Compositions and methods for engineering and selecting CAR T cells with desired phenotypes

Abstract

Described are compositions and methods for cell genome manipulation, which allow simple and efficient targeted knock-in of CAR and simultaneous knock-out of individual genes.These compositions and methods are particularly applicable to the massively parallel manipulation, selection and identification of CAR T cell variants that exhibit desired phenotypes.Provided are AAV vectors that contain crRNA and CAR expression cassettes and homologous arms for their targeted genome integration.Also provided are libraries that contain multiple AAV vectors and their use in screening to identify desirable CAR T cell variants.Also provided are treatment methods that use CAR T cell variants that exhibit one or more improved phenotypes.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefit and priority of U.S. Provisional Patent Application No. 63 / 065,194, filed on 13 August 2020, which is incorporated herein by reference in its entirety.

[0002] Description of research funded by the federal government. This invention was developed with government support under CA238295, CA231112, and CA225498, granted by the National Institutes of Health. The U.S. Government has certain rights to this invention.

[0003] Reference to sequence listings The sequence listing submitted as a text file with the filename "YU_7927_PCT_ST25", created on 12 August 2021 and having a size of 2,557,417 bytes, is incorporated herein by reference pursuant to Section 1.52(e)(5) of Title 37 of the United States Patent Rules.

[0004] Field of Invention The present invention relates to methods for manipulating improved chimeric antigen receptor T cells, more specifically to gene editing technologies and immunotherapy. [Background technology]

[0005] Background of the Invention Cell therapies, such as chimeric antigen receptor T cells (CAR-T), have proven to be powerful cancer treatments. CAR-T cell adoptive transfer therapy has demonstrated outstanding efficacy in treating hematological malignancies, particularly B-cell leukemia and lymphoma (Neelapu SS., et al., N Engl J Med., 377(26):2531-2544 (2017); Porter DL., et al., N Engl J Med., 365:725-733 (2011)), and is approved by the U.S. Food and Drug Administration (FDA). CAR-T and other forms of adoptive T cell therapy are already experiencing a surge in popularity. There are over 1,000 active clinical trials and a great many preclinical studies (Tang J., et al., Nat Rev Drug Discov., 17(11):783-784 (2018)). These include CAR-Ts that target several different cancer antigens, such as CD19 and CD22-targeted CARs for B-cell malignancies (Fry TJ., et al., Nat Med., 24(1):20-28 (2018); Porter et al., 2011), B-cell maturation antigen (BCMA)-targeted CARs for multiple myeloma, and other CARs for several solid tumor targets such as mesothelin, HER2, and EGFRvIII (Ahmed N., et al., JAMA Oncology 3:1094-1101 (2017); Raje N., et al., N Engl J Med., 380:1726-1737 (2019)). Novel CAR-T receptor morphologies have recently emerged targeting various targets, such as NKG2D, MUC1, CD20, CD30, CD33, CD133, and claudin, but these CAR-Ts are still in the early stages of development (Brudno, JN. and Kochenderfer JN., Nature reviews Clinical oncology 15, 31 (2018); Reinhard K., et al, Science 367, 446-453 (2020)).These studies have revealed the vast landscape of CAR-T-based immunotherapies across a broad range of oncology indications (June CH., et al., Science 359, 1361-1365 (2018)).

[0006] Despite current successes, there remain significant challenges with CAR-T therapies. To date, there are no FDA-approved CAR-T therapies for solid tumors. Even in liquid cancers, despite high response rates, the majority of patients relapse due to poor CAR-T cell expansion, persistence, or lack of specific antigens (Porter DL., et al., Sci Transl Med. 7(303):303ra139 (2015); Gardner R., et al., Blood, 27(20):2406-10 (2016)). Multiple obstacles exist with CAR-T therapies, including lack of antigen, metabolic suppression in the tumor microenvironment, insufficient T cell trafficking to the cancer site, lack of effective cancer cell killing, severe toxicities such as cytokine release syndrome (CRS), suboptimal T cell proliferation levels, and lack of CAR-T persistence, as commonly seen in the clinic (June et al., 2018).

[0007] To improve these features and enhance CAR-T function, many efforts have been devoted. Examples include, among others, the reorganization of signaling domains (Sadelain M., et al., Nature 545, 423-431 (2017)), the manipulation of various CAR-T components, such as single-chain variable fragments (scFv) or transmembrane regions (Sadelain et al., 2017), the overexpression of boosting factors (Lynn RC., et al., Nature 576, 293-300 (2019)), and the co-administration of immunomodulatory factors or viral vectors (Ma L., et al., Science 365, 162-168 (2019)). Some studies have tested the improvement of CAR-T cell function and persistence by changing co-stimulatory domains or reducing CAR binding affinity (Ghorashian S., et al., Nature Medicine 25, 1408-1414 (2019); Savoldo B., et al., The Journal of Clinical Investigation 121, 1822-1826 (2011)). Nevertheless, persistence remains a major challenge for CAR-T cells.

[0008] Therefore, there is an urgent need for techniques to engineer improved CAR-Ts that enable CAR T therapies showing reduced immune rejection risk, alleviated fatigue, as well as enhanced persistence and effector function.

[0009] Thus, an object of the present invention is to provide compositions and methods for engineering improved CAR T cells.

[0010] Another object of the present invention is to provide CAR T cells showing more stable CAR expression.

[0011] Another object of the present invention is to provide CAR T cells with higher persistence in culture and in vivo.

[0012] A further object of the present invention is to provide CAR T cells that exhibit increased cytotoxic activity and reduced exhaustion. A further object of the present invention is to provide a method for efficient high-throughput CAR-T manipulation for generating and selecting CAR T variants having a desired phenotype. [Prior art documents] [Non-patent literature]

[0013] [Non-Patent Document 1] Neelapu SS., et al., N Engl J Med., 377(26):2531-2544 (2017) [Non-Patent Document 2] Porter DL., et al., N Engl J Med., 365:725-733 (2011) [Non-Patent Document 3] Tang J., et al., Nat Rev Drug Discov., 17(11):783-784 (2018) [Non-Patent Document 4] Fry TJ., et al., Nat Med., 24(1):20-28 (2018) [Non-Patent Document 5] Ahmed N., et al., JAMA Oncology 3:1094-1101 (2017) [Non-Patent Document 6] Raje N., et al., N Engl J Med., 380:1726-1737 (2019) [Non-Patent Document 7] Brudno, JN. and Kochenderfer JN., Nature reviews Clinical oncology 15, 31(2018) [Non-Patent Document 8] Reinhard K., et al, Science 367, 446-453 (2020) [Non-Patent Document 9] June CH., et al., Science 359, 1361-1365 (2018) [Non-Patent Document 10] Porter DL., et al., Sci Transl Med. 7(303):303ra139 (2015) [Non-Patent Document 11] Gardner R., et al., Blood, 27(20):2406-10 (2016) [Non-Patent Document 12] Sadelain M., et al., Nature 545, 423-431 (2017) [Non-Patent Document 13] Lynn RC., et al., Nature 576, 293-300 (2019) [Non-Patent Document 14] Ma L., et al., Science 365, 162-168 (2019) [Non-Patent Document 15] Ghorashian S., et al., Nature Medicine 25, 1408-1414 (2019) [Non-Patent Document 16] Savoldo B., et al., The Journal of Clinical Investigation 121, 1822-1826 (2011) [Overview of the Initiative] [Means for solving the problem]

[0014] Summary of the Invention

[0015] Compositions and methods are provided for cell genome manipulation (e.g., T cell manipulation) that enable simple and efficient targeted knock-in of CARs and simultaneous knockout of individual genes. The compositions and methods can be particularly applied to large-scale parallel manipulation, selection and identification of CAR T cell variants exhibiting a desired phenotype (e.g., improved persistence), and their subsequent use in CAR-T therapy.

[0016] An AAV vector is provided comprising one or more reverse-ended repeat (ITR) sequences, a 5' homologous arm, a crRNA expression cassette, a chimeric antigen receptor (CAR) expression cassette, and a 3' homologous arm. Generally, the crRNA expression cassette comprises a promoter (e.g., U6) ligated to act on a sequence encoding one or more guide RNAs. The CAR expression cassette may comprise a promoter (e.g., EFS promoter) and / or a polyadenylation signal sequence ligated to act on a sequence encoding a CAR. Preferably, the crRNA and CAR expression cassettes are located between the 5' and 3' homologous arms. In some embodiments, the homologous arm is homologous to a site within the TRAC locus.

[0017] In some embodiments, the crRNA expression cassette encodes two guide RNAs, a first guide RNA and a second guide RNA. In some embodiments, the first guide RNA targets a site within the TRAC locus, while the second guide RNA targets any site in the genome. For example, the second guide RNA may target genes involved in T cell exhaustion, T cell proliferation, T cell costimulation, memory T cell differentiation, T cell receptor signaling, epigenetic regulation, adaptive immune responses, immune responses against tumor cells, other immune functions, or a combination thereof.

[0018] A CAR can be designed to target any desired antigen or ligand (e.g., recognize or bind to it). Preferably, the CAR targets one or more cancer-specific or cancer-associated antigens. In some embodiments, the CAR is an anti-CD19 CAR or an anti-CD22 CAR.

[0019] In some embodiments, the AAV vector contains the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the AAV vector contains a sequence having 75% or more sequence identity to SEQ ID NO: 1 or SEQ ID NO: 2. The AAV vector used in the composition and method may be a naturally occurring serotype of AAV or an artificial variant. In preferred embodiments, the serotype of the AAV vector is AAV6 or AAV9.

[0020] A library of AAV vectors is also described. The library may contain multiple AAV vectors. In some embodiments, each vector in the library independently contains a crRNA expression cassette encoding a first guide RNA and a second guide RNA. In preferred embodiments, all vectors in the library have the same first guide RNA (e.g., a guide RNA targeting the TRAC locus). In some embodiments, each vector in the library contains a second guide RNA that is specific across multiple AAV vectors. The library contains approximately 100 to approximately 300,000, approximately 1,000 to approximately 5,000, or approximately 5,000 to approximately 10,000 distinct guide RNAs in total.

[0021] Cells containing vectors and libraries thereof are also provided. For example, a population of cells may contain any of the vectors described above. Populations of cells containing the library as a whole are also provided. In some embodiments, each cell in the population contains at most one or two AAV vectors contained in the library.

[0022] Methods for using vectors and their libraries are also described. For example, vectors and libraries can be used to perform high-throughput screening. An exemplary method includes the step of identifying one or more genes that enhance a desired phenotype in cells containing CARs. Generally, the method includes (a) exposing a population of cells containing the entire library of vectors to an RNA-induced endonuclease and conditions suitable for genomic integration of crRNA and CAR expression cassettes and expression of the guide RNA and CAR encoded therein; and (b) selecting cells exhibiting a desired phenotype. In a preferred embodiment, the crRNA and CAR expression cassettes are integrated into the TRAC locus.

[0023] RNA-inducible endonucleases can be introduced into cells by viral vectors encoding RNA-inducible endonucleases, or by direct electroporation of endonuclease proteins or endonuclease protein-RNA complexes. RNA-inducible endonucleases can also be provided as mRNA encoding them. The mRNA may contain modifications such as N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine (ψ), N1-methylpseudridine (me1ψ), and 5-methoxyuridine (5moU); a 5' cap; a poly(A) tail; one or more nuclear localization signals; or a combination thereof. The mRNA may have codons optimized for expression in eukaryotic cells and can be introduced into cells, for example, by electroporation, transfection, and / or nanoparticle-mediated delivery. Preferred RNA-induced endonucleases include Cpf1, or its variants, derivatives, or fragments, such as Cpf1 derived from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1, including improved variants such as enAsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), Lachnospiraceae bacterium MA2020 (Lb2Cpfl), Lachnospiraceae bacterium MC2017 (Lb3Cpfl), Moraxella bovoculi 237 (MbCpf1), or Prevotella disiens (PdCpf1).

[0024] The method is suitable for identifying cells exhibiting any desired characteristics or phenotypes. Exemplary phenotypes that may be screened or selected include increased tumor / tumor microenvironment invasion, increased or optimized target cell affinity, increased cytotoxicity to target cells, increased persistence, increased growth / proliferation, reduced exhaustion, improved anti-cancer metabolic function, increased ability to prevent immune evasion, reduced nonspecific cytokine production, decreased off-target toxicity, reduced cytokine release syndrome (CRS) (e.g., when introduced in vivo), and combinations thereof. In some embodiments, cells with the desired phenotype are selected by co-culturing a population of cells with target cells for any period suitable for sufficient selection. This may be a defined period, e.g., about 1 to about 60 days. Cells may be repeatedly co-culturified during this period (e.g., new batches of target cells may be periodically added to the co-culture). Generally, target cells express one or more antigens recognized by CAR. In some embodiments, the target cells are cancer cells. In some embodiments, cells having a desired phenotype are selected by flow cytometry-based or affinity-based sorting, selection based on immunomarkers, in vivo tumor invasion (e.g., exposing a population of cells to target cells within the subject, e.g., tumor cells, for a period of time that allows for sufficient selection), CAR-antigen interactions, directed evolution, or a combination thereof.

[0025] The method may further include the step of identifying the crRNA expression cassette present in selected cells. Such identification can be achieved by sequencing the genomic DNA of the selected cells (e.g., in or near the genomic integration region). Once the crRNA expression cassette present in the selected cells is known, genes that enhance the desired phenotype can be identified as genes targeted by the guide RNA encoded by the crRNA expression cassette.

[0026] The cells used in the composition and method are T cells (e.g., CD8 +T cells, e.g., effector T cells, memory T cells, central memory T cells, and effector memory T cells; CD4 + This could be T cells (e.g., Th1 cells, Th2 cells, Th3 cells, Th9 cells, Th17 cells, Tfh cells, and Treg cells; or gamma-delta T cells / gdT cells), hematopoietic stem cells (HSCs), macrophages, natural killer cells (NKs), B cells, dendritic cells (DCs), or other immune cells.

[0027] For example, isolated cells that can be modified according to the methods described above are described. For example, isolated CAR T cells are provided that express a CAR and also have one or more mutations in one or more genes identified by the screening methods described above. In some embodiments, cells can be selected and isolated by the screening methods, or cells can be independently generated by modifying cells to express a CAR of interest and to contain one or more mutations in one or more genes identified by screening. Mutations can cause partial or complete loss of function of a gene or its gene product. In some embodiments, CAR T cells contain one or more mutations in one or more genes selected from Table 2 or Table 3. In preferred embodiments, CAR T cells contain one or more mutations in genes selected from PRDM1, DPF3, SLAMF1, TET2, HFE, PELI1, PDCD1, HAVCR2 / TIM3, TET2, NR4A2, LAIR1, USB1 and combinations thereof. In some embodiments, isolated CAR T cells exhibit one or more desirable phenotypes (e.g., phenotypes selected or screened by the methods provided). For example, compared to CAR T cells that do not contain one or more gene mutations, the cells may exhibit increased memory, increased cell proliferation, increased persistence, increased cytotoxicity against target cells (e.g., cancer cells), decreased T cell terminal differentiation, and / or reduced T cell exhaustion. Populations of cells can be obtained by expanding isolated cells. Pharmaceutical compositions containing populations of cells together with pharmaceutically acceptable buffers, carriers, diluents, or excipients are also provided.

[0028] Methods of treatment are also provided. Exemplary methods include treating a subject having a disease, disorder, or condition by administering an effective amount of the pharmaceutical composition described above to the subject. In some embodiments, the disease, disorder, or condition is associated with the high or specific expression of an antigen. Generally, the cells in the composition (e.g., CAR T cells) express CARs that specifically target the antigen. Cells for use according to the composition and method can be obtained from any suitable source. For example, in some embodiments, cells can be obtained from a healthy donor. In some embodiments, cells can be obtained from a subject having a disease, disorder, or condition. Preferably, the cells are obtained from the donor or subject before being genetically modified to express CARs and to contain a desired mutation in one or more genes.

[0029] In some embodiments, the disease, disorder, or condition is cancer, inflammatory disease, neuronal disorder, HIV / AIDS, diabetes, cardiovascular disease, infectious disease, or autoimmune disease.

[0030] Exemplary cancers include, but are not limited to, leukemia or lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), mantle cell lymphoma, non-Hodgkin lymphoma, and Hodgkin lymphoma.

[0031] Preferably, the subject to be treated according to any of the above-described treatment methods may be a human being. [Brief explanation of the drawing]

[0032] [Figure 1]Figure 1 shows the establishment and characterization of the CLASH system for mass chimeric antigen receptor (CAR) manipulation in human primary T cells. Figure 1 is a schematic diagram of the AAV construct design for CLASH. The crRNA expression cassette and CAR expression cassette were inserted between the left and right TRAC homologous arms in the AAV skeleton. Figure 1 also shows a schematic diagram of CLASH-mediated simultaneous CAR-T and Descartes library knock-in to the TRAC locus in human primary CD8 T cells. Human primary CD8 T cells were transduced with AAV-CLASH Descartes-Lib AAV6 after 4 hours of electroporation with Cas12a mRNA. The crRNA and CAR transgenes show parallel integration to the TRAC locus via AAV-mediated HDR. [Figure 2-1] Figure 2A is a schematic diagram showing the Rene and Descartes library designs. The diagram of the immunogene category circles is not drawn to exact proportions. The Descartes library contains the entire Rene library as well as an additional set of immunogenes and additional non-targeted control (NTC) crRNAs. Figure 2B is a schematic diagram of CAR-T cell persistence screening by continuous co-culture with NALM6 cells. CAR-T cells were co-cultured with NALM6 at an E:T ratio of 0.2:1 for 8 rounds after electroporation. Stimulation time points are indicated in chronological order. Figures 2C–2H are bar graphs showing quantification of memory, cytotoxicity, and exhaustion marker expression in vector and Descartes-Lib CAR-T cells after repeated co-culture with NALM6. The percentages of CD45RO+CCR7+ (Figure 2C), IFNγ+ (Figure 2D), TNFα+ (Figure 2E), PD-1+ (Figure 2F), LAG3+ (Figure 2G), and TIGIT+ (Figure 2H) cells are quantified in each group (infection replication, n=3). Significance was assessed using independent two-sided t-tests. *p<0.05, ***p<0.001. Data are shown as mean ± sem. [Figure 2-2] Same as above. [Figure 3-1]Figures 3A and 3B are graphs showing screening analyses of day 32 (Figure 3A) or day 54 (Figure 3B) samples compared to day 0 samples, using log-normalized differences in crRNA abundance. Figures 3C to 3K are graphs showing quantification of CD45RO+CCR7+ (Figures 3C, 3D, 3E), IFNγ+ (Figures 3F, 3G, 3H), and TNFα+ (Figures 3I, 3J, 3K) CAR-T cell percentages compared to vector controls for each candidate gene. Marker expression levels were measured after 5 days of electroporation. Statistical significance was assessed using one-way ANOVA with Dunnett's multiple comparison test. Figure 3L is a graph showing quantification of the CAR-T cell to cancer cell ratio at day 14 (pooled spleen and bone marrow samples; n=6 mice, 12 samples). Significance was assessed using the Mann-Whitney test. Figure 3M shows Venn diagrams of overlapping top crRNAs between in vitro (days 32 and 54) and in vivo (days 7, 11, and 14) CLASH-Descartes experiments. FDR=5% *p<0.05, **p<0.01, ***p<0.001, and nsP>0.05. Data are shown as mean ± sem. [Figure 3-2] Same as above. [Figure 3-3] Same as above. [Figure 4-1]Figures 4A–4T illustrate the characterization of PRDM1 mutant CAR T cells. Figure 4A is a schematic diagram of the primary structure of the PRDM1 protein, with two different PRDM1 crRNA cleavage sites pointed to the PR domain and zinc finger domain, respectively. Predicted PRDM1-cr1 and PRDM1-cr2 cleavage sites are indicated by red arrows. Three qPCR probe target sites are indicated by blue arrows. Figure 4B is a graph showing the quantification of total indel percentages at genomic loci targeted by PRDM1-cr1 / cr2 in different healthy donor and CAR-T morphologies. Genomic DNA was isolated from CAR-T cells treated with vector or PRDM1-cr1 / cr2 AAV6 over 5 days (technical replication, n=3). Data are shown as mean ± sem. Figures 4C–4D show Nextera-NGS sequencing results illustrating specific variants observed in genomic regions targeted by PRDM1-cr1 (Figure 4C) and PRDM1-cr2 (Figure 4D) in CAR-T cells. The percentage of total reads corresponding to each genotype is indicated in the blue box on the right. The red arrowheads indicate predicted cleavage sites. One representative sample data from three infection replication cycles is shown. Figures 4E to 4M are graphs showing the quantification of the percentages of CD62L+ (Figure 4E), CCR7+ (Figure 4F), CD28+ (Figure 4G), IL7RA+ (Figure 4H), TNFα+ (Figure 4I), IFNγ+ (Figure 4J), granzyme B+ (Figure 4K), LAG3+ (Figure 4L), and TIM3+ (Figure 4M) cells in vector or PRDM1-cr1 / cr2 mutant CAR-T cells (infection replication, n=3). All experiments were analyzed by two-way ANOVA with Tukey multiple comparison test to assess significance. *P<0.05, **p<0.01, ***P<0.001 and ns p>0.05, data are shown as mean ± sem. Figures 4N to 4O are graphs showing the quantification of the frequencies of CCR7+ (Figure 4N) and CD62L+ (Figure 4O) in different healthy donors (n=5) after transduction with vector or PRDM1-cr1 AAV6 over a 5-day period.Significance was assessed using a paired t-test. **P<0.01. Figures 4P–4Q are graphs showing the proliferation of CLASH-generated PRDM1 and control CD22 CAR-T cells in donor 2 (Figure 4P) and donor 0286 (Figure 4Q) in response to stimulation with mitomycin-C pre-treated NALM6 cells after 5 days of electroporation. CAR-T cells were transduced separately with vector or PRDM1-cr1 AAV6 (cell culture replication, n=3). Significance was assessed using two-way ANOVA, ***p<0.001. Data are shown as mean ± sem. Figure 4R is a graph showing the time course analysis of IFNγ protein expression in vector and PRDM1 mutant CAR-T cells in response to NALM6 cell stimulation in each round. Significance was assessed using two-way ANOVA with Tukey multiple comparison test. Comparisons between the vector and PRDM1 groups at each time point were also performed. *P<0.05, **P<0.01, and ***P<0.001; data are shown as mean ± sem. Figures 4S-4T are graphs showing the cytotoxicity of vector and PRDM1 mutant CAR-T cells by cell death assays after 7 rounds of co-culture with NALM6 and donor 2 (Figure 4S) and donor 0286 (Figure 4T). In vitro cytotoxic activity of CAR-T cells was measured by bioluminescence assays at different E / T ratios using NALM6-GL cells stably transduced with GFP and luciferase genes as target cells. Significance was assessed using two-way ANOVA. ***P<0.001; data are shown as mean ± sem. [Figure 4-2] Same as above. [Figure 4-3] Same as above. [Figure 4-4] Same as above. [Figure 4-5] Same as above. [Figure 5-1]Figures 5A to 5L demonstrate that PRDM1 mutant CAR-T cells exhibit enhanced therapeutic efficacy in vivo. Figure 5A is a schematic diagram of the experimental design. To evaluate the antitumor capacity of PRDM1 mutant CAR-T cells in vivo, mice were injected with 5 × 10⁵ NALM6-GL cells on day 0. On day 3, they were injected with either the vector, PRDM1 mutant CAR-T cells, or untransduced CD8 T cells. Mice were imaged every 3–4 days. After termination, the spleen, blood, and bone marrow were analyzed by flow cytometry. Figure 5B is a graph showing the quantification of systemic bioluminescence signaling over time, comparing normal CD8 T cells, the vector, and PRDM1 CAR22 cells. Figure 5C is a graph showing the quantification of systemic bioluminescence signaling over time, comparing normal T cells, the vector, and PRDM1-CAR19 cells. Significance was assessed using two-way ANOVA in Figures 5A and 5B. ***P<0.001, data shown as mean ± sem. Figures 5D-5F are graphs showing the quantification of the CAR-T cell to cancer cell ratio in blood (Figure 5D), bone marrow (Figure 5E), and spleen (Figure 5F). Significance was assessed using the Mann-Whitney test. Figures 5G-5I are graphs showing the quantification of the percentage of memory-like CAR-T (CD45RO+CD62L+) in blood (Figure 5G), bone marrow (Figure 5H), and spleen (Figure 5I). Figures 5D-5I: Vector CAR19 (n=8) and PRDM1 CAR19 (n=8). Significance was assessed using the Mann-Whitney test. **P<0.01, ***P<0.001 and ns P>0.05, data shown as mean ± sem. Figures 5J to 5L show survival curves for animals with leukemia treated with either the vector or PDRM1 mutant CD22 CAR T cells on day 3 after tumor induction (Figure 5J), the vector or PDRM1 mutant CD22 CAR T cells on day 8 after tumor induction (Figure 5K), and the vector or PDRM1 mutant CD19 CAR T cells on day 3 after tumor induction (Figure 5L).pXD60 = vector control anti-CD22 TRAC knock-in CAR-T; pXD60-PRDM1 = cr-PRDM1 CLASH anti-CD22 TRAC knock-in CAR-T; pXD71 = vector control anti-CD19 TRAC knock-in CAR-T; pXD71-PRDM1 = cr-PRDM1 CLASH anti-CD19 TRAC knock-in CAR-T. In Figures 5J to 5L, significance was evaluated using the log-rank test, p < 0.0001. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 5-4] Same as above. [Figure 6-1] Figure 6A is a volcano plot of differentially expressed genes in PRDM1 mutant vs. control CD22 CAR-T cells on day 33. Figures 6B and 6C are enrichment plots showing enriched gene ontology pathways found by DAVID analysis in differentially upregulated genes (Figure 6B) and differentially downregulated genes (Figure 6C) in PRDM1-deficient vs. control CAR-T cells with a q-value threshold < 1e-3 on day 33. [Figure 6-2] Same as above. [Figure 7-1]Figures 7A and 7B are graphs showing the quantification of CD28 (Figure 7A) and IL7RA (Figure 7B) positive cells in CLASH-generating vector and PRDM1 mutant CD22 CAR-T cells in the first, third, and fifth rounds of co-culture with NALM6 cells (infection replication, n=3). Figures 7C to 7J are graphs showing the quantification of mRNA expression by RT-PCR analysis for KLF2 (Figure 7C), S1PR1 (Figure 7D), TBX21 (Figure 7E), FOXO1 (Figure 7F), NFKB1 (Figure 7G), STAT1 (Figure 7H), STAT6 (Figure 7I), CDCA7 (Figure 7J), and BATF (Figure 7K) in vector and PRDM1 mutant CAR-T cells in the first, third, and fifth rounds of co-culture with NALM6 cells (infection replication, n=3). Figures 7L to 7O are graphs showing the quantification of TIM3 / HAVCR2 (Figure 7L), LAG3 (Figure 7M), 2B4 / CD244 (Figure 7N), and CD39 / ENTPD1 (Figure 7O) positive cells in vector and PRDM1 mutant CAR-T cells in the first, third, and fifth rounds of co-culture with NALM6 cells (infection replication, n=3). Surface marker expression was assessed by flow cytometry. All experimental data were analyzed by two-way ANOVA with Sidac's multiple comparison test to assess significance. *P<0.05, **P<0.01, ***P<0.001, and ns P>0.05; data are shown as mean ± sem. Figure 7P is a schematic diagram showing the immunological phenotype and associated genes in PRDM1 mutant CAR-T cells. [Figure 7-2] Same as above. [Figure 7-3] Same as above. [Figure 7-4] Same as above. [Figure 7-5] Same as above. [Modes for carrying out the invention]

[0033] Detailed description of the invention Genetically modified CAR-T cells are expected to exhibit potent and specific antitumor activity in clinical settings, acting as "living drugs" (Porter, DL., et al., N. Engl. J. Med., 365(8): 725-733 (2011)). Transduction efficiency, transgene expression levels, and CAR stability or retention are important aspects of CAR T cell therapy. However, in conventional lentiviral transduction, CAR-T cells tend to lose their transgenes and, therefore, tend to lose their ability to recognize and destroy cancer cells (Ellis, J., Human Gene Therapy., 16:1241-1246 (2005)). Therefore, manipulating CAR-T persistence has become one of the most important tasks to give CAR-T cells sufficient power and thereby enable their effectiveness in vivo.

