Compositions and methods for enhancing immune responses
Patent Information
- Application Number
- JP2022575729
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-06-09
- Filing Date
- 2021-06-08
- Publication Date
- 2025-09-25
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Existing cancer immunotherapies face challenges in sustaining T cell responses within the tumor microenvironment, leading to dysfunctional T cells that fail to effectively reject tumors.
Modifying immune cells, such as T cells, to attenuate the expression and activity of the YTH N6-methyladenosine RNA-binding protein 2 (YTHDF2), enhancing their anti-tumor activity and reversing exhaustion by using agents like CRISPR/Cas9 systems, siRNA, and antibodies to target YTHDF2, and engineering cells with chimeric antigen receptors (CARs) to enhance tumor recognition.
Enhances T cell function and anti-tumor immunity, improving T cell proliferation and cytokine production, and reversing T cell exhaustion, leading to more effective cancer treatment outcomes.
Smart Images

Figure 00000072_0000 
Figure 00000073_0000 
Figure 00000073_0001
Abstract
Description
[Background technology]
[0001] Spontaneous T cell infiltration and proliferation in the tumor microenvironment are essential for the clinical efficacy of immunotherapy. However, in many patients, tumor-infiltrating T cells do not survive, and the sustained T cell response necessary for complete tumor rejection is not achieved. Identifying molecular pathways that influence the dysfunction of tumor-infiltrating T cells may provide targets to improve the response to immunotherapy.
[0002] While significant progress has been made in the field of cancer immunotherapy, the development of more powerful and effective treatments remains an urgent need. [Disclosure of the Invention]
[0003] This application relates to compositions and methods for enhancing the immune response against cancer cells and / or tumor antigens. Meanwhile, the inventors have found that the protein YTH N6-methyladenosine RNA-binding protein 2 (YTHDF2) is associated with the expression of T cell exhaustion signature genes. Mice lacking YTHDF2 in their T cells have shown superior anti-tumor immunity against lymphoma and solid tumors (such as melanoma and colon cancer). In YTHDF2-deficient mice, tumor-infiltrating T cell function is enhanced. Furthermore, the branching of T cell exhaustion is associated with memory-like or stem-like CD8 + They were rescued to face the fate of T cells.
[0004] On the other hand, the present invention provides modified immune cells having reduced YTHDF2 expression and / or activity, and enhanced antitumor activity, compared to unmodified corresponding immune cells.
[0005] In some embodiments, the immune cells are immune effector cells.
[0006] In some embodiments, the immune cells are T cells. In some embodiments, the immune cells are CD4 +It is a cell. In some embodiments, immune cells are CD8 + These are cells. In some embodiments, the immune cells are tumor-infiltrating T cells.
[0007] In some embodiments, immune cells are cells engineered to express chimeric antigen receptors (CARs) (e.g., a population of cells such as an immune effector cell population). In some embodiments, immune cells are CAR-T cells.
[0008] In some embodiments, the CAR used in this application comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the antigen-binding domain binds to a tumor antigen (such as CD20 or CLDN18.2). In some embodiments, the antigen is CD20, a claudin protein, CLDN18, or CLDN18.2. In some embodiments, the antigen-binding domain is an antibody or antibody fragment derived from rituximab. In some embodiments, the transmembrane domain of the above CAR has (i) an amino acid sequence having at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 10, but with 20, 10, or five or fewer modifications, or a sequence having 95-100% (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) identity to the amino acid sequence of SEQ ID NO: 10, or (ii) the sequence of SEQ ID NO: 10. In some embodiments, the antigen-binding domain of the CAR is linked to the transmembrane domain by a hinge region having a sequence having SEQ ID NO: 9 or 95-100% identity thereto (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more). In some embodiments, the intracellular signaling domain of the CAR includes a primary signaling domain and / or a co-stimulatory signaling domain, which includes a functional signaling domain for CD3ζ. In some embodiments, the primary signaling domain of the above-mentioned CAR is (i) an amino acid sequence having at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 8, but with 20, 10, or 5 or fewer modifications, or a sequence having 95-100% identity (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) to the amino acid sequence of SEQ ID NO: 8, or (ii) an amino acid sequence of SEQ ID NO: 8.In some embodiments, the intracellular signaling domain of the CAR described above comprises a co-stimulatory signaling domain, or a primary signaling domain and a co-stimulatory signaling domain, wherein the co-stimulatory signaling domain comprises a functional signaling domain (CD137) at 4-1BB. In some embodiments, the co-stimulatory signaling domain of the CAR described above comprises an amino acid sequence having at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 7, but with 20, 10, or 5 or fewer modifications, or a sequence having 95-100% (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the intracellular domain of the CAR described above comprises the sequence of SEQ ID NO: 7 and the sequence of SEQ ID NO: 8, wherein the sequences constituting the intracellular signaling domain are expressed as a single polypeptide chain in the same open reading frame.
[0009] In some embodiments, immune cells are cells engineered to express T cell receptors (e.g., a population of cells such as an immune effector cell population). In some embodiments, immune cells are TCR-T cells.
[0010] In some embodiments, the unmodified corresponding immune cells are TCF1 - That is the case.
[0011] In some embodiments, the unmodified corresponding immune cells are Tim3 + That is the case.
[0012] In some embodiments, unmodified corresponding immune cells are PD-1 + That is the case.
[0013] In some embodiments, modified immune cells are PD-1 + or PD-1 - That is the case.
[0014] In some embodiments, the modified immune cell is TCF1 + and / or TCF7 + is.
[0015] In some embodiments, the modified immune cell is Tim3 - is.
[0016] In some embodiments, the immune cell is modified by an agent capable of attenuating the expression and / or activity of YTHDF2. In some embodiments, the immune cells of the present application (e.g., engineered or modified immune effector cells such as T cells) contain an agent capable of attenuating the expression and / or activity of YTHDF2.
[0017] In some embodiments, the agent capable of attenuating the expression and / or activity of YTHDF2 includes an agent capable of attenuating the expression and / or activity of the gene encoding YTHDF2, and / or an agent capable of attenuating the expression and / or activity of the YTHDF2 protein.
[0018] In some embodiments, the immune cell is a human cell.
[0019] In some embodiments, the agent capable of attenuating the expression and / or activity of YTHDF2 includes one or more of high and low molecular weight agents.
[0020] In some embodiments, the agent capable of attenuating the expression and / or activity of YTHDF2 includes one or more of polypeptides and nucleic acid molecules.
[0021] In some embodiments, the agent capable of attenuating the expression and / or activity of YTHDF2 includes one or more of an antibody or its derivative, an antibody-drug conjugate, a fusion protein, and an antisense molecule.
[0022] In some embodiments, agents capable of attenuating the expression and / or activity of YTHDF2 include one or more of ubiquitin, protacs, dsRNA, siRNA, shRNA, aptamers, and gRNAs.
[0023] In some embodiments, agents capable of attenuating the expression and / or activity of YTHDF2 include one or more mutants or variants of the YTHDF2 protein capable of attenuating the activity of endogenous YTHDF2, and nucleic acid molecules encoding mutants or variants of the YTHDF2 protein. In some embodiments, agents capable of attenuating the expression and / or activity of YTHDF2 are dominant inhibitors (e.g., m 6 A nucleic acid comprising YTHDF2 (which cannot recognize, bind to, and / or modify A RNA), or the above-mentioned dominant inhibitory YTHDF2.
[0024] In some embodiments, immune cells undergo modifications resulting in complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2.
[0025] In some embodiments, agents capable of reducing the expression and / or activity of YTHDF2 include (1) a gene editing system or its regulatory elements that target one or more sites in the gene encoding YTHDF2, e.g., Ythdf2 or its regulatory elements, (2) nucleic acids encoding one or more components of the gene editing system described above, or (3) a combination thereof.
[0026] In some embodiments, the gene editing system is selected from a CRISPR / Cas9 system, a zinc finger nuclease system, a TALEN system, and a meganuclease system.
[0027] In some embodiments, the gene editing system is a CRISPR / Cas system comprising a gRNA molecule having a targeting sequence that hybridizes to a target sequence of the Ythdf2 gene. In some embodiments, the gene editing system binds to a target sequence in an early exon or intron of the gene encoding YTHDF2. In some embodiments, the gene editing system binds to a target sequence upstream of exon 4 of the gene encoding YTHDF2, for example, in exon 1, exon 2 and / or exon 3.
[0028] In some embodiments, the gene editing system binds to a target sequence in a late exon or intron of the gene encoding YTHDF2. In some embodiments, the gene editing system binds to a target sequence downstream of exon 3 of the gene encoding YTHDF2, for example, in exon 4, exon 5, exon 6, exon 7 and / or exon 8.
[0029] In some embodiments, the gene editing system binds to a target sequence in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and / or exon 8 of the gene encoding YTHDF2.
[0030] In some embodiments, the targeting sequence is the targeting sequence represented by SEQ ID NO. 17.
[0031] In some embodiments, the agents capable of attenuating the expression and / or activity of YTHDF2 are Ythdf2-specific siRNA or shRNA, or nucleic acids encoding the above-mentioned siRNA or shRNA. In some embodiments, the siRNA or shRNA has a sequence complementary to the Ythdf2 mRNA sequence.
[0032] On the other hand, the present application provides a composition comprising the modified immune cells of the present application and optionally pharmaceutically acceptable excipients.
[0033] On the other hand, the present application provides a composition for stimulating a T cell-mediated immune response against cancer cells and / or tumor antigens, comprising a drug capable of attenuating the expression and / or activity of YTHDF2 and optionally pharmaceutically acceptable excipients.
[0034] On the other hand, the present application provides a composition for treating cancer comprising a drug capable of attenuating the expression and / or activity of YTHDF2 and optionally pharmaceutically acceptable excipients.
[0035] In some embodiments of the compositions of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 include agents capable of attenuating the expression and / or activity of the gene encoding YTHDF2, and / or agents capable of attenuating the expression and / or activity of the YTHDF2 protein.
[0036] In some embodiments of the compositions of the present application, the agents capable of attenuating the expression and / or activity of YTHDF2 include one or more high-molecular-weight and low-molecular-weight substances.
[0037] In some embodiments of the compositions of the present application, the agents capable of attenuating the expression and / or activity of YTHDF2 comprise one or more polypeptides and nucleic acid molecules.
[0038] In some embodiments of the compositions of the present application, the agent capable of attenuating the expression and / or activity of YTHDF2 comprises one or more of the following: an antibody or its derivative, an antibody-drug conjugate, a fusion protein, and an antisense molecule.
[0039] In some embodiments of the compositions of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 include one or more of ubiquitin, protacs, dsRNA, siRNA, shRNA, aptamers, and gRNAs.
[0040] In some embodiments of the compositions of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 include one or more mutants or variants of the YTHDF2 protein capable of attenuating the activity of endogenous YTHDF2, and nucleic acid molecules encoding mutants or variants of the YTHDF2 protein. In some embodiments of the compositions of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 are dominant inhibitors (e.g., m 6 A nucleic acid comprising YTHDF2 (which cannot recognize, bind to, and / or modify A RNA), or the above-mentioned dominant inhibitory YTHDF2.
[0041] In some embodiments of the compositions of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 are (1) a gene editing system or its regulatory elements that target one or more sites in the gene encoding YTHDF2, e.g., Ythdf2 or its regulatory elements, (2) nucleic acids encoding one or more components of the gene editing system, or (3) a combination thereof.
[0042] In some embodiments of the compositions of the present application, the gene editing system is selected from a CRISPR / Cas9 system, a zinc finger nuclease system, a TALEN system, and a meganuclease system.
[0043] In some embodiments of the compositions of the present application, the gene editing system is a CRISPR / Cas system comprising a gRNA molecule having a targeting sequence that hybridizes to a target sequence of the Ythdf2 gene. In some embodiments of the compositions of the present application, the gene editing system binds to a target sequence in an early exon or intron of the gene encoding YTHDF2. In some embodiments of the compositions of the present application, the gene editing system binds to a target sequence upstream of exon 4 of the gene encoding YTHDF2, for example, in exon 1, exon 2 and / or exon 3.
[0044] In some embodiments of the compositions of the present application, the gene editing system binds to a target sequence in a late exon or intron of the gene encoding YTHDF2. In some embodiments of the compositions of the present application, the gene editing system binds to a target sequence downstream of exon 3 of the gene encoding YTHDF2, for example, in exon 4, exon 5, exon 6, exon 7 and / or exon 8.
[0045] In some embodiments, the gene editing system binds to a target sequence in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and / or exon 8 of the gene encoding YTHDF2.
[0046] In some embodiments of the composition of the present application, the targeting sequence is the targeting sequence represented by SEQ ID NO. 17.
[0047] In some embodiments of the compositions of the present application, the agent capable of attenuating the expression and / or activity of YTHDF2 is a Ythdf2-specific siRNA or shRNA, or a nucleic acid encoding the above-mentioned siRNA or shRNA. In some embodiments of the compositions of the present application, the siRNA or shRNA has a sequence complementary to the Ythdf2 mRNA sequence.
[0048] In some embodiments, the composition of the present application also comprises a second active ingredient. In some embodiments, the second active ingredient is an anticancer agent. In some embodiments, the second active ingredient comprises cancer immunotherapy. In some embodiments, the second active ingredient comprises an immune checkpoint inhibitor. In some embodiments, the second active ingredient comprises a drug selected from an anti-PD-L1 antibody or its antigen-binding moiety, an anti-PD-1 antibody or its antigen-binding moiety, an anti-CTLA-4 antibody or its antigen-binding moiety, and an IDO inhibitor. In some embodiments, the second active ingredient comprises pembrolizumab, nivolumab, cemiplimab, atezolizumab, avelumab, durvalumab, and / or ipilimumab.
[0049] In some embodiments of the composition of the present application, the second active ingredient is contained in a separate container and is not mixed with a modified immune cell or a drug capable of attenuating the expression and / or activity of YTHDF2.
[0050] On the other hand, the present invention provides a method for activating immune cells, which includes attenuating the expression and / or activity of YTHDF2 in immune cells.
[0051] On the other hand, the present invention provides a method for generating immune cells having enhanced antitumor activity, which includes attenuating the expression and / or activity of YTHDF2 in immune cells.
[0052] On the other hand, the present invention provides a method for preventing and / or reversing immune cell exhaustion, which includes reducing the expression and / or activity of YTHDF2 in immune cells.
[0053] In some embodiments of the method of the present invention, the immune cells are immune effector cells. In some embodiments of the method of the present invention, the immune cells are T cells. In some embodiments of the method of the present invention, the immune cells are CD4 + It is a cell. In some embodiments of the method of the present invention, immune cells are CD8 + These are cells. In some embodiments of the method of the present invention, the immune cells are tumor-infiltrating T cells.
[0054] In some embodiments of the present invention, the immune cells are cells engineered to express a chimeric antigen receptor (CAR) (for example, a population of cells such as an immune effector cell population). In some embodiments, the immune cells are CAR-T cells.
[0055] In some embodiments of the method of the present application, the CAR used in the present application comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the antigen-binding domain binds to a tumor antigen (e.g., CD20 or CLDN18.2). In some embodiments, the antigen is CD20 or CLDN18.2. In some embodiments, the antigen-binding domain is an antibody or antibody fragment derived from rituximab. In some embodiments, the transmembrane domain of the above CAR has (i) an amino acid sequence having at least one, two or three modifications to the amino acid sequence of SEQ ID NO: 10, but with 20, 10 or fewer modifications, or a sequence having 95-100% identity (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) to the amino acid sequence of SEQ ID NO: 10, or (ii) the sequence of SEQ ID NO: 10. In some embodiments, the antigen-binding domain of the CAR is linked to the transmembrane domain by a hinge region having a sequence having SEQ ID NO: 9 or 95-100% identity thereto (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more). In some embodiments, the intracellular signaling domain of the CAR includes a primary signaling domain and / or a co-stimulatory signaling domain, which includes a functional signaling domain for CD3ζ. In some embodiments, the primary signaling domain of the above-mentioned CAR is (i) an amino acid sequence having at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 8, but with 20, 10, or 5 or fewer modifications, or a sequence having 95-100% identity (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) to the amino acid sequence of SEQ ID NO: 8, or (ii) an amino acid sequence of SEQ ID NO: 8.In some embodiments, the intracellular signaling domain of the CAR described above comprises a co-stimulatory signaling domain, or a primary signaling domain and a co-stimulatory signaling domain, wherein the co-stimulatory signaling domain comprises a functional signaling domain (CD137) at 4-1BB. In some embodiments, the co-stimulatory signaling domain of the CAR described above comprises an amino acid sequence having at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 7, but with 20, 10, or 5 or fewer modifications, or a sequence having 95-100% (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the intracellular domain of the CAR described above comprises the sequence of SEQ ID NO: 7 and the sequence of SEQ ID NO: 8, wherein the sequences constituting the intracellular signaling domain are expressed as a single polypeptide chain in the same open reading frame.
[0056] In some embodiments of the method of the present invention, the immune cells are cells engineered to express T cell receptors (e.g., a population of cells such as an immune effector cell population). In some embodiments, the immune cells are TCR-T cells.
[0057] In some embodiments of the present invention, attenuation includes modifying immune cells with a drug capable of attenuating the expression and / or activity of YTHDF2 in immune cells.
[0058] In some embodiments of the method of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 include agents capable of attenuating the expression and / or activity of the gene encoding YTHDF2, and / or agents capable of attenuating the expression and / or activity of the YTHDF2 protein.
[0059] In some embodiments of the present invention, the agents capable of attenuating the expression and / or activity of YTHDF2 include one or more high molecular weight and low molecular weight compounds.
[0060] In some embodiments of the method of the present application, the agent capable of attenuating the expression and / or activity of YTHDF2 comprises one or more polypeptides and nucleic acid molecules.
[0061] In some embodiments of the method of the present application, the agent capable of attenuating the expression and / or activity of YTHDF2 comprises one or more of the following: an antibody or its derivative, an antibody-drug conjugate, a fusion protein, and an antisense molecule.
[0062] In some embodiments of the method of the present application, agents capable of attenuating the expression and / or activity of YTHDF2 include one or more of ubiquitin, protacs, dsRNA, siRNA, shRNA, aptamers, and gRNAs.
[0063] In some embodiments of the method of the present application, an agent capable of attenuating the expression and / or activity of YTHDF2 comprises one or more mutants or variants of the YTHDF2 protein capable of attenuating the activity of endogenous YTHDF2, and nucleic acid molecules encoding mutants or variants of the YTHDF2 protein. In some embodiments of the composition of the present application, an agent capable of attenuating the expression and / or activity of YTHDF2 is a dominant inhibitor (e.g., m 6 A nucleic acid comprising YTHDF2 (which cannot recognize, bind to, and / or modify A RNA), or the above-mentioned dominant inhibitory YTHDF2.
[0064] In some embodiments of the method of the present invention, agents capable of attenuating the expression and / or activity of YTHDF2 are (1) a gene editing system or its regulatory elements that target one or more sites in the gene encoding YTHDF2, e.g., Ythdf2 or its regulatory elements, (2) nucleic acids encoding one or more components of the gene editing system described above, or (3) a combination thereof.
[0065] In some embodiments of the method of the present invention, the gene editing system is selected from a CRISPR / Cas9 system, a zinc finger nuclease system, a TALEN system, and a meganuclease system.
[0066] In some embodiments of the method of the present application, the gene editing system is a CRISPR / Cas system comprising a gRNA molecule having a targeting sequence that hybridizes to a target sequence of the Ythdf2 gene. In some embodiments of the composition of the present application, the gene editing system binds to a target sequence in an early exon or intron of the gene encoding YTHDF2. In some embodiments of the composition of the present application, the gene editing system binds to a target sequence upstream of exon 4 of the gene encoding YTHDF2, for example, in exon 1, exon 2 and / or exon 3.
[0067] In some embodiments of the method of the present application, the gene editing system binds to a target sequence in a late exon or intron of the gene encoding YTHDF2. In some embodiments of the composition of the present application, the gene editing system binds to a target sequence downstream of exon 3 of the gene encoding YTHDF2, for example, in exon 4, exon 5, exon 6, exon 7 and / or exon 8.
[0068] In some embodiments of the present invention, the gene editing system binds to a target sequence in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7 and / or exon 8 of the gene encoding YTHDF2.
