Methods

A miRNA biomarker panel in blood or serum samples addresses the limitations of LDCT and ctDNA by offering a sensitive and cost-effective method for early lung cancer detection, enhancing screening accessibility and reducing false positives.

GB2634272BActive Publication Date: 2026-04-21AVERYWELL LTD
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
AVERYWELL LTD
Filing Date
2023-10-04
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Current lung cancer screening methods, such as low dose computed tomography (LDCT) scans, have high false positive rates and are not accessible in primary healthcare settings, lacking a clearly defined target population and requiring extensive healthcare infrastructure, while liquid biopsies using circulating tumor DNA (ctDNA) are costly and time-consuming.

Method used

A method utilizing a signature of miRNA biomarkers, including miR-1246, miR-1290, miR-221, miR-223, miR-1268, miR-106b, miR-21, miR-196a, miR-130b, miR-155, miR-23a, miR-16, miR-222, miR-451, and miR-486, detected in blood or serum samples, to diagnose lung cancer with high sensitivity and specificity.

Benefits of technology

The miRNA biomarker panel provides a simple, non-invasive, and cost-effective means to detect lung cancer, particularly at early stages, reducing false positives and improving accessibility compared to existing imaging methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000002_0000
    Figure 00000002_0000
  • Figure 00000003_0000
    Figure 00000003_0000
Patent Text Reader

Abstract

A method for determining the presence of lung cancer in a subject wherein the method comprises determining the level of any 6 or more of the following sixteen miRNAs: miR-1246; miR-1290; mir-221; mir-
Need to check novelty before this filing date? Find Prior Art