[0034] As demonstrated in the examples, a high-throughput method was developed to test factors that can enhance the persistence and / or other desirable characteristics of CAR-T cells during manipulation. This method addresses several technical challenges in CAR-T manipulation, including (1) how to increase CAR-T knock-in in a large-scale parallel manner; (2) how to accurately compare different variants of CAR-T cells that have a stable, standardized core CAR component across all variants; (3) how to ensure quantitative evaluation between different CAR variants at high resolution in the same setting; and (4) how to target a set of CAR-T candidates with a high probability of maximizing the opportunity to devise or select the most promising candidates for validation and downstream research and development.

[0035] These challenges are overcome by the development of a platform for highly efficient, large-scale parallel CAR-T manipulation. This platform, Cas12a / Cpf1-based Large-scale AAV-perturbation with Simultaneous HDR-knockin (CLASH), enables the rapid generation of customer-desired CAR-T variants in a simple procedure involving Cpf1 mRNA electroporation via multifunctional pooled AAV transduction. The example demonstrates that the CLASH method generates library-scale CAR-Ts, each knocked into a desired locus in the genome using one additional candidate immunomodulator disrupted by the Cas12a / Cpf1 system. The CAR-T variant library was systematically assayed using a long-term co-culture system of CAR-T cells and antigen-specific cancer cells, thereby identifying candidate CAR-T variants with long-term persistence. Re-engineering and validation of these top variants individually demonstrated that they enhance CAR-T cell persistence by increasing memory-like surface markers and / or cytotoxic cytokine release. Among these, PRDM1-mutant CAR-T increased the potential, lifespan, proliferation, and persistence of memory cells in vivo in a mouse model of leukemia, which translated to therapeutic efficacy. Thus, CLASH demonstrates rapid, efficient, and highly scalable manipulation of CAR-T cells for rational optimization of persistence while maintaining versatility for application to other desired features.

[0036] I. Definition In the context of genome modification, "introduce" refers to making contact. For example, introducing a gene editing composition (e.g., one containing RNA-induced endonuclease or an AAV vector) into a cell results in contact between the cell and the composition. The term encompasses the transmission of the contact composition into the cell by any suitable means, such as transfection, electroporation, transduction, gene gun, nanoparticle delivery, etc.

[0037] "Homologous" refers to sequence similarity or sequence identity between two polypeptides or two nucleic acid molecules. When the positions in both sequences being compared are occupied by the same base or amino acid monomer subunit—for example, when the positions in each of two DNA molecules are occupied by adenine—then those molecules are homologous at that position. The percentage of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions being compared, multiplied by 100. For example, if 6 out of 10 positions in two sequences match or are homologous, then the two sequences are 60% homologous. As an example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, comparisons are performed when the two sequences are aligned to obtain the greatest possible homology.

[0038] The term “operatably linked” or “linked to function” refers to a functional link between a regulatory sequence and a heterogeneous nucleic acid sequence that enables them to function in their intended manner (e.g., resulting in the expression of the latter). The term encompasses positioning the regulatory region and the sequence to be transcribed into the nucleic acid in a location that influences the transcription and translation of such sequence. For example, to place a coding sequence under the control of a promoter, the translation start site of the translation reading frame of a polypeptide is generally located between 1 and approximately 50 nucleotides downstream of the promoter. However, the promoter may also be located approximately 5,000 nucleotides upstream of the translation start site, or approximately 2,000 nucleotides upstream of the transcription start site. Promoters generally include at least a core (basic) promoter.

[0039] "Endogenous" refers to any material that originates from within or is produced within an organism, cell, tissue, or system. "Exogenous" refers to any material that is introduced from outside an organism, cell, tissue, or system, or is produced outside of it.

[0040] The term “expression” encompasses the transcription and / or translation of a specific nucleotide sequence driven by a promoter. “Expression vector” or “expression cassette” refers to a vector containing a recombinant polynucleotide having an expression regulatory sequence operably ligated to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, while other elements for expression may be supplied by host cells or within an in vitro expression system. Expression vectors include all known in the art that incorporate recombinant polynucleotides, e.g., cosmids, plasmids (e.g., naked or liposome-containing), phagemids, BACs, YACs, and viral vectors (e.g., vectors derived from lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0041] The term "homologous recombination repair," or HDR, refers to a cellular process in which broken or nicked ends of a DNA strand are repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced by the template sequence. The homologous template nucleic acid can be provided by a homologous sequence located somewhere in the genome (sister chromatid, homologous chromosome, or a repeating region on the same or different chromosome). Alternatively, an exogenous template nucleic acid can be introduced to achieve the specific changes induced by HDR at a target site in the sequence. In this way, specific mutations can be introduced at the break site.

[0042] A "mutation" refers to a change in the sequence of a nucleotide (e.g., DNA) that results in a modification from a given reference sequence. A mutation can be a deletion, insertion, duplication, and / or substitution of at least one deoxyribonucleic acid base, such as a purine (adenine and / or guanine) and / or pyrimidine (thymine, uracil, and / or cytosine). A mutation may or may not result in a discernible change in the observable characteristics (phenotype) of the subject.

[0043] The term “antigen” refers to a molecule to which an antibody or T cell receptor (e.g., CAR) can bind. In some embodiments, an antigen can induce an immune response. This immune response may result in either antibody production or activation of specific immune-qualified cells, or both. It will be understood by those skilled in the art that any macromolecule, including proteins or peptides, can function as an antigen. Furthermore, antigens may be derived from recombinant or genomic DNA. It will be understood by those skilled in the art that any DNA containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response can encode an “antigen.” Furthermore, it will be understood by those skilled in the art that an antigen does not need to be encoded by the full-length nucleotide sequence of a gene. Furthermore, it will be understood by those skilled in the art that an antigen does not need to be encoded by a “gene” at all. Antigens can be synthesized or obtained from biological samples. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids. In the context of cancer, “antigen” refers to an antigenic substance produced in tumor cells, and therefore capable of inducing an immune response in the host. These cancer antigens may be useful as markers for identifying tumor cells that may be potential candidates / targets during treatment or therapy. There are several types of cancer or tumor antigens. These include cancer / tumor-specific antigens (TSAs), which are present only on tumor cells and not on healthy cells, and cancer / tumor-associated antigens (TAAs), which are present in tumor cells and also on some normal cells. In some embodiments, TAAs are more abundantly expressed in cancer cells than in non-cancerous cells. In some embodiments, chimeric antigen receptors are specific to tumor-specific antigens. In some embodiments, chimeric antigen receptors are specific to tumor-associated antigens.

[0044] A "bispecific chimeric antigen receptor" refers to a CAR containing two antigen-binding domains, wherein the first domain is specific to a first ligand / antigen / target and the second domain is specific to a second ligand / antigen / target. In some embodiments, the ligand / antigen / target is a B cell-specific protein, a tumor-specific ligand, a tumor-associated ligand, or a combination thereof. A bispecific CAR is specific to two different antigens. A multispecific or multivalent CAR is specific to one or more different antigens, e.g., two, three, four, five, or more. In some embodiments, a multispecific or multivalent CAR targets and / or binds to three or more different antigens.

[0045] "Code" or "encoding" refers to the inherent properties of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, that serve as a template for the synthesis of other polymers and macromolecules having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids in biological processes, and the resulting biological properties. Thus, a gene codes for a protein if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and used as a template for the transcription of a gene or cDNA, and the non-coding strand can be said to code for a protein or other product of that gene or cDNA.

[0046] The terms "target nucleic acid," "target sequence," and "target site" refer to nucleic acid sequences designed to specifically hybridize with oligonucleotides such as gRNA. A target nucleic acid has a sequence complementary to the nucleic acid sequence of the corresponding oligonucleotide that is directed to the target. A target nucleic acid or target site can refer to a specific sequence of a larger nucleic acid, or an entire sequence (e.g., a gene or mRNA), to which the oligonucleotide is directed. The differences in usage should be clear from the context.

[0047] The term “locus” refers to a specific physical location on a chromosome for a DNA sequence (e.g., a gene). The term “locus” can also refer to a specific physical location on a chromosome for an RNA-induced endonuclease target sequence. Such a locus may include a target sequence recognized and / or cleaved by an RNA-induced endonuclease. It is understood that a locus of interest may include nucleic acid sequences present in the body of the cellular genetic material (e.g., on chromosomes) and also in parts of the genetic material that may exist independently of the aforementioned body, such as plasmids, episomes, viruses, transposons, or, in non-limiting examples, organelles such as mitochondria.

[0048] "Isolated" means modified or removed from its natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not "isolated," but the same nucleic acid or peptide that is partially or completely separated from its naturally occurring coexisting material is "isolated." Isolated nucleic acids or proteins can exist in a substantially purified form or in a non-natural environment, such as a host cell. "Isolated nucleic acid" refers to a nucleic acid segment or fragment separated from the sequence adjacent to it in its natural state, for example, a DNA fragment that has been removed from the sequence that would normally be adjacent to it in its naturally occurring genome. The term also applies to nucleic acids that are substantially purified from other components that naturally accompany the nucleic acid (e.g., RNA or DNA or proteins that naturally accompany it in a cell). Thus, the term includes, for example, recombinant DNA that is incorporated into a vector, an autocopulatory plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or that exists as a separate molecule independently of other sequences (e.g., as cDNA, or as a genome or cDNA fragment, produced by PCR or restriction enzyme digestion).

[0049] In the context of cells, the term “isolated” refers to cells that have been altered or removed from their native state. Therefore, isolated cells are in an environment different from the environment in which they naturally exist, for example, by being separated from their natural environment, for example, by being concentrated to a concentration not found in nature. “Isolated cells” is intended to include cells in a sample in which the cells of interest are substantially enriched and / or in which the cells of interest are partially or substantially purified.

[0050] The terms “transformed,” “transduced,” and “transfected” encompass the introduction of nucleic acids or other materials into cells by one of several techniques known in the art.

[0051] A “vector” is a composition of matter containing isolated nucleic acids that can be used to deliver isolated nucleic acids into the interior of a cell. Examples of vectors include, but are not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term “vector” includes self-replicating plasmids or viruses. The term is also interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds and liposomes. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, and retroviral vectors.

[0052] The term “sequence identity percentage (%)” refers to the percentage of nucleotides or amino acids in a candidate sequence that are identical to a nucleotide or amino acid in a reference nucleic acid sequence, after the sequences have been aligned and gaps introduced as necessary to achieve the maximum sequence identity percentage. Alignment for determining sequence identity percentage can be achieved in various ways within the scope of the skills in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR) software. Appropriate parameters for measuring alignment, including any algorithm necessary to achieve maximum alignment over the entire length of the sequences being compared, can be determined by known methods.

[0053] The sequence identity percentage of a given nucleic acid or amino acid sequence C to, with, or relative to a given nucleic acid or amino acid sequence D (which may instead be expressed as a given sequence C having or containing a particular sequence identity percentage to, with, or relative to a given sequence D) is calculated as follows: 100 multiplied by the fraction W / Z (Here, W is the number of nucleotides or amino acids that are scored as identical matches in the alignment of C and D by the sequence alignment program, and Z is the total number of nucleotides or amino acids in D). It will be understood that if the length of sequence C is not equal to the length of sequence D, then the sequence identity % of C to D will not be equal to the sequence identity % of D to C.

[0054] The term "subject" includes, but is not limited to, animals, plants, bacteria, viruses, parasites, and any other living organism or entity. Subjects may be vertebrates, more specifically mammals (e.g., humans, horses, pigs, rabbits, dogs, sheep, goats, non-human primates, cows, cats, guinea pigs, or rodents), fish, birds, reptiles, or amphibians. The term does not indicate a specific age or sex. Therefore, it is intended to encompass adult and neonatal subjects, as well as fetuses, regardless of sex. "Patient" refers to a subject suffering from a disease or disorder. The term "patient" includes human and veterinary subjects.

[0055] The terms “inhibit” or “reduce” and other forms of these words, e.g., “inhibit” or “reduce,” mean to reduce, hinder, or suppress a particular characteristic, such as activity, response, state, disease, or other biological parameter. It is understood that this is generally relative to some standard or expected value, but does not necessarily require mentioning a standard or relative value. “Inhibit” or “reduce” can also mean hindering or suppressing the synthesis, expression, or function of a protein compared to a standard or control. Inhibition / reduction may include, but is not limited to, the complete elimination of activity, response, state, disease, or other biological parameter. For example, the term may encompass a 10% reduction in activity, response, state, disease, or other biological parameter compared to natural or control levels. In some embodiments, the reduction may be an integer between approximately 1% and 100% or any amount in between, compared to the natural or control level.

[0056] "Treatment" or "to treat" means administering a composition to an object or system having an undesirable condition (e.g., cancer). A condition may include one or more symptoms of a disease, pathological condition, or disorder. Treatment includes the medical management of an object for the purpose of curing, alleviating, stabilizing or preventing a disease, pathological condition, or disorder. This includes active treatment, i.e., treatment carried out particularly toward improvement of the disease, pathological condition, or disorder, and also causal treatment, i.e., treatment carried out toward the removal of the cause of the associated disease, pathological condition, or disorder. In addition, the term includes palliative treatment, i.e., treatment planned for the relief of symptoms rather than a cure of the disease, pathological condition, or disorder; preventive treatment, i.e., treatment aimed at minimizing, or partially or completely preventing, the onset of the associated disease, pathological condition, or disorder; and supportive treatment, i.e., treatment used to complement another specific treatment carried out toward improvement of the associated disease, pathological condition, or disorder. It is understood that treatments are intended to cure, alleviate, stabilize or prevent a disease, pathological condition, or disorder, but do not necessarily need to actually result in a cure, alleviation, stabilize or prevention. The effects of treatments can be measured or assessed in a manner that is described and known as suitable for diseases, pathological conditions, or disorders included in the art. Such measurements and assessments can be made from a qualitative and / or quantitative perspective. Thus, for example, the characteristics or features of a disease, pathological condition, or disorder, and / or the symptoms of a disease, pathological condition, or disorder can be reduced to any effect or to any amount.

[0057] "Prevention" or "prevention" means administering the composition to an object or system at risk of an undesirable condition (e.g., cancer). The condition may include one or more symptoms of a disease, pathological condition, or disorder. The condition may also be a predisposition to a disease, pathological condition, or disorder. The effect of administering the composition to an object may be the cessation of a particular symptom of the condition, the reduction or prevention of the symptoms of the condition, a decrease in the severity of the condition, the complete elimination of the condition, the stabilization or delay of the occurrence or progression of a particular event or characteristic, or a reduction in the chance of a particular event or characteristic occurring.

[0058] The term “effective dose” or “therapeutic dose” means an amount sufficient to alleviate or improve one or more symptoms of the disorder, disease, or condition being treated, or to provide a differently desired pharmacological and / or physiological effect. Such improvement requires only reduction or modification, and does not necessarily require complete disappearance. The exact amount will vary depending on various factors, such as subject-dependent variable factors (e.g., age, immune system health, weight, etc.), the disease or disorder being treated, the route of administration, and the pharmacokinetics and pharmacodynamics of the administered drug.

[0059] "Pharmacologically acceptable" means a material that is not biologically or otherwise undesirable. For example, the material can be administered to a subject together with a selected compound without producing any undesirable biological effects or adversely interacting with any of the other components of the pharmaceutical composition contained in the pharmaceutical composition.

[0060] Unless otherwise indicated herein, the enumeration of value ranges is intended solely as a way of abbreviating the individual values ​​contained within the range, and each individual value is incorporated herein as if it were individually enumerated.

[0061] The use of the term "approximately" is intended to describe a value within a range of approximately + / - 10% above or below the stated value, and in other embodiments, the value may have a range of approximately + / - 5% above or below the stated value.

[0062] II. Composition Compositions for use in methods are provided. For example, gene editing compositions for use in methods for modifying the genome of cells are provided. Exemplary compositions include nucleic acid vectors, libraries thereof, and cells containing the vectors and libraries. Pharmaceutical compositions containing modified cells are also provided.

[0063] A. Gene editing compositions Exemplary gene-editing compositions for modifying the genome of cells include RNA-induced endonucleases and vectors (e.g., AAV vectors). The vectors may contain sequences encoding one or more crRNAs that direct the endonuclease to one or more target genes (e.g., a crRNA expression cassette), sequences encoding one or more chimeric antigen receptors (e.g., a CAR expression cassette), and / or one or more sequences homologous to one or more target sites (e.g., TRACs).

[0064] RNA-inducible endonucleases and vectors may be in the same or different compositions and may be introduced into cells together or separately. For example, RNA-inducible endonucleases and vectors may be provided in different compositions that are introduced into cells together or separately. In some embodiments, when the gene editing composition is administered as isolated nucleic acids or contained within an expression vector, the RNA-inducible endonuclease (e.g., Cpf1) may be encoded by the same nucleic acid or vector as the crRNA and CAR expression cassette. Alternatively, or in addition, the RNA-inducible endonuclease may be encoded in a nucleic acid or vector that is physically separate from the vector encoding the crRNA and CAR expression cassette.

[0065] In some embodiments, after the introduction of an RNA-induced endonuclease, the AAV vector may be introduced into cells immediately or after a specific period of time, for example, about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, or 96 hours.

[0066] RNA-induced endonucleases can modify one or more target genes or their gene products (e.g., increase or decrease their expression and / or increase or decrease their activity). For example, RNA-induced endonucleases can cause disruption of one or more target genes. This disruption may result in reduced or absent expression and / or decreased or absent activity of the target gene or gene product, and may include, but is not limited to, insertions, deletions, duplications, translocations, DNA or histone methylation, acetylation, and combinations thereof. Methods for determining the expression and / or activity of gene products are known in the art. These include, but are not limited to, PCR, Northern blotting, Southern blotting, Western blotting, nuclease surveyor assays, sequencing, ELISA, FACS, mRNA sequencing, single-cell RNA sequencing, and other molecular biology, chemical, biochemical, cell biology, and immunology assays. Those skilled in the art will understand how to determine and / or confirm the modification of a target gene based on methods known in the art and the teachings described herein.

[0067] RNA-inducible endonucleases can be introduced into cells by a variety of techniques, including viral and nonviral methods. For example, RNA-inducible endonucleases can be introduced by viral vectors encoding RNA-inducible endonucleases (e.g., retroviruses, such as lentiviruses, adenoviruses, poxviruses, Epstein-Barr viruses, or adeno-associated viruses (AAVs)). Nonviral methods, such as physical and / or chemical methods, can also be used and include, but are not limited to, cationic liposomes and polymers, DNA nanoclews, gene guns, microinjection, transfection, electroporation, nucleofection, particle bombardment, sonication, magnetofection, conjugation with cell-permeable peptides, and / or nanoparticle-mediated delivery. Such methods are described, for example, in Nayerossadat N., et al., Adv. Biomed. Res., 1:27 (2012) and Lino CA, et al., Drug Deliv., 25(1):1234-1257 (2018). Considering the advantages and disadvantages of each method, those skilled in the art will be able to determine the optimal method for introducing RNA-induced endonucleases.

[0068] In a preferred embodiment, mRNA is introduced into cells by electroporation. Electroporation is a transient destabilization of the cell membrane by inserting a pair of electrodes into the cell membrane, which in turn allows nucleic acid molecules (e.g., DNA, RNA) in the culture medium surrounding the destabilized membrane to permeate into the cytoplasm and nucleoplasm of the cell. RNA-inducible endonucleases can also be introduced by direct electroporation of the endonuclease protein or the endonuclease protein-RNA complex (e.g., the endonuclease protein complexed with crRNA).

[0069] In a preferred embodiment, RNA-induced endonucleases can be provided to cells in the form of mRNA encoding the RNA-induced endonuclease. The mRNA may or may not be modified. The mRNA may be modified, for example, to reduce the immunogenicity of the RNA-induced endonuclease, to optimize translation, and / or to result in increased stability and / or increased expression. Modified mRNA can incorporate several chemical changes into the nucleotides, including changes to nucleic acid bases, ribose sugars, and / or phosphodiester linkages. Compared to unmodified mRNA, these modified mRNAs can improve the efficiency of the RNA-induced endonuclease, reduce off-target effects, reduce toxicity, increase endonuclease protein levels, increase endonuclease activity, and / or increase mRNA stability. Li, B., et al., Nat. Biomed. Eng., 1(5): pii: 0066 (2017) and WO2017 / 181107 disclose compositions and methods for modifying mRNA that can be used according to the compositions and methods.

[0070] Exemplary mRNA modifications include, but are not limited to, N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine (ψ), N1-methylpseudridine (me1ψ), and 5-methoxyuridine (5moU), a 5' cap, a poly(A) tail, one or more nuclear localization signals, or a combination thereof.

[0071] mRNA can be codon-optimized for expression in eukaryotic cells (e.g., cells derived from plants, humans, mice, rats, rabbits, dogs, or non-human mammals or primates). Codon optimization refers to a genetic engineering technique that uses rare codon changes to synonymous codons that are more frequently used in a target cell type, with the aim of increasing protein production. Generally, codon optimization involves modifying a nucleic acid sequence by replacing at least one codon in the native sequence (e.g., about one, or more than one, two, three, four, five, ten, 15, 20, 25, 50, or more codons) with a codon that is more frequently or most frequently used in the host cell's gene while maintaining the native amino acid sequence, in order to enhance expression in the target host cell. Different species exhibit specific biases for certain codons of particular amino acids. Codon bias (differences in codon usage frequency between organisms) often correlates with messenger RNA (mRNA) translation efficiency, which in turn is thought to depend, among many other factors, on the characteristics of the translated codon and the availability of specific transfer RNA (tRNA) molecules. The dominance of a selected tRNA in a cell generally reflects the most frequently used codon in peptide synthesis. Therefore, genes can be tuned to optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, in the "Codon Usage Database" at www.kazusa.orjp / codon / , and these tables can be adapted in several ways. See Nakamura, Y., et al., Nucl. Acids Res., 28:292 (2000). Computer algorithms for codon-optimizing specific sequences for expression in specific host cells are also available, such as Gene Forge (Aptagen; Jacobus, PA). In some embodiments, one or more codons in the sequence encoding an RNA-induced endonuclease correspond to the codon most frequently used for a particular amino acid.

