclease activity is deactivated but not the helicase activity) is selected from dCas9, dCas13, the nickase protein Cpf1 , the nickase protein Cas9 (nCas9), the dCas or nCas recombinant with epigenetic or transcriptional regulators, base editors or dimerization domains (dCas9- DNMT3A, CRISPRi and CRISPRa, dCas9-rAPOBEC1, RESCUE, REPAIR systems and Fokl dimerization domains).

[0109] Therefore, said recombinant Cas family protein can be chosen among: Cas9, Cas 13, Cas12, Cpf1 , evoCas9, dCas9, dCas13, nickase Cpf 1 , nickase Cas9 (nCas9), dCas or nCas comprising epigenetic or transcriptional regulators, base editors or dimerization domains, dCas9- DNMT3A, CRISPRi, CRISPRa, dCas9-rAPOBEC1 , dCas or nCas including RESCUE, REPAIR systems and Fokl dimerization domains.

[0110] The Cas family proteins listed above are well known to those in the field, for example the acronym DNMT famously stands for DNA methyl transferase and dCas9- DNMT3A is well known in the literature.

[0111] Among the mutations affecting the dCas9 enzyme that cause the inactivation of the nuclease activity but not of the helicase activity, the D10A mutation and the H840A mutation are cited by way of example but not limitation. In one embodiment that can include all the embodiments described herein, in the nanocomplex of the invention, the surface of said gold nanoparticle can be further functionalized with one or more groups having the following formula II:

[0112] -W- R1-X-NH-Y-Ni2+-Z', wherein:

[0113] -W is a sulfide group (-S-), or an N-heterocyclic carbene group (NHC) R1is a C2 -C18 alkyl chain (preferably C2 -C4);

[0114] X is a spacer consisting of a polymeric chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate; Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED), and

[0115] Z' is an additional recombinant protein (excluding Z) or a target cell-specific ligand or a nuclear targeting-specific ligand.

[0116] In one embodiment Z' may be a restriction enzyme, e.g. a thermosensitive restriction enzyme. In this embodiment, said enzyme may be selected, e.g., from TspRI, Taql, Tail, Tsel.

[0117] Alternatively, Z' can also be a specific ligand for target cells such as tumor cells. A nonlimiting example of such ligand can be represented by antibodies or inhibitors against surface receptors over-expressed by tumor cells, membrane molecules, such as epidermal growth factor receptor (EGFR), human epidermal growth factor receptor 2 (HER2), vascular endothelial growth factor (VEGF), surface receptor for protein kinase ALK, epithelial cell adhesion molecule (EpCAM), prostate specific membrane antigen (PSMA)) or specific ligands for nuclear targeting (cellular retinoic acid-binding protein type II (CRABP-II), Dexamethasone (Dex)).

[0118] The presence of specific target ligands advantageously allows for preferential delivery to the cells or tissues of interest by delivering the genome editing system to the particular cellular target to which it is intended to be directed.

[0119] When the gold nanoparticle according to the invention is functionalized with both the group having formula I and the one having formula II, such groups can be present on the surface of said nanoparticle in equimolar ratio or in non-equimolar ratio.

[0120] In one embodiment R1is a C2 -C4 alkyl chain

[0121] In one embodiment -W is a sulfide group (-S-)

[0122] In one embodiment X is PEG

[0123] In a further embodiment Y is NTA.

[0124] In a preferred embodiment said NTA has a density of 1 to 100%, preferably 5 to 40%.

[0125] In a preferred form X is PEG and Y is NTA.

[0126] In a further preferred form -W is (-S-), X is PEG, Y is NTA and R1is a C2 -C4 alkyl chain In a further preferred form -W is (-S-), Z is Cas9, dCas9, Cas13, dCas13, X is PEG, Y is NTA and R1is a C2 -C4 alkyl chain.

[0127] The gold nanoparticle according to the invention (also referred to as a plasmonic nanoparticle) can sustain a localized surface plasmon resonance, capable of absorbing electromagnetic radiation at a controlled wavelength in the visible or near-infrared range, i.e. in a wavelength range between about 300 nm and about 2 m, preferably between 400 nm and 1800 nm, and converting it into heat. As is known in the art, the generation of heat by a plasmonic nanoparticle depends on the amount of the “detuning” factor, i.e. the difference between the wavelength of the light source used for irradiation and the surface plasmon resonance frequency of said nanoparticle (SPR).

[0128] In one embodiment, said gold nanoparticle is spherical and its inorganic core has a diameter between 2nm and 60nm, preferably between 2 and 30nm. In one embodiment, said spherical nanoparticle has a diameter of about 12nm.

[0129] In a further embodiment, said gold nanoparticle, it is non-spherical in shape or is preferably in the form of a nanorod “nanorod” whose inorganic core has at least one dimension (height, length, width), preferably two, between 2nm and 60nm. In a preferred embodiment, said nanorod has at least two dimensions, respectively, of about 5nm and 20nm.

[0130] In the context of this description, the term “dimension” is intended to include any of the measurements that identify and determine the extent of a body either in volume or surface area, including for example length, width, height or depth.

[0131] In one embodiment, the surface of said nanoparticle is at least 40%, 30%, 20% or 10% functionalized with -W-R1-X-NH-Y-Ni2+-Z and at least 60%, 70%, 80% or 90% is untagged or bears the functional group -W- R1-X-NH2.

[0132] According to the invention, said polymer chain X preferably has a degree of polymerization (n) between 10 units and 200 units, preferably between 20 and 90 units. Preferably, said polymer chain is polyethylene glycol (PEG), even more preferably it is PEG with a degree of polymerization between 40 and 105, and with a molecular weight of approximately 1300 to 4800 daltons.

[0133] Non-limiting examples of PEGs known in the state of the art suitable for the implementation of the present invention are: n one preferred embodiment, PEG 3000 is used, i.e. PEG having n between 60 and 75 and a molecular weight between 2700 and 3300 daltons.

[0134] The “CRISPR-Cas” enzyme complex indicated as “Z” in the formula according to the present description, comprises at least or consists of a Cas or dCas enzyme as defined above and a single-stranded guide RNA molecule, gRNA, comprising (or consisting of) from the 3' end to the 5' end a nucleotide sequence suitable for binding said Cas or dCas enzyme, and a nucleotide sequence suitable for hybridizing to a target genomic sequence. The nucleotide sequence suitable for hybridizing to the target genomic sequence may be designed according to the desired target DNA. The invention also relates to a genome editing system comprising nanocomplexes according to the present invention, said system being designed with an appropriate guide RNA according to the desired editing (target sequence, for example chosen according to the pathology that one wishes to treat). These nanocomplexes can be functionalized as described above and on the surface of each gold nanoparticle one or more different groups of formula I can be linked (for example in the guide RNA, in R1 , in X and / or in Y, and 0, 1 or more different groups of formula II, for example in R1 , in X and / or in Y').

[0135] In one particularly advantageous embodiment, suitable for reducing off-target cuts by the Cas enzyme, a genome editing system such as that described in patent application WO2020152573 may be used, comprising a Cas protein mutated so as to lose endonuclease activity (hence dCas) wherein the cutting of the target DNA is performed by means of a system that exploits the ability of gold nanoparticles to sustain a plasmon resonance and to generate heat when a dimer of said nanoparticles is irradiated with a suitable wavelength. According to this embodiment, the editing system comprises at least two nanocomplexes as defined and claimed herein wherein the Cas enzyme is a dCas enzyme as defined herein, which differ from each other in the nucleotide sequence suitable for hybridizing to the target genomic sequence present in the gRNA. The nucleotide sequences suitable for hybridizing to the target genomic sequence will be designed in such a way as to bring the gold nanoparticles to which they are complexed to a distance from each other such that they form dimers.