[0069] In some embodiments of the method of the present application, the targeting sequence is the targeting sequence represented by SEQ ID NO. 17.
[0070] In some embodiments of the method of the present application, the agent capable of attenuating the expression and / or activity of YTHDF2 is a Ythdf2-specific siRNA or shRNA, or a nucleic acid encoding the above-mentioned siRNA or shRNA. In some embodiments of the composition of the present application, the siRNA or shRNA has a sequence complementary to the Ythdf2 mRNA sequence.
[0071] In some embodiments of the method of the present application, attenuation includes causing immune cells to undergo modifications resulting in complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2.
[0072] In some embodiments, the above methods are in vivo, in vitro, and / or ex vivo methods.
[0073] On the other hand, the present invention provides a method for treating a disease, disorder or condition related to the expression of a tumor antigen in a subject in need, comprising administering to the subject an agent capable of attenuating the expression and / or activity of YTHDF2, and / or modified immune cells of the present invention.
[0074] In some embodiments, the disease, disorder, or condition is cancer. In some embodiments, the cancer is selected from hematological cancers, lymphomas, and solid tumors. In some embodiments, the cancer is selected from melanoma, colon cancer, pancreatic cancer, breast cancer, lung cancer, and liver cancer.
[0075] On the other hand, the present application provides a method for treating cancer in a subject in need, comprising administering to the subject an agent capable of attenuating the expression and / or activity of YTHDF2, and / or modified immune cells of the present application. In some embodiments, the cancer is selected from hematological cancers, lymphomas, and solid tumors. In some embodiments, the cancer is selected from melanoma, colon cancer, pancreatic cancer, breast cancer, lung cancer, and liver cancer.
[0076] On the other hand, the present invention provides a method for stimulating a T cell-mediated immune response to cancer cells and / or tumor antigens in a subject in need, comprising administering to the subject a drug capable of attenuating the expression and / or activity of YTHDF2, and / or modified immune cells of the present invention.
[0077] On the other hand, the present invention provides a method for providing antitumor immunity to a subject in need, comprising administering to the subject a drug capable of reducing the expression and / or activity of YTHDF2, and / or modified immune cells of the present invention.
[0078] On the other hand, the present invention provides a method for preventing and / or reversing T cell exhaustion in a subject in need, comprising administering to the subject an agent capable of reducing the expression and / or activity of YTHDF2, and / or modified immune cells of the present invention. In some embodiments, T cell exhaustion is CD8 + This is T cell exhaustion.
[0079] In some embodiments of the method of the present application, the subjects are cancer patients. In some embodiments, the subjects are patients with cancer selected from hematological cancers, lymphomas, and solid tumors. In some embodiments, the subjects are patients with cancer selected from melanoma, colon cancer, pancreatic cancer, breast cancer, lung cancer, and liver cancer.
[0080] In some embodiments of the method of the present application, the subject has received, is receiving, and / or will receive another therapy, such as anticancer therapy. In some embodiments, the anticancer therapy includes cancer immunotherapy. In some embodiments, the anticancer therapy includes or is an immune checkpoint inhibitor. In some embodiments, the anticancer therapy includes a drug selected from an anti-PD-L1 antibody or its antigen-binding moiety, an anti-PD-1 antibody or its antigen-binding moiety, an anti-CTLA-4 antibody or its antigen-binding moiety, and an IDO inhibitor. In some embodiments, the anticancer therapy includes pembrolizumab, nivolumab, semiprimab, atezolizumab, avelumab, durvalumab, and / or ipilimumab.
[0081] In some embodiments, the above method further comprises administering one or more additional anticancer therapies to the subject. In some embodiments, the additional anticancer therapy includes cancer immunotherapy. In some embodiments, the additional anticancer therapy includes an immune checkpoint inhibitor. In some embodiments, the additional anticancer therapy includes a drug selected from an anti-PD-L1 antibody or its antigen-binding moiety, an anti-PD-1 antibody or its antigen-binding moiety, an anti-CTLA-4 antibody or its antigen-binding moiety, and an IDO inhibitor. In some embodiments, the additional anticancer therapy includes pembrolizumab, nivolumab, semiprimab, atezolizumab, avelumab, durvalumab, and / or ipilimumab.
[0082] On the other hand, this application aims to: 1) activate immune cells, 2) generate immune cells with enhanced antitumor activity, 3) prevent and / or reverse immune cell exhaustion, 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need, 5) treat cancer in subjects in need, 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need, 7) provide antitumor immunity to subjects in need, and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 +10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides the use of agents capable of attenuating the expression and / or activity of YTHDF2 in the manufacture of compositions and / or pharmaceuticals used for one or more purposes of increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0083] In some embodiments relating to use, the cancer or tumor is selected from hematological cancers, lymphomas, and solid tumors. In some embodiments, the cancer or tumor is selected from melanoma, colon cancer, pancreatic cancer, breast cancer, lung cancer, and liver cancer.
[0084] On the other hand, this application aims to: 1) activate immune cells, 2) generate immune cells with enhanced antitumor activity, 3) prevent and / or reverse immune cell exhaustion, 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need, 5) treat cancer in subjects in need, 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need, 7) provide antitumor immunity to subjects in need, and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 +The invention provides the use of a combination of a drug capable of attenuating the expression and / or activity of YTHDF2 with an additional active ingredient in the manufacture of a drug used for one or more purposes of increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0085] In some embodiments of use, additional active ingredients include cancer immunotherapy. In some embodiments, additional active ingredients include immune checkpoint inhibitors. In some embodiments, additional active ingredients include agents selected from anti-PD-L1 antibodies or their antigen-binding moieties, anti-PD-1 antibodies or their antigen-binding moieties, anti-CTLA-4 antibodies or their antigen-binding moieties, and IDO inhibitors. In some embodiments, additional active ingredients include pembrolizumab, nivolumab, semiprimab, atezolizumab, avelumab, durvalumab, and / or ipilimumab.
[0086] On the other hand, this application aims to: 1) activate immune cells, 2) generate immune cells with enhanced antitumor activity, 3) prevent and / or reverse immune cell exhaustion, 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need, 5) treat cancer in subjects in need, 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need, 7) provide antitumor immunity to subjects in need, and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 +The present invention provides modified immune cells or cell populations to be used for one or more purposes of increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0087] On the other hand, this application aims to: 1) activate immune cells, 2) generate immune cells with enhanced antitumor activity, 3) prevent and / or reverse immune cell exhaustion, 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need, 5) treat cancer in subjects in need, 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need, 7) provide antitumor immunity to subjects in need, and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides compositions to be used for one or more purposes of increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0088] On the other hand, this application aims to: 1) activate immune cells, 2) generate immune cells with enhanced antitumor activity, 3) prevent and / or reverse immune cell exhaustion, 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need, 5) treat cancer in subjects in need, 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need, 7) provide antitumor immunity to subjects in need, and 8) CD4 +9) Increase and / or improve T cell proliferation, 10) Increase and / or improve CD8+ T cell proliferation, 11) Increase the number of CD8+ cytotoxic T cells in or around the tumor site, 12) Tumor-infiltrating CD8 + The present invention provides a drug capable of attenuating the expression and / or activity of YTHDF2, which can be used for one or more purposes of increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0089] On the other hand, the present invention comprises an agent capable of attenuating the expression and / or activity of YTHDF2 and additional active ingredients of the present invention, which include: 1) activating immune cells; 2) generating immune cells with enhanced antitumor activity; 3) preventing and / or reversing immune cell exhaustion; 4) treating diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treating cancer in subjects in need; 6) stimulating T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) providing antitumor immunity to subjects in need; and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides a combination of one or more of the following objectives: 12) increasing the number of T cells, 13) enhancing T cell cytokine production, 14) enhancing the antitumor response to cancer immunotherapy, and 15) preventing and / or reversing T cell exhaustion in subjects in need.
[0090] On the other hand, the present invention provides a method for treating a subject, comprising administering to the subject: 1) immune cells of the present invention (such as modified immune cells of the present invention), 2) a drug capable of attenuating the expression and / or activity of YTHDF2 of the present invention, or 3) additional active ingredients of the present invention, or any combination thereof.
[0091] Other aspects and advantages of the present application will be readily apparent to those skilled in the art through the following detailed description. The present invention provides only exemplary embodiments, which are described in the following detailed description. As will be understood, the present application can be implemented in other different embodiments, and some of its details can be modified in various obvious ways without departing from the present application. Accordingly, the accompanying drawings and specification should be considered illustrative and not limiting.
[0092] Embedding by reference All publications, patents, and patent applications relating to this Spec. are incorporated herein by reference to the same extent that each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference.
[0093] The novel features of this application are specifically described in the appended claims. The features and advantages of this application will be better understood by referring to the following detailed description. The following detailed description illustrates exemplary embodiments employing the principles of this application, together with the appended drawings (also referred to herein as "Figures"). [Brief explanation of the drawing]
[0094] [Figure 1] Figures 1a-1d show that the antitumor effect was enhanced after attenuation of YTHDF2 in T cells. [Figure 2] Figures 2a-2g show that T cell function was enhanced after attenuation of YTHDF2. [Figure 3] Figures 3a-3e show the reversal of T cell exhaustion and enhancement of T cell function after attenuation of YTHDF2. [Figure 4] Figures 4a to 4b show the design of the CAR. [Figure 5] Figures 5a–5d show CAR expression in cells after infection with different doses of the virus. [Figure 6] Figures 6a to 6d show the expression of CAR in various T cells of the present invention. [Figure 7] Figures 7a to 7b show the tumor cell-killing effects of various CAR-T cells of the present invention. [Figure 8] Figures 8A-8B show the CAR design and CAR expression in various T cells according to the present invention. [Figure 9] Figure 9 shows the tumor cell-killing effect of various CAR-T cells of the present invention. [Figure 10] Figure 10 shows the tumor cell-killing effect of various CAR-T cells of the present invention. [Modes for carrying out the invention]
[0095] Various embodiments of the present application have been described herein, and it will be apparent to those skilled in the art that all these embodiments are provided for illustrative purposes only. Various modifications, alterations, and substitutions can be made without departing from the present invention. It should be understood that various alternative forms of the embodiments of the present application described herein may be adopted.
[0096] On the other hand, the present invention provides modified immune cells. Modified immune cells have reduced YTHDF2 expression and / or activity compared to unmodified corresponding immune cells. Modified immune cells may also have enhanced antitumor activity.
[0097] On the other hand, the present application provides a composition which may contain the modified immune cells of the present application. The composition may also contain pharmaceutically acceptable excipients.
[0098] On the other hand, the present application provides a composition for stimulating a T cell-mediated immune response against cancer cells. On the other hand, the present application provides a composition for stimulating a T cell-mediated immune response against tumor antigens. The above compositions may include agents capable of attenuating the expression and / or activity of YTHDF2. The above compositions may further include pharmaceutically acceptable excipients.
[0099] On the other hand, the present application provides a composition for treating cancer. The composition may include an agent capable of reducing the expression and / or activity of YTHDF2. The composition may further include pharmaceutically acceptable excipients.
[0100] On the other hand, the present invention provides a method for activating immune cells. The above method may include attenuating the expression and / or activity of YTHDF2 in immune cells.
[0101] On the other hand, the present invention provides a method for generating immune cells having enhanced antitumor activity. The above method may include attenuating the expression and / or activity of YTHDF2 in immune cells.
[0102] On the other hand, the present invention provides a method for preventing and / or reversing the exhaustion of immune cells. The above method may include attenuating the expression and / or activity of YTHDF2 in immune cells.
[0103] On the other hand, the present invention provides a method for treating diseases, disorders, or conditions related to the expression of tumor antigens in subjects in need. The above method may include administering to a subject an agent capable of reducing the expression and / or activity of YTHDF2.
[0104] On the other hand, the present invention provides a method for treating diseases, disorders, or conditions associated with the expression of tumor antigens in subjects in need. The above method may include administering the modified immune cells of the present invention to the subject.
[0105] On the other hand, the present invention provides a method for treating diseases, disorders, or conditions associated with the expression of tumor antigens in subjects in need. The above method may include administering to a subject a drug capable of attenuating the expression and / or activity of YTHDF2 and immune cells of the present invention (such as modified immune cells).
[0106] On the other hand, the present invention provides a method for treating cancer in subjects who require it. The above method may include administering to a subject a drug capable of reducing the expression and / or activity of YTHDF2.
[0107] On the other hand, the present invention provides a method for treating cancer in subjects in need. The above method may include administering the modified immune cells of the present invention to the subject.
[0108] On the other hand, the present invention provides a method for treating cancer in subjects in need. The above method may include administering to a subject a drug capable of reducing the expression and / or activity of YTHDF2 and immune cells of the present invention (such as modified immune cells).
[0109] On the other hand, the present invention provides a method for stimulating a T cell-mediated immune response against cancer cells and / or tumor antigens in subjects where such stimulation is needed. The above method may include administering to a subject a drug capable of attenuating the expression and / or activity of YTHDF2.
[0110] On the other hand, the present invention provides a method for stimulating a T cell-mediated immune response against cancer cells and / or tumor antigens in subjects where such stimulation is needed. The above method may include administering the modified immune cells of the present invention to a subject.
[0111] On the other hand, the present invention provides a method for stimulating a T cell-mediated immune response to cancer cells and / or tumor antigens in subjects where such stimulation is needed. The above method may include administering to a subject a drug capable of attenuating the expression and / or activity of YTHDF2 and immune cells of the present invention (such as modified immune cells).
[0112] On the other hand, the present invention provides a method for providing antitumor immunity to subjects in need. The above method may include administering to a subject a drug capable of reducing the expression and / or activity of YTHDF2.
[0113] On the other hand, the present invention provides a method for providing antitumor immunity to subjects in need. The above method may include administering the modified immune cells of the present invention to the subjects.
[0114] On the other hand, the present invention provides a method for providing antitumor immunity to subjects in need. The above method may include administering to a subject a drug capable of attenuating the expression and / or activity of YTHDF2 and immune cells of the present invention (such as modified immune cells).
[0115] On the other hand, the present invention provides a method for preventing and / or reversing T cell exhaustion in subjects in need. The above method may include administering to subjects a drug capable of reducing the expression and / or activity of YTHDF2.
[0116] On the other hand, the present invention provides a method for preventing and / or reversing T cell exhaustion in subjects in need. The above method may include administering the modified immune cells of the present invention to a subject.
[0117] On the other hand, the present invention provides a method for preventing and / or reversing T cell exhaustion in subjects in need. The above method may include administering to a subject a drug capable of reducing the expression and / or activity of YTHDF2 and immune cells of the present invention (such as modified immune cells).
[0118] On the other hand, the present invention aims to: 1) activate immune cells; 2) generate immune cells with enhanced antitumor activity; 3) prevent and / or reverse immune cell exhaustion; 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treat cancer in subjects in need; 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) provide antitumor immunity to subjects in need; and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides the use of agents capable of reducing the expression and / or activity of YTHDF2 in the manufacture of compositions and / or pharmaceuticals for the purpose of increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and / or 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0119] On the other hand, the present invention aims to: 1) activate immune cells; 2) generate immune cells with enhanced antitumor activity; 3) prevent and / or reverse immune cell exhaustion; 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treat cancer in subjects in need; 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) provide antitumor immunity to subjects in need; and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 +The invention provides the use of combinations of drugs with additional active ingredients that can reduce the expression and / or activity of YTHDF2 in the manufacture of pharmaceuticals for increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and / or 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0120] On the other hand, the present invention aims to: 1) activate immune cells; 2) generate immune cells with enhanced antitumor activity; 3) prevent and / or reverse immune cell exhaustion; 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treat cancer in subjects in need; 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) provide antitumor immunity to subjects in need; and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides modified immune cells or cell populations for increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and / or 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0121] On the other hand, the present invention aims to: 1) activate immune cells; 2) generate immune cells with enhanced antitumor activity; 3) prevent and / or reverse immune cell exhaustion; 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treat cancer in subjects in need; 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) provide antitumor immunity to subjects in need; and 8) CD4 +To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides compositions for increasing the number of T cells, 12) enhancing T cell cytokine production, 13) enhancing the antitumor response of cancer immunotherapy, and / or 14) preventing and / or reversing T cell exhaustion in subjects in need.
[0122] On the other hand, the present invention aims to: 1) activate immune cells; 2) generate immune cells with enhanced antitumor activity; 3) prevent and / or reverse immune cell exhaustion; 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treat cancer in subjects in need; 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) provide antitumor immunity to subjects in need; and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides a drug capable of reducing the expression and / or activity of YTHDF2 to increase the number of T cells, 12) enhance T cell cytokine production, 13) enhance the antitumor response to cancer immunotherapy, and / or 14) prevent and / or reverse T cell exhaustion in subjects in need.
[0123] On the other hand, the present invention aims to: 1) activate immune cells; 2) generate immune cells with enhanced antitumor activity; 3) prevent and / or reverse immune cell exhaustion; 4) treat diseases, disorders or conditions related to the expression of tumor antigens in subjects in need; 5) treat cancer in subjects in need; 6) stimulate T cell-mediated immune responses against cancer cells and / or tumor antigens in subjects in need; 7) provide antitumor immunity to subjects in need; and 8) CD4 + To increase and / or improve T cell proliferation, 9) CD8 + 10) To increase and / or improve T cell proliferation, CD8 in or around the tumor site + Increasing the number of cytotoxic T cells, 11) tumor infiltration CD8 + The present invention provides a combination of agents and additional active ingredients of the present invention that can reduce the expression and / or activity of YTHDF2 relating to the present invention for the following purposes: 12) increasing the number of T cells, 13) enhancing T cell cytokine production, 14) enhancing the antitumor response of cancer immunotherapy, and / or 15) preventing and / or reversing T cell exhaustion in subjects in need.
[0124] On the one hand, the present application provides a method for treating a subject according to the present application. The above method may include administering to the subject: 1) immune cells of the present application (such as modified immune cells of the present application), 2) an agent capable of attenuating the expression and / or activity of YTHDF2 of the present application, and / or 3) an additional active ingredient of the present application. For example, the above method may include administering to the subject: 1) immune cells of the present application (such as modified immune cells of the present application) and 2) an agent capable of attenuating the expression and / or activity of YTHDF2 of the present application. Also, for example, the above method may include administering to the subject: 1) immune cells of the present application (such as modified immune cells of the present application) and 3) an additional active ingredient of the present application. Also, for example, the above method may include administering to the subject: 2) an agent capable of attenuating the expression and / or activity of YTHDF2 of the present application and 3) an additional active ingredient of the present application. Also, for example, the above method may include administering to the subject: 1) immune cells of the present application (such as modified immune cells of the present application), 2) an agent capable of attenuating the expression and / or activity of YTHDF2 of the present application, and 3) an additional active ingredient of the present application.
[0125] As used herein, the terms "comprising," "having," "being able to," "containing," and variations thereof refer to open-ended transitional phrases, terms, or words that do not usually exclude the possibility of additional acts or structures. The singular forms "a," "and," "the" include plural referents.
[0126] Regarding the notation of numerical ranges in this specification, it is explicitly assumed that each numerical value in between is expressed with the same degree of accuracy. For example, in the range of 6 to 9, in addition to 6 and 9, the numbers 7 and 8 are assumed, and in the range of 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9 and 7.0 are explicitly assumed. Therefore, the description in the form of a range is merely for convenience and simplification, and should not be construed as strictly limiting the scope of application of the present invention. The description of a range should be understood as specifically disclosing not only the individual numerical values within the range, but also all possible sub-ranges. For example, the description of a range such as 1 to 6 should be understood as specifically disclosing sub-ranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, and the individual values within the range, such as 1, 2, 2.7, 3, 4, 5, 5.3, 6. Also, for example, in the range of 95 to 100% (for example, 95 to 96%, 95 to 97%, 95 to 98%, 95 to 99%, 95 to 99.5% or more), it includes those with the same identity of 95%, 96%, 97%, 98% or 99%, and there are sub-ranges with the same identity such as 96 to 99%, 96 to 98%, 96 to 97%, 97 to 99%, 97 to 98%, 98 to 99%. This applies regardless of the width of the range.