Description

Field of the invention 5 The invention is in the field of diagnostics. Background An improved understanding of lung cancer genomics has led to continuous 10 advancement in chemotherapy and immunotherapy treatment for lung cancer (Howlader et al., 2020; Herbst etal., 2020). Despite higher survival rates, lung cancer remains the leading cause of cancer death worldwide in 2020; accounting for 11.4% of cancer diagnosis and 18% of cancer death (Sung et al., 2021). 15 Lung cancer mortality is almost twice that of all other major cancer types as most lung cancer cases are diagnosed at advanced stages (stage III / IV) ( https: / / seer.cancer.gov / statistics-network / explorer / application.html). There are effective cancer screening programmes for breast and colorectal cancer, ensuring that a large proportion of these cancer types are diagnosed at an early stage. The 5-year 20 survival rate of patients with distant lung disease is 9%, a huge reduction when compared to patients with localized disease whom 5-year survival can be as high as 65% (https: / / seer.cancer.gov / statfacts / html / lungb.html). As patients with early-stage lung cancer are usually asymptomatic, it is imperative that an effective lung cancer screening protocol is developed to reduce lung cancer mortality. 25 Lung cancer screening trials utilizing low dose computed tomography scans (LDCT) of the thorax in smokers, have showed up to a 24% relative risk reduction in lung cancer mortality. However, CT imaging has a high false positive rate (56%) for the diagnosis of lung cancer (which can lead to undue psychological stress, additional diagnostic and 30 surgical procedures, and a rise in health cost for patients (Jonas et al., 2021)) and is not available in the primary healthcare settings. (National Lung Screening Trial Research Team et al., 2011; de Koning et al., 2020). Further, the implementation of a lung cancer screening program incorporating LDCT scan of the thorax at a population level is filled with numerous challenges (Wait etal., 2022; van Meerkbeek etal., 2021). 35 The lack of a clearly defined target population that will benefit from LDCT screening is a factor that has precluded nationwide establishment of lung cancer screening program. Lung cancer epidemiology and the proportion of lung cancer associated with smoking varies greatly worldwide (Sung et al., 2020). Certain populations may have additional risk factors for lung cancer, including air pollution (Harris 2023; Gourd 2022). As LDCT trials only demonstrated mortality benefit and cost-effectiveness in heavy smokers, it is unclear if similar benefits would be achieved in a non-smokers or 5 population with low smoking prevalence. A successful lung cancer screening program with protocolised scheduling of LDCT, CT scan reporting and management of nodule requires the support of a holistic healthcare system. Some of the minimum requisites include adequate expertise manpower, 10 accessible and up-to-date infrastructure, and strong clinical governance, to solid fuels (Cheng et al., 2022). The present invention aims to address these problems and provide a simple, non-invasive means to screen for the presence of lung cancer, particularly early-stage lung 15 cancer. Brief summary of the invention Liquid biopsy involves the sampling of blood serum or bodily fluids for circulating 20 tumour cells (CTCs) or tumour biomarkers, such as proteins, circulating DNA (ctDNA), messenger RNA (mRNA) and micro-RNA (miRNA). The process of liquid biopsy can be fast, minimally invasive, and more readily accessible as compared to radio-imaging methods for cancer detection. Biomarkers that are dysregulated in pre-clinical or early stages of cancer would have a highly promising role in cancer screening (Freitas et al., 25 2021). ctDNA is released into the blood stream from cancer cells that undergo apoptosis. In early stages of cancer, ctDNA may not be detectable or are present in very low quantities. As a result, the sensitivity of ctDNA is relatively lower in diagnosis of early- 30 stage cancers (Li and Liang, 2020; Bettegowda et al., 2014). ctDNA assays also require DNA sequencing, which is costly and time consuming, requiring up to weeks for results to be processed. Hence, ctDNA is an unsuitable biomarker for the purpose of cancer screening. 35 The inventors have surprisingly identified a signature of miRNA biomarkers that can be detected in a blood or serum sample that is able to diagnose the presence of lung cancer, regardless of lung cancer subtypes. The miRNA panel shows great potential in changing the landscape for lung cancer screening and diagnostic algorithm of lung nodules picked up on LDCT. Detailed description of the invention 5 The presently claimed subject matter is as defined in the claims. For the avoidance of doubt, to the extent that subject matter not falling within the claimed subject matter is mentioned herein, it is included merely for reference purposes. 10 In one aspect, the invention provides a method for determining the presence of lung cancer in a subject wherein the method comprises determining a biomarker signature in a sample, wherein determining the biomarker signature comprises determining in said sample the level of 6 or more miRNAs comprising Biomarker 2 [SEQ ID NO: 2] mir-1290 and Biomarker 5 [SEQ ID NO: 5] mir-1268 or a sequence that is at least 15 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical thereto and 4 or more of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 6 [SEQ ID NO: 6] mir-106b; 20 Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of 25 any 6 or more of the miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1, 3, 4, 6-16. Also described is a method for determining the presence of lung cancer in a subject wherein the method comprises determining the level of any one or more of 1, 30 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, or all of the following miRNAs in a sample obtained from the subject: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 35 5 [SEQ ID NO: 5] mir-1268 ; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8 [SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir- 16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486. 19 11 25 Wherein the relevant miRNA biomarkers are: Biomarker SEQ ID NO miRbase ID Sequence Biomarker 1 1 miR-1246 AAUGGAUUUUUGGAGCAGG Biomarker 2 2 miR-1290 UGGAUUUUUGGAUCAGGGA Biomarker 3 3 mir-221 AGCUACAUUGUCUGCUGGGUUUC Biomarker 4 4 mir-223 CGUGUAUUUGACAAGCUGAGUU Biomarker 5 5 mir-1268 CGGGCGUGGUGGUGGGGGUG Biomarker 6 6 mir-106b UAAAGUGCUGACAGUGCAGAU Biomarker 7 7 mir-26 UUCAAGUAAUUCAGGAUAGGU Biomarker 8 8 mir-21 UAGCUUAUCAGACUGAUGUUGA Biomarker 9 9 mir-196a UAGGUAGUUUCAUGUUGUUGGG Biomarker 10 10 mir-130b ACUCUUUCCCUGUUGCACUAC Biomarker 11 11 mir-155 UUAAUGCUAAUCGUGAUAGGGGUU Biomarker 12 12 mir-23a AUCACAUUGCCAGGGAUUUCC Biomarker 13 13 mir-16 UAGCAGCACGUAAAUAUUGGCG Biomarker 14 14 mir-222 AGCUACAUCUGGCUACUGGGU Biomarker 15 15 mir-451 AAACCGUUACCAUUACUGAGUUUCC Biomarker 16 16 mir-486 UGUACUGAGCUGCCCCGAG The skilled person will appreciate that it is reasonable to expect there to be some divergence in these sequences across individuals. Accordingly, in some disclosures, determining the level of any one or more of the miRNAs described herein includes determining the level of one or more miRNAs that have at least 90%, 91%, 92%, 93%, 10 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the relevant SEQ ID NO, for example to any of SEQ ID NOs: 1-16. Each of these biomarkers has been found to have diagnostic power in the absence of being used in combination with the other biomarkers. For example each of the 16 15 biomarkers described herein is considered to be useful in the diagnosis or determination of the presence of lung cancer when from a blood or plasma sample. See for example the table below and Figure 1. 0 1 P-value1 OR (95% Ci) P-value2 (N=55) (N=45) Biomarker 1 19 11 25 Mean (SD) 31.0 (3.67) 28.7 (2.11) <0.001 0.73 (0.59, 0.87) 0.001 Median [Min, Max] 30.3 [25.2, 40.0] 28.4 [25.0, 33.1] Biomarker 2 Mean (SD) 34.2 (3.27) 32.0 (2.79) <0.001 0.78 (0.66, 0.90) 0.002 Median [Min, Max] 33.4 [27.7, 40.0] 31.8 [26.8, 40.0] Biomarker 3 Mean (SD) 26.0 (3.46) 23.9 (2.60) 0.0011 0.78 (0.65, 0.91) 0.003 Median [Min, Max] 25.5 [20.5, 40.0] 23.7 [18.9, 29.4] Biomarker 4 Mean (SD) 31.9 (4.71) 30.1 (3.94) 0.0328 0.9 (0.81,0.99) 0.04 Median [Min, Max] 30.4 [24.6, 40.0] 29.1 [24.4, 40.0] Biomarker 5 Mean (SD) 32.7 (3.11) 31.0 (3.24) 0.0098 0.84 (0.72, 0.96) 0.014 Median [Min, Max] 32.9 [25.4, 40.0] 30.9 [23.2, 40.0] Biomarker 6 Mean (SD) 28.3 (4.07) 26.5 (3.47) 0.0142 0.87 (0.76, 0.97) 0.021 Median [Min, Max] 27.5 [20.8, 40.0] 26.0 [20.6, 37.3] Biomarker 7 Mean (SD) 25.0 (3.62) 23.5 (2.26) 0.0166 0.84 (0.71,0.97) 0.027 Median [Min, Max] 24.3 [18.1,40.0] 23.4 [19.2, 28.1] Biomarker 8 Mean (SD) 24.6 (3.50) 22.9 (2.44) 0.0045 0.81 (0.69, 0.94) 0.01 Median [Min, Max] 24.1 [17.9, 36.4] 22.6 [18.3, 28.6] Biomarker 9 Mean (SD) 36.7 (2.73) 34.2 (2.76) <0.001 0.73 (0.62, 0.85) <0.001 Median [Min, Max] 36.7 [31.3, 40.0] 33.9 [29.7, 40.0] Biomarker 10 Mean (SD) 34.9 (4.72) 33.1 (3.98) 0.0376 0.91 (0.83, 1.00) 0.043 Median [Min, Max] 34.9 [26.0, 40.0] 32.0 [26.4, 40.0] Biomarker 11 Mean (SD) 31.8 (4.41) 30.9 (3.60) 0.26 0.94 (0.85, 1.04) 0.269 Median [Min, Max] 31.0 [25.2, 40.0] 30.0 [26.2, 40.0] Biomarker 12 Mean (SD) 24.4 (2.83) 23.2 (2.01) 0.0186 0.82 (0.68, 0.97) 0.027 Median [Min, Max] 24.0 [18.8, 31.4] 23.2 [18.6, 28.4] Biomarker 13 Mean (SD) 22.1 (3.97) 20.4 (2.51) 0.0114 0.84 (0.72, 0.96) 0.02 Median [Min, Max] 21.4 [14.6, 40.0] 20.1 [14.3, 26.3] Biomarker 14 Mean (SD) 29.2 (4.03) 27.6 (2.60) 0.0221 0.87 (0.75, 0.98) 0.035 Median [Min, Max] 28.4 [22.7, 40.0] 27.3 [22.6, 35.9] Biomarker 15 Mean (SD) 19.2 (3.68) 17.4 (2.49) 0.006 0.83 (0.71,0.95) 0.012 Median [Min, Max] 18.9 [11.9, 31.9] 16.9 [10.9, 23.5] Biomarker 16 Mean (SD) 23.3 (2.66) 21.9 (1.72) 0.003 0.76 (0.61,0.92) 0.007 Median [Min, Max] 23.2 [17.1,31.5] 21.6 [18.4, 26.4] Some of these markers (amongst many others) have been associated with lung cancer previously. However the inventors have surprisingly found that only a subset of these (i.e. the 16 biomarkers described herein) are able to demonstrate the necessary 5 specificity and sensitivity, when the level of those markers are determined from a blood or plasma sample, to be useful. Furthermore, some of these biomarkers were considered previously to be downregulated in the lung cancer condition. Surprisingly, all of the 16 biomarkers described herein were found to be upregulated, i.e. demonstrate a higher level of expression in the lung cancer state than the healthy 10 state, contradicting the state of the art. 19 11 25 miRNA Expression based on published data Citation miR-1246 Up Huang et al 2015, Zhang et al, 2016, Cordoba-Lanus 2023 miR-1290 Up Mo et al, 2015, Zhang et al, 2016 mir-221 Up Fabrizio et al, 2011, Sozzie et al, 2014, Geng et al 2014. mir-223 Up Geng et al, 2014, X. Chen et al, 2012 mir-1268 up Asakura et al, 2020 mir-106b Up Zhang et al, 2016 mir-26 up Fabrizio et al, 2011 mir-21 up Sozzie et al, 2014, Hetta et al. 2019, Xue et al 2016 mir-196a Up Liu et al, 2012 mir-130b up Zhang et al, 2016, Hirono et al 2019 mir-155 Up Xue et al 2016, Shao et al 2019 mir-23a up Hetta et al, 2019, Hsu et al, 2017 mir-16 Up Sozzie et al, 2014 mir-222 up X.Chen et al mir-451 Up / down Bian et al, 2011 mir-486 down Sozzie et al, 2014, Fabrizio et al, 2011 The inventors have found that a diagnostic panel comprising determining the level of any combination of any 6 or 7 or 8 of the above 16 biomarkers is particularly useful in 15 predicting the presence of lung cancer. For example, exemplary combinations and the sensitivity, specificity and accuracy are as follows, and hold for all permutations of 8 miRNAs from the above 16: 19 11 25 Combination Sensitivity Specificity Accuracy AUC ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 9', 'Biomarker 10', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.846153846 0.826923 0.85355 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 9', 'Biomarker 10', 'Biomarker 11', 'Biomarker 16'] 0.807692308 0.846153846 0.826923 0.85355 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 7', 'Biomarker 10', 'Biomarker 11', 'Biomarker 13'] 0.807692308 0.846153846 0.826923 0.849112 ['Biomarker 1', 'Biomarker 3', 'Biomarker 4', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.846153846 0.826923 0.844675 ['Biomarker 1', 'Biomarker 5', 'Biomarker 9', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 13', 'Biomarker 16'] 0.807692308 0.846153846 0.826923 0.843195 ['Biomarker 1', 'Biomarker 3', 'Biomarker 4', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 13'] 0.807692308 0.846153846 0.826923 0.841716 ['Biomarker 1', 'Biomarker 3', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 14', 'Biomarker 16'] 0.807692308 0.846153846 0.826923 0.840237 ['Biomarker 1', 'Biomarker 5', 'Biomarker 8', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 13', 'Biomarker 16'] 0.807692308 0.846153846 0.826923 0.840237 ['Biomarker 1', 'Biomarker 3', 'Biomarker 5', 'Biomarker 7', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 13'] 0.807692308 0.846153846 0.826923 0.838757 ['Biomarker 1', 'Biomarker 3', 'Biomarker 4', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 15'] 0.807692308 0.846153846 0.826923 0.83432 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 7', 'Biomarker 10', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.862426 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 8', 'Biomarker 10', 'Biomarker 11', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.859467 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 8', 'Biomarker 10', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.859467 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 7', 'Biomarker 10', 'Biomarker 12', 'Biomarker 13'] 0.807692308 0.807692308 0.807692 0.856509 19 11 25 Combination Sensitivity Specificity Accuracy AUC ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 6', 'Biomarker 10', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.847633 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.847633 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 13'] 0.807692308 0.807692308 0.807692 0.846154 ['Biomarker 1', 'Biomarker 3', 'Biomarker 5', 'Biomarker 8', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.846154 ['Biomarker 1', 'Biomarker 3', 'Biomarker 5', 'Biomarker 9', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.846154 ['Biomarker 1', 'Biomarker 2', 'Biomarker 3', 'Biomarker 5', 'Biomarker 6', 'Biomarker 10', 'Biomarker 11', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.846154 ['Biomarker 1', 'Biomarker 3', 'Biomarker 5', 'Biomarker 10', 'Biomarker 11', 'Biomarker 12', 'Biomarker 13', 'Biomarker 16'] 0.807692308 0.807692308 0.807692 0.843195 Accordingly in one disclosures, the method comprises determining the level of any 6 or 7 or 8 or more of the following miRNAs: 5 Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] 10 mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486, or that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of SEQ ID NOs: 1-16. 15 The inventors have found that 6 of the miRNA biomarkers are particularly useful. Accordingly in another disclosure, the method comprises determining the level of any 1, 2, 3, 4, 5, 6, , or all of the following miRNAs: Biomarker 5 [ SEQ ID NO: 5] mir-1269; Biomarker 3 [ SEQ ID NO: 3] mir-221; Biomarker 6 [ SEQ ID NO: 6] mir-106b; Biomarker 13 [ SEQ ID NO: 13] mir-16; Biomarker 9 [SEQ ID NO: 9] mir-196a, Biomarker 2 [ SEQ ID NO: 2] mir-1290 or that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% 5 identical to any of the above sequences. A particular panel of 6 miRNAs is particularly useful. The table below shows that a panel comprising the following 6 biomarkers demonstrated the best clinically relevant parameters. Accordingly, in another embodiment, the method comprises determining 10 the level of all of the following miRNAs: Biomarker 5 [ SEQ ID NO: 5] mir-1269; Biomarker 3 [ SEQ ID NO: 3] mir-221; Biomarker 6 [ SEQ ID NO: 6] mir-106b; Biomarker 13 [ SEQ ID NO: 13] mir-16; Biomarker 9 [SEQ ID NO: 9] mir-196a. Biomarker 2 [ SEQ ID NO: 2] mir-1290 or that 15 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the above sequences. 19 11 25 Biomarkers # of top biomarkers Validation AUC AUC Testing NPV Sensit Specif PPV 5 1 0.724 0.731 0.818 0.643 0.643 0.833 5,3 2 0.768 0.757 0.818 0.643 0.643 0.828 5,3,6 3 0.775 0.744 0.818 0.643 0.643 0.818 5,3,6,13 4 0.774 0.750 0.818 0.643 0.643 0.833 5,3,6,13,9 5 0.780 0.763 0.909 0.571 0.625 0.900 5,3,6,13,9,2 6 0.781 0.796 1.000 0.571 0.647 1.000 5,3,6,13,9,2,15 7 0.783 0.763 0.909 0.571 0.625 0.889 5,3,6,13,9,2,15,7 8 0.781 0.770 0.909 0.571 0.625 0.894 5,3,6,13,9,2,15,7,8 9 0.778 0.731 0.818 0.642 0.642 0.818 5,3,6,13,9,2,15,7,8,1 10 0.783 0.757 0.909 0.571 0.625 0.900 5,3,6,13,9,2,15,7,8,1,16 11 0.788 0.753 0.909 0.571 0.625 0.889 5,3,6,13,9,2,15,7,8,1,16,11 12 0.782 0.740 0.909 0.571 0.625 0.900 5,3,6,13,9,2,15,7,8,1,16,11,12 13 0.786 0.737 0.909 0.643 0.667 0.909 5,3,6,13,9,2,15,7,8,1,16,11,12,10 14 0.785 0.718 0.909 0.571 0.625 0.900 5,3,6,13,9,2,15,7,8,1,16,11,12,10,4 15 0.786 0.718 0.636 0.786 0.700 0.733 All 16 0.793 0.708 0.727 0.714 0.667 0.769 The particular combinations of miRNAs that can be used to determine the presence of 20 cancer can be termed a biomarker signature. Accordingly reference herein to a biomarker signature refers to a combination of miRNAs which can be used to determine the presence of lung cancer. The term "identical to" is known to the person skilled in the art, and relates to the 5 percentage identity between two or more nucleic acid sequences or two or more amino acid sequences. The terms "identical to" and "sequence identity" are interchangeable - i.e., where a first sequence is X% (where X is an integer between 0 and 100) "identical to" a second sequence, the first sequence shares X% "sequence identity" with the second sequence. 10 To determine the percentage identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid 15 residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences 20 ( / .e., % identity=number of identical overlapping positions / total number of positionsxlOO%). In one embodiment, the two sequences are the same length. Percentage identity between two sequences can also be identified using a mathematical algorithm. One example of a mathematical algorithm for the comparison of two 25 sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264 2268 (herein incorporated by reference in its entirety), modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873 5877 (herein incorporated by reference in its entirety). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215:403 (herein incorporated 30 by reference in its entirety). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389 3402 (herein incorporated by reference in its entirety). Alternatively, PSI BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI Blast 35 programs, the default parameters of the respective programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., National Center for Biotechnology Information (NCBI) on the worldwide web, ncbi.nlm.nih.gov). Another example of a mathematical algorithm for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11 17 (herein incorporated by reference in its entirety). Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. Another example of a mathematical algorithm for the comparison of two sequences is the algorithm of Thompson et al., 1994, Nucleic Acids 5 Res. 22(22):4673-80 (herein incorporated by reference in its entirety), incorporated into the ClustalW program. The percentage identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating 10 percentage identity, typically only exact matches are counted. By "sample obtained from a subject" we include any sample from a subject that comprises miRNAs. Preferably the sample to be tested is provided from an individual that is a mammal. In some embodiments, the individual may be a primate (for 15 example, a human; a monkey; an ape); a rodent (for example, a mouse, a rat, a hamster, a guinea pig, a gerbil, a rabbit); a canine (for example, a dog); a feline (for example, a cat); an equine (for example, a horse); a bovine (for example, a cow); or a porcine (for example, a pig). Most preferably, the mammal is human. 20 The sample to be tested in the methods of the invention may comprise or consist of: a cell; tissue; fluid sample (or derivative thereof); and may preferably comprise or consist of blood (fractionated or unfractionated), plasma, plasma cells, serum, tissue cells, pleural fluid, pleural cells. 25 In one embodiment, the sample is a lung tissue sample. In an alternative or additional embodiment, the sample is a sample comprising or consisting of lung cells, for example epithelial cells or alveolar cells or pleural cells. In a preferred embodiment, the sample comprises one or more lung cancer cells. In some embodiments, the sample comprises one or more lung cancer cells and / or is selected from the group comprising: a biopsy 30 (such as a core needle biopsy; fine needle biopsy; bronchoscopy sample); a tissue sample (such as a lung tissue or lung cancer tissue); an organ sample; and / or a bodily fluid sample (such as blood, saliva, sputum, urine, or pleural fluid). Preferably the same is a blood sample or a serum / plasma sample. 35 A blood sample may be obtained from a subject using methods known to the person skilled in the art. Exemplary sampling methods may be selected from the group comprising or consisting of: venipuncture; fingerprick; arteriopuncture; capillary sampling; heel-prick; scalp vein sampling; and ear lobe puncture. By "lung cancer" we include any type of cancer that forms in tissues in the lungs, 5 usually in the cells lining air passages. The two main types are small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). The methods of the invention are able to determine the presence of lung cancer. The methods of the present invention are not able to determine the subtype of lung cancer. 10 Once the presence of lung cancer has been determined, other tests are then advised to determine the type and the stage of the lung cancer. The methods of the invention permit the diagnosis of both early lung cancer and later stage lung cancer. The methods described herein are particularly useful in determining 15 the presence of early stage lung cancer. In one embodiment, the method is for diagnosis of early-stage lung cancer. LO CXI By "diagnosis" we include determining the presence or absence of a disease state in an individual (e.g., determining whether an individual is or is not suffering from lung 20 cancer). In one embodiment, where the subject has been diagnosed with lung cancer based on the level of the one or more miRNAs, the subject is further analysed to determine the stage and / or subtype of lung cancer. Suitable methods for further analysing the 25 subject to determine the stage and / or subtype of lung cancer are known to the person skilled in the art, and generally include providing a sample from a subject and analysing said sample using techniques such as cytopathology or karyotyping. In some embodiments the sample for further analysis is a lung biopsy. Accordingly, in some embodiments where the method comprises determining the stage and / or subtype of 30 lung cancer, said determining comprises providing a lung tissue biopsy from the subject and analysing said lung tissue biopsy. In some embodiments, the lung cancer is Non-Small Cell Lung Cancer (NSCLC). Therefore, in some embodiments, the method is for the diagnosis of NSCLC in an 35 individual, and comprises the method of determining the level of the miRNA markers as set out herein, with additional tests to determine the type of lung cancer as NSCLC. Suitable methods of determining the type of lung cancer as NSCLC are provided herein and include the analysis of a lung biopsy from the subject. In an additional or alternative embodiments, the NSCLC is selected from the group comprising: adenocarcinoma; squamous cell carcinoma; adenosquamous carcinoma; large cell carcinoma; or large cell neuroendocrine cancer. In some preferred 5 embodiments, the NSCLC is adenocarcinoma. In additional or alternative embodiments, the NSCLC in the individual is early-stage NSCLC (i.e.. Stage 0,1 or Stage II) or is late-stage NSCLC (i.e. Stage III or Stage IV). 10 By "classifying the NSCLC in the individual", we include assigning NSCLC in an individual into a particular group. The NSCLC within these groups may have similar physical properties or pathologies, they may be expected to behave similarly, or the individuals with these NSCLC groups may be expected to have similar prognoses. In a preferred embodiment, individuals with NSCLC in the same group or subtype have a 15 similar or the same prognosis. In some embodiments, the lung cancer is Small Cell Lung Cancer (SCLC). Therefore, in some embodiments, the method is for the diagnosis of SCLC in an individual, and comprises the method of determining the level of the miRNA markers as set out herein, 20 with additional tests to determine the type of lung cancer as SCLC. Suitable methods of determining the type of lung cancer as SCLC are provided herein and include further analysis of a lung biopsy. By "Small Cell Lung Cancer (SCLC)" we include any type of lung cancer that is not Non-25 Small Cell Lung Cancer (NSCLC). By "Non-Small Cell Lung Cancer (NSCLC)" we include any type of lung cancer that is not Small Cell Lung Cancer (SCLC). For example, the NSCLC may be adenocarcinoma; squamous cell carcinoma; adenosquamous carcinoma; large cell carcinoma; or large 30 cell neuroendocrine cancer. In one embodiment, the invention provides a method for lung cancer screening wherein the method comprises performing the method for determining the presence of lung cancer of the invention. The methods of this invention are suitable for testing a sample from any individual who has, or is suspected of having, lung cancer, whether that is NSCLC or SCLC. The method is considered to be particularly useful as part of a screening programme for the detection of early stage cancers in subjects that have no symptoms of cancer, or may have some symptoms of lung cancer but who have not yet received a diagnosis of cancer. 5 In one embodiment, the subject a) has not had a diagnosis of lung cancer; b) is considered to be a healthy individual; c) has not undergone treatment for lung cancer; and / or d) has any one or more symptoms of lung cancer, but has not had a diagnosis 10 of lung cancer. In some embodiments the method is considered to be useful in the context of determining metastatic cancers that have spread to the lung tissue. Accordingly in some embodiments the subject has received a diagnosis of a cancer that is not a lung 15 cancer. In some embodiments the subject has received a diagnosis of a cancer that is not a lung cancer but which has a high probably of metastasis to the lung. LO CXI In some embodiments, the methods described herein are able to diagnose lung cancer at an early stage, as the methods can be carried out on a sample from an individual 20 either when they are showing no symptoms (i.e., asymptomatic) or when they are displaying minor symptoms. Therefore, one advantage of the invention described herein is that it can allow diagnosis of lung cancer at a much earlier stage than traditional diagnostic methods, allowing patients to seek prompt treatment that is key to long term survival. 25 Symptoms of lung cancer can be found in Wilkinson et al. (2017) Oxford Handbook of Clinical Medicine (10th Ed), Oxford University Press, and Cassidy et al. (2015) Oxford Handbook of Oncology (4th Ed), Oxford University Press (each herein incorporated by reference in its entirety). Exemplary symptoms of lung cancer include those selected 30 from the group comprising or consisting of: persistent cough; breathlessness; coughing up blood; chest pain; shoulder pain; chest ache; shoulder ache; recurrent chest infection; loss of appetite; fatigue; weight loss (optionally unexplained weight loss); changes in the shape of fingers and / or fingernails; finger clubbing; hypertrophic pulmonary osteoarthropathy; nausea and vomiting; headaches; confusion; weakness; 35 restlessness; irritability; muscle weakness, spasms, cramps, or aches; seizures; dry eyes; blurred vision; dysphagia; dizziness; dry mouth; constipation; erectile dysfunction. It will be clear to the skilled person that when determining whether a level of one or more miRNAs indicates the presence of lung cancer or not, the level of the one or more miRNAs in the sample from the test subject can be compared to a control value. 