METHOD FOR DETECTING AND POSSIBLY QUANTIFYING AN ANALYTE WITH A STEM-LOOP DUAL OLIGONUCLEOTIDE AND SAID OLIGONUCLEOTIDE

Abstract

The present invention relates to a method for detecting and possibly quantifying an analyte that may be present in a liquid sample, said method employing a double stem-loop oligonucleotide and a two-primer LAMP amplification. The present invention also relates to specific double stem-loop oligonucleotides.

Description

Description Title of the invention: METHOD FOR DETECTING AND POSSIBLY QUANTIFYING AN ANALYTE WITH A DUAL STEM-LOOP STRUCTURE OLIGONUCLEOTIDE AND LEDIT OLIGONUCLEOTIDE technical field

[0001] The present invention relates to the field of tools and methods for detecting molecules of interest.

[0002] — More particularly, the present invention proposes a method for detecting and possibly quantify an analyte of interest in a liquid sample putting in works an oligonucleotide with a double stem-loop structure and a LAMP amplification (for "Loop-mediated isothermal AMPlification") with two primers. The present The invention also relates to oligonucleotides with a double stem-loop structure by- specific and usable in such a detection and possible quantification process. PREVIOUS STATE OF THE ART

[0003] Numerous works and studies in fields including, in particular, the academic research; clinical and diagnostic research and analysis, with tests performed on blood samples or cell biopsies or tissues islands; environmental monitoring; civil monitoring; ali- security commentary and in particular quality control; criminal trace analysis. im- complicate the detection of molecules of interest in a sample, and in particular in a liquid sample.

[0004] Several techniques have been developed for this purpose.

[0005] — A first immuno-enzymatic detection technique called the ELISA method (for "Enzyme-Linked Immunosorbent Assay") was developed in the early 20th century. 1970s. In this technique, a sandwich between two specific antibodies and the target can be achieved. The first antibody is used to capture the target, by for example, at the bottom of a well, while the second antibody is used for amplification by- zymatic, directly or via a secondary antibody coupled to an enzyme such as the HRP (for "Horse Radish Peroxidase"). The ELISA method is specific to a antibody and allows quantification of the target using a range of quanti- measurements carried out beforehand or simultaneously. This method is still active currently used and many variants exist. Indeed, an aptamer which is an oligonucleotide sequence specifically selected for its interaction with an analyte or any other oligonucleotide sequence having a specific affinity Aptamers can be used instead of antibodies to target an analyte. They are a good alternative because they can detect small molecules, are highly specific to a target, much easier to produce and handle, more stable, and less expensive. However, when the target to be detected is present in very low concentrations in the sample, the ELISA technique with antibodies or aptamers proves ineffective. To overcome this problem, amplification of a DNA probe is generally necessary. Therefore, other detection methods have been developed using polymerase chain reaction (PCR). Specific examples of such methods include immuno-PCR and aptamer-PCR. In immuno-PCR, the enzymatic amplification of the ELISA technique is replaced by DNA amplification. The second antibody is then coupled to a DNA sequence, which is exponentially amplified by PCR. This method is highly specific and quantitative, but it still requires the presence of two target-specific antibodies, and in particular the development of an antibody coupled to DNA, which makes this method complex and expensive. Aptamero-PCR, on the other hand, allows the secondary antibody to be replaced by an oligonucleotide containing an aptamer sequence specific to the target to be detected. Detection is achieved by direct amplification of this probe by PCR. This method allows for a detection limit of a few picomolars. However, both immuno-PCR and aptamero-PCR share the drawbacks of PCR, namely the need for long temperature cycles involving different temperatures. Finally, another amplification method has been developed to replace PCR for the amplification of double-stranded DNA. This method, called LAMP (for "Loop-mediated isothermal AMPlification" and patented [1], has the major advantage of being isothermal, with amplification carried out at a constant temperature typically between 60°C and 65°C. Thus, a protein detection method using LAMP amplification was described by Pourhassan-Moghaddam et al., 2013 [2]. It employs, on the one hand, an antibody or aptamer attached to a surface to capture the target and, on the other hand, an oligonucleotide containing an aptamer sequence that recognizes the target. This oligonucleotide is then amplified using the classical LAMP method with four primers. However, the complex design of the four primers essential to the LAMP amplification method makes this process complex and expensive to implement. Finally, a method for detecting micro-RNAs (mi-RNAs) by a method LAMP with two primers has been developed [3,4]. This method has the advantage of being quantitative. However, it only allows the detection of RNA from which a complementary DNA fragment (cDNA) is formed by means of a reverse transcription reaction. Two hairpin DNA probes, designated H1 and H2 in Du et al., 2016 [4], are designed. Probe H1 has an extension at its 3° end that is complementary to half of the cDNA fragment, and probe H2 has an extension at its 5' end that is complementary to the other half of the cDNA fragment. In the presence of the cDNA fragment, probes H1 and H2 hybridize to it, and if no mismatch exists between the extensions of probes H1 and H2 and the cDNA fragment, a covalent bond between the two DNA probes H1 and H2 can be formed using a high-fidelity ligase such as Tag DNA ligase.It is therefore clear that this method for detecting miRNAs is not generic, as it requires the preparation of two probes specific to each miRNA to be detected. Furthermore, this method involves several steps before implementing the LAMP technique, including a reverse transcription step and a ligation step, the latter potentially complex with a low yield and the need for an additional enzyme. Despite this, in their publication Du et al, 2016 [4], the authors emphasize that this step is crucial, particularly for better discrimination of mutations in miRNAs (sentence bridging the columns on page 12722). There is therefore a real need for a method to detect molecules of interest of various kinds in a sample that does not present the drawbacks of prior art methods. The inventors have thus set themselves the goal of solving this technical problem. Description of the invention The present invention solves the technical problems and drawbacks listed above. The inventors have proposed a method for detecting and, optionally, quantifying an analyte using an oligonucleotide tool that takes advantage of the benefits of two-primer LAMP amplification, namely, an isothermal and quantifiable method requiring only two primers. Thus, the LAMP amplification of the detection method according to the invention is faster, less complex, and less expensive due to the reduced number of primers. Furthermore, the method according to the present invention uses at most one antibody specific to the analyte to be detected and may even require no antibody at all. The oligonucleotide tool used in the present invention is a double stem-loop oligonucleotide. The expressions and term "double stem-loop oligonucleotide," "two stem-loop oligonucleotide," "Dumbbell-structured oligonucleotide" and "dumbbell" are equivalent and can be used interchangeably within the framework of the present invention. The inventors have shown that it is possible to introduce, into any portion of this dumbbell, a specific sequence of the analyte to be detected without inhibiting the two-primer LAMP amplification (see section II of the experimental part below). It is also possible to introduce several specific sequences, identical or different, of the analyte to be detected into one or more portions of this dumbbell, thereby significantly improving the sensitivity of the detection method. Alternatively, a dumbbell can be used in which several specific sequences of different analytes to be detected are present, thus enabling the detection of one or more of these analytes in a liquid of interest. In this implementation, the specificity of the detection, if desired, is ensured by the probe, which is capable of binding a given analyte and is immobilized on the surface of a solid support. The double stem-loop oligonucleotide implemented within the framework of the present invention is clearly distinct from the double stem-loop oligonucleotides of the prior art. Indeed, in a detection method such as that described by Pourhassan-Moghaddam et al., 2013 [2], such an oligonucleotide is one of the products generated during a four-primer LAMP amplification. In contrast, in the context of the present invention, this oligonucleotide is a synthetic reagent present prior to contact between the surface on which the analyte to be detected is immobilized and the various elements necessary for LAMP amplification, such as primers and the enzyme catalyzing this amplification. Similarly, the double stem-loop oligonucleotide implemented in the present invention is clearly distinct from the oligonucleotide described in [3,4]. The latter is necessarily produced in the presence of the analyte to be detected, since the cDNA obtained from this analyte serves as a template during the ligation step resulting in a double stem-loop oligonucleotide. In the present invention, the oligonucleotide is synthesized in the absence of the analyte to be detected. Furthermore, in the oligonucleotide described in [3,4], the sequence between the stems of the two stem-loop structures does not, strictly speaking, correspond to a specific recognition sequence of the mi-RNA to be detected, since, due to the intermediary that is the cDNA, this sequence is the DNA version of the mi-RNA sequence and therefore does not constitute a specific recognition sequence of the mi-RNA to be detected capable of binding specifically to the mi-RNA.Finally, while the portion between the stems of the two stem-loop structures is essential to the process described in [3,4], the inventors of the present have shown that it is possible to use oligonucleotides with a double stem-loop structure that do not exhibit a . such portion {see point III of the experimental part below). Thus, the present invention relates to a method for detecting and possibly quantifying an analyte possibly present in a liquid sample, comprising the following steps: 1) bring said liquid sample into contact with the surface of a solid support comprising at least one active zone on which at least one probe capable of binding said analyte is immobilized; ii) bring said surface into contact with a solution containing at least one oligonucleotide with a double stem-loop structure, capable of binding to said analyte, said oligonucleotide having been synthesized prior to said contact; iii) wash said surface; (iv) bring said surface into contact with two loop-mediated isothermal amplification primers under conditions permitting amplification of said oligonucleotide: (v) detect and possibly quantify the product of the amplification of said oligonucleotide (whereby said analyte is detected and possibly quantified). The liquid sample used in the context of the present invention is a liquid capable of containing the analyte to be detected and possibly quantified. It can be of very diverse nature and origin. This liquid sample is advantageously chosen from the group consisting of a biological fluid; a plant fluid such as sap, nectar and root exudate; a sample taken from a culture medium or from a biological culture reactor such as a cell culture of higher eukaryotes, yeasts, fungi or algae; a liquid obtained from one (or more) animal or plant cell(s); a liquid obtained from animal or plant tissue; a sample taken from a food matrix; a sample taken from a chemical reactor; municipal, river, sea, swimming pool, cooling tower or groundwater; a sample taken from a liquid industrial effluent; wastewater from, in particular, intensive livestock farms or industries in the chemical, pharmaceutical or cosmetic fields; a sample taken from an air filter or a coating;a sample taken from an object such as a fragment of fabric, a garment, a sole, a shoe, a tool or a weapon; a pharmaceutical product; a cosmetic product; a perfume; a soil sample or a mixture thereof. In the context of the present invention, "sampling" means any type of sample collection, for example, by contact, scraping, drilling, cutting, punching, grinding, washing, rinsing, suction or pumping. The biological fluid is advantageously chosen from the group consisting of blood such as whole blood or anticoagulated whole blood, blood serum, plasma Blood, lymph, saliva, sputum, tears, sweat, semen, urine, feces, milk, cerebrospinal fluid, interstitial fluid, isolated bone marrow fluid, mucus or fluid from the respiratory, intestinal, or genitourinary tract, cell extracts, tissue extracts, and organ extracts. Thus, biological fluid can be any fluid naturally secreted or excreted from a human or animal body, or any fluid recovered from a human or animal body by any technique known to those skilled in the art, such as extraction, sampling, or washing. The steps of recovering and isolating these various fluids from the human or animal body are carried out prior to implementing the process according to the invention. Similarly, if one of the envisaged samples does not allow the implementation of the process of the invention, for example due to its gaseous or solid nature, its concentration or the elements it contains such as solid residues, waste, suspension or interfering molecules, the process of the invention further includes a preliminary step of preparing the liquid sample with possibly dissolving the sample by techniques known to those skilled in the art such as filtration, precipitation, dilution, distillation, mixing, concentration, lysis, etc. The analyte to be detected and possibly quantified in the liquid sample can be chosen from the group consisting of a molecule of environmental interest such as a pesticide; a molecule of biological interest; a molecule of pharmaceutical interest; a toxin; a carbohydrate such as glucose; a lipid such as cholesterol; a peptide; an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a nuclear or membrane receptor; an agonist or antagonist of a nuclear or membrane receptor; a hormone; a polyclonal or monoclonal antibody; an antibody fragment such as a Fab, F(ab), Fv fragment or a hypervariable domain (or CDR for "Complementarity Determining Region"); a nucleotide molecule; ions such as mercury or lead ions; a eukaryotic cell; a prokaryotic cell and a virus. The term "nucleotide molecule" used herein is equivalent to the following terms and expressions: "nucleic acid", "polynucleotide", "nucleotide sequence", "polynucleotide sequence". For the purposes of this invention, "nucleotide molecule" means a chromosome; a gene; a regulatory polynucleotide; DNA, single-stranded or double-stranded, genomic, chromosomal, chloroplast, plasmid, mitochondrial, recombinant or complementary; a total RNA; a messenger RNA; a ribosomal RNA (or ribozyme); a transfer RNA; a microRNA; an aptamer sequence; or a portion or fragment thereof. Note that, in certain implementations, the analyte to be detected and possibly quantified in the liquid sample can be defined as a small molecule, i.e., a molecule with a molecular weight less than or equal to 10,000 daltons, and in particular less than or equal to 8,000 daltons. This small molecule can belong to any of the elements in the analyte lists above. Step i) of the method according to the present invention employs a probe capable of binding said analyte immobilized on the surface of a solid support. The probe used to functionalize an active region of the solid support surface is any molecule capable of forming a bond pair with the analyte to be detected, the probe and the analyte corresponding to the two partners of this bond pair. The bonds involved in the analyte-probe interaction are advantageously either non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals forces, or high-energy bonds such as covalent bonds. The probe used is therefore dependent on the analyte to be detected. Depending on this analyte, a person skilled in the art will be able to choose the most suitable probe without inventive effort. It can be chosen from the group consisting of a carbohydrate; a peptide; an antigen; an epitope; a protein; a glycoprotein; an enzyme; an enzyme substrate; a membrane or nuclear receptor; an agonist or antagonist of a membrane or nuclear receptor; a toxin; a polyclonal or monoclonal antibody; an antibody fragment such as a Fab, F(ab*), Fv fragment or a hypervariable domain; a nucleotide molecule as previously defined; a peptide nucleic acid; and an aptamer. Any solid support suitable for implementing the present invention is usable. This could be, for example, a biochip support such as those classically used in silicon, glass, metal, polymer, or plastic. This solid support could also consist of particles, and in particular silica particles, polymeric particles, and / or magnetizable particles. The functionalization of the active zone of the solid support surface by a probe as previously defined can be achieved by any suitable technique enabling the attachment of a compound to a solid support. In particular, simple adsorption, ionic bonding, hydrogen bonding, electrostatic interactions, hydrophobic interactions, Van der Waals interactions, or covalent grafting can be considered. In a particular embodiment of the present invention, the surface of the solid support has functional groups by means of which the probe(s) is / are able to become immobilized. Advantageously, these functional groups are selected from among carboxylic groups, radical entities, alcohol, amine, amide, epoxy, or thiol functions. These groups are carried, from intrinsically or through functionalization, by the active zone of the solid support surface. The probe(s) may also exhibit such functional groupings, intrinsically or through functionalization. In a first embodiment of the present invention, the probe(s) can be immobilized directly at the functionalized or non-functionalized surface. A solid support coated with a protein such as streptavidin is an example of direct immobilization, in which the probe must be functionalized with biotin. In a second embodiment of the present invention, the probe(s) can be immobilized indirectly at the level of the functionalized or non-functionalized surface. This indirect immobilization involves a spacer arm (or joining agent) bonded, on one side, to the surface and, on the other side, to a probe. Illustrative examples include silane reagents used for grafting probe(s) onto glass, complexing thiol products onto gold surfaces, and immobilizing probe(s) in polymer matrices. The bonds used during direct or indirect immobilization can be any type of bond known to those skilled in the art, including covalent bonds, ionic bonds, hydrogen bonds, electrostatic interactions, hydrophobic interactions, Van der Waals forces, or adsorption. Advantageously, a surface blocking step can be performed prior to probe fixation. The blocking solution used in this blocking step can include one or more of the following components: albumin such as BSA (Bovine Serum Albumin), gelatin, casein, milk protein, whey, polyethylene glycol, and polymers such as polyvinylpyrrolidone. Step 1) of the process according to the invention consists of bringing the liquid sample as previously defined into contact with the surface of a solid support functionalized by one or more probe(s) capable of binding the analyte to be detected, whereby, if the liquid sample contains this analyte, the latter is captured at the level of the probe(s). Typically, step i) of contact can last between 1 min and 24 h, between 2 min and 12 h, between 5 min and 6 h, between 10 min and 3 h, between 15 min and 2 h, between 20 min and 1 h, and, in particular, on the order of 30 min (i.e., 30 min + 5 min). Furthermore, step i) of contact can be carried out at a temperature between 4°C and 100°C, in particular between 10°C and 60°C, especially between 15 and 45°C, and, more particularly, at room temperature (i.e., 23°C + 5°C) or at physiological temperature (i.e., 37°C + 5°C). Following step 1) and prior to step ii) of the process according to the present invention, the surface of the solid support can be washed to remove elements present in the liquid sample that were not captured by the probe(s). However, This additional washing step is optional since these elements can be eliminated later, particularly during washing step iii). If this optional washing step is implemented, the surface of the solid support is subjected to at least one rinse to remove all traces of the liquid sample. This rinse is typically performed with an aqueous rinsing solution that preserves the probe / analyte interaction or irreversibly binds the analyte and the probe. This solution can also eliminate non-specific interactions. It may contain one or more of the following components: a buffer such as Tris, phosphate, acetate, or borate buffer; salts such as KCl, NaCl, (NH₄)SO₄, MgCl₂, or CaCl₂; detergents or surfactants such as Tween®, Triton®, or sodium dodecyl sulfate (or SDS); denaturing agents such as formamide or dimethyl sulfoxide; an organic solvent such as ethanol, methanol, or acetonitrile; and bridging agents such as formaldehyde or glutaraldehyde.This rinsing can be repeated two, three, five, ten, or even fifty times, using the same or a different rinsing solution for each rinse. Typically, the rinsing is repeated three times with a solution containing phosphate-buffered saline (or PBS) and 0.1% Tween® 0.1%. Furthermore, when this optional washing step is implemented, it is carried out at a temperature between 4°C and 100°C, in particular between 10°C and 60°C, in particular between 15°C and 45°C and, more specifically, at room temperature or physiological temperature. Step ii) of the method according to the present invention consists of contacting the surface of the solid support on which the analyte to be detected is optionally retained via the probe(s) functionalizing this surface with a solution containing at least one oligonucleotide with a double stem-loop structure, capable of binding to said analyte. Whereby, if this analyte is present on the surface of the solid support, the oligonucleotide binds to it. In other words, the oligonucleotide with a double stem-loop structure is capable of forming a bond pair with the analyte to be detected, the oligonucleotide and the analyte corresponding to the two partners of this bond pair. The bonds involved in the oligonucleotide-analyte interaction are advantageously non-covalent and low-energy bonds such as hydrogen bonds or Van der Waals forces. As previously explained, the oligonucleotide was synthesized prior to the contact in step ii). In other words, this synthesis is carried out neither in the presence of the solid support surface functionalized by the probe(s) as previously defined, nor in the presence of the analyte to be detected. Typically, the synthesis of this stem-loop oligonucleotide does not involve two of the primers usually used in a LAMP amplification. four primers. Advantageously, this synthesis is a chemical synthesis classically used to prepare oligonucleotides. The oligonucleotide with a double stem-loop structure implemented in step ii) corresponds to formula (I) or (II) below: [Chem.1] L'-Fic-F2-FO"-Fi-Int-Bic-BO'-B7c-B1-3" an [Chem.2] S'-Fic-F2-FO'-F1-Bic-BO"-B2c-B1-3" fn) in which: The F1c portion has a nucleotide sequence complementary to the nucleotide sequence of the F1 portion, whereby the F1c and F1 portions hybridize to form the stem of the first stem-loop structure. the portion F2-F0" forms the loop of the first stem-loop structure, hereinafter referred to as loop FO, portion B1 has a nucleotide sequence complementary to the nucleotide sequence of portion B1c, whereby portion B1 and portion B1c hybridize to form the stem of the second stem-loop structure. the portion BO”-B2c forms the loop of the second stem-loop structure, hereinafter referred to as loop BO, and the Int portion separates the F1 portion and the B1c portion includes at least one nucleotide. In the context of the present invention, two nucleotide sequences are complementary to each other when a sufficient number of nucleotides from the first nucleotide sequence can bind, by means of hydrogen bonds, to the corresponding nucleotides of the second nucleotide sequence such that pairing between the two nucleotide sequences can occur. "Complementarity," as used here, refers to the pairing capacity between the nucleotides of a first nucleotide sequence and a second nucleotide sequence. Non-complementary nucleotides between two nucleotide sequences may be tolerated provided that the two nucleotide sequences remain capable of specifically hybridizing to each other.Furthermore, a first nucleotide sequence can hybridize onto one or more segments of a second nucleotide sequence in such a way that the intermediate or adjacent segments are not. involved in hybridization. In certain forms of implementation of the invention, a first nucleotide sequence or a specific part thereof, is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a second nucleotide sequence or a specified part thereof. In the double stem-loop oligonucleotide implemented in the invention, the nucleotide at the 5' end of portion F1c is linked, by means of hydrogen bonds, with the corresponding nucleotide in portion F1 and the nucleotide at the 3' end of portion B1 is linked, by means of hydrogen bonds, with the corresponding nucleotide in portion Blc. Typically, in the double stem-loop oligonucleotide implemented in the invention, the F1 portion and the Flc portion each comprise from 10 to 35 nucleotides, in particular between 15 and 25 nucleotides and, by way of particular example, 21 nucleotides. The melting temperature (Tm) of F1-F1c is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art may find additional information concerning these portions in [1]. Typically, the B1 and B1c portions each comprise 10 to 35 nucleotides, particularly between 15 and 30 nucleotides and, as a specific example, 25 nucleotides. The temperature Tm of B1-BIc is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art can find additional information regarding these portions in [1]. In particular, the F2 portion comprises 8 to 25 nucleotides and, as a particular example, 18 nucleotides, and the FO portion is such that the FO loop comprises 10 to 70 nucleotides. In addition, the B2c portion comprises 8 to 35 nucleotides, notably between 15 and 30 nucleotides and, as a particular example, 18 nucleotides, and the BO® portion is such that the BO loop comprises 10 to 70 nucleotides. In the oligonucleotide of formula (I), the Int portion can comprise up to 70 nucleotides. Advantageously, the double stem-loop oligonucleotide implemented in the process according to the present invention comprises fewer than 200 nucleotides, in particular fewer than 180 nucleotides, more particularly fewer than 170 nucleotides, more particularly fewer than 160 nucleotides, and especially fewer than 150 nucleotides. With such a small size, the chemical synthesis of this oligonucleotide is facilitated, and the cost of this synthesis, and consequently the cost of the process according to the invention, is reduced. The oligonucleotide with a double stem-loop structure implemented in the process according to The present invention is capable of binding to the analyte to be detected. In other words, the nucleotide sequence of this oligonucleotide contains at least one sequence specific to the analyte to be detected, such as, for example, an aptamer or a transcription factor, or at least one sequence complementary to a portion of the nucleotide sequence