[0136] In one embodiment, therefore, the genome editing system according to the invention comprises a first and a second nanocomplex as defined and claimed herein, adapted to form a dimer. In this embodiment, the gRNA of the first nanocomplex comprises a first guide nucleotide sequence adapted to hybridize to a first complementary region of the target genomic sequence, and the gRNA of the second nanocomplex comprises a second guide nucleotide sequence adapted to hybridize to a second complementary region of the target genomic sequence. According to this embodiment, the 3' end of the first complementary region is in close proximity to the 5' end of the second complementary region on the target genomic sequence, the distance between said ends being preferably in the range of zero to 500 nucleotides, more preferably in the range of zero to 200 nucleotides, even more preferably in the range of zero to 100 nucleotides. Accordingly, in this embodiment, the first and second guide sequences direct the sequence-specific binding of the first and second nanocomplexes to their respective first and second complementary sequences in the target genomic sequence, thereby bringing the plasmonic nanoparticles of said first and second nanocomplexes into proximity. This mechanism allows distinguishing the off-targets (sites recognized by only one guide RNA) from the on-target (site recognized by both guide RNAs). It is therefore necessary for a double condition to occur simultaneously such as an AND logic gate.

[0137] • The invention also provides a genome editing system comprising at least two nanocomplexes as described above which differ from each other in the nucleotide sequence capable of hybridizing to a target genomic sequence of said gRNA, said complexes being capable of forming a dimer whose gold nanoparticles are capable of sustaining a surface plasmon resonance capable of generating a temperature increase of at least 80°C on their surface when the dimer composed of said at least two nanocomplexes is exposed to electromagnetic radiation resonant with said dimer at a wavelength in the range between 300 nm and 2 pm.

[0138] • The invention also relates to a pharmaceutical composition comprising nanocomplexes as described and claimed herein and at least one pharmaceutically acceptable carrier and / or excipient.

[0139] The invention therefore also provides an in vitro genome editing process of incubating a target cell with the nanocomplex, composition or genome editing system as described and claimed herein.

[0140] According to a more preferred embodiment, the target cell of the process of the invention may be a prokaryotic or eukaryotic cell. Preferably the target cell is a eukaryotic cell, preferably a mammalian cell, more preferably a human cell, even more preferably a diseased human cell.

[0141] The invention further provides a pharmaceutical formulation comprising nanocomplexes as described and defined in the description and claims and at least one pharmaceutically acceptable carrier or excipient or the genome editing system as described and claimed for use as a medicament or for use in the therapeutic treatment of a patient in need thereof. Such therapeutic treatment may occur, by way of example and not limitation, by topical administration of any pharmaceutical composition comprising the nanocomplex, editing system or formulation as described and claimed or by injection administration of any pharmaceutical composition comprising the nanocomplex, editing system or formulation as described and claimed, to a patient who needs it.

[0142] Such a patient may be any multicellular eukaryotic organism, preferably a mammal, most preferably a human.

[0143] As described above, the ability of the nanocomplexes of the invention to be integrated extremely effectively into cells and to localize both in the nucleus and in the mitochondria, as well as to operate in an extremely targeted and selective manner on the genome of a target cell, makes the nanocomplexes and the system of the invention particularly suitable for use in clinical-therapeutic applications, in particular for applications that aim to selectively intervene on diseased cells but also for applications in the biotechnological field, in particular for applications for the development of non-human genetically modified organisms for applications in basic research, agri-food industry, pharmaceutical industry and development of materials and biofuels.

[0144] The present invention also relates to nanocomplexes, the composition or the system of the invention for use as a medicine or a therapeutic method (of genome editing) which comprises the administration to a patient who needs it, of the nanocomplexes, the system or the composition of the invention in therapeutically effective quantities. This therapeutic method is applicable to all those patients who need or benefit from genome editing procedures aimed at correcting genetic defects that are the cause or contributory cause of the pathology. Preferably, but not by way of limitation, the therapeutic use of genome editing can be aimed at pathologies caused or contributory by mutations of the genome and can be for example aimed at the treatment of a pathology chosen from melanoma, solid tumors, leukemia and diseases caused or contributory by mutations of the mitochondrial DNA, cardiomyopathies of genetic cause.

[0145] As stated above, in one embodiment, said target cell is a eukaryotic cell or a prokaryotic cell. Preferably, said eukaryotic cell is an animal cell. In a preferred embodiment, said cell is mammalian, such as farm or domestic mammals. More preferably, said cell is a human cell. In one embodiment, the target cell is a diseased cell or one that has alterations in the genomic DNA.

[0146] Another object hereof is a formulation comprising nanocomplexes or the genome editing system according to any of the embodiments described herein, and at least one pharmaceutically acceptable carrier. One skilled in the art can identify which carriers are pharmaceutically acceptable for use in the present invention. The composition may be in the form of a suspension / solution for injection, nebulization, for oral, topical, oropharyngeal, ocular administration, or it may be for oral, rectal, topical administration.

[0147] The present invention also provides a process for the preparation of a nanocomplex as defined in any of the embodiments described herein, comprising the following steps: i) add a solution of (W-R1-X-NH2)n, wherein n is 1 and when n is 1 W is thiol (HS) or N -heterocyclic carbene (NHC) and when n is 2 W is S,

[0148] R1is a C 2 -Cis alkyl chain (preferably C2-C4);

[0149] X is a spacer consisting of a polymeric chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate; to a solution of gold nanoparticles in the form of nanorods or spherical and perform dialysis against water thus obtaining a solution of AuNP-W-R1-X-NH2 functionalized nanoparticles, wherein W is -S or N-heterocyclic carbene ii) add to the solution obtained in point i) a) a solution of sulfo-GMBS e b) a solution of HSC 3-Y, wherein Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED) and perform dialysis against water thus obtaining a solution of functionalized AuNP-W- R1-X-NH-Y nanoparticles; iii) add to the solution obtained in point ii) a nickel salt solution thus obtaining AuNP-W- R1-X-NH-Y Ni2+functionalized nanoparticles iv) add to the solution obtained in point iii) a solution comprising Z as defined above in the solution in point iii); v) add to the solution obtained in point iv) a suspension of Ni-X agarose resin (for the purification of histidine-tagged fusion proteins), centrifuge and collect the AuNP solution, obtaining a solution of AuNP-W-R1-X-NH-Y-Ni2+-Z.

[0150] When Z does not comprise the guide RNA, the method comprises a further step v') of adding to the solution obtained in point v) a guide RNA to obtain a solution of AuNP-X- R1-PEG-NH-Y-Ni2+-Z wherein Z is a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family, including dCas or other known Cas variants, a single-stranded gRNA guide RNA molecule comprising from the 3' end to the 5' end a nucleotide sequence suitable for binding said Cas protein and a nucleotide sequence suitable for hybridising to a target genomic sequence (also indicated as Cas:gRNA).