5 The control value can be a negative control, and / or can be a positive control. The skilled person is able to determine adequate control samples. It will be appreciated that the test and any control samples should be from the same species and preferably the same sample type. 10 For example, in some embodiments the level of the one or more miRNAs in the test sample is compared to the level of the same one or more miRNAs in one or more negative control samples. A negative control sample may be, for example, the average level of the miRNA in a test sample obtained from a number of subjects that are known to not have lung cancer. In some embodiments, the control sample has been obtained 15 from a healthy individual; or a population of healthy individuals. In some embodiments where the level of the one or more miRNAs in the sample from the test subject is higher or lower than the level in the control samples, the test subject is confirmed as having lung cancer. In some embodiments the level of the miRNAs in the test subject has to be above, below or within pre-determined threshold or range for a determination of 20 lung cancer to be made. In some embodiments, the pre-determined threshold is a universal threshold, a constant value for the Ct value. In some embodiments, the predetermined threshold level is a level of the miRNA associated with a population of healthy individuals, i.e., individuals known to not have lung cancer. Determining appropriate thresholds is within the skilled person's abilities. 25 Conversely, if the level of the one or more miRNAs in the test sample is the same as, or similar to the level of the miRNAs in the negative control samples, for example within a predetermined range, above or below a predetermined threshold, the subject is determined to not have lung cancer. 30 As will be appreciated, the level of one or more miRNAs in the test sample may be alternatively or additionally compared to the level of miRNAs in one or more positive control samples. Accordingly, in some embodiments the control sample is a positive control sample, for example is the average level of the miRNA in a test sample obtained 35 from a number of subjects that are known to have lung cancer. In some embodiments where the level of the one or more miRNAs in the sample from the test subject is the same as or higher than the level in the positive control samples or is within a pre-determined range, the test subject is confirmed as having lung cancer. In some embodiments the level of the miRNAs in the test subject has to be above, below or within pre-determined threshold or range in order for a determination of lung cancer to be made. Determining appropriate thresholds is within the skilled 5 person's abilities. Conversely, if the level of the one or more miRNAs in the test sample is above or below the level of the miRNAs in the positive control samples, or above / below a predetermined threshold value or range, the subject is determined to not to have lung 10 cancer. LO CXI The control samples may be physical samples that are processed at the same time as the test sample. However, it is generally more practical if the control samples are levels of each particular miRNA that have been predetermined, for example when 15 developing the initial signature. In this way, the value of a given miRNA in the test sample can be compared to a known level of the same miRNA in a positive and / or negative control sample, and a determination made as to the presence or absence of lung cancer. 20 In one embodiment, the method further comprises the step of determining that the subject has lung cancer if the level of the one or more miRNAs in the sample from the test subject is: a) at least 1.25, or at least 1.5, 1.75, 2.0, 2.25, 2.5, 2.75, or at least 3.0, 3.5, 4.0, 4.5, or at least 5.0, 6.0, 7.0, 8.0, 9.0, or at least 10, 20, 30, 40, 50, 60, 25 70, 80, 90, or at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, or at least 1280 times higher than the level of the one or more miRNAs in the negative control sample, the population of healthy individuals, or the predetermined threshold level; and / or 30 b) above a predetermined range or within a pre-determined threshold level. In one embodiment, the method further comprises method the step of determining that the subject does not have or is not at high risk of having lung cancer, where the level of the one or more miRNAs in the test sample is: 35 a) the same as or substantially similar to the level of the same one or more miRNAs in the negative control sample the population of healthy individuals, or the predetermined threshold level; b) is not at least 1.25, or at least 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 or at least 3.0, 3.5, 4.0, 4.5, or at least 5.0, 6.0, 7.0, 8.0, 9.0, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, or at least 1280 times higher than the level of the one or more 5 miRNAs in the negative control sample, the population of healthy individuals, or the predetermined threshold level; and / or c) within a predetermined range or below a predetermined threshold. The above is described in the context of the miRNAs that provide a signature that io correlates with disease being over expressed in the diseased phenotype vs the nondiseased phenotype. The skilled person will however appreciate that there may be some additional miRNAs that are repressed in the diseased phenotype vs the nondiseased phenotype, and the skilled person will understand how to apply that signature, for example will know which controls to use and what comparisons to make. 15 For the avoidance of doubt, the level of the miRNAs set out in SEQ IDs 1-16 are upregulated or overexpressed in the lung-cancer condition state and their overexpression relative to a control sample from a healthy individual / population of healthy individuals indicates the presence of lung cancer. 20 In some embodiments the level of the one or more miRNAs determined in a test sample from the test subject is compared to both a positive and a negative control. By "determining the level of" we include the meaning of determining the expression level of. The skilled person is readily able to determine the level of or the expression 25 level of a particular miRNA in a particular sample. Routine methods include PCR based amplification methods such as qPCR or real-time PCR or digital PCR. In some embodiments the miRNA is converted to cDNA and then amplified. In some embodiments the miRNA is converted to cDNA in such a way as to allow amplification of all cDNAs using a common set of primers. Commercially available kits can be used 30 to isolate the RNA and to perform the necessary reverse transcription step. In some instances the miRNA is extended at each end prior to reverse transcription. This allows the cDNA to be amplified by universal primers. The amount of each miRNA present in the sample from the patient can be determined 35 using quantitative methods such as real time PCR or digital PCR, such as using TaqMan primers and probes. In some embodiments the threshold cycle value (the ct value) is used to determine the level of the about of a given miRNA present in the sample. Accordingly in some embodiments said determining is carried out using quantitative PCR. The level of the one or more miRNAs in the sample can be determined using any 5 suitable means. For example, in one embodiment the levels of the miRNAs are determined using reverse transcription followed by qPCR. In one embodiment, the qPCR is TaqMan PCR. The skilled person is able to design appropriate primers to amplify the required 10 miRNA(s). For example, miRNAs may suitably be amplified using universal primers that bind to the poly(A) tail of the miRNA. The primers may be DNA primers that driver the generation of cDNA as part of a reverse transcription step. The end of the miRNA - for example, the 3' end - may be extended prior to the reverse transcription step. Additional primers for use in the qPCR step may be targeted to the known sequence of 15 the cDNA to be detected, or may be universal primers. In some other embodiments, determination of the level of the one or more miRNAs is via hybridisation of miRNA, cDNA, or DNA amplicon generated during the qPCR reaction to a detection probe. The detection probe may be an oligonucleotide, for example. 20 The oligonucleotide may be conjugated to a moiety that generates a visible read-out, for example horseradish peroxidase or a fluorescent moiety. Where the oligonucleotide probe is conjugates to a fluorescent moiety, it may also be conjugated to a quencher moiety. Such arrangements include, for example, TaqMan probes, the functioning of which is known to the person skilled in the art. 25 Preferably the method of determining the level of the one or more miRNAs produces a visible readout, i.e., visible to the naked eye, so that the method can be performed in the absence of sophisticated laboratory equipment. Alternatively, the visible read out may be a fluorescence read out as described herein. As will be appreciated, there are 30 a variety of different fluorescent moieties that may be conjugated to oligonucleotide probes for the detection of nucleic acids, each of which may emit fluorescent light of a different wavelength. Accordingly, although such read-outs may require the use of sophisticated laboratory equipment to be detected, the use of a fluorescent moiety-conjugated probe for the detection the miRNA, cDNA, or DNA amplicon generated 35 during a qPCR reaction may advantageously allow the detection of more than one miRNA, cDNA, or DNA amplicon in a single reaction. Accordingly, in some embodiments, the method of determining the level of the one or more miRNA is a multiplex method, wherein the levels multiple different miRNAs are detected in one reaction. Any suitable method can be used to obtain miRNA from the sample. In one embodiment, the miRNAs are isolated using column-based extraction or magnetic-bead based extraction. In one embodiment, the one or more miRNAs are produced by the subject, optionally 10 produced by the lung tissue of the subject, optionally produced at higher levels by a lung tumour cell or host immune cells. The host immune cells may be present in the lung tumour; may be present in tissues that are adjacent to or proximal to the lung tumour; and / or may disseminated through the body of the subject, for example be circulating in the blood, lymph, or interstitial fluid of the subject. 15 In one embodiment, the method further comprises performing a low dose computed tomography scan (LDCT) on the patient. In a further embodiment, wherein the level of the one or more miRNAs is considered 20 in conjunction with an LDCT scan, optionally wherein a diagnosis of the presence or absence of lung cancer is based on the level of the one or more miRNAs and information obtained from the LDCT scan. In one embodiment, wherein the subject has been diagnosed with a lung nodule 25 following a computerised tomography (CT) scan, MRI scan, LDCT scan or X-ray scan. In another embodiment, wherein in the event that the individual is diagnosed with lung cancer, the method further comprises a step of providing the individual with a lung cancer therapy, optionally wherein the lung cancer therapy is selected from the group 30 comprising: surgery, chemotherapy, radiotherapy, immunotherapy, chemoimmunotherapy, thermochemotherapy and combinations thereof, adoptive cell therapies, gene therapies, cancer vaccines, and oncolytic virus therapies. The invention also provides a method of determining whether a lung nodule is a lung 35 cancer tumour or is benign, wherein the method comprises performing the method of determining the presence of lung cancer according to any of the aforementioned methods, on a subject identified as having a lung nodule, optionally identified as having a lung nodule based on a CT scan. The invention also provides a method for determining the efficacy of a treatment against lung cancer in a subject wherein the method comprises: 5 a) determining the level of one or more miRNAs in a sample from the subject; b) treating said subject with an appropriate therapeutic to treat lung cancer; c) determining the level of the same one or more miRNAs as in (a) in a sample from the subject. 10 The method may further comprise making a determination that the treatment is effective if the level of the one or more miRNAs in (c) i.e. post-treatment is lower than the level of the same miRNAs in (a) i.e. prior to treatment. The method may further comprise making a determination that the treatment is 15 ineffective if the level of the one or more miRNAs in (c) i.e. post-treatment is the same as or higher than the level of the same miRNAs in (a) i.e. prior to treatment. Preferences for features of this method are as described elsewhere herein, for example preferences for the miRNAs are as described elsewhere herein. 20 The invention also provides a method for lung nodule management comprising a) determining the level of one or more miRNAs in a sample from a subject that has been identified as having a lung nodule; 25 b) determining whether the lung nodule is likely to be a tumour based upon the level of the one or more miRNAs determined in (a), for example in accordance with the method of determining the presence of lung cancer of the invention. The method may further comprise treating the subject for a non-cancerous lung nodule 30 when the subject is determined to not have lung cancer based on the level of the one or more miRNAs, for example in accordance with the method of determining the presence of lung cancer of the invention. In accordance with the invention as set out by the appended claims, the invention does not include a method of treatment. Subsequent references to methods of treatment should be construed as references to 35 a biomarker signature for use in the treatment and / or diagnosis of lung cancer. Preferences for features of this method are as described elsewhere herein, for example preferences for the miRNAs are as described elsewhere herein. As will be understood, any method for determining the efficacy of a treatment against lung cancer in a subject; or the method for lung nodule management may comprise additional diagnostic steps comprising performing diagnostic tests other than 5 determining the level of one or more miRNA. Such methods may include, for example, cytopathology, karyotyping. The invention also provides a kit for performing any of the methods described herein. 