of the analyte to be detected when the latter is a nucleotide molecule as previously defined. This sequence, i.e., the sequence specific to the analyte to be detected or the sequence complementary to a portion of the nucleotide sequence of the analyte, may be located in any one or more of the portions of the oligonucleotide as previously defined.For example, this sequence may be found in portion F1, in portion Flc, in portion B1, in portion B1c, in portion F0*, in portion F2, in portion Int, in portion B2c, in portion BO, in both portion F1c and portion F2, in both portion F2 and portion F0', in both portion F0® and portion F1, in both portion F1c and portion Int (oligonucleotide of formula (I)), in both portion F1c and portion B1 (oligonucleotide of formula (II)), in both portion Int and portion B1c (oligonucleotide of formula (I)), in both portion B1c and portion BO°, in both portion BO° and portion B2c, in both portion B2c and portion B1.As previously mentioned, the stem-loop double oligonucleotide can comprise several sequences specific to one or more analytes to be detected and / or several sequences complementary to a portion of the nucleotide sequence of one or more analytes to be detected. These different sequences may be located, within the oligonucleotide, in the same portion or in different portions as previously defined. Furthermore, in a specific implementation, the stem-loop oligonucleotide can include at least one sequence specific to the probe used to bind the analyte to be detected, or at least one sequence complementary to a portion of the probe's nucleotide sequence when the latter is a nucleotide molecule as previously defined. In this implementation, particularly useful for miRNAs and small molecules, the oligonucleotide binds to the analyte-probe pair, thereby providing stronger specific binding. It is clear that the oligonucleotide must not, at the chosen contact temperature, simply bind to the probe to avoid false positives.Similarly, the specific sequence(s) of the probe or the sequence(s) complementary to a part of the nucleotide sequence of the probe when the latter is a nucleotide molecule must be different from the specific sequence(s) of the analyte to be detected and from the sequence(s) complementary to a part of the nucleotide sequence of the analyte when the latter is a . nucleotide molecule. This particular implementation is illustrated in points V.2 and V.3 below. Everything previously specified for the analyte-specific sequences to be detected and the sequences complementary to a portion of the analyte's nucleotide sequence, and in particular their location within the oligonucleotide sequence, applies mutatis mutandis to the probe-specific sequences and the sequences complementary to a portion of the probe's nucleotide sequence. In step ii) of the process according to the present invention, the surface of the solid support, on which at least one analyte is optionally held by means of a probe, is brought into contact with a solution containing at least one oligonucleotide with a double stem-loop structure as previously defined. This solution is advantageously an aqueous solution that allows for the dumbbell / analyte interaction. It may comprise one or more of the following components: a buffer such as Tris, phosphate, acetate, or borate buffer; salts such as KCl, NaCl, (NH₄):SO₄, MgCl, or CaCl₂; detergents or surfactants such as Tween®, Triton®, or sodium dodecyl sulfate (or SDS); denaturing agents such as formamide or dimethyl sulfoxide; an organic solvent such as ethanol, methanol, or acetonitrile; and bridging agents such as formaldehyde or glutaraldehyde.Advantageously, when the oligonucleotide includes an aptamer sequence for analyte recognition, the solution used will be composed entirely or partially of the components constituting the aptamer selection buffer. The solution used in step ii) may, in addition, include one or more components selected from genomic DNA, serum, albumin, a synthetic polymer, and any other component that limits non-specific adsorption. Furthermore, the stem-loop double-structure oligonucleotide is present in this solution in an amount between |aM and |mM, and in particular between 100 aM and |M. Specific examples of usable concentrations include 10 pM, 100 pM, |nM, or 10 nM. Advantageously, the oligonucleotide with a double stem-loop structure is present in the solution used in step ii) at a concentration of 100 pM. Typically, step (ii) of contact can last between 1 min and 24 h, between 2 min and 12 h, between 5 min and 6 h, between 10 min and 3 h, between 15 min and 2 h, between 20 min and 1 h and, in particular, on the order of 30 min (i.e. 30 min + 5 min). Similarly, step (ii) of contact can be carried out at a temperature between 4°C and 100°C, in particular between 10°C and 60°C, especially between 15 and 30°C and, more particularly, at room temperature (i.e. 23°C + 5°C) or at physiological temperature (i.e. 37°C + 5°C). Following step ii) and prior to LAMP amplification, the surface of the solid support must be washed to remove any elements that could give false positives, such as, for example, oligonucleotides with a double stem-loop structure. not specifically related to the analyte to be detected or related to elements not related to the probes functionalizing the surface of the solid support. This is step iii) of the method according to the present invention. During this step, the surface of the solid support is subjected to at least one rinse, typically performed with a rinsing solution consisting of an aqueous solution that either preserves the weight / analyte interaction or irreversibly binds the analyte and the weight. This solution can also eliminate non-specific interactions. It may contain one or more of the following components: a buffer such as Tris, phosphate, acetate, or borate buffer; salts such as KCl, NaCl, (NH₄), SO₄, MgCl₂, or CaCl₂; detergents or surfactants such as Tween®, Triton®, or sodium dodecyl sulfate (or SDS); denaturing agents such as formamide or dimethyl sulfoxide; an organic solvent such as ethanol, methanol, or acetonitrile; and bridging agents such as formaldehyde or glutaraldehyde. This rinsing can be repeated two, three, five, 10 and even 50 times using the same or a different rinsing solution for each rinse.Typically, rinsing is repeated three times with a solution comprising PBS and 0.1% Tween® 0.1%. Furthermore, step iii) is carried out at a temperature between 4°C and 100°C, in particular between 15°C and 80°C, especially between 30°C and 60°C and, more particularly, at a temperature of around 40°C (i.e. 40°C + 5°C). Step iv) of the process according to the invention is the two-primer LAMP amplification proper. The only two primers used in this step correspond respectively to formula (III) and formula (IV) below: [Chem.3] 5'-Fic-F2-3° {HD [Chem.4] 5'-B1c-B2-3° {v; Portion B2 has a nucleotide sequence complementary to the nucleotide sequence of portion B2c, portions F1c, F2, B1c and B2c being as previously defined. Formula (III) or formula (IV) primers are respectively called, in four-primer LAMP amplification, FIP primer (for "Forward Inner Primer") and BIP primer (for "Backward Inner Primer"). The temperature Tm of B2-B2c is notably higher than the temperature used during amplification and, in particular, above 5°C to 7°C. Those skilled in the art may find additional information regarding these portions in [1]. The temperature Tm of F2-F2c is notably higher than the temperature used during amplification and, in particular, 5°C to 7°C higher. Those skilled in the art can find additional information regarding these portions in [1]. It should be noted that, in step iv) of the process according to the present invention, the analyte is not used as a primer for LAMP amplification. Step iv) of the process according to the present invention consists of bringing into contact the surface on which one or more probes specific to the analyte to be detected are immobilized with a reaction mixture comprising the primers FIP and BIP and any element necessary for the production of an amplification product if the oligonucleotide with a double stem-loop structure is present. Typically, the reaction mixture used in step iv) includes a suitable buffer, such as phosphate buffer or Tris buffer; deoxyribonucleosides (ANTPs), such as an equimolar mixture of dATP, dCTP, dGTP, and dTTP; and a LAMP amplification-catalyzing enzyme. Such an enzyme is a polymerase with high strand-displacement activity in addition to replication activity. Specific examples of such enzymes include those listed below: - Bst DNA polymerase, - Bca (exo-) DNA polymerase, - Klenow fragment of DNA polymerase 1, - Vent DNA polymerase, - Vent(Exo-) DNA polymerase (exonuclease activity-free Vent DNA polymerase), - DeepVent DNA polymerase, - DeepVent(Exo-) DNA polymerase (DeepVent DNA polymerase without exo-nuclease activity), - 29 phage DNA polymerase, - MS-2 phage DNA polymerase, - Z-Taq DNA polymerase (Takara Shuzo), and - KOD DNA polymerase (TOYOBO). The reaction medium may also include salts such as magnesium salts, manganese salts and / or ammonium salts; detergents and / or elements useful for the detection and quantification of the amplification product of the double stem-loop oligonucleotide such as, for example, calcein, an intercalating dye such as, for example, propidium iodide, SYTO 9, SYBR green and EvaGreen. Step iv) of the process according to the present invention is carried out during a a period of time and at a temperature sufficient for the production of an amplification product if the oligonucleotide with a double stem-loop structure is present. Advantageously, this step is carried out under isothermal conditions, and in particular at a temperature between 15°C and 90°C, specifically between 50°C and 80°C, and more particularly around 65°C (i.e., 65°C + 5°C). The duration of step iv) of the process according to the present invention is between 1 min and 120 min, specifically between 5 min and 90 min, and in particular between 15 min and 60 min. Step v) consists of detecting and possibly quantifying the amplification product of the double stem-loop oligonucleotide and therefore detecting and possibly quantifying the analyte to which the double stem-loop oligonucleotide is bound since the accumulation of the amplification product is an indicator of the presence of this analyte immobilized on the surface of the solid support. Step v) can be carried out simultaneously with or after step iv). A person skilled in the art is familiar with various techniques for performing this detection. The amplification product can be detected in step v) by measuring the turbidity caused by the magnesium pyrophosphate precipitated in solution as a by-product of the amplification. This measurement can be carried out visually or using a turbidity meter. The amplification product can be detected, during step v), by a pH probe allowing monitoring of the acidification of the reaction mixture during LAMP amplification. The amplification product can be detected, during step v), via gel electrophoresis. The amplification product can also be detected, during step v), by a colorimetric test or by fluorescence measurement, particularly when calcein or a fluorescent intercalating dye is present in the reaction mixture. When quantification of the analyte is required during step v) of the process according to the present invention, this quantification is performed by comparison with a standard range of analytes at known concentrations. This quantification is a standard step in the ELISA method. The present invention also relates to a double stem-loop oligonucleotide that can be used in the process according to the present invention; said oligonucleotide corresponds to formula (II) below: [Chem.5] S°-Fic-F2-FO"-F1-Bic-BO"-B2e-B1I-3" sb in which portion F1, portion F2, portion F0”, portion F1, portion Block, portion BO”, portion B2c and portion B1 are as previously defined. Brief description of the drawings [fig.1] presents the principle diagram of the detection of DNA according to the method according to the invention in which the solid support is a magnetic bead. [Fig. 2] shows the amplification curves of the DNA target according to the protocol described in section II.1. Solutions "reaction 1" and "reaction 2" are duplicates containing the beads, the 100 nM DNA probe, the 100 nM target, and the 100 pM dumbbell. The negative control contains the beads and the 100 pM dumbbell with rinsing. The positive controls "100 pM" and "1 pM" contain the beads and the dumbbell without the target, and no rinsing was performed. Figure 3 shows the amplification curves of the DNA target according to the protocol described in section II.1 with an amplification range. The dashed curves labeled "Tro4cZip6" represent solutions containing the beads, the DNA probe, the DNA target at concentrations ranging from 10 nM to 1 pM, and the dumbbell at 100 pM. The negative control, "control neg," contains the beads and the dumbbell at 100 pM without the target. The positive controls are represented by the curves labeled "range." They contain the beads, a complementary probe, a portion of the dumbbell, and the dumbbell. [Fig. 4] shows the amplification curves of the DNA target according to the protocol described in section II.2. Solutions "reaction a" and "reaction b" are duplicates containing the beads, the 100 nM DNA probe, the 100 nM DNA target, and the 100 pM dumbbell. The negative control contains the beads and the 100 pM dumbbell with rinsing. The positive controls "100 pM" and "100 pM" contain the beads and the dumbbell without the target, and no rinsing was performed. [Fig. 5] shows the amplification curves of the DNA target with an amplification range according to Protocol III. The dashed curves labeled "Tro4cZip6" represent solutions containing the beads, the DNA probe, the DNA target at concentrations ranging from 1 nM to 100 fM, and the dumbbell containing no nucleotides in the Int portion at 100 pM. The negative control contains the beads and the dumbbell at 100 pM without the target. The positive controls are represented by the curves labeled "range." They contain the beads, a probe complementing a portion of the dumbbell, and the dumbbell. Figure 6 shows the variation of the logarithm of the target DNA concentration as a function of the threshold cycle (Ct). The experimental points for the positive controls in Figure 5 are shown in black. The experimental points for the detection range containing the target DNA Tro4cZip6 are shown in gray. [fig.7] presents the schematic diagram of the detection of a protein according to the method according to the invention in which the solid support is a magnetic bead. Figure 8 shows the troponin detection amplification curves. The "troponin 100 nM" and "troponin 10 nM" solutions contain the beads, the 100 nM antibody probe, troponin at 100 nM and 10 nM respectively, and the 100 pM weight. The negative control contains the beads and the 100 pM weight with rinsing. [fig.9] presents the principle diagram of the detection of a protein according to the method according to the invention in which the solid support is a magnetic bead and two protein-specific aptamers are used. [fig.10] presents the principle diagram of the detection of a mi-RNA according to the method according to the invention in which the solid support is a magnetic bead. [fig.11] presents the principle diagram of the detection of a small molecule according to the method according to the invention in which the solid support is a magnetic ball. DETAILED DESCRIPTION OF SPECIFIC METHODS OF IMPLEMENTATION Ld Preliminary Experiments. The inventors carried out a first experiment comparing LAMP amplification with 4 primers of a linear strand of 200 bases of DNA and amplification with 2 or 4 primers of an oligonucleotide with two stem-loop structures. The results showed, on the one hand, the absence of possible quantification by a four-primer LAMP amplification of a 200-base linear DNA strand and, on the other hand, the speed of two-primer LAMP amplification of an oligonucleotide with two stem-loop structures compared to a four-primer LAMP amplification. Furthermore, the inventors investigated two-primer LAMP amplification of solutions of the same oligonucleotide with two stem-loop structures at different concentrations (100 pM, 10 pM, 1 pM, 100 fM, 10 fM, 1 fM, and 100 aM). This work demonstrated that two-primer LAMP amplification works up to a DNA concentration of 100 aM in less than 60 minutes. IT. Method for detecting DNA according to the present invention with an oligonucleotide of formula (D. IT.1. Recognition site in the FO loop of said oligonucleotide. The target DNA to be detected designated Tro4cZip6 corresponds to the sequence TAA- GAGGGGCAGCGCATGAGAAAGGTTGGCGTACTGCACGGACCGGTATGCGA CCTGGTATGC (SEQ ID NO: 1 in the sequence listing in the appendix). The basic diagram of DNA detection according to the method of the invention as implemented to detect this target DNA is shown in Figure 1. Biotinylated probe DNA sequences, designated Zip6cbio, complementary to a portion of the target DNA sequence and of the sequence CGCATACCAGGTCGCA- TACCGGTC (SEQ ID NO: 2 in the attached sequence list) at 100 nM are incubated with 200 picograms of streptavidin-coated magnetic microbeads at 25°C for 30 min to immobilize them on the microbeads. Then, the microbeads are aggregated using a magnet and rinsed three times with a solution containing PBS and 0.1% Tween® 0.1%. Next, the 100 nM target DNA is incubated in the solution containing the microbeads at 37°C for 30 min, and three rinses are performed as before. The third step consists of incubating, at 37°C for 