[0127] The modifier "about" used in relation to a quantity includes the recited value and has a meaning indicating the context (for example, at least including the degree of error related to the measurement of a specific quantity). The modifier "about" should be understood as disclosing a range defined by the absolute values of the two end points. For example, the expression "about 2 to about 4" also discloses the range of "2 to 4". When referring to measurable values such as quantities and time durations, "about" includes variations of ±20%, in some cases ±10%, in some cases ±5%, in some cases ±1%, in some cases ±0.1% from the specified value, and these variations are appropriate.
[0128] As used herein, the term “subject” usually refers to a human or an animal. For example, it may refer to any vertebrate, including (but not limited to) mammals (e.g., cattle, pigs, camels, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats and mice, non-human primates (e.g., cynomolgus macaques, chimpanzees and other monkeys) and humans). In some embodiments, the subject is a human.
[0129] The term “treat / treated / treating” may be used interchangeably herein and typically refers to a method of treatment that alleviates (reduces) an undesirable physiological condition, disorder or disease, or to obtain a beneficial or desirable clinical outcome. In some aspects of this disclosure, beneficial or desirable clinical outcomes include, but are not limited to, relief of symptoms, reduction of the severity of a condition, disorder or disease, stabilization (without exacerbation) of a condition, disorder or disease, delay of the onset of a condition, disorder or disease, or mitigation of the progression of a condition, disorder or disease, improvement and remission (whether partial or complete remission, detectable or undetectable), or enhancement or improvement of a condition, disorder or disease. Treatment also includes extending survival compared to the survival expected without treatment.
[0130] The term "modified / modify / modification" is interchangeable herein and typically means the introduction or generation of alteration or change. When used in the context of genes, the above modifications may include any conventional method that causes a change in the genetic makeup of a target cell or subject. Examples include mutations caused by ultraviolet irradiation, chemical mutations, targeted mutations such as site mutations in cells (e.g., immune cells), and the creation of transgenic mice.
[0131] The terms "attenuating / attenuation / attenuated" are used interchangeably and, as used herein, may refer to inhibition or reduction of the amount of a target gene or target protein (such as YTHDF2), or inhibition or reduction of the activity of a target gene or target protein (such as YTHDF2). Such attenuation can be achieved, for example, by using antibodies or their derivatives, antibody-drug conjugates, fusion proteins, small molecules, antisense molecules, dsRNA, siRNA, shRNA, aptamers and / or gRNA (e.g., in combination with gene editing systems (such as CRIPSR / Cas9)). Alternatively, YTHDF2 can be attenuated, for example, by contacting immune cells with a YTHDF2 inhibitor to inhibit the binding and / or recognition of m6A-modified mRNA by YTHDF2.
[0132] As used herein, the term “small molecule” typically refers to any chemical substance or other component other than peptides and nucleic acids that can be used to influence biological processes, particularly the regulation of m6A mRNA modification (e.g., YTHDF2 activity). Small molecules may include therapeutics currently known and used, or any number of therapeutics synthesized in libraries of such molecules for the purpose of screening biological functions. Small molecules are distinguished from macromolecules by size. Small molecules may have molecular weights of less than about 5,000 daltons (Da), such as less than about 2,500 Da, less than about 1,000 Da, or less than about 500 Da. Small molecules may include (but are not limited to) organic compounds and their peptide mimes, as well as complexes.
[0133] As used herein, the term “organic compound” generally refers to any carbon-based compound other than macromolecules such as nucleic acids and polypeptides. Organic compounds may contain elements other than carbon, such as calcium, chlorine, fluorine, copper, hydrogen, iron, potassium, nitrogen, oxygen, and sulfur. Organic compounds may be aromatic or aliphatic. Non-limiting examples of organic compounds include acetone, alcohols, aniline, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, amino acids, nucleosides, nucleotides, lipids, retinoids, steroids, proteoglycans, ketones, aldehydes, saturated, unsaturated, and polyunsaturated fats, oils and waxes, alkenes, esters, ethers, thiols, sulfides, cyclic compounds, heterocyclic compounds, imidazoles, and phenols. The organic compounds used herein also include nitrated organic compounds and halogenated (e.g., chlorinated) organic compounds.
[0134] The terms “peptide,” “polypeptide,” and “protein” may be used interchangeably herein and may typically refer to linked amino acid sequences that may be natural, synthetic, or modified or combined natural and synthetic. These terms include antibodies, antibody mimes, domain antibodies, lipocalins, and targeted proteases. These terms also include vaccines containing peptides or peptide fragments intended to produce antibodies against a peptide or peptide fragment.
[0135] As used herein, the term “antibody” typically refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. Antibodies may be polyclonal or monoclonal, multi-stranded or single-stranded, or intact immunoglobulins, and may be derived from natural or recombinant sources. Antibodies may be tetramers of immunoglobulin molecules. Antibodies may be conjugated with chemical moieties. Antibodies may be human antibodies or humanized antibodies.
[0136] As used herein, the term “antibody fragment” typically refers to at least a portion of an antibody that possesses the ability to specifically interact with an antigen epitope (e.g., by binding, steric hindrance, stabilization / destabilization, or spatial distribution). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fv(sdFv), Fd fragments composed of VH and CH1 domains, linear antibodies, single-domain antibodies such as sdAb(VL or VH), camelid VHH domains, multispecific antibodies formed from antibody fragments (such as a bivalent fragment containing two Fab fragments disulfide-linked at a hinge region), and antibody isolation CDRs or other epitope-binding fragments. Antigen-binding fragments can also be incorporated into single-domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs, and bis-scFvs (see, for example, Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005).
[0137] As used herein, the term “antisense” molecule typically refers to an antisense or sense oligonucleotide containing a single-stranded nucleic acid sequence (either RNA or DNA) capable of binding to a target mRNA (sense) or DNA (antisense) sequence. The ability to induce antisense or sense oligonucleotides based on a given protein-coding cDN sequence is described, for example, in Stein and Cohen, Cancer Res. 48:2659, (1988) and van der Krol et al., BioTechniques 6:958, (1988). Antisense molecules may be modified or unmodified RNA, DNA, or mixed polymer oligonucleotides. These molecules function by specifically binding to matching sequences, thereby inhibiting peptide synthesis through steric blocking or activation of the RNase H enzyme (Wu-Pong, November 1994, BioPharm, 20-33). Antisense molecules can also alter protein synthesis by inhibiting RNA processing and transport from the nucleus to the cytoplasm (Mukhopadhyay & Roth, 1996, Crit. Rev. in Oncogenesis 7, 151-190). Furthermore, the binding of single-stranded DNA to RNA can induce nuclease-mediated degradation of heterogeneous double-stranded DNA (Wu-Pong, above). Skeletal modification DNA chemicals that have been shown to act as RNase H substrates include phosphorothioates, phosphorodithioates, borontrifluorides, and oligonucleotides containing 2'-arabino and 2'-fluoroarabino.
[0138] As used herein, the term “siRNA” typically refers to small interfering RNAs, specifically small inhibitory RNA double helixes that induce RNA interference (RNAi) pathways. (Elbashir, SM et al., Nature 411:494-498 (2001); Caplen, NJ et al., Proc. Natl. Acad. Sci. USA 98:9742-9747 (2001); Harborth, J. et al., J Cell Sci. 114:4557-4565 (2001).) These molecules vary in length (generally 18-30 base pairs) and exhibit varying degrees of complementarity to their target mRNA in antisense. Some, but not all, siRNAs have unpaired overhanging bases at the 5' or 3' ends of the sense and / or antisense strands. The term “siRNA” encompasses double helixes with two separate strands, and single helixes that can form hairpin structures containing the double-helix region. The siRNA molecules used herein are not limited to RNA molecules, but also include chemically modified nucleotides and non-nucleotides. siRNA gene targeting can be performed by transient delivery of siRNA into cells (achieved by classical methods such as liposome-mediated transfection, electroporation, or microinjection).
[0139] As used herein, the term “gRNA” typically refers to a guide polynucleotide (i.e., a guide polynucleotide / Cas nucleic acid endonuclease complex) capable of forming a complex with a Cas nucleic acid endonuclease, where the guide polynucleotide / Cas nucleic acid endonuclease complex guides the Cas nucleic acid endonuclease to the DNA target site to recognize and bind to the DNA target site and optionally nick or cleave (introduce single-strand or double-strand breaks). The guide polynucleotide / Cas nucleic acid endonuclease complex as used herein may comprise a Cas protein and a suitable polynucleotide component from one of the four known CRISPR systems (Horvath and Barrangou, Science 327: 167-170, e.g., type I, type II, or type III CRISPR systems). Cas nucleic acid endonucleases unwind the DNA double helix at the target sequence and optionally cleave at least one DNA strand, mediated by the recognition of the target sequence by a polynucleotide (crRNA or guide RNA, but not limited to these) complexed with the Cas protein. Such recognition and cleavage of the target sequence by Cas nucleic acid endonucleases typically occurs when the correct protospacer-adjacent motif (PAM) is located at or adjacent to the 3' end of the DNA target sequence. Alternatively, the Cas proteins described herein may not possess DNA cleavage or nicking activity, but can specifically bind to the DNA target sequence when complexed with an appropriate RNA component.
[0140] As used herein, the term “CAR-T cell” usually refers to a T cell that contains and / or expresses a chimeric antigen receptor (CAR) molecule. As used herein, the term “CAR molecule” usually refers to a CAR (e.g., a CAR polypeptide), a nucleic acid encoding a CAR, or both.
[0141] As used herein, the term “YTHDF2” typically refers to YTH N6-methyladenosine RNA-binding protein 2 or its functional fragments, which specifically recognize and bind to N6-methyladenosine (m6A)-containing RNA and regulate mRNA stability. Human and mouse amino acid and nucleic acid sequences can be found in public databases such as GenBank, UniProt, and Swiss-Prot. For example, the amino acid sequence of human YTHDF2 can be found under accession numbers NP_001166299.1, NP_001166599.1, and NP_057342.2, and the encoding mRNA sequence can be found under accession numbers NM_001172828.1, NM_001173128.1, and NM_016258.2.
[0142] As used herein, the term “self-derived” generally refers to any substance that originates from the same organism and is subsequently introduced into that organism.
[0143] As used herein, the term “homogeneous” typically refers to any substance originating from a different animal of the same species as the individual into which it is introduced. Two or more individuals are said to be homogeneous if they differ in one or more gene loci. In some cases, homogeneous substances from individuals of the same species may be genetically distinct enough to interact antigenically.
[0144] The terms “cancer” and “tumor” may be used interchangeably herein and generally refer to diseases characterized by the uncontrolled proliferation of abnormal cells. Both terms include solid tumors and humoral tumors, such as diffuse and circulating tumors. They include not only malignant cancers but also premalignant cancers and tumors.
[0145] As used herein, the phrase “disease, disorder or condition related to the expression of a tumor antigen” typically includes, but is not limited to, diseases or conditions related to the expression of a tumor antigen or cells related to the expression of a tumor antigen, such as, for example, proliferative disorders of cancer or malignant tumors, or precancerous conditions of spinal dysplasia, myelodysplastic syndromes or preleukemia, or non-cancer-related indications related to cells expressing a tumor antigen. In one embodiment, the cancer related to the expression of a tumor antigen as described herein is a hematological cancer. In one embodiment, the cancer related to the expression of a tumor antigen as described herein is a solid tumor. Further diseases related to the expression of a tumor antigen as described herein include, but are not limited to, atypical and / or nonclassical cancers, malignant tumors, precancerous conditions or proliferative disorders related to the expression of a tumor antigen as described herein. Non-cancer-related indications related to the expression of a tumor antigen as described herein include, but are not limited to, autoimmune diseases, inflammatory diseases and transplantation. In some embodiments, tumor antigen-expressing cells express or express mRNA encoding a tumor antigen at any given time. In one embodiment, tumor antigen-expressing cells produce tumor antigen proteins (e.g., wild-type or mutant), and the amount of tumor antigen protein can be normal, increased, or decreased.
[0146] As used herein, the term “immune effector cell” typically refers to cells involved in promoting immune responses, such as immune effector responses. Examples of immune effector cells include T cells such as α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and bone marrow-derived phagocytic cells. As used herein, “immune effector function or immune effector response” typically refers to the function or response of immune effector cells that enhance or promote an immune attack by target cells, for example. For example, immune effector function or response is the property of T cells or NK cells to promote the killing of target cells or to suppress the growth or proliferation of target cells. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector function or response.
[0147] As used herein, the terms "active" and "activation" generally refer to a specific function of a cell. For example, the activation of T cells may be cytolytic activity or helper activity, including cytokine secretion.
[0148] As used herein, the term "encoding" generally refers to the inherent property of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA or mRNA) to be used as a template for the synthesis of other polymers and macromolecules in a biological process, and the above polymers and macromolecules have a defined nucleotide sequence (such as rRNA, tRNA and mRNA) or a specified amino acid sequence, and the biological properties resulting therefrom. Thus, when a protein is produced in a cell or other biological system by transcription and translation of mRNA corresponding to a certain gene, that gene, cDNA or RNA encodes that protein. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence and is usually described in the sequence listing) and the non-coding strand (used as a transcription template for a gene or cDNA) can be referred to as a protein or other product encoding the gene or cDNA.
[0149] As used herein, the phrase "nucleotide sequence encoding an amino acid sequence" generally includes all nucleotide sequences encoding the same amino acid sequence in a degenerate form with respect to each other. The phrase "nucleotide sequence encoding a protein or RNA" may include introns to the extent that the nucleotide sequence encoding a protein may contain introns in some forms.
[0150] As used herein, the term "endogenous" generally refers to any substance introduced from within or produced within an organism, cell, tissue or system.
[0151] As used herein, the term “exogenous” usually refers to any substance introduced from or produced outside of an organism, cell, tissue, or system.
[0152] As used herein, the term “expression” typically refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.
[0153] In the context of this application, the following abbreviations for commonly existing nucleic acid bases are used: "A" for adenosine, "C" for cytosine, "G" for guanosine, "T" for thymidine, and "U" for uridine.
[0154] As used herein, the terms “nucleic acid” or “polynucleotide” typically refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), or combinations thereof, and polymers of these in single-stranded or double-stranded forms. The term “nucleic acid” includes genes, cDNA, or mRNA. In one embodiment, the nucleic acid molecule is synthetic (e.g., chemosynthesized) or recombinant. Unless otherwise specified, the term encompasses nucleic acids including analogs or derivatives of native nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a similar manner to naturally occurring nucleotides. Unless otherwise specified, a particular nucleic acid sequence implicitly includes its conservedly modified variants (e.g., degenerate codon substitutions), alleles, orthologues, SNPs, and complementary sequences, as well as sequences explicitly shown. Specifically, degenerate codon substitution is performed by creating a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or a deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19:5081 (1991), Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985), and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).
[0155] The terms “cancer-associated antigen” and “tumor antigen” are interchangeable herein and typically refer to molecules (usually proteins, carbohydrates, or lipids) that are preferentially expressed on the surface of cancer cells in an intact or fragmented form (e.g., MHC / peptides) compared to normal cells and are useful for preferential targeting of drugs to cancer cells. In some embodiments, tumor antigens are markers expressed by both normal and cancer cells. In some embodiments, cancer-associated antigens are cell surface molecules that are overexpressed on cancer cells compared to normal cells, for example, by 1-fold, 2-fold, 3-fold, or more than 3-fold overexpression compared to normal cells. In some embodiments, cancer-associated antigens are cell surface molecules that are improperly synthesized on cancer cells, such as molecules containing deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, cancer-associated antigens are expressed only on the cell surface of cancer cells in an intact or fragmented form (e.g., MHC / peptides) and are not synthesized or expressed on the surface of normal cells.
[0156] As used herein, the term “specifically binds” typically refers to a molecule (e.g., an antibody or ligand) that recognizes and binds to a homologous ligand protein present in the sample, but does not inherently recognize or bind to other molecules in the sample. In some embodiments, the molecules of this disclosure bind to a target molecule at a rate of approximately 10° -6 Less than M (for example, about 5 × 10) -7 Less than M, approximately 2 x 10 -7 Less than M, approximately 10 -7 Less than M, approximately 5 x 10 -8 Less than M, approximately 2 x 10 -8 Less than M, approximately 10 -8 Less than M, approximately 5 x 10 -9 Less than M, approximately 4 x 10 -9 Less than M, approximately 3 x 10 -9 Less than M, approximately 2 x 10 -9 Less than M or about 10 -9 Binding affinity (K less than M) D It binds specifically to this.
[0157] K D The ratio of the dissociation rate to the binding rate (k) is usually the ratio of the dissociation rate to the binding rate.off / k on ) may refer to and can be determined using any conventional method known in the art, including but not limited to surface plasmon resonance, microscale thermophoresis, HPLC-MS methods and flow cytometry (FACS, etc.). In some embodiments, K D The value can be appropriately determined using flow cytometry.
[0158] As used herein, the term “anticancer agent” typically refers to a drug that can inhibit and / or prevent the growth of tumors or cancer cells.
[0159] As used herein, the term “CTLA-4” typically refers to cytotoxic T lymphocyte-associated protein 4, as well as functional fragments thereof, derived from any vertebrate, including mammals such as primates (e.g., humans, monkeys) and rodents (e.g., mice and rats). Exemplary sequences of human CTLA-4 include the Homo sapiens (human) CTLA-4 protein (NCBI reference sequence AAL07473.1). Exemplary sequences of CTLA-4 include the cynomolgus monkey (monkey) CTLA-4 protein (NCBI reference sequence XP_005574071.1). As used herein, the term “CTLA-4” is generally intended to encompass any form of CTLA-4, e.g., 1) naturally occurring raw CTLA-4 molecules, naturally occurring CTLA-4 variants including “full-length” CTLA-4 chains or splice variants or allele variants, 2) any form of CTLA-4 produced by intracellular processing, or 3) full-length, fragment (e.g., truncated, extracellular / transmembrane domain) or modified (e.g., mutant, glycosylated / polyethylene glycolated, His-tagged / immunofluorescence fusion) CTLA-4 subunits produced by recombinant methods.
[0160] The terms "anti-CTLA-4 antibody," "anti-CTLA-4 binding domain," or "CTLA-4 binding domain" refer to an antibody or antigen-binding domain that can specifically bind to CTLA-4 (e.g., human or monkey CTLA-4).
[0161] As used herein, the term "PD-1" typically refers to a programmed cell death protein belonging to the immunoglobulin superfamily and functioning as a co-inhibitory receptor that negatively regulates the immune system. PD-1 is a member of the CD28 / CTLA-4 family and has two ligands, including PD-L1 and PD-L2. A representative amino acid sequence of human PD-1 is disclosed in NCBI accession number NP_005009.2, and a representative nucleic acid sequence encoding human PD-1 is shown in NCBI accession number NM_005018.2.
[0162] As used herein, the term “PD-L1” typically refers to programmed cell death ligand 1 (PD-L1, see, e.g., Freeman et al., (2000) J. Exp. Med. 192: 1027). A representative amino acid sequence of human PD-L1 is disclosed in NCBI accession number NP_054862.1, and a representative nucleic acid sequence encoding human PD-L1 is shown in NCBI accession number NM_014143.3. PD-L1 binds to receptors PD-1 or B7-1, which are expressed on activated T cells, B cells, and myeloid cells. PD-L1 binding to its receptor induces signaling that suppresses TCR-mediated cytokine production and T cell proliferation. Therefore, PD-L1 is thought to play a crucial role in suppressing the immune system during certain events such as pregnancy, autoimmune diseases, and tissue allogeneic transplantation, enabling tumors and cancer cells to evade immune checkpoints and avoid immune responses.
[0163] As used herein, the terms “anti-PD-1 antibody,” “anti-PD-1 binding domain,” or “PD-1 binding domain” typically refer to an antibody or antigen-binding domain that can specifically bind to PD-1 (e.g., human or monkey PD-1) with an affinity sufficient to provide use for diagnosis and / or therapy.
[0164] As used herein, the term “antitumor immunity” typically refers to the immune response induced when cancer antigens are recognized by immune cells.
