Direct amplification and detection of viral and bacterial pathogens

HK40082755BActive Publication Date: 2026-07-17QUEST DIAGNOSTICS INVESTMENTS INC

Patent Information

Authority / Receiving Office
HK · HK
Patent Type
Patents
Current Assignee / Owner
QUEST DIAGNOSTICS INVESTMENTS INC
Filing Date
2023-05-02
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Current diagnostic methods for viral and bacterial pathogens, such as RT-PCR, are time-consuming and expensive, requiring complex sample preparation and nucleic acid extraction steps, which hinder rapid and cost-effective detection.

Method used

A reagent mixture comprising a cationic surfactant and buffer, including components like KCl and bovine serum albumin, allows for direct amplification of nucleic acids without prior extraction, utilizing thermocycling and DNA polymerase to amplify target nucleic acids in biological samples.

Benefits of technology

Enables rapid and sensitive detection of pathogens like influenza and C. difficile directly from samples, reducing the need for extraction and purification steps while maintaining or improving sensitivity compared to traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000040_0000
    Figure 00000040_0000
  • Figure 00000041_0000
    Figure 00000041_0000
  • Figure 00000042_0000
    Figure 00000042_0000
Patent Text Reader
Need to check novelty before this filing date? Find Prior Art

Description

FIELD OF THE INVENTION

[0001] The present invention relates to diagnostic and detection methods for viral and bacterial pathogen nucleic acids using direct amplification.BACKGROUND OF THE INVENTION

[0002] The following discussion of the background of the invention is merely provided to aid the reader in understanding the invention and is not admitted to describe or constitute prior art to the present invention.

[0003] Clinical detection of viruses is usually accomplished using any one of a variety of methods. For example, virus particles or nucleic acids may be isolated from a biological samples (e.g., nasopharyngeal aspirates, throat swabs, blood fluids, fecal material, etc.). A retrospective diagnosis may be made by serology. Complement Fixation Tests (CFT) are most widely used in this method, although hemagglutination inhibition (HAI) and enzyme immonoassays (EIA) may be used to give a type-specific diagnosis. For more rapid diagnosis, either antigen detection or RNA detection may be performed. Antigen detection may be done by IFT or EIA, however, to achieve the highest level of sensitivity and specificity, RNA detection by reverse transcriptase polymerase chain reaction (RT-PCR) is used. However, the latter is expensive and technically demanding.

[0004] Similarly, bacterial detection may be accomplished using a variety of methods, including gram staining, culture, microarray, and polymerase chain reaction (PCR) or real-time PCR. Unlike detection of viruses such as Influenza, which has a genome composed of RNA and therefore requires a transcription step to create target cDNA for use in traditional or real-time PCR, bacterial detection can be accomplished using a standard PCR protocol. Even without the additional RT step, however, PCR or real-time PCR are, as described below, time-consuming and expensive diagnostic methods.

[0005] RT-PCR is a laboratory technique used to amplify and quantify a targeted nucleic acid. The procedure follows the general principle of polymerase chain reaction, although in RT-PCR an RNA strand is first reverse transcribed into its DNA complement (cDNA) using the enzyme reverse transcriptase, and the resulting cDNA is amplified using traditional PCR or real-time PCR. The reverse transcription (RT) step can be performed either in the same tube with PCR (one-step PCR) or in a separate one (two-step PCR) using a temperature between about 40°C and 50°C, depending on the properties of the reverse transcriptase used. The dsDNA is then denaturized at about 95°C, so that the two strands separate and the primers can bind again at lower temperatures and begin a new amplification reaction. DNA extension from the primers takes place using a thermostable Taq DNA polymerase, usually at about 72°C. Real-time RT-PCR provides a method in which the amplicons can be visualized as the amplification progresses using a fluorescent reporter molecule.

[0006] Given the high degree of complexity associated with the preparing and processing viral and bacterial nucleic acids from biological samples for detection, diagnosis, and / or quantitation, in cases where rapid diagnosis is sought, there is a need for methods involving fewer steps, fewer technological requirements, and shorter durations. Anusak Kerdsin ET AL (2010-01-01) and G. LIGUORI ET AL (2006-11-14) teach direct amplification of pathogens from nasal and oral samples. WO 2009 / 016652 A1 teaches a direct PCR in presence of a buffer containing only non-ionic detergents, such as Nonidet-P40. MERCIER B ET AL (1990-10-11) and EP 1 715 063 A2 both teach direct PCR detection of targets without prior DNA extraction from the samples. WO 2010 / 116290 A1 generally discloses a scorpion type primer. HEEJIN BAE ET AL (2009-05-03) suggests the use of BSA and MgCl2 to optimize PCR reactions whereas WO 2011 / 010740 A1 suggests the use of cationic surfactants for direct PCR methods.SUMMARY OF THE INVENTION

[0007] The present invention, which is defined in the appended claims, is based on the discovery of a reagent mixture comprising a cationic surfactant, that allows for direct amplification of a sample, without the step of nucleic acid extraction.

[0008] In one aspect, the present disclosure, without being part of the invention, provides a method for identifying the presence or absence of a target nucleic acid from a microorganism in a biological sample obtained from a human, said method comprising: (a) contacting the sample with a DNA polymerase and a buffer under conditions suitable for amplification of the target nucleic acid from the sample without extracting the target nucleic acid from the sample; (b) thermocycling the sample from step (a) such that the target nucleic acid, if present, is amplified; and (c) detecting the amplified target nucleic acid, if present, produced from step (b), wherein the sample nucleic acid is not extracted prior to amplification.

[0009] In another aspect, the present disclosure, without being part of the invention, provides a method for identifying the presence or absence of a target nucleic acid from a microorganism in a biological sample obtained from a human, said method comprising: (a) contacting the sample with a DNA polymerase and a buffer under conditions suitable for amplification of the target nucleic acid from the sample without extracting the target nucleic acid from the sample; (b) thermocycling the sample from step (a) such that the target nucleic acid, if present, is amplified; and (c) detecting the amplified target nucleic acid, if present, produced from step (b), wherein nucleic acid in the sample is not extracted from the sample prior to amplification, and wherein the buffer comprises at least one of component selected from the group consisting of KCl, bovine serum albumin and a surfactant.

[0010] In some embodiments, the sample nucleic acid is not diluted prior to step (a). In further embodiments, the sample may be heated prior to step (b), or, in still further embodiments, prior to step (a). The sample may be heated prior to step (b) for at least about 2 minutes at a temperature of at least about 70°C.

[0011] In further embodiments, the buffer may comprise potassium chloride (KCl), and, in some embodiments, KCl may be present in a concentration of about 5 mM to about 50 mM. The buffer may further comprise the GoTaq ™< Flexi buffer, which may be present during step (b) in a 1X-5X concentration. The buffer may also comprise bovine serum albumin. The buffer may comprise a surfactant. In some embodiments, the surfactant is a cationic surfactant. In still further embodiments, the DNA polymerase is a Taq polymerase. The target nucleic acid may be DNA or, in some embodiments, RNA. When the sample is an RNA, it may be further contacted with a reverse transcriptase. The sample may be simultaneously contacted with the DNA polymerase and the reverse transcriptase.

[0012] In further embodiments, the sample is selected from the group consisting of blood, serum, plasma, cerebrospinal fluid, oral fluid, and stool. In some embodiments, the sample is whole blood. In some embodiments, the sample is obtained from the buccal region. In still further embodiments, the microorganism may be a virus, or may be selected from the group consisting of an influenza virus, a respiratory syncytial virus, a herpes simplex virus, and an enterovirus. The microorganism may also, in some embodiments, be a bacterium, such as, in further embodiments, C. difficile.

[0013] As used herein, the term "RNA" refers to a nucleic acid molecule comprising a ribose sugar as opposed to a deoxyribose sugar as found in DNA. As used herein, RNA refers to all species or RNA including messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), as well as small RNA species that have regulatory function. "Small RNA species" have a specific meaning and refer to untranslated RNAs with housekeeping or regulatory roles in bacteria. "Small RNA species" are not rRNA or tRNA.

[0014] As used herein, the term "target nucleic acid" refers to any nucleic acid molecule or fragment that is diagnostic of a particular virus or bacteria including, for example, a pathogen virus or bacterial. Target nucleic acids may be DNA or RNA molecules that are derived from the target species.

[0015] As used herein, the term "thermocycling" refers to any technique by which a laboratory apparatus is used to amplify segments of nucleic acid with a primer extension reaction using pre-programmed cycles of raised and lowered temperatures. Examples of thermocycling include, but are not limited to, PCR, real-time PCR, and RT-PCR.

[0016] As used herein, the term "reverse transcriptase polymerase chain reaction" or "RT-PCR" refers to any technique for synthesizing and amplifying a DNA molecule with a sequence that is a copy of an RNA sequence. RT-PCR is useful in detecting RNA species such as in quantitative analysis of gene expression, as well as for producing DNA copies of RNA for use in cloning, cDNA library construction, probe synthesis, and signal amplification in in situ hybridizations.

[0017] As used herein, the term "reagent mix" refers to a composition having all the elements required to perform reverse transcription polymerase chain reaction, or real-time polymerase chain reaction, including but not limited to primers having specificity for the sequence of the diagnostic target RNA or DNA, respectively, and a polymerase.

[0018] As used herein, "primer" refers to an oligonucleotide, synthetic or naturally occurring, which is capable of acting as a point of initiation of nucleic acid synthesis or replication along a template strand when placed under conditions in which the synthesis of a complementary strand is catalyzed by a polymerase. Within the context of reverse transcription, primers are composed of nucleic acids and prime on RNA templates. Within the context of PCR, primers are composed of nucleic acids and prime on DNA templates.

[0019] As used herein, the term "DNA polymerase" refers to any enzyme that helps catalyze in the polymerization of deoxyribonucleotides into a DNA strand. DNA polymerases act to add free nucleotides to the 3' end of a newly-forming strand, resulting in elongation of the new strand in a 5'-3' direction.

[0020] As used herein, "lysis" means perturbation or alteration to a cell wall or viral particle facilitating access to or release of the cellular RNA or DNA. Neither complete disruption nor breakage of the cell wall is an essential requirement for lysis.

[0021] As used herein, the term "cycle threshold" or "Ct" refers to the cycle during thermocycling in which the increase in fluorescence due to product formation reaches a significant and detectable level above background signal.

[0022] As used herein, the term "direct amplification" refers to a nucleic acid amplification reaction in which the target nucleic acid is amplified from the sample without prior purification, extraction, or concentration. It is a relative measure of the concentration of target in the PCR reaction. Many factors impact the absolute value of Ct besides the concentration of the target. However, artifacts from the reaction mix or instrument that change the fluorescence measurements associated with the Ct calculation will result in template-independent changes to the Ct value.

[0023] As used herein, the term "extraction" refers to any action taken to remove nucleic acids from other (non-nucleic acid) material present in the sample. Such action includes, but is not limited to, mechanical or chemical lysis, addition of detergent or protease, or precipitation and removal of non-nucleic acids such as proteins.

[0024] As used herein, the term "interfering substance" or "interferent" refers to any substance in a sample that is not a target nucleic acid. Such interfering substances include synthetic and biological substances. Such synthetic substances include chemicals and pharmaceutical drugs. Such biological substances include blood, urine, proteins and other biological molecules.BRIEF DESCRIPTION OF THE FIGURES

[0025] Figure 1(A) is a line graph depicting the results of an H1N1 assay wherein samples with the FastStart buffer underwent direct amplification according to the FastStart protocol; (B) is a line graph depicting the results of an H1N1 assay wherein samples with the GoTaq buffer underwent direct amplification according to the GoTaq protocol. Figure 2(A) and (B) are line graphs depicting the effects of two sample storage buffers: universal transport medium (UTM) (A) and 1X Tris-EDTA ("TE") (B) were compared using the FastStart protocol. Figure 3(A) is a line graph depicting the results of an H1N1 assay wherein samples with the FastStart buffer underwent amplification according to the FastStart protocol after nucleic acid extraction; (B) is a line graph depicting the results of an H1N1 assay wherein samples with the FastStart buffer underwent direct amplification according to the FastStart protocol, without any prior nucleic acid extraction or purification. Figure 4 (A) and (B) are line graphs demonstrating the effectiveness of the GoTaq chemistry and cycling conditions for direct amplification using Influenza A-positive samples. Figure 5 is a line graph depicting the sensitivity of direct amplification assays with added KCl compared with direct amplification assays without KCl. Figure 6 is a line graph depicting the sensitivity of direct amplification assays with added surfactant compared with direct amplification assays without surfactant. Figure 7 is a line graph depicting the sensitivity of direct amplification assays with pre-heating compared with direct amplification assays without pre-heating. Figure 8 is a line graph depicting amplification plots from a single blood sample that was exposed to a different anticoagulant in different tubes (heparin, EDTA, citrate). Figure 9 is a line graph depicting the ability of direct amplification assays to detect samples from buccal swabs. DETAILED DESCRIPTION

[0026] The present invention is defined in the appended claims.

[0027] The present disclosure is directed to diagnostic methods for the detection of human pathogens including, for example, respiratory viruses such as influenza A and B viruses and respiratory syncytial viruses (RSV), enterovirus, herpes simplex virus 1 and 2 (HSV-1 and HSV-2, respectively), varicella zoster virus (VZV); and (pathogenic) bacteria such as Clostridium difficile using a PCR method that does not involve an extraction or purification step to isolate viral / bacterial (i.e., target) nucleic acid prior to PCR, and that provides substantially equivalent (or better) sensitivity to similar assays using a specific extraction or purification protocol.

[0028] More particularly, the present method involves addition of surfactants to the PCR cocktail to lyse cells or virions, combined certain procedural steps to increase the availability of target nucleic acids. Samples are then heated to about 50°C prior to the reverse transcriptase step, and this assists with viral lysis and with inactivation of RNAses. Following the RT step, a PCR reaction is performed. For bacterial or DNA virus targets, no reverse transcriptase is required.

[0029] Patient samples are added to the reagent mix in a ratio of approximately 10-40% patient sample to 60-90% reagent mix, and, optimally, 20-30% patient sample to 70-80% reagent mix. The reagent mix includes a polymerase derived from Thermus aquaticus (e.g., GoTaq FlexiDNA Polymerase ™< ; Promega) and an amplification buffer including an ionic detergent (e.g., GoTaq Flexi PCR Buffer ™< ; Promega). The amplification buffer, which may be supplied as a 10X buffer, is diluted to about 5X, about 2.5X, or about 1X concentration for use. The reagent mix further includes KCl (for viral samples only) and MgCl 2 , as well as dNTPs. In one formulation encompassed by the present invention, the RT-PCR reagent mixture contains of: 0.5 µL 5X GoTaq Flexi ™< PCR Buffer, 0.25 µL 25 mM MgCl 2 , 0.05 µL 10 mM dNTPs, 0.20 µL 5 U / µL Go Taq FlexiDNA ™< polymerase, and 0.5 µL 10 mM KCl. The patient sample may be heated, either before or after the RT step, and then undergoes PCR.

[0030] The reagent mixtures of the present invention allow for the direct amplification of nucleic acids from samples without the requirement for nucleic acid extraction or purification prior to amplification. Without wishing to be bound by any theory, it is believed that, if required, lysis takes place via a combination of heat and surfactant action. Furthermore, it is believed that the inventive reagent mixtures neutralize amplification inhibitors usually present in RT-PCR reactions, obviating the need for dilution of the specimen; a standard technique used in other direct amplification methodologies. The relatively high salt concentrations may contribute to performance by increasing the oligonucleotide binding efficiencies. However, the reagent mixtures vary based on the type of target nucleic acid.

[0031] In one embodiment, the reagent mixture for viral RNA detection includes, at a minimum, a reverse transcriptase, high concentrations of forward and reverse primers, optimally scorpion primers, MgCl 2 , potassium chloride, dNTPs, 5X GoTaq Flexi ™< PCR Buffer (Promega; Cat. No. M891A or M890A) or its equivalent, and a T. aquaticus derivative polymerase such as 5 U / µl Taq Polymerase (e.g., GoTaq FlexiDNA Polymerase ™< ; Promega Cat. No. M8295). For improved performance, RNAsin may also be added. Additionally, reagent mix for pathogen detection in a spinal fluid or fecal sample also contains BSA.

[0032] The reagent mixture for bacterial detection should include, at a minimum, high concentrations of forward and reverse primers, optimally scorpion primers, MgCl 2 , BSA, dNTPs, 5X GoTaq Flexi ™< PCR Buffer (Promega; Cat. No. M891A or M890A) or its equivalent, and a T. aquaticus derivative polymerase such as 5 U / µl Taq Polymerase (e.g., GoTaq FlexiDNA Polymerase ™< ; Promega Cat. No. M8295). For improved performance, RNAsin may also be added.

[0033] In one embodiment, the assay includes no template control (NTC), positive control, and DNA internal control (IC). The assay can be evaluated based on the Ct values for the controls. In one example, in an assay for detecting C. difficile, if the Ct values for NTC is 0 and IC is ≤40, the control is valid. In another example, in an assay for detecting C. difficile, if the Ct value for the positive control is 0, the assay is considered invalid. In another example, in an assay for detecting C. difficile, if the Ct value for C. difficile is ≤40, but ≠ 0, along with a valid NTC, the assay run is considered valid and acceptable. In another example, in an assay for detecting C. difficile, if the Ct value for C. difficile is = 0, and Ct value for IC is ≤40, but ≠ 0, C. difficile is considered not detected. In another example, in an assay for detecting C. difficile, if the Ct value for C. difficile is = 0, and Ct for IC = 0, the assay is considered invalid.Source of Viral Particles

[0034] Obtaining viral nucleic acid for a detection assay from a sample may be by way of collecting a liquid sample, extracting a solid or semi-solid sample, swabbing a surface, or additional technique. Viral RNA may be assayed directly if the existing concentration adequately provides target RNA for an RT-PCR reaction. Alternatively, virions may be concentrated by methods such as centrifugation, binding to a surface through immunoadsorption or other interaction, or filtration.Source of Bacterial Cells

[0035] Obtaining bacterial cells for a detection assay from a sample may be by way of collecting a liquid sample, extracting a solid or semi-solid sample, swabbing a surface, or additional technique. Bacterial cells may be assayed directly if the existing concentration adequately provides target RNA for an RT-PCR reaction. Alternatively, bacterial cells may be concentrated by methods such as centrifugation, binding to a surface through immunoadsorption or other interaction, or filtration. In addition, the bacterial cell number may be increased by growing the cells on culture plates or in liquid medium prior to concentration or direct assay.

[0036] Typical bacteria suitable within the context of the invention are gram-negative and gram-positive bacteria including, but not limited to, Listeria, Escherichia, Salmonella, Campylobacter, Clostridium, Helicobacter, Mycobacterium, Staphylococcus, Camplobacter, Enterococcus, Bacillus, Neisseria, Shigella, Streptococcus, Vibrio, Yersinia, Bordetella, Borrelia, and Pseudomonas.Target Nucleic Acids

[0037] RNA types that may be assayed as target nucleic acids include rRNA, mRNA, transfer-RNA (tRNA), or other RNA polynucleotides. Species of rRNA include 5S, 16S, and 23S polynucleotides, which may contain one or more sub-sequences characteristic of a group of related bacteria. The detection capacity of the characteristic sequence is variable and depends on the level of relatedness of the virus or bacteria to be detected by the assay. Other RNA polynucleotides may be used as diagnostic target RNA so long as they contain unique sub-sequences that adequately distinguish among bacteria at the desired relatedness level. Examples can be identified from tRNA and mRNA species, as well as from any RNA produced in a bacterial cell that includes one or more characteristic sub-sequence. Primers may be designed by one skilled in the art to prime the synthesis of a copy DNA using the target RNA as template in a reverse transcription reaction. One skilled in the art will also know how to design pairs of primers for the amplification of the unique sub-sequences of the target RNA using the copy DNA as template in PCR. It is well known in the art that primers used synchronously in PCR should have similar hybridization melting temperatures. The diagnostic target RNA within the bacterial cell must be made accessible to the RT or RT-PCR reaction composition. After being collected, the nucleic acid sample may be directly added to the reaction composition, which then undergoes thermocycling.

[0038] Although optionally present, a specific lysing agent is preferably omitted from the reagent mixture because the sufficient release of viral / bacterial nucleic acids from the sample is obtained without it. Generally, a lysing agent is added prior to contact with the RT, RT-PCR, or PCR reaction composition. The use of lysing agents is well known to those of skill in the art. Lysing agents include but are not limited to chemicals, enzymes, physical shearing, osmotic agents and high temperature. By the term "lysis buffer" is meant a buffer that contains at least one lysing agent. Typical enzymatic lysing agents include, but are not limited to, lysozyme, glucolase, zymolose, Iyticase, proteinase K, proteinase E and viral endolysins and exolysins. The viral endolysins and exolysins are from bacteriophages or prophage bacteria and combinations of these. Typical viral endolysins include but are not limited to endolysins from Listeria bacteriophages (A118 and PLYI18), endolysins from bacteriophage PM2, endolysins from the B. subtilis bacteriophage PBSX, endolysins from Lactobacillus prophages Lj928, Lj965 and bacteriophage 15 Phiadh, endolysin (Cpl-I) from the Streptococcus pneumoniae bacteriophage Cp-I and the bifunctional peptidoglycan lysin of Streptococcus agalactiae bacteriophage B30. These last two have different bacterial strain specificity. Also contemplated are two-component, that is, holin-endolysin, cell 20 lysis genes, holWMY and IysWMY of the Staphylococcus wameri M phage varphiWMY Endolysin combinations of these are also contemplated. For a discussion of viral lysis, see especially, Loessner, M J et al. (1995) Applied Environmental Microbiology I 61: 1150-1152.

[0039] Rather than using endolysins, treatment with heat prior to or after the RT step aids in lysis in the present method. Incubation of the sample in the range of temperature from about 25°C. to less than about 100°C, and preferably about 50°C and 75°C, may improve the accessibility of bacterial RNA as a template for RT or RT-PCR. This heat pretreatment may be for a time period in the range of about 1 minute to about 60 minutes, with treatments of 1 to 20 minutes being typical, depending on the temperature of incubation. Heat treatment may include multiple incubations at different temperatures. Heat treatment may be in the presence or absence of RNase inhibitor as described below. Particularly useful treatments are at about 50° C. for about 5 to 20 min in the presence of RNase inhibitor.

[0040] At least one RNAse inhibitor may be added to the virions or bacterial cells. Typically, inhibitors and their concentrations are chosen so as not to interfere with any of the primer-directed amplification processes and components. RNase inhibitors are known to those of skill in the art and include chemicals such as guanidinium isothiocyanate and diethyl-pyrocarbonate, protein inhibitors such as Superaseln (Ambion), RNase Block (Stratagene), human placental ribonuclease inhibitor and porcine liver RNase inhibitor (Takara Mirus Bio), anti-nuclease antibodies such as Anti-RNase (Novagen) and Ribonuclease Inhib III (PanVera), and reagents such as RNAlater (Ambion) and RNA protect Bacteria Reagent (Qiagen).Assay Methods

[0041] In the present method, the presence of diagnostic target RNAs is tested by reverse transcription alone or, preferably, by reverse transcription and polymerase chain reaction. When used together, reverse transcription and polymerase chain reaction may be performed sequentially in two steps, or together in one step with all reaction composition reagents being added to the sample. Incubation of the sample in the reverse transcription reaction composition allows a DNA copy from the target RNA to be synthesized. The reagent mix includes a primer that hybridizes to the target RNA to prime the synthesis of the copy DNA. In addition, the reagent mix includes dNTPs, MgCl 2 , KCl (in viral samples only), a reverse transcriptase and a reverse a transcriptase buffer (in viral samples only), and, for stool samples, BSA (in bacterial samples only). More than one primer may be included if it is desired to make DNA copies from more than one target RNA. However, no RNase inhibitor is used. The product of the reverse transcription reaction may then be transferred to another assay tube where PCR is performed according to protocol well known in the art. The PCR composition typically includes a pair of primers that initiate synthesis of the desired segment of DNA from the reverse transcribed template. In addition, the PCR mix usually comprises dNTPs, a thermostable DNA polymerase such as Taq polymerase, and polymerase buffer. More than one pair of primers may be included if synthesis of multiple segments of DNA is desired. Also a single new primer may be added that will amplify a DNA segment with the original RT-PCR primer as the second primer of the pair. Additional reverse transcriptases that may be used for viral samples include, but are not limited to, HIV Reverse Transcriptase (Ambion), Transcriptor Reverse Transcriptase (Roche), Thermoscript Reverse Transcriptase (Invitrogen). Additional DNA polymerases that may be used include, but are not limited to, Pfu, Vent, and Sequitherm DNA Polymerase (EPICENTRE).

[0042] Regardless of whether the RT-PCR is carried out as two steps or one step, the RT step is run first and typically consists of a single temperature incubation at a temperature of between about 37°C. and about 70°C. Different temperatures are appropriate for different Rt enzymes and different primers, as is known to one skilled in the art. The subsequent PCR reaction typically consists of an initial incubation at about 94°C. to about 96°C. for about 6 to about 15 minutes. This step is used to denature the cDNA and also to activate heat activated Taq polymerase enzymes. This is then followed by multiple cycles of amplification of the cDNA target. Three operations are performed during each cycle: target denaturation, primer annealing and primer extension. Target denaturation typically occurs at greater than about 90° C. Primer annealing temperature is dictated by the melting temperature of the specific primers used in the reaction and primer extension is performed at temperatures ranging from about 60° C. to about 72° C. depending on the thermostable polymerase being used. When primer annealing and extension are performed at the same temperature, this is a two temperature PCR compared with a three temperature PCR in which each of the three steps occur at a different temperature. After the amplification phase is complete, a final extension time is typically added to ensure the synthesis of all amplification products.

[0043] Target nucleic acids also include DNA including, for example, DNA derived from bacterial species and DNA viruses. Viral DNA suitable for assessment include both DNA obtained directly from the viral capsid as well as DNA integrated into the host genome.Detection of RT and RT-PCR Product

[0044] Methods for directly detecting the cDNA product of an RT reaction are well known to one skilled in the art and make use of labels incorporated into or attached to the cDNA product. Signal generating labels that may be used are well known in the art and include, for example, fluorescent moieties, chemiluminescent moieties, particles, enzymes, radioactive tags, or light emitting moieties or molecules. Fluorescent moieties are particularly useful, especially fluorescent dyes capable of attaching to nucleic acids and emitting a fluorescent signal. A variety of dyes are known in the art such as fluorescein, Texas Red, and rhodamine. Particularly useful are the mono reactive dyes Cy3 and Cy5, both available commercially (from, for example, Amersham Pharmacia Biotech, Arlington Heights, Ill.). A more sensitive way to specifically detect the labeled DNA is to hybridize the products against target DNA sequence molecules that are immobilized in a matrix, such as a nylon membrane or a glass slide. The signals after hybridization can then be scanned with a laser scanner with appropriate filtering to detect the specific dye used. This is well known in the art, especially in DNA microarray technology. A label may be incorporated into the cDNA during its synthesis in the RT reaction, or it may be attached to the cDNA product after its synthesis. For example, the RT reaction can be carried out with labeled primers. One type of labeled primer has attached particles having a large number of signal generating molecules. Reverse transcription using a labeled nucleotide, such as dye-labeled UTP and / or CTP, incorporates a label into the transcribed nucleic acids. Alternatively, a post-synthesis coupling reaction can be used to detect the cDNA products. Attaching labels to nucleic acids is well known to those of skill in the art and may be done by, for example, end-labeling with, e.g. a labeled RNA or by treatment of the nucleic acid with kinase and subsequent attachment of a nucleic acid linker joining the sample nucleic acid to the label, e.g., a fluorophore. In another labeling method, the DNA products from the RT reaction are amplified by coupling to an in vitro transcription reaction. For example, the T7 promoter region is incorporated into the primer used for the RT reaction. A T7 in vitro transcription kit can then be used to generate a large amount of RNA to increase the detection sensitivity. The T7 in vitro transcriptional kit can be purchased from Ambion (2130 Woodward, Austin, Tex.) or other commercial sources.RT-PCR Detection

[0045] Methods for RT-PCR product detection include gel electrophoresis separation and ethidium bromide staining, or detection of an incorporated fluorescent label or radiolabel in the product. Methods that do not require a separation step prior to detection of the amplified product may also be used. These methods are commonly referred to as Real-Time PCR or homogeneous detection. Most real time methods detect amplified product formation by monitoring changes in fluorescence during thermocycling. These methods include but are not limited to: TaqMan ®< dual labeled probes (Applied Biosystems, Foster City, Calif. 94404), Molecular Beacons (Tyagi S and Kramer FR (1996) Nat BiotechnoI14:303-308), and SYBR ®< Green dye (Molecular Probes, Inc Eugene, Oreg. 97402-0469). Some of these same homogeneous methods can be used for end point detection of amplified products as well. An example of this type of method is SYBR ®< Green dye dissociation curve analysis. In dissociation curve analysis a final slow ramp in temperature, generally about 60° C. to 90° C, combined with fluorescence monitoring can detect the melting point and thereby the presence of an amplified product (Ririe et al. (1997) Anal. Biochem. 245: 154-60).Assay Sensitivity

[0046] The sensitivity of the direct amplification assays can be increased by adding one or more sensitivity-increasing components to the buffer used in the assays. Such components include, but are not limited to, KCl, a surfactant and albumin. In some embodiments, the albumin is bovine serum albumin. In some embodiments, the surfactant is a cationic surfactant. The sensitivity of the direct amplification assays also can be increased by providing additional heating to the assays, such as pre-heating a sample before the reagents are added. In some embodiments, the sensitivity can be increased by a combination of the sensitivity-increasing components and additional heating.EXAMPLES

[0047] The present methods, thus generally described, will be understood more readily by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present methods and kits.EXAMPLE 1: Universal Master Mix

[0048] Except as otherwise noted, the 2.5X Universal Master Mix (UMM) is prepared in the following proportions. The table below provides the volume of reagents suitable to prepare 15 ml of UMM, however, any suitable volume may be prepared according to need. Reagent Volume per 15 ml 5X GoTaq Flexi PCR Buffer ™< (Promega; Cat. No. M891A or M890A)5.0 ml25 mM MgCl22.5 ml10 mM dNTPs (10 mM for each of dATP, dGTP, dCTP, and dTTP)0.5 ml5 U / µl Taq Polymerase (e.g., GoTaq FlexiDNA Polymerase ™< ; Promega Cat. No. M8295)2.0 ml10 mM KCl5.0 ml

[0049] The GoTaq Flexi Buffer ™< and equivalents contain ionic detergents and lack magnesium.EXAMPLE 2: Effect of KCl On Direct Amplification of Respiratory Virus Nucleic Acids

[0050] Contrived swab specimens containing influenza B virus were prepared by adding cultured influenza B virus ("Flu B") (Great Lakes strain) to viral transport medium samples, along with an internal control nucleic acid. The Ct values for the Flu B and control nucleic acids were determined in the presence and absence of 25 mM KCl, using the Universal Master Mix of Example 1, with the omission of KCl from the UMM, and further containing either 1 or 2 µl of reverse transcriptase (Improm II Reverse Transcriptase, Promega Cat. No. A3800). Serial dilutions of template copies of Flu B virus were assessed at TCID 50 / ml of 158 and 39.5. The RT-PCR reaction was run as follows: Stage 1: 75°C for 3 min (once) Stage 2: 47°C for 10 min (once) Stage 3: 97°C for 2 min (once) Stage 4: 102°C for 1 sec. followed by 60°C for 20 sec. for data collection (repeated 45 times)

[0051] The threshold for Ct determination was 50,000. The fluorophores for the Flu B and internal control probes were JOE and Q670, respectively. All assays were run in duplicate and the results averaged. Table 1: Effect of KCl on Direct RT-PCR From Serum (Flu B TCID 50 / ml= 158)25 mM KClReverse TranscriptaseFlu B CtFlu B Avg. CtInternal Control Ct+1 µl34.234.038.4+1 µl33.836.2+2 µl33.733.737.8+2 µl33.738.4--1 µl34.034.434.6--1 µl34.834.6--2 µl33.633.936.2--2 µl34.234.9 Table 2: Effect of KCl on Direct RT-PCR From Serum (Flu B TCID 50 / ml= 39.5)25 mM KClReverse TranscriptaseFlu B CtFlu B Avg. CtInternal Control Ct+1 µl35.936.337.6+1 µl36.740.2+2 µl35.435.636.2+2 µl35.739.1--1 µl35.537.641.1--1 µl39.635.6--2 µl35.736.135.8--2 µl36.436.3

[0052] The results in Tables 1 and 2 demonstrate that the presence of KCl enhances the sensitivity of a direct RT-PCR amplification assay for respiratory viruses (Flu B) in serum at low viral concentrations. These results further indicate that the presence of KCI mitigates or negates the necessity for concentrating and / or purifying virus from serum prior to analysis by RT-PCR.EXAMPLE 3: Direct Amplification of Respiratory Virus Nucleic Acids From Clinical Samples

[0053] Various clinical samples (buccal swab and cerebrospinal fluid) were assessed for the presence of HSV-1 and / or HSV-2. The Universal MM from Example 1 was used, with the noted modifications to MgCl 2 and KCl.

[0054] The buccal swab RT-PCR amplification master mix was: Component Concentration 2.5X Universal MM1xScorpion Forward Primer600 nMReverse Primer600 nMMgCl 2 5 mMPotassium Chloride40 mM

[0055] The CSF RT-PCR amplification master mix was: Component Concentration 2.5X Universal MM1xScorpion Forward Primer600 nmReverse Primer600 nmMgCl 2 2.5 mM100X BSA (10 mg / ml)0.1-0.5 mg / mlPotassium Chloride40 mM

[0056] Clinical samples were analyzed using both the direct RT-PCR amplification protocol and an RT-PCR amplification protocol that used an initial nucleic acid extraction protocol. Nucleic acids were extracted using a Roche MagNA Pure LC instrument, and the corresponding Total Nucleic Acid Isolation Kit. A total of 200 µl of sample was extracted, and the nucleic acid was eluted in 50 µl.

[0057] For each assay, 10 µl of sample was added to 40 µl of the Master mix described in this Example. The RT-PCR reaction was run as follows: Stage 1: 75°C for 3 min (once) Stage 2: 47°C for 10 min (once) Stage 3: 97°C for 2 min (once) Stage 4: 102°C for 1 sec. followed by 60°C for 10 sec. for data collection (repeated 50 times)

[0058] The results are as follows: TABLE 3: Multiplex Amplification Assessment of Multiple Respiratory Viruses in Clinical SamplesVBS ID#Sample TypeCt Value With ExtractionCt Value With Direct AmplificationHSV-1HSV-2HSV-1HSV-2Internal Control42731SwabN / A28.2ND29.233.472734SwabN / A24.1ND29.134.142735SwabN / A17.5ND18.241.942933Swab0.031.5ND32.835.042944CSF0.00.0NDND35.342946CSF0.00.0NDND35.342947CSF0.00.0NDND36.2041378Swab20.7ND20.1ND33.8041379Swab26.6ND25.2ND32.842846Swab0.00.0NDND35.042847Swab0.00.042.7ND34.442848Swab0.00.0NDND33.942827Swab34.20.034.4ND33.242839Swab0.033.4ND35.834.542952CSF34.50.033.8ND34.142955CSF30.20.034.6ND44.642963CSF32.90.034.0ND35.842984CSF0.037.4ND40.0ND43009CSF0.045.2ND40.537.742975CSF0.037.6ND39.038.742995CSF0.034.1ND35.135.843010CSF0.037.9ND38.437.943001CSF0.032.3ND33.637.842957CSF27.30.032.0ND35.342959CSF30.10.030.1ND35.142961CSF31.30.032.043.134.839929Swab0.038.1ND24.1ND39984Swab39.80.037.6ND36.339713Swab38.50.030.843.336.639724Swab26.00.028.5ND35.6

[0059] These data demonstrate that for HSV infected buccal or CSF samples, the direct amplification method described above provides comparable results in a multiplex RT-PCR amplification assay relative to an RT-PCR protocol that performs a nucleic acid extraction and concentration prior at analysis.EXAMPLE 4: Effect of the RNAse Inhibitors on Direct Nucleic Acid Amplification Assays

[0060] A control virus was spiked into viral transport media to create a synthetic sample for analysis using the direct amplification RT-PCR assay described above. For each assay, 10 µl of sample was added to 40 µl of the UMM described in Example 1, in the presence or absence of 1 µl of an RNAse Inhibitor ("RNAsin") (Promega Cat. No.N261B). The RT-PCR reaction was run as follows: Stage 1: 50°C for 10 min (once) Stage 2: 97°C for 2 min (once) Stage 3: 102°C for 1 sec. followed by 58°C for 20 sec. for data collection (repeated 50 times)

[0061] In the absence of the RNAsin, the Ct could not be determined suggesting that the viral RNA was degraded prior to RT. The average Ct in the presence of RNAsin was 32.5 from assays run in duplicate. These results demonstrate that the presence of RNAsin improves the sensitivity of the direct RT-PCR amplification method.EXAMPLE 5: Effect of Sample Pre-heating on Direct Nucleic Acid Amplification Assays

[0062] Viral transport media was spiked with a combination of influenza A, influenza B, and RSV viruses at approximately 5,000 virus copies / ml to form "FABR" synthetic samples, or with Influenza B virus (10 -4< ) alone. These samples were assessed by direct amplification using the Universal Master Mix of Example 1 with the addition of 1 µl Improm II reverse transcriptase and 0.25 µl RNAsin. MS2 phage was added as an internal control. Experimental samples were pre-heated for 3 min at 75°C and 10 µl of sample was added to 40 µl of Universal Master Mix for each assay. The RT-PCR reaction was run as follows: Stage 1: 50°C for 10 min (once) Stage 2: 97°C for 2 min (once) Stage 3: 102°C for 1 sec. followed by 58°C for 20 sec. for data collection (repeated 50 times)

[0063] The results are as follows: TABLE 4: Multiplex Amplification Assessment of Multiple Respiratory Viruses in Clinical Samples With Sample Pre-heatingCalculated Ct ValueFlu AFlu BRSVInternal ControlFABR w / pre-heat33.534.033.834.6Flu B w / pre-heatND32.3ND33.8FABR w / out pre-heat33.3ND37.433.8Flu B w / out pre-heatNDNDND33.9

[0064] Next, control cerebral spinal fluid samples were spiked with HSV-1 virus (TCID 50 / ml = 2.14) and control virus were assessed with and without sample pre-heating in the absence of RNAsin. Specificity of the HSV-1 detection methodology was confirmed by simultaneously assessing the samples for the presence of HSV-2 nucleic acid. HSV-2 was not detected in any sample. The results are as follows: TABLE 5: Direct Amplification Assessment of HSV in Clinical Samples With Sample Pre-heatingNo Pre-heatingWith Pre-heatingHSV-1I.C.HSV-1I.C.Sample #138.531.336.629.9Sample #238.331.035.429.7Sample #3ND30.935.429.7Sample #439.631.035.629.8Sample #541.131.136.229.8Sample #638.130.935.529.9Sample #737.631.235.629.6Sample #840.031.235.529.8Average 39.0 31.1 35.7 29.8