[0151] In case you want to obtain functionalized nanoparticles with both

[0152] -W- R1-X-NH-Y-Ni2+-Z that with

[0153] -W- R1-X-NH-Y-Ni2+-Z'

[0154] Step iv) is replaced by step iv') wherein both Z and Z' are added, in equimolar proportions or not depending on the functionalization that is desired to obtain.

[0155] In a further embodiment, after said step v) or v') the method optionally comprises a step vi) of adding 50% glycerol for storage of the solution.

[0156] In an embodiment that also includes the previous ones, triethylamine can be added to point ii) a) of the process for the preparation of said nanocomplexes (see e.g. scheme 3).

[0157] All embodiments relating to R1 , X, Y, Z and Z' described for the nanocomplex apply to the process for its preparation.

[0158] In a preferred form, the nanocomplex is AuNP-S-R1-PEG-NH-NTA Ni2+-Cas:gRNA.

[0159] As regards step i), the ligand that allows the functionalization of the nanoparticle could be a thiol, a disulfide or an N-heterocyclic carbene group (NHC) as summarized in the following reaction schemes:

[0160] 1) Au (nanoparticles) + HS-R1-X-NH2 (thiol ligand) = Au-S-R1-X-NH2 (functionalized AuNPs) + H2 (byproduct)

[0161] 2) 2Au (nanoparticles) + (S-R1-X-NH2)2 (disulfide ligand) = 2Au-SR1-X-NH2(functionalized AuNPs)

[0162] 3) Au (nanoparticles) + C(carbene)-R1-X-NH2 (carbene ligand) = Au-C(carbene)-R1-X- NH2 (functionalized AuNPs)

[0163] In one embodiment, said R1is (preferably C2 -C4);

[0164] In one embodiment, X is PEG.

[0165] Preferably said PEG is PEG with molecular weight of about 2800-3300 Da.

[0166] In one embodiment, said dialysis against water of steps i) and ii is performed 1 to 5 times, preferably 3 times, with membranes with MWCO (Molecular weight cut-off) at 3.5 kDa.

[0167] In one embodiment, said W-R1-X-NH2 solution has a concentration of 0.1 to 1 mM, preferably 0.2 mM.

[0168] In one embodiment, said solution of gold nanoparticles in nanorod or spherical form has a concentration of 0.1 to 10 mM (preferably 1 mM) In one embodiment, said sulfo-GMBS solution has a concentration of 0.1 to 1 mM

[0169] In one embodiment, said HSC3 -NTA solution has a concentration of 0.1 to 1 mM (preferably 0.3 mM)ln one embodiment, said AuNP-S-R1-PEG-NH2functionalized nanoparticle solution has a concentration of 1 to 100 mM (preferably 10 mM)ln one embodiment, said nickel salt solution is a NiSO4 solution and has a concentration of 1 to 100 mM (preferably 1 mM for nanorods and 100 mM for spherical particles)

[0170] In one embodiment, said Cas is Cas9, dCas9, Cas13, dCas13, Cas12, dCas12 and has a concentration of 1 to 100 protein molecules per nanoparticle (preferably 1-10)

[0171] In one embodiment, said glycerol is added in such a way as to have a final concentration of glycerol of approximately 50% with respect to the total weight or volume of the solution. In one embodiment, the sulfo-GMBS solution, HSC3 -NTA, nickel salt, Cas-comprising solution and AuNP-S-R1-PEG-NH-NTA Ni2+solution used in the method are buffer solutions, wherein said buffer is preferably 30 mM HEPES pH 8.0, 400 mM KCI and 50% glycerol.

[0172] In a preferred embodiment, the process for preparing a nanocomplex as defined in the present invention comprises the following steps:

[0173] 0.1 to 1 mM HS-R1-PEG-NH2 solution to a solution of gold nanoparticles in the form of nanorods or spherical (10 ml, from 0.1 to 10 mM) and dialyze against water (3 times, MWCO (Molecular weight cut-off) 3.5 kDa) thus obtaining a solution of functionalized AuNP-S-R1-PEG-NH2 nanoparticles (from 1 to 100 mM); ii) add (to 10 ml) a) to the solution obtained at point i) a solution of sulfo-GMBS in buffer (30mM in the concentrations above is indicated from 0.1 to 1 mM, 1 ml) and b) a solution of HSC3 -NTA in buffer (30mM in the above concentrations is indicated from 0.1 to 1mM, 1 ml), and perform dialysis against water (3 times, MWCO 3.5 kDa) thus obtaining a solution of AuNP-S-R1-PEG-NH-NTA functionalized nanoparticles (2.1x1012NRs / ml (nanorods per ml)); iii) add to the solution obtained in point ii) a nickel salt solution (from 1 to 100 mM, 3 mL) (preferably NiSO4 ) in buffer (1 mL, 30 mM) thus obtaining functionalized AuNP-S-R1- PEG-NH-NTA Ni2+nanoparticles (2.1x1012NRs / mL) iv) add to the solution obtained in point iii) a solution comprising Cas in buffer to the solution of point iii) in buffer; v) add to the solution obtained in point iv) a suspension of nickel agarose resin NTA (ThermoFisher Scientific, 88221), centrifuge and collect the AuNP solution, obtaining a solution of AuNP-S-R1-PEG-NH-NTA Ni2+-Cas; vi) optionally add glycerol (final glycerol concentration 50%)

[0174] A further object of the present invention is a process for preparing gold nanoparticles in the form of nanorods, comprising the following steps:

[0175] (i) add an aqueous solution of cetyltrimethylammonium bromide (CTAB) to an aqueous solution of HAuCk ; ii) add to the solution obtained in point i) a solution of NaBH4 to obtain a solution of gold grains; iii) add a solution of didodecylammonium bromide (BDAC) and CTAB to a further solution of HAUCI4; iv) add to the solution of point iii) a solution of AgNOs and l-ascorbic acid; v) add the solution obtained in point ii) to the solution obtained in point iv) until the solution thus obtained changes from purple to red; vi) centrifuge the solution obtained in point v) and remove the supernatant, thus obtaining a solution of nanoparticles in the form of nanorods stabilized by BDAC and CTAB.

[0176] In one embodiment, said CTAB solution added at point i) has a concentration preferably of 0.0005M M.

[0177] In one embodiment, said NaBH4s solution added at point ii) has a concentration preferably 0.01 M.

[0178] In one embodiment, said BDAC solution added at point iii) has a concentration preferably 0.06M.

[0179] In one embodiment, said CTAB solution added at point iii) has a concentration preferably 0.14M.

[0180] In one embodiment, said AgNOs solution added at point iv) has a concentration preferably 0.004M.

[0181] In one embodiment, said l-ascorbic acid solution added at point iv) has a concentration preferably 0.0778M

[0182] In one embodiment, all species used in the method are brought to room temperature, and operations are carried out at 33°C to avoid crystallization of CTAB.

[0183] DESCRIPTION OF THE SEQUENCES

[0184] SEQ ID NO 1 artificial construct from exon 1 of the zebrafish Tyr gene.

[0185] 5'-

[0186] AATTCCTGCCAACGACCCCATTTTCATCATCATGCTTTTATTGACAGCCGGTGTGT

[0187] GTAAAGCCTCTCCGGTGTGTGTGAAGCGTCTCCGGTGTGTGTGAAGCCTCTCACT

[0188] CTCCTCGACTCTTCATCATCATGTCTCTCCATCTCCTCCTCTTCTTCTTCCTCCAGC

[0189] TCTTCAGCTCGTCTCTCCAGCAGTTCCCCCGAGGTCTGCACCTCCCCAGAAGTCC TCCAGTCCAAACGCTGCTGT

[0190] CCAGTCTGGCCCGGCGACGGCTCCGTGTGCGGCGTCCAGTCAGGTCGAGGGTT

[0191] CTGTCAGGACGTCCTGGTG

[0192] TCCGACCTTCCCAACGGGCCGCAGTATCCTCACTCAGGAGTGGACGATCGAGAG

[0193] CGATGGCCTTTAGTGTTTTACAACCAAACCTGCCAGTGCGCCGGAAACTACATGG

[0194] GGTTTGATTGCGGCGAATGCAAGTTCGGCTTCTTCGGTGCCAACTGCGCAGAGA

[0195] GACGCGAGTCTGTGCGCAGAAATATATTCCAGCTGTCCACTACCGAGAGGCAGA

[0196] GGTTCATCTCGTACCTAAATCTGGCCAAAACCACCATAAGCC

[0197] CCGATTATATGATCGTAACAGGAACGTACGCGCAGATGAACAACGGCTCCACGCC

[0198] AATGT

[0199] TCGCCAACATCAGTGTGTACGATTTATTCGTGTGGATGCATTATTACGTGTCCCGG

[0200] GACGCTCTGCTCGGTGGGCCTGGGAATGTGTGGGCTGATATTGATTTTGCGCATG

[0201] AGTCGGCGGCGTTTCTGCCTTGGCATCGGGTGTATCTGCTGTTTTGGGAGCATGA

[0202] GATCCGGAAGCTGACGGGAGACTTTAACTTCACCATCCCGTACTGGGACTGGCG

[0203] GGACGCGCAGGACTGTCAGGTGTGCACGGATGA

[0204] GCTGATGGGGGCGCGCAGCAGCCTCAACCGCAGCCTGATCAGCCCCTCCTCTGT

[0205] GTTCTCATCCT

[0206] GGAAGGTGATCTGTTCTCAGCCTGAAAGTTACAACCTCCGCGAGGCTTTGTGTGA

[0207] CGGGTCGCCGGAGGGGCCTTTACTGCGCAATCCCGGGGACCACGACCGGATCC

[0208] GGGTACCGCGGCTGCCCACATCCGCCGATGTAGAGTCGGTGCTGCGGCTGACG

[0209] GACTACGAGACCGGGCAGATGGACCGACGGGCAAACCTGAGCTTCAGGAACGC

[0210] GCTGGAAGGTTTTGCTAATCCTGAGACGGGTTTGGCAGT

[0211] GACGGGTCGCAGTTTGATGCATAACTCTTTACATGTATTCATGAACGGCTCCATGT

[0212] CTTCAGTGCG - 3'

[0213] SEQ ID NO 2 gRNA2 for target exon 1 of zebrafish gene used for in vitro studies

[0214] GGGGCCGCAGTATCCTCACTC

[0215] SEQ ID NO 3 gRNA1 for target exon 1 of zebrafish gene used for Creating a dimeric form of AuNR-dCas9 in zebrafish

[0216] GGACTGGAGGACTTCTGGGG

[0217] SEQ ID NO 4 gRNA4 to target MC4R gene in human melanoma cells A375

[0218] TGGTGAACTCCACCCACCGT

[0219] SEQ ID NO 5 gRNA5 for target exon 1 of zebrafish gene used to create a dimeric form of AuNR-dCas9 in zebrafish

[0220] TGTCCAGTCTGGGCCCGGCGA

[0221] SEQ ID NO 6 gRNA6 to target ASAH1 gene in human melanoma cells A375

[0222] AGAAAGCTCGCGGGTCCCAC SEQ ID NO 7 primer fwd to amplify the human ASAH1 gene 5'-AGCCGCTTAATGAACTGCTG-3'

[0223] SEQ ID NO 8 primer rev to amplify the human ASAH1 gene 5'-AGAATTGAGGCCTCGGTGAA-3'

[0224] SEQ ID NO 9 primer fwd to amplify exon 1 of the zebrafish tyr gene

[0225] 5'- CCAGCCTCTTCAGCTCGTCTC - 3'

[0226] SEQ ID NO 10 primer rev to amplify exon 1 of the zebrafish tyr gene

[0227] 5' - TCTCGATCGTCCACTCCTGA - 3'

[0228] At any point in this specification and the claims the term comprising may be replaced by the term “consisting of’ “consisting of’.

[0229] The examples given below are intended to show possible ways of carrying out the invention but are not intended to be in any way limiting.

[0230] Standard procedures for the fabrication of gold nanoparticles in spherical or nanorod form may be used. Furthermore, any technical equivalents obvious to one skilled in the art are to be considered as covered by the present invention.

[0231] In compliance with Art. 170bis paragraph 2 of the CPI and in accordance with Art. 21 paragraph 2 of the CPI Implementation Regulation adopted with Ministerial Decree 13.1.2010 n.33, it is declared that:

[0232] The material of Animal / vegetable origin in the reported experiments were used commercial cell lines of human melanoma A375 and the fish Danio rerio (zebrafish, wildtype AB strain) at the basis of the invention object of the above application is of ATCC- CRL-1619™ for cells and KIT-AB1175 for zebrafish

[0233] In compliance with Art. 170bis paragraph 4 CPI, it is declared that: with reference to the biological material, containing microorganisms or genetically modified organisms, which is the subject of or used in this application, the obligations arising from national or community regulations have been complied with, and in particular, from the provisions of paragraph 6 of the legislative decrees of 12 April 2001 no. 206 and 8 July 2003 no. 224, concerning such modifications.

[0234] EXAMPLES

[0235] 1. CHEMICAL SYNTHESIS OF THE NTA THIOLATED LIGAND

[0236] The synthesis of the NTA-terminated thiol is performed by a reaction sequence shown in Scheme 1. 3-Mercaptoproanoic acid is treated with DCC and NHS to yield a corresponding active ester. Reaction of H(Z)lysotbu.hcl with excess t-butyl bromoacetate gives the protected NTA functionalization. The next step requires removal of the benzyloxycarbonyl group. The reaction is performed by hydrogenolysis of the Z group in the presence of Pd / C. Subsequent reaction with the active ester of 3-mercaptopropanoic acid affords the protected NTA-terminated thiol. Reaction with TFA yields the expected NTA-terminated thiol.

[0237] Scheme 1. Synthesis of NTA ligand

[0238] 2. SYNTHESIS OF SPHERICAL GOLD NANOPARTICLES

[0239] The synthesis procedure is based on the conversion of AuCh to AuCI 4XH2O.

[0240] The sodium citrate reduction method known in literature was used. AuNPs with background-COOH or background-NH2 are prepared and stabilized with carboxyl- terminated polyethylene thiol and amino-terminated polyethylene thiol, respectively.

[0241] For the COOH-background, after purification, the terminal carboxyl groups are activated by formation of active esters (sulfoNHS) and treated with COOH-terminated NTA. Subsequent treatment with nickel salt (Ni2+) and His-tagged Cas enzyme allowed protein attachment. Activation of carboxyl groups and attachment of Cas enzyme do not consume all available carboxyl groups. The final AuNPs possess some free carboxylic acid groups to provide an appropriate background and improved solubility in aqueous solution (Scheme 2).