10 In the invention, the kit comprises means to determine a biomarker signature, wherein determining the biomarker signature consists of determining the level of the following miRNAs: Biomarker 2 [SEQ ID NO: 2] mir-1290 and Biomarker 5 [SEQ ID NO: 5] mir-1268 or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical thereto and at least four of the following; 15 Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ 20 ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486. The disclosure provides a kit comprising one or more or all of the following: a) Means to determine the level of at least one of the following; 25 Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] 30 mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir- 16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; b) means for the extraction and purification of RNA from a sample; and / or c) a control sample of RNA prepared from a sample from subjects, 35 optionally wherein the means to determine the level of at least one of the miRNAs comprises: i) at least one pair of primers are arranged so as to amplify at least one or more of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; 5 Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 10 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16; ii) at least one or more probe arranged so as to hybridise to at least one or 15 more of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; LO CXI Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; 19 11 NJ O Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or miRNAs with a sequence that has at least 90%, 91%, 92%, 25 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16; iii) reverse transcriptase and / or DNA polymerase; iv) a microarray; and / or 30 vi) an array card. In another disclosure, b) comprises microRNA extraction columns or magnetic beads. By "miRNA extraction columns", we include the meaning columns used to isolate 35 miRNAs from the blood sample in a process called extraction. This step is critical to concentrate and purify microRNAs for subsequent analysis. Extraction columns may contain resins or filters that selectively bind miRNAs while removing other contaminants. In some disclosures, the at least one or more probe(s) in are TaqMan probes. In some disclosures, the means to determine the level of at least one of the miRNA comprise PCR buffers. 5 By "Taqman probes", we include the meaning specialized DNA probes that are labelled with a fluorescent dye (or moiety) and a quencher molecule. The probes are designed to be complementary to the target miRNA sequence to be detected. During the analysis, the probe binds to the target miRNA, and when the DNA polymerase replicates 10 the DNA strand, the quencher is cleaved, leading to the release of fluorescence by the fluorescent dye (or moiety). This fluorescence signal indicates the presence and quantity of the target miRNA. By "buffers", we include the meaning solutions used to create and maintain a suitable 15 chemical environment for the various reactions in the liquid biopsy process. They help stabilize the microRNAs, enzymes, and other components involved. Different steps of the process might require different buffer compositions and pH levels. Buffers may also comprise co-factors required by enzymes for their function. For example, a buffer for use with a reverse transcriptase and / or DNA polymerase may comprise a 20 magnesium salt that provides Mg2+ ions required for polynucleotide extension by the polymerases; and / or ATP. By "enzymes", we include the meaning biological catalysts that facilitate biochemical reactions. In the context of a liquid biopsy test, enzymes like reverse transcriptase 25 and DNA polymerase are used. Reverse transcriptase converts miRNAs into cDNA, and DNA polymerase amplifies the cDNA for detection. As will be appreciated by the skilled person, TaqMan assays require the presence of a polymerase with exonuclease activity. Accordingly, in some disclosures the polymerase has exonuclease activity, optionally 3'-5' exonuclease activity or 5'-3' exonuclease activity. These enzymes are crucial for 30 the accurate and sensitive detection of miRNAs. In one disclosure the kit comprises: a) Means to determine the level of at least one of the miRNAs associated with 35 the presence of said lung cancer; b) means for the extraction and purification of RNA from a lung tissue sample; LO CXI c) a control sample of RNA prepared from a lung tissue sample from subjects that do not have lung cancer. In some disclosures the means to determine the level of at least one of the miRNAs 5 comprises: a) at least one pair of primers are arranged so as to amplify at least one or more or all of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ 10 ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; 15 Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16; b) one or more hybridisation probes able to specifically hybridise to one or more 20 of the following miRNAs: at least one pair of primers are arranged so as to amplify at least one or more or all of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ 25 ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; 30 Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16;. In some disclosures the kit comprises means to determine the level of (for example 35 primers and / or probes): any 1, 2, 3, 4, 5, 6, 7, or 8, or all of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 12 [SEQ ID NO: 12] mir-23a; and Biomarker 16 [SEQ ID NO: 16] mir-486; 5 or determining the level of any 1, 2, 3, 4, 5, 6, 7, or 8 or all of miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-3, 5, 9, 10, 12, and / or 16; or 10 all of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; 15 Biomarker 12 [SEQ ID NO: 12] mir-23a; and Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-3, 5, 9, 10, 12, and 16. 20 In some disclosures the kit comprises means to determine the level of (for example primers and / or probes) all of: Biomarker 5 [ SEQ ID NO: 5] mir-1269; Biomarker 3 [ SEQ ID NO: 3] mir-221; Biomarker 6 [ SEQ ID NO: 6] mir-106b; Biomarker 13 [ SEQ ID NO: 13] mir-16; Biomarker 9 [SEQ ID NO: 9] mir-196a. Biomarker 2 [ SEQ ID NO: 2] mir-1290 or that 25 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to any of the above sequences. The disclosure further provides a method of treating lung cancer in an individual comprising the steps of: 30 (i) diagnosing lung cancer according to any of the aforementioned methods; and (ii) providing the individual with lung cancer therapy. 35 The disclosure further provides, a method, use, array, or kit for determining the presence of lung cancer in an individual substantially as described herein. Preferences and options for a given aspect, feature or parameter of the invention should, unless the context indicates otherwise, be regarded as having been disclosed in combination with any and all preferences and options for all other aspects, features and parameters of the invention. For example, the disclosure provides: 5 a method for determining the presence of lung cancer in a subject wherein the method comprises determining the level of any one or more of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, or all of the following miRNAs in a sample obtained from the subject: 10 Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] 15 mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ 20 ID NOs: 1-16. and the invention also provides: a method of determining whether a lung nodule is a lung cancer tumour or is 25 benign, wherein the method comprises performing the method of determining the presence of lung cancer as provided herein on a subject identified as having a lung nodule, optionally identified as having a lung nodule based on a CT scan. The disclosure also provides: 30 A method of treating lung cancer in an individual comprising the steps of: (i) diagnosing lung cancer according to the as provided herein; and (ii) providing the individual with lung cancer therapy. 35 The invention also provides the use of the miRNA signatures described, to determine the presence of lung cancer in a subject. Preferences for features of this aspect of the invention are as described elsewhere herein. The disclosure also provides a method, use, array, or kit for determining the presence of lung cancer in an individual substantially as described herein. 5 The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge. The contents of all prior-published documents listed or discussed in this specification are herein incorporated by reference in their entirety. 10 The presently claimed subject matter is as defined in the claims. Further described herein is the following non-exhaustive list of numbered paragraphs. 1. A method for determining the presence of lung cancer in a subject wherein the method comprises determining the level of any one or more of or 1, 2, 3, 4, 5, 6, 7, 8, 15 9, 10, 11, 12, 13, 14, 15, or 16, or all of the following miRNAs in a sample obtained from the subject: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 20 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; 25 Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of any one or more of or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, or all of the miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16. 30 2. The method according to paragraph 1, wherein the method comprises determining the level of any 6 or more of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 35 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir- 16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of any 6 or more of the miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16. 3. The method according to paragraph 1, wherein the method comprises determining the level of any 1, 2, 3, 4, 5, 6, 7, or 8, or all of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 5 [SEQ ID NO: 5] mir-1268; 10 Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 12 [SEQ ID NO: 12] mir-23a; and Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of any 1, 2, 3, 4, 5, 6, 7, or 8 or all of miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-3, 5, 9, 10, 12, and / or 16. 15 4a. The method according to any one of paragraphs 1-3, wherein the method comprises determining the level of all of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; 20 Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 12 [SEQ ID NO: 12] mir-23a; and Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-3, 5, 9, 25 10, 12, and 16. 4b. The method according to any one of paragraphs l-4a, wherein the method comprises determining the level of all of the following miRNAs: In some embodiment the kit comprises means to determine the level of (for example 30 primers and / or probes) all of: Biomarker 5 [ SEQ ID NO: 5] mir-1269; Biomarker 3 [ SEQ ID NO: 3] mir-221; Biomarker 6 [ SEQ ID NO: 6] mir-106b; Biomarker 13 [ SEQ ID NO: 13] mir-16; Biomarker 9 [SEQ ID NO: 9] mir-196a. Biomarker 2 [ SEQ ID NO: 2] mir-1290 or that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% 35 identical to any of the above sequences. 5. The method according to any one of paragraphs l-4b, wherein the one or more miRNAs are produced by the subject, optionally produced by the lung tissue of the subject, optionally produced at higher levels by a lung tumour cell or immune cell. 5 6. The method of any of paragraphs 1-5, wherein the sample is a liquid biopsy, optionally is a blood sample or a plasma sample. 7. The method of any of paragraphs 1-6 wherein the sample comprises one or more lung cancer cells; and / or is selected from the group comprising: a biopsy (such io as a core needle biopsy; fine needle biopsy; bronchoscopy sample); a tissue sample (such as a lung tissue or lung cancer tissue); an organ sample; and / or a bodily fluid sample (such as blood, saliva, sputum, urine, or pleural fluid). 8. The method according to any of the preceding paragraphs wherein the method 15 further comprises comparing the level of the one or more miRNAs from the subject to the level of the same one or more miRNAs in one or more control samples. 9. The method according to paragraph 8, wherein the control sample is a negative control sample, for example a sample that has been obtained from a healthy individual; 20 or a population of healthy individuals. 10. The method of any of the preceding paragraphs wherein the method further comprises comparing the level of the one or more miRNAs from the subject to a predetermined threshold level, optionally wherein the predetermined threshold level is a 25 level of the miRNA associated with a population of healthy individuals, i.e., individuals known to not have lung cancer, optionally where the predetermined threshold level is the Ct value for the level of the miRNA as determined by qPCR. 11. The method according to paragraph 9 or 10 further comprising the step of 30 determining that the subject has lung cancer if the level of the one or more miRNAs in the sample from the test subject is: a) at least 1.25, or at least 1.5, 1.75, 2.0, 2.25, 2.5, 2.75, or at least 3.0, 3.5, 4.0, 4.5, or at least 5.0, 6.0, 7.0, 8.0, 9.0, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 35 1100, 1200, or at least 1280 times higher than the level of the one or more miRNAs in the negative control sample, the population of healthy individuals, or the predetermined threshold level; and / or b) above a predetermined range or within a predetermined threshold level. 12. The method according to paragraph 9 or 10, further comprising the step of determining that the subject does not have or is not at high risk of having lung cancer, where the level of the one or more miRNAs in the test sample is: 5 a) the same as or substantially similar to the level of the same one or more miRNAs in the negative control sample the population of healthy individuals, or the predetermined threshold level; b) is not at least 1.25, or at least 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 or at least 3.0, 3.5, 4.0, 4.5, or at least 5.0, 6.0, 7.0, 8.0, 9.0, or at least 10, 20, 30, 40, 50, 10 60, 70, 80, 90, or at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, or at least 1280 times higher than the level of the one or more miRNAs in the negative control sample, the population of healthy individuals, or the predetermined threshold level; and / or c) within a predetermined range or below a predetermined threshold. 15 13. The method according to any of the preceding paragraphs wherein the method further comprises performing a low-dose computed tomography (LDCT) scan on the patient. 20 14. The method according to any of the preceding paragraphs wherein the level of the one or more miRNAs is considered in conjunction with an LDCT scan, optionally wherein a diagnosis of the presence or absence of lung cancer is based on the level of the one or more miRNAs and information obtained from the LDCT scan. 25 19. The method according to any one of the preceding paragraphs, wherein where the subject has been diagnosed with lung cancer based on the level of the one or more miRNAs, the subject is further analysed to determine the stage and / or subtype of lung cancer. 30 20. The method of paragraph 19, wherein determining the stage and / or subtype of lung cancer comprises providing a lung tissue biopsy from the subject and analysing said lung tissue biopsy. 21. The method according to any one of the preceding paragraphs wherein the lung 35 cancer is selected from the group comprising or consisting of: NSCLC or SCLC. 22. The method according to any one of the preceding paragraphs, wherein the lung cancer is Non-Small Cell Lung Cancer (NSCLC). 23. The method according to paragraph 22, wherein the NSCLC is selected from the group comprising: adenocarcinoma; squamous cell carcinoma; adenosquamous carcinoma; large cell carcinoma; or large cell neuroendocrine cancer, preferably 5 wherein the NSCLC is adenocarcinoma. 24. The method according to paragraph 22 or 24, wherein the NSCLC in the individual is early-stage NSCLC (i.e.. Stage 0, I or Stage II) or is late-stage NSCLC (i.e.. Stage III or Stage IV). 10 25. The method according to any one of paragraphs 1-21, wherein the lung cancer is Small Cell Lung Cancer (SCLC). 26. A method for lung nodule management comprising 15 a) determining the level of one or more miRNAs as described in any of paragraphs 1-25 in a sample from a subject that has been identified as having a lung nodule; b) determining whether the lung nodule is likely to be a tumour based upon 20 the level of the one or more miRNAs determined in (a), for example in accordance with the method of determining the presence of lung cancer of the invention. 27. The method according to any one of the preceding paragraphs wherein the 25 subject: a) has not had a diagnosis of lung cancer; b) is considered to be a healthy individual; c) has not undergone treatment for lung cancer; and / or d) has any one or more of the following symptoms, but has not had a diagnosis of lung 30 cancer: persistent cough; breathlessness; coughing up blood; chest pain; shoulder pain; chest ache; shoulder ache; recurrent chest infection; loss of appetite; fatigue; weight loss (optionally unexplained weight loss); changes in the shape of fingers and / or fingernails; finger clubbing; hypertrophic pulmonary osteoarthropathy; nausea and vomiting; headaches; confusion; weakness; restlessness; irritability; muscle 35 weakness, spasms, cramps, or aches; seizures; dry eyes; blurred vision; dysphagia; dizziness; dry mouth; constipation; erectile dysfunction. 28. The method according to any one of the preceding paragraphs wherein the method is for diagnosis of early-stage lung cancer. 29. The method according to paragraph 28, wherein the early-stage lung cancer is: 5 a) early-stage NSCLC (i.e., Stage 0, I or Stage II NSCLC); or b) early-stage SCLC (i.e., limited SCLC). 30. The method according to any one of the preceding paragraphs wherein the subject has been diagnosed with a lung nodule following a computerised tomography 10 (CT) scan, MRI scan, LDCT scan or X-ray scan. 31. The method according to any of the preceding paragraphs wherein in the event that the individual is diagnosed with lung cancer, the method further comprises a step of providing the individual with a lung cancer therapy, optionally wherein the lung 15 cancer therapy is selected from the group comprising: surgery, chemotherapy, radiotherapy, immunotherapy, chemoimmunotherapy, thermochemotherapy and combinations thereof, adoptive cell therapies, gene therapies, cancer vaccines, and oncolytic virus therapies. 20 32. A method of determining whether a lung nodule is a lung cancer tumour or is benign, wherein the method comprises performing the method of determining the presence of lung cancer according to any of paragraphs 1-31 on a subject identified as having a lung nodule, optionally identified as having a lung nodule based on a CT scan. 25 33. A kit comprising one or more or all of the following: a) means to determine the level of at least one of the following; Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ 30 ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; 35 b) means for the extraction and purification of RNA from a sample; and / or c) a control sample of RNA prepared from a sample from subjects, optionally wherein the means to determine the level of at least one of the miRNAs comprises: i) at least one pair of primers are arranged so as to amplify at least one or more of the following miRNAs; Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; 5 Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 10 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or at least one or more miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16; ii) at least one or more probe arranged so as to hybridise to at least one or 15 more of the following miRNAs: Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; LO CXI Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; 19 11 NJ O Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or at least one or more miRNAs with a sequence that has at 25 least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-16; iii) at least one or more probe arranged so as to hybridise all of the following miRNAs (i.e. there is at least one probe that can hybridise to each of the miRNAs, rather than a single probe that can bind to all of the miRNAs - however 30 this embodiment is also considered within the scope of the invention]: Biomarker 5 [ SEQ ID NO: 5] mir-1269; Biomarker 3 [ SEQ ID NO: 3] mir-221; Biomarker 6 [ SEQ ID NO: 6] mir-106b; Biomarker 13 [ SEQ ID NO: 13] mir-16; Biomarker 9 [SEQ ID NO: 9] mir-196a. Biomarker 2 [ SEQ ID NO: 2] mir-1290 or that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 35 99% or 100% identical to any of the above sequences. optionally wherein the at least one or more probe(s) are TaqMan probes; iii) reverse transcriptase and / or DNA polymerase; iv) a microarray; and / or vi) an array card. 5 35. The method according to paragraph 33, wherein b) means for the extraction and purification of RNA from a sample comprises microRNA extraction columns or magnetic beads. 36. A method of treating lung cancer in an individual comprising the steps of: 10 (i) diagnosing lung cancer according to the method defined in any one of Paragraphs 1-35; and (ii) providing the individual with lung cancer therapy. 15 37. A method, use, array, or kit for determining the presence of lung cancer in an individual substantially as described herein. LO CXI References 20 1. Howlader N, Forjaz G, Mooradian MJ, Meza R, Kong CY, Cronin KA, et al. The Effect of Advances in Lung-Cancer Treatment on Population Mortality. N Engl J Med. 2020;383(7):640-9. 2. Herbst RS, Garon EB, Kim DW, Cho BC, Perez-Gracia JL, Han JY, et al. Long- Term Outcomes and Retreatment Among Patients With Previously Treated, 25 Programmed Death-Ligand 1-Positive, Advanced Non-Small-Cell Lung Cancer in the KEYNOTE-010 Study. J Clin Oncol. 2020;38(14):1580-90. 3. Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209-49. 30 4. National Cancer Institute S, Epidemiology, and End Results Program (SEER). SEER*Explorer: An interactive website for SEER cancer statistics [Internet resource]. 2022 [Available from: https: / / seer.cancer.gov / statistics- network / explorer / application.html. 5. National Cancer Institute S, Epidemiology, and End Results Program (SEER). 35 Cancer Stat Facts: Lung and Bronchus Cancer 2022 [Available from: https: / / seer.cancer.gov / statfacts / html / lungb.html. 6. National Lung Screening Trial Research Team, Aberle DR, Berg CD, Black WC, Church TR, Fagerstrom RM, et al. The National Lung Screening Trial: overview and study design. Radiology. 2011;258(l):243-53. 7. de Koning HJ, van der Aalst CM, de Jong PA, Scholten ET, Nackaerts K, 5 Heuvelmans MA, et al. Reduced Lung-Cancer Mortality with Volume CT Screening in a Randomized Trial. N Engl J Med. 2020;382(6):503-13. 8. Wait S, Alvarez-Rosete A, Osama T, Bancroft D, Cornelissen R, Marusic A, et al. Implementing Lung Cancer Screening in Europe: Taking a Systems Approach. JTO Clin Res Rep. 2022;3(5): 100329. 10 9. van Meerbeeck JP, Franck C. Lung cancer screening in Europe: where are we in 2021? Transl Lung Cancer Res. 2021;10(5):2407-17. 10. Jonas DE, Reuland DS, Reddy SM, Nagle M, Clark SD, Weber RP, etal. Screening for Lung Cancer With Low-Dose Computed Tomography: Updated Evidence Report and Systematic Review for the US Preventive Services Task Force. JAMA. 15 2021;325(10):971-87. 11. Harris E. Research Shows Air Pollution Promotes Lung Cancer. JAMA. 2023;329(18):1543. 12. Gourd E. New evidence that air pollution contributes substantially to lung cancer. Lancet Oncol. 2022;23(10):e448. 20 13. Cheng ES, Chan KH, Weber M, Steinberg J, Young J, Canfell K, et al. Solid Fuel, Secondhand Smoke, and Lung Cancer Mortality: A Prospective Cohort of 323,794 Chinese Never-Smokers. Am J Respir Crit Care Med. 2022;206(9): 1153-62. 14. Freitas C, Sousa C, Machado F, Serino M, Santos V, Cruz-Martins N, et al. The Role of Liquid Biopsy in Early Diagnosis of Lung Cancer. Front Oncol. 2021;ll:634316. 25 15. Li RY, Liang ZY. Circulating tumor DNA in lung cancer: real-time monitoring of disease evolution and treatment response. Chin Med J (Engl). 2020;133(20):2476-85. 16. Bettegowda C, Sausen M, Leary RJ, Kinde I, Wang Y, Agrawal N, etal. Detection of circulating tumor DNA in early- and late-stage human malignancies. Sci Transl Med. 2014;6(224):224ra24. 30 17. Wu KL, Tsai YM, Lien CT, Kuo PL, Hung AJ. The Roles of MicroRNA in Lung Cancer. Int J Mol Sci. 2019;20(7). 18. Wang W, Li X, Liu C, Zhang X, Wu Y, Diao M, et al. MicroRNA-21 as a diagnostic and prognostic biomarker of lung cancer: a systematic review and meta-analysis. Biosci Rep. 2022;42(5). 35 19. Zhong S, Golpon H, Zardo P, Borlak J. miRNAs in lung cancer. A systematic review identifies predictive and prognostic miRNA candidates for precision medicine in lung cancer. Transl Res. 2021;230:164-96. 20. Frydrychowicz M, Kuszel L, Dworacki G, Budna-Tukan J. MicroRNA in lung cancer-a novel potential way for early diagnosis and therapy. J Appl Genet. 2023. 21. Kirschner MB, Kao SC, Edelman JJ, Armstrong NJ, Vallely MP, van Zandwijk N, et al. Haemolysis during sample preparation alters microRNA content of plasma. PLoS 5 One. 2011;6(9):e24145. 22. Hong LZ, Zhou L, Zou R, Khoo CM, Chew ALS, Chin CL, et al. Systematic evaluation of multiple qPCR platforms, NanoString and miRNA-Seq for microRNA biomarker discovery in human biofluids. Sci Rep. 2021;ll(l):4435. 23. Zhang YK, Zhu WY, He JY, Chen DD, Huang YY, Le HB, et al. miRNAs expression 10 profiling to distinguish lung squamous-cell carcinoma from adenocarcinoma subtypes. J Cancer Res Clin Oncol. 2012;138(10): 1641-50. 24. Cheong JK, Tang YC, Zhou L, Cheng H, Too HP. Advances in quantifying circulatory microRNA for early disease detection. Curr Opin Biotechnol. 2022;74:256-62. 15 25. Geng Q, Fan T, Zhang B, Wang W, Xu Y, Hu H. Five microRNAs in plasma as novel biomarkers for screening of early-stage non-small cell lung cancer. Respir Res. 2014;15(l): 149. 26. Sozzi G, Boeri M, Rossi M, Verri C, Suatoni P, Bravi F, etal. Clinical utility of a plasma-based miRNA signature classifier within computed tomography lung cancer 20 screening: a correlative MILD trial study. J Clin Oncol. 2014;32(8):768-73. 27. Ying L, Du L, Zou R, Shi L, Zhang N, Jin J, et al. Development of a serum miRNA panel for detection of early stage non-small cell lung cancer. Proc Natl Acad Sci USA. 2020;117(40):25036-42. 28. Asakura K, Kadota T, Matsuzaki J, Yoshida Y, Yamamoto Y, Nakagawa K, 25 Takizawa S, Aoki Y, Nakamura E, Miura J, Sakamoto H, Kato K, Watanabe SI, Ochiya T. A miRNA-based diagnostic model predicts resectable lung cancer in humans with high accuracy. Commun Biol. 2020 Mar 19;3(1):134. doi: 10.1038 / s42003-020-0863-y. PMID: 32193503; PMCID: PMC7081195. 29. Hetta HF, Zahran AM, Shafik EA, El-Mahdy RI, Mohamed NA, Nabil EE, Esmaeel 30 HM, Alkady OA, Elkady A, Mohareb DA, Hosni A, Mostafa MM, Elkady A. Circulating miRNA-21 and miRNA-23a Expression Signature as Potential Biomarkers for Early Detection of Non-Small-Cell Lung Cancer. Microrna. 2019;8(3):206-215. doi: 10.2174 / 1573399815666190115151500. PMID: 30652656. 30. Huang, W., Li, H. &Luo, R. RETRACTED ARTICLE: The microRNA-1246 promotes 35 metastasis in non-small cell lung cancer by targeting cytoplasmic polyadenylation element-binding protein 4. Diagn Pathol 10, 127 (2015). https: / / doi.org / 10.1186 / sl3000-015-0366-l 31. Liu, Xh., Lu, Kh., Wang, Km. et al. MicroRNA-196a promotes non-small cell lung cancer cell proliferation and invasion through targeting HOXA5. BMC Cancer 12, 348 (2012). https: / / doi.org / 10.1186 / 1471-2407-12-348 32. Mo D, Gu B, Gong X, Wu L, Wang H, Jiang Y, Zhang B, Zhang M, Zhang Y, Xu 5 J, Pan S. miR-1290 is a potential prognostic biomarker in non-small cell lung cancer. J Thorac Dis. 2015 Sep;7(9): 1570-9. doi: 10.3978 / j.issn.2072-1439.2015.09.38. PMID: 26543604; PMCID: PMC4598517. 33. X. Chen et al., Identification of ten serum microRNAs from a genome-wide serum microRNA expression profile as novel noninvasive biomarkers for nonsmall cell 10 lung cancer diagnosis. Int. J. Cancer 130, 1620-1628 (2012). 34. Xue X, Liu Y, Wang Y, Meng M, Wang K, Zang X, Zhao S, Sun X, Cui L, Pan L, Liu S. MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519. doi: 10.18632 / oncotarget. 13022. PMID: 27811366; PMCID: PMC5356677. 15 35. Zhang, W., Chin, T., Yang, H. et al. Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progression. Nat Commun 7, 11702 (2016). https: / / doi.org / 10.1038 / ncommsll702 LO CXI 20 Figure legends 1— Figure 1: Diagnostic accuracy of individual biomarkers. The accuracy of each individual -j— biomarker is determined by taking the average of its sensitivity and specificity and it ranges from 58%-72%. A) Importance ranking of each individual biomarker. B) Area 25 under the curve for each biomarker. Figure 2: The biomarkers can pick up lung cancer at early stages better than late stages. The performance in terms of sensitivity of the combination of 8 biomarkers is compared between the early-stage and late-stage lung cancer patients. The lung 30 cancer patients includes both NSCLC and SCLC patients. The combination of 8 biomarkers is more superior in detection in early stages than late stages. Examples 35 Example 1 - Lung cancer diagnosis study design This is an age and gender matched case-control study that recruit subjects from a tertiary teaching hospital in Singapore (Sengkang General Hospital). The inclusion criteria for cases are subjects with a new diagnosis of lung cancer made from positive histopathology. Inclusion criteria for cohort are subjects with no radiographic imaging evidence of lung nodules or mass and subjects who have benign lung condition following biopsy of lung nodules. All subjects are aged between 18 and 85 years of age and mentally competent to give informed consent for participation in the study. 5 Patients with a known history of malignancy or active malignancy undergoing treatment will be excluded from the study. Example 2 - Materials and methods 10 All subjects underwent venipuncture and have 5ml of peripheral blood samples drawn in plain serum tubes (BD vacutainer plus plastic serum tube). Blood samples were left to clot for 45-60min and centrifuged at 2000g for 15mins at room temperature. Serum was aliquoted and stored in cryotubes at -80 °C for long term storage. Haemolyzed samples were not analysed due to potential contamination by miRNAs released from 15 red blood cells (Kirschner et al., 2011). miRNA extraction, isolation and quantification The expression for each of the miRNA was quantified and compared between the cases and healthy controls. The experimental details are as follow. Total RNA isolation 20 (including miRNA) from 200 pL of blood serum of each patient was extracted. cDNA was synthesized by extending the miRNA at each end prior to RT. The cDNA was then pre-amplified using universal primers and a master mix to uniformly increase the amount of cDNA for each target, maintaining the relative differential levels. Unlike traditional preamplification, these primers recognize the universal sequences added to 25 every miRNA at the 5' and 3' ends, helping to ensure there is no amplification bias. TaqMan primers and probes were used to quantitate each miRNA target via real time qPCR. The primer and probe set for each miRNA were either preformulated or customized. The reactions were incubated in a 96-well plate at 95°C for 30s, followed by 40 cycles of 95°C for 3s and 60°C for 30s. The qPCR reaction can be carried out in 30 either Thermoscientific Quantstudio 3 or Applied Biosystems HT7500. Statistical analysis Ct values are generated from the qPCR results for each of the miRNA biomarkers for all the patients. The Ct value of each miRNA is normalized with a threshold Ct value to 35 determine the fold change. A fold change of greater than 2 is considered a positive expression of the miRNA in the blood sample. Example 3 - miRNA biomarker validation results Patient characteristics miRNA levels were analysed in a case-control cohort consisting of 45 cases and 55 5 controls. The patients were between 24 to 82 years old. The demographics and baseline characteristics of the study cohort is as summarised. Among the cases, 41 were diagnosed with non-small cell lung cancer (NSCLC), while 4 had small cell carcinomas. The distribution of lung cancer stages at the time of io diagnosis was as follows: 18 patients at Stage I, 3 patients at Stage II, 4 patients at Stage III, and 16 patients at Stage IV with metastatic disease. Among the small cell carcinomas, 3 patients were diagnosed at the limited stage, while 1 patient was at the extensive stage (Table 1). 15 Table 1: Demographics and baseline characteristics of the study cohort 19 11 25 Control Cases Asian 51 37 Caucasian 4 8 Total 55 45 Age 24 to 82 NSCLC Stage I - 18 Stage II - 3 Stage III - 4 Stage IV - 16 SCLC Limited - 3 Extensive - 1 miRNA biomarkers for early lung cancer detection 20 Through an extensive manual curation of published literature, including PubMed, Embase, Web of Science and ScienceDirect and published systematic reviews, we meticulously compiled a comprehensive list of 48 potential biomarkers for lung cancer (18-20). This rigorous process involved thorough examination of numerous studies, analysing their findings, and identifying markers that showed promising correlations with the disease. Subsequently, we conducted detailed expression analysis on these 5 48 biomarkers on early-stage lung cancer samples. Out of the 48 biomarkers, 16 biomarkers demonstrated consistent and significant expression patterns within our samples, exhibiting at least a 2-fold increase compared to healthy controls. This suggests their potential relevance in the context of lung cancer. 10 Diagnostic accuracy of miRNA panel for lung cancer To assess the performance of each biomarker, we evaluated their sensitivity and specificity. These measures allow us to determine their ability to accurately identify lung cancer cases and distinguish them from healthy individuals. Additionally, we 15 calculated the overall accuracy, which represents an average of the sensitivity and specificity values. The accuracy of each biomarker ranged from 58% to 72%, as depicted in Figure 1. These findings highlight the potential of each these selected biomarkers as diagnostic tools for early-stage lung cancer with varied performance. 20 To further optimize the diagnostic accuracy of these biomarkers in lung cancer detection, we employed machine learning techniques to vary the combination between six to twelve biomarkers. Leveraging the power of computational algorithms, we developed a robust model capable of assessing the combined predictive value of multiple biomarkers. The objective was to identify the most effective combination that 25 would yield the highest accuracy, sensitivity, and specificity in diagnosing lung cancer. After an in-depth analysis using the machine learning approach, we successfully identified the optimal combination of eight biomarkers. This carefully chosen set demonstrated exceptional performance in accurately distinguishing lung cancer cases from healthy individuals. Our lung cancer biomarkers have an Area Under the Curve 30 (AUC) value of 0.83 and this indicates a high level of sensitivity and specificity in distinguishing between lung cancer cases and healthy individuals. Comparing early-stage vs late-stage patients, we can achieve a high sensitivity of 83% and 71% respectively (Table 2). 35 Table 2: Comparison of early-stage vs late-stage patients for lung cancer biomarkers Positive Negative Total Early Stage 20 4 24 Late Stage 15 6 21 Controls 14 41 55 Total 49 51 100 Sensitivity Early Stage (I, II, Limited) 83% Late Stage (III, IV, Extensive) 71% Specificity 75% PPV 71% NPV 80% 19 11 25 The higher sensitivity for early-stage patients suggested that our biomarkers perform better in picking up early stage than late-stage cancer and this embodies its application 5 for early cancer screening. Additionally, we attained a specificity of 75% which is superior to the standard of care using low-dose CT scan to reduce the likelihood of false positives (Figure 2). The discovery of this refined panel of 8 biomarkers underscores the potential for significant advancements in the early detection for lung cancer screening. 10 Diagnostic accuracy of miRNA panel for lung cancer (Including nodule / CT features') With the positive outcomes of several lung cancer screening trials demonstrating the effectiveness of lung cancer screening in reducing mortality, the implementation of CT 15 screening programs targeting high-risk individuals is expected to lead to an increase in the incidence of incidental lung nodules. While the majority of these incidental pulmonary nodules (IPNs) are benign, the current predictive tools such as Brock's calculators, for distinguishing between benign and malignant nodules are not optimal. This has resulted in a significant number of follow-up CT scans, unnecessary invasive 20 biopsies with associated risks, and, though rare, even mortality, causing heightened patient anxiety and contributing to excessive healthcare expenditures. Addressing these challenges is crucial, and there is an urgent need for more accurate and efficient diagnostic methods to differentiate between benign and potentially 25 cancerous nodules. Our approach of incorporating miRNA data with LDCT scan results and patient clinical information shows great promise in addressing the diagnostic challenge posed by indeterminate pulmonary lung nodules, especially those measuring less than 6mm. By utilizing advanced machine learning techniques, specifically logistic regression, we have successfully distinguished between benign and malignant lung nodules with remarkable efficacy. Our comprehensive multi-modal approach combines miRNA data 5 with LDCT scan data, including nodule size, shape, position, and patient clinical information, such as patient history and smoking status. The integration of miRNA biomarkers with LDCT scans has resulted in a significant enhancement of the sensitivity of our miRNA test, increasing it from 71-83% to an impressive 95%. Moreover, we have also improved the specificity from 75%-91%. This promising advancement holds 10 potential to revolutionize lung cancer screening and diagnosis, providing better patient outcomes and optimizing healthcare resources. Example 4 - miRNA biomarker validation discussion 15 Potential application as a lung cancer screening tool (Stand-alone) Our lung cancer biomarkers have an Area Under the Curve (AUC) value of 0.83 and this indicates a high level of sensitivity and specificity in distinguishing between lung cancer cases and healthy individuals. Comparing early-stage vs late-stage patients, we 20 can achieve a high sensitivity of 83% and 71% respectively. The higher sensitivity for early-stage patients suggested that our biomarkers perform better in picking up early stage than late-stage cancer and this embodies its application for early cancer screening. Additionally, we attained a specificity of 75% which is superior to the standard of care using low-dose CT scan to reduce the likelihood of false positives 25 (Figure 2). The discovery of this refined panel of 8 biomarkers underscores the potential for significant advancements in the early detection for lung cancer screening. Potential application as a lung cancer screening tool in conjunction with LDCT (Reducing false positives) 30 Lung nodule management remains a challenge to clinicians, especially in Asia which is endemic tuberculosis areas. Different guidelines are available with various recommendations; however, the suitability of these guidelines for the Asian population is still unclear especially for lung nodules that are smaller than 3mm. With the use of 35 low-dose CT scans, there is a concern regarding the false positive rate, which can lead to unnecessary anxiety, pain, and invasive biopsies for patients. Therefore, there is a critical need for a reliable and accurate diagnostic test that can effectively identify the right patients who require further invasive procedures. In our pursuit to address this diagnostic challenge, we incorporated miRNA data with the LDCT scan results and patient clinical information. By utilizing machine learning logistics regression techniques, we were able to effectively distinguish benign lung 5 nodules from malignant ones. From our study, using this multi-modal approach, we can enhance the sensitivity of our miRNA test from 71-83% to an impressive 95%, and also improving the specificity from 75%- 91%. The integration of our biomarkers with LDCT scans has demonstrated significant potential in improving the overall diagnostic accuracy for identifying lung cancer cases. Our findings indicate that incorporating 10 miRNA data into the existing LDCT screening process can effectively improve the poor specificity of LDCT scan. This advancement has the potential to minimize false positives, reducing unnecessary patient distress and invasive procedures. Strength and limitation 15 Our study is one of the first to validate a panel of miRNA biomarkers in detection of lung cancer, regardless of lung cancer subtypes. Multiple previous studies have previously validated miRNA biomarkers for NSCLS alone (Geng et al., 2014; Sozzi et al., 2014; Ying etal., 2020). 20 The limitation of our study is our relatively small sample size, limiting the power of statistical analysis and strength of association between the miRNA biomarkers and lung cancer. This study also only involved a cohort of patients from South-east Asia ethnicity. Different racial and ethnic groups may have different baseline miRNA profiles, 25 potentially altering the sensitivity and specificity of our propriety miRNA panel for lung cancer testing in different populations. Conclusion 30 A panel utilising 8 miRNA biomarkers in peripheral blood specimen performed very well in detection of lung cancer, regardless of subtypes. The miRNA panel shows great potential in changing the landscape for lung cancer screening and diagnostic algorithm of lung nodules picked up on LDCT.