[0065] These results demonstrate that briefly pre-heating the samples prior to direct RT-PCR amplification and assessment enhances the sensitivity of viral detection in most cases (i.e., at least for FluB, RSV, and HSV-1) and does not negatively influence the sensitivity for others (i.e., FluA). Furthermore, sample pre-heating reduces or eliminates the need for the inclusion of an RNAse inhibitor.EXAMPLE 6A: Stool Sample Protocol With BSA

[0066] A human stool sample is obtained from a patient using standard clinical methodology. Samples are maintained at 2-25°C for transport and short-term storage and subjected to not more than one freeze / thaw cycle prior to use. For assessment, a flocked swab is dipped into a thoroughly-mixed stool specimen and the excess stools is removed by pressing the swab against the side of the specimen container. The swab is then swirled in 1 ml of Tris-EDTA (TE) buffer and discarded. The sample is heated at 97°C for 10 minutes. The sample is then diluted 1:4 using the UMM of Example 1 (i.e., 2µl of sample is added to 8µl of UMM) with the UMM modifications noted below. Optionally, 2µl of a solution containing a positive internal control nucleic acid may be added to 8µl of UMM, which contains 4 µl of the UMM, along with 0.35 mg / ml BSA, 600 nM each of the forward and reverse primers, 300 nM each of internal control primers, and 0.5 µl of internal control DNA). The C. difficile target primer was labeled with a FAM fluorophore, and the internal control target was labeled with a Quasar670 fluorophore. Thermocycling began with an initial denaturation step at 97°C for 2 minutes, followed by 40 cycles of 97°C for 10 seconds, and 60°C for 30 seconds. Real-time PCR was performed for 40 cycles and the amplification curves was determined using fluorescently-labeled probes specific for the target nucleic acid, which in this experiment was the C. difficile TCD-B gene. Component Concentration 2.5X Universal MM1xScorpion Forward Primer600 nMReverse Primer600 nMMgCl 2 5 mM100X BSA (10 mg / ml)0.35 mg / ml EXAMPLE 6B: Stool Sample Protocol Without BSA

[0067] In order to determine whether the addition of BSA is likely to decrease inhibition of detection resulting from stool material, the RT-PCR assay was performed according to the protocol used for testing samples with BSA using Clostridium difficile DNA as a target both in the presence and absence of BSA. The stool samples were prepared according to the formulation shown in Example 6A, although the BSA-negative samples omitted the 100X BSA. The MagnaPure system (Roche) was used for nucleic acid purification. The PCR reaction was performed as described above, with the BSA-negative PCR formulation plated in wells 1-20, and the BSA-positive PCR formulation was plated in wells 21-40.

[0068] The results, which are shown in Table 6, indicate that BSA addition decreases inhibition of gram-positive anaerobic bacterial nucleic acid detection from a stool sample. EXAMPLE 7: Direct RT-PCR Amplification is Buffer-dependent

[0069] Samples of Influenza A, and an internal control were assessed using direct amplification to determine whether the enzymes used in the Universal Master Mix as defined in Example 1 are unique in their ability to facilitate a direct detection assay. A hybrid primer concentration was used consisting of 600 nM influenza A scorpion / primer (directed to the matrix gene), 500 nM swine H1 scorpion / primer (directed to the hemaglutanin gene), and 150 nM armored RNA internal control (IC) scorpion primer specific for MS2 phage. The reaction mix was prepared using two distinct enzymes and buffer systems: GoTaq ®< Flexi, along with its accompanying 5X PCR Buffer (Promega; Cat. No. M891A or M890A) as a component of universal MM, and FastStart High Fidelity, with its accompanying 10x Buffer (Roche), as a component of RNA MM, in concentrations as follows: TABLE 7: Reaction Mix Components and ConcentrationsFastStartGoTaqRNA MM4.0 µL2.5X universal MM4.0 µLImprom II RT0.5 µLImprom II RT0.5 µLRNAse inhibitor0.2 µLRNAse inhibitor0.2 µL20X H1N1 primer mix0.5 µL20X H1N1 primer mix0.5 µL1:100000 MS2 phage0.5 µL1:100000 MS2 phage0.5 µLWater2.3 µLWater2.3 µLSample2.0 µLSample2.0 µL

[0070] The samples consisted of influenza viruses that were spiked into viral transport media. A total of 2 µl of specimen was added to 8 µl of each reaction mix listed above. Each sample was amplified directly without pre-extraction.

[0071] Thermocycling was then performed, and amplification curves are determined using fluorescently-labeled probes specific for the target nucleic acids. InfA M gene probes, H1N1-specific HA gene probes, and IC probes were labeled with FAM, CFR610, and Q670, respectively. Two cycling protocols were then used for RT-PCR (ICy / Universal 96-well disc; 3M). The GoTaq and the FastStart assays were first performed with GoTaq cycling, then both were performed with FastStart cycling. The FastStart protocol was as follows: Stage 1: 47°C for 15 min (once) Stage 2: 97°C for 10 min (once) Stage 3: 97°C for 15 sec. followed by 60°C for 30 sec. (repeated 40 times)

[0072] The GoTaq cycling protocol was as follows: Stage 1: 47°C for 10 min (once) Stage 2: 97°C for 2 min (once) Stage 3: 97°C for 5 sec. followed by 58°C for 30 sec. (repeated 40 times)

[0073] The results are shown in FIG. 1(A) and (B) which represent samples with FastStart buffer run using FastStart cycling protocol, and with GoTaq buffer run using GoTaq cycling protocol. No amplification was observed with FastStart cycling conditions and buffer system, whereas robust amplification was observed using the GoTaq cycling conditions and buffer system.

[0074] The effect of sample storage buffer was also compared. Specifically, H1N1 nucleic acid amplification from samples stored in universal transport medium (UTM) or 1X Tris-EDTA ("TE") was compared using the FastStart protocol. As shown in FIG. 2, no significant amplification was observed in the UTM samples, whereas the TE samples yielded robust amplification curves.

[0075] The effect of nucleic acid extraction on the FastStart chemistry and cycling conditions was investigated. As shown in FIG. 3, it was confirmed that the FastStart protocol failed to amplify H1N1 nucleic acids directly from clinical samples (FIG 3B). However, robust amplification was observed for samples in which the nucleic acids were extracted prior to the amplification reaction (FIG 3A). These results demonstrate that not all RT-PCR amplification conditions may be applied to direct amplification / detection systems and that the GoTaq chemistry is particularly suited for this assay format.

[0076] The effectiveness of the GoTaq chemistry and cycling conditions for direct amplification was confirmed using Influenza A-positive patient samples (including 2009 pandemic H1N1 positive samples). Amplification was performed using the following parameters: PCR Reaction Setup2.5X universal MM4.0 µLImprom II RT0.5 µLRNAse inhibitor0.2 µL20X H1N1 primer mix0.5 µL1:100000 MS2 phage0.5 µLWater2.3 µLSample2.0 µL Cycling Conditions

[0077] Stage 1: 47°C for 10 min (once) Stage 2: 97°C for 2 min (once) Stage 3: 97°C for 5 sec. followed by 58°C for 30 sec. (repeated 40 times)

[0078] The results shown in FIG. 4A are from samples containing non-pandemic influenza A virus, and amplification of the FAM target indicates detection of influenza A, but not of pandemic H1N1 influenza A. FIG. 4B shows amplification of pandemic H1N1 samples, and demonstrates amplification of the influenza A target, along with the H1N1-specific target.Example 8: Detection of Flu A, Flu B and RSV by Direct Nucleic Acid Amplification Assays and Comparison with Methods Using Nucleic Acid Extraction

[0079] Nucleic acid from the clinical specimens (swabs) and control samples were amplified using the direct nucleic acid amplification assays and the results were compared with amplification results using methods involving nucleic acid extraction. The sequences of the amplification primers are shown in the table below. Name Sequence Univ Flu A ScorpionUniv Flu A Rev Primer5' TCTTGTCACCTCTGACTAAGGGGAT 3'Flu B ScorpionFlu B Rev Primer5' AGCTGCAAAGCAACATTGGAG 3'RSV A / B ScorpionRSV A / B Rev Primer5' GCAAATATGGAAACATACGTGAACAA 3'RNA IC ScorpionRNA IC Rev Primer5' TTCAGCGACCCCGTTAGC 3'

[0080] Clinical specimens and control samples were heated at 65°C to 70°C for 5 min. The reaction mixture was prepared as follows:Reaction Mixture

[0081] Reaction ComponentVolume (µL)2.5X master mix4.0Reverse transcriptase0.5RNase inhibitor0.250X flu A primer pair0.250X flu B primer pair0.250X RSV primer pair0.250X internal control primer pair0.2Internal control RNA (heated)0.5Nuclease-free water2.0Reaction Mix8.0Specimen (heated)2.0Total reaction volume10.0

[0082] Thermocycling was then performed using the following cycling parameter.Cycling parameters

[0083] Step Time (sec) Temp (°C) Repeat cDNA synthesis600471Initial heating120971Denaturation59740Anneal / extension3058

[0084] The amplification results using the direct nucleic acid amplification assays were compared with the amplification results obtained using methods involving nucleic acid extraction as shown below.Clinical specimens (swabs) tested

[0085] Previous resultNumber of specimensFlu A positive35Flu B positive91RSV positive47Negatives19Total193

[0086] There was 100% concordance between the results obtained using the direct nucleic acid amplification assays and the results obtained using methods involving nucleic acid extraction as shown above.Example 9: Detection of HSV-1, HSV-2, and VZV by Direct Nucleic Acid Amplification Assays and Comparison with Methods Using Nucleic Acid Extraction

[0087] Nucleic acids from the clinical specimens as well as contrived samples were amplified using the direct nucleic acid amplification assays and the results were compared with amplification results using methods involving nucleic acid extraction. The reaction mixture was prepared as follows:Reaction Mixture

[0088] Reaction componentVolume (µL)2.5X master mix4.025X HSV1 primer pair0.425X HSV2 primer pair0.450X VZV primer pair0.250X Internal control primer pair0.2Internal control DNA0.2Nuclease-free Water0.6Reaction mix6.0Sample4.0Total reaction volume10.0

[0089] The sequences of the amplification primers are shown in the table below.Sequences

[0090] Sequence NameSequenceHSV-1 ScorpionHSV-2 ScorpionHSV-1&2 primerGGTGGTGGACAGGTCGTAGAGVZV ScorpionVZV primerGCAGTTGCAAACCGGGAT

[0091] Thermocycling was performed using the following cycling parameter.Cycling parameters

[0092] Step Time (sec) Temp (°C) Repeat Initial heating120971Denaturation109740Anneal / extension3060

[0093] The amplification results using the direct nucleic acid amplification assays were compared with the amplification results obtained using methods involving nucleic acid extraction as shown below.VZV

[0094] A total of 32 out of 32 specimens (13 swabs, 2 vitreous fluid, 17 CSF) were detected as positive for VZV using amplification methods involving nucleic acid extraction, while 31 out of 32 specimens detected as positive by the direct amplification method. The CSF sample that was tested negative, was detected with Ct 37.1 when tested with nuclease inhibitor.HSV-1 and HSV-2Clinical Specimens (swabs):

[0095] Two HSV-1 samples that were detected as positive using amplification methods involving nucleic acid extraction were also tested as positive using the direct amplification method. Similarly, two HSV-2 samples that were detected as positive using amplification methods involving nucleic acid extraction were also tested as positive using the direct amplification method.Contrived Samples:

[0096] The detection results using the contrived samples in the direct amplification versus an extraction of nucleic acid prior to amplification are shown below for HSV-1 and HSV-2.HSV-2

[0097] HSV2 (TCID 50 * / mL)Universal Direct detected / totalExtracted method detected / total2.8X10 3< 1 / 11 / 11.4X10 2< 1 / 11 / 11.4X10 1< 2 / 22 / 21.4X10 0< 2 / 22 / 21.4X10 -1< 2 / 22 / 2* TCID 50 : 50% tissue culture infective dose HSV-1

[0098] HSV1 (TCID 50 * / mL)Universal Direct detected / totalExtracted method detected / total1.8X10 3< 1 / 11 / 10.9X10 3< 2 / 22 / 21.8X10 2< 2 / 22 / 20.9X10 2< 2 / 22 / 21.8X10 1< 1 / 22 / 2* TCID 50 : 50% tissue culture infective dose

[0099] Thus, the results using the direct amplification method and the method using nucleic acid extraction are comparable for detecting HSV-1 and HSV-2.Example 10: Detection of Enterovirus by Direct Nucleic Acid Amplification Assays and Comparison with Methods Using Nucleic Acid Extraction

[0100] Nucleic acids from the samples were amplified using the direct nucleic acid amplification assays and the results were compared with amplification results using methods involving nucleic acid extraction. The reaction mixture was prepared as follows:Reaction Mixture

[0101] Reaction ComponentVolume (µL)2.5X master mix4.0Reverse transcriptase0.5RNase inhibitor0.150X enterovirus primer pair0.250X internal control primer pair0.2Internal control RNA0.1Reaction Mix5.0Sample5.0Total reaction volume10.0

[0102] The sequences of the amplification primers are shown in the table below.Sequences

[0103] Sequence NameSequenceEnterovirus ScorpionEnterovirus primerCAATTGTCACCATAAGCAGCCA

[0104] Thermocycling was performed using the following cycling parameter.Cycling parameters

[0105] Step Time (sec) Temp (°C) Repeat cDNA synthesis600471Initial heating120971Denaturation59745Anneal / extension3058

[0106] The amplification results using the direct nucleic acid amplification assays were compared with the amplification results obtained using methods involving nucleic acid extraction as shown below.

[0107] 32 samples testing negative by amplification methods involving nucleic acid extraction were also negative by the direct amplification method. 16 samples testing positive by amplification methods involving nucleic acid extraction were also positive by the direct amplification method.

[0108] The detection results using the contrived samples in the direct amplification versus an extraction of nucleic acid prior to amplification are shown below. Enterovirus (TCID 50 / mL)Direct Amplification detected / totalMethod using Nucleic Acid Extraction method detected / total9.0X10 4< 1 / 11 / 19.0X10 3< 1 / 11 / 19.0X10 2< 2 / 22 / 29.0X10 1< 2 / 22 / 29.0X10 0< 2 / 22 / 24.5X10 0< 4 / 44 / 41.8X10 0< 4 / 44 / 4TCID 50 : 50% tissue culture infective dose

[0109] Thus, the results using the direct amplification method and the method using nucleic acid extraction are comparable for detecting Enterovirus.Example 11: Detection of Clostridium difficile by Direct Nucleic Acid Amplification Assays and Comparison with Methods Using Nucleic Acid Extraction

[0110] Nucleic acids from the samples were amplified using the direct nucleic acid amplification assays and the results were compared with amplification results using methods involving nucleic acid extraction.

[0111] Stool specimens were obtained from different individuals. Flocked swab was dipped into the stool specimen. Excess stool specimen was removed. The swab was placed in 1 ml of TE buffer, swirled, and the swab was discarded. The samples were heated at 97° for 10 min in a heating block.

[0112] The PCR master mix was prepared as follows:PCR Mix

[0113] Component Concentration 2.5X Universal MM1xScorpion Forward Primer600 nMReverse Primer600 nMMgCl 2 5 mM100X BSA (10 mg / ml)0.35 mg / ml

[0114] Two microliters of the heated sample was added to eight microliters of the master mix and the PCR was carried out using the following cycling parameters: Step Cycles Temp (°C) Time 11972 min2409710 sec6030 sec

[0115] The primers target toxin B region of C. difficile. The sequences of the amplification primers and the amplicon are shown below. C difficile Scorpion primer: C difficile Reverse primer: 5'd ACTAATCACTAATTGAGCTGTATCAGGA 3' C. difficile amplicon:

[0116] Fluorescent signal from C. difficile Scorpion primers was detected at 495 nm and the signal from internal control was detected at 644 nm.

[0117] The amplification results using the direct nucleic acid amplification assays were compared with the results obtained using amplification methods involving nucleic acid extraction as shown below. Methods involving nucleic acid extractionTotal% AgreementDirect amplification methodPositiveNegativePositive109711699.1 % (109 / 110)Negative1727391.1% (72 / 79)Total11079189

[0118] Thus, 99% of the samples identified positive by amplification methods involving nucleic acid extraction were also identified positive by the direct amplification assay, and 91% of the samples identified negative by amplification methods involving nucleic acid extraction also were identified negative by the direct amplification assay.

[0119] The Limit of Detection (LoD) was determined using a panel consisting of contrived samples in stool-TE buffer matrix, spiked with C. difficile bacterial stock. The panel included negatives (unspiked matrix) and samples of varying concentrations around the approximate LoD (obtained in an earlier phase of testing). Results (positive / negative) of twenty four (24) replicates from three (3) distinct preparations and PCR runs (eight replicates / run) at each level were analyzed with Probit Analysis to determine the lowest concentration which could accurately be detected with 95% probability. The limit of detection is 0.04 cfu / reaction.Reproducibility of the assay

[0120] Reproducibility study was performed using contrived samples in stool-TE buffer matrix, spiked with C. difficile bacterial stock. The panel included a negative (unspiked matrix), a low positive (approximately 2 to 4 times LOD), and a medium positive (approximately 8 to 10 times LOD) samples. The Reproducibility study was performed using two integrated cycler instruments for five days (not consecutive days). Each day, two runs were performed on each instrument. Each run included four replicates of each panel member and positive control (PC) and one replicate of no template control (NTC). The panel and PC were assayed with four replicates, and NTC, in singlicate in each run of the Integrated Cycler instrument. One lot of direct amplification assays was used to run the panel over a period of five days (not consecutive days) at two runs per day per instrument. There was a minimum of two instruments with at least one operator per instrument. The summary of the reproducibility of the results is shown below. Performance of the assay in presence of potentially interfering substances

[0121] The performance of this assay was evaluated with potentially interfering substances that may be present in stool samples at the concentrations indicated in the table below. A total of 21 potentially interference substances in replicates of 4 each and baseline (positive) sample in replicates of 5 were tested initially. All but two interference samples tested as "Positive" in all 4 replicates during initial run. All five replicates were "Positive" for two interference substances (Vancomycin & Pepto-Bismol) upon repeat / confirmatory run. No Interference was observed. Substance Active Ingredient Final Sample Preparation Concentration C. difficile Result MucinImmunoglobulins, Lysozyme, Polymers, etc3mg / mLDetectedMetronidazoleMetronidazole14mg / mLDetectedVancomycinVancomycin1.4mg / mLDetected (8 of 9 replicates)Stearic acidStearic acid4mg / mLDetectedPalmitic acidPalmitic acid2mg / mLDetectedBarium sulfateBarium sulfate5mg / mLDetectedNystatinNystatin10,000 USP units / mLDetectedWhole bloodGlucose, Hormones, Enzymes, Ions, Iron, etc.5% (v / v)DetectedAntacid and Anti-gas generic (liquid)Aluminum Hydroxide Magnesium Hydroxide0.1 mg / mLDetectedMilk of MagnesiaMagnesium Hydroxide0.2mg / mLDetectedImodium ADLoperamide0.005mg / mLDetectedPepto-BismolBismuth Subsalicylate0.175mg / mLDetected (7 of 9 replicates)Moist towelettes genericBenzalkonium Chloride10% (v / v)Detectedantacid genericCalcium Carbonate0.1mg / mLDetectedPreparation HPhenylephrine2% (w / v)DetectedTrojan with nonoxynol-9Nonoxynol-91.4mg / mLDetected1% Hydrocortisone CreamHydrocortisone2% (w / v)DetectedFleetMineral Oil2% (w / v)DetectedLaxative genericSennosides0.1mg / mLDetectedAlevenaproxen sodium14mg / mLDetectedKY Jellywater2% (w / v)Detected Cross Reactivity