[0242]

[0243] Scheme 2. Scheme for the preparation of carboxylic acid-background stabilized AuNP and NTA-mediated binding to Cas enzyme. For the NH2-background, after purification, some of the terminal amino groups are treated with active ester with maleimide functional group. This functional group allows for effective immobilization of NTA by the reaction between the maleimide functional group and the NTA-terminated thiol. Subsequent treatment with nickel salt (Ni2+) and His- tagged dCas9 allows the attachment of dCas9 to AuNPs (Scheme 3). The attachment of dCas9 does not consume all the available amino groups. The final AuNPs possess some free amino groups to provide an appropriate background and better solubility in aqueous solution.

[0244]

[0245] Scheme 3. Scheme for the preparation of amine-background stabilized AuNP and NTA-mediated binding to dCas9 (Au_12_PEG3000NTA_N). 3. SYNTHESIS OF ROD-SHAPED GOLD NANOPARTICLES

[0246] 3.1. Preparation of gold grains

[0247] All reagents must be warmed to room temperature (RT). The synthesis is performed in an incubator set at 33°C to avoid crystallization of CTAB. Deionized and degassed water was used as solvent. A solution of CTAB (1 .0 mmol, Sigma Aldrich; cat# 52365) in water (5mL) was added to a solution of HAuCk (0.0025 mmol, Acros Organics; cat# 437170010) in water (5mL) with stirring. Then, NaBH4 solution (0.006 mmol, Sigma Aldrich; cat# 71320-25G) in cold water (0.6mL) was added. The color of the reaction mixture changed from yellow to light brown. The fresh grain solution was used for the preparation of gold nanorods (AuNP nanorods).

[0248] 3.2. Preparation of AuNP nanorods

[0249] All reagents must be warmed to RT. The synthesis is carried out in an incubator set at 33°C to avoid crystallization of CTAB. Deionized and degassed water was used as solvent. A solution of BDAC (0.3 mmol, Sigma Aldrich; cat# B4136) and CTAB (0.7 mmol, Sigma Aldrich; cat# 52365) in water (5 mL) was added to a solution of HAuCl4 (0.005 mmol, Acros Organics; cat# 437170010) in water (5 mL) with stirring. Then solutions of AgNOs (0.0007 mmol, Sigma Aldr ich; cat# 209139) in water (0.17 mL) and L-ascorbic acid (0.0054 mmol, Sigma Aldrich; cat# A92902) in water (0.07 mL) were added. The formation of nanorods was promoted by the addition of fresh grain solution (0.1 mL). When the color changes from purple to red, the mixture is centrifuged (30 min, 9600 rpm). The supernatant is removed and the residue is in water (0.5 ml) to give a BDAC and CTAB stabilized AuNP nanorod solution.

[0250] 4. FUNCTIONALIZATION OF SPHERICAL GOLD NANOPARTICLES AuNP

[0251] 4.1 Synthesis of citrate-stabilized spherical gold nanoparticles (AU_12_CITRATE) 100mL of an aqueous solution containing 0.1 M HAuCI4 (Alfa Aesar; cat# 12325) is heated to 95°C under a nitrogen flow. 2.8mL of a 170mM sodium citrate solution (Sigma Aldrich; cat#71402) is added. The solution turns red and mixing continues for 35min under stirring. The mixture is cooled at room temperature.

[0252] Synthesis of Au_NP_PEG3000NH2

[0253] An aqueous solution of HSPEG3000NH2 (IRIS Biotech; cat# PEG1197) is added to 50mL of 1mM Au_12_citrate. The mixture is stirred for 1 hour at room temperature (RT). Excess reagent is removed by filter centrifugation (1100 xg) to obtain spherical nanoparticles (HSPEG3000NH2-stabilized AuNP). Then, water is added and the centrifugation is repeated twice (washes). An example of centrifugation filters to use are Amicon with cut-offs (eg, 30 / 50 kDa).

[0254] 4.2 Synthesis of Au_NP_PEG3000-NTA_N

[0255] A solution of Sulfo-GMBS (Prochimia Surfaces; cat# CR003-0.1) in buffer (1 mL) (20 mM TAPS pH 8.0) is added to the AuNP_PEG3000NH2 solution in water (5 mL) and mixed for 15 minutes. Then, a solution of HSC3NTA (Prochimia Surfaces; cat# FT016-m4-0.05) in buffer (1 mL) (20 mM TAPS pH 8.0) is added. The mixture is mixed for one hour, the excess reagent is removed by filter centrifugation (1100 xg). The solution is removed until approximately 1 mL is left. Then, buffer (20 mM TAPS, pH 8.0) is added and the centrifugation is repeated twice. An example of centrifugation filters to use are Amicon with cut-off (eg, 30 / 50 kDa). In this way, spherical gold particles with concentration 12X1013NP / mL are obtained, diameter (TEM): 12 nm, UV-Vis: 520 nm.

[0256] 4. 3. Preparation of Au_NP_PEG3000-NTA_N Ni2+

[0257] A solution of NiSO4(0.1 M, 80 pL) was added to 1 mL of Au_NP_PEG_NTA_N (1x1013NPs / mL) in the original tube. The mixture was mixed (inverting the tube) and incubated at room temperature for 1 h. Then, 3 mL of 20 mM TAPS buffer pH 8.0 was added and the mixture was centrifuged for 20 min using the benchtop centrifuge (950 x g) using a centrifugal filter. The solution should be removed to leave approximately 100-150 pL. The step was repeated two more times. Then, a buffer (30 mM HEPES, 400 mM KCI, pH=8.0) was added and the centrifugation was repeated. This step was repeated three times in total. The retained volume was transferred to a new microtube and the volume was measured with a pipette. The final volume should be about 200 pl. The purified Ni2+ AuNP can be stored at RT. Amicon filters with a higher cut-off value (e.g. 30 / 50 kDa) can be used, wherein case the flow rate will be faster.

[0258] 4.4. Preparation of Au_NP_PEG3000-NTA_N Ni2+Cas9

[0259] A solution of Cas9 (200 pg) in buffer was added to a solution of Au_NP_PEG3000_NTA Ni2+(T 1013NPs / mL) of approx. 200 uL volume and mixed well by gentle pipetting or swirling the vial.

[0260] NOTE: The total amount of protein to be effectively loaded onto the AuNP surface directly relates to the amount of AuNP used. Use the maximum amount that can be associated with a specific amount of AuNP / Ni2+AuNP sample loaded, following the calculation table below. If the protein is available in lyophilized form, prepare the reconstitution solution of the Cas concentration in buffer (30m M HEPES, 400mM KCI, pH=8.0) to reach the protein concentration of 1 pg / pl.

[0261] The mixture was incubated at 4-8 °C (in a refrigerator) for 1 hour and gently shaken occasionally.

[0262] NOTE 1 : For highly thermosensitive proteins this step can also be performed on ice NOTE 2: It is suggested to continue the AuNP-Cas purification protocol without delay as it may negatively affect the final activity of the protein component and the stability of the loaded AuNP-Cas. Do not freeze the sample.

[0263] Table 1 : Calculations for binding Cas to AuNP

[0264] 4.3. Purification of Au_NP_PEG3000-NTA_N Ni2+Cas9 100 pL of 6BCL_NTA_Ni_X Nickel NTA agarose resin was added to a 1.5 mL microtube. The tube was centrifuged at 500 x g for 1 min and the supernatant was discarded with a pipette. 500 pL of equilibration buffer (30 mM HEPES, 400 Mm KCI, 10 Mm Imidazole pH 8.0) was added to each centrifuged resin and the resins were resuspended by pipetting and centrifuged at 500 x g for 1 min. The supernatant was discarded with a pipette. An entire AuNP-Cas sample was loaded into the resin, mixed by vortexing (low speed) or rotating the tube to completely resuspend the resin, and incubated for 1 h at 4-8 °C. The tube was inverted occasionally to resuspend the resin in the sample. NOTE: For highly thermosensitive proteins this step can also be performed on ice.

[0265] The sample was centrifuged at 500 x g and 4°C for 1 minute and the supernatant was collected with a pipette and transferred to a second tube containing resin equilibrated as before.

[0266] NOTE: Save the purification resin pellet which can be recovered and reused.

[0267] The mixture was incubated for 1 hour at 4-8°C.

[0268] NOTE: This step aims to ensure complete removal of any unbound Cas9 protein.

[0269] After centrifugation of the mixture at 500 x g for 1 min at 4 °C, the supernatant containing the purified AuNP-Cas was carefully collected and transferred to the storage tube. The protein conjugate was stored at 4-8 °C or at -20 °C if sterile glycerol was added to a final concentration of 50%.

[0270] 5. FUNCTIONALIZATION OF AuNP NANORODS

[0271] 5.1. Preparation of AuNP_PEG3000NH2 Nanorod

[0272] A solution of HSPEG3000NH2 (IRIS Biotech; cat# PEG1197) in water (1 mL) was added to the AuNP_BDAC / CTAB nanorod solution (10 mL) with stirring at RT for 1 h and then at 33°C overnight. Excess reagent was removed by dialysis against water (3 times, MWCO 3.5kDa) to give HSPEG3000NH2-stabilized AuNP nanorods.

[0273] 5.2. Preparation of AuNP_PEG3000_NTA_N nanorods

[0274] A solution of Sulfo-GMBS (Prochimia Sufaces; cat# CR003-0.1) in buffer (1 mL) (30 mM HEPES pH 8.0, 400 mM KCI) was added to a solution of AuNP_PEG3000NH2 nanorods in water (10 mL) with stirring for 15 min. Then a solution of HSC3NTA in buffer (1 mL) (30 mM HEPES pH 8.0, 400 mM KCI) was added. The mixture was stirred for 1 h and excess reagent was removed by dialysis against the buffer (30 mM HEPES pH 8.0, 400 mM KCI, 3 times, MWCO 3.5kDa). AuNP nanorod concentration: 2.1x1012NR / mL, length (TEM) 40 nm, diameter (TEM): 10 nm, UV-Vis: 530, 862 nm.

[0275] 5.3. Preparation of Au_NR_PEG3000-NTA_N Ni2+ A solution of NiSC (1 mM, 3mL) in buffer (30 mM HEPES, 400mM KCI, pH=8.0) was added to a solution of Au_NR_PEG_NTA_N (2.1 1012 NRs / mL) in buffer (1 mL, 30 mM HEPES, 400mM KCI, pH=8.0). The mixture was incubated at 33°C for 1 h and centrifuged for 5 min using the benchtop centrifuge (800 x g) using a centrifugal filter. The solution should be removed to leave approximately 1 ml. Then buffer (30mM HEPES, 400mM KCI, pH=8.0) was added and centrifugation was repeated. Amicon filters with a higher cut-off value (e.g.: 30 / 50 kDa) can be used, wherein case the flow rate will be faster.

[0276] 5.4. Preparation of Au_NR_PEG3000-NTA_N Ni2+Cas9

[0277] A solution of Cas9 (20 pg) in buffer was added to a solution of Au_NR_PEG3000_NTA Ni2+ (2.1x1012NRs / mL) in buffer (30 mM HEPES, 400 mM KCI, pH=8.0) and mixed well by gentle pipetting or swirling the vial. The mixture was incubated at 4-8 °C (in a refrigerator) for at least 20 min and gently shaken occasionally. The mixture was added to a suspension of Nickel NTA agarose resin 6BCL_NTA_Ni_X and incubated for 20 min at 4-8 °C in a refrigerator. After centrifugation of the mixture at 500 x g for 1 min at 4 °C, the AuNP.NTA.N nanorod solution was collected and glycerol was added (final glycerol concentration 50%). The protein conjugate stored at 4-8 °C.

[0278] 6. CHARACTERIZATION

[0279] Figures 2-4 show the size, LIV-VIS spectrum and transmission electron microscopy (TEM) image for AuNP.NTA.N (spherical). Figures 5-7 show the size, LIV-VIS spectrum and TEM image for AuNP.NTA.N nanorods (rods). The binding efficiency is 1 -50 Cas enzyme molecules per particle. The preferred value is 20-30 Cas enzyme molecules per particle.

[0280] 7. CUTTING EFFICIENCY OF (SPHERICAL) AUNP WITH NTA LIGAND: COOH VS NH2BACKGROUND

[0281] After functionalization of AuNP.NTA.N with Cas9 protein via NTA ligand (AuNP-Cas9), and incubation with gRNA, the AuNP.NTA.N-Cas9:gRNA complex is formed. This complex is able to induce a DNA double-strand break (DSB) at a target sequence. Figure 8 shows the incubation of AuNP.NTA.N-Cas9:gRNA with a synthesized DNA fragment of 1274 bp. The fragment corresponds to the beginning of the first exon of the zebrafish tyrosinase gene (Tyr1274). The AuNP-Cas9:gRNA is able to recognize and cut the target DNA. However, the AuNP-Cas9:gRNA consisting of the NH2 background (AuNP.NTA.N- Cas in the figure) works more efficiently than the one with the COOH background (AuNP.NTA.C-Cas in the figure). For the NH 2 background, there is no difference in the cleavage efficiency of the highest dose between conjugated and unconjugated enzyme (AuNP.NTA.N-Cas9:gRNA versus Cas9:gRNA) (Figure 7C). 8. CELLULAR INTERNALIZATION OF AuNP.NTA.N-CAS9 (NTA LIGAND, BACKGROUND-COOH)

[0282] The internalization of AuNP.NTA.N-Cas9 into the human melanoma cell line A375 was studied by TEM. Figure 9 provides an example. In these experiments, cells were seeded at a density of 5000 cells per cm2. After overnight incubation, the particles were diluted in Optimem (DMEM with high glucose plus GlutaMAX, without sodium pyruvate, without serum without antibiotics) to a concentration of 7x1011NP / ml and then incubated with the cells for a determined time (30 min, 1h and 5h). The following groups were tested: untreated, Cas9, AuNP, AuNP-Cas9. After incubation, cells were fixed in Petri dishes with 1.5% glutaraldehyde in Na Cacodylate buffer (0.1 M pH 7.4), then scraped, collected in 1 .5 ml tubes and centrifuged for pellet stabilization. After rinsing, cells were post-fixed, stained, dehydrated, embedded in epoxy resin as described in (doi: 10.1038 / s41598- 020-68405-4). For ultrastructural analysis, thin sections of 90 nm thickness were collected on copper grids and analyzed by TEM.

[0283] As evident from Figure 9, the AuNP with -COOH background shows a low tendency to enter cells where they are visualized as nanoparticle agglomerates in the cytoplasm (Figure 9). Similar results were found with AuNP-Cas9 with -COOH background (data not shown).

[0284] 9. CELLULAR INTERNALIZATION OF AUNP-CAS9 (NTA LIGAND, NH2- BACKGROUND)

[0285] Internalization of naked and functionalized AuNPs was studied as previously described. AuNPs with NH2 background entered cells where they localized as monodisperse particles in vesicles (Figure 9A) or cytoplasm (Figure 9B) or nucleus (Figure 9C). However, only 20% of cells were positive for nanoparticle localization.

[0286] In contrast, the AuNP-Cas9 complex was found to localize in 100% of cells. The nanoparticles are monodisperse in the extracellular environment, where they interact with the cell membrane (Figure 10, arrows). The complex is also highly stable in the intracellular environment and AuNP-Cas9 do not clump even when confined in vesicles such as endosomes, endolysosomes, or autophagosomes (Figure 11). AuNP-Cas9 appear to be localized in vesicles or to be free in the cell cytoplasm, where they can interact with organelles such as the endoplasmic reticulum or mitochondria (Figure 12). These results are also confirmed by confocal imaging: AuNP-Cas9 are able to enter the nucleus of A375 cells with a better efficiency rate than the gold standard lipofection method (RNAiMAX from Thermofisher, 13778100) (Figure 13).

[0287] 10. AUNP-CAS9 (NTA LIGAND, BACKGROUND- NH2) EFFICIENTLY EDIT THE

[0288] GENIC DNA OF A375 CELLS Figure 15 provides an example of gene editing by AuNP-Cas9 in A375 melanoma cells. In this experiment, Cas9 was incubated with gRNA targeting the second exon of the ASAH1 gene. This gene encodes the enzyme acid ceramidase, which is involved in drug resistance and tumor recurrence in invasive melanoma lesions. Briefly, A375 cells were transfected following a canonical editing approach, where Cas9:gRNA is introduced by lipofection at a concentration of 10 nM. In parallel, we delivered AuNP-Cas9:gRNA at 10 and 70.8 nM directly into the cell medium, without any transfection reagent. Genomic DNA was then extracted, amplified and analyzed by high resolution melting (HRM) with the following primers: ASAH1 Fwd 5'-AGCCGCTTAATGAACTGCTG-3' (SEQ ID NO 7) and ASAH1 Rev 5'-AGAATTGAGGCCTCGGTGAA-3' (SEQ ID NO 8). Column 1 of Figure 14 shows the different melting profiles grouped by treatments, while column 2 groups samples by sequence alteration detection. The figure shows the mean percent fluorescence versus temperature in the upper panel, while the lower panel plots the difference in melting temperature of samples compared to untreated samples. The analysis revealed that A375 cells treated with 70.8 nM AuNP-Cas 9 and Lipofectamine- transfected RNP were recognized as edited, while treated cells of the control groups (treated with Cas9 without gRNA or treated with AuNP-Cas9 at the low dose of 10 nM) did not differ from the fusion profile of untreated A375 cells.

[0289] 11 . NANOROD'S ABILITY TO GENERATE A THERMAL DSB

[0290] AuNP nanorods were functionalized in dCAS9. The AuNP-Cas9 nanorod was here optimized to induce a DSB as described in PCT / IB2020 / 050432. Figure 15 shows the scheme of their use as a dimer, as described in PCT / IB2020 / 050432. An example is shown in Figure 16. gRNA1 (SEQ ID NO 3) and gRNA5 (SEQ ID NO 5) were designed upon the sequencing of Tyr1274 (SEQ ID NO 1). AuNP-Cas9:gRNA1 nanorod and AuNP-Cas9:gRNA5 nanorod were injected into zebrafish embryos at the 1-cell stage. At the 2-4 cell stage, embryos were irradiated (laser A=870 nm, 1 min, laser intensity 8x1014 W / m2, pulse duration 200 fs, repetition rate 80 MHz). Performing HRM with dimer-treated zebrafish embryos, with and without irradiation, we noted lower melting temperatures in the irradiated samples that could indicate gene editing (Figure 16).

[0291] 12. PRODUCT SPECIFICATIONS FOR SPHERICAL AUNP WITH NTA BINDER

[0292] 13. STABILITY OF NANOTRANSDUCERS LOADED WITH PROTEIN CARGO (His Tag Cas9 cargo)

[0293] To determine the stability of AuNPs with Cas9 on the surfaces, the following tests were performed: three different batches of AuNPs were chosen, loaded with nickel and further functionalized with Cas9 according to the standard IGeneer protocol (https: / / www.prochimia.com / products / downloadable-files (drop-down menu: User Manual for transducer preparation). AuNP functionalized with Cas9 protein on the surface were stored in pure state at -20 °C in 50% glycerol buffer for the indicated period of time.. The presence of full-length protein for the subsequent 1 , 3 and 6 months of storage was confirmed by SDS-PAGE using 8% polyacrylamide gel electrophoresis followed by Coomassie Brilliant Blue staining (Figure 18). The described time course tests were supported by a clear-looking solution of NP-Cas9 nanotransducers without any visible sign of precipitation and DLS measurement.

[0294] 14 PURE NANOTRANSDUCERS BASED ON FREEZE-DRIED NANORODS BEFORE PROTEIN FUNCTIONALIZATION

[0295] Freeze-dried AuNR (without surface proteins) was reconstituted in pure sterile water and loaded with nickel and functionalized with Cas9 protein according to the modified IGeneer nanorod kit protocol. Successful functionalization was confirmed by the presence of full-length Cas9 protein by Coomassie Blue-stained SDS-PAGE gel electrophoresis (Figure 19).

[0296] To extend the lifetime of the nanotransducers, freeze-drying test of AuNP with Cas9 on the surface was performed. The entire construct was successfully reconstituted and stably stored for up to 1 month at 4 °C. The presence of full-length Cas9 protein was confirmed by Coomassie Blue-stained SDS-PAGE gel electrophoresis (Figure 20). The figure indeed confirms the presence of proteins in a freeze-dried sample of AuNP with Cas9 bound on the surface.

[0297] In summary it has been demonstrated that:

[0298] (i) the protein-coupled nanotransducers of the invention can be stored at -20 °C for 6 months;

[0299] (ii) the protein-free nanotransducers can be freeze-dried and reconstituted for successful functionalization with Cas9 protein cargo; (iii) nanotransducers already functionalized with the Cas9 protein load can be subjected to a freeze-drying process and subsequent reconstitution in the fully solubilized state;

Claims

CLAIMS1. A nanocomplex comprising a gold nanoparticle the surface of which is functionalized with at least one group having the following formula I:-W- R1-X-NH-Y-Ni2+-Z, wherein:-W is a sulfide group -S-, or an N-heterocyclic carbene group NHC;R1is a C2 -C18 alkyl chain;X is a spacer consisting of a polymeric chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate;Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED);Z is selected from a recombinant protein of the Cas family, fused at the C terminus or at the N terminus with a histidine tag that binds the Y group via the Ni2+ion’ or from a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family, fused at the C terminus or at the N terminus with a histidine tag or a single-stranded gRNA guide RNA molecule comprising from the 3’ end to the 5’ end a nucleotide sequence capable of binding said Cas protein and a nucleotide sequence suitable for hybridizing to a target genomic sequence.

2. The nanocomplex according to claim 1 wherein said recombinant protein of the Cas family is selected from: Cas9, Cas 13, Cas12, Cpf1 , evoCas9, dCas9, dCas13, nickase Cpf1 , nickase Cas9 (nCas9), dCas or nCas comprising epigenetic or transcriptional regulators, or base editors or dimerization domains, dCas9- DNMT3A, CRISPRi, CRISPRa, dCas9-rAPOBEC1 , dCas or nCas including RESCUE, REPAIR systems and Fokl dimerization domains.

3. The nanocomplex according to anyone of claims 1 or 2 wherein the surface of said gold nanoparticle is further functionalized with one or more groups having the following formula II:-W- R1-X-NH-Y-Ni2+-Z', wherein:-W is a sulfide group (-S-), or an N-heterocyclic carbene group (NHC) R1is a C2 -C18 alkyl chain (preferably C2 -C4 );X is a spacer consisting of a polymeric chain selected from: polyethylene glycol (PEG), polyacrylamide, polydecyl methacrylate, polystyrene, dendrimer molecules, polycaprolactone, polyacetic acid, poly-(lactic-co-glycolic acid), polyglycolic acid, polyhydroxybutyrate, polycarbohydrate;Y is nitrilotriacetic acid (NTA) or iminodiacetic acid (IDA) or tri(carboxymethyl)ethylenediamine (TED),AndZ' is an additional recombinant protein or a target cell-specific ligand or a nuclear targeting-specific ligand.

4. The nanocomplex according to claim 3 wherein Z' is selected from, a restriction enzyme, a heat-activated restriction enzyme, a tumor cell-specific ligand.

5. The nanocomplex according to anyone of claims 1 to 4 wherein -W is a sulfide group, and / or wherein R1is a Ci-C 4 alkyl chain and / or, and / or X is polyethylene glycol, and / or Y is nitrilotriacetic acid.

6. The nanocomplex according to anyone of claims 1 to 5 wherein said nanoparticle is spherical and whose inorganic core has a diameter of between 2nm and 60nm, preferably about 12nm or said nanoparticle is a nanorod having at least one dimension (height, length, width) of between 2nm and 60nm, preferably at least two dimensions, respectively, of about 5nm and 20nm.

7. The nanocomplex according to anyone of claims 1 to 6 wherein said surface is for at least 40%, 30%, 20% or 10% functionalized with -W- R1-X-NH-Y-Ni2+-Z and for at least 60%, 70%, 80% or 90% it bears the functional group -W- R1-X-NH2.

8. The nanocomplex according to anyone of claims 1 to 5 wherein X has a degree of polymerization (n) ranging from 1 unit to 200 units, preferably from 1 to 70 units.

9. A genomic editing system comprising at least two nanocomplexes as defined in any one of claims 1 to 8.

10. The genomic editing system wherein said at least two nanocomplexes differ from each other in the nucleotide sequence suitable for hybridizing to a target genomic sequence of said gRNA.

11. A composition comprising nanocomplexes according to anyone of claims 1 to 9 and at least one pharmaceutically acceptable carrier.

12. The nanocomplex according to anyone of claims 1 to 8, or genomic editing system according to anyone of claims 9 or 10 or composition according to claim 11 for use as a medicament.

13. The nanocomplex, or genomic editing system, or composition for use according to claim 12 in the treatment of pathologies caused or co-caused by genetic, chromosomal and / or mitochondrial defects.

14. An in vitro genomic editing process comprising the passage of-incubating a target cell with the nanocomplex according to anyone of claims 1 to 8 or with the genome editing system according to anyone of claims 9 or 10.

15. The process according to claim 14 wherein said target cell is a eukaryotic cell or a prokaryotic cell.

16. The process according to claim 15 wherein said eukaryotic cell is a mammalian cell, preferably human.

17. A process for the preparation of a nanocomplex as defined in any of claims 1 , and 3 to 8 when depending on claim 1 , comprising the following steps: i) adding a solution of (W-R1-Y-NH2)n, wherein n is 1 and when n is 1 W is thiol (HS) or N -heterocyclic carbene (NHC) and when n is 2 W is S to a solution of gold nanoparticles in nanorod or spherical form and perform dialysis against water thus obtaining a solution of functionalized AuNP-W-R1-X-NH2 nanoparticles ii) adding to the solution obtained in point i) a) a solution of sulfo-GMBS e b) a solution of HSC3-Y and perform dialysis against water thus obtaining a solution of functionalized AuNP-W- R1-X-NH-Y nanoparticles, iii) add to the solution obtained in point ii) a nickel salt solution thus obtaining AuNP-S- R1-X-NH-Y Ni2+functionalized nanoparticles iv) adding to the solution obtained in point iii) a solution comprising Z; v) adding to the solution obtained in point iv) a suspension of Ni-Y agarose resin, centrifuge and collect the gold nanoparticle solution, obtaining a solution of AuNP-W-R1-X-NH-Y Ni2+-Z; and wherein, when Z does not comprise the guide RNA, the process comprises a further step vii) adding the guide RNA to the solution obtained in point vi) obtaining a solution of AuNP- W-R1-X-NH-Y-Ni2+-Z wherein Z is a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family and a single-stranded gRNA guide RNA molecule comprising from the 3' endto the 5' end a nucleotide sequence capable of binding said Cas protein and a nucleotide sequence suitable for hybridizing to a target genomic sequence.

18. A process for the preparation of a nanocomplex as defined in anyone of claims 3 to 8 when dependent on 3 comprising the following steps: i) adding a solution of (W-R1-Y-NH2)n wherein n is 1 and when n is 1 W is thiol (HS) or N -heterocyclic carbene (NHC) and when n is 2 W is S, to a solution of gold nanoparticles in nanorods or spherical form and perform dialysis against water thus obtaining a solution of functionalized AuNP-W-R1-X-NH2nanoparticles ii) adding to the solution obtained in point i) a) a solution of sulfo-GMBS e b) a solution of HSC3-Y and perform dialysis against water thus obtaining a solution of functionalized AuNP-W-R1-X-NH-Y nanoparticles, iii) adding to the solution obtained in point ii) a nickel salt solution thus obtaining AuNP- S-R1-X-NH-Y Ni2+functionalized nanoparticles iv') adding to the solution obtained in point iii) a solution comprising Z and Z'; v) adding to the solution obtained in point iv) a suspension of Ni-Y agarose resin, centrifuge and collect the gold nanoparticle solution, obtaining a solution of AuNP-W-R1- X-NH-Y Ni2+-Z; and wherein, when Z does not comprise the guide RNA, the process comprises a further step vii) adding the guide RNA to the solution obtained in point vi) thereby obtaining a solution of AuNP-W-R1-X-NH-Y-Ni2+-Z wherein Z is a CRISPR-Cas enzyme complex comprising a recombinant protein of the Cas family and a single-stranded gRNA guide RNA molecule comprising from the 3' end to the 5' end a nucleotide sequence suitable for binding said Cas protein and a nucleotide sequence suitable for hybridising to a target genomic sequence.

19. The process according to claim 18 wherein triethylamine is also added to point ii) a).