Claims

19 11 251. A method for determining the presence of lung cancer in a subject wherein the method comprises determining a biomarker signature in a sample, wherein determining the biomarker signature comprises determining in said sample the level of 6 or more miRNAs comprising Biomarker 2 [SEQ ID NO: 2] mir-1290 and Biomarker 5 [SEQ ID NO: 5] mir-1268 or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical thereto and 4 or more of the following miRNAs:Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486; or determining the level of any 6 or more of the miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1, 3, 4, 6-16.

2. The method according to claim 1, wherein determining the biomarker signature comprises determining the level of:a) all of the following miRNAs:Biomarker 5 [ SEQ ID NO: 5] mir-1268; Biomarker 3 [ SEQ ID NO: 3] mir-221; Biomarker 6 [ SEQ ID NO: 6] mir-106b; Biomarker 13 [ SEQ ID NO: 13] mir-16; Biomarker 9 [SEQ ID NO: 9] mir-196a. Biomarker 2 [ SEQ ID NO: 2] mir-1290 or determining the level of miRNAs with a sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NOs: 1-3, 5, 9, 10, 12, and 16; orb) all of the following miRNA:Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 2 [SEQ ID NO: 2] miR-1290; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 5 [SEQ ID NO: 5] mir-1268; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 12 [SEQ ID NO: 12] mir-23a; and Biomarker 16 [SEQ ID NO: 16] mir-486.

3. The method according to any of claims 1 or 2 wherein the sample is a blood sample or a plasma sample.

4. The method according to any of claim 1 or 2 wherein the sample:19 11 25a) is a liquid biopsy, optionally is a blood sample or a serum or plasma sample; and / orb) comprises one or more lung cancer cells; and / or is selected from the group comprising: a biopsy (such as a core needle biopsy; fine needle biopsy; bronchoscopy sample); a tissue sample (such as a lung tissue or lung cancer tissue); an organ sample; and / or a bodily fluid sample (such as blood, saliva, sputum, urine, or pleural fluid).

5. The method according to any one of claims 1-4, wherein the one or more miRNAs are produced by the subject, optionally produced by the lung tissue of the subject, optionally produced at higher levels by a lung tumour cell or immune cell.

6. The method according to any of the preceding claims wherein the method further comprises comparing the level of the one or more miRNAs from the subject to the level of the same one or more miRNAs in one or more control samples.

7. The method according to claim 6, wherein the control sample is a negative control sample.

8. The method of claim 7 wherein the negative control sample is a sample that has been obtained from a healthy individual; or a population of healthy individuals.

9. The method of any of the preceding claims wherein the method further comprises comparing the level of the one or more miRNAs from the subject to a pre-determined threshold level, optionally wherein the predetermined threshold level is a level of the miRNA associated with a population of healthy individuals, i.e., individuals known to not have lung cancer, optionally where the predetermined threshold level is the Ct value for the level of the miRNA as determined by qPCR.

10. The method according to claim 8 or 9 further comprising the step of determining that the subject has lung cancer if the level of the one or more miRNAs in the sample from the test subject is:i) a) at least 1.25, or at least 1.5, 1.75, 2.0, 2.25, 2.5, 2.75, or at least 3.0, 3.5, 4.0, 4.5, or at least 5.0, 6.0, 7.0, 8.0, 9.0, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100,19 11 251200, or at least 1280 times higher than the level of the one or more miRNAs in the negative control sample, the population of healthy individuals, or the predetermined threshold level; and / orb) above a predetermined range or within a predetermined threshold level; orii) a) the same as or substantially similar to the level of the same one or more miRNAs in the negative control sample the population of healthy individuals, or the predetermined threshold level;b) is not at least 1.25, or at least 1.5, 1.75, 2.0, 2.25, 2.5, 2.75 or at least 3.0, 3.5, 4.0, 4.5, or at least 5.0, 6.0, 7.0, 8.0, 9.0, or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or at least 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, or at least 1280 times higher than the level of the one or more miRNAs in the negative control sample, the population of healthy individuals, or the predetermined threshold level; and / orc) within a predetermined range or below a predetermined threshold.

11. The method according to any of the preceding claims wherein:a) the method further comprises performing a low-dose computed tomography (LDCT) scan on the patient; and / orb) the level of the one or more miRNAs is considered in conjunction with an LDCT scan, optionally wherein a diagnosis of the presence or absence of lung cancer is based on the level of the one or more miRNAs and information obtained from the LDCT scan.

12. The method according to any one of the preceding claims, wherein where the subject has been diagnosed with lung cancer based on the level of the one or more miRNAs, the subject is further analysed to determine the stage and / or subtype of lung cancer; optionallywherein determining the stage and / or subtype of lung cancer comprises providing a lung tissue biopsy from the subject and analysing said lung tissue biopsy.

13. The method according to any one of the preceding claims wherein the lung cancer is selected from the group comprising or consisting of: NSCLC or SCLC.

14. The method according to any one of the preceding claims, wherein the lung cancer is Non-Small Cell Lung Cancer (NSCLC); optionallywherein:19 11 25a) the NSCLC is selected from the group comprising: adenocarcinoma; squamous cell carcinoma; adenosquamous carcinoma; large cell carcinoma; or large cell neuroendocrine cancer, preferably wherein the NSCLC is adenocarcinoma; and / orb) the NSCLC in the individual is early-stage NSCLC (i.e., Stage 0, I or Stage II) or is late-stage NSCLC (i.e., Stage III or Stage IV).

15. The method according to any one of claims 1-13, wherein the lung cancer is Small Cell Lung Cancer (SCLC).

16. The method according to any one of the preceding claims, wherein the method comprises lung cancer screening, lung nodule management and treatment response monitoring and companion diagnostics.

17. The method according to any one of the preceding claims wherein the subject:a) has not had a diagnosis of lung cancer;b) is considered to be a healthy individual;c) has not undergone treatment for lung cancer; and / ord) has any one or more of the following symptoms, but has not had a diagnosis of lung cancer: persistent cough; breathlessness; coughing up blood; chest pain; shoulder pain; chest ache; shoulder ache; recurrent chest infection; loss of appetite; fatigue; weight loss (optionally unexplained weight loss); changes in the shape of fingers and / or fingernails; finger clubbing; hypertrophic pulmonary osteoarthropathy; nausea and vomiting; headaches; confusion; weakness; restlessness; irritability; muscle weakness, spasms, cramps, or aches; seizures; dry eyes; blurred vision; dysphagia; dizziness; dry mouth; constipation; erectile dysfunction.

18. The method according to any one of the preceding claims wherein the method is for diagnosis of early-stage lung cancer; optionallywherein the early-stage lung cancer is:a) early-stage NSCLC (i.e., Stage 0, I or Stage II NSCLC); orb) early-stage SCLC (i.e., limited SCLC).

19. The method according to any one of the preceding claims wherein the subject has been diagnosed with a lung nodule following a computerised tomography (CT) scan, MRI scan, LDCT scan or X-ray scan.

20. The method according to any of the preceding claims wherein in the event that the individual is diagnosed with lung cancer, the method further comprises a step of providing19 11 25the individual with a lung cancer therapy, optionally wherein the lung cancer therapy is selected from the group comprising: surgery, chemotherapy, radiotherapy, immunotherapy, chemoimmunotherapy, thermochemotherapy and combinations thereof, adoptive cell therapies, gene therapies, cancer vaccines, and oncolytic virus therapies.

21. A method of determining whethera lung nodule is a lung cancertumour or is benign, wherein the method comprises performing the method of determining the presence of lung cancer according to any of claims 1-20 on a subject identified as having a lung nodule, optionally identified as having a lung nodule based on a CT scan.

22. A kit comprising means to determine a biomarker signature, wherein determining the biomarker signature consists of determining the level of the following miRNAs: Biomarker 2 [SEQ ID NO: 2] mir-1290 and Biomarker 5 [SEQ ID NO: 5] mir-1268 or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical thereto and at least four of the following;Biomarker 1 [SEQ ID NO: 1] miR-1246; Biomarker 3 [SEQ ID NO: 3] mir-221; Biomarker 4 [SEQ ID NO: 4] mir-223; Biomarker 6 [SEQ ID NO: 6] mir-106b; Biomarker 7 [SEQ ID NO: 7] mir-26; Biomarker 8[SEQ ID NO: 8] mir-21; Biomarker 9 [SEQ ID NO: 9] mir-196a; Biomarker 10[SEQ ID NO: 10] mir-130b; Biomarker 11 [SEQ ID NO: 11] mir-155; Biomarker 12 [SEQ ID NO: 12] mir-23a; Biomarker 13 [SEQ ID NO: 13] mir-16; Biomarker 14 [SEQ ID NO: 14] mir-222; Biomarker 15 [SEQ ID NO: 15] mir-451; Biomarker 16 [SEQ ID NO: 16] mir-486.

23. The kit according to claim 22, further comprising microRNA extraction columns or magnetic beads.

Citation Information

Patent Citations

  • miRNA BIOGENESIS IN EXOSOMES FOR DIAGNOSIS AND THERAPY

    US20160024503A1

  • Cancer biomarkers and methods of use

    US20200325539A1

  • Mirna fingerprint in the diagnosis of lung cancer

    US20220042102A1

  • Mirnas as biomakers for distinguishing benign from malignant thyroid neoplasms

    US20220213551A1

  • miRNA IN THE DIAGNOSIS OF OVARIAN CANCER

    WO2011095623A2