[0165] As used herein, the term “cancer immunotherapy” typically refers to any therapy designed to induce or enhance a patient’s immune response to cancer cells. For example, cancer immunotherapy includes, but is not limited to, cancer antigen-specific active immunotherapy, therapy with immunomodulators (e.g., activators or inhibitors of immunomodulators, or inhibitors of checkpoint inhibitors), or therapy with cancer cells or mixtures of cancer cell-derived antigens (therapy with cancer cell line-derived antigens). Cancer immunotherapy includes therapies that stimulate or restore the immune system’s ability to fight cancer by inducing, enhancing, or suppressing the immune response. Cancer immunotherapy targets immune activity against disease-specific antigens by increasing immune cell recognition of targets or by reducing disease-related immunosuppression.
[0166] As used herein, the term “tumor-infiltrating T cells” typically refers to T cells that infiltrate a tumor. Tumor-infiltrating T cells may exhibit spontaneous reactivity to autologous tumor antigens. These cells may be found within the tumor stroma and / or within the tumor itself.
[0167] As used herein, the term “TCR-T cell” typically refers to a T cell that contains or expresses an engineered and / or modified T cell receptor.
[0168] As used herein, the term “IDO inhibitor” typically refers to a drug that inhibits the activity of indoleamine 2,3-dioxygenase (IDO), thereby reversing IDO-mediated immunosuppression. IDO inhibitors can inhibit IDO1 and / or IDO2 (INDOL1). IDO inhibitors can be reversible or irreversible. A “reversible IDO inhibitor” is a compound that reversibly inhibits IDO enzyme activity at either a catalytic or non-catalytic site, while an “irreversible IDO inhibitor” is a compound that irreversibly destroys IDO enzyme activity by forming a covalent bond with the enzyme.
[0169] As used herein, the term “immune checkpoint inhibitor” typically refers to any molecule that directly or indirectly, partially or completely inhibits an immune checkpoint pathway. The function of immune checkpoint pathways is generally thought to be to switch on and off various aspects of the immune system, particularly T cells, as well as other cells such as bone marrow cells, NK cells, and B cells. Following T cell activation, numerous inhibitory receptors can be upregulated and present on the surface of T cells to suppress the immune response at the appropriate time. Examples of immune checkpoint pathways include, but are not limited to, PD-1 / PD-L1, CTLA-4 / B7-1, TIM-3, LAG3, B7-H1, H4, HAVCR2, IDO1, CD276 and VTCN1, B7-H3, B7-H4, CD47 and KIR. For example, non-exclusive examples of immune checkpoint inhibitors or modulators include fully human noclonal antibodies such as BMS-936558 / MDX-1106, BMS-s936559 / MDX-1105, ipilimumab / Yervoy, tremelimumab, BMS-986016, durvalumab, MEDI4736, urelumab, CDX-1127, and avelumab; humanized antibodies such as CT-011, IV1K-3475, Hu5F9-G4, CC-90002, MBG453, TSR-022, and atezolizumab; and fusion proteins such as AMP-224, TTI-621, and others. Other non-exclusive examples of immune checkpoint modulators (agonists) include antibodies against CD40, OX40, GITR, CD137 (4-1 BB), CD27, ICOS, and TRAIL.According to this disclosure, one or more immune checkpoint modulators may independently be polypeptides or nucleic acid molecules encoding polypeptides, wherein the polypeptides include a domain capable of binding to a target immune checkpoint and / or inhibiting ligand binding to the target immune checkpoint, so as to exert antagonistic function (i.e., being able to antagonize immune checkpoint-mediated inhibitory signals) or agonist function (i.e., being able to enhance stimulatory signals via an immune checkpoint). One or more of the above immune checkpoint modulators may be independently selected from peptides (e.g., peptide ligands), soluble domains of innate receptors, RNAi, antisense molecules, antibodies, and protein frameworks. For example, an immune checkpoint modulator may be an antibody. In the context of this disclosure, the term immune checkpoint modulator antibody is used in its broadest sense and includes, for example, natural or artificially engineered full-length antibodies or functional fragments or analogs thereof that can bind to a target immune checkpoint or epitope (and thus retain a target-binding portion). The above antibodies may be from any source, such as, for example, human antibodies, humanized antibodies, animal antibodies (e.g., rodent or camel antibodies), or chimeric antibodies. The antibodies described above may be of any isotype, and are particularly preferably IgG1 or IgG4 isotypes. Furthermore, the antibodies may be glycosylated or unglycosylated. Standard analytical methods known in the art for evaluating the ability of antibodies to bind to immune checkpoints include, for example, ELISA, Western blot, RIA, and flow cytometry. Antibody binding dynamics (e.g., binding affinity) can also be evaluated by standard analytical methods known in the art, such as Biacore analysis. Where referring to immune checkpoint inhibitors in this application, immune checkpoint modulators may also be used unless it is clear from the wording of the context that otherwise.
[0170] As used herein, the term “exhaustion” typically refers to T-cell exhaustion, a state of T-cell dysfunction that occurs during many chronic infections and cancers. T-cell exhaustion is characterized by reduced T-cell effector function, persistent expression of inhibitory receptors, and / or a transcriptional state different from that of functional effector or memory T cells. T-cell exhaustion impairs the optimal control of infections and tumors. T-cell exhaustion can manifest as a gradual and progressive loss of T-cell function. As used herein, “restoring exhaustion” generally means the activity or ability to restore at least some of the weakened or reduced antitumor activity of exhausted T cells. Restoring exhaustion may also include preventing T-cell depletion.
[0171] As used herein, the term "PROTAC" typically refers to a protein hydrolysis target chimera. A PROTAC may be a bifunctional small molecule consisting of at least two active domains capable of removing a specific protein. A PROTAC may function by inducing intracellular protein hydrolysis of a target protein. For example, a PROTAC may comprise two covalent protein-binding molecules, one capable of binding to an E3 ubiquitin ligase and the other capable of binding to a target protein (e.g., YTHDF2) for degradation. The recruitment of the E3 ligase to the target protein (e.g., YTHDF2) is thought to result in ubiquitination, followed by degradation of the target protein by the proteasome.
[0172] As used herein, the term “T cell-mediated immune response” typically refers to an immune response influenced by the modulation of T cell co-stimulation. Exemplary immune responses include T cell responses such as cytokine production and cytotoxicity. Furthermore, T cell-mediated immune responses also include immune responses indirectly influenced by T cell activation, such as antibody production (humoral response) and activation of cytokine-responsive cells (e.g., macrophages).
[0173] As used herein, the terms “chimeric antigen receptor” or “CAR” typically refer to a set of polypeptides that, in their simplest embodiment, generate intracellular signals and give the cell specificity to target cells, typically cancer cells, when present within an immune effector cell. In some embodiments, the CAR comprises at least an extracellular antigen-binding domain, a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as the “intracellular signaling domain”) comprising a functional signaling domain derived from a stimulating and / or co-stimulating molecule as defined below. In some embodiments, the set of polypeptides are adjacent to each other. In some embodiments, the set of polypeptides comprises a dimerization switch. The dimerization switch allows the polypeptides to be linked to each other, for example, by linking the antigen-binding domain to the intracellular signaling domain, if a dimerizing molecule is present. The stimulating molecule is a ζ chain that associates with the T cell receptor complex. The cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one of the co-stimulating molecules as defined below. On the other hand, the co-stimulatory molecule is selected from the co-stimulatory molecules described herein, for example, 4-1BB (i.e., CD137) and / or CD28. On the other hand, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from the stimulatory molecule. On the other hand, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain derived from a co-stimulatory molecule and a functional signaling domain derived from the stimulatory molecule. On the other hand, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising two functional signaling domains derived from one or more co-stimulatory molecules and a functional signaling domain derived from the stimulatory molecule.On the other hand, a CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more costimulatory molecules, as well as a functional signaling domain derived from a stimulatory molecule. On the other hand, a CAR has an optional leader sequence at the amino terminus (N terminus) of the CAR fusion protein. On the other hand, a CAR also includes a leader sequence at the N terminus of the extracellular antigen-binding domain that is optionally cleaved from the antigen-binding domain (e.g., scFv) during cell processing and CAR localization to the cell membrane.
[0174] A CAR as described herein, which includes an antigen-binding domain (e.g., scFv or TCR) that targets a specific tumor marker X, is also called an X CAR. For example, a CAR containing an antigen-binding domain that targets CD20 is called a CD20 CAR or 20 CAR. For example, a CAR containing an antigen-binding domain that targets CLDN18.2 is also called a CLDN18.2 CAR.
[0175] As used herein, the term “signaling domain” typically refers to a functional portion of a protein that acts by transmitting information within a cell through a defined signaling pathway, thereby regulating cellular activity by generating second messengers or by functioning as an effector in response to such messengers.
[0176] As used herein, the term “scFv” typically refers to a fusion protein comprising at least one antibody fragment containing a light chain variable region and at least one antibody fragment containing a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region are contiguous (e.g., via a synthetic linker such as a short, flexible polypeptide linker) and can be expressed as a single-chain polypeptide, and the scFv maintains the specificity of the complete antibody from which it is derived. Unless otherwise specified, when used herein, an scFv may have the VL and VH variable regions in any order (e.g., relative to the N-terminus and C-terminus of the polypeptide). The scFv may comprise a VL-linker-VH or a VH-linker-VL.
[0177] As used herein, the term “binding domain” typically refers to a protein containing at least one immunoglobulin variable domain sequence, such as an immunoglobulin chain or a fragment thereof. The terms “binding domain” or “antibody molecule” encompass antibodies and antibody fragments. In one embodiment, the antibody molecule is a multispecific antibody molecule, such as a bispecific antibody molecule.
[0178] The portion of the CAR in this application that includes an antibody or antibody fragment may exist in various forms in which the antigen-binding domain is expressed as part of a continuous polypeptide chain containing, for example, a single-domain antibody fragment (sdAb), a single-chain antibody (scFv), a humanized antibody, or two-specific antibodies. In one embodiment, the antigen-binding domain of the CAR in this application consists of an antibody fragment. In a further embodiment, the CAR comprises an antibody fragment containing scFv.
[0179] As used herein, the terms “antigen” or “Ag” typically refer to molecules that trigger an immune response. This immune response may involve antibody production, activation of specific immunological cells, or both. It will be understood by those skilled in the art that virtually any macromolecule, including any protein or peptide, can act as an antigen. Furthermore, antigens may originate from recombinant DNA or genomic DNA. Those skilled in the art will understand that any DNA consisting of a nucleotide sequence or partial nucleotide sequence encoding a protein that triggers an immune response therefore encodes the “antigen” as used herein. Furthermore, it will be understood by those skilled in the art that antigens do not need to be encoded only by the full-length nucleotide sequence of a gene. Antigens do not need to be encoded by a “gene.” Antigens may be synthetic, derived from biological samples, or be macromolecules other than polypeptides. Such biological samples include, but are not limited to, tissue samples, tumor samples, cells, or fluids containing other biological components.
[0180] As used herein, the terms “anti-cancer” or “anti-tumor” typically refer to biological effects that can manifest in various forms, including, but not limited to, reduction in tumor size, decrease in the number of cancer cells, decrease in the number of metastases, extension of life expectancy, decrease in cancer cell proliferation, decrease in cancer cell survival, or improvement of various physiological symptoms associated with cancer. Furthermore, “anti-cancer” or “anti-tumor” effects may also be expressed as the ability to prevent the development of cancer.
[0181] As used herein, the term “derived” typically refers to the relationship between a first molecule and a second molecule. It usually refers to the structural similarity between the first and second molecules, and does not imply, or include, any limitations on the processes or sources of the first molecule derived from the second molecule. For example, in the case of an intracellular signaling domain derived from a CD3ζ molecule, the intracellular signaling domain retains a CD3ζ structure sufficient to have the desired function, i.e., the ability to produce a signal under appropriate conditions. This does not imply, or include, any limitations on the specific processes that give rise to the intracellular signaling domain. For example, it does not mean that to provide an intracellular signaling domain, one must start with a CD3ζ sequence and delete or mutate unwanted sequences to reach the intracellular signaling domain.
[0182] As used herein, the term “intracellular signaling domain” typically refers to the intracellular portion of a molecule. Intracellular signaling domains generate signals that promote immune effector functions in CAR-containing cells (e.g., CART cells). For example, in CART cells, examples of immune effector functions include cytolytic activity, including cytokine secretion, and helper activity.
[0183] The intracellular signaling domain may consist of a primary intracellular signaling domain. An exemplary primary intracellular signaling domain may include one derived from a molecule responsible for the primary stimulus or antigen-dependent stimulus. In one embodiment, the intracellular signaling domain includes a co-stimulatory intracellular domain. An exemplary co-stimulatory intracellular signaling domain may include one derived from a molecule responsible for the co-stimulatory signal or antigen-independent stimulus. For example, in the case of CART, the primary intracellular signaling domain may include the cytoplasmic sequence of the T cell receptor, and the co-stimulatory intracellular signaling domain may include the cytoplasmic sequence from the co-receptor or co-stimulatory molecule.
[0184] The primary intracellular signaling domain may contain an immune receptor tyrosine-based activation motif or a signaling motif known as an ITAM. Examples of ITAM-containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3ζ.
[0185] The terms "ζ" or "ζ chain," "CD3-ζ" or "TCR-ζ" are defined as the protein provided as GenBank accession number BAG36664.1, or equivalent residues from non-human species such as mice, rodents, monkeys, and apes. The "ζ-stimulating domain" or "CD3-ζ-stimulating domain" or "TCR-ζ-stimulating domain" are defined as amino acid residues or functional derivatives from the cytoplasmic domain of the ζ chain that are sufficient to functionally transmit the initial signals necessary for T cell activation. The cytoplasmic domain of ζ contains residues 52 to 164 of GenBank accession number BAG36664.1, or equivalent residues from non-human species such as mice, rodents, monkeys, and apes that are functional orthologs of the above residues. The "ζ-stimulating domain" or "CD3-ζ-stimulating domain" is the sequence provided as SEQ ID NO: 8.
[0186] As used herein, the term “costimulatory molecule” typically refers to a congenital binding partner on a T cell that specifically binds to a costimulatory ligand and thus mediates a costimulatory response by T cells (e.g., not limited to proliferation). A costimulatory molecule is a cell surface molecule or ligand of a non-antigen receptor necessary for an effective immune response. Examples of costimulatory molecules include, but are not limited to, CD28 and 4-1BB (CD137). The costimulatory intracellular signaling domain may be the intracellular portion of the costimulatory molecule. Costimulatory molecules can be presented on protein families such as TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activators (SLAM proteins), and activating NK cell receptors. Examples of such molecules include CD28 and 4-1BB (CD137).
[0187] An intracellular signaling domain may consist of the complete intracellular portion of the molecule from which it originates, or a complete native intracellular signaling domain or a functional fragment or derivative thereof.
[0188] As used herein, the term "4-1BB" typically refers to the amino acid sequence provided as GenBank accession number AAA62478.2, or a TNFR superfamily member having equivalent residues from non-human species such as mice, rodents, monkeys, and apes. The "4-1BB costimulatory domain" is defined as amino acid residues 214 to 255 of GenBank accession number AAA62478.2, or equivalent residues from non-human species such as mice, rodents, monkeys, and apes. On the other hand, the "4-1BB costimulatory domain" is the sequence provided as SEQ ID NO: 7, or equivalent residues from non-human species such as mice, rodents, monkeys, and apes.
[0189] As used herein, the terms “immune effector function” or “immune effector response” typically refer to the function or response of immune effector cells that enhance or promote an immune attack by target cells. For example, immune effector function or response refers to the properties of T cells or NK cells that promote the killing of target cells or inhibit the growth or proliferation of target cells. In the case of T cells, primary stimulation and co-stimulation are examples of immune effector function or response.
[0190] Unless otherwise specified, "nucleotide sequences encoding an amino acid sequence" include nucleotide sequences that encode the same amino acid sequence in a condensed polymerized state. The expression "nucleotide sequences encoding a protein or RNA" may contain introns to the extent that nucleotide sequences encoding proteins may contain introns in some form.
[0191] As used herein, the terms “effective dose” or “therapeutic dose” usually mean the amount of a compound, formulation, material, or composition described herein that is effective in obtaining a particular biological outcome.
[0192] As used herein, the term “expression” typically refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.
[0193] As used herein, the terms “homologous” or “identical” typically refer to subunit sequence identity between two polymer molecules (e.g., between two nucleic acid molecules (e.g., two DNA molecules or two RNA molecules) or between two polypeptide molecules). If the subunit positions in both molecules are occupied by identical monomer subunits, for example, if one position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position. The homology between two sequences varies directly by the number of identical or homologous positions; for example, if half the positions of the two sequences are homologous (e.g., five positions in a polymer of subunits of length 10), then the two sequences are 50% homologous, and if 90% of the positions (e.g., nine out of 10) are identical or homologous, then the two sequences are 90% homologous.
[0194] As used herein, the terms “cancer-associated antigen” or “tumor antigen” typically refer to molecules (typically proteins, carbohydrates, or lipids) that are expressed on the surface of cancer cells, either as a whole or as fragments (e.g., MHC / peptides), and are useful for preferential targeting of pharmacological agents to cancer cells. In some embodiments, tumor antigens are markers expressed by both normal and cancer cells, such as cell lineage markers like CD19 on B cells. In some embodiments, tumor antigens are cell surface molecules that are 1-fold, 2-fold, 3-fold, or more than 3-fold overexpressed in cancer cells compared to normal cells. In some embodiments, tumor antigens are cell surface molecules improperly synthesized in cancer cells, such as molecules containing deletions, additions, or mutations compared to molecules expressed in normal cells. In some embodiments, tumor antigens are expressed only on the surface of cancer cells, either as a whole or as fragments (e.g., MHC / peptides), and are neither synthesized nor expressed on the surface of normal cells.
[0195] As used herein, the term “substantially purified” cells generally refers to cells that substantially contain no other cell types. Furthermore, substantially purified cells mean cells isolated from other cell types that would normally be associated with them in their natural state. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term simply refers to cells isolated from cells naturally associated with them in their natural state. In some embodiments, cells are cultured in vitro. In other embodiments, cells are not cultured in vitro.
[0196] As used herein, the term “gene editing system” typically refers to a system in which, for example, one or more molecules direct and act upon one or more nucleic acid modifications, such as deletions, at or near genomic DNA sites targeted by the system. Gene editing systems are known in the art.
[0197] As used herein, the term “dominant inhibitory” typically refers to a gene product or protein that interferes with the function of another gene product or protein. The other gene product affected may be the same as or different from the dominant inhibitory protein. Dominant inhibitory gene products can exist in various forms, including truncated, full-length proteins or fragments thereof with point mutations, or fusions of full-length wild-type or mutant proteins or fragments thereof with other proteins. The level of inhibition observed may be very low. For example, a large amount of the dominant inhibitory protein may be required compared to the functional protein involved in a certain process to confirm its effect. Under normal biological analysis conditions, it may be difficult to confirm its effect. In one embodiment, the dominant inhibitory YTHDF2 is m 6 It cannot bind to, recognize, and / or modify A RNA.
[0198] immune cells The immune cells of the present application can be immune effector cells. For example, the immune cells can be lymphocyte cells such as T cells. In some cases, the immune cells can be CD4 + cells. In some cases, the immune cells can be CD8 + cells. In some cases, the immune cells can express or contain tumor-specific receptors such as tumor-specific chimeric antigen receptors and / or tumor-specific T cell receptors. In some cases, the immune cells can be tumor infiltrating lymphocyte cells (e.g., tumor infiltrating T cells). In some cases, the immune cells can be lymphocyte cells (e.g., T cells) obtained from a subject (such as a cancer patient). In some cases, the immune cells may be isolated from tumor tissue.
[0199] The immune cells can be cells (e.g., a cell population such as an immune effector cell population) engineered to express a chimeric antigen receptor (CAR). In some cases, the immune cells can be CAR-T cells. In some cases, the immune cells can be cells (e.g., a cell population such as an immune effector cell population) engineered to express a T cell receptor (such as a tumor-specific T cell receptor). In some cases, the immune cells can be TCR-T cells.
[0200] The unmodified immune cells can be TCF1 - . In some cases, the unmodified immune cells can be Tim3 + . In some cases, the unmodified immune cells can be PD-1 + . In some cases, the unmodified immune cells can be TCF1 - Tim3 + . In some cases, the unmodified immune cells can be TCF1 - PD-1 + . In some cases, the unmodified immune cells can be Tim3 + PD-1 + . In some cases, the unmodified immune cells can be TCF1 - PD-1 + Tim3 + .
[0201] In some cases, the proportion of TCF1 - cells in the immune cell population before modification may be higher than the proportion of TCF1 + cells (e.g., at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0202] In some cases, the proportion of Tim3 + cells in the immune cell population before modification may be higher than the proportion of Tim3 - cells (e.g., at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0203] In some cases, the proportion of PD-1 + cells in the immune cell population before modification may be higher than the proportion of PD-1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0204] In some cases, TCF1 in the immune cell population before modification - Tim3 + The percentage of cells is TCF1 + Tim3 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0205] In some cases, TCF1 in the immune cell population before modification - PD-1 + The percentage of cells is TCF1 + PD-1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0206] In some cases, Tim3 in the immune cell population before modification + PD-1 + The proportion of cells is Tim3 - PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0207] In some cases, TCF1 in the immune cell population before modification - PD-1 + Tim3 + The percentage of cells is TCF1 + PD-1 - Tim3 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0208] After modification, the modified immune cells are PD-1 + or PD-1 - It is possible. In some cases, modified immune cells may have TCF1 + and / or TCF7 + It is possible. In some cases, modified immune cells may have Tim3 - It is possible. In some cases, modified immune cells may have TCF1 + Tim3 - It is possible. In some cases, modified immune cells may be TCF7 + Tim3 - It is possible. In some cases, modified immune cells may have PD-1 + Tim3 - It is possible. In some cases, modified immune cells may have PD-1 - Tim3 - It is possible. In some cases, modified immune cells may have Tim3 - TCF7 + TCF1 + It is possible. In some cases, modified immune cells may have Tim3 - TCF1 + PD-1 + It is possible. In some cases, modified immune cells may have Tim3 - TCF1 + PD-1 -It is possible. In some cases, modified immune cells may have Tim3 - TCF7 + PD-1 + It is possible. In some cases, modified immune cells may have Tim3 - TCF7 + PD-1 - It is possible. In some cases, modified immune cells may have Tim3 - TCF7 + TCF1 + PD-1 + It is possible. In some cases, modified immune cells may have Tim3 - TCF7 + TCF1 + PD-1 - It is possible. In some cases, modified immune cells may be TCF7 + TCF1 + It is possible. In some cases, modified immune cells may be TCF7 + PD-1 + It is possible. In some cases, modified immune cells may be TCF7 + PD-1 - It is possible. In some cases, modified immune cells may be TCF7 + TCF1 + PD-1 - It is possible. In some cases, modified immune cells may be TCF7 + TCF1 + PD-1 + It is possible. In some cases, modified immune cells may have TCF1 + PD-1 - It is possible. In some cases, modified immune cells may have TCF1 + PD-1 + It is possible.
[0209] In some cases, after modification, TCF1 in the immune cell population + The percentage of cells is TCF1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0210] In some cases, after modification, TCF7 in the immune cell population + The percentage of cells is TCF7 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0211] In some cases, after modification, PD-1 in the immune cell population + The proportion of cells is PD-1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0212] In some cases, after modification, PD-1 in the immune cell population - The proportion of cells is PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0213] In some cases, after modification, Tim3 in the immune cell population - The proportion of cells is Tim3 +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0214] In some cases, after modification, TCF1 in the immune cell population + Tim3 - The percentage of cells is TCF1 - Tim3 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0215] In some cases, after modification, TCF7 in the immune cell population + Tim3 - The percentage of cells is TCF7 - Tim3 +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0216] In some cases, after modification, PD-1 in the immune cell population + Tim3 - The proportion of cells is PD-1 - Tim3 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0217] In some cases, after modification, PD-1 in the immune cell population - Tim3 - The proportion of cells is PD-1 + Tim3 +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0218] In some cases, after modification, Tim3 in the immune cell population - TCF7 + TCF1 + The proportion of cells is Tim3 + TCF7 - TCF1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0219] In some cases, after modification, Tim3 in the immune cell population - TCF1 + PD-1 + The proportion of cells is Tim3 +TCF1 - PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0220] In some cases, after modification, Tim3 in the immune cell population - TCF1 + PD-1 - The proportion of cells is Tim3 + TCF1 - PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0221] In some cases, after modification, Tim3 in the immune cell population - TCF7 + PD-1+ The proportion of cells is Tim3 + TCF7 - PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0222] In some cases, after modification, Tim3 in the immune cell population - TCF7 + PD-1 - The proportion of cells is Tim3 + TCF7 - PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0223] In some cases, after modification, Tim3 in the immune cell population- TCF7 + TCF1 + PD-1 + The proportion of cells is Tim3 + TCF7 - TCF1 - PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0224] In some cases, after modification, Tim3 in the immune cell population - TCF7 + TCF1 + PD-1 - The proportion of cells is Tim3 + TCF7 - TCF1 - PD-1 +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0225] In some cases, after modification, TCF7 in the immune cell population + TCF1 + The percentage of cells is TCF7 - TCF1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0226] In some cases, after modification, TCF7 in the immune cell population + PD-1 + The percentage of cells is TCF7 - PD-1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0227] In some cases, after modification, TCF7 in the immune cell population + PD-1 - The percentage of cells is TCF7 - PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0228] In some cases, after modification, TCF7 in the immune cell population + TCF1 + PD-1 - The percentage of cells is TCF7 - TCF1 - PD-1 +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0229] In some cases, after modification, TCF7 in the immune cell population + TCF1 + PD-1 + The percentage of cells is TCF7 - TCF1 - PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0230] In some cases, after modification, TCF1 in the immune cell population + PD-1 - The percentage of cells is TCF1 - PD-1 +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0231] In some cases, after modification, TCF1 in the immune cell population + PD-1 + The percentage of cells is TCF1 - PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0232] In some cases, after modification, TCF1 in the immune cell population + The proportion of cells is TCF1 in the corresponding immune cell population before the above modification. +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0233] In some cases, after modification, TCF7 in the immune cell population + The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0234] In some cases, after modification, PD-1 in the immune cell population + The proportion of cells is PD-1 in the corresponding immune cell population before the above modification. +It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0235] In some cases, after modification, PD-1 in the immune cell population - The proportion of cells is PD-1 in the corresponding immune cell population before the above modification. - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0236] In some cases, after modification, Tim3 in the immune cell population - The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0237] In some cases, after modification, TCF1 in the immune cell population + Tim3 - The proportion of cells is TCF1 in the corresponding immune cell population before the above modification. + Tim3 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0238] In some cases, after modification, TCF7 in the immune cell population + Tim3 - The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + Tim3- It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0239] In some cases, after modification, PD-1 in the immune cell population + Tim3 - The proportion of cells is PD-1 in the corresponding immune cell population before the above modification. + Tim3 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0240] In some cases, after modification, PD-1 in the immune cell population - Tim3 - The proportion of cells is PD-1 in the corresponding immune cell population before the above modification.- Tim3 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0241] In some cases, after modification, Tim3 in the immune cell population - TCF7 + TCF1 + The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF7 + TCF1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0242] In some cases, after modification, Tim3 in the immune cell population - TCF1+ PD-1 + The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF1 + PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0243] In some cases, after modification, Tim3 in the immune cell population - TCF1 + PD-1 - The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF1 + PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0244] In some cases, after modification, Tim3 in the immune cell population - TCF7 + PD-1 + The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF7 + PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0245] In some cases, after modification, Tim3 in the immune cell population - TCF7 + PD-1 - The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF7 + PD-1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0246] In some cases, after modification, Tim3 in the immune cell population - TCF7 + TCF1 + PD-1 + The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF7 + TCF1 + PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0247] In some cases, after modification, Tim3 in the immune cell population -TCF7 + TCF1 + PD-1 - The proportion of cells is Tim3 in the corresponding immune cell population before the above modification. - TCF7 + TCF1 + PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0248] In some cases, after modification, TCF7 in the immune cell population + TCF1 + The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + TCF1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0249] In some cases, after modification, TCF7 in the immune cell population + PD-1 + The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0250] In some cases, after modification, TCF7 in the immune cell population + PD-1 - The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + PD-1 -It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0251] In some cases, after modification, TCF7 in the immune cell population + TCF1 + PD-1 - The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + TCF1 + PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0252] In some cases, after modification, TCF7 in the immune cell population + TCF1 + PD-1 +The proportion of cells is TCF7 in the corresponding immune cell population before the above modifications. + TCF1 + PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0253] In some cases, after modification, TCF1 in the immune cell population + PD-1 - The proportion of cells is TCF1 in the corresponding immune cell population before the above modification. + PD-1 - It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0254] In some cases, after modification, TCF1 in the immune cell population+ PD-1 + The proportion of cells is TCF1 in the corresponding immune cell population before the above modification. + PD-1 + It may be higher than the percentage of cells (for example, at least about 1% higher, at least about 2% higher, at least about 3% higher, at least about 4% higher, at least about 5% higher, at least about 8% higher, at least about 10% higher, at least about 15% higher, at least about 16% higher, at least about 17% higher, at least about 18% higher, at least about 19% higher, at least about 20% higher, at least about 25% higher, at least about 30% higher, at least about 35% higher, at least about 40% higher, at least about 45% higher, at least about 50% higher, at least 60% higher, at least 70% higher, at least 80% higher, at least 90% higher, at least 100% higher, at least 1.5 times higher, at least 2 times higher, at least 2.5 times higher, at least 3 times or more higher).
[0255] Immune cells may be modified with agents capable of attenuating the expression and / or activity of YTHDF2. For example, in a population of immune cells, one or more cells may be modified with agents capable of attenuating the expression and / or activity of YTHDF2. In some embodiments, the immune cells of the present invention (e.g., manipulated or modified immune effector cells such as T cells) may contain agents capable of attenuating the expression and / or activity of YTHDF2.
[0256] A drug capable of attenuating the expression and / or activity of YTHDF2 can be introduced into immune cells, and activation and / or expression in the immune cells (depending on the conditions) can be induced. In some cases, a drug capable of attenuating the expression and / or activity of YTHDF2 can be exposed to immune cells for a sufficient time to attenuate the expression and / or activity of YTHDF2. For example, the drug can be administered into the culture medium used for culturing immune cells.
[0257] Immune cells may be modified to result in complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2. For example, in a population of immune cells, one or more cells may be modified to result in complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2. Such modifications may include homologous recombination that alters the Ythdf2 gene, such as functionally disrupting it, by using a nucleic acid molecule (e.g., a vector into which deletion, addition, or substitution is introduced) containing at least a portion of the Ythdf2 gene. The Ythdf2 gene may be a human gene or a non-human homolog of the human Ythdf2 gene. For example, the mouse Ythdf2 gene is used to construct homologous recombination vectors suitable for altering the endogenous Ythdf2 gene in the mouse genome. In some embodiments, the vector may be designed so that the endogenous Ythdf2 gene is functionally disrupted after homologous recombination (i.e., does not encode a functional protein and is also called a “knockout” vector). Alternatively, the vector may be designed so that the endogenous Ythdf2 gene encodes a functional protein even if it is mutated or modified after homologous recombination (for example, it is possible to alter the expression of the endogenous Ythdf2 protein by modifying an upstream regulatory region). In a homologous recombination vector, the modified portion of the Ythdf2 gene may be facultative to additional nucleic acids of the Ythdf2 gene at its 5' and 3' ends to enable homologous recombination between the exogenous Ythdf2 gene carried by the vector and the endogenous Ythdf2 gene in a cell (such as an immune cell). The additional facultative Ythdf2 nucleic acids may be long enough to successfully perform homologous recombination with the endogenous gene. Typically, the vector may contain several thousand base pairs of facultative DNA (both at the 5' and 3' ends). The vector can be introduced into immune cells (for example, by electroporation), and cells in which the introduced Ythdf2 gene homologously recombinates with the endogenous Ythdf2 gene can be selected.
[0258] In some cases, the modification is not applied directly to the immune cells (e.g., immune effector cells such as T cells), but rather the immune cells may originate from the aforementioned cells (such as progenitor cells of immune cells) or organisms that have undergone modifications resulting in a complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2 in the cell or organism (e.g., differentiated from, for example, as offspring of immune cells).
[0259] Such modified cells (e.g., immune cells or their progenitor cells) or organisms (e.g., transgenic non-human animals) may contain selected systems that enable controlled gene expression and / or controlled deletion. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. For a description of the cre / loxP recombinase system, see, for example, Lakso et al., (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a recombinase system is the FLP recombinase system of budding yeast (Saccharomyces cerevisiae) (O'Gorman et al., (1991) Science 251:1351-1355).
[0260] In some cases, immune cells (e.g., manipulated or modified immune effector cells such as T cells) may contain nucleic acid molecules encoding CARs or TCRs. For example, the nucleic acid molecule may be introduced directly into immune cells. In some cases, the nucleic acid molecule may be introduced into immune cells via a vector (e.g., liposomes or viral vectors). Nucleic acid molecules may be able to express CARs or TCRs in mammalian immune effector cells (e.g., T cells).
[0261] Immune cells can be human cells, such as human T cells.
[0262] In some cases, the source of cells, such as immune cells (e.g., T cells) or their progenitor cells, may be obtained from a subject before amplification, genetic modification, or other modification. “Subject” as used herein is intended to include living organisms (e.g., mammals) capable of eliciting an immune response. Examples of subjects include humans, monkeys, chimpanzees, dogs, cats, mice, rats, and their transgenic species. Immune cells or their progenitor cells can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, tissue from infection sites, ascites, pleural fluid, splenic tissue, and / or tumors.
[0263] Chimeric antigen receptor (CAR) The immune cells of this application may include and / or express a CAR and / or a nucleic acid molecule encoding a CAR. The CAR may include an antigen-binding domain (e.g., an antibody or antibody fragment, a TCR or TCR fragment) that specifically binds to a cancer-associated antigen as described herein, and whose sequence is adjacent to and in the same open reading frame as a nucleic acid sequence encoding an intracellular signaling domain. The intracellular signaling domain may include a co-stimulatory signaling domain and / or a primary signaling domain, e.g., a ζ chain. The co-stimulatory signaling domain refers to a portion of the CAR that includes at least a portion of the intracellular domain of a co-stimulatory molecule.
[0264] For example, the CAR used in this application may include an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. The antigen-binding domain can bind to a tumor antigen (e.g., CD20 or CLDN18.2). As an example, the antigen-binding domain may include or be an antibody or antibody fragment derived from rituximab.
[0265] The transmembrane domain of the CAR may (i) have at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 10, but with 20, 10, or 5 or fewer modifications, or have 95-100% (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) identity to the amino acid sequence of SEQ ID NO: 10, or (ii) have the sequence of SEQ ID NO: 10.
[0266] The antigen-binding domain of the CAR can be linked to the transmembrane domain by a hinge region. The aforementioned hinge region may have a sequence with SEQ ID NO: 9 or a sequence having 95-100% identity with it (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more).
[0267] The intracellular signaling domain of CAR may include a primary signaling domain and / or a co-stimulatory signaling domain. The primary signaling domain may include a functional signaling domain of CD3ζ. In some cases, the primary signaling domain of CAR may have (i) an amino acid sequence having at least one, two, or three modifications of the amino acid sequence of SEQ ID NO: 8, but with 20, 10, or fewer modifications, or a sequence having 95-100% (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) identity to the amino acid sequence of SEQ ID NO: 8, or (ii) the amino acid sequence of SEQ ID NO: 8.
[0268] The intracellular signaling domain of CAR may include a co-stimulatory signaling domain, or a primary signaling domain and a co-stimulatory signaling domain. The co-stimulatory signaling domain may include a functional signaling domain (CD137) at 4-1BB. In some cases, the co-stimulatory signaling domain of CAR may have an amino acid sequence with at least one, two, or three modifications to the amino acid sequence of SEQ ID NO: 7, but with 20, 10, or fewer modifications, or a sequence that is 95-100% (e.g., 95-96%, 95-97%, 95-98%, 95-99%, 95-99.5%, or more) identical to the amino acid sequence of SEQ ID NO: 7.
[0269] In some cases, the intracellular domain of CAR has sequences with SEQ ID NO: 7 and SEQ ID NO: 8, where the sequences constituting the intracellular signaling domain are expressed in the same open reading frame and can be expressed as a single polypeptide chain.
[0270] For example, the CAR of the present application may include an scFv domain. The scFv may be immediately followed by an arbitrary hinge sequence, such as the one provided by SEQ ID NO: 9, a transmembrane region, such as the one provided by SEQ ID NO: 10, an intracellular signaling domain, such as the one provided by SEQ ID NO: 7, and a CD3ζ sequence having, for example, SEQ ID NO: 8, where the above domains are adjacent to each other, reside in the same open reading frame, and can form a single fusion protein.
[0271] Exemplary CAR constructs may include any leader sequence, an extracellular antigen-binding domain (e.g., the antigen-binding domain described herein), a hinge (e.g., the hinge region described herein), a transmembrane domain (e.g., the transmembrane domain described herein), and an intracellular stimulating domain (e.g., the intracellular stimulating domain described herein).
[0272] Another exemplary CAR construct may include any leader sequence (e.g., the leader sequence described herein), an extracellular antigen-binding domain (e.g., the antigen-binding domain described herein), a hinge (e.g., the hinge region described herein), a transmembrane domain (e.g., the transmembrane domain described herein), an intracellular costimulatory signaling domain (e.g., the costimulatory signaling domain described herein), and / or an intracellular primary signaling domain (e.g., the primary signaling domain described herein).
[0273] An exemplary hinge / spacer sequence is provided as SEQ ID NO: 9. An exemplary transmembrane domain sequence is provided as SEQ ID NO: 10. An exemplary intracellular signaling domain sequence of the 4-IBB protein is provided as SEQ ID NO: 7. An exemplary CD3ζ domain sequence is provided as SEQ ID NO: 8.
[0274] antigen-binding domain The CAR of this application may include a target-specific binding element, also called an antigen-binding domain. The selection of this element depends on the type and number of ligands that define the surface of the target cell. For example, the antigen-binding domain may be selected to recognize ligands that act as cell surface markers on target cells associated with a particular disease state. Examples of cell surface markers that can function as ligands for the antigen-binding domain in the CAR of this application include those associated with viruses, bacterial and parasitic infections, autoimmune diseases, and cancer cells.
[0275] For example, CAR-mediated T cell responses can be directed to a target antigen by manipulating the antigen-binding domain of the CAR, which specifically binds to the desired antigen.
[0276] For example, the portion of the CAR containing the antigen-binding domain may include an antigen-binding domain that targets a tumor antigen (e.g., the tumor antigen described herein).
[0277] The antigen-binding domain may be any domain that binds to an antigen, including but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies and their functional fragments, and may include but not limited to single-domain antibodies such as heavy-chain variable domains (VH), light-chain variable domains (VL), and variable domains (VHH), such as nanobodies derived from camelids, and alternative frameworks known in the art that function as antigen-binding domains, such as recombinant fibronectin domains, T cell receptors (TCRs) or fragments thereof, such as single-chain TCRs. In some cases, it is advantageous that the antigen-binding domain originates from the same species in which the CAR is ultimately used. For example, for use in humans, it may be advantageous that the antigen-binding domain of the CAR contains human or humanized residues of the antigen-binding domain of the antibody or antibody fragment.
[0278] For example, a 20 CAR is a CD20 CAR that contains an antigen-binding domain that specifically binds to CD20. In some cases, the antigen-binding domain for CD20 is either the antigen-binding portion of an antibody such as CDR, rituximab, ofatumumab, ocrelizumab, veltuzumab, or GA101, or contains one of these.
[0279] The antigen-binding domain may contain one, two, or three (e.g., all three) heavy chain CDRs (HC CDR1, HC CDR2, and HC CDR3) of the antibodies listed above and / or one, two, or three (e.g., all three) light chain CDRs (LC CDR1, LC CDR2, and LC CDR3) of the antibodies listed above.
[0280] In some cases, the antigen-binding domain may include the heavy chain variable region and / or light chain variable region of the antibody mentioned above.
[0281] In some cases, the antigen-binding domain may contain a humanized antibody or antibody fragment.
[0282] In some cases, non-human antibodies may be humanized, where specific sequences or regions of the antibody may be modified to increase their similarity to antibodies or fragments naturally produced in humans. For example, the antigen-binding domain may be humanized.
[0283] The antigen-binding domain of the CAR can specifically bind to the tumor antigens described herein.
[0284] The antigen-binding domain of a CAR may include an scFv consisting of a linker having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 or more amino acid residues between its VL and VH regions. The above linker sequence may contain any naturally occurring amino acids. For example, the linker sequence may contain the amino acids glycine and serine. As another example, the linker sequence may be (Gly4Ser) n It may contain a set of multiple repeating sequences of glycine and serine, where n is a positive integer greater than or equal to 1. For example, n could be 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.
[0285] In some cases, the antigen-binding domain may be a T cell receptor (TCR) or a fragment thereof, such as a single-stranded TCR (scTCR). For example, an scTCR can be engineered to contain vα and vβ genes from a T cell clone linked by a linker (e.g., a flexible peptide).
[0286] Sometimes, the proteins of this application may be produced, for example, by using a separate promoter or a bicistronic transcript (which allows for the production of two proteins by cleaving a single translation product or by translating two different protein products). For example, the CAR and YTHDF2 attenuators of this application (e.g., a dominant inhibitory YTHDF2 protein) may be produced as bicistronic transcripts. For example, a sequence encoding a cleavable peptide, such as a P2A or F2 sequence, may be located between the first and second proteins. Examples of peptide cleavage sites include any GSG residue and include T2A (SEQ ID NO: 19), P2A (SEQ ID NO: 16), E2A (SEQ ID NO: 20), and / or F2A (SEQ ID NO: 21).
[0287] Attenuation of YTHDF2 expression and / or activity This application provides several methods for reducing the expression and / or activity of YTHDF2.
[0288] For example, the present application may use agents capable of reducing the expression and / or activity of YTHDF2. This may include agents capable of reducing the expression of the gene encoding YTHDF2. This may include agents capable of reducing the activity of the gene encoding YTHDF2. This may include agents capable of reducing the expression of the YTHDF2 protein. This may include agents capable of reducing the activity of the YTHDF2 protein.
[0289] In some cases, YTHDF2 attenuators may also attenuate the expression and / or activity of targets other than YTHDF2. In other cases, YTHDF2 attenuators may enhance or increase the activity and / or expression of targets other than YTHDF2.
[0290] Such attenuators can be polymers. Polymers can be naturally occurring or chemically synthesized organic or inorganic molecules ranging from about 1,000 daltons or more to about 1, 2, 3, 5, 7, 10 or 10 trillion daltons or more. Polymers may comprise two or more monomeric subunits or derivatives thereof linked by covalent bonds, ionic bonds, or other chemical interactions such as hydrogen bonds, ion pairings, base pairings, or charge pairings formed by charge polarization. Monomeric subunits may be different from or identical to each other and, in some embodiments, can form polymers. Polymers may be molecules capable of forming tertiary and / or quaternary structures, whether or not they have one or more subunits and / or are polymers. Examples of polymers include polynucleotides, nucleic acid molecules (including DNA, RNA, siRNA, snRNA, tRNA, antisense RNA, and ribozymes), peptide nucleic acids (PNA), polypeptides, glycopeptides, proteins, carbohydrates, or lipids or their derivatives or combinations, for example, nucleic acid molecules containing a peptide nucleic acid moiety or glycoprotein, respectively. Examples of macromolecules include viruses, viral particles, phages, viroids, prions, and macromolecular aggregates such as combinations and conjugates thereof.
[0291] Such weakening agents may be small molecules. Small molecules may be naturally occurring or chemically synthesized organic or inorganic molecules with a dalton content of less than about 1000 daltons, and between about 1000 daltons and about 950, 900, 850, 800, 750, 700, 650, 600, 550, 500, 450, 400, 375, 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, 5 or less. Small molecules may be any molecule that is not macromolecule, such as proteins or nucleic acids. "Small molecules" may include molecules having two or more monomeric subunits, such as dipeptides or dinucleotides. For example, YTHDF2 inhibitors can inhibit the N6-methyladenosine (m6A) binding domain of YTH domain-containing family proteins. For instance, YTHDF2 inhibitors can inhibit ICs of less than 10,000 nM, less than 1,000 nM, less than 100 nM, less than 10 nM, and less than 1 nM. 50 Therefore, it is possible to inhibit the interaction between YTHDF2 and m6A. For example, YTHDF2 inhibitors with Kd values of 10,000 nM or less, 1,000 nM or less, 100 nM or less, 10 nM or less, and 1 nM or less may show high binding activity to the YTH domain.
[0292] Such attenuators may contain or may contain polypeptides. In some cases, such attenuators may contain or may contain nucleic acid molecules. For example, such attenuators may contain antibodies or derivatives thereof, antibody-drug conjugates, fusion proteins and / or antisense molecules.
[0293] In some cases, agents capable of attenuating YTHDF2 expression and / or activity include one or more of ubiquitin, protacs, dsRNA, siRNA, shRNA, aptamers, and gRNAs. These agents (e.g., nucleic acid molecules or proteins) may be naturally occurring or modified. For example, RNA or DNA may be modified to be nuclease-resistant.
[0294] In some cases, drugs capable of attenuating YTHDF2 expression and / or activity may include mutants or variants of the YTHDF2 protein capable of attenuating the activity of endogenous YTHDF2. In some cases, drugs capable of attenuating YTHDF2 expression and / or activity may include nucleic acid molecules encoding mutants or variants of the YTHDF2 protein.
[0295] For example, drugs capable of attenuating the expression and / or activity of YTHDF2 may include dominant inhibitory YTHDF2, or nucleic acid molecules encoding that dominant inhibitory YTHDF2. Dominant inhibitory YTHDF2 may be a mutant or variant YTHDF2 protein, or a gene encoding that mutant or variant protein, which substantially prevents the corresponding YTHDF2 protein with wild-type function from performing its wild-type function. The wild-type function described above is m 6 This may include activity that recognizes, binds to, and / or modifies A RNA.
[0296] Dominant inhibitory gene products can exist in various forms, including full-length proteins or fragments thereof with shortenings, point mutations, or fusions of full-length wild-type or mutant proteins or fragments thereof with other proteins. The observed level of inhibition may be very low. For example, large amounts of the dominant inhibitory protein may be required compared to the functional protein involved in a certain process to confirm its effect. Under normal biological analysis conditions, it may be difficult to confirm its effect. In one embodiment, the dominant inhibitory YTHDF2 is m 6 A RNA may not be able to bind to, recognize, and / or modify it.
[0297] In some cases, the expression and / or activity of YTHDF2 can be reduced by genetic engineering. For example, immune cells may have undergone modifications that result in complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2.
[0298] For example, in a population of immune cells, one or more cells have undergone modifications that result in complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2.
[0299] For example, such modifications may include homologous recombination that alters (e.g., functionally disrupts) the Ythdf2 gene using a nucleic acid molecule (e.g., a vector) containing at least a portion of the Ythdf2 gene into which deletions, additions, or substitutions have been introduced. The Ythdf2 gene may be a human gene or a non-human homolog of the human Ythdf2 gene. For example, the mouse Ythdf2 gene is used to construct homologous recombination vectors suitable for altering the endogenous Ythdf2 gene in the mouse genome, respectively. In some embodiments, the vector may be designed so that the endogenous Ythdf2 gene is functionally disrupted after homologous recombination (i.e., it no longer codes for a functional protein and is also called a “knockout” vector). Alternatively, the vector may be designed so that the endogenous Ythdf2 gene codes for a functional protein even after being modified by post-recombination mutation or other means (e.g., it is possible to alter the expression of the endogenous Ythdf2 protein by modifying an upstream regulatory region). In homologous recombination vectors, the modified portion of the Ythdf2 gene may be flanked at its 5' and 3' ends by additional nucleic acids of the Ythdf2 gene to enable homologous recombination between the exogenous Ythdf2 gene carried by the vector and the endogenous Ythdf2 gene of the cell (e.g., immune cells). The additional flanked Ythdf2 nucleic acids may be long enough to successfully perform homologous recombination with the endogenous gene. Typically, the vector may contain several thousand base pairs of flanked DNA (at both the 5' and 3' ends). The vector can be introduced into immune cells (e.g., by electroporation), and cells in which the introduced Ythdf2 gene has homologously recombined with the endogenous Ythdf2 gene can be selected.
[0300] In some cases, the modification is not applied directly to the immune cells (e.g., immune effector cells such as T cells), but rather the immune cells may originate from the aforementioned cells (e.g., progenitor cells of immune cells) or organisms that have undergone modifications resulting in a complete or partial deletion, complete or partial substitution, and / or reduced expression of the gene expressing YTHDF2 in the cell or organism (e.g., differentiated from, for example, as offspring of immune cells).
[0301] Such modified cells (e.g., immune cells or their progenitor cells) or organisms (e.g., transgenic non-human animals) may contain selected systems that enable controlled gene expression and / or controlled deletion. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. For a description of the cre / loxP recombinase system, see, for example, Lakso et al., (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a recombinase system is the FLP recombinase system of budding yeast (O'Gorman et al., (1991) Science 251:1351-1355).
[0302] In some cases, agents capable of reducing the expression and / or activity of YTHDF2 include, or may include, (1) a gene editing system that targets one or more sites within the gene encoding YTHDF2 or its regulatory elements (e.g., Ythdf2 or its regulatory elements), (2) nucleic acids encoding one or more components of the gene editing system described above, or (3) a combination thereof.
[0303] For example, the gene editing system may be selected from the CRISPR / Cas9 system, zinc finger nuclease system, TALEN system, and meganuclease system.
[0304] The CRISPR / Cas system can be used for gene editing (silencing, enhancing, or altering specific genes) in eukaryotes (such as mice or primates). This is achieved, for example, by introducing a plasmid containing a specially designed CRISPR and one or more suitable Cass sequences into eukaryotic cells. The CRISPR sequence, sometimes called the CRISPR locus, contains alternating repeat sequences and spacer sequences. In naturally occurring CRISPRs, the spacer sequences typically contain exogenous bacterial sequences, such as plasmid or phage sequences, while in the exemplary YTHDF2 CRISPR / Cas system, the spacer sequences may originate from the Ythdf2 gene sequence or the sequences of its regulators.
[0305] RNA from the CRISPR locus is constitutively expressed and processed into small RNAs. These small RNAs contain spacer sequences adjacent to repeat sequences. The RNAs lead to the repression of other Cas proteins at the RNA or DNA level in response to exogenous genetic elements. (Horvath et al., (2010) Science 327: 167-170; Makarova et al., (2006) Biology Direct 1: 7). Thus, the spacer sequences act as templates for RNA molecules, similar to siRNAs. (Pennisi (2013) Science 341: 833-836).
[0306] The CRISPR system may rely on the protein Cas9, a nuclease with two active cleavage sites, one on each strand of its double helix. The binding of Cas9 to modified CRISPR locus RNA can be used in gene editing systems.
[0307] For example, the CRISPR / Cas system can be used to modify the Ythdf2 gene by deleting one or more nucleic acids, such as Ythdf2 gene regulatory elements, or by introducing terminations, thereby reducing the expression of functional YTHDF2. The CRISPR / Cas system can be used in a reversible manner to turn off the Ythdf2 gene, similar to RNA interference. For example, in mammalian cells, RNA can guide the Cas protein to the Ythdf2 promoter and sterically block RNA polymerase.
[0308] A CRISPR / Cas system for gene editing in eukaryotic cells typically includes (1) a guide RNA molecule (gRNA) containing a targeting sequence (which can hybridize to a genomic DNA target sequence) and a sequence capable of binding to Cas (e.g., the Cas9 enzyme), and (2) Cas such as Cas9 or a protein. The targeting sequence may be located on the same molecule as the sequence capable of binding to Cas (e.g., the Cas9 enzyme), or on different molecules. If located on different molecules, each molecule may contain a hybridization domain that allows the molecules to associate, for example, through hybridization.
[0309] Technologies known in the art, such as those described in U.S. Patent Application Publication No. 20140068797, WO2015 / 048577, and Cong (2013) Science 339: 819-823, can be used to produce artificial CRISPR / Cas systems that attenuate the activity and / or expression of YTHDF2. Other artificial CRISPR / Cas systems known in the art that inhibit YTHDF2 can also be produced, such as those described in Tsai (2014) Nature Biotechnol., 32:6 569-576, and U.S. Patents 8,871,445, 8,865,406, 8,795,965, 8,771,945, and 8,697,359, which are incorporated herein by reference in their entirety. Such a system for inhibiting YTHDF2 can be produced, for example, by manipulating the CRISPR / Cas system to include a gRNA molecule having a targeting sequence that hybridizes to the sequence of the Ythdf2 gene. For example, the gRNA may contain a targeting sequence that is perfectly complementary to 15-25 nucleotides (e.g., 20 nucleotides) of the Ythdf2 gene. In some cases, 15-25 nucleotides (e.g., 20 nucleotides) of the Ythdf2 gene may be located immediately 5' to a protospacer-adjacent motif (PAM) sequence recognized by the Cas protein of the CRISPR / Cas system (for example, the system is the Streptococcus pyogenes (S. pyogenes) Cas9 protein, where the PAM sequence contains NGG, and N can be any of A, T, G, or C).
[0310] Exotic DNA, such as the CAR-encoding DNA described herein, can be introduced into cells along with the CRISPR / Cas system. Depending on the sequence of the exotic DNA and the chromosomal sequence, this process can be used to integrate the CAR-encoding DNA, as described herein, into, for example, a site targeted by the CRISPR / Cas system or its vicinity. Such integration may result in CAR expression and disruption of the Ythdf2 gene.
[0311] In some cases, the gene editing system may include a CRISPR / Cas system containing a gRNA molecule having a targeting sequence that hybridizes to a target sequence in the Ythdf2 gene. The gene editing system may bind to a target sequence in an early exon or intron of the gene encoding YTHDF2. In some cases, the gene editing system may bind to a target sequence upstream of exon 4 of the gene encoding YTHDF2 (e.g., in exons 1, 2, and / or 3). In some cases, the gene editing system may bind to a target sequence in a late exon or intron of the gene encoding YTHDF2. For example, the gene editing system may bind to a target sequence downstream of exon 3 of the gene encoding YTHDF2 (e.g., in exons 4, 5, 6, 7, and / or 8).
[0312] In some cases, the gene editing system can bind to a target sequence within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and / or exon 8 of the gene encoding YTHDF2. In some embodiments, the targeting sequence is the targeting sequence represented by SEQ ID NO. 17.
[0313] In some cases, TALEN gene editing systems may be used to reduce the expression and / or activity of YTHDF2. TALENs are artificially produced by fusing a TAL effector DNA-binding domain to a DNA-cleaving domain. The transcriptional activator-like effector (TALE) can be engineered to bind to any desired DNA sequence, including a portion of the Ythdf2 gene. By combining the engineered TALE with the DNA-cleaving domain, restrictive endonucleases specific to any desired DNA sequence (including the Ythdf2 gene sequence) can be produced. These restrictive endonucleases can then be introduced into cells, where they can be used for genome editing. Boch (2011) Nature Biotech. 29: 135-6, and Boch et al. (2009) Science 326: 1509-12, Moscou et al. (2009) Science 326: 3501. TALE is a protein secreted by Xanthomonas. The DNA-binding domain contains a repeating, highly conserved 33-34 amino acid sequence, excluding the 12th and 13th amino acids. These two sites are highly variable and show a strong correlation with specific nucleotide recognition. They can therefore be manipulated to bind to desired DNA sequences.
[0314] To produce TALENs, the TALE protein is fused with a nuclease (N), such as a wild-type or mutant Fokl endonuclease. Several mutations have been made to Fokl for use in TALENs, including, for example, improvements in cleavage specificity or activity. Cermak et al., (2011) Nucl. Acids Res. 39: e82; Miller et al., (2011) Nature Biotech. 29: 143-8; Hockemeyer et al., (2011) Nature Biotech. 29: 731-734; Wood et al., (2011) Science 333: 307; Doyon et al., (2010) Nature Methods 8: 74-79; Szczepek et al., (2007) Nature Biotech. 25: 786-793; and Guo et al., (2010) J. Mol. Biol. 200: 96.
[0315] The Fokl domain functions as a dimer and requires two constructs, each possessing a unique DNA-binding domain for a site in the target genome with appropriate orientation and spacing. Both the number of amino acid residues between the TALEN DNA-binding domain and the Fokl cleavage domain, and the number of bases between the two individual TALEN-binding sites, are considered important parameters for achieving high levels of activity. Miller et al., (2011) Nature Biotech. 29: 143-8.
[0316] The Ythdf2 gene TALEN can be used intracellularly to produce double-strand breaks (DSBs). Mutations can be introduced at the break site if the repair mechanism improperly repairs the break by non-homologous end joining. For example, improper repair may introduce a frameshift mutation. Alternatively, exogenous DNA, such as the CAR encoding DNA described herein, can be introduced into the cell along with the TALEN, and depending on the sequence and chromosomal sequence of the exogenous DNA, this method can be used to integrate the CAR encoding DNA described herein into or near the target site of the TALEN. As described herein, in the examples, without being confined to theory, such integration may result not only in the disruption of the Ythdf2 gene but also in the expression of the CAR.
[0317] Sequence-specific TALENs in the Ythdf2 gene can be constructed using any method known in the art, including a variety of schemes using modular elements. Zhang et al., (2011) Nature Biotech. 29: 149-53; Geibler et al., (2011) PLoS ONE 6: el9509, US 8,420,782, US 8,470,973, the contents of which are incorporated herein by reference in their entirety.
[0318] In some cases, zinc finger nucleases may be used to reduce the expression and / or activity of YTHDF2. "ZFN" or "zinc finger nuclease" refers to a zinc finger nuclease, an artificial nuclease that can be used to modify, for example, delete one or more nucleic acids in a desired nucleic acid sequence (e.g., the Ythdf2 gene). Similar to TALENs, ZFNs contain a Fokl nuclease domain (or a derivative thereof) fused to a DNA-binding domain. In the case of ZFNs, the DNA-binding domain contains one or more zinc fingers. (Carroll et al., (2011) Genetics Society of America 188: 773-782, and Kim et al., (1996) Proc. Natl. Acad. Sci. USA 93: 1156-1160.)
[0319] Zinc fingers are small protein structural motifs stabilized by one or more zinc ions. Zinc fingers, for example, may include Cys2His2 and can recognize sequences of approximately 3 bp. By combining a variety of zinc fingers with known specificities, multi-finger polypeptides recognizing sequences of approximately 6, 9, 12, 15, or 18 bp can be produced. A diverse range of selection and modular assembly techniques are available for producing zinc fingers (and combinations thereof) that recognize specific sequences, including in phage displays, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells.
[0320] Similar to TALENs, ZFNs must dimerize to cleave DNA. Therefore, a pair of ZFNs must target non-palindromic DNA sites. The two individual ZFNs must have their nucleases properly detach and bind to the opposite strand of DNA. Bitinaite et al., (1998) Proc. Natl. Acad. Sci. USA 95: 10570-5.
[0321] Furthermore, similar to TALENs, ZFNs can create double-strand breaks in DNA, which, if improperly repaired, can lead to frameshift mutations, resulting in decreased expression and levels of the Ythdf2 gene in cells. ZFNs can also be used with homologous recombination to mutate the Ythdf2 gene or to introduce CAR-encoding nucleic acids into or near the target sequence. As described above, CAR-encoding nucleic acids can be introduced as part of the template DNA.
[0322] Sequence-specific ZFNs in the Ythdf2 gene can be constructed using any method known in the art. See, for example, Provasi (2011) Nature Med. 18: 807-815, Torikai (2013) Blood 122: 1341-1349, Cathomen et al., (2008) Mol. Ther. 16: 1200-7, and Guo et al., (2010) J. Mol. Biol. 400: 96, U.S. Patent Publication 2011 / 01589570, and U.S. Patent Publication 2012 / 0060230, which are incorporated herein by reference in their entirety. A ZFN gene editing system may include, for example, nucleic acids encoding one or more components of a ZFN gene editing system that targets the Ythdf2 gene.
[0323] In some cases, double-stranded RNA ("dsRNA") such as siRNA or shRNA can be used to attenuate Ythdf2 or as a YTHDF2 attenuator. Furthermore, this application intends to use nucleic acids encoding the above-mentioned dsRNA Ythdf2 gene attenuator.