30 min, 100 pM of a two-stem-loop oligonucleotide containing, in its F0 loop, a probe complementary to a portion of the target DNA to be detected. This oligonucleotide has the sequence CGGATCCAAGACGCGGTTTATCGTGCAGTACGCCAACCTTTCTCATGCGCT GCCCCTCTTAATAAACCGCGTCTTGGATCCGTGACATCTCTGAGTTATATCT TTCCCCCCCTCACTGACCCTCCTTCGGGGGAAAGATATAACTCAGAGATG (SEQ ID NO: 3 in the sequence list in the appendix). Then, the microbeads are aggregated using a magnet and rinsed three times with a solution containing PBS and 0.1% Tween® 0.1%, at 40°C. Finally, after the last rinsing step, the two primers FIP and BIP and the Bst 2.0 DNA Polymerase enzyme (New England Biolabs) required for LAMP amplification are added. The FIP primer has the sequence CGGATCCAA-GACGCGGTTTATCGTGCAGTACGCCAACCTTTCTCA (SEQ ID NO: 4 in the sequence list in the appendix) and the BIP primer has the sequence CATCTCTGAGT-TATATCTTTCCCCCGAAGGAGGGTCAGTGAGG (SEQ ID NO: 5 in the sequence list in the appendix). Amplification is performed at a temperature of 65°C. The results of this amplification are shown in Figure 2. The curves labeled "reaction 1" and "reaction 2" show that detection of the DNA target is possible in approximately 20 minutes. These curves are superimposed on the positive control curve containing 100 pM dumbbell, while the negative control is amplified after only 30 minutes. The amplification of the negative control is due to dumbbell residues that were not completely removed during rinsing. The significant difference (more than 10 minutes) between the Ct values ​​of the "reaction" curves and the negative control confirms that the method used is capable of detecting a DNA target in a buffered medium. This experiment therefore validates the detection of DNA by two-primer amplification in accordance with the method according to the invention. The inventors conducted further experiments. A range of quantifications was performed to define the sensitivity limit of the method. The resulting amplification curves are shown in Figure 3. The experimental curves shown in Figure 3 highlight the aspect The quantitative aspect of the method, on the one hand, and the detection limit reached so far, on the other. Indeed, the curves obtained from the range performed between 10 nM and |pM of target show that it is possible to quantify a DNA target in a sample from a simultaneously established standard curve, according to the same principle as the standard curve of an ELISA test. The detection limit achieved in this experiment was 100 pM of target DNA. However, various optimizations have since been carried out, making it possible to reach a detection limit of 10 pM in a complex medium. Similarly, experiments using other probes and other DNA targets to be detected were carried out in order to validate the generic nature of the process. Finally, experiments identical to the previous ones but carried out in a blood plasma type medium validated the detection method in a complex medium. II.2. Recognition site in the BQ loop of said oligonucleotide. This experiment is similar to the experiment in section II.1 above, using the same DNA probe, the same oligonucleotide with a double stem-loop structure, and the same procedure, but a new DNA target recognized by a different part of the oligonucleotide is detected. This target has the sequence GAAGGAGGGTCAGT-GAGGGACCGGTATGCGACCTGGTATCG (SEQ ID NO: 6 in the sequence list in the appendix). Its recognition site in the oligonucleotide is located in the stem-loop. The results obtained and presented in Figure 4 show that the position of the probe complementary to the target in the oligomer does not inhibit two-primer amplification. II. Method for detecting DNA according to the present invention with an oligonucleotide of formula (IT). A dumbbell of formula (IT), that is to say not containing oligonucleotide in the Int portion, and therefore shorter than the one previously used of formula (I) was chemically synthesized. This oligonucleotide has the sequence CGGATCCAAGACGCGGTTTATCGTGCAG- TACGCCAACCTTTCTCAATAAACCGCGTCTTGGATCCGCATCTCTGAGTTAT ATCTTTCCCCCCCTCACTGACCCTCCTTCGGGGGAAAGATATAACTCAGAG ATG (SEQ ID NO: 7 in the sequence list in the appendix). The detection procedure performed is identical to that described in section II.1. The probe DNA is the sequence named SEQ ID NO: 2 in the sequence list in the appendix. The FIP and BIP primers are identical to those described in section II.1. The target to be detected is the sequence named SEQ ID NO: 6 in the sequence list in the appendix. The dumbbell used is the one described above. The procedure is identical to that described in point IL.1. The amplification curves obtained are shown in Figure 5. The results in Figures 5 and 6 first demonstrate that the amplification of a dumbbell of formula (II) is functional. Second, they show that the amplification is accelerated due to the reduced length of the dumbbell. The detection limit reached is 100 pM. This experiment therefore validates the claim that the Int portion is optional in the dumbbell. TV. Method for detecting a protein according to the present invention with an oligonucleotide of formula (D. In this experiment, the method according to the present invention is used to detect a protein, troponin, in a sandwich-type format by two-primer LAMP amplification as schematically shown in Figure 7. The same protocol as described in section II.1 is used, but the first DNA probe is replaced by a biotinylated anti-troponin antibody, Anti-h cTnI 9701 SPRN-5 (Medix Biochemica). The target to be detected is now troponin, rather than a DNA sequence. The SEQ ID NO: 3 sequence stop in the attached sequence list contains a troponin-specific aptamer probe. The results obtained and presented in Figure 8 demonstrate the possibility of detecting troponin by the method according to the present invention. V. Other forms of implementation of the process according to the present invention. V.1. Detection of proteins with two aptamers. The detection method according to the invention can also be used to detect a protein in a sandwich-like format with two target-specific aptamers. Therefore, the antibody probe from the experiment described in section IV above is replaced by a biotinylated aptamer according to the schematic diagram shown in Figure 9. V.2. Detection of miRNAs. Another target that can be considered is short RNA oligonucleotides or microRNAs (miRNAs), such as cardiac miRNAs. As described by Wang et al., 2010 [5], these RNA sequences appear to be promising biomarkers for the diagnosis of myocardial infarction. The principle is similar to DNA detection but slightly more complex because it involves short oligonucleotide sequences (between 20 and 22 nucleotides). Therefore, a DNA / RNA sandwich must be established where the number of bases hybridized between the target and the probes is large enough to guarantee the stability of the complex. The DNA probe is thus designed to be complementary to a portion of the target RNA sequence (between 12 and 16 bases) so that the resulting complex is sufficiently stable at room temperature and can withstand washing. Similarly, the The dumbbell probe contains a sequence of 6 to 10 bases complementary to the target RNA (those not included in the DNA probe). The DNA probe is also complementary to a portion of the dumbbell probe (between 4 and 8 complementary nucleotides), which increases the formation of the DNA probe-miRNA-dumbbell complex. The basic diagram of miRNA detection according to the method of the present invention is shown in Figure 10. V.3. Detection of small molecules. Another type of target that can be targeted by the detection method according to the invention is the category of small molecules. Indeed, small molecules are difficult to detect due to their small size and low concentrations. Antibodies cannot be used as probes. The adenosine detection model described by Melaine et al., 2016 [6], can be used. The basic diagram of small molecule detection according to the method of the present invention is shown in Figure 11. References [1] US Patent 6,410,278 published on June 25, 2002. [2] Pourhassan-Moghaddam er al, 2013, « Protein detection through different platforms of immuno-loop-mediated isothermal amplification », Nanoscale Research Letters, vol. 8:485, pages 1-11. [3] Du et al, 2016, « À ligation-based loop-mediated isothermal amplification (ligation-LAMP) strategy for highly selective microRNA detection », Chem. Commun, vol. 52, pages 12721-12724, [4] Demande de brevet CN 106148549 publiée le 23 novembre 2016. [5] Wang er al, 2010, « Circulating microRNA: a novel potential biomarker for early diagnosis of acute myocardial infarction in humans », Clinical Research, vol. 31, pages 659-666. [6] Melaine et al, 2016, « À nanoparticle-based thermo-dynamic aptasensor for small molecule detection », Nanoscale, vol. 8, page 16947-16954.

Claims

Demands

1. A method for detecting and possibly quantifying an analyte actually present in a liquid sample, including the steps following: 1) bring the liquid sample into contact with the surface of a support solid comprising at least one active zone on which at least one probe capable of binding said analyte is immobilized; 11) bring said surface into contact with a solution containing at least an oligonucleotide with a double stem-loop structure, capable of binding audit analyte, said oligonucleotide having been previously synthesized said contact; iii) wash said surface; (iv) bring said surface into contact with two amplification primers loop-mediated isotherm under conditions allowing the amplification of said oligonucleotide; v) detect and possibly quantify the amplification product said oligonucleotide.

2. The method according to claim !, characterized in that said oligonu- The nucleotide with a double stem-loop structure corresponds to formula (I) or (ID) below. After : [Chem.6] S'-Fic-F2-FO0"-Fi-nt-R1c-BO-B2c-B1-3" tl [Chem.7] S'-F1c-F2-F0'-F1-Bic-B0"-B2c-B1-3' {a in which: the Flc portion has a nucleotide sequence complementary to the nucleotide sequence of portion F1 by which portion Flc and the F1 portion hybridize to form the stem of the first structure stem-loop, The F2-FO' portion forms the loop of the first stem-loop structure, the B1 portion has a nucleotide sequence complementary to the nucleotide sequence of portion B1c by which portion B1 and portion B1c hybridize to form the stem of the second structure stem-loop, the portion BO”-B2c forms the loop of the second stem-loop structure, And The Int portion separates the F1 portion and the Blc portion and includes at minus one nucleotide.

3. A process according to claim 2, characterized in that, in said oligo- nucleotide with a double stem-loop structure of formula (I) or (ID), said portion F1 and said portion Flc each comprise from 10 to 35 nucleotides; said portion B1 and said portion B1c each comprise from 10 to 35 nucleotides; said portion F2 comprises 8 to 25 nucleotides and said portion FO? is such that the loop of the first stem-loop structure includes 10 to 70 nucleotides; and / or said portion B2c comprises 8 to 35 nucleotides and said portion BO° is such that the loop of the second stem-loop structure includes 10 to 70 nucleotides.

4. A method according to claim 2 or 3, characterized in that, in said oligonucleotide with a double stem-loop structure of formula (I) or (ID, said portion F1 and said portion Flc each comprise 21 nu- cleotides; said portion B1 and said portion B1c each comprise 25 nu- cleotides; said portion F2 comprises 18 nucleotides; and / or said portion B2c comprises 18 nucleotides.

5. A method according to any one of claims 2 to 4, characterized in that said oligonucleotide with a double stem-loop structure presents at at least one specific sequence of the analyte to be detected or at least one complementary sequence to a part of the nucleotide sequence of the analyte to be detected when the latter is a nucleotide molecule.

6. Method according to claim 5, characterized in that said sequence specific to the analyte to be detected or said complementary sequence to a portion of the analyte's nucleotide sequence is found in the portion F1, in portion F1c, in portion B1, in portion B1c, in the FO portion”, in the F2 portion, in the Int portion, in the portion B2c, in portion BO', both in portion F1c and the portion F2, both in portion F2 and in portion F0®, both in the FO portion” and in the F1 portion, both in the Flc portion and in the Int portion for an oligonucleotide of formula (I), both in the Flc portion and in the B1 portion for an oligonucleotide of formula (ID), both in the Int portion and in the Blc portion for an oligonu- cleotide of formula (I), both in portion B1c and in portion BO', both in portion BO” and in portion B2c, both in the section B2c and in section B1.

7. A method according to any one of claims 2 to 6, characterized in that said oligonucleotide with a double stem-loop structure presents at less a specific sequence of said probe or a complementary sequence- comment on a part of the probe's nucleotide sequence when The latter is a nucleotide molecule.

8. A method according to any one of claims 1 to 7, characterized in what the two primers implemented during said step iv) correspond respectively to formula (III) and formula (IV) below. After : [Chem.8] S'-Fic-F2-3° G [Chem.9] S'-B1c-B2-3" {iv} Portion B2 has a nucleotide sequence complementary to the nucleotide sequence of portion B2c, the portions Flc, F2, Blc and B2c being as defined in one any of claims 2 to 4.

9. A method according to any one of claims 1 to 8, characterized in that the said amplification product is detected, during said step v), by measuring turbidity, using a pH probe, via electrophoresis on gel, by a colorimetric test or by fluorescence measurement.

10. | Method according to any one of claims 1 to 9, characterized in that, following said step 1) and prior to said step ii), the The surface of the solid support is washed.

11. — A double stem-loop oligonucleotide capable of being put into work in the process according to any one of claims 1 to 10, said oligonucleotide corresponds to the following formula (IT): [Chem.10] S'-F1ic-F2-FO"-F1-Bic-BO"-B2c-B1-3" (It) wherein portion F1, portion F2, portion F0®, portion F1, portion Blc, portion BO*, portion B2c and portion B1 are as defined in any one of claims 2 to 4.