[0122] Analytical Specificity for various possible cross reactants was performed. A total of 47 potential cross reactant organisms were tested. Only the Rotavirus organism tested "Negative" in initial testing of all three replicates. Confirmatory run of five replicates for "Rotavirus" also tested "Negative". No cross-reactivity was observed. Organism Suggested source or DI Concentration tested Dilution Result Acinetobacter baumanniiATCC 196060.5 McFarland1:1Did not cross reactAcinetobacter IwoffiiATCC 153090.5 McFarland1:1Did not cross reactAdenovirus 40ATCC VR-931N / A1:10 5< Did not cross reactBacillus cereusATCC 1070210 6< CFU / mL1:860Did not cross reactBacteroides merdaeATCC 431840.5 McFarlandNeatDid not cross reactBacteroides stercorisATCC 431830.5 McFarlandNeatDid not cross reactBifidobacterium adolescentisATCC 157030.5 McFarlandNeatDid not cross reactCampylobacter coliATCC 434790.5 McFarland1:1Did not cross reactCampylobacter jejuni sub sp jejuniATCC 332920.5 McFarlandNeatDid not cross reactCandida albicansZeptoMetrix 080150410 6< CFU / mL1:100Did not cross reactClostridium tetaniATCC 194060.5 McFarlandNeatDid not cross reactCitrobacter freundiiZeptoMetrix 080156310 6< CFU / mL1:5200Did not cross reactCitrobacter koseriATCC 270280.5 McFarland1:1Did not cross reactClostridium butyricumATCC 123980.5 McFarlandNeatDid not cross reactClostridium difficile(non-toxigenic ATCC 700057)0.5 McFarland1:4500Did not cross reactClostridium innocuumATCC 145010.5 McFarlandNeatDid not cross reactClostridium novyiATCC 194020.5 McFarlandNeatDid not cross reactClostridium paraputrificumATCC 257800.5 McFarlandNeatDid not cross reactClostridium perfringensATCC 131240.5 McFarlandNeatDid not cross reactClostridium septicumATCC 124640.5 McFarlandNeatDid not cross reactClostridium symbiosumATCC 149400.5 McFarlandNeatDid not cross reactCoxsackie virusATCC VR-3010 5< TCID 50 / mL1:28.1Did not cross reactCytomegalovirus AD169ZeptoMetrix 0810003CF10 5< TCID 50 / mL1:20.8Did not cross reactEchovirusATCC VR-3610 5< TCID 50 / mL1:15.8Did not cross reactEnterobacter aerogenesZeptoMetrix 080151810 6< CFU / mL1.10000Did not cross reactEnterobacter cloacaeATCC 130470.5 McFarland1:1Did not cross reactEnterococcus faecalisATCC 512990.5 McFarland1:1Did not cross reactEscherichia coliZeptoMetrix 080151710 6< CFU / mL1:20000Did not cross reactFusobacterium variumATCC 85010.5 McFarlandNeatDid not cross reactKlebsiella oxytocaATCC 334960.5 McFarland1:1Did not cross reactLactobacillus acidophilusZeptoMetrix 080154010 6< CFU / mL1:2120Did not cross reactLactobacillus reuteriATCC 232720.5 McFarlandNeatDid not cross reactListeria monocytogenesZeptoMetrix 080153410 6< CFU / mL1:11800Did not cross reactNorovirusClinical sampleN / ASwabDid not cross reactPeptostreptococcus anaerobiusATCC 273370.5 McFarlandNeatDid not cross reactProteus mirabilisZeptoMetrix 080154410 6< CFU / mL1:144Did not cross reactPseudomonas aeruginosaZeptoMetrix 080151910 6< CFU / mL1:10500Did not cross reactRotavirusClinical sampleN / ASwabDid not cross reactRotavirus (retest)ZeptoMetrix 0810041CF10 5< TCID 50 / mL1:200Cross reacted*Salmonella enterica subsp. Enterica (formerly Salmonella choleraesuis subsp. choleraesuis)ATCC 140280.5 McFarland1:1Did not cross reactSalmonella enterica subsp. arizonae (Borman) Le Minor et al. deposited as Arizona arizonae Kauffmann and EdwardsATCC 133140.5 McFarland1:1Did not cross reactSerratia marcescensATCC 138800.5 McFarland1:1Did not cross reactShigella boydiiATCC 92070.5 McFarland1:1Did not cross reactShigella dysenteriaeATCC 118350.5 McFarland1:1Did not cross reactShigella sonneiATCC 299300.5 McFarland1:1Did not cross reactStreptococcus agalactiaeZeptoMetrix 080154510 6< CFU / mL1:22000Did not cross reactVibrio choleraeGenomic DNA5 ng / µLN / ADid not cross reactNegative stoolNA-negative matrixNA-negative matrixN / ADid not cross react* Subsequent testing of the sample at a clinical testing lab confirmed the sample was positive for C. difficile. Example 12: Detection of Group A Streptococcus by Direct Nucleic Acid Amplification Assays and Comparison with Methods Using Nucleic Acid Extraction

[0123] Nucleic acids from the samples were amplified using the direct nucleic acid amplification assays and the results were compared with amplification results using methods involving nucleic acid extraction.

[0124] Swab samples were used in the direct amplification assay. The PCR master mix was prepared as follows:PCR Mix

[0125] Component Concentration Universal MM1xScorpion Forward Primer600 nMReverse Primer600 nMMgCl 2 2.5 mMPotassium Chloride40 mM

[0126] 2 uL of transport medium from a swab sample was added to 8 uL of PCR master mix and PCR was carried out using the following cycling parameters: Temp (°C)TimeStep 1Cycles 1976 min2409710 sec6030 sec

[0127] The sequences of the amplification primers and the amplicon are shown below. Group A Streptococcus Scorpion primer: Group A Streptococcus Reverse primer: 5' d TAACCCAGTATTTGCCGATCAA 3' Group A Streptococcus amplicon:

[0128] The amplification results using the direct nucleic acid amplification assays were compared with the results obtained using amplification methods involving nucleic acid extraction as shown below. Methods involving nucleic acid extractionTotal% AgreementDirect amplification methodPositiveNegativePositive4534893.8% (45 / 48)Negative334935299.1% (349 / 352)Total48352400

[0129] Thus, 93.8% of the samples identified positive by amplification methods involving nucleic acid extraction also were identified positive by the direct amplification assay, and 99% of the samples identified negative by amplification methods involving nucleic acid extraction also were identified negative by the direct amplification assay.Example 13: Detection of Flu A, Flu B and RSV by Direct Nucleic Acid Amplification Assays in the Presence of Interfering Substances

[0130] Using the experimental protocol of Example 8, nucleic acid from clinical specimens were amplified using the direct nucleic acid amplification assays in the presence of various interfering substances listed in the table below: Interferent ID Interferent Concentration tested ControlNoneN / A1human blood2% (v / v)2Afrin (Oxymetazoline)15% (v / v)3Beconase AQ (Beclomethasone)5% (v / v)4Nasal corticosteroid (Fluticasone)5% (v / v)5Nasal gel (Zicam)5% (v / v)6Mucin60 µg / mL7Systemic antibacterial (Tobramycin)10 µg / mL8Relenza (Zanamivir)3.3 mg / mL9Tamilflu (Oseltamivir)1.0 µM10Topical antibiotic (Mupirocin)2.5 mg / mL

[0131] The direct amplification assays were conducted in duplicates for each potential interfering substance. The Q670 fluorescent label used for an internal control, PC represents a positive control and NEG represents a negative control.

[0132] The table below presents Ct results of detecting the Flu A virus in the presence of the potential interfering substances.

[0133] The table below presents Ct results of detecting the Flu B virus in the presence of the potential interfering substances.

[0134] The table below presents Ct results of detecting the RSV virus in the presence of the potential interfering substances.

[0135] The results were verified to be accurate based on a lack of valid amplification signal in the FAM, JOE or CFR610 channels for the negative control and a Ct < 40 in the Q670 channel. Also, the PC reactions gave a Ct < 40 in the FAM, JOE and CFR610 channels.

[0136] The results of the direct amplification assays for detecting Flu A, Flu B and RSV demonstrate that there was no significant change in Ct values with any of the interferents for any of the viruses tested, as compared with the control samples without any interfering substance. The direct amplification assays are therefore not affected by potential inferfering substances when detecting low positive samples of these viruses.Example 14: Detection of HSV-1 and HSV-2 by Direct Nucleic Acid Amplification Assays in the Presence of Interfering Substances

[0137] Using the experimental protocol of Example 3, nucleic acid on a negative swab matrix and in synthetic cerebralspinal fluid were amplified using the direct nucleic acid amplification assays in the presence of various interfering substances listed in the table below: Interferent ID Interfereting Substances Matrix Concentration tested 1Whole Bloodswab and CSF10% (v / v)2Female Urineswab10% (v / v)3Albumin (protein)swab and CSF10 mg / mL4Casein (protein)swab and CSF10 mg / mL5K-Y Brand Jellyswab5% (v / v)6Acyclovir (Acycloguanosine)swab and CSF2.5 mg / mL7Betadine (topical antiseptic)swab and CSF5% (v / v)8White Blood CellCSF5.5x10e8 WBC / mL9Hemoglobin*CSF0.625 - 5.0 mg / mLControlNoneswab and CSFN / A

[0138] The whole blood potential interfering substance (Interferent ID: 1) was tested at 10%, which is clinically more relevant than purified hemoglobin. Also, the hemoglobin potential interfering substance (Interferent ID: 9) was tested at higher concentrations of 5.0 - 1.25 mg / mL, but detection of HSV-1 and HSV-2 were inhibited at these concentrations.

[0139] The direct amplification assays were conducted in triplicates for each potential interfering substance. The Q670 fluorescent label was used for an internal control, PC represents a positive control and NEG represents a negative control.

[0140] The table below presents Ct results of detecting the HSV-1 virus on the negative swab matrix in the presence of the potential interfering substances.

[0141] The fluid check for female urine (Interferent ID: 2) failed, as indicated by higher fluorescent values than the control with no sample, although HSV-1 was detected in the female urine samples. The K-Y brand jelly (Interferent ID: 5) produced an earlier Ct value compared to control samples, even though the same HSV-1 levels were used for all potential interference substance testing. The female urine and K-Y jelly potential interferents were retested and reproducibly produced an earlier Ct for both samples.

[0142] The table below presents Ct results of detecting the HSV-2 virus on the negative swab matrix in the presence of the potential interfering substances.

[0143] The fluid check problem relating to the female urine sample described above for HSV-1 also applied to HSV-2.

[0144] The table below presents Ct results of detecting the HSV-1 virus in the synthetic cerebralspinal fluid in the presence of the potential interfering substances.

[0145] The table below presents Ct results of detecting the HSV-2 virus in the synthetic cerebralspinal fluid in the presence of the potential interfering substances.

[0146] The results were verified to be accurate based on a lack of valid amplification signal in the FAM or CFR610 channels for the negative control and a Ct < 40 in the Q670 channel. Also, the PC reactions gave a Ct < 40 in the FAM and CFR610 channels.

[0147] The results of the direct amplification assays for detecting HSV-1 and HSV-2 demonstrate that there was no significant change in Ct values with any of the interferents for either of the viruses tested. The direct amplification assays are therefore not affected by potential inferfering substances when detecting low positive samples of these viruses.Example 15: Components of Direct Amplification Assays Providing Improved Performance

[0148] The following data represent components of the direct amplification assays that allow for improved performance. In one embodiment, a combination of all of these components provides a system that allows real time PCR to be effective even in the presence of known inhibitors (e.g., blood and heparin).Effect of KCl

[0149] Adding KCl (up to 20-40 mM) to a direct amplification assay improves fluorescence signals and confers improved sensitivity to the reaction. The data in Figure 5 demonstrates detection of MRSA in the presence and absence of KCl. Although some detection is possible without KCl, the presence of KCl improves the efficacy of the reaction. The data in Figure 5 was generated in the presence of other reaction components, such as a cationic surfactant.Effect of BSA

[0150] BSA was added to stool samples containing C. difficile, at various concentrations. At higher concentrations, represented by the 3500 ng / reaction below, inhibition was removed from some patient samples. As can be seen in the table below (presenting Ct values), at a lower 5 ng / reaction concentration of BSA, the C. difficile target was not detected and the internal control was missed in 2 out of 3 samples. Specifically, the internal control was detected with Sample A. However, the lower Ct value, as compared with the sample at higher concentrations, demonstrates delayed amplification and is characteristic of inhibition (the Ct value is the PCR cycle at which sufficient signal is generated to detect the target in question). Effect of Surfactants

[0151] Adding cationic surfactants improves fluorescence signals and confers improved sensitivity to a direct amplification assay. As demonstrated in Figure 6, in which a direct amplification assay was conducted on Simplexa Bordetella, some detection is possible without addition of the surfactant. However, when using the surfactant, efficacy of the reaction is improved, as demonstrated by greater signal height, which confers improved sensitivity.Effect of Additional Heating

[0152] Some organisms tested require additional heating steps to improve assay performance. For example, sensitivity improvements were observed for Flu B when using additional heating beyond that provided in a standard reaction (e.g., pre-heating), as demonstrated in Figure 7. The improvement with Flu B was seen at a temperature of 70 °C. Assay performance detecting other organisms, such as C. difficile and Group A Streptococcus, was seen at a temperature of 95 °C. Heating the sample to destroy inhibitors and to lyse organisms must be balanced with the potential for heat to destroy reagents. In some embodiments, heating the samples is performed prior to adding the reagents (e.g., buffer).Tolerance of system

[0153] The data below (Bordetella pertussis / parapertussis PCR) shows that the direct amplification assays can tolerate up to 30% transport media (Copan UTM) without inhibition. All samples tested below with direct detection methodology used a 30% sample and 70% direct amplification reaction mix. Results from direct detection were compared to results using DNA extraction and purification prior to amplification. The direct method had 99% sensitivity and specificity compared to the extraction and purification test using patient specimens.

[0154] Previous publications required significant dilution prior to adding specimen to the reaction mixture, therefore limiting sensitivity.Example 16: Direct Amplification Assays with Additional Specimen Types Whole blood

[0155] Whole blood was used to perform human genetic testing. Whole blood could be used with either a 1:4 dilution or with 0.5 µl in a 10 µl reaction volume. In either case, the heme (which is a known PCR inhibitor) did not affect the assay. Complete concordance was achieved when testing for the presence of Factor V Leiden mutations or Factor II mutations using the direct amplification method and when using the reference method which utilized nucleic acid extraction prior to amplification and mutation detection. Simplexa Direct FVLWTHETHOMTotalREFWT48900489HET050050HOM0044Total489504543 Simplexa Direct FIIWTHETHOMTotalREFWT51900519HET024024HOM0000Total519240543 Whole blood with Heparin

[0156] The data in Figure 8 shows amplification plots from a single blood sample that was collected into 3 tubes, each with a different anticoagulant (heparin, EDTA, citrate). As can be seen, the amplification plots show that all samples give efficient amplification, even when heparin, a known PCR inhibitor, is used as the anticoagulant.Buccal swabs

[0157] The data in Figure 9 represents 4 replicates from each of 2 samples of human genetic DNA for mutations (detecting the Factor V Leiden mutation region), plus one negative control. Efficient amplification is seen for all replicates. Samples were collected by the swabbing inner cheek for about 10 seconds to ensure the whole swab surface was used. The swabs were then placed into 500 uL 1X TE Buffer 2 uL, which was loaded directly into the PCR sample without extraction.Comparison to previously published literature

[0158] Previously published results indicate that in order for effective detection, samples must be diluted. Compared to these publications, for example, the Pandori et al., BMC Infect. Dis., 6:104 (2006) reference, the foregoing data demonstrates a 10 fold greater amount of sample, providing a limit of detection that is 10 fold lower than the published method.

Claims

1. A method for identifying the presence or absence of a target nucleic acid from a bacterium in a biological sample obtained from a human, said method comprising: (a) contacting the sample with a T. aquaticus (Taq) DNA polymerase and a buffer under conditions suitable for amplification of the target nucleic acid from the sample without extracting the target nucleic acid from the sample; (b) thermocycling the sample from step (a) such that the target nucleic acid, if present, is amplified; and (c) detecting the amplified target nucleic acid, if present, produced from step (b), wherein nucleic acid in the sample is not extracted from the sample prior to amplification, and wherein said buffer comprises an amplification buffer comprising a cationic surfactant, magnesium chloride (MgCl2), bovine serum albumin (BSA), dNTPs, an RNase inhibitor, and a scorpion primer for detection of the target nucleic acid, wherein 20-30% of the total volume of the sample mixture following step (a) is the biological sample, and wherein the amplification buffer is present during step (b) in a 1X - 5X concentration.

2. The method of claim 1, wherein the sample is not diluted prior to step (a).

3. The method of claim 1, wherein the sample is heated prior to step (b) for at least about 2 minutes at a temperature of at least about 70°C.

4. The method of claim 1, wherein the sample is heated prior to step (a).

5. The method of claim 1, wherein the sample is selected from the group consisting of whole blood, serum, plasma, cerebrospinal fluid, oral fluid, and stool.

6. The method of claim 1, wherein the bacterium is Clostridium or Streptococcus.

7. The method of claim 1, wherein the bacterium is Clostridium difficile.

8. The method of claim 7, wherein the scorpion primer is a forward primer comprising SEQ ID NOS: 24-25.

9. The method of claim 7, wherein the buffer contains a reverse primer having the sequence of SEQ ID NO: 26.

10. The method of claim 1, wherein the bacterium is group A Streptococcus bacteria.

11. The method of claim 10, wherein the scorpion primer is a forward primer comprising SEQ ID NOS: 28-29.

12. The method of claim 10, wherein the buffer contains a reverse primer having the sequence of SEQ ID NO: 30.

13. A method for identifying the presence or absence of a target nucleic acid from a virus in a biological sample obtained from a human, said method comprising: (a) contacting the sample with a T. aquaticus (Taq) DNA polymerase and a buffer under conditions suitable for amplification of the target nucleic acid from the sample without extracting the target nucleic acid from the sample; (b) thermocycling the sample from step (a) such that the target nucleic acid, if present, is amplified; and (c) detecting the amplified target nucleic acid, if present, produced from step (b), wherein nucleic acid in the sample is not extracted from the sample prior to amplification, and wherein said buffer comprises an amplification buffer comprising a cationic surfactant, a reverse transcriptase, an RNase inhibitor, magnesium chloride (MgCl2), potassium chloride (KCl), dNTPs, and a scorpion primer for detection of the target nucleic acid, wherein 20-30% of the total volume of the sample mixture following step (a) is the biological sample, wherein the sample is heated prior to step (a) or step (b) at a temperature of at least about 70°C, and wherein the amplification buffer is present during step (b) in a 1X - 5X concentration.

14. The method of claim 13, wherein the sample is not diluted prior to step (a).

15. The method of claim 13, wherein the sample is heated prior to step (b) for at least about 2 minutes at a temperature of at least about 70°C.

16. The method of claim 13, wherein the sample is heated prior to step (a).

17. The method of claim 13, wherein the sample is selected from the group consisting of whole blood, serum, plasma, cerebrospinal fluid, oral fluid, and stool.

18. The method of claim 13, wherein the virus is selected from the group consisting of an influenza virus, a respiratory syncytial virus, a varicella zoster virus, a herpes simplex virus, and an enterovirus.