[0324] In some cases, the YTHDF2 attenuator is a nucleic acid such as siRNA or shRNA that is specific to the dsRNA, for example, the nucleic acid that codes for YTHDF2 (e.g., genomic DNA or mRNA that codes for YTHDF2).
[0325] This application provides a composition comprising a dsRNA, such as siRNA or shRNA, comprising at least 15 consecutive nucleotides, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides, for example, 21 consecutive nucleotides, wherein the consecutive nucleotides are complementary (e.g., 100% complementary) to the sequence of the Ythdf2 gene nucleic acid sequence (e.g., genomic DNA or mRNA encoding YTHDF2). The above at least 15 consecutive nucleotides, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides, for example, 21 consecutive nucleotides, may comprise the target sequence of the shRNA or the consecutive nucleotides of the nucleic acid encoding YTHDF2 shRNA. While some target sequences and / or shRNA molecules are presented as DNA, it is understood that dsRNA agents that target or have these sequences may be RNA, or any nucleotide, modified nucleotide, or substitute known herein and / or in the art, provided that the molecule is still capable of mediating RNA interference.
[0326] Therefore, in some cases, agents capable of attenuating the expression and / or activity of YTHDF2 may include, or be, Ythdf2-specific siRNA or shRNA, or nucleic acids encoding the above-mentioned siRNA or shRNA. In some embodiments, the siRNA or shRNA contains a sequence complementary to the Ythdf2 mRNA sequence.
[0327] Cancer / tumor-related antigens In this application, cancer-associated antigens may be expressed on the surface of cancer cells. In some cases, cancer-associated antigens themselves may be present inside the cell, but fragments (peptides) of such antigens may also be presented on the surface of cancer cells by MHC (major histocompatibility complex). Examples of cancer / tumor-associated antigens include, for example, EGFR, HER2 / neu, HER3, HER4, Ep-CAM, CEA, TrAIL, TRAIL receptor 1, TRAIL receptor 2, lymphotoxin-β receptor, CCR4, CD19, CD20, CD22, CD28, CD33, CD40, CD80, CSF-1R, CTLA-4, fibroblast-activating protein (FAP), hepsin, melanoma-associated chondroitin sulfate proteoglycan (MCSP), prostate-specific membrane antigen (PSMA), VEGF receptor 1, VEGF receptor 2, IGF-1R, TSLP-R, TIE-1, TIE-2, TNF-α, TWEAK (TNF-like weak apoptosis), and IL-1R, preferably including EGFR, HER2 / neu, CEA, CD20, and / or IGF-1R.
[0328] Pharmacologically acceptable excipients The composition of the present application may comprise one or more pharmaceutically acceptable excipients. The pharmaceutically acceptable excipients may comprise any inert substances in combination with one or more active ingredients of the present application (e.g., modified cells or attenuators).
[0329] For example, pharmaceutically acceptable excipients may include one or more of the following: solvents, penetration enhancers, antioxidants, thickeners, ointment bases, protective agents, adsorbents, lubricants, ointments, preservatives, humectants, buffers, adjuvants, bioavailability enhancers, carriers, flow enhancers, sweeteners, diluents, dyes / colorants, flavorings, solubilizers (including surfactants), wetting agents, dispersants, suspending agents, stabilizers, and / or isotonic agents.
[0330] Combination therapy The modified cells (e.g., modified immune cells), YTHDF2 attenuators, compositions, and / or methods of this application can be used in combination with one or more additional active ingredients or therapeutic (hereinafter also referred to as second active ingredient) compositions.
[0331] For example, the composition may contain one or more additional active ingredients. In some cases, modified cells (e.g., modified immune cells) may contain additional active ingredients, or may be administered in combination with additional active ingredients or treatments.
[0332] Additional active ingredients or therapies may be administered before, concurrently with, or after administration of the modified cells (e.g., modified immune cells), compositions, YTHDF2 attenuators and / or the methods of the present invention.
[0333] In some cases, the additional active ingredient may be contained in the same package or container as the modified cells (e.g., modified immune cells) and / or the YTHDF2 attenuator of the Application. In other cases, the additional active ingredient may be contained in a separate container, for example, a different container from the container containing the modified cells (e.g., modified immune cells) and / or the YTHDF2 attenuator of the Application. In some cases, even if the additional active ingredient is present in the same container or package, it is not in direct contact (e.g., not mixed) with the modified cells (e.g., modified immune cells) and / or the YTHDF2 attenuator of the Application.
[0334] The additional active ingredient may be an anticancer agent. For example, the additional active ingredient may include cancer immunotherapy. In some cases, the additional active ingredient may include an immune checkpoint attenuator. In some embodiments, the additional active ingredient may include a drug selected from an anti-PD-L1 antibody or its antigen-binding moiety, an anti-PD-1 antibody or its antigen-binding moiety, an anti-CTLA-4 antibody or its antigen-binding moiety, and an IDO attenuator. For example, the additional active ingredient may include any anticancer agent containing pembrolizumab, nivolumab, semiprimab, atezolizumab, avelumab, durvalumab, ipilimumab, and / or any one or more of the antigen-binding moieties listed above.
[0335] In vivo method, in vitro method, ex vivo method The present invention provides a method for increasing the activity and / or immune response of immune cells (e.g., immune effector cells), such as CAR 20-expressing cells described herein, including, for example, CAR 20-expressing cells, comprising the step of attenuating the expression and / or activity of YTHDF2 in the above cells. The above method may include reducing or eliminating the function or expression of YTHDF2.
[0336] For example, the above method may include contacting the above cells with the YTHDF2 attenuator described herein. The above contact may be performed ex vivo. In some cases, the contact may be performed in vivo. In some cases, the contact may be performed before, simultaneously with, or after modifying the above cells to express the CAR or TCR described herein.
[0337] The present invention provides a method comprising the step of introducing cells into a gene editing system, for example, a CRISPR / Cas gene editing system targeting, for example, the Ythdf2 gene, or a CRISPR / Cas system comprising a gRNA having a targeting sequence complementary to the target sequence of the Ythdf2 gene, as in the method described above. In some cases, the CRISPR / Cas system may be introduced into the cells as a ribonucleoprotein complex of gRNA and Cas enzyme, for example, by electroporation. For example, the method described above may include introducing nucleic acid molecules encoding one or more components of the CRISPR / Cas system into the cells. In some cases, the nucleic acid may be placed on a vector encoding a CAR (for example, a CAR as described herein).
[0338] In some cases, the above method may include the step of introducing a weakened dsRNA (e.g., shRNA or siRNA) that targets the Ythdf2 gene into the cells. For example, the above method may include introducing a nucleic acid encoding a weakened dsRNA (e.g., shRNA or siRNA) that targets the Ythdf2 gene into the above cells. In some cases, the nucleic acid may be placed on a vector encoding a CAR (e.g., a CAR as described herein).
[0339] Disease, disorder, or medical condition The cells, methods, and compositions of this application can be used to prevent, improve, and / or treat diseases, disorders, or conditions, such as diseases, disorders, or conditions, that are associated with the expression of cancer / tumor-related antigens as described herein.
[0340] For example, a disease, disorder, or medical condition could be cancer.
[0341] In some cases, cancer may be selected from blood cancers, lymphomas, and solid tumors.
[0342] In some cases, the cancer may be selected from melanoma, colon cancer, pancreatic cancer, breast cancer, lung cancer, and liver cancer.
[0343] subject The modified immune cells, YTHDF2 attenuators, compositions, and / or methods of this application may be administered to subjects in need.
[0344] In some cases, the subjects may be cancer patients. For example, a subject may be a patient with a cancer selected from blood cancers, lymphomas, and solid tumors. In other cases, a subject may be a patient with a cancer selected from melanoma, colon cancer, pancreatic cancer, breast cancer, lung cancer, and liver cancer.
[0345] In some cases, subjects have received, are receiving, and / or intend to receive additional treatment. Such additional treatment may be anti-cancer treatment.
[0346] In some cases, anticancer therapy may include cancer immunotherapy. For example, anticancer therapy may include, or may be, immune checkpoint attenuators. In some cases, anticancer therapy may include agents selected from anti-PD-L1 antibodies or their antigen-binding moieties, anti-PD-1 antibodies or their antigen-binding moieties, anti-CTLA-4 antibodies or their antigen-binding moieties, and IDO attenuators. In some cases, anticancer therapy may include pembrolizumab, nivolumab, semiprimab, atezolizumab, avelumab, durvalumab, and / or ipilimumab.
[0347] Activation of immune cells and enhancement of the immune response The YTHDF2 attenuator, modified immune cells, composition and method of this application can be used to activate immune cells and / or to enhance immune responses such as antitumor immune responses.
[0348] For example, the ability of activated immune cells to kill tumor cells or control tumor growth in vivo may increase (e.g., by at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0349] In some cases, an increase in the proliferation of CD4+ T cells may be observed in a single immune cell population (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more). In some cases, an increase in the proliferation of CD8 +An increase in T cell proliferation (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more) may be observed.
[0350] In some cases, an enhanced antitumor immune response may lead to increased CD8 activity in or around the tumor site. + This can be indicated by an increase in the number of cytotoxic T cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0351] In some cases, an enhanced antitumor immune response is associated with tumor infiltration CD8 +This can be indicated by an increase in the number of T cells (for example, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0352] In some cases, increased activity of immune cells (e.g., T cells) may be manifested by increased cytokine production by immune cells (e.g., IFN-γ and / or IL-2) (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0353] In some cases, increased immune cell activity or enhanced immune response can delay or reverse immune cell exhaustion (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more), e.g., CD8 + This can be indicated by a delay or reversal of T cell exhaustion (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0354] For example, increased immune cell activity or enhanced immune response may be manifested by increased TCF-1 and / or TCF-7 expression (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).Increased expression can be characterized by an increase in the amount / level of TCF-1 and / or TCF-7 inside / on cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more) or in a single immune cell population (e.g.) This can be characterized by an increase in the number / percentage of TCF-1 and / or TCF-7 expressing cells in immune effector cell populations such as T cell populations (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0355] In some cases, increased immune cell activity or enhanced immune response may be manifested by a decrease in T-bet expression (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).The decrease in expression can be characterized by a decrease in the amount / level of T-bet inside / on cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more) or in a single immune cell population (e.g., In immune effector cell populations such as T cell populations, this can be characterized by a decrease in the number / percentage of T-bet-expressing cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0356] In some cases, increased immune cell activity or enhanced immune response may be manifested by a decrease in eomesodermine (Eomes) expression (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).The decrease in expression can be characterized by a decrease in the amount / level of Eomes inside / on cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more) or in a single immune cell population (e.g., In immune effector cell populations such as T cell populations, Eomes expression can be characterized by a decrease in the number / percentage of Eomes-expressing cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0357] In some cases, increased immune cell activity or enhanced immune response may be manifested by a decrease in PD-1 expression (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).The decrease in expression can be characterized by a decrease in the amount / level of PD-1 inside / on cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more) or in a single immune cell population (e.g., In immune effector cell populations such as T cell populations, this can be characterized by a decrease in the number / percentage of PD-1 expressing cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0358] In some cases, increased immune cell activity or enhanced immune response may be manifested by a decrease in Tim-3 expression (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).The decrease in expression can be characterized by a decrease in the amount / level of Tim-3 inside / on cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more) or in a single immune cell population (e.g., In immune effector cell populations such as T cell populations, this can be characterized by a decrease in the number / percentage of Tim-3 expressing cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0359] In some cases, increased activity of immune cells or enhancement of the immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), CD45 + Cells (e.g., CD45) + CD4 + Cells or CD45 + CD8 +This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0360] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), PD1 - TCF1 + This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0361] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population) due to PD1 - TCF1 + CD62L -This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0362] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), PD1 - TCF1 + CD62L + This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0363] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), Tim3 - TCF1 +This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0364] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), IFN-γ + CD8 + This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0365] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), IFN-γ + IL-2 +This can be revealed by an increase in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more).
[0366] In some cases, increased immune cell activity or enhanced immune response occurs in a single immune cell population (e.g., an immune effector cell population such as a T cell population), Tim3 + TCF1 - This can be revealed by a decrease in the number and / or percentage of cells (e.g., at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 8%, at least about 10%, at least about 15%, at least about 16%, at least about 17%, at least about 18%, at least about 19%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 1.5 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 3.5 times, or more). [Examples]
[0367] The following examples are provided to give a complete disclosure and explanation to those skilled in the art of how to implement and use the invention, and are not intended to limit the scope of what the inventors consider to be the invention, nor are they intended to represent all or only experiments. Efforts have been made to ensure accuracy with respect to the numerical values used (e.g., quantity, temperature, etc.), but some experimental errors and deviations should be taken into consideration. Unless otherwise specified, parts refer to parts by weight, molecular weight to weight-average molecular weight, temperature to Celsius, and pressure to atmospheric pressure or near atmospheric pressure. Standard abbreviations may be used, for example, bp to base pair, kb to kilobase, pl to picoliters, s or sec to seconds, min to minutes, h or hr to hours, aa to amino acid, nt to nucleotide, im to intramuscular, ip to intraperitoneal, and sc to subcutaneous.
[0368] material and method mouse Ythdf2 flox / flox Mice were prepared as described above, and CD4-Cre transgenic mice were prepared using standard procedures. The mice used in the experiments were further backcrossed for two generations to C57BL / 6J. To ensure comparability of the genetic background, mice were maintained by crossing CD4creYthdf2flox / flox and Ythdf2flox / flox. CD4creYthdf2flox / flox or their littermate control WT mice were used in all experiments. Lactate offspring were housed together during the experimental period to reduce microbial and environmental changes. Ythdf2 flox / floxPrimers used for mouse genotyping: GAACGGTATTGTCGGTATTGTCA (SEQ ID NO. 1) and AGACCACTCCAACACAGAACTT (SEQ ID NO. 2); Primers used for CD4-Cre genotyping: GTTCTTTGTATATATTGAATGTTAGCC (SEQ ID NO. 3), TATGCTCTAAGGACAAGAATTGACA (SEQ ID NO. 4) and CTT TGC AGA GGG CTA ACA GC (SEQ ID NO. 5). CD45.1 OTI mice were purchased from Jackson Laboratory. CD45.1 OTI CD4 cre DF2 flox / flox The mice were bred in-house. All mice were used between 6 and 12 weeks of age. All mice were kept free of specific pathogens and were used in accordance with the animal experiment guidelines established by the Tsinghua University Laboratory Animal Management and Use Committee.
[0369] cell line B16-OVA was an OVA transfection clone derived from the mouse melanoma cell line B16. mB16-zsGreen-OTIp(B16-OZ) was selected as a single clone after transduction with a lentivirus expressing zsGreen-OTIp (SIINFEKL). MC38 was a mouse colon adenocarcinoma cell line. E. G7 was an OVA transfection clone derived from the mouse lymphoma cell line EL4. E. G7 cells were cultured at 37°C and 5% CO2 in RPMI 1640 (Thermo) containing 10% FBS and 1% penicillin-streptomycin, supplemented with 0.1 M HEPES buffer and 0.1 mM non-essential amino acids. Other cells were maintained at 37°C and 5% CO2 in DMEM (Thermo) containing 10% FBS and 1% penicillin-streptomycin, supplemented with 2 mM L-glutamine, 0.1 M HEPES buffer, and 0.1 mM non-essential amino acids.
[0370] The Lenti-X 293 cell line was purchased from Clontech (Mountain View, CA). Raji cells were generously provided by the Chinese Academy of Sciences Stem Cell Bank (Shanghai, China). Lenti-X 293 cells were cultured in DMEM. Raji cells were maintained in RPMI-1640. All cell media were supplemented with 10% thermoinactivated fetal bovine serum (Gibco), 2 mmol / L of L-glutamine, 100 units / mL of penicillin, and 100 μg / mL of streptomycin.
[0371] primary cell culture Single-cell suspensions of T cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum at 37°C and 5% CO2, stimulated with 2 μg / mL anti-CD3 and 0.5 μg / mL anti-CD28 (Invitrogen), and supplemented with 55 μM 2-mercaptoethanol, 0.1 M HEPES buffer, and 0.1 mM non-essential amino acids.
[0372] In vitro tolerance induction CD4 cre DF2 f / f Mouse-derived CD8 + T cells, EasySep(trademark) mouse CD8 + T cells were isolated using a T cell isolation kit (catalog number 19853). On days 0, 3, and 5, 5 × 10⁶ cells were isolated in RPMI-1640 complete medium. 5 CD8 / mL + T cells were stimulated for 24 hours with 2 μg / mL anti-CD3, 0.5 μg / mL anti-CD28 (Invitrogen), and 10 ng / mL IL-2. The stimulation medium was then removed and replaced with complete medium supplemented with IL-2 only to allow the cells to rest. After three rounds of stimulation, viable cells were purified for flow cytometry.
[0373] Tumor growth and treatment Approximately 1×10 6 Individual B16-OVA, MC38, or E.G7 tumor cells were subcutaneously inoculated into the flanks of mice. Tumor volume was measured by length (a) and width (b), where tumor volume = ab.2 It was calculated as / 2. Tumor volume is 2000 mm 3 Mice with a life expectancy of less than 10°C were considered viable. In in vivo exhaustion experiments, 200 μg of anti-CD8 or anti-CD4 antibody was intraperitoneally injected 3 days after tumor inoculation. In anti-PD-L1 treatment, 1 × 10°C 6 Individual B16-OVA tumor cells were subcutaneously inoculated into the flanks of mice. Nine days after tumor inoculation, 100 μg of anti-PD-L1 antibody or rat immunoglobulin was administered. Rag1 was used for adoptive immunotransmission of T cells. - / - Alternatively, to other receptor mice, 5 × 10 on day 0. 5 Individual B16-OVA were administered. On the same day, CD45.1 OTI CD4 cre DF2 f / f Or CD45.1 OTI DF2 f / f T cells were purified from mice using a T cell-negative isolation kit (Stemcell). 5 × 10 6 T cells were intravenously injected into receptor mice.
[0374] Acute and chronic viral infections The mouse is typically an LCMV-Armstrong (2x10) 5 Intraperitoneal infection is caused by individual plaque-forming units (PFUs), or by LCMV clone 13 (2 × 10⁻¹⁶). 6 Mice were infected intravenously with individual PFUs. Mice were infected at 6-10 weeks of age, and both males and females were included without randomization or blinding. Eight days after infection, the mice were euthanized and spleen cells were evaluated. Spleen CD8 + T cells are LCMV-GP33-41-4mers (GP33 + The samples were analyzed by flow cytometry using staining.
[0375] Flow cytometry and cell sorting For flow cytometry analysis and cell sorting in Examples 1-4 (where applicable), tumors, lymph nodes, and spleens were collected from mice and digested with 0.26 U / mL Liberase TL and 0.25 mg / mL DNase I at 37°C for 30 minutes. The samples were then filtered through a 70 μm cell strainer and washed twice with staining buffer. Cells were resuspended in staining buffer (PBS with 2% FBS and 1 mM EDTA). Cells were incubated with Fc Block (clone 2.4G2) for 10 minutes. Specific antibodies were then added and stained on ice for 30 minutes. OT-I specific T cells were stained using iTAg tetramer / H-2KbOVA (SIINFEKL) (MBL). After the washing step, cells were analyzed using BD Fortessa (BD) or sorted using Aria IIIu (BD). Flow cytometry data were analyzed using Flowjo.
[0376] For flow cytometry analysis and cell sorting in Examples 5–8 (where applicable), single-cell suspensions were incubated with anti-CD16 / 32 (anti-FcγRII / III, clone 2.4G2) for 10 minutes, followed by staining with conjugated antibodies. Fluorescently labeled monoclonal antibodies were obtained from BioLegend (anti-human CD3-FITC (OKT3) and anti-human CD19-APC (H1B19)) and Jackson ImmunoResearch Laboratories (Alexa Fluor 647-labeled goat anti-mouse Fab antibody). Samples were analyzed on a Cytoflex (Beckman Coulter), and data were analyzed using FlowJo software (TreeStar, Inc).
[0377] RNA sequencing CD4 count 7 days after tumor inoculation cre DF2 f / f or DF2 f / f Tumor infiltration CD8 from mice + T cells were sorted by flow cytometry. LCMV clone 13 infected CD4 cre DF2f / f or DF2 f / f Gp33 from mouse spleen + CD8 + T cells were isolated. Total RNA was extracted from the T cells using TRIzol reagent (Invitrogen). The RNA library was constructed using the SMARTER Stranded Total RNA-seq Kit V2-Pico input (Clontech 634418).
[0378] m 6 A sequence determination Total RNA was isolated from T cells. Polyadenylated RNA was further enriched using the Dynabeads mRNA purification kit (Invitrogen). The RNA samples were fragmented into approximately 100-nucleotide fragments at 94°C for 45 seconds using an RNA fragmentation reagent (Thermo). 6 A-IP was performed using fragmented RNA (100 ng mRNA or 5 μg total RNA) according to the EpiMark N6-Methyladenosine Concentration Kit (NEB E1610S) protocol. Libraries were prepared by concentrating RNA using RNA Clean & Concentration-5 (Zymo Research) and then using the SMARTER Stranded Total RNA-seq Kit V2-Pico input (Clontech 634418). Sequencing was performed using an Illumina HiSeq4000 machine.
[0379] ATAC Sequence Determination Tumor-infiltrating CD8+ T cells or tolerant T cells cultured in vitro were lysed with ATAC-RSB buffer. The cell lysates were digested with Tn5 transposase on ice. Subsequently, a library was constructed using the TruePrep DNA Library Prep Kit V2 for Illumina (Vazyme). Sequencing was performed using an Illumina HiSeq4000 machine.
[0380] CAR design and fabrication The antigen target region scFv (SEQ ID NO. 6) of the chimeric antigen receptor (CAR) was derived from rituximab. "20 CAR" (SEQ ID NO. 11) contains a rituximab-derived scFv, an intracellular signaling domain 41BB (SEQ ID NO. 7) and CD3ζ (SEQ ID NO. 8), a CD8α hinge domain (SEQ ID NO. 9) and a 41BB transmembrane domain (SEQ ID NO. 10), where the scFv is linked to the intracellular signaling domain via the CD8α hinge domain and the 41BB transmembrane domain. YTHDF2 (SEQ ID NO. 15) was linked to CD3ζ (SEQ ID NO. 8) via a P2A peptide (SEQ ID NO. 16) to produce 20-YTHDF2 (SEQ ID NO. 14).
[0381] Lentiviral transfer vectors were constructed by cloning 20 CAR-coding DNA (SEQ ID NO. 12) and 20-YTHDF2 CAR-coding DNA (SEQ ID NO. 13) into the pCDH-EF1-MSC vector skeleton (Palo Alto, CA, USA). Lentiviruses were generated by transient transfection of Lenti-X 293 cells with the constructed vector plasmid. 48 and 72 hours after transfection, the supernatant containing lentiviral particles was collected and concentrated by ultracentrifugation (Beckman) at 25,000 rpm at 4°C. The concentrated virus was slowly lysed in complete RPMI-1640 medium over 4–16 hours. Viral titers were determined at indicated volumes by flow cytometry analysis of transduced Lenti-X 293 cells.
[0382] CAR-T cell production Peripheral blood mononuclear cells (PBMCs) were supplied by Shanghai Longyao Biotechnology Co Ltd (Shanghai, China) and purified by negative selection using the EasySep® Human T Cell Isolation Kit (Stem Cells). The purified T cells were inoculated into 96-well plates and stimulated with anti-CD3 and anti-CD28 antibodies for 72 hours. The activated T cells were then transduced with lentivirus encoding 20-CAR or 20-YTHDF2-CAR at a final multiplicity of infection (MOI) of 10. For 20-YTHDF2-knockout CAR-T cells (referred to herein as 20-YTHDF2-KO), 20 CAR-T cells were harvested, washed twice with PBS, and resuspended in P3 primary cell solution (Lonza). Alt-R crRNA (SEQ ID NO: 17) (90 pmol) and Alt-R tracrRNA (SEQ ID NO: 18) (45 pmol) (IDT) were reconstituted in nuclease-free double-strand buffer (IDT), heated in a PCR thermocycle at 95°C for 5 minutes to anneal the oligonucleotides, and the mixture was slowly cooled to room temperature. The crRNA-tracrRNA double helix and Cas9 protein V3 (50 μg) (IDT) were gently mixed by transfer and incubated at room temperature for at least 15 minutes. T cells were mixed and incubated with 5 μl RNP at room temperature for 2 minutes. The cell / RNP mixture was electroporated using a 4D-Nucleofector (4D-Nucleofector core unit: Lonza), and the transfected cells were transferred to a 96-well plate using pre-warmed T cell medium. During in vitro amplification, CAR-T cells were stimulated weekly with irradiated Raji cells. CAR-T cells were cultured in RPMI-1640 medium containing 200 IU / mL IL-2 and 4 ng / mL IL-21.
[0383] In vitro tumor cell death assay In a 96-well plate, a total of 1 x 10 5Individual CAR-T cells were incubated with Raji cells at different effector cell:target cell (E:T) ratios (e.g., 1:1 or 1:2). Cells were harvested 24 hours after plating and analyzed by flow cytometry. Anti-CD3 and anti-CD19 were used to differentiate CAR-T cells from tumor cells.
[0384] Example 1: Preparation of knockout mice Ythdf2 flox / flox The mice were prepared as described above and maintained in the C57BL / 6 ground. In some embodiments, the mice were crossed with OT-I TCR transgenic mice or mice expressing Cre recombinase under the control of the Cd4 gene regulator (Cd4Cre). In some embodiments, CD4 cre Ythdf2 flox / flox Mice were crossbred with OT-I TCR transgenic mice.
[0385] Example 2: Evaluation of T cell function E. Neoantigen-specific CD8 in G7 tumors + To determine whether a T cell response is generated, CD4 cre Ythdf2 flox / flox (CD4 cre DF2 f / f ) and Ythdf2 flox / flox (DF2 f / f ) Tumor infiltration in mice: SIINFEKL MHC-I tetramer + CD8 + The frequency of T cells was analyzed, as shown in Figure 2, CD4 + and CD8 + The proportion of T cells is CD4 cre Ythdf2 flox / flox It was increased in mice (Figure 2a), indicating enhanced T cell infiltration in the tumor microenvironment. Also, DF2 f / f Mice have antigen-specific CD8 in their tumors. + Although T cells could not be accumulated, CD4 cre DF2 f / f The mouse is DF2 f / fCompared to mice, CD8 against tumor neoantigens in vivo + A significant increase in T cells was observed (Figure 2b-2c). To further investigate the function of tumor-infiltrating T cells, they were stimulated with PMA and ionomycin and blocked with BFA for 2 hours. When IFN-γ-producing cells were quantified, CD4 cre DF2 f / f In mice, IFN-γ + CD8 + The proportion of T cells was significantly increased compared to control mice (Figure 2d). Similar results were observed in the B16 melanoma model (Figure 2e-2g).
[0386] Example 3: Evaluation of antitumor effect m 6 A leader protein Ythdf2 conditional knockout mice (Figure 1a) were subjected to WT control DF2 flox / flox Along with mice, obalbumin protein (OVA)-expressing lymphoma E. G7 cells were subcutaneously inoculated. Compared to WT control mice, CD4 cre Ythdf2 flox / flox The mice showed better tumor control and longer survival. These findings were also validated in OVA-expressing B16 melanoma models, MC38 cell colon cancer models, and Hepa 1-6 cell hepatocellular carcinoma models, which have been reported to have a broader neoantigen pool. CD4 cre Ythdf2 flox / flox In mice, a tumor-suppressing effect comparable to that observed in WT control mice was observed (Figure 1b-1d).
[0387] Example 4: Reversal of T cell exhaustion As can be seen from the results of the above examples, the deletion of Ythdf2 showed improved antitumor activity. Furthermore, in Ythdf2 conditional knockout mice and WT mice, tumor-infiltrating CD8 + It was found that the stages of T cell exhaustion differ. PD-1 - TCF1 + CD62l +Early T cells labeled with DF2 were accumulated in Ythdf2 conditional knockout mice (Figure 3a). WT control mice (DF2 flox / flox In mice, exhausted T cells (TCF1 - Tim3 + The density of cells is high, and in Ythdf2 conditional knockout mice, exhausted T cell progenitor cells (TCF1 + Tim3 - The proportion of ) is increasing (Figure 3b). T cell factor-1 (TCF-1) critically regulates T cell development. Recent studies have revealed that TCF-1 not only controls the early development of T cell fate determination but is also involved in the process of T cell exhaustion.
[0388] In Ythdf2 conditional knockout T cells, TCF-1 expression was found to be approximately twofold upregulated compared to WT T cells (Figure 3c). PD-1 and Tim3 expression were also reduced in T cells from Ythdf2 conditional knockout mice compared to WT mice (Figure 3d).
[0389] 7 days after tumor inoculation, 5 x 10 5 Five wild-type (WT) OT-I cells (n=5) and eight Ythdf2 cKO OT-I cells (n=8) were adopted into mice carrying B16-OVA. Tumor growth was observed every other day. Ythdf2 conditional knockout T cells showed better tumor control and longer survival (Figure 3e).
[0390] Regarding the combination of YTHDF2 deficiency and immune checkpoint blockade, WT control DF2 with MC38 under administration of anti-PD-L1 antibody and anti-CD40 antibody and without administration. f / f Mouse and CD4 cre DF2 f / f We tested mice.
[0391] Example 5: CAR expression Figures 4a-4b show the design of the 20 CAR. In a 24-well plate, 2 × 10 5Individual Lenti-X 293 cells were infected with 0 μl (Figure 5a), 0.33 μl (Figure 5b), 1 μl (Figure 5c), or 3 μl (Figure 5d) of concentrated virus in the presence of 10 μg / ml polybrene. After 24 hours, the cells were added to complete DMEM medium and further incubated at 37°C and 5% CO2. Viral titers were measured after 48 hours by flow cytometry. It was found that 86.8% of Lenti-X 293 cells expressed CAR when only 0.33 μl of concentrated virus was used (Figure 5b). Furthermore, the increase in CAR expression was dependent on the dose of virus administered.
[0392] Figure 8A shows the design of the CLDN18.2 CAR.
[0393] Example 6: Production of CAR-T cells To evaluate whether CAR is expressed on the surface of T cells, human primary T cells were stimulated with 0.25 μg / ml anti-CD3 and 1 μg / ml anti-CD28 for 2 days, left for 3 days, and then infected with a virus at MOI 10 to produce 20 CAR-T (expressing 20 CAR) and 20-YTHDF2-OE CAR-T (expressing 20-YTHDF2 CAR) cells. Furthermore, using 20 CAR-T cells, YTHDF2 was knocked out using a CRISPR / Cas9 gene editing system to create 20-YTHDF2-KO CAR-T cells. After 5 days, CAR expression was examined by flow cytometry. As shown in Figure 6, more than 70% of the transfected T cells expressed 20-CAR (Figure 6b for 20-CAR-T cells, and Figure 6d for 20-YTHDF2-KO CAR-T cells), and more than 30% of the transfected T cells expressed 20-YTHDF2-CAR (Figure 6c for 20-YTHDF2-OE CAR-T cells). Furthermore, weekly stimulation of T cells with irradiated Raji cells increased the CAR expression rate to approximately 100%.
[0394] Anti-human CLDN18.2 single-stranded variable fragment (scFv) (SEQ ID NO: 22) was ligated to CD8 hinge Tm (SEQ ID NO: 23), 4-1BB (SEQ ID NO: 7), and CD3ζ (SEQ ID NO: 8) to create CAR constructs. YTHDF2 sgRNA (segment 5 is SEQ ID NO: 24, segment 6 is SEQ ID NO: 25) or YTHDF2 (SEQ ID NO: 15) was ligated to CD3ζ via the porcine teschovirus-1 2A (P2A) (SEQ ID NO: 16) peptide. The CAR-encoding DNA was cloned into the pCDH-MSC-EF1 vector backbone (SBI System Biosciences, Palo Alto, CA) to create a lentiviral transfer vector. Lentiviruses were generated using Lenti-X 293T cells.
[0395] Peripheral blood mononuclear cells (PBMCs) were derived from umbilical cord blood provided by Shanghai Longyao Biotechnology Co., Ltd (Shanghai, China) and isolated using Ficoll-Paque density gradient centrifugation. Total T cells were purified using the EasySep® Human T Cell Isolation Kit (Stemcell). Purified T cells were inoculated into 96-well plates and stimulated for 72 hours with plate-bound anti-CD3 (0.25 μg / mL) and anti-CD28 (1 μg / mL) antibodies. Next, activated T cells were transduced with a lentivirus encoding a specified CAR at a multiple of infection (MOI) of 10. During in vitro amplification, CAR-T cells were stimulated weekly with irradiated Raji cells (effector cell-to-target cell ratio (E:T) = 3:1). CAR-T cells were cultured in RPMI-1640 medium supplemented with 10% thermally inactivated FBS, 2 mmol / L glutamine, 100 units / mL penicillin, 100 μg / mL streptomycin, 50 IU / mL IL-2, and 4 ng / mL IL-21. CLDN18.2 CARs overexpressing YTHDF2 were constructed by lentiviral transfection, and YTHDF2 knockout CARs were constructed using CRISPR / cas9 technology with CLDN18.2 CARs and YTHDF2 sgRNA electrolysis. Single-cell suspensions of the cells were incubated with anti-CD16 / 32 (anti-FcgIII / II receptor, clone 2.4G2) for 10 minutes and then stained with the indicated conjugated antibodies (conjugated Abs). All fluorescently labeled monoclonal antibodies (mAbs) were obtained from Biolegend or eBioscience. Samples were analyzed on a Cytoflex flow cytometer (Beckman Coulter), and the data were analyzed using FlowJo software V10 (TreeStar). After stimulation with irradiated Raji cells, the percentage of CAR-T cells increased to nearly 100%.As shown in Figure 8B, CLDN18.2 CAR-T cells (expressing CLDN18.2 CAR), CLDN18.2-YTHDF2-OE CAR-T cells (expressing CLDN18.2-YTHDF2 CAR), CLDN18.2-YTHDF2-KO CAR-T-#5 cells (expressing CLDN18.2 CAR and knocking out YTHDF2 with sgRNA #5), CLDN18.2-YTHDF2-KO CAR-T-#6 cells (expressing CLDN18.2 CAR and knocking out YTHDF2 with sgRNA #6), and control T cells were produced.
[0396] Example 7: Tumor cell death effect of CAR-T cells The proliferation of 20 CAR-T, 20-YTHDF2-OE CAR-T, and 20-YTHDF2-KO CAR-T cells produced according to Example 6 was examined. Briefly, the cells were stimulated weekly with irradiated Raji cells. Cell counts were recorded as revealed by trypan blue. As shown in Figure 7a, 20-YTHDF2-KO CAR-T cells were observed to proliferate faster than 20 CAR-T cells and 20-YTHDF2-OE CAR-T cells, particularly in the later stages of long-term culture.
[0397] Next, using the lymphoma cell line Raji as an example, we examined the tumor-killing activity of 20 CAR-T, 20-YTHDF2-OE CAR-T, and 20-YTHDF2-KO CAR-T cells produced according to Example 6. In short, 1 × 10 5 Individual CAR-T cells were co-cultured in triplicate with Raji cells in various specified effector cell:target cell (E:T) ratios. After 24 hours, the ability to kill tumor cells was measured using a flow cytometer to identify residual tumor cells (CD3). - CD19 + This was determined by analyzing the following. As shown in Figure 7b, 20-YTHDF2-KO CAR-T cells showed significantly superior tumor-killing activity compared to 20 CAR-T cells, while YTHDF2-overexpressing 20-YTHDF2-OE CAR-T cells showed the lowest tumor-killing activity, with similar results obtained for E:T ratios of 1:1 and 1:2.
[0398] As shown in Figure 9, the in vivo antitumor effect of YTHDF2 knockout CLDN18.2 CAR in CFAPC-1 was investigated. Female NOD / SCID / γ- / -(NSG) mice were purchased from Shanghai Southern Model Organisms Center, Inc. (Shanghai, China) and maintained under specific pathogen-free conditions. Animal care and use followed institutional and National Institutes of Health (NIH) protocols and guidelines. NSG mice (n=6) were given 2*10 6 Each mouse was subcutaneously inoculated with CFPAC-1 (pancreatic cancer cell line). One week after tumor cell inoculation, the mice were randomly divided into groups and given PBS, 1 x 10 7 1 x CLDN18.2 CAR-T or 1 x 10 7 Tumors were treated with CLDN18.2 CAR-T transdermal thrombi (CLDN18.2-YTHDF2-KO CAR-T-#5 or CLDN18.2-YTHDF2-KO CAR-T-#6) in which individual YTHDF2 cells were knocked out. Tumor volume was measured twice weekly after CAR-T transdermal thrombi treatment, along three orthogonal axes (a, b, c), and calculated using the formula (a*b*c) / 2.
[0399] As shown in Figure 10, the in vivo antitumor effect of YTHDF2-overexpressing CLDN18.2 CAR in CFAPC-1 was investigated. Female NOD / SCID / γ- / -(NSG) mice were purchased and maintained. NSG mice (n=6) were given 2*10 6 Each CFPAC-1 cell was subcutaneously inoculated. One week after tumor cell inoculation, the mice were randomly divided into groups and given PBS, 1 x 10 7 1 x CLDN18.2 CAR-T or 1 x 10 7 Each tumor was treated with a YTHDF2-overexpressing CLDN18.2 CAR-T receptor (CLDN18.2-YTHDF2-OE CAR-T). Tumor volume was measured twice a week after CAR-T treatment, along three orthogonal axes (a, b, c), and calculated using the formula (a*b*c) / 2.
[0400] These results suggest that immune cells (such as T cells) with reduced YTHDF2 expression / activity exhibit improved proliferative activity and a heightened ability to kill tumor cells.
[0401] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided merely as examples. The present invention is not intended to be limited by any particular embodiment provided herein. While the present invention has been described with reference to the foregoing specification, the descriptions and examples of embodiments herein are not intended to be constrained. Now, those skilled in the art will be able to conceive of numerous variations, modifications, and substitutions without departing from the present invention. Furthermore, it should be understood that all aspects of the present invention are not limited to any particular description, configuration, or relative proportion described herein, depending on various conditions and variables. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed when carrying out the present invention. Thus, the present invention is considered to also encompass such alternatives, modifications, variations, or equivalents. The following claims define the scope of the present invention, and the methods and structures within these claims, as well as their equivalents, are intended to be covered thereby.
Claims
1. compared to unmodified counterpart immune cells. Attenuated YTH N6-methyladenosine RNA-binding protein 2 (YTHDF2) expression and / or activity, and have enhanced antitumor activity A modified immune cell, comprising: The modified immune cell, wherein the immune cell is a TCR-T cell.
2. The immune cells are modified with an agent capable of attenuating the expression and / or activity of YTHDF2; The modified immune cell of claim 1, wherein the agent capable of attenuating the expression and / or activity of YTHDF2 comprises one or more of ubiquitin, PROTAC, dsRNA, siRNA, shRNA, aptamer and gRNA.
3. The agent capable of attenuating the expression and / or activity of YTHDF2 is a gene editing system that targets one or more sites within the gene encoding YTHDF2 or its regulatory elements. The modified immune cell of claim 2.
4. A modified immune cell as described in claim 3, wherein the gene editing system is a CRISPR / Cas9 system.
5. The modified immune cells described in claim 4, wherein the modified immune cells are PD-1 + or PD-1 − , TCF1 + and / or TCF7 + , or Tim3 − .
6. A modified immune cell as described in claim 5, wherein the corresponding unmodified immune cell is TCF1 - , Tim3 + or PD-1 + .
7. A method for producing a composition comprising the modified immune cells of any one of claims 1 to 6 and optionally a pharmaceutically acceptable excipient. composition.
8. Further comprising a second active ingredient which is an anticancer agent; the second active ingredient comprises an agent selected from the group consisting of an anti-PD-L1 antibody or an antigen-binding portion thereof, an anti-PD-1 antibody or an antigen-binding portion thereof, an anti-CTLA-4 antibody or an antigen-binding portion thereof, and an IDO attenuator; The composition of claim 7.
9. A composition described in claim 7 or 8, used in the treatment of cancer.