[0072] The gene editing composition also includes a library, for example, a library of AAV vectors. The library may be a collection of multiple vectors, which may be the same or different. In a preferred embodiment, the library contains multiple different AAV vectors. For example, in some embodiments, all vectors in the library have the same first guide RNA (e.g., a guide RNA targeting the TRAC locus), and each vector in the library also contains a second guide RNA that is specific to the multiple AAV vectors. The specific guide RNA is the only RNA of that kind in the vector or in the library of vectors (e.g., the guide RNA may be the only one with a specific nucleotide sequence). Overall, the library may contain any number of guide RNAs. For example, the library may contain guide RNAs that target the entire set of protein-coding genes in the genome as a whole (e.g., a human genome-wide library). Alternatively, the library may contain guide RNAs that target a selected subset of genes or sites. In some embodiments, the library contains multiple guide RNAs collectively encoded by nucleic acid sequences selected from SEQ ID NOs: 3-12,134. In a preferred embodiment, the library contains, as a whole, guide RNA encoded by the nucleic acid sequences of SEQ ID NOs: 3-4,087 (Rene library) or SEQ ID NOs: 4,088-12,134 (Descartes library).

[0073] The library may contain multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) specific guide RNAs targeting the same gene. In preferred embodiments, the library also contains a representative number (e.g., 1000) of non-targeting control guide RNAs. Preferably, the library contains a total number of guide RNAs that represent all of the target gene or site to be targeted. For example, the upper limit of the number of guide RNAs may reflect the currently pooled oligonucleotide synthesis and / or cloning limits (e.g., about 300,000 distinct guide RNA sequences). In some embodiments, the library contains about 100 or more distinct guide RNA sequences. In some embodiments, the library contains approximately 1,000, 5,000, 8,000, 10,000, 15,000, 20,000, 30,000, 40,000, 50,000, 100,000, 150,000, 200,000, 250,000, 300,000, or more distinct guide RNA sequences. In some embodiments, the library contains approximately 100 to approximately 300,000 distinct guide RNA sequences. In some embodiments, the library may be in the form of a plasmid collection or a viral collection containing the library vector as a whole.

[0074] 1. RNA-induced endonucleases An RNA-induced endonuclease is a polypeptide whose endonuclease activity and specificity depend on its association with an RNA molecule. The entire sequence of this RNA molecule, or more generally, a fragment of this RNA molecule, has the ability to designate a target sequence in the genome. Generally, this RNA molecule has the ability to hybridize to a target sequence and mediate the endonuclease activity of the RNA-induced endonuclease. Non-limiting examples of RNA-induced endonucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), Cpf1, their homologs, or modified versions thereof. A preferred RNA-induced endonuclease is Cas12a (Cpf1), a component of the CRISPR / Cas system.

[0075] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is an acronym for DNA loci containing multiple, short, direct repeats of a base sequence. The prokaryotic CRISPR / Cas system has been adapted for use in prokaryotes such as gene editing (silencing, enhancing, or altering specific genes) (see, for example, Cong, Science, 15:339(6121):819-823 (2013) and Jinek, et al., Science, 337(6096):816-21 (2012)). By providing cells with the necessary elements, including the Cas gene and a specifically designed CRISPR system, the genome can be cut and modified at any desired location. Methods for preparing compositions for use in genome editing using the CRISPR / Cas system are described in detail in WO2013 / 176772 and WO2014 / 018423, which are incorporated herein by reference in their entirety.

[0076] The term "Cas" (CRISPR-related) generally refers to the effector proteins of the CRISPR-Cas system or complex. Unless otherwise specified, the term "Cas" may be used synonymously with "CRISPR" protein, "CRISPR-Cas protein," "CRISPR effector," "CRISPR-Cas effector," "CRISPR enzyme," and "CRISPR-Cas enzyme." RNA-induced endonucleases can be Cas effectors, Cas proteins, or Cas enzymes. Generally, the “CRISPR system” refers as a whole to transcripts or other elements that are involved in or direct the expression of CRISPR-related (“Cas”) genes, including the sequence encoding the Cas gene, and, where applicable, the tracr (trans-activated CRISPR) sequence (e.g., tracrRNA or active partial tracrRNA), the tracr mate sequence (in the context of the endogenous CRISPR system, “direct repeats” and encompassing the partial direct repeats processed by tracrRNA), the guide sequence (also called “spacers” in the context of the endogenous CRISPR system), or, where the term is used, “RNA” (e.g., RNA for inducing Cas, such as Cas9 or Cpf1, e.g., CRISPR RNA (crRNA) and / or trans-activated (tracr)RNA or single guide RNA (sgRNA) (chimeric RNA)), or other sequences and transcripts from the CRISPR locus. Generally, the CRISPR system is characterized by elements that facilitate the formation of the CRISPR complex at the site of the target sequence. For example, see Shmakov et al. (2015) "Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems," Molecular Cell, DOI: dx.doi.org / 10.1016 / j.molcel.2015.10.008.

[0077] RNA-induced endonucleases may be Cas effector proteins selected from type II, type V, or type VI Cas effector proteins, without limitation.

[0078] In some embodiments, one or more elements of the CRISPR system are introduced into target cells, and as a result, the expression of the CRISPR system elements directs the formation of the CRISPR complex to one or more target sites. The specifics may vary depending on the different CRISPR system being manipulated, but the overall methodology is similar. Performers interested in targeting DNA sequences using CRISPR technology can insert a short DNA fragment containing the target sequence into a guide RNA expression plasmid. The sgRNA expression plasmid contains the target sequence (approximately 20 nucleotides), the morphology of the tracrRNA sequence (scaffold) if necessary, as well as a promoter and necessary elements suitable for proper processing in eukaryotic cells. Such vectors are commercially available (see, for example, Addgene). Many systems rely on custom-made complementary oligomers that are annealed to form double-stranded DNA and then cloned into sgRNA expression plasmids. Co-expression of sgRNA and the appropriate Cas enzyme in cells results in single-strand or double-strand breaks (depending on the activity of the Cas enzyme) at the desired target site.

[0079] Cas12a(Cpf1) In a preferred embodiment, the RNA-inducible endonuclease is Cpf1. The RNA-inducible endonuclease may be a Cpf1 orthologue, variant, or engineered derivative derived from any bacterial species known to contain Cpf1. For example, Cpf1 effector proteins may be from Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridium It may originate from organisms belonging to genera including tridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Methylobacterium, or Acidaminococcus. More specifically, in some embodiments, the RNA-induced endonuclease is Cpf1 from one of the following organisms: S. mutans, S. agalactiae, S. equisimilis, S. sanguinis, S. pneumonia; C. jejuni, C. coli; N. salsuginis, N. tergarcus; S. auricularis, S. carnosus; N. meningitides, N. gonorrhoeae; L. monocytogenes, L. ivanovii; C. botulinum, C. difficile, C. tetani, C. sordellii.

[0080] In some embodiments, Cpf1 is Francisella tularensis 1 (e.g., Francisella tularensis subsp. GW2011_GWC2_44_17, Smithella sp.SCADC, Acidaminococcus sp.BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3. Derived from or isolated from bacterial species selected from Prevotella disiens and Porphyromonas macacae.Preferred RNA-guided endonucleases include Francisella novicida U112 (FnCpf1), Acidaminococcus sp.BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), Lachnospiraceae bacterium MA2020 (Lb2Cpfl), Lachnospiraceae bacterium MC2017(Lb3Cpfl), Moraxella bovoculi 237(MbCpf1), Butyrivibrio proteoclasticus(BpCpf1), Parcubacteria bacterium GWC2011_GWC2_44_17(PbCpf1);Peregrinibacteria bacterium GW2011_GWA_33_10(PeCpf1), Leptospira Cpf1 derived from inadai (LiCpf1), Smithella sp.SC_K08D17 (SsCpf1), Porphyromonas crevioricanis (PcCpf1), Porphyromonas macacae (PmCpf1), Candidatus Methanoplasma termitum (CMtCpf1), Eubacterium eligens (EeCpf1), Moraxella bovoculi 237 (MbCpf1), or Prevotella disiens (PdCpf1), or its variants, derivatives, or fragments. In preferred embodiments, Cpf1 is LbCpf1, or its variants, derivatives, or fragments.

[0081] The Cpf1 effector protein may be a modified, for example, engineered or naturally occurring Cpf1. The modified protein may contain mutations in one or more amino acid residues of the effector protein. The mutations may be in one or more catalytic domains of the effector protein (e.g., the RuvC domain, or a catalytic domain homologous to the RuvC domain). The effector protein may have reduced or absent nuclease activity compared to an effector protein lacking one or more mutations. In some embodiments, the effector protein does not direct DNA or RNA strand cleavage to the target gene locus of interest.

[0082] In some embodiments, one or more modified or mutant amino acid residues are D917A, E1006A, or D1255A, in accordance with the amino acid position numbering of the FnCpf1 effector protein. In some embodiments, one or more mutant amino acid residues are D908A, E993A, and D1263A, in accordance with the amino acid position in AsCpf1, or LbD832A, E925A, D947A, and D1180A, in accordance with the amino acid position in LbCpf1.

[0083] Mutations can also be induced in adjacent residues, for example, in amino acids near those shown above that are involved in nuclease activity. In some embodiments, only the RuvC domain is inactivated, while in other embodiments, another putative nuclease domain is inactivated. In some embodiments, two FnCpf1, AsCpf1, or LbCpf1 variants (each a different nickase) are used to increase specificity. For example, two nickase variants can be used to cleave DNA at the target (in this case, both nickases cleave the DNA strand, but only one DNA strand is cleaved and then repaired, minimizing or eliminating off-target modifications). In some embodiments, the Cpf1 effector protein cleaves sequences associated with or located at the target gene locus of interest as a homodimer containing two Cpf1 RNA-induced endonucleases. In some embodiments, the homodimer may contain two Cpf1 effector proteins having different mutations in their respective RuvC domains.

[0084] In some embodiments, Cpf1 is a wild-type protein, humanized Cpf1, a variant, a derivative, a fragment, a domain-shuffled version, or a combination thereof. In some embodiments, the RNA-induced endonuclease may be a chimeric Cpf1 effector protein having a first fragment from a first Cpf1 effector protein ortholog and a second fragment from a second Cpf1 effector protein ortholog, wherein the first and second effector protein orthologs are different (e.g., from different organisms).

[0085] Cpf1 effector proteins may have one or more heterogeneous functional domains, such as nuclear localization signaling (NLS) domains. NLS domains may be located at, near, or adjacent to the terminus of the Cpf1 effector protein. Heterogeneous functional domains also include transcriptional activation domains (e.g., VP64, VPR, p65, HSF1, Activ), transcriptional repression domains (e.g., KRAB; methyltransferase domains of DNMT family members including DNMT1, DNMT3A, DNMT3B, and DNMT3L; or SID domains (e.g., SID4X)), and nuclease domains (e.g., Fok1). Heterofunctional domains may possess one or more of the following activities: methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcription termination factor activity, histone modification activity, nuclease activity, single-strand RNA cleavage activity, double-strand RNA cleavage activity, single-strand DNA cleavage activity, double-strand DNA cleavage activity, and nucleic acid binding activity. Heterofunctional domains can be fused, ligated, tethered, or otherwise associated with RNA-induced endonucleases.

[0086] A protospacer-adjacent motif (PAM) or PAM-like motif directs the binding of an RNA-induced endonuclease complex to a target gene locus of interest. In some embodiments, the PAM is a 5'TTN with N being A / C / G or T and the effector protein being FnCpf1p; or a 5'TTTV with V being A / C or G and the effector protein being AsCpf1, LbCpf1, or PaCpf1p. In some embodiments, the PAM is located upstream of the 5' end of the protospacer. T-rich PAMs of the Cpf1 family enable targeting and editing of AT-rich genomes.

[0087] Cas12a effector proteins may further include dCpf1 fused to adenosine or cytidine deaminase, for example, those described in U.S. Provisional Patent Applications Nos. 62 / 508,293, 62 / 561,663, 62 / 568,133, 62 / 609,949, and 62 / 610,065. Further Cas12a effector proteins that may be used are discussed in International Patent Applications Nos. WO2016 / 205711, WO2017 / 106657, and WO2017 / 172682.

[0088] Considering the potential toxicity of intracellular RNA-induced endonucleases due to possible nonspecific interactions with various RNAs within the cell or off-site targeting, several methods can be employed to temporarily induce the nuclease activity of RNA-induced endonucleases such as Cpf1 into the cell (e.g., by mRNA electroporation), ideally for the lifetime of the guide RNA. In some embodiments, RNA-induced endonucleases (e.g., Cpf1) can be expressed in a stabilized or inactive form, activated by activation by an enzyme produced by the cell or by destabilization of its polypeptide structure within the cell. Conditional protein stability can be obtained, for example, by fusing the endonuclease to a stabilized / destabilized protein based on the FKBP / rapamycin system, where the conformational change of the protein is induced by a small molecule, as a non-limiting example. Endonucleases can also be locked or unlocked using chemical or photo-induced dimerization of the protein partner fused to the endonuclease protein.

[0089] 2. Vector Suitable vectors for inclusion in or providing elements of gene-editing compositions include, but are not limited to, plasmids and viral vectors derived from bacteriophages, baculoviruses, retroviruses (e.g., lentiviruses), adenoviruses, poxviruses, Epstein-Barr viruses, and adeno-associated viruses (AAVs). Viral vectors may be derived from DNA viruses (e.g., dsDNA or ssDNA viruses) or RNA viruses (e.g., ssRNA viruses). A wide variety of vectors and expression systems are commercially available from suppliers including Addgene, Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen / Life Technologies (Carlsbad, CA).

[0090] In a preferred embodiment, the AAV vector is provided as a component of a gene editing composition for modifying the genome of one or more cells. The AAV vector can provide one or more elements of the gene editing composition (e.g., a crRNA expression cassette, a CAR expression cassette, a homologous arm).

[0091] AAV is a non-pathogenic single-stranded DNA virus that has been actively used for many years to deliver therapeutic genes in both in vitro and in vivo systems (Choi, et al., Curr. Gene Ther., 5:299-310, (2005)). AAV belongs to the parvovirus family and replicates by co-infection with other viruses, primarily adenoviruses. Initially serologically distinguished, molecular cloning of the AAV gene has identified hundreds of unique AAV strains in a vast number of species. Each end of the single-stranded DNA genome contains a reverse-end repeat (ITR), the only cis-acting element required for genome replication and packaging. The single-stranded AAV genome contains three genes: Rep (replication), Cap (capsid), and aap (assembly). These three genes, through the use of three promoters, alternative translation initiation sites, and differential splicing, produce at least nine gene products. These coding sequences are flanked by ITRs. The Rep gene encodes four proteins (Rep78, Rep68, Rep52, and Rep40), while Cap expression generates viral capsid proteins (VP; VP1 / VP2 / VP3), which are actively involved in cell binding and internalization, as well as forming the capsid shell that protects the viral genome. The viral shell is estimated to contain 60 proteins arranged in an icosahedral structure with the capsid proteins in a molar ratio of 1:1:10 (VP1:VP2:VP3).

[0092] Recombinant AAVs (rAAVs), which lack viral DNA, are essentially nanoparticles based on proteins engineered to traverse the cell membrane, ultimately capable of transporting their DNA cargo and delivering it to the cell nucleus. In the absence of the Rep protein, the ITR flanking transgene encoded within the rAAV can form a circular concatemer that persists as an episome within the nucleus of the transduced cell. Because the recombinant episomal DNA is not integrated into the host genome, it will eventually be diluted over time as the cell undergoes repeated replication rounds. This ultimately leads to the loss of the transgene and its expression, with the rate of transgene loss depending on the turnover rate of the transduced cell. These characteristics make rAAVs ideal for certain gene therapy applications.

[0093] AAV may be advantageous over other viral vectors due to its low toxicity (for example, which may be due to a purification method that does not require ultracentrifugation of cellular particles that could activate an immune response) and the low probability of causing insertional mutations because AAV is not incorporated into the host genome (primarily the remaining episomal genome).

[0094] The sequences placed between ITRs generally include a mammalian promoter, the gene of interest, and a terminator. Often, a potent, constitutively active promoter is desired for high-level expression of the gene of interest. Commonly used promoters of this type include the CMV (cytomegalovirus) promoter / enhancer, elongation factor 1α short (EFS), SV40 (monkey virus 40), chicken β-actin, and CAG (CMV, chicken β-actin, rabbit β-globin). All of these promoters result in constitutively active high-level gene expression in most cell types. Some of these promoters are used for silencing in certain cell types; therefore, this consideration should be evaluated for each application.

[0095] In some cases, it may be advantageous to place the transgene (e.g., the target of integration) under the control of an endogenous promoter (e.g., a promoter at or near the integration site). For example, a CAR expression cassette provided by an AAV vector may contain a splice acceptor / donor, a 2A peptide, and / or an internal ribosome entry site (IRES) ligated to act on the transgene (e.g., CAR) to enable expression of the transgene under the control of the gene at the integration site and / or the promoter in frame and / or at the integration site. In other cases, it may be advantageous for the transgene to be under the control of an exogenous promoter, such as a constitutive or inductive promoter. In such cases, a CAR expression cassette provided by an AAV vector may contain a promoter (e.g., EFS or tetracycline-inducible promoter) ligated to act on the transgene (e.g., reporter gene, CAR).

[0096] In some embodiments, the crRNA expression cassette and the CAR expression cassette reside on a single nucleic acid molecule, for example, a single AAV vector. In some embodiments, the crRNA expression cassette resides on a first nucleic acid molecule, for example, a first AAV vector, and the CAR expression cassette resides on a second nucleic acid molecule, for example, a second AAV vector. The first and second nucleic acid molecules may be AAV vectors, for example, AAV6 or AAV9. In some embodiments, the RNA-induced endonuclease, the crRNA expression cassette, and the CAR expression cassette reside on a single nucleic acid molecule, for example, an AAV vector, for example, AAV6 or AAV9.

[0097] The packaging limit of the vector to be used determines the number and combinations of gene editing elements (e.g., RNA-induced endonuclease, crRNA expression cassette, CAR expression cassette, or a combination thereof) that can be provided by the vector. For example, AAV has a packaging limit of approximately 4.5–4.8 Kb. Therefore, attempts to package larger constructs can lead to a significant reduction in viral production. In preferred embodiments, the RNA-induced endonuclease is introduced into cells by different means from a vector encoding a crRNA expression cassette and / or a CAR expression cassette. The introduction of gene editing compositions (e.g., an AAV vector containing RNA-induced endonuclease, crRNA expression cassette, and CAR expression cassette) into cells can be performed ex vivo, simultaneously or at different times.

[0098] In a preferred embodiment, the vector is an AAV vector comprising (i) a crRNA expression cassette encoding one or more guide RNAs (e.g., selected from SEQ ID NOs: 3-12,134); (ii) a chimeric antigen receptor (CAR) expression cassette; and (iii) 5' and 3' homologous recombination repair (HDR) arms for target genome integration. Preferably, the crRNA expression cassette encodes two guide RNAs. In some embodiments, the first guide RNA is constitutively present (e.g., a guide RNA targeting the TRAC locus). In some embodiments, the crRNA expression cassette contains one or more restriction sites (e.g., BbsI) downstream of the first guide RNA, allowing insertion of any sequence of interest (e.g., a sequence encoding a second guide RNA). The sequence to be inserted may be variable, and for example, the sequence may vary depending on the gene or locus to be targeted. The presence of one or more restriction sites (e.g., BbsI) allows for vector linearization, followed by ligation of the sequence encoding the guide RNAs. In some embodiments, the crRNA expression cassette and the CAR expression cassette are positioned between the 5' HDR arm and the 3' HDR arm so that both cassettes receive genomic integration at specific target sites.

[0099] Exemplary sequences of preferred AAV vectors containing anti-CD22 CAR are provided below: [ka] [ka] [ka] [ka] [ka] [ka] (Sequence ID 1; TRAC-LHA-pAAV-U6LbcrTRAC-DR-BbsI-EFS-CD22BBz-TRAC-RHA, or pXD060). In Sequence ID No. 1, nucleotides 1-141 correspond to the ITR, nucleotides 156-800 correspond to the TRAC left homologous arm, nucleotides 816-1065 correspond to the human U6 promoter, nucleotides 1067-1087 correspond to the direct repeat, nucleotides 1088-1107 correspond to the TRAC-targeted crRNA, nucleotides 1108-1128 correspond to the direct repeat, nucleotides 1129-1144 correspond to the double BbsI site, nucleotides 1198-1453 correspond to the EFS-NS promoter, nucleotides 1478-2938 correspond to the CD22BBz CAR, nucleotides 2945-2992 correspond to the poly(A) signal, nucleotides 2999-3657 correspond to the TRAC right homologous arm, and nucleotides 3751-3891 correspond to the ITR.

[0100] Exemplary sequences of preferred AAV vectors containing anti-CD19 CAR are provided below: [ka] [ka] [ka] [ka] (Sequence ID 2; TRAC-LHA-pAAV-U6LbcrTRAC-DR-BbsI-EFS-CD19BBz-TRAC-RHA or pXD071). The vector sequence of Sequence ID 2 is generally comparable to the sequence of Sequence ID 1, in which the CD22BBz domain at nucleotides 1478-2938 of Sequence ID 1 is replaced with a CD19BBz domain. Most notably, nucleotides 1478-2255 of Sequence ID 1, which encode the anti-CD22 antigen-binding domain, are replaced with an anti-CD19 antigen-binding domain in Sequence ID 2.

[0101] Sequence IDs 1 and 2 contain the sequences of the CD22 CAR and CD19 CAR, respectively, but it is understood that any CAR of interest may be included instead, for example, as described above in Sequence IDs 1 and 2. In addition, these vectors may be modified to contain any guide RNA of interest. For example, a guide RNA targeting the TRAC locus (crTRAC) may be substituted, and sequences encoding additional guide RNAs, such as one of Sequence IDs 3-12,134, may be included in the vector (e.g., at the BbsI site), or in combination thereof. Thus, Sequence ID 1 or Sequence ID 2, with or without sequences encoding TRAC-targeting crRNA, and / or with or without existing CAR coding sequences or other CAR coding sequences used in their place, are clearly disclosed. In some embodiments, preferred vectors include variants having approximately 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or higher sequence identity with respect to SEQ ID NO: 1 or SEQ ID NO: 2 or any of the above-described variations thereof.

[0102] The AAV vectors used in the compositions and methods may include, but are not limited to, naturally occurring serotypes of AAV, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12; artificial variants, such as AAV.rhlO, AAV.rh32 / 33, AAV.rh43, AAV.rh64Rl, rAAV2-retro, AAV-DJ, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB; or other natural or manipulated versions of AAV. In preferred embodiments, the AAV used in the compositions and methods is AAV6 or AAV9.

[0103] Twelve native serotypes of AAV have been identified to date, with AAV2 being the best-characterized and most commonly used. These serotypes, due to their different targeting or the types of cells they infect, make AAV a highly useful system for preferentially transducing specific cell types. For example, AAV serotypes 1, 2, and 5, or the hybrid capsid AAV1, AAV2, AAV5, or any combination thereof, can be used to target brain or nerve cells, while AAV4 can be selected to target cardiac cells. AAV8 is useful for delivery to liver cells. Researchers have further refined the targeting of AAV by pseudotyping or by mixing capsids and genomes from different viral serotypes. These serotypes are indicated using a slash; therefore, AAV2 / 5 indicates a virus containing the genome of serotype 2 packaged in a capsid from serotype 5. The use of these pseudotyped viruses can also alter targeting, in addition to improving transduction efficiency. For example, AAV2 / 5 targets neurons that are not efficiently transduced by AAV2 / 2 and is more widely distributed in the brain, which indicates an improvement in transduction efficiency.

[0104] Other engineered AAVs have also been developed and can be used for the purpose of introducing transgenes, as well as in compositions and methods. These are well known in the art, and those skilled in the art will be able to determine the optimal AAV serotype to be used for each application.

[0105] crRNA / guide RNA A gene editing composition comprises one or more crRNAs (also called guide RNAs) that direct an RNA-induced endonuclease to one or more target genes / sites. Preferably, the crRNAs are supplied in an AAV vector (e.g., an AAV6 or AAV9 vector). The crRNAs can be supplied individually or together in the form of a crRNA expression cassette. The guide RNA sequence can be configured as a single sequence or as a combination of one or more different sequences, for example, as a multiple configuration (called an array). For example, in relation to a viral vector, multiple crRNAs / gRNAs may be arranged in tandem and, if necessary, separated by nucleotide sequences such as direct repeats in the form of a crRNA expression cassette. The crRNA expression cassette contains one or more regulatory sequences (e.g., a U6 promoter) ligated to act on the sequence encoding the crRNA. For example, a crRNA expression cassette may contain multiple gRNAs under the control of a single promoter (e.g., a U6 promoter) designed in array format to allow simultaneous expression of multiple gRNA sequences. In some embodiments, each individual crRNA or gRNA guide sequence may target a different target. A crRNA expression cassette may encode two or more (e.g., two, three, four, five, or more) crRNAs that direct endonucleases to different target genes or target sites (e.g., two, three, four, five, or more). In a preferred embodiment, the crRNA expression cassette encodes two guide RNAs.

[0106] crRNA / gRNA may be contained individually in a composition and introduced into cells individually or as a whole. Alternatively, these components may be provided in a single composition for introduction into cells. Similar to mRNA encoding RNA-induced endonucleases, crRNA or guide RNA (gRNA) may be introduced into cells by any suitable means, for example, by viral or nonviral techniques. For example, crRNA may be provided in a viral vector (e.g., retrovirus, e.g., lentivirus, adenovirus, poxvirus, Epstein-Barr virus, adeno-associated virus (AAV), etc.) or by transfection, electroporation, or nucleofection.

[0107] In contrast to Cas9, Cpf1 is tracrRNA-independent and requires only a long crRNA of approximately 42 nucleotides, which has 20-23 nucleotides at its 3' end that are complementary to the protospacer of the target DNA sequence. Cpf1-associated CRISPR arrays are processed into mature crRNA without requiring additional tracrRNA, and when complexed with Cpf1, the Cpf1p-crRNA complex is sufficient on its own to efficiently cleave target DNA. The crRNA contains a spacer sequence (or guide sequence) and a direct repeat sequence. The seed sequence is located within approximately the first 5 nucleotides of the 5' end of the spacer sequence, and mutations within the seed sequence negatively affect the cleavage activity of the Cpf1 effector protein complex.

[0108] The term “guide RNA” refers to a polynucleotide sequence containing a putative or identified crRNA sequence or guide sequence. The guide RNA can be any polynucleotide sequence that has sufficient complementarity with the target nucleic acid sequence to hybridize with the target nucleic acid sequence and to direct the sequence-specific binding of RNA-induced endonucleases to the target nucleic acid sequence. In some embodiments, when optimally aligned using a preferred alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence is about 50% or higher, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or higher. The optimal alignment can be determined using any suitable algorithm for aligning sequences, and non-restrictive examples of such algorithms include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transformation (e.g., the Burrows-Wheeler aligner), ClustalW, ClustalX, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

[0109] Guide RNA (gRNA) sequences for use in compositions and methods may be sense or antisense sequences. While specific gRNA sequences may vary, regardless of the sequence, a useful guide RNA sequence will minimize off-target effects and achieve highly efficient modification of the target gene or target site. The length of guide RNA sequences varies from approximately 10 to approximately 60 or more nucleotides, for example, approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, 50, 55, 60 or more nucleotides. The ability of a guide sequence to direct the sequence-specific binding of a nucleic acid targeting complex to the target sequence can be evaluated by any suitable assay.

[0110] In some embodiments, the crRNA sequence has one or more stem-loops or hairpins and is 30 or more nucleotides long, 40 or more nucleotides long, or 50 or more nucleotides long. In certain embodiments, the crRNA sequence is between 42 and 44 nucleotides long. In some embodiments, the crRNA contains a direct repeat of about 19 nucleotides and a spacer sequence between 23 and 25 nucleotides.

[0111] In the context of CRISPR complex formation, the “target sequence” refers to a sequence that the guide sequence is designed to target, for example, to have complementarity, and hybridization of the target sequence and the guide sequence facilitates the formation of the CRISPR complex. The section of the guide sequence in which complementarity to the target sequence is important for cleavage activity is called the seed sequence. The target sequence can include any polynucleotide, such as DNA or RNA polynucleotides, and is contained within the target gene locus of interest.

[0112] The target sequence is thought to have to associate with a PAM (protospacer-adjacent motif), i.e., a short sequence recognized by the CRISPR complex. While the exact sequence and length requirements for the PAM vary depending on the CRISPR enzyme used, the PAM is generally a 2-5 base pair sequence adjacent to the protospacer (also called the target sequence). Those skilled in the art will be able to identify further PAM sequences for use with a given RNA-inducible endonuclease. Furthermore, manipulation of the PAM interaction (PI) domain of an RNA-inducible endonuclease may allow for programming the PAM specificity to improve target site recognition fidelity and increase the versatility of Cas, e.g., Cpf1, a genome manipulation platform. Cas proteins can be manipulated to alter their PAM specificity, as described, for example, in Kleinstiver, BP., et al., Nature., 523(7561):481-5 (2015).

[0113] Once the desired DNA target sequence or target gene is identified, there is a wealth of available resources to help the executor determine a suitable target site. For example, a vast amount of publicly available resources, including a bioinformatics-generated list of approximately 190,000 possible guide RNAs targeting more than 40% of human exons, are available to assist the executor in selecting a target site and designing the relevant guide RNA to influence nicks or double-strand breaks at that site. See also crispr.u-psud.fr / , a tool designed to help scientists find CRISPR targeting sites in a wide range of species and generate appropriate crRNA sequences.

[0114] Guide RNAs can be sequences complementary to coding or non-coding sequences (e.g., target sequences, target sites, or target genes). gRNA sequences can be complementary to either the sense or antisense strand of the target sequence. They may contain additional 5' and / or 3' sequences, which may or may not be complementary to the target sequence. They may have less than 100% complementarity to the target sequence, e.g., 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% complementarity.

[0115] When a ribonucleoprotein complex is formed with crRNA, the RNA-induced endonuclease localizes to a sequence (e.g., a target sequence, target site, or target gene), causing disruption of the target gene, and / or one or more homologous arms may mediate the targeted integration of the transgene by HDR at the target site. The target site may be within the locus of the gene to be disrupted, or at a different locus. For example, the target site may overlap with a portion of the gene, such as an enhancer, promoter, intron, exon, or untranslated region (UTR).

[0116] Exemplary target gene / target promoter Gene editing compositions are generally applicable to targeting and / or modifying (e.g., disrupting) any sequence of interest within the genome, including non-coding and coding regions. Those skilled in the art will understand that the target sequence depends on the application in which the genome modification will be performed, and that appropriate crRNA / gRNAs are designed accordingly. For example, in relation to CAR T cells, it is desirable to create standardized therapies in which allogeneic therapeutic cells are administered to subjects who require them. Allogeneic means that the cells used to treat a patient originate from a donor of the same species as the patient, and are therefore genetically different. However, their use is significantly limited by host-versus-graft rejection (HvG) and graft-versus-host disease (GvHD). In connection with these, it is desirable to produce CAR T cells in which proteins involved in HvG and GvHD are disrupted. Therefore, TCR alpha, TCR beta, one or more HLA genes, one or more major histocompatibility complex (MHC) genes, or combinations thereof can be targeted by crRNA / gRNAs.

[0117] Immune checkpoint proteins are a group of molecules expressed by T cells that effectively act as "brakes" to downmodulate or inhibit the immune response. Examples of immune checkpoint molecules include programmed death 1 (PD-1, also known as PDCD1 or CD279, accession number: NM_005018), cytotoxic T lymphocyte antigen 4 (CTLA-4, also known as CD152, GenBank accession number AF414120.1), LAG3 (also known as CD223, accession number: NM_002286.5), Tim3 (also known as HAVCR2, GenBank accession number: JX049979.1), and BTLA(C Also known as D272, accession number: NM_181780.3), BY55 (also known as CD160, GenBank accession number: CR541888.1), TIGIT (also known as IVSTM3, accession number: NM_173799), LAIR1 (also known as CD305, GenBank accession number: CR542051.1), SIGLEC10 (GenBank accession number: AY358337.1), 2B4 (also known as CD244, accession number: NM_001) Examples include, but are not limited to, CTLA-4, PPP2CA, PPP2CB, PTPN6, PTPN22, CD96, CRTAM, SIGLEC7, SIGLEC9, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, FAS, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, M ORA, IL10RB, HM0X2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, F0XP3, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1 B2, and GUCY1 B3, which directly inhibit immune cells. For example, CTLA-4 inhibits certain CD4 and CD8 These are cell surface proteins expressed on T cells, and when engaged with their ligands (B7-1 and B7-2) on antigen-presenting cells, T cell activation and effector function are inhibited.Therefore, gene editing compositions can be used to target and inactivate any immune checkpoint protein, including but not limited to the aforementioned immune checkpoint proteins such as PD1 and / or CTLA-4.

[0118] Any gene within a cell's genome may be a target gene or contain a target site. A gene may have a known or putative role in any biological process or molecular function of interest. In some embodiments, genes having a known or putative role in T cell exhaustion, T cell proliferation, T cell costimulation, memory T cell differentiation, T cell receptor signaling, epigenetic regulation, adaptive immune response, immune response against tumor cells, other immune functions, or combinations thereof may be target genes or target sites. Genes involved in such and other biological processes are publicly known and can be determined by those skilled in the art. For example, gene ontology (GO) databases and molecular signature databases (MSigDB) provide lists of genes and / or gene products associated with various biological functions. In some embodiments, genes listed in Table 2 or Table 3 (provided in Example 1) may be target genes or target sites. In some embodiments, the target gene or target site is a gene or site targeted by one or more guide RNAs selected from the Rene library (SEQ ID NOs. 3-4,087) and / or the Descartes library (SEQ ID NOs. 4,088-12,134).

[0119] In some embodiments, the target gene or target site is selected from PRDM1, DPF3, SLAMF1, TET2, HFE, PELI1, PDCD1, HAVCR2 / TIM3, TET2, NR4A2, LAIR1, and USB1. In some embodiments, exemplary target genes or target sites include, but are not limited to, PDCD1 and TRAC.

[0120] Chimeric antigen receptor (CAR) One or more CAR expression cassettes containing one or more CARs (e.g., one, two, three, four, five, or more) linked to a regulatory sequence are provided as part of a gene editing composition. Such regulatory sequences may, without limitation, include promoters, splice receptors, IRESs, 2A peptides, triple helices, polyadenylation signals, or combinations thereof. Once incorporated into a target site, one or more CARs are expressed in recipient cells (e.g., T cells).

[0121] Immunotherapy using T cells genetically engineered to express chimeric antigen receptors (CARs) is rapidly emerging as a promising new treatment for hematological and non-hematological malignancies. CARs are engineered receptors that possess both antigen-binding and T-cell-activating functions. Based on the CAR's location within the T-cell membrane, CARs can be divided into three major distinct domains, which include an extracellular antigen-binding domain, followed by a space domain, a transmembrane domain, and an intracellular signaling domain. The antigen-binding portion, most commonly derived from the variable region of immunoglobulin, consists of VH and VL chains linked by a linker to form a so-called "scFv". The segment interposed between the scFv and the transmembrane domain is the "spacer domain," which, in some embodiments, is the constant IgG1 hinge-CH2-CH3 Fc domain. In some cases, the spacer domain and transmembrane domain are derived from CD8. The intracellular signaling domain, which mediates T-cell activation, includes a CD3ζ coreceptor signaling domain derived from the C region of the TCR α and β chains, and one or more co-stimulatory domains.

[0122] CARs can be used to generate immune-responsive cells, such as T cells, that are specific to selected targets, such as malignant cells, and a wide variety of receptor chimeric constructs have been described (see U.S. Patents 5,843,728, 5,851,828, 5,912,170, 6,004,811, 6,284,240, 6,392,013, 6,410,014, 6,753,162, 8,211,422; and PCT Publication WO9215322). Alternative CAR constructs may be considered to belong to a subsequent generation. First-generation CARs generally consist of single-strand variable fragments of antigen-specific antibodies (scFv-CD3ζ or scFv-FcRγ; see U.S. Patents 7,741,465, 5,912,172, and 5,906,936), linked by a flexible linker to either the CD3ζ or FcR-gamma transmembrane and intracellular signaling domains, for example, by the CD8α hinge domain and the CD8α transmembrane domain, including, for example, a VL linked to the VH of a particular antibody. Second-generation CARs incorporate the intracellular domain of one or more co-stimulatory molecules, such as CD28, OX40 (CD134), or 4-1BB (CD137), into their endodomains (see, for example, scFv-CD28 / OX40 / 4-1BB-CD3ζ; U.S. Patents Nos. 8,911,993, 8,916,381, 8,975,071, 9,101,584, 9,102,760, and 9,102,761). Third-generation CARs include combinations of co-stimulatory end-domains such as CD3ζ chain, CD97, GDI la-CD18, CD2, ICOS, CD27, CD154, CDS, OX40, 4-1BB, or CD28 signaling domains (e.g., scFv-CD28-4-1BB-CD3ζ or scFv-CD28-OX40-CD3ζ; see U.S. Patents 8,906,682, 8,399,645, 5,686,281, PCT Publication Nos. WO2014134165, PCT Publication Nos. WO2012079000).Alternatively, the co-stimulation can be organized by expressing CARs in antigen-specific T cells, and these antigen-specific T cells are selected to be activated and expanded by the accompanying co-stimulation after engagement of their native αβTCRs with an antigen on, for example, a professional antigen-presenting cell.

[0123] In some embodiments, the CAR targets (e.g., recognizes and / or binds to) one or more antigens specific to cancer, inflammatory diseases, neuronal disorders, HIV / AIDS, diabetes, cardiovascular diseases, infectious diseases, autoimmune diseases, or combinations thereof. Those skilled in the art will be able to determine appropriate antigens that would be targeted by the CAR for a particular disease, disorder, or condition based on general knowledge in the art and / or routine experimentation.

[0124] Exemplary antigens specific to cancers that may be targeted by CAR include 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B lymphoma cells, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD152, CD19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, and CD44. v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, Fibronectin Extradomain-B, Folate Receptor 1, GD2, GD3 Ganglioside, Glycoprotein 75, GPNMB, HER2 / neu, HGF, Human Scattering Factor Receptor Kinase, IGF-1 Receptor, IGF-I, IgG1, L1-CAM, IL-13, IL-6, Insulin-like Growth Factor I Receptor, Integrin α5β1, Integrin ανβ3, MORAb-009, MS4A1, MUC1, Mucin CanAg, N-Glycolylneuraminic Acid, NPC-1C, PDGF-R a, PDL192, Phosphatidylserine, Prostate Cancer Cells, RANKL, RON, ROR1, SCH Examples include, but are not limited to, 900105, SDC1, SLAMF7, TAG-72, tenascin C, TGF-beta 2, TGF-β, TRAIL-R1, TRAIL-R2, tumor antigen CTAA16.88, VEGF-A, VEGFR-1, VEGFR2, vimentin, and combinations thereof.

[0125] Exemplary antigens specific to inflammatory diseases that may be targeted by CARs include AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basidine), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (IL-2 receptor α chain), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, Lama glama, LFA-1 (CD11a), MEDI-528, myostatin, OX-40, and rhuMAb. Examples include, but are not limited to, β7, sclerostin, SOST, TGF-beta-1, TNF-α, VEGF-A, and combinations thereof.

[0126] Exemplary antigens specific to neuronal damage that may be targeted by CARs include, but are not limited to, beta-amyloid, MABT5102A, and combinations thereof.

[0127] Examples of diabetes-specific antigens that may be targeted by CARs include, but are not limited to, L-Iβ, CD3, and combinations thereof.

[0128] Examples of cardiovascular disease-specific antigens that may be targeted by CARs include, but are not limited to, C5, cardiac myosin, CD41 (integrin alpha-lib), fibrin II, beta chain, ITGB2 (CD18), sphingosine-1-phosphate, and combinations thereof.

[0129] Exemplary antigens (or antigen-associated viruses) specific to infectious diseases that may be targeted by CARs include, but are not limited to, anthrax toxin, CCR5, CD4, clamping factor A, cytomegalovirus, cytomegalovirus glycoprotein B, endotoxin, Escherichia coli, hepatitis B surface antigen, hepatitis B virus, HIV-1, Hsp90, influenza A hemagglutinin, lipoteichoic acid, Pseudomonas aeruginosa, rabies virus glycoprotein, respiratory syncytial virus, TNFα, and combinations thereof.

[0130] In preferred embodiments, CAR may be AFP, AKAP-4, ALK, androgen receptor, B7H3, BCMA, Bcr-Abl, BORIS, Carbonic, CD123, CD133, CD44, GD2, Claudin, CD138, CD174, CD19, CD20, CD22, CD30, CD33, CD38, CD80, CD86, CEA, CEACAM5, CEACAM6, Cyclin, CYP1B1, EBV, EGFR, EGFR806, EGFRvIII, EpCAM, EphA2, ERG, ETV6-AML, FAP, Fos-related antigen 1, Fucosyl, Conjugate, GD2, GD3, GloboH, GM3, gp100, GPC3, HER-2 / neu, HER2, HMWMAA, HPV E6 / E7, hTERT, idiotype, IL12, IL13RA2, IM19, IX, LCK, regmine, lgK, LMP2, MAD-CT-1, MAD-CT-2, MAGE, melan A / MART1, mesothelin, MET, ML-IAP, MUC1, variant p53, MYCN, NA17, NKG2D, NKG2D-L, NY-BR-1, NY-ESO-1, OY-TES1, p53, Page4, PAP, The target is one or more antigens selected from PAX3, PAX5, PD-L1, PDGFR-β, PLAC1, polysialic acid proteinase 3 (PR1), PSA, PSCA, PSMA, mutant Ras, RGS5, RhoC, ROR1, SART3, sLe(a), sperm protein 17, SSX2, STn, Survivin, Tie2, Tn, TRP-2, tyrosinase, VEGFR2, WT1, and XAGE.

[0131] Preferably, the CAR may be an anti-CD19 CAR (e.g., CD19BBz) or an anti-CD22 CAR (e.g., CD22BBz). In some embodiments, the CAR may be bispecific. In some embodiments, the CAR may be polyvalent. Bispecific or multispecific (polyvalent) CARs, including but not limited to those described in WO2014 / 4011988 and US20150038684, are intended for use in methods and compositions.

[0132] In some embodiments, the CAR expression cassette may, alternatively or in addition, contain a gene of interest, such as a reporter gene. The reporter gene may include any gene that can be used as an indicator of a successful event, such as transfection, transduction, and / or recombination. The reporter gene may be fused to a regulatory sequence or gene of interest to report its expression site or level, or it may function as a control to standardize transfection efficiency, for example. The reporter gene may include a gene encoding a fluorescent protein, or an enzyme that converts an invisible substrate into a luminescent or colored product. The reporter gene may also include a selectable marker that confers the ability to grow in the presence of toxic compounds that would otherwise kill or damage cells, such as antibiotics or herbicides. The selectable marker may also confer the ability to utilize compounds, such as abnormal carbohydrates or amino acids. Non-limiting examples of selectable markers include genes that confer resistance to blastosidine, G418 / geneticin, hygromycin B, puromycin, or zeosin.

[0133] Each CAR expression cassette may be contained in a composition individually and introduced into cells individually or as a whole. Alternatively, these components may be provided in a single composition for introduction into cells. Preferably, one or more CAR expression cassettes are provided in a single viral vector, for example, an AAV vector packaged in an AAV serotype, such as an AAV6 or AAV9 vector.

[0134] Homologous arms A gene editing composition can be used to introduce targeted double-strand breaks (DSBs) into endogenous DNA sequences. The DSBs activate cellular DNA repair pathways that can be utilized to achieve desired DNA sequence modifications near the break site. In certain embodiments, homologous recombination with one or more homologous sequences is facilitated at the DSB site to introduce one or more crRNAs and / or CARs of interest.

[0135] In some embodiments, the AAV vector contains one or more homologous sequences (referred to as homologous arms) to enable homologous recombination in or near the target sequence that is nicked or cleaved by an RNA-induced endonuclease as part of the nucleic acid targeting complex. The homologous arms may be of any preferred length, e.g., about 10 or more than about 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, or more nucleotide lengths. In some embodiments, the homologous arms are complementary to or homologous to a portion of the target sequence. When optimally aligned, the homologous arms may overlap one or more nucleotides of the target sequence (e.g., about one or more, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, or more nucleotides). In some embodiments, when the homologous arm and the polynucleotide containing the target sequence are optimally aligned, the nearest neighbor nucleotide of the homologous arm is within approximately 1, 5, 10, 15, 20, 25, 50, 75, 100, 200, 300, 400, 500, 1000, 5000, 10000 or more nucleotides from the target sequence.

[0136] In certain embodiments, the AAV template includes the following components: a 5' homologous arm, a replacement sequence (e.g., a crRNA expression cassette and / or a CAR expression cassette), and a 3' homologous arm. The homologous arm is intended to accommodate recombination into the chromosome, and therefore replacement of a portion of the endogenous genomic sequence with the replacement sequence. In some embodiments, the homologous arm is adjacent to the most distal cleavage site. In some embodiments, the 3' end of the 5' homologous arm is located next to the 5' end of the replacement sequence. In some embodiments, the 5' homologous arm may extend at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides toward the 5' end of the replacement sequence. In some embodiments, the 5' end of the 3' homologous arm is located next to the 3' end of the replacement sequence. In some embodiments, the 3' homologous arm may extend at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides toward the 3' end of the substitution sequence.

[0137] In some embodiments, the 5' and 3' homologous arms are homologous to the TRAC locus, for example, the first exon of the TRAC locus. Other loci that homologous arms may be homologous include, but are not limited to, other TCR loci, such as TRBC1, TRBC2, TRAV1-1, and TRBV1; immunogenes, such as PD-1 and B2M; safe harbors, such as AAVS1; intergenetic regions; and other genomic regions.

[0138] In homologous recombination repair (HDR), a donor polynucleotide homologous to the cleaved target DNA sequence is used as a template for repairing the cleaved target DNA sequence, resulting in the transfer of genetic information from the donor polynucleotide to the target DNA. Therefore, new nucleic acid material can be inserted / copied into that site. "Donor sequence," "donor polynucleotide," or "donor oligonucleotide" refers to the nucleic acid sequence (e.g., crRNA expression cassette and / or CAR expression cassette) that will be inserted into the cleavage site. Donor polynucleotides generally contain sufficient homology to the genomic sequence at the cleavage site, for example, approximately 70%, 75%, 80%, 85%, 90%, 95%, or 100% homology to nucleotide sequences adjacent to the cleavage site, e.g., within approximately 50 bases or less from the cleavage site, e.g., within approximately 30 bases, 15 bases, 10 bases, or 5 bases, or directly adjacent to the cleavage site, in order to support homologous recombination repair with the genomic sequence with which they are homologous. Donor sequences are generally not identical to the genomic sequence they replace. Rather, donor sequences may contain at least one or more single base changes, insertions, deletions, inversions, or rearrangements relative to the genomic sequence, provided that sufficient homology exists to support homologous recombination repair. In some embodiments, the donor sequence includes non-homologous sequences (e.g., a crRNA expression cassette and / or a CAR expression cassette) with two homologous regions adjacent to each other, and thus the non-homologous sequences are inserted into the target region by homologous recombination repair between the target DNA region and the two adjacent sequences.

[0139] In some embodiments, a sequence containing one or more homologous arms and a replacement sequence (hereinafter referred to herein as an HDR template) is single-stranded or double-stranded. In some embodiments, the HDR template is DNA, e.g., double-stranded or single-stranded DNA. In some embodiments, the HDR template alters the structure of the target site by participating in homologous recombination. In some embodiments, the HDR template alters the sequence of the target site. In some embodiments, the HDR template results in the incorporation of a modified or non-naturally occurring nucleotide sequence into the target nucleic acid. The structure of the target sequence can be altered using an HDR template having homology to the target site in the target gene. The HDR template may include a sequence that results in a sequence change of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleotides of the target sequence.

[0140] B. Cells that will be modified and / or screened. Gene editing compositions and methods can be used to achieve genome modification and subsequent screening of any cell type. For example, the cell may be a prokaryotic or eukaryotic cell. The cell may be a mammalian cell. Mammalian cells may be human or non-human mammals, such as primates, cattle, sheep, pigs, dogs, rodents, monkeys, rats, or mouse cells. The cell may be a non-mammalian eukaryotic cell, such as poultry (e.g., chicken), vertebrate fish (e.g., salmon), or crustacean (e.g., oyster, cream, lobster, shrimp) cells. The cell may also be a plant cell.

[0141] In preferred embodiments, the cells are human cells, including but not limited to skin cells, lung cells, cardiac cells, kidney cells, pancreatic cells, muscle cells, nerve cells, human embryonic stem cells, blood cells (e.g., leukocytes), and pluripotent stem cells. More preferably, the cells to be modified are immune cells, such as T cells (e.g., CD8 cells). +T cells, e.g., effector T cells, memory T cells, central memory T cells, and effector memory T cells; or CD4 + This could be T cells (e.g., Th1 cells, Th2 cells, Th3 cells, Th9 cells, Th17 cells, Tfh cells, and Treg cells; or gamma-delta T cells / gdT cells), hematopoietic stem cells (HSCs), macrophages, natural killer cells (NKs), B cells, dendritic cells (DCs), or other immune cells.

[0142] In some embodiments, the cells may be from an established cell line, or they may be primary cells, where “primary cells” refers to cells and cell cultures derived from the subject and grown in vitro for a limited number of subculturing or divisions of the culture.

[0143] T cell source Prior to expansion and genetic modification, cells (e.g., T cells) can be obtained from affected or healthy subjects. T cells can be obtained from several samples, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, tissue from infection sites, ascites, pleural fluid, splenic tissue, and tumors. In some embodiments, T cells can be obtained from a single unit of blood collected from a subject using any number of techniques known to those skilled in the art, such as Ficoll® isolation. In one preferred embodiment, cells from the circulating blood of an individual are obtained by apheresis. The apheresis product generally contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. Cells collected by apheresis can be washed to remove the plasma fraction and to place the cells into a suitable buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with phosphate-buffered saline (PBS). Washing solutions may lack calcium and / or magnesium, or many but not all divalent cations. After washing, cells are sterilized with various biocompatible buffers, e.g., Ca 2+ Contains no Mg 2+It can be resuspended in, for example, PBS, PlasmaLyte A, or other physiological saline solutions with or without buffers. Alternatively, undesirable components of the apheresis sample can be removed and the cells can be resuspended directly in the culture medium.

[0144] In some embodiments, T cells can be isolated from peripheral blood lymphocytes by, for example, centrifugation through a PERCOLL™ gradient or counterflow centrifugal elutriation to lyse red blood cells and deplete monocytes. Specific subpopulations of T cells, such as CD3 + , CD28 + , CD4 + , CD8 + , CD45RA + and CD45RO + of T cells can be further isolated by positive or negative selection techniques. For example, in some embodiments, T cells can be isolated by incubation with anti-CD3 / anti-CD28 conjugate beads, such as DYNABEADS® M-450 CD3 / CD28 T, for a period sufficient for positive selection of the desired T cells.

[0145] C. Pharmaceutical Composition A pharmaceutical composition is provided, comprising genetically modified cells, or a population of genetically modified cells, together with a pharmaceutically acceptable buffer, carrier, diluent, or excipient. The cell population can be obtained by expanding isolated genetically modified cells (e.g., CAR T cells obtained using any described components and methods, e.g., the CLASH system). Cells can be modified to be bispecific or multispecific (e.g., by expressing bispecific or multispecific CARs, by expressing two or more CARs, etc.). Cells may be isolated from diseased or healthy subjects prior to genetic modification. The introduction of a gene editing composition (e.g., an RNA-induced endonuclease and one or more AAV vectors) into cells can be performed ex vivo. In some embodiments, the pharmaceutical composition contains cells containing one or more CARs (e.g., anti-CD19 and / or anti-CD22 CARs) and / or mutations in one or more desired genes, the genes including, but not limited to, TCR alpha, TCR beta, HLA genes, histocompatibility complex (MHC) genes, genes listed in Table 2 or Table 3, TRAC, PRDM1, DPF3, SLAMF1, TET2, HFE, PELI1, PDCD1, HAVCR2 / TIM3, TET2, NR4A2, LAIR1, and USB1.

[0146] A "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle involved in transporting or delivering a compound of interest from one tissue, organ, or part of the body to another tissue, organ, or part of the body. For example, a carrier may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier may be "pharmaceutically acceptable" in that it must be compatible with the other components of the formulation. It must also be suitable for use in contact with any tissue or organ it may come into contact with, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that would unduly outweigh its therapeutic benefits.

[0147] The composition can be conveniently formulated into a pharmaceutical composition comprising one or more cells associated with a pharmaceutically acceptable carrier. For example, see Remington's Pharmaceutical Sciences, latest edition, by EW Martin Mack Pub. Co., Easton, PA, which discloses typical carriers that may be used and conventional methods for preparing pharmaceutical compositions. These would most typically be standard carriers for administering the composition to humans. Such pharmaceutical compositions may include buffers, e.g., neutral buffered saline, phosphate buffered saline; carbohydrates, e.g., glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids, e.g., glycine; antioxidants; chelating agents, e.g., EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.

[0148] A pharmaceutical composition can be administered in several ways, depending on whether a topical (e.g., limited to a specific region, physiological system, tissue, organ, or cell type) or systemic treatment is desired, and depending on the area to be treated. Therefore, a pharmaceutical composition can be formulated for delivery by any route of administration. “Route of administration” can refer to any route of administration known in the art, including but not limited to aerosol, nasal, oral, intravenous, intramuscular, intraperitoneal, inhalation, transmucosal, transdermal, parenteral, infusion, implantation or implantation, continuous infusion, topical application, and / or injection.

[0149] Parenteral administration, when used, is generally characterized by injection. Injectable preparations can be prepared in conventional forms, either as a liquid solution or suspension, as a solid form suitable for dissolving or suspending in liquid before injection, or as an emulsion. Preferred routes of parenteral administration include intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion, and catheter-based infusion into vascular structures); peritistal and intratistal injections (e.g., intraocular injection, intraretinal injection, or subretinal injection); subcutaneous injection or deposition (e.g., by osmotic pump); and direct application by catheter or other indwelling devices (e.g., implants).

[0150] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, sterile aqueous or non-aqueous suspensions and emulsions, which may also contain buffers, diluents and other suitable additives. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and organic esters for injection, such as ethyl oleate. Aqueous carriers include water, alcoholic solutions / aqueous solutions, alcoholic / aqueous emulsions or suspensions, which may include saline and buffering media. Parenteral vehicles include sodium chloride solutions, ringer's dextrose, dextrose and sodium chloride, Ringer's lactate, or fixative oils. Intravenous vehicles include liquids and nutritional supplements, electrolyte supplements (e.g., those based on ringer's dextrose), etc. Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present.

[0151] In some embodiments, the composition is administered parenterally or intraperitoneally to the target by transarterial, subcutaneous, intradermal, intratumoral, intranodal, intramedullary, intracystic, intramuscular, or intravenous injection. The composition can be directly injected into the site of inflammation, the site of local disease, lymph nodes, organs, tumors, etc. The pharmaceutical composition is preferably formulated for intravenous administration. The amount and frequency of administration will be determined by factors such as the patient's condition and the type and severity of the patient's disease, but the appropriate dosage may be determined by clinical trials.

[0152] III.CAR-T generation method A method is provided for producing cells or populations of cells (e.g., T cells) that express chimeric antigen receptors (CARs). CARs are designed in a modular manner, generally comprising an extracellular target-binding domain, a hinge region, a transmembrane domain for tethering the CAR to the cell membrane, and one or more intracellular domains for transmitting activation signals. Depending on the number of co-stimulatory domains, CARs can be classified as first-generation (CD3z only), second-generation (one co-stimulatory domain + CD3z), or third-generation CARs (one or more co-stimulatory domains + CD3z). Introduction of CAR molecules into T cells successfully redirects T cells with greater antigen specificity and provides the necessary signals to drive full T cell activation. Since antigen recognition by CAR T cells is based on the binding of a single-stranded variable fragment (scFv) that binds to the target to the intact surface antigen, cell targeting is not MHC-restricted, co-receptor-dependent, or dependent on the processing and effective presentation of the target epitope.

[0153] Generally, CAR T cells are generated by modifying the genome of recipient T cells to contain and express CARs. Recipient T cells can be selected from memory T cells, effector T cells, central memory T cells, effector memory T cells, Th1 cells, Th2 cells, Th17 cells, and regulatory T cells. The genome may be edited with an RNA-induced endonuclease such as Cpf1, which cleaves genomic DNA at sites where it is directed by one or more guide RNAs. Vectors containing CARs may have homologous arms that facilitate targeted integration of the CAR at target sites (e.g., at or near DNA cleavage sites). CARs may be expressed regulated or under the control of endogenous or exogenous promoters.

[0154] In certain embodiments, a method for producing CAR T cells comprises the steps of contacting T cells with an RNA-induced endonuclease and an AAV vector, wherein the AAV vector comprises (i) a crRNA expression cassette encoding a first guide RNA and optionally a second guide RNA, (ii) a chimeric antigen receptor (CAR) expression cassette, and (iii) 5' and 3' homologous recombination repair (HDR) arms for target genome integration. The contact step is carried out under conditions suitable for T cell genome editing, such that the CAR expression cassette is integrated into the genome and subsequently expressed. Suitable conditions include, but are not limited to, introducing gene editing compositions into cells, expressing them, and / or enabling them to function as needed (e.g., the mRNA encoding the RNA-induced endonuclease is translated, resulting in the expression of the endonuclease protein; the crRNA and / or CAR expression cassette are integrated into the genome, transcribed, and / or translated), cell culture, and / or other conditions (e.g., medium, pH, temperature, CO2 content, etc.). In some embodiments, the first guide RNA targets the TRAC locus; the 5' and 3' HDR arms are homologous to the TRAC locus; the crRNA expression cassette and CAR expression cassette are incorporated into the TRAC locus via HDR; and combinations thereof.

[0155] The results of the screening and other assays discussed herein can be used to induce the development of other modified cells. For example, genes identified as important can be knocked out, knocked down, or otherwise targeted using other means known in the art. Thus, cells are also provided that have a chimeric antigen receptor (CAR) expression cassette and a heterogeneous nucleic acid construct encoding the reduction or loss of expression at one or more targeted gene loci of one or more guide RNAs selected from the group consisting of SEQ ID NOs: 3-12,134. These cells do not need to express the guide RNA. The reduction in the expression of the target gene can be modulated, for example, by (i.e., permanent) gene mutation or knock, or by using inhibitory nucleic acids, including but not limited to antisense molecules, siRNA, miRNA, aptamers, ribozymes, triple-stranding molecules, RNAi, and external guide sequences, which can be transiently transfected into cells or expressed from expression constructs transfected into cells or incorporated into their genomes. Such cells can be used in any of the methods discussed herein, in particular therapeutic methods.

[0156] The following provides exemplary materials and protocols that may be used to generate and characterize CAR T cells.

[0157] A. Material 1. Plasmids and DNA (i)NSL-LbCpf1-NSL mRNA (TriLink BioTechnologies) mRNA transcripts were modified by complete substitution of pseudo-U and capped using CleanCap® AG (Cap 1). The mRNA can be polyadenylated by deoxyribonuclease and phosphatase treatment. The mRNA can be purified by silica membrane and packaged as a solution in 1 mM sodium citrate, pH 6.4. (ii) Plasmids: AAV6 / AAV9, PDF6, AAV vectors (including pXD060, pXD017, pXD071), or derivatives of any of these vectors, having or not having crRNA selected from the Rene library, the Descartes library, or other crRNAs. 2. Cell line (i) Human peripheral blood CD8 + and / or CD4 + T cells (STEMCELL Technologies, or other donors) (ii) HEK293FT cells (ThermoFisher) (iii) NALM6 cells (ATCC) 3. Kits and Chemicals

[0158] Antibodies and staining reagents: APC Anti-Human TIGIT-Biolegend; Catalog Number: 372705 APC / Cyanine 7 Anti-Human CD8α-Biolegend; Catalog Number: 300926 FITC Anti-Human CD197 (CCR7) Antibody - Biolegend; Catalog Number: 353216 FITC anti-human CD3 antibody - Biolegend; Catalog number: 300306 PE anti-human IgG Fc-Biolegend; Catalog number: 409304 Brilliant Violet510 (trademark) anti-human CD8-Biolegend; Catalog number: 344732 Brilliant Violet421 (trademark) anti-human CD62L-Biolegend; Catalog number: 304828 PerCP / Cyanine 5.5 Anti-Human / Mouse Granzyme B-Biolegend; Catalog Number: 372212 Brilliant Violet421 (trademark) anti-human CD366 (Tim-3)-Biolegend; Catalog number: 345008 FITC Anti-Human TNF-Biolegen; Catalog Number: 502906 APC Anti-Human CD25-Biolegend; Catalog Number: 356109 PerCP / Cyanine 5.5 Anti-Human CD27-Biolegend; Catalog Number: 393209 PE anti-DYKDDDDK (Sequence ID 12,246) tag - Biolegend; Catalog number: 637310 PE / Cy7 Anti-Human CD197 (CCR7) Antibody - Biolegend; Catalog Number: 353225 APC Anti-Human CD45RO-Biolegend; Catalog Number: 304210 APC Anti-Human IFN-Biolegend; Catalog Number: 506510 PerCP / Cyanine 5.5 Anti-Human CD223 (LAG-3)-Biolegend; Catalog Number: 369312 APC anti-human CD127 (IL-7Rα) [Clone: ​​A019D5] - Biolegend; Catalog number: 351315 Brilliant Violet421 (trademark) anti-human CD210 (IL-10R)-Biolegend; Catalog number: 308815 PerCP / Cyanine 5.5 Anti-Human CD122 (IL-2Rβ)-Biolegend; Catalog Number: 339011 PE / Cyanine 7 Anti-Human CD244(2B4)-Biolegend; Catalog Number: 329519 APC / Cyanine 7 Anti-Human CD294 (CRTH2)-Biolegend; Catalog Number: 350113 APC / Cyanine 7 Anti-Human CD28-Biolegend; Catalog Number: 302965 FITC anti-human CD69 [clone: ​​FN50]-Biolegend; Catalog number: 310903 Human monoclonal BLIMP1 / PRDM1 antibody - R&D; Catalog number: MAB36081 Blimp-1 / PRDI-BF1(C14A4) Rabbit mAb-CST; Catalog Number: 9115 Recombinant human Siglec-2 / CD22 Fc chimeric protein - R&D; Catalog number: 1968-SL-050 Pierce® Recombinant Biotinylated Protein L-ThermoFisher; Catalog Number: 21189

[0159] Bacterial and viral strains: One Shot Stbl3 Chemical Competent E. coli-ThermoFisher; Catalog Number: C737303 Endura® Electrocompetent Cells - Lucigen; Catalog Number: 60242-2

[0160] qPCR probe: ID2 ThermoFisher Assay ID: Hs04187239_m1 RASA3 ThermoFisher Assay ID: Hs01071043_m1 PCDH8 ThermoFisher Assay ID: Hs00159910_m1 IFIT3 ThermoFisher Assay ID: Hs01922752_s1 TNFSF4 ThermoFisher Assay ID: Hs00967195_m1 RIN3 ThermoFisher Assay ID: Hs01112081_m1 PTPN14 ThermoFisher Assay ID: Hs00193643_m1 CDCA7 ThermoFisher Assay ID: Hs00230589_m1 RUNX3 ThermoFisher Assay ID: Hs00231709_m1 FOXO1 ThermoFisher Assay ID: Hs01054576_m1 TBX21 ThermoFisher Assay ID: Hs00203436_m1 BATF ThermoFisher Assay ID: Hs00232390_m1 CXCR6 ThermoFisher Assay ID: Hs00174843_m1 PRF1 ThermoFisher Assay ID: Hs00169473_m1 STAT6 ThermoFisher Assay ID: Hs00598625_m1 STAT1 ThermoFisher Assay ID: Hs01013996_m1 SOCS1 ThermoFisher Assay ID: Hs00705164_s1 IL13 ThermoFisher Assay ID: Hs00174379_m1 WNT11 ThermoFisher Assay ID: Hs00182986_m1 KLF2 ThermoFisher Assay ID: Hs00360439_g1 S1PR1 ThermoFisher Assay ID: Hs00173499_m1 IRF4 ThermoFisher Assay ID: Hs01056534_m1 NFKB1 ThermoFisher Assay ID: Hs00765730_m1 GAPDH ThermoFisher Assay ID: Hs02786624_g1 PRDM1_ISO1 ThermoFisher Assay ID: APU6667 PRDM1_ISO2 ThermoFisher Assay ID: APRWH2D PRDM1_ISO3 ThermoFisher Assay ID: APT2DMA

[0161] Chemicals, peptides, and recombinant proteins: DPBS, calcium-free, magnesium-free - Gibco; Catalog number: 14190250 RPMI 1640 medium - Gibco; Catalog number: 11875-093 DMEM, high glucose, pyruvate - Gibco; Catalog number: 11995065 Fetal Bovine Serum - Sigma Aldrich; Catalog Number: F4135-500ML Penicillin-Streptomycin (10,000 U / mL) - Gibco; Catalog Number: 15140122 2-Mercaptoethanol - Sigma Aldrich; Catalog Number: M6250-10ML X-VIVO 15 Serum-Free Hematopoietic Cell Medium - Lonza; Catalog Number: BE02-060F Corning; Human AB serum; Male donor; Type AB; US; 100 mL, 35-060-CI 1 / EA-Corning; Catalog number: MT35060CI ACK Dissolving Buffer - Lonza; Catalog Number: 10-548E PEI MAX-Polyscience; Catalog Number: 24765-1 PEG8000-Promega; Catalog Number: V3011 RIPA buffer - Boston BioProducts; Catalog number: BP-115 Protease inhibitor cocktail - ThermoFisher; Catalog number: 78437 Pierce® BCA Protein Assay Kit - ThermoFisher; Catalog Number: 23227 LS Column - Miltenyi; Catalog Number: 130-042-401 Human CD8 T cell isolation kit - Miltenyi; Catalog number: 130-096-495 Streptoavidin microbeads - Miltenyi; Catalog number: 130-048-102 FcR blocking reagent, human-miltenyi; Catalog number: 130-059-901 Pierce (trademark) NHS activated agarose slurry - ThermoFisher; Catalog number: 26200 Recombinant Human IL-2 (Carrier-Free)-Biolegend; Catalog Number: 589104 BD Cytofix / Cytoperm (trademark) Fixation / Permeation Solution Kit - BD; Catalog Number: 554714 QuickExtract DNA Extraction Solution - Epicenter; Catalog Number: QE09050 QIAamp DNA Blood Mini Kit - Qiagen; Catalog Number: 51106 T7 Endonuclease I-NEB; Catalog Number: M0302L Proteinase K-Qiagen; Catalog Number: 19131 Ribonuclease A-Qiagen; Catalog Number: 19101 Gibson Assembly (registered trademark) Master Mix-NEB; Catalog number: E2611 Phusion Flash High-Fidelity PCR Master Mix - ThermoFisher; Catalog Number: F548L DreamTaq Green PCR Master Mix (2X) - ThermoFisher; Catalog Number: K1082 QIAquick Gel Extraction Kit Qiagen Catalog Number: 28706 E-Gel (trademark) Low Range Quantitative DNA Ladder - ThermoFisher; Catalog Number: 12373031 NEBNext® Ultra® RNA Library Prep Kit-NEB; Catalog Number: E7530S Illumina NEBNext (registered trademark) Multiplex Oligos-NEB; Catalog number: E7335S Nextera DNA Library Prep Kit - Illumina; Catalog Number: FC-121-1030 Nextera Index Kit - Illumina; Catalog Number: FC-121-1011 TRIzol® Reagent - Invitrogen; Catalog Number: 15596026 RNeasy Plus Mini Isolation Kit - Qiagen; Catalog Number: 74134 M-MLV reverse transcriptase - Sigma Aldrich; Catalog number: M1302-40KU Oligo(dT)20 Primer - ThermoFisher; Catalog Number: 18418020 TaqMan® Fast Universal PCR Master Mix - Invitrogen; Catalog Number: 4352042 BpiI (BbsI) (10 U / μL) - ThermoFisher; Catalog Number: ER1012 Benzonase® Nuclease - ThermoFisher; Catalog Number: E1014-25KU 4-20% Mini-PROTEAN® TGX® Precast Protein Gels, 10-well BioRad; Catalog Number: 4561094 Bovine serum albumin - Sigma Aldrich; Catalog number: A9418-100G Pierce (trademark) ECL Western Blotting Substrate-ThermoFisher; Catalog Number: 32106 EDTA-Sigma Aldrich; Catalog Number: E8008-100ML XenoLight D-Luciferin-K+ Salt Bioluminescent Substrate-Perkin Elmer; Catalog Number: 122799 Neon™ Transfection System 100 μL Kit - Invitrogen; Catalog Number: MPK10025.

[0162] B.Equipment (i) PCR thermocycle (ii) tissue culture hood (iii) 15cm tissue culture dish (Corning) (iv) Retronectin-coated plate (Takara) (v) Neon® Transfection System (ThermoFisher) (vi) Bioanalyzer (Agilent) (vii) Pipettes and tips (viii) Next-generation sequencing machine (Illumina) (ix) Cell culture incubator (37°C, 5% CO2) (x) Countess Automatic Cell Counter (Thermo Fisher) (xi) Plate reader (PerkinElmer) (xii)BD FACSAria II (BD Biosciences) (xiii) FlowJo software 9.9.4 (Treestar, Ashland, OR)

[0163] Construction of C.AAV vectors 1. Design and construction of crRNA expression vectors (i) Identify genes for knockout by targeted delivery of HDR templates. While TRAC is used as an example, any gene containing a Cpf1 PAM sequence can be targeted. (ii) Design LbCpf1 crRNA (20 bp) using Benchling or other computer pipelines. crTRAC:GAGTCTCTCAGCTGGTACAC(Sequence IDs 12,135) (iii) Synthesize an oligonucleotide having two LbCpf1 direct repeats and an attached end. (iv) Digest pXD060, pXD017, or pXD071 with FD BbsI and insert the guide after the U6 promoter.

[0164] 2. CAR sequence generation (i) CD22BBz CAR generation can be carried out as previously described (Haso, W., et al., Blood., 121(7):1165-74 (2013). A human CD22-specific CD22-binding scFv(m971), followed by a CD8 hinge transmembrane domain linked to the 4-1BB(CD137) intracellular domain and the CD3ζ intracellular domain. (ii) The sequence of CD19-binding scFv(FMC63) can be found in NCBI (GenBank: HM852952), and this sequence may be followed by a CD8 hinged transmembrane region linked to the 4-1BB(CD137) intracellular domain and the CD3ζ intracellular domain (Kochenderfer, JN., et al., J. Immunother., 32(7):689-702 (2009)). To detect CD19BBz CARs in a different way, a flag or other tag sequence may be appended after the CD8α reader sequence. (iii) Use gBlock(IDT) to synthesize m971-BBz and FMC63-BBz.

[0165] 3. HDR mold design (i) First generation CD4 + The left and right homologous arms of the TRAC locus from T cells are amplified by PCR using a locus-specific primer set with multiple cloning sites (MCS). PCR annealing temperature (60°C). (ii) Sequence the amplicons.

[0166] 4. AVV-crRNA-HDR-CAR vector cloning (i) Cloning the HDR sequence into the AAV vector (pXD060) using Gibson assembly. Incubating the sample in a thermocycler at 50°C for 30 minutes. (ii) Construction of pXD071 (CD19CAR): pXD040 is digested, and then the CAR sequence is cloned into the MCS by Gibson assembly.

[0167] D.AAV production and titer measurement 1. AAV production (i) HEK293FT cells are transfected with polyethyleneimine (PEI) in a 15 cm tissue culture dish with the AAV construct, AAV2 transgene vector, packaging (pDF6) plasmid, and AAV6 / 9 serotype plasmid. (ii) The transfected cells are collected using PBS 72 hours after transfection.

[0168] 2. AAV purification and titer measurement (i) Mix the transfected cells with pure chloroform (1 / 10 volume). (ii) Incubate the cells at 37°C for 1 hour with vigorous shaking. (iii) Add NaCl until the final concentration reaches 1M. (iv) Centrifuge at 20,000g at 4°C for 15 minutes. (v) Transfer the aqueous layer to another tube and discard the chloroform layer. (vi) Add PEG8000 to the sample up to 10% (w / v) and shake until dissolved. (vii) Incubate the mixture at 4°C for 1 hour, then centrifuge at 20,000 g at 4°C. (viii) Discard the supernatant and suspend the pellet in DPBS containing MgCl2. (ix) Treat the sample with universal nuclease and incubate at 37°C for 30 minutes. (x) Add chloroform (1:1 volume), shake, and centrifuge at 12,000 g at 4°C for 15 minutes. (xi) The aqueous layer is isolated and concentrated using 100 kDa MWCO. Concentrating AAV at a high concentration reduces the volume required for infection and thus lowers the toxicity of AAV. AAV should be divided into aliquots and stored at -80°C. (xii) The viral titer is measured by qPCR using a custom-ordered Taqman assay (ThermoFisher) targeting promoter U6.

[0169] ET cell electroporation Human primary peripheral blood CD4 +T cells can be obtained from healthy donors (STEMCELL technologies). These T cells can be cultured in X-VIVO medium (Lonza) containing 5% human AB serum and recombinant human IL-2 at 30 U / mL. (i) Activate T cells with CD3 / CD28 Dynabeads for two days prior to electroporation. (ii) Remove the Dynabeads using a magnetic holder. (iii) 2 × 10 per 10 μL tip reaction in the electroporation buffer R (Neon Transfection System Kit) 5 2 × 10 cells or 100 μL tip reaction 6 Prepare the cells at a specific density. (iv) Mix with 1 μg or 10 μg of modified NLS-LbCpf1-NLS mRNA (TriLink) according to the reaction volume. (v) Administer an electric shock using program 24 (1,600V, 10ms and 3 pulses). (vi) Immediately after electroporation, transfer the cells into 200 μl or 1 mL of pre-warmed X-VIVO medium (antibiotic-free). (vii) Two to four hours after electroporation, the indicated volume of AAV (AAV volume less than 20% of the culture volume) is added to the T cells. CAR will begin to be expressed after two to three days and will be enriched after stimulation of the target cells.

[0170] F. CAR-T detection by flow cytometry (i) After 5 days of electroporation, 1 × 10 6 CD22BBz CAR transduced T cells were incubated with 0.2 μg of CD22-Fc (R&D system) in 100 μL of PBS for 30 minutes, and then stained with PE-IgG-Fc and FITC-CD3 antibodies for 30 minutes. (ii) For CD19CAR detection, CD19BBz CAR transduced T cells are incubated with APC-anti-Flag and FITC-CD3 antibodies for 30 minutes. (iii) Wash the cells twice, and quantify and sort the labeled cells using BD FACSAria II. (iv) The staining pattern can be analyzed using FlowJo software 9.9.4 (Treestar, Ashland, OR).

[0171] G.T7E1 assay Five days after electroporation, collect the bulk transduced T cells and sort the T cells. Genomic DNA can be collected using QuickExtract DNA Extraction Solution (Epicentre). (i) PCR amplifies the target locus from genomic DNA around the cleavage site. (ii) Run the PCR amplicon on a 2% E-gel EX and purify it using the QIAquick Gel Extraction Kit (using known band sizes). (iii) After purification, denature, anneal 200 ng of the purified PCR product, and digest it with T7E1 at 37 °C for 45 minutes (New England BioLabs). (iv) Load the digested PCR product onto a 2% E-gel EX and quantify the amount of DNA fragments using the E-Gel™ Low Range Quantitative DNA Ladder (ThermoFisher).

[0172] H. HDR quantification and NGS sequencing analysis 1. Semi-quantitative In-Out PCR (i) Use three primers for In-Out PCR: TRAC primer 1: Binds to the sequence of the left TRAC homologous arm TRAC primer 2: Binds to the genomic sequence outside this AAV donor CD22CAR primer 3: Recognizes the sequence contained in the m971-BBz cassette (ii) Normalize the amplicon (labeled TRAC-HDR) concentration by comparison with the product obtained from an uninfected control having genomic DNA isolated from human CD4 + T cells. (iii) PCR products can be used for Nextera library preparation according to the manufacturer's protocol (e.g., Illumina). (iv) The prepared library can be sequenced with 100 bp single-ended reads using an Illumina HiSeq 4000 instrument or equivalent.

[0173] 2. Indel Quantification (i) Some PCR products from amplification around the cleavage sites of genomic DNA (the same sample as in the T7E1 assay) can be used for Nextera library preparation according to the manufacturer's protocol (Illumina). (ii) The prepared library can be sequenced with 100 bp paired-end reads using an Illumina HiSeq 4000 instrument or equivalent (generating 29 million to 74 million reads per library). (iii) Map the pair of reads to the amplicon sequence (the expected sequence provided in FASTA format to generate the index) using BWA-MEM with the -M option. (iv) Discard 100bp reads in the SAM file that fall outside the + / - 75bp window of the expected cut site in the amplicon. (v) Discard soft clipped reads (identified by the character "S" in the CIGAR string). (vi) Identify indel reads based on the presence of the character "I" or "D" within the CIGAR string. (vii) Quantify the cutting efficiency as the percentage of indels relative to the total (indels + wild-type leads) within the defined window.

[0174] I. Functional assay of co-cultures 1. Stable cell line generation (i) Generate a lentivirus containing the GFP-luciferase reporter gene. (ii) NALM6 cells (ATCC) are infected with lentivirus concentrated to half its original volume by spinoculation at 32°C for 45 minutes at 800g on a retronectin-coated (Takara) plate. (iii) After 2 days of infection, GFP-positive cells (NALM6-GL) are selected by flow cytometry. (iv) After culturing for another two days, a second selection round is performed. (v) Cells are incubated with 150 μg / ml of D-luciferin (PerkinElmer), and luciferase expression is assessed by measuring the bioluminescence signal intensity using the IVIS system.

[0175] 2. Cancer cell lysis assay (cell death assay) (i) 2 × 10 4 Seed NALM6-GL cells into a 96-well plate. (ii) Co-culture the modified T cells with NALM6-GL at the specified E:T ratio for 24 hours. (iii) Add 150 μg / ml of D-luciferin (PerkinElmer) to each well and measure the luciferase assay intensity using a plate reader (PerkinElmer) to assess cell proliferation.

[0176] 3. T cell exhaustion assay (i) Co-culture CAR T cells with NALM6-GL cells at an appropriate E:T ratio (e.g., 0.2:1) for an appropriate period (e.g., 24 hours). (ii) Collect the cells and wash them once with DPBS. Incubate the cells with 0.2 μg of CD22-Fc (R&D Systems) in 100 μL of DPBS for 30 minutes. (iii) Stain the cells with PE-IgG-Fc, PD-1-FITC, TIGIT-APC, and LAG3-Percp / cy5.5 (Biolegend) for 30 minutes. (iv) The stained cells are measured by flow cytometry.

[0177] 4. Intracellular staining of IFNγ and TNF-α (i) After 5 days of infection, AAV-transduced CD22BBz CAR-T cells are co-cultured with NALM6 in a 1:1 E:T ratio in fresh medium supplemented with brefeldin A and 2 ng / mL of IL-2. (ii) After 5 hours of incubation, collect surface CARs and stain them. (iii) Fix and permeabilize the cells with fixation / permeabilization solution (BD), and add anti-IFNγ-APC or anti-TNF-α-FITC for intracellular staining. (iv) After 30 minutes, the stained cells are washed with BD Perm / Wash® buffer and measured by flow cytometry.

[0178] IV.How to use A. Screening Methods for performing screening are provided. Generally, screening is designed to identify genes involved in one or more phenotypes of interest. Exemplary cellular phenotypes include increased tumor / tumor microenvironment invasion, increased target cell affinity, increased cytotoxicity to target cells, increased persistence, increased expansion / proliferation, reduced exhaustion, improved anti-cancer metabolic function, increased ability to prevent immune evasion, reduced nonspecific cytokine production, decreased off-target toxicity, reduced cytokine release syndrome (CRS) (e.g., when introduced in vivo), and combinations thereof. Screening is loss-of-function or gain-of-function. Screening can be performed in vitro (e.g., in cultured cells) or in vivo (e.g., in subjects such as mice or rats).

[0179] Generally, screening involves contacting cells with a library of vectors containing guide RNA and / or CARs and RNA-induced endonucleases (e.g., Cpf1). Screening is performed under conditions that allow cells to undergo genetic modification (e.g., knock-in and subsequent expression of CARs, and / or modification of target genes or target sites). The screening method further includes a step of applying selective pressure to cells to enrich them with cells exhibiting the desired phenotype. In some embodiments, the method may include a step of identifying guide RNAs that are enriched or abundant (e.g., compared to a control guide RNA) in the selected cells. In some embodiments, the method may include a step of identifying guide RNAs that are depleted or depleted (e.g., compared to a control guide RNA) in the selected cells. Enrichment or depletion of guide RNA is enrichment or depletion compared to a point in time before selection (e.g., day 0), untargeted guide RNA, or a combination thereof. Since the targeted genes of each guide RNA are known, identification of guide RNAs makes it possible to identify genes that contribute to the desired phenotype. The screening results can be validated by independently generating cells containing one or more modifications (e.g., mutations) of one or more genes identified by the screening. The same or different guide RNAs can be used for validation.

[0180] An exemplary screening for identifying one or more genes that enhance a desired phenotype of cells containing a CAR comprises: (a) contacting a population of cells with an RNA-guided endonuclease and a library containing a plurality of vectors, wherein each vector independently contains: (i) a crRNA expression cassette encoding a first guide RNA and a second guide RNA; (ii) a CAR expression cassette; and (iii) 5' and 3' homologous arms for targeted genomic integration by homologous recombination repair (HDR); and (b) selecting cells that exhibit the desired phenotype. In some preferred embodiments, each AAV vector in the plurality of AAV vectors contains a unique second guide RNA. The contacting step is performed under conditions that allow for the targeted genomic integration of the crRNA and CAR expression cassettes and the expression of the guide RNAs and CARs encoded thereby. In some embodiments, the first guide RNA targets the TRAC locus, and the second guide RNA targets genes involved in T cell exhaustion, T cell proliferation, T cell co-stimulation, memory T cell differentiation, T cell receptor signaling, epigenetic regulation, adaptive immune response, immune response to tumor cells, and / or other immune functions, or combinations thereof. In some embodiments, the first guide RNA targets the TRAC locus and / or the second guide RNA within the population of cells targets one or more genes selected from Table 2 or Table 3, as a whole.

[0181] The method may further comprise identifying the crRNA expression cassette present in the selected cells, such that genes that enhance the desired phenotype are identified based on their targeting by the guide RNAs encoded by the crRNA expression cassette. In some embodiments, identification of the crRNA expression cassette can be accomplished by sequencing genomic DNA.

[0182] B. Treatment method A method is provided for inducing or increasing the immune response of a target by administering an effective amount of a pharmaceutical composition containing a population of genetically modified cells (e.g., CAR T cells) to the target.

[0183] Drugs and compositions may also be used in methods for treating diseases, disorders, or conditions. An exemplary method includes the step of treating a subject (e.g., a human) having a disease, disorder, or condition by administering an effective amount of a pharmaceutical composition containing a population of genetically modified cells (e.g., CAR T cells) to the subject. In some embodiments, the disease, disorder, or condition is associated with the high or specific expression of an antigen. In some embodiments, the cells administered to the subject contain / express CARs that target the antigen.

[0184] In some embodiments, cells are isolated from a subject with a disease, disorder, or condition, or from a healthy donor, before genetic modification. For example, in some embodiments, the treatment method includes the steps of (i) obtaining cells (e.g., T cells) from the subject, (ii) modifying the cells to express a heterologous CAR, and (iii) administering an effective amount of the modified cells to the subject. In some embodiments, the CAR recognizes an antigen associated with the disease, disorder, or condition. Any treatment method may further include the step of expanding the population of cells before and / or after genetic modification.

[0185] In some embodiments, in addition to CAR incorporation and expression, cells are further modified by one or more mutations that cause reduced or lost function of one or more genes (or their gene products) selected from PRDM1, DPF3, SLAMF1, TET2, HFE, PELI1, PDCD1, HAVCR2 / TIM3, TET2, NR4A2, LAIR1, USB1, and genes listed in Table 2 or Table 3.

[0186] Diseases that will be treated The subjects to whom the composition is administered may have a disease, disorder, or condition, for example, but not limited to, cancer, inflammatory diseases, neuronal disorders, HIV / AIDS, diabetes, cardiovascular diseases, infectious diseases, immune system disorders, such as autoimmune diseases, or a combination thereof.

[0187] 1. Cancer Cancer is a disease of genetic instability that causes cancer cells to acquire remarkable features proposed by Hanahan and Weinberg, including (i) self-sufficiency in growth signals; (ii) insensitivity to anti-growth signals; (iii) evasion of apoptosis; (iv) persistent angiogenesis; (v) tissue invasion and metastasis; (vi) unlimited replication capacity; (vii) reprogramming of energy metabolism; and (viii) evasion of immune destruction (Cell., 144:646-674, (2011)).

[0188] Tumors that can be treated according to the method are classified according to the embryonic origin of the tissue from which the tumor originates. Carcinomas are tumors that arise from endoderm or ectoderm tissue, such as the epithelial layer of the skin or viscera and glands. Sarcomas, which occur less frequently, originate from mesoderm connective tissue, such as bone, fat, and cartilage. Leukemia and lymphoma are malignant tumors of hematopoietic cells in the bone marrow. Leukemia proliferates as single cells, while lymphoma tends to grow as a tumor mass. Malignant tumors can appear in a great many organs or tissues of the body and establish cancer.

[0189] The compositions and methods are generally suitable for the treatment of carcinomas, sarcomas, lymphomas, and leukemias. The compositions and methods described are useful for treating or alleviating subjects with benign or malignant tumors by delaying or inhibiting the growth / proliferation or viability of tumor cells in the subject, reducing the number, growth, or size of tumors, inhibiting or reducing tumor metastasis, and / or suppressing or alleviating symptoms associated with tumor development or growth.

[0190] In some embodiments, cancer is humoral cancer (e.g., acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), multiple myeloma (MM), acute lymphoblastic leukemia (ALL), Hodgkin lymphoma, B-cell acute lymphoblastic leukemia (BALL), T-cell acute lymphoblastic leukemia (TALL), small lymphocytic leukemia (SLL), B-cell prelymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasms, Burkitt lymphoma, diffuse large B-cell lymphoma (DLBCL), chronic myeloid leukemia, myeloproliferative neoplasms, follicular lymphoma, myelodysplasia, myelodysplastic syndromes, non-Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasms, and Waldenström macroglobulinemia).

[0191] In some embodiments, cancer is a solid tumor. The term “solid tumor” refers to an abnormal mass of tissue that does not typically contain cysts or fluid areas. Solid tumors can be benign or malignant. Various types of solid tumors have names derived from the types of cells that form them. Examples of solid tumors include, but are not limited to, mesothelioma, non-small cell lung cancer, small cell lung cancer, squamous cell carcinoma of the lung, large cell lung cancer, pancreatic cancer, pancreatic ductal adenocarcinoma, esophageal adenocarcinoma, breast cancer, glioblastoma, ovarian cancer, colorectal cancer, prostate cancer, cervical cancer, skin cancer, melanoma, kidney cancer, liver cancer, brain cancer, thymoma, sarcoma, carcinoma, uterine cancer, kidney cancer, gastrointestinal cancer, urothelial carcinoma, pharyngeal cancer, head and neck cancer, rectal cancer, esophageal cancer, or bladder cancer, or their metastases. [Table 1-1] [Table 1-2]

[0192] The types of cancer that can be treated with the provided compositions and methods include, but are not limited to, cancers of the bone, bladder, brain, breast, cervix, colorectal, esophagus, kidney, liver, lung, nasopharyngeal, pancreas, prostate, skin, stomach, and uterus, as well as vascular cancers such as multiple myeloma, adenocarcinoma, and sarcoma. In some embodiments, the compositions are used to treat multiple types of cancer simultaneously. The compositions can also be used to treat metastases or tumors at multiple locations.

[0193] 2. Immune system disorders Immune system disorders can also be treated. Non-limited examples of immune system disorders include 22q11.2 deletion syndrome, chondrodysplasia and severe combined immunodeficiency, adenosine deaminase 2 deficiency, adenosine deaminase deficiency, adult-onset immunodeficiency due to anti-interferon-gamma autoantibodies, agammaglobulinemia, non-Breton type, Eicardi-Goutier syndrome, Eicardi-Goutier syndrome type 5, allergic bronchopulmonary aspergillosis, alopecia, alopecia totalis, alopecia generalis, amyloidosis AA, familial visceral amyloidosis, and telangiectatic ataxia. Symptoms, autoimmune lymphoproliferative syndrome, autoimmune lymphoproliferative syndrome caused by CLTA4 haploinsufficiency, polyglandular autoimmune syndrome type 1, autosomal dominant hyper-IgE syndrome, autosomal recessive early-onset inflammatory bowel disease, autosomal recessive hyper-IgE syndrome, naked lymphocytic syndrome 2, Barth syndrome, Blau syndrome, Bloom syndrome, bronchiolitis obliterans, C1q deficiency, familial chronic mucocutaneous candidiasis, autosomal recessive chondrohair hypoplasia, CHARGE syndrome, Chediak-Higashi syndrome, cherubism, lipodystrophy Chronic atypical neutrophilic dermatosis with fever and high fever, chronic graft-versus-host disease, chronic granulomatous disease, chronic infantile neurocutaneous arthritis syndrome, chronic mucocutaneous candidiasis (CMC), Cohen's syndrome, combined immunodeficiency with cutaneous granulomatous disease, unclassifiable immunodeficiency, complement component 2 deficiency, complement component 8 deficiency type 1, complement component 8 deficiency type 2, congenital alveolar proteinosis, cryoglobulinemia, cutaneous mast cell tumor, periodic neutropenia, interleukin-1 receptor antagonist deficiency, dendritic cell, monocyte, B lymphocyte, and natural killer lymphocyte deficiencies, congenital Abnormal keratosis, autosomal dominant congenital abnormal keratosis, autosomal recessive congenital abnormal keratosis, X-linked congenital abnormal keratosis, verrucous epidermal dysplasia, familial amyloidosis, Finnish type, familial cold autoinflammatory syndrome, familial Mediterranean fever, familial mixed cryoglobulinemia, Felty syndrome, glycogen storage disease type 1B, Grischelli syndrome type 2, Hashimoto's encephalopathy, Hashimoto's syndrome, hemophagocytic lymphohistiocytosis, Henecum syndrome, hepatic vein atresia with immunodeficiency, hereditary folate malabsorption, Hermanskie paradox syndrome 2, herpes simplex encephalitis, Hoyeraal-Hreidarsson syndrome, hyper-IgE syndrome, hyper-IgD syndrome,ICF syndrome, idiopathic acute eosinophilic pneumonia, idiopathic CD4-positive T lymphopenia, IL12RB1 deficiency, immune deficiency due to absence of thymus, immune dysfunction with T cell inactivation due to impaired cow's influx 1, immune dysfunction with T cell inactivation due to impaired calcium influx 2, immunodeficiency with type 1 hyper-IgM, immunodeficiency with type 2 hyper-IgM, immunodeficiency with type 3 hyper-IgM, immunodeficiency with type 4 hyper-IgM, immunodeficiency with type 5 hyper-IgM, immunodeficiency with thymoma, immunodeficiency without anhidrotic ectodermal dysplasia, immunomodulatory disorders, polyglandular endocrine disorders / intestinal diseases X Linked type, immunoglobulin A deficiency type 2, multiple intestinal obstruction, IRAK-4 deficiency, isolated growth hormone deficiency type 3, Kawasaki disease, large granular lymphocytic leukemia, leukocyte adhesion disorder type 1, LRBA deficiency, lupus, lymphocytic hypophysitis, Magid syndrome, Melkerson-Rosenthal syndrome, MHC class 1 deficiency, Muckle-Wells syndrome, multifocal fibrosclerosis, multiple sclerosis, MYD88 deficiency, neonatal systemic lupus erythematosus, Netherton syndrome, neutrophil secondary granule deficiency, Nijmihen chromosomal instability syndrome, Omen syndrome, autosomal recessive osteopetrosis type 7, recurrent Rheumatism, Papillon-Lefervre syndrome, partial androgen insensitivity syndrome, PASLI disease, Pearson syndrome, childhood multiple sclerosis, periodic fever, aphthous stomatitis, pharyngitis and lymphadenitis, PGM3-CDG, polymorphic cutaneous atrophy with neutropenia, pruritic urticarial papules of pregnancy, purine nucleoside phosphorylase deficiency, septic arthritis, pyoderma gangrenosum and acne, relapsing polychondritis, reticular dysplasia, sarcoidosis, Sey-Barber-Miller syndrome, Schimke immune osteogenesis imperfecta, Schnitzler syndrome, selective IgA deficiency, selective IgM deficiency, severe combined immunodeficiency Severe combined immunodeficiency due to total or complete RAG1 / 2 deficiency, severe combined immunodeficiency with ionizing radiation sensitivity, severe combined immunodeficiency, autosomal recessive severe congenital neutropenia type 3, severe congenital neutropenia X-linked, Schbachmann-Diamond syndrome, Singleton-Merten syndrome, SLC35C1-CDG (CDG-IIc), specific antibody deficiency, intravertebral chondrodysplasia, Stevens-Johnson syndrome, T-cell immunodeficiency, congenital alopecia and onychomycosis, TARP syndrome, hair-hepatocolitis syndrome, tumor necrosis factor receptor-associated periodic syndromes, twin-to-twin transfusion syndrome,These include Vici syndrome, WHIM syndrome, Wiscott-Aldrich syndrome, Woods-Black-Norbury syndrome, X-linked agammaglobulinemia, X-linked lymphoproliferative syndrome, X-linked lymphoproliferative syndrome 1, X-linked lymphoproliferative syndrome 2, X-linked magnesium deficiency with Epstein-Barr virus infection and neoplasms, X-linked severe combined immunodeficiency, and ZAP-70 deficiency.

[0194] The compositions and methods can also be used to treat autoimmune diseases or disorders. Exemplary autoimmune diseases or disorders, not mutually exclusive with the above-mentioned immune system disorders, include: achalasia, Addison's disease, adult-onset Still's disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM / anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune autonomic neuropathy, autoimmune encephalomyelitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, axonal and neurological neuropathy. AMAN), Baro's disease, Behçet's disease, benign mucosal pemphigoid, bullous pemphigoid, Castleman disease (CD), celiac disease, Chagas disease, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic relapsing polymyelitis (CRMO), Churg-Strauss syndrome (CSS) or eosinophilic granulomatosis (EGPA), scarring pemphigoid, Cogan syndrome, cold agglutinin disease, congenital heart block, Coxsacki myocarditis, CREST syndrome, Crohn's disease, herpetiform dermatitis, dermatomyositis, Devic's disease (neuromyelitis optica), discoid lupus, Dressler syndrome, intrauterine Membranosis, eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, fibromyalgia, fibrotic alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture syndrome, granulomatosis with polyangiitis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schönlein purpura (HSP), herpes zoster of pregnancy or bullous pemphigoid of pregnancy (PG), hidradenitis suppurativa (HS) (reverse acne), hypogammaglobulinemia, IgA nephropathy, IgG4-related sclerosing disease, Immunotherapy-induced thrombocytopenic purpura (ITP), inclusion body myositis (IBM), interstitial cystitis (IC), juvenile arthritis, juvenile diabetes mellitus (type 1 diabetes mellitus), juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, leukocytoclastic vasculitis, lichen planus, lichen sclerosing, woody conjunctivitis, linear IgA disease (LAD), lupus, chronic Lyme disease, Meniere's disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), Mohren's ulcer, Mucha-Habermann disease, multifocal motor neuropathy (MMN) or MMNCB, multiple sclerosis, myasthenia gravis, myositis,Narcolepsy, neonatal lupus, neuromyelitis optica, neutropenia, ocular scarring pemphigoid, optic neuritis, relapsing rheumatoid arthritis (PR), PANDAS, paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), Parry-Romberg syndrome, ciliary body squamous cellulitis (peripheral uveitis), Personage-Turner syndrome, pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia (PA), POEMS syndrome, polyarteritis nodosa, polysomnogenesis syndrome type I, II, III, polymyalgia rheumatica, polymyositis, post-myocardial infarction syndrome, post-pericardiotomy syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, progesterone dermatitis, psoriasis, psoriatic arthritis, pure red cell fistula (PRCA), pyoderma gangrenosum, Raynaud's phenomenon, Examples include reactive arthritis, reflex sympathetic dystrophy, relapsing polychondritis, restless legs syndrome (RLS), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, Schmidt syndrome, scleritis, scleroderma, Sjögren's syndrome, sperm and testicular autoimmunity, generalized rigidus syndrome (SPS), subacute bacterial endocarditis (SBE), Suzak syndrome, sympathetic ophthalmitis (SO), Takayasu's arteritis, temporal arteritis / giant cell arteritis, thrombocytopenic purpura (TTP), Tolosa-Hunt syndrome (THS), transverse myelitis, type 1 diabetes mellitus, ulcerative colitis (UC), undifferentiated connective tissue disease (UCTD), uveitis, vasculitis, vitiligo, Vogt-Koyanagi-Harada disease, and Wegener's granulomatosis (or granulomatosis with polyangiitis (GPA)).

[0195] Effective amount An effective or therapeutically effective dose of a pharmaceutical composition may be a sufficient dosage to treat, suppress or alleviate one or more symptoms of a disease or disorder, or to otherwise provide a desired pharmacological and / or physiological effect, such as reduction, inhibition or reversal of one or more pathophysiological mechanisms underlying a disease or disorder, such as cancer.

[0196] In some embodiments, the administration of a pharmaceutical composition elicits an anti-cancer response, and the amount administered may be expressed as an amount effective in achieving the desired anti-cancer effect in the recipient. For example, in some embodiments, the amount of the pharmaceutical composition is effective in inhibiting the viability or proliferation of cancer cells in the recipient. In some embodiments, the amount of the pharmaceutical composition is effective in reducing the tumor burden in the recipient, or in reducing the total number of cancer cells, or a combination thereof. In other embodiments, the amount of the pharmaceutical composition is effective in alleviating one or more symptoms or signs of cancer in a cancer patient. Signs of cancer may include cancer markers, such as PSMA levels in the patient's blood.

[0197] The effective amount of pharmaceutical composition required will vary depending on the subject's species, age, weight and overall condition, the severity of the disorder being treated, the properties of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), and its mode of administration. Therefore, it is impossible to determine the exact amount of any pharmaceutical composition. However, those skilled in the art can determine the appropriate amount using only routine experiments, given the disclosed teachings. For example, effective dosages and schedules for administering a pharmaceutical composition can be determined empirically, and making such determinations is within the scope of skill in the art. For further guidance, see Remington: The Science and Practice of Pharmacy (Gennaro ed. 20th edition, Williams & Wilkins PA, USA) (2000). In some embodiments, the dosage range for administering the composition is large enough, for example, to cause a reduction in cancer cell proliferation or viability, or to reduce the tumor burden.

[0198] The dosage should not be so high as to cause adverse side effects, such as undesirable cross-reactions or anaphylactic reactions. Generally, the dosage will vary depending on the patient's age, condition, and sex, the route of administration, whether other drugs are included in the regimen, and the type, stage, and location of the disease being treated. The dosage may be adjusted by the individual physician if there are any contraindications. It will also be understood that the effective dosage of the composition used in the treatment may increase or decrease during the course of a particular treatment. Changes in dosage may result from and be revealed by the results of diagnostic assays.

[0199] Generally, pharmaceutical compositions containing CAR T cells are 10 4 ~10 9 cells / kg body weight, preferably 10 5 ~10 6 The cells may be administered in doses that include all integer values ​​within these ranges of cells / kg body weight. CAR T cell compositions may also be administered once or multiple times in these doses. Cells can be administered by infusion techniques, which are generally known in immunotherapy. Those skilled in the pharmaceutical art can easily determine the optimal dose and treatment regimen for a particular patient by monitoring the patient for signs of the disease and adjusting treatment accordingly. In some embodiments, the unit dose is contained in a unit dosage form for intravenous injection, oral administration, inhalation, or intratumoral injection.

[0200] Treatment can be continued for a sufficient amount of time to achieve one or more desired therapeutic goals, such as a reduction in the number of cancer cells compared to the start of treatment, or the complete absence of cancer cells in the recipient. The progress of treatment can be monitored using any known means for monitoring the progress of anti-cancer treatment in a patient. In some embodiments, administration is given daily, once a week, or once every few days of the week during treatment. In some embodiments, the treatment regimen is given for up to two, three, four, or five days, several weeks or several months, or up to six months, or more than six months, for example, up to one year, two years, three years, or up to five years.

[0201] Combination therapy The compositions can be administered alone or in combination with one or more conventional treatments, such as conventional treatments for the disease or disorder being treated. In some embodiments, the conventional treatment includes the administration of one or more compositions in combination with one or more additional active agents. The additional active agents may have the same or different mechanisms of action. In some embodiments, the combination produces an additive effect on the treatment of the disease or disorder (e.g., cancer). In some embodiments, the combination produces an effect that exceeds the additive effect on the treatment of the disease or disorder.

[0202] Additional treatments or procedures may be administered concurrently with or sequentially with the administration of the composition. In some embodiments, additional treatments are performed between drug-dosing cycles or during drug-free periods that are part of the drug-dosing regimen of the composition.

[0203] Combination therapy can be achieved by using a single pharmaceutical composition containing the therapeutic agent, or by administering two or more separate compositions at the same or different times. Multiple treatments may be administered in any order, preceding or following other treatments at intervals ranging from minutes to weeks. In embodiments where other drugs are administered separately, it is preferable to administer the treatments within a time frame that allows the drugs to still exert a beneficial combined effect on the patient. In such cases, it is intended that both modalities be administered within approximately 12 to 24 hours of each other, more preferably within approximately 6 to 12 hours of each other. However, in some situations, it may be desirable to extend the duration of treatment when several days (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 days, or more) to several weeks (e.g., 1, 2, 3, 4, 5, 6, 7, 8 weeks, or more) elapse between each administration.

[0204] In some embodiments, additional treatments or procedures include surgery, radiotherapy, chemotherapy, immunotherapy, cancer vaccines (e.g., dendritic cell vaccines), cryotherapy, or gene therapy. Immunotherapy includes, but is not limited to, the administration of one or more immune checkpoint blockers. Examples of immune checkpoint blockers include, but are not limited to, antibodies or antigen-binding fragments that are inhibitors of CTLA-4, PD-1, PD-L1, PD-L2, TIM-3, LAG3, or combinations thereof, such as pembrolizumab (anti-PD1 mAb), durvalumab (anti-PD1 mAb), PDR001 (anti-PD1 mAb), atezolizumab (anti-PD1 mAb), nivolumab (anti-PD1 mAb), tremelimumab (anti-CTLA4 mAb), avelumab (anti-PD1 mAb), ipilimumab (anti-CTLA4 mAb), and RG7876 (CD40 agonist mAb).

[0205] Further therapeutic agents suitable for use in combination therapy include conventional cancer treatments, such as chemokines, cytokines, and chemokines. Possible chemokines include, but are not limited to, alkylating agents, antimetabolites, mitotic inhibitors, anthracyclines, cytotoxic antibiotics, topoisomerase inhibitors, and combinations thereof. Monoclonal antibodies and tyrosine kinase inhibitors that directly target molecular abnormalities in certain types of cancer (chronic myeloid leukemia, gastrointestinal stromal tumors), such as imatinib mesylate (GLEEVEC® or GLIVEC®), may also be used. Other suitable anticancer agents include antibodies against vascular endothelial growth factor (VEGF), such as bevacizumab (AVASTIN®) and rhuFAb Examples include angiogenesis inhibitors, including V2 (ranibizumab, LUCENTIS®), and other anti-VEGF compounds; thalidomide (THALOMID®) and its derivatives, e.g., lenalidomide (REVLIMID®); endostatins; angiostatins; receptor tyrosine kinase (RTK) inhibitors, e.g., sunitinib (SUTENT®); tyrosine kinase inhibitors, e.g., sorafenib (NEXAVAR®), erlotinib (TARCEVA®), pazopanib, axitinib, and lapatinib; transforming growth factor-α or transforming growth factor-β inhibitors; and antibodies against epidermal growth factor receptors, e.g., panitumumab (VECTIBIX®) and cetuximab (ERBITUX®).

[0206] Further representative chemotherapeutic agents that may be used include amsacrin, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clofarabine, chrysanthaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epipodophyllotoxin, epirubicin, etoposide, etoposide phosphate, fludarabine, fluorouracil, gemcitabine, and hydroxycarbamide. amide), idarubicin, ifosfamide, irinotecan (innotecan), leucovorin, liposomal doxorubicin, liposomal daunorubicin (daunorubici), romucitane, mechloretamine, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, pentostatin, procarbazine, larcitrexed, satoraplatin, streptozocin, teniposide, Examples of such agents include, but are not limited to, tegafur-uracil, temozolomide, teniposide, thiotepa, thioguanine, topotecan, treosulfan, vinblastine, vincristine, vindesine, vinorelbine, taxol and its derivatives, tratuzumab (HERCEPTIN®), cetuximab, and rituximab (RITUXAN® or MABTHERA®), bevacizumab (AVASTIN®), and combinations thereof. Representative apoptosis promoters include, but are not limited to, fludarabine taurosporine, cycloheximide, actinomycin D, lactosylceramide, 15d-PGJ(2)5, and combinations thereof.

[0207] In some embodiments, the compositions and methods are used, for example, before or in conjunction with surgical resection of a tumor to prevent metastasis of a primary tumor. In some embodiments, the compositions and methods are used to enhance the body's own anti-tumor immune function.

[0208] V. Kit Gene editing compositions, reagents, compositions, and other materials can be packaged together in any suitable combination as a kit useful for carrying out or assisting in the carrying out of a method. A given kit is useful if its components are designed and suitable for use together in a method. For example, a kit having one or more compositions for administration to a subject may include pre-measured doses of the compositions in sterile needles, ampoules, tubes, containers, or other suitable containers. The kit may include instructions for use regarding the dose and administration regimen.

[0209] A kit is provided that includes an RNA-induced endonuclease (e.g., Cpf1), an AAV crRNA library, and teaching materials for its use. In a preferred embodiment, the library comprises multiple vectors, each independently containing a crRNA expression cassette encoding one or more crRNAs (e.g., two distinct crRNAs) and optionally a CAR expression cassette. In some embodiments, the kit may contain a population of cells (e.g., T cells) containing the AAV crRNA library as a whole. Teaching materials may include publications, records, figures, or any other means of representation that can be used to convey the usefulness of the kit's composition and methods. For example, teaching materials may provide instructions for using the kit components, e.g., for transfection, transduction, infection, and screening.

[0210] Please understand that, unless otherwise indicated, the methods and compositions are not limited to any particular synthesis method, analytical technique, or reagent, and are therefore subject to change. Also, please understand that the terminology used is intended solely to describe a particular embodiment and is not intended to be limiting.

[0211] The present invention can be further understood by referring to the following numbered sections. 1. A library containing two or more vectors, where each vector is: One or more reverse terminal repeat (ITR) sequences, a 5' homologous arm, a crRNA expression cassette, a chimeric antigen receptor (CAR) expression cassette, and a 3' homologous arm. A library that includes this.

[0212] 2. The library of item 1, wherein the crRNA expression cassette of each vector independently encodes a first guide RNA and a second guide RNA, and the first guide RNA is identical across multiple vectors.

[0213] 3. A library of item 1 or 2, wherein the second guide RNA is specific to each vector across multiple vectors.

[0214] 4. A library relating to any one of items 1 to 3, wherein one or more sequences encoding one or more of the encoded guide RNAs are selected from the group consisting of SEQ ID NOs: 3 to 12, 134.

[0215] 5. A library of any one of items 1-4, containing approximately 100-300,000, 1,000-5,000, or 5,000-10,000 distinct guide RNAs in total.

[0216] 6. A library according to any one of items 1 to 7, containing, as a whole, the guide RNA encoded by sequence numbers 3-4,087 (Rene library), sequence numbers 4,088-12,134 (Descartes library), or sequence numbers 3-12,134.

[0217] 7. A library according to any one of items 1 to 6, wherein each crRNA expression cassette contains a U6 promoter operably ligated to a sequence encoding one or more guide RNAs.

[0218] 8. A library according to any one of items 1-7, wherein each crRNA expression cassette contains sequences encoding a first guide RNA and a second guide RNA.

[0219] 9. A library of any one of items 1-8, comprising an EFS promoter and / or polyadenylation signal sequence ligated to act on a CAR-coding sequence.

[0220] 10. A library of any one of items 1-9, in which the crRNA expression cassette and / or CAR expression cassette of each vector are located between the 5' homologous arm and the 3' homologous arm.

[0221] A library of any one of items 1-10, in which the 11.5' and 3' homologous arms are homologous to the TRAC locus.

[0222] 12. A library of any one of items 1-11, in which each vector encodes at least one guide RNA that targets the TRAC locus.

[0223] 13. A library of any one of items 1 to 12, wherein the CAR targets one or more cancer-specific antigens or cancer-associated antigens.

[0224] 14. A library of any one of items 1-13, where the CAR is either an anti-CD19 CAR or an anti-CD22 CAR.

[0225] 15. A library of any one of items 2-14, in which the second guide RNA targets genes involved in T cell exhaustion, T cell proliferation, T cell costimulation, memory T cell differentiation, T cell receptor signaling, epigenetic regulation, adaptive immune response, immune response against tumor cells, other immune functions, or a combination thereof.

[0226] 16. The vector is The nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, with or without a TRAC-targeting crRNA encoding sequence, with or without one or more additional crRNA coding sequences inserted as needed into the BbsI cloning site, and / or with an existing CAR coding sequence or another CAR coding sequence used instead, or Includes sequence variants having 75% or higher sequence identity with respect to any of the above, A library of any one of items 1 through 15.

[0227] 17. A library of any one of items 1 to 16, where each vector is a viral vector, preferably an adeno-associated virus (AAV) vector, and optionally the AAV is AAV6.

[0228] 18. A vector of any one of items 1 through 17.

[0229] 19. A population of cells containing the AAV vector described in item 18.

[0230] 20. A population of cells that, if necessary, contain as a whole a library of any one of items 1 to 17, with each cell containing at most one or two AAV vectors included in the library.

[0231] 21. A method for identifying one or more genes that enhance a desired phenotype in cells containing CARs, (a) The step of bringing a population of cells from item 20 into contact with an RNA-induced endonuclease under conditions suitable for genomic integration and expression of the guide RNA and CAR contained in the vector; and (b) step of selecting cells that exhibit the desired phenotype Methods that include...

[0232] 22. The method of item 21, wherein the crRNA expression cassette and the CAR expression cassette are incorporated into the TRAC gene locus.

[0233] 23. The method of item 21 or 22, wherein the RNA-inducible endonuclease is provided as mRNA encoding an RNA-inducible endonuclease, a viral vector encoding an RNA-inducible endonuclease, or an RNA-inducible endonuclease protein, or a complex of an RNA-inducible endonuclease protein and RNA.

[0234] 24. The method of item 23, wherein RNA-induced endonucleases are provided by electroporation.

[0235] 25. The method according to any one of items 21-24, wherein the RNA-induced endonuclease is Cpf1, or an active variant, derivative, or fragment thereof.

[0236] 26. A method according to any one of items 21-25, wherein the desired phenotype is selected from the group including increased tumor / tumor microenvironment invasion, increased or optimized target cell affinity, increased cytotoxicity to target cells, increased persistence, increased expansion / proliferation, reduced exhaustion, improved anti-cancer metabolic function, increased ability to prevent immune evasion, reduced nonspecific cytokine production, reduced off-target toxicity, reduced cytokine release syndrome (CRS), and combinations thereof.

[0237] 27. A method according to any one of paragraphs 21-26, wherein the selection step includes co-culturing a population of cells with target cells containing one or more antigens recognized by CAR for a specified period of time, selection based on flow cytometry or affinity, selection based on an immunomarker, in vivo tumor invasion, CAR-antigen interaction, directed evolution, or a combination thereof.

[0238] 28. The method of item 27, wherein a population of cells is repeatedly co-cultured with target cells.

[0239] 29. The method of paragraph 27 or 28, wherein the period includes approximately 1 to approximately 60 days.

[0240] 30. A method according to any one of items 27-29, wherein the target cells include cancer cells.

[0241] 31. The method of any one of items 21-30, further comprising the step of identifying the crRNA expression cassette present in the selected cells.

[0242] 32. The method of item 31, wherein the step of identifying a crRNA expression cassette includes sequencing the genomic DNA of selected cells.

[0243] 33. The method of paragraph 31 or 32, wherein one or more genes that enhance a desired phenotype are identified as targeted genes of a guide RNA encoded by a crRNA expression cassette.

[0244] 34. A method according to any one of items 21 to 33, wherein the cell population includes effector T cells, memory T cells, central memory T cells, effector memory T cells, Th1 cells, Th2 cells, Th3 cells, Th9 cells, Th17 cells, Tfh cells, Treg cells, gamma-delta T cells, hematopoietic stem cells (HSCs), macrophages, natural killer cells (NKs), B cells, dendritic cells (DCs), or other immune cells.

[0245] 35. T cells, CD4 + or CD8 + The method described in section 34 involves T cells.

[0246] 36. Isolated CAR T cells comprising a CAR and one or more mutations in one or more genes identified by the method of any one of items 21 to 35.

[0247] 37. CAR T cells of item 36, in which one or more mutations cause a decrease in the function of one or more genes or their gene products.

[0248] 38. CAR T cells of item 36 or 37, wherein one or more genes are selected from the group comprising PRDM1, DPF3, SLAMF1, TET2, HFE, PELI1, PDCD1, HAVCR2 / TIM3, TET2, NR4A2, LAIR1, and USB1.

[0249] 39. CAR T cells of any one of items 36-38 that exhibit increased memory, increased cell proliferation, increased persistence, increased cytotoxicity to target cells, decreased T cell terminal differentiation, and / or reduced T cell exhaustion compared to CAR T cells that do not contain one or more mutations in one or more genes.

[0250] A population of CAR T cells obtained by magnifying any one of the CAR T cells described in section 40, items 36-39.

[0251] 41. A pharmaceutical composition comprising a population of CAR T cells as described in item 40 and a pharmaceutically acceptable buffer, carrier, diluent, or excipient.

[0252] 42. A method for treating a subject having a disease, disorder or condition, comprising the step of administering an effective amount of the pharmaceutical composition of item 41 to the subject.

[0253] 43. The method of paragraph 42, wherein the disease, disorder, or condition is related to the high or specific expression of an antigen.

[0254] 44. CAR T cells target antigens using the method described in section 43.

[0255] 45. The method of any one of paragraphs 42 to 44, wherein cells are isolated from a healthy donor or from an object having a disease, disorder or condition, prior to the introduction of one or more mutations in one or more genes.

[0256] 46. ​​The method of any one of paragraphs 42-45, wherein the disease, disorder or condition is cancer, inflammatory disease, neuronal disorder, HIV / AIDS, diabetes, cardiovascular disease, infectious disease, or autoimmune disease.

[0257] 47. The method of paragraph 46, wherein the cancer is a leukemia or lymphoma selected from the group including chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), mantle cell lymphoma, non-Hodgkin lymphoma, and Hodgkin lymphoma.

[0258] 48. Any method described in items 42-47, wherein the subject is a human.

[0259] 49. A cell comprising a heterogeneous nucleic acid construct which includes one or more crRNA expression cassettes containing nucleic acid sequences encoding one or more guide RNAs selected from the group consisting of SEQ ID NOs: 3-12,134, and a chimeric antigen receptor (CAR) expression cassette.

[0260] 50. Cells comprising a heterologous nucleic acid construct encoding a chimeric antigen receptor (CAR) expression cassette, and reduced or lost expression at one or more gene loci targeted by one or more guide RNAs selected from the group consisting of SEQ ID NOs: 3-12, 134 and others.

[0261] 51. Cells of item 49 or 50 in which a heterologous nucleic acid construct is present at the TRAC gene locus within the cell's genome, and the CAR is, if necessary, an anti-CD19 or anti-CD22 CAR.

[0262] The present invention will be further understood by referring to the following non-limiting embodiments. [Examples]

[0263] (Example 1) Establishment of a CLASH system for ultra-parallel CAR-T operations material and method Design and generation of CLASH AAV structures To generate the CLASH AAV vector (pAAV-LHA-U6-DR-crTRAC-DR-BbsI-EFS-CAR-scFv-RHA or pXD60), the TRAC HDR arm and CD22BBz / CD19BBz CAR were amplified as previously reported (Dai X., et al., Nat. Methods, 16:247-254 (2019)). A single guide targeting the first exon of the TRAC locus and a crRNA cassette containing a double BbsI cleavage site were inserted behind the left TRAC arm. Different fragments were cloned using Gibson assembly and traditional restriction cloning.

[0264] Design of the Rene and Descartes Cas12a / Cpf1 crRNA library The Descartes library contains 8,047 crRNAs (sequence numbers 4,088 to 12,134) targeting 954 genes (see Table 2), with approximately 8 crRNAs and 1,000 non-targeting controls (NTCs) per gene. The target genes were selected as a superset from the following gene list: T cell exhaustion (Wherry EJ., et al., Immunity 27, 670-684 (2007)), epigenetic regulators (Arrowsmith CH., et al., Nature reviews Drug discovery 11, 384-400 (2012)), T cell costimulation (GO:0031295), memory T cell differentiation (GO:0043379), T cell receptor signaling pathway (GO:0050852), adaptive immune response (GO:0002250), immune response against tumor cells (GO:0002418), T cell proliferation (GO:0042098), and TET2. The Rene library contains 4,085 crRNAs (SEQ ID NOs. 3-4,087) targeting 472 genes (see Table 3), including those related to T cell exhaustion, epigenetic regulators, T cell costimulation (GO:0031295), memory T cell differentiation (GO:0043379), and TET2. A total of 500 non-targeted control (NTC) crRNAs were spiked into the Rene library. All crRNAs were scored for selection using Deep Cpf1 (Kim HK., et al., Nat Biotechnol., 36(3):239-241 (2018)). [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 3-1] [Table 3-2] [Table 3-3]

[0265] Clone and preparation of libraries and individual crRNAs Rene and Descartes libraries were synthesized using a CustomArray. Both Rene and Descartes libraries were amplified using two-round PCR. PCR products were purified using a PCR purification kit (Qiagen). The Descartes crRNA library was cloned into a CLASH AAV plasmid by linearization via BbsI digestion and Gibson assembly. The Gibson-assembled Descartes library product was transformed into highly efficient competent cells (Endura) by electroporation. After electroporation by colony counting, an estimated crRNA library coverage of ≥100× was observed. All bacteria were collected in a pool, and the plasmid library was purified using the EndoFree Plasmid Maxi kit (Qiagen). The expression of crRNA in the library plasmids was validated by NGS.

[0266] AAV6 packaging and purification Human T cells were targeted by packaging Descartes libraries, empty vectors, or individual gene-targeting CLASH vectors with AAV6 serotype vectors. Briefly, the AAV6 serotype plasmid, the packing plasmid pDF6, and the AAV6 transgene vector plasmid were added in a ratio of 1.7:2:1, followed by polyethyleneimine, and thoroughly mixed by vortexing. The solution was left at room temperature for 10-20 minutes, and then added dropwise to HEK293FT cells in a 15 cm tissue culture dish (Corning) at a concentration of 80-90%. After 72 hours of transfection, the transfected cells were collected with PBS. For AAV purification, the transfected cells were mixed with pure chloroform (1:10 volume) and incubated at 37°C for 1 hour with vigorous shaking. Pure NaCl was added to a final concentration of 1 M, and the sample was centrifuged at 20,000 g at 4°C for 15 minutes. The aqueous layer was transferred to a separate tube, while the chloroform layer was discarded. PEG8000 was added to a 10% (w / v) concentration, followed by vigorous shaking to dissolve, and the mixture was incubated at 4°C for 1 hour. The sample was centrifuged at 20,000 g at 4°C for 15 minutes. The supernatant was then discarded, and the pellet was resuspended in Dulbecco's phosphate-buffered saline (DPBS) containing MgCl2. The dissolved solution was treated with universal nuclease (Thermo Fisher) and incubated at 37°C for 30 minutes. Chloroform was added (1:1 volume), followed by vortexing and centrifugation at 14,000 g at 4°C for 15 minutes. The aqueous layer was dropped into a 100 kDa molecular cutoff filter (Millipore) and centrifuged at 3000 g to concentrate the virus. The virus was dose-decomposed by quantitative PCR using a custom Taqman assay targeted to the U6 promoter.

[0267] Library-scale AAV transduction Human primary peripheral blood CD8 + T cells or human peripheral blood mononuclear cells (PBMCs) were purchased from STEMCELL Technologies according to the manufacturer's protocol.+ Using a T cell isolation kit (Miltenyi Biotec), CD8 cells were extracted from PBMCs. + T cells were isolated. The T cells were cultured in X-VIVO medium (Lonza) containing 5% human AB serum and recombinant human IL-2 at 20 ng / mL. Electroporation was performed after thawing the T cells for two days. Approximately 2.5 × 10⁶ cells were obtained per 100 μL tip reaction in the electroporation buffer R (Neon transfection kit). 6 Cells were prepared at a density of 10 cells. A total of 20 reactions were set up for electroporation of the Descartes library. After each reaction, T cells were mixed with 10 μg of modified NLS-LbCpf1 mRNA (TriLink) and electroshocked with program 24 (1,600 V, 10 ms and 3 pulses). Immediately after electroporation, the cells were transferred to 1 mL of preheated X-VIVO medium (containing 5% human AB serum but without antibiotics). The estimated number of viral particles (vp) per cell (MOI = 1 × 10⁶) was calculated. 3 ~10 4 The indicated volume of AAV6 in vp / c) was added to T cells after electroporation for 2-4 hours. Due to the fact that empty / defective AAVs exist during packaging, which make the AAVs non-infectious, the actual infectious vp is often lower, and the functional infectivity is 1 × 10⁻⁶. 3 ~10 4 The vp / c ratio should be lower than the vp / c ratio. Although T cells can possess two or more AAVs, T cells only have two copies of the genome; therefore, the CLASH HDR knock-in design sets an upper limit on crRNA integration, so that each cell can have two or fewer different integrated crRNAs. Five days after transduction, the percentage of CAR-positive cells was 10.9%, and an effective infection multiplicity (effective MOI) of 0.1096 was observed over a comparable screening period (term).

[0268] Verification of ultra-parallel HDR knock-in in human T cells Following five days of electroporation, genomic DNA from a massively parallelized T-cell pool was extracted using the QIAamp DNA blood mini-kit (Qiagen). In-out PCR was used to amplify the fragments incorporated from the gDNA. The PCR products were purified using the PCR purification kit (Qiagen) and sequenced by Keck Biotechnology Resource Laboratory (Yale).

[0269] Reproduction All experiments were carried out using at least two biological replications. Experimental replications are indicated where appropriate in the corresponding descriptions in each figure.

[0270] result Currently, due to various challenges, no method exists for high-throughput CAR-T manipulation. Therefore, the CLASH system was developed based on the advantageous features of AAV and the Cas12a / Cpf1 gene editing system. Using the AAV vector, three components were encoded in the transgene: a homologous recombination repair (HDR) arm for targeted knock-in, a CAR expression cassette, and a Cas12a / Cpf1 CRISPR RNA (crRNA) expression cassette for genetic manipulation (Figure 1). While HDR can be used to target any location in the genome, the TRAC locus was targeted first for clinically relevant CAR knock-in. The basis of the CAR expression cassette can be standardized so that all variants can be directly compared for their phenotype, such as persistence. crRNA can be a single element or can be easily manipulated in a pooled form by simple molecular cloning. The advantage of transactivating RNA (tracrRNA) independence allows for the manipulation of multiple crRNAs to be expressed under the same polymerase III promoter. We manipulated an AAV vector expressing three components (CLASH AAV vector, abbreviated as CLASH vector): (1) an anti-CD22 CAR construct (abbreviated as CAR22) having a CD22-scFv, transmembrane domain (TM), and signaling domain (4-1BB, CD3z); (2) a constitutive crRNA targeting the 5' end of the first exon of TRAC to facilitate knock-in; and (3) a wildcard crRNA cassette isolated from crTRAC by a Cas12a / Cpf1 serial repeat sequence (DR) to examine virtually any number of crRNAs for any set of genes. All of these components are flanked by 5'- and 3'-TRAC HDR arms so that they can be knocked in simultaneously at the same location (Figure 1). The CLASH AAV vector thus provided three distinct functions in one setting: knock-in to the TRAC locus, CAR expression, and targeted mutagenesis.

[0271] To enable ultra-parallel CAR knock-in in human primary T cells, we developed and optimized a workflow for CLASH-mediated human CAR-T cell manipulation (Figure 1). In this workflow, Cas12a / Cpf1 mRNA is first delivered to human primary CD8 T cells by electroporation, followed by transduction with AAV6 encoding the CLASH vector or library. To examine the CAR generation efficiency of CLASH, on-target integration of CARs into T cells was measured by FACS 5 days post-transduction. By staining for CD3, which forms a surface complex with the TCR, the TRAC knockdown efficiency (CD3 - ) was determined to be >60%, with on-target integration of CAR22 in donor 2 and donor 3 CD8 T cells of 37.4% and 51% respectively (CD3 - CAR22 + ) was.

[0272] To achieve massively parallel CAR-T manipulation (CAR-T mass manipulation) using immunologically relevant targets, two Cas12a / Cpf1 guide RNA libraries were designed to diversify wildcard crRNA locations through targeted mutagenesis. The first library, Descartes, contained 8,047 crRNAs targeting 954 immunogenes (see Table 2), with 8 crRNAs per gene for most genes and 1,000 untargeted controls (NTCs) (Figure 2A). Immunogenetic genes were selected as a superset from gene sets related to T cell exhaustion (Wherry et al., 2007), epigenetic regulators (Arrowsmith et al., 2012), T cell costimulation, memory T cell differentiation, T cell receptor signaling pathways, adaptive immune responses, immune responses against tumor cells, T cell proliferation, and the epigenetic regulator TET2. Similarly, we designed Rene, a smaller library containing 4,085 crRNAs targeting a more refined set of genes (Table 3). All crRNAs were scored for selection using Deep Cpf1 (Kim et al., 2018) to enhance potential gene editing efficiency and reduce potential off-target effects. These libraries were cloned into CLASH AAV vectors. Library composition was validated by next-generation sequencing (NGS) using vector-specific primer readings.

[0273] To examine (i) whether the entire CLASH construct was integrated into the TRAC locus in the human T cell genome, and (ii) whether the knock-in scale was achieved for multiple constructs in the same pool of T cells, genomic regions were amplified rather than the AAV donor using specific primers adjacent to genomic regions outside the 5'- and 3'-HDR arms, and the inserted regions were sequenced. Sanger sequencing results showed, firstly, that the designed knock-in region was indeed present in the genomic DNA; and secondly, there was clear sequence degeneracy in the crRNA wildcard region, indicating the presence of diverse crRNAs in the targeted pool of human T cells. Sanger sequencing results for pooled Descartes-Lib CD22 CAR-T cell genomic DNA at the TRAC locus in both the Descartes-Lib AAV plasmid pool and the Descartes-Lib CLASH knock-in genomic DNA pool showed degeneracy at the library site, but not in either vector control. The observed success of pooled knock-in demonstrated that this CLASH system thus provides a platform for high-throughput generation of defined genome-integrated CARs at a custom-defined library scale in human T cells.

[0274] (Example 2) CLASH mediates high-throughput manipulation and long-term co-culture selection of pooled CAR-T variants. Materials and methods CLASH time course dynamics in long-term CAR-T co-culture Following electroporation with NLS-LbCpf1 mRNA, T cells were infected with the vector or Descartes AAV6. After 5 days of electroporation, the percentage of positive CAR-T cells was determined by staining with CD3 and CAR-specific antibodies. Based on the minimum expression of transduced cells (20 × crRNA), 2 × 10⁶ cells per replication were observed. 6We used positive CAR-T cells. The T cells were co-cultured with NALM6 at a low E:T ratio (0.2:1). After NALM6 clearance, a new round of stimulation was performed until the vector-positive CAR-T cells were exhausted. After each round of stimulation, the T cells were collected and frozen in liquid nitrogen. Genomic DNA (gDNA) was isolated using a DNA purification kit (Qiagen).

[0275] Reading the time course of CLASH CAR-T co-culture. After each round of stimulation, T cell genomic DNA (gDNA) was isolated using a DNA purification kit (Qiagen). A two-step PCR strategy was used for crRNA library reading, in which the first In-Out PCR amplified the integrated fragment from the gDNA, and the second PCR added the appropriate sequencing adapter to the product of the first PCR. For the first round of PCR, the thermocycling parameters were 20 cycles of 1 minute at 98°C (1 second at 98°C, 5 seconds at 60°C, 25 seconds at 72°C) and 2 minutes at 72°C. For each PCR reaction, 2 μg of total gDNA was used for in vitro and 5 μl of DNA extract solution for in vivo. A total of 3–4 reactions were used to capture the full expression of the library. PCR products were pooled for each biological sample and used for amplification with barcoded second PCR primers. For the second round of PCR, the thermocycling parameters were 28 cycles of 1 minute at 98°C (1 second at 98°C, 5 seconds at 61°C, and 10 seconds at 72°C) and 2 minutes at 72°C. The second PCR products were pooled and then normalized for each individual biological sample before combining the separate, uniquely barcoded biological samples. The pooled products were then gel-purified from 2% E-gel EX (Life Technologies) using the QIAquick gel extraction kit (Qiagen). The purified pooled libraries were then sequenced using a HiSeq or NovaSeq system (Illumina).

[0276] Flow cytometry All antibodies for flow cytometry were purchased from Biolegend. Unless otherwise specified, all flow antibodies were used at a 1:200 dilution for staining. For surface staining, cells were stained with surface marker antibodies in a 2% FBS-in-PBS staining buffer for 30 minutes on ice. Before analysis, samples were washed twice with 2% FBS-in-PBS. For CAR staining, CD22BBz CAR-transduced T cells were incubated with 0.2ug CD22-Fc (R&D system) in 100uL staining buffer for 30 minutes, followed by staining with PE-IgG-Fc (Biolegend). For intracellular cytokine staining analysis, CAR + T cells and NALM6 were plated in a 1:1 E:T ratio in 96-well plates (Corning), and 0.2 μl of brefelzin A solution (1000×, clone BFA, BioLegend) was added for 5 hours before each test. After incubation, intracellular cytokine staining was performed using the following antibodies obtained from BioLegend, according to the manufacturer's instructions, with the BD Cytofix / Cytoperm™ fixation / permeabilization solution kit (BD): PerCP / Cyanine 5.5 anti-human / mouse granzyme B (clone QA16A02), FITC anti-human TNFα [clone MAb11], and APC anti-human IFNγ (clone B27).

[0277] Standard statistical analysis All statistical methods are described in their corresponding entries in the figures. P-values ​​and statistical significance were estimated for all analyses. Two groups were compared using independent, two-sided, and Mann-Whitney tests. Multiple groups were compared using one-way ANOVA, two-way ANOVA, Dunnett's multiple comparison test, and Tukey's multiple comparison test. Data between two groups were analyzed using two-sided independent t-tests. Multiple t-tests using the Holm-Sidak method were used for multiple group comparisons. Different levels of statistical significance were accessed based on specific p-values ​​and type I error cutoffs (0.05, 0.01, 0.001, 0.0001). Data analysis was performed using GraphPad Prism v.8 and RStudio.

[0278] result CAR-T cell therapy is limited by insufficient T cell proliferation and persistence, particularly under chronic exposure to viruses or tumor antigens that can cause T cell dysfunction (Savoldo B., et al., Clin Invest., 121(5):1822-6(2011); Shin H., and Wherry EJ., Curr Opin Immunol., 19:408-415 (2007)). Therefore, we used the CLASH system to rapidly identify more persistent forms of CAR-T cells. In small-scale experiments, repeated co-cultures of CAR-T cells with antigen-specific tumor cells at lower effector:tumor (E:T) ratios resulted in the formation of a T central memory cell population (CD45RO) after each round of co-culture. + CD62L + It was observed that the reduction in IFNγ and TNFα expression ability due to continuous exposure significantly promoted T cell differentiation. An in vitro long-term culture system was designed to identify genes whose disruption could increase the lifespan and cytotoxicity of CAR-T cells due to chronic antigen exposure (Figure 2B). Using the pipeline established above, a pool of TRAC knock-in human CAR-T variants was rapidly generated using AAV-CLASH Descartes-Lib. Control knock-in CAR-T cells, otherwise identical but without additional mutagenesis, were generated using an empty CLASH vector. After transduction with the vector or Descartes-Lib AAV6, control or pooled mutant CAR-T cells were repeatedly co-incubated with NALM6 cells at an E:T ratio of 0.2 for 54 days, and their fractions were collected in each round for genomic DNA prep and deep sequencing. Long-term culture was performed in three independent series so that each CLASH Descartes CAR-T pool had a matched time series.

[0279] Initially (on day 0), the vector and Descartes-Lib transduced CAR-T cell pools exhibited similar immunophenotypes. During tissue culture, dynamic changes in the cancer cell to CAR-T cell ratio were observed after multiple rounds of co-culture, indicating selection within the pool (Figure 2B). After the final round of stimulation on day 54, the vector CAR-T cells had lost their ability to kill, with 90.6% of NALM6 cells (CD8) being transfused. - CAR22 - ) remain, while Descartes-Lib CAR-T cells have dramatically more efficient tumor cell clearance compared to vector CAR-T cells, with only 2.7% being NALM6 cells (CD8 - CAR22 - ) remained. The percentage of central memory CAR-T cells in the vector and Descartes-Lib CAR-T cells was not different before stimulation. However, the Descartes library showed a significant increase in CD45RO in the pool. + CCR7 + As indicated by the cell population, T cell terminal differentiation was significantly prevented on day 54 (Figure 2C). To investigate whether Descartes-Lib pooled CAR-T cells retain cytotoxicity after long-term co-culture, intracellular IFNγ and TNFα were measured by FACS after 5 hours of restimulation with specific antigens. Compared to vector CAR-T cells, the Descartes-Lib CAR-T cell pool showed higher levels of IFNγ at the endpoint (d54), but not for TNFα (Figures 2D-2E). The Descartes-Lib CAR-T cell pool showed reduced T cell exhaustion with decreased surface levels of PD-1 and LAG3, but no change in TIGIT (Figures 2F-2H). Observations of differences between pooled mutants and wild-type CAR controls at the overall population level indicate that at least a subset of mutant variants in the Descartes-Lib pool contributed to the diverse phenotypic shifts of these CAR-T cells.

[0280] Identification and validation of candidate CAR-T variants in long-term co-culture. To determine the actual composition and dynamics of the variants, the library reading method was optimized, and crRNA expression in the Descartes library across all samples was determined. NGS was performed on all experimental replications at all collection points throughout the entire time course of CAR-T: cancer cell co-culture. Correlation analysis of crRNA expression in genome reading of the Descartes-Lib CLASH knock-in CAR-T pool was performed. Pearson correlations of crRNA library expressions across time points were calculated based on log2 rpm values. It was observed that crRNA expressions for samples collected at each time point spontaneously clustered, correlated more strongly with each other than samples at other time points, suggesting a high degree of consistency. The crRNA expressions of corresponding samples along each time point were also more similar to the matched samples at other time points than to the other two unmatched samples, exhibiting a tiled pattern in the correlation heatmap that shows the consistency of matched samples along the time trajectory, thereby demonstrating a high level of technical reproducibility. Throughout the three replication cycles, library diversity decreased over time, and the CAR-T library pool became increasingly dominated by smaller fractions of crRNA over time, as shown in the cumulative distribution function (CDF) plot, which points to the time gradient in this process.

[0281] (Example 3) Identification and validation of genes whose loss of function enhances the persistence of CAR-T variants. material and method Primary and dynamic time course of Cas12a / Cpf1 crRNA library expression analysis The raw read counts from each sample were converted to reads per million (rpm) and then log2-converted for a specific analysis. Pearson correlations for heatmaps were calculated using the cor function in R, and empirical cumulative distribution functions were computer-processed and plotted using ggplot's stat_ecdf. Top candidate genes were determined using criteria based on RIGER and false detection rate (FDR). For RIGER analysis of CRISPR screening, sgRNAs were scored and ranked by ties in rank, disrupted by a random order, using read count tables to calculate log-multiple changes for T cell samples collected from each day vs. day 0 sample. These data were then used as input to a Java®-based implementation of RIGER (github.com / broadinstitute / rigerj) to generate p-values ​​and gene rankings based on consistent enrichment across multiple sgRNAs for candidate gene identification (Shalem O., et al., Science, 343:84-87 (2014)). For computer processing of gene rankings, both the second-highest ranked sgRNA and weighted sum scoring methods were used. For FDR-based analysis, crRNAs were determined to be statistically significant when enriched using a false discovery rate (FDR) threshold of 1.0% or 5.0% based on the abundance of all untargeted controls. Multiple different in vitro and in vivo screening reads were performed, along with both primary and dynamic time-course crRNA expression analyses. Custom R scripts were used for Venn diagrams and other visualizations, heatmaps, and statistical analyses.

[0282] CD22 CAR-T generation through individual gene disruption Individual crRNAs were cloned into CLASH vector plasmids using linearization via BbsI digestion and a rapid ligation kit (NEB). The ligated products were transformed into Stbl3 competent cells by heat shock at 42°C for 90 seconds. Single clones were collected, and plasmids were isolated using a miniprep kit (Qiagen). Plasmid sequences were confirmed by Keck Biotechnology Resource Laboratory (Yale).

[0283] T7E1 assay Five days after electroporation and AAV transduction, positive CAR-T cells were stained and sorted by BD FACSAria II. Genomic DNA was extracted using the QIAamp DNA blood mini-kit (Qiagen). PCR amplification of the genomic region adjacent to crRNA was performed using appropriate primers. Using Phusion Flash High Fidelity master mix (Thermo Fisher), the thermocycling parameters for PCR were 35 cycles of 2 minutes at 98°C (1 second at 98°C, 5 seconds at 60°C, 15 seconds at 72°C) and 2 minutes at 72°C. Next, PCR amplicons were used for the T7E1 assay according to the manufacturer's protocol. Statistical significance was assessed by a two-sided independent Welch's t-test.

[0284] Nextera Library Prep and Amplicon Sequencing Following the manufacturer's protocol, PCR products described from the T7E1 experiment were used for Nextera library preparation (Nextera XT DNA Library Preparation Kit, Illumina). Briefly, 1 ng of purified PCR product was fragmented and tagged using Nextera Amplicon Tagment Mix as recommended by the manufacturer, followed by limited-cycle PCR with indexing primers and an Illumina adapter. After this amplification, DNA was purified and sequenced using 100 bp paired-end reads on an Illumina HiSeq 4000, Novaseq, or equivalent. For indel quantification, reads were mapped to expected amplicon sequences using BWA-MEM with the -M option. Subsequently, 100 bp reads from SAM files that were perfectly mapped within a + / - 75 bp window of the expected cleavage site within the amplicon were identified (soft-clipped reads were discarded). Indel reads were then identified by the presence of the letter "I" or "D" within the CIGAR string. Severance efficiency was quantified as the percentage of indels across total (indel plus wild-type) reads within the defined window.

[0285] CLASH CAR-T crRNA screening process Raw single-end fastq read files were filtered and demultiplexed using Cutadapt. Reads were demultiplexed for barcodes contained in forward-read PCR primers. To identify and remove extraneous sequences immediately upstream of the crRNA, the following setting was used:cutadapt -g TAATTTCTACTAAGTGTAGAT(SEQ ID NO: 12,136) -e 0.1 -m 19 --discard-untrimmed. Then, 20bp crRNA sequences were mapped to the designed Descartes library sequences using a bowtie index generated by the bowtie-build command in Bowtie 1.2.2. Mapping was performed using the following setting: bowtie -v 1 -m 1, and the number of reads mapped to each crRNA in the library was quantified. This process was used for multiple different in vitro and in vivo CLASH crRNA library reads, and also for MIPs crRNA expression reads.

[0286] CLASH time course of in vivo CAR-T expression in cancer models NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice were purchased from Jackson Laboratory and bred in-house. NSG mice between 6 and 8 weeks of age were used for 5 × 10⁶ cubic centimeters. 5 2 × 10⁶ NALM6-GL cells were inoculated intravenously. Prior to treatment, mice were randomly assigned to different groups. 6Vector-CAR-T cells or Descartes CAR-T cells were injected into mice and returned after 3 days. NSG mice were euthanized on days 7, 11, and 14. The spleen and bone marrow were immediately collected. Erythrocytes were lysed by incubation with ACK (Ammonium-Chloride-Potassium) lysis buffer (Thermo Fisher) for 2 minutes. After washing, cell surface markers were labeled as described for FACS and evaluated by BD FACSAria II. CAR-positive T cells were sorted and genomic DNA was extracted using QuickExtract DNA extraction solution (Lucigen).

[0287] MIPs library selection and cloning The MIPs library contains 56 crRNAs targeting seven top hit genes derived from validation, with approximately eight crRNAs per gene. 56 crRNAs were selected from the Descartes library. To generate the MIPs AAV vector, pre-mixed crRNAs were cloned into PXD60 plasmids by linearization via BbsI digestion and rapid ligation. The MIPs library product was transformed into highly efficient competent cells (Endura) by electroporation. Colony counting revealed an estimated crRNA library coverage of >300× (16,800 colonies) after electroporation. All bacteria were collected in a pool. The plasmid library was purified using the EndoFree Plasmid Maxi kit (Qiagen). CrRNA expression in the library plasmids was validated by NGS. MIPs library transduction was performed similarly to library-scale AAV transduction. Three reaction cycles were set up for MIPs library electroporation.

[0288] MIPS probe design MIPS probes were designed according to a previously published protocol (website: github.com / shendurelab / MIPGEN) and then processed by a customized selection algorithm. 107 MIP probes were designed using MIPgen. Briefly, a 77bp region adjacent to the predicted cleavage site of each of the 56 unique crRNAs was selected as the target region, and a bed file containing these coordinates was used as input. These coordinates included overlapping regions, which were then consolidated into 31 unique regions. Each probe contains an extended probe sequence, a ligation probe sequence, and a 6bp degenerate barcode (NNNNNN) for PCR duplicate removal. A total of 107 MIP probes covering a total amplicon of 5,675bp were designed (SEQ ID NOs: 12,139–12,245). Statistics regarding MIP target size were as follows: minimum, 154bp; maximum, 331bp; mean, 183bp; median, 163bp. Each MIP was synthesized, normalized, and pooled using standard oligo synthesis (IDT).

[0289] MIPS Target Acquisition Sequencing After 10 days of electroporation, CAR-positive cells from the MIPS library and control group were sorted by FACS (BD), and CAR-T cell genomic DNA was then isolated using a DNA purification kit (Qiagen). The experimental workflow followed the standard protocol. Briefly, 50–100 ng of high-quality, unfragmented genomic DNA was used for hybridization. After gap filling and ligation, circularized DNA molecules were used as templates for PCR with universal primers complementary to the linker sequence. Then, in the PCR amplification step, sample-specific barcode sequences and Illumina adapters were introduced. Following this amplification, DNA was purified and sequenced using 100 bp paired-end reads on an Illumina HiSeq 4000, Novaseq, or equivalent.

[0290] MIPS Data Analysis For MIPS library crRNA representation in plasmids and samples, a subset library containing MIPs crRNAs was used, and standard screening and mapping were performed as described above. For mutation-based MIPs target capture sequencing analysis, raw paired-end fastq read files were first mapped to a reference hg38 Homo sapiens genome assembly and sorted using BWA and SAMTools. For coarse filtering, reads near the target crRNA region were selected using BEDTools (+ / -1000bp), and then indexed and used for variant calling using SAMTools and Varscan v2.4.1 with the parameters pileup2indel --min-coverage 1 --min-reads2 1 --min-var-freq 0.001 --p-value 0.05. The generated VCF files were then used for fine mapping to crRNA cleavage regions.

[0291] To define cleavage regions, crRNAs were first disintegrated based on whether their cleavage sites were within or equal to 16 bp. For mapping, crRNA cleavage regions were defined as + / - 8 bp from the maximum / minimum cleavage site for disintegrated crRNAs (thus, undisintegrated crRNAs would have a 16 bp window, while disintegrated crRNAs would be larger). For insertions, variant location points in the genome were maintained as defined by the VCF output. For deletions, variant location points in the genome were adjusted to reflect the central point of the deletion. Variants were mapped to crRNA cleavage regions based on the above. Further downstream analyses, including analyses comparing cleavage efficiency with crRNA expression, were based on disintegrated crRNA references. For MIP crRNA representation in library and associated cleavage efficiency bar plots, crRNAs with nearly zero reads in library sequencing (PRDM-cr6 and PRDM-cr7 for MIP1, and PRDM-cr1 for MIP3) were removed for visualization purposes (however, these were included in all other analyses and statistical tests). For analyses including MIP cleavage efficiency normalized by library representation, the mean total variant frequency per target region was divided by a normalization factor defined as (mean library reads) / median (mean library reads). Statistical tests and visualizations were performed using custom R scripts.

[0292] result A series of analyses were performed to identify which variants of CAR-T in the Descartes pool were more persistent and potentially possessed enhanced effector function. Overall time-course heatmaps of all crRNAs revealed that the majority of crRNAs decreased over time, with many being depleted by day 32. However, distinct sets of crRNAs emerged as persistent clusters, albeit to varying degrees. To identify enriched hits, time-course studies were performed for individual crRNAs and individual genes at later time points (e.g., d32) and terminal time points (d54). Fractions of crRNA were highly enriched at day 32 with a false discovery rate (FDR) of 1.0%, while fewer crRNAs were enriched at day 54. Comparison of crRNA abundances at day 32 or 54 relative to zero-point baseline (day 0) revealed a rapidly decaying distribution of persistent crRNAs, with a small number of enriched crRNAs exceeding baseline (Figures 3A-3B). These crRNA examples showed varying degrees of persistence up to different time points. Representative highly enriched crRNAs target several potential candidate genes, including PRDM1 / BLIMP-1, DPF3, SLAMF1, TET2, HFE / HLA-H, and PELI1. RIGER analysis also revealed several similar high-rank candidate genes, including PRDM1, DPF3, SLAMF1, HFE, and PELI1.

[0293] To examine the behavior of individual crRNAs targeting the same gene over three replication cycles over time, crRNAs were internally compared to each other and externally compared to the mean and 99% confidence interval (CI) of 1,000 NTCs, representing putatively neutral behavior, and visualized on the same plot for each gene. Certain known T cell exhaustion surface markers (PDCD1, HAVCR2 / TIM3), transcription factors previously associated with T cell function (TET2, NR4A2), and under-characterized candidates identified from time-course analysis (PRDM1, DPF3, PELI1, and LAIR1) were tested. While the mean NTC had a median decay of 20 days, distinct crRNAs representing distinct CAR-T variants were observed to persist at higher levels at d20 or later time points (d32, d41, or d54). TET2 was previously identified as a key factor suppressing CAR-T cell enlargement and persistence in vivo (Fraietta JA, et al., Nature, 558:307-312 (2018)). One TET2 mutant CAR-T variant, as well as several mutant variants of NR4A2, PRDM1, DPF3, PELI1, and LAIR1, showed enhanced persistence compared to NTC CAR-T cells.

[0294] Based on their temporal dynamics, we further investigated seven candidate genes that had not been previously reported in CAR-T function: DPF3, HFE / HLA-H, LAIR1 / CD305, USB1, PELI1, PRDM1 / BLIMP-1, and SLAMF1 / CD150. To examine whether these genetic variants of CAR-T cells possessed an enhanced antitumor phenotype, individual CAR-T variants were first regenerated using a single AAV-CLASH vector encoding CAR22 and a high-rank crRNA targeting each of these genes. Next, cleavage efficiency was measured by a T7E1 endonuclease assay and then by NGS, and we found that all genes except LAIR1 showed highly efficient gene editing (DPF3, HFE, USB1, PELI1, PRDM1, and SLAMF1 achieved indels exceeding 80%), and the majority of these were out-of-frame. Flow cytometry analysis of memory cell populations revealed an increase in the central memory T cell population in DPF3, LAIR1, PELI1, PRDM1, and SLAMF1 mutant CAR-T cells compared to vector-controlled CAR-T cells (Figures 3C-3E). Quantification of intracellular IFNγ and TNFα levels showed that DPF3, HFE, and USB1-edited CAR-T cells had higher levels of IFNγ and TNFα after 5 hours of NALM6 stimulation (Figures 3F-3K). PELI1 mutants showed lower levels of both IFNγ and TNFα; PRDM1 and LAIR1 mutants showed lower levels of IFNγ but not TNFα. SLAMF1 mutants showed only slight to almost no change in IFNγ and TNFα levels compared to the vector (Figures 3F-3K).

[0295] To determine whether the gene editing capability of crRNA correlated with its screening performance in CLASH experiments, CLASH-MIPS (molecular inversion probe sequencing) experiments were performed in T cells. In these experiments, crRNA abundance was measured by reading a crRNA library integrated into the genome, and the actual gene editing efficiency of individual crRNAs was measured by MIPS using three biological replications. The results were then compared with the screening performance of crRNAs in CLASH experiments. A minipool of 56 crRNAs targeting seven top candidate genes was designed as described above, and CAR-T minipools were generated by cloning them into CLASH vectors and CLASHed human CD8 T cells (by mRNA electroporation and AAV6 transduction as described above). The size of the minipools was determined considering (1) the sensitivity of MIPS for measuring genomic variants; (2) the ability of MIPS to capture actual genome editing events at each specific crRNA target site by dilution of editing events in a pooled manner; and (3) the relative gene editing challenges in T cells. Library reading successfully mapped the crRNA abundances in the minipools. Using d32 data, which represents a balanced point in time after a considerable period has elapsed for selection rather than a stage where most crRNA is lost (e.g., d54), the gene-editing capacity of individual crRNAs (measured by MIPS) was compared to their screening performance in the CLASH-Descartes experiment. Different sets of crRNAs for individual genes showed a fluctuating strength of correlation between gene-editing efficiency (MIPS) and screening performance (CLASH) in a pooled manner. However, considering all genes / total crRNAs measured, the overall gene-editing efficiency (MIPS) was significantly correlated with the mean screening performance (CLASH). This significant correlation persists regardless of whether gene-editing efficiency is normalized by crRNA abundance or not.These data suggest that crRNA screening performance significantly correlates with their ability to perform gene editing in T cells, and that the majority of the tested crRNAs individually demonstrated high gene editing efficiency. This indicates that the crRNAs enriched in the screening largely represent true cutters and screening performers for top candidate genes.

[0296] In vivo selection of CLASH-mediated human CAR-T variants in cancer models To further identify which CAR-T variants possess superior antitumor phenotypes, time-course in vivo CLASH-Descartes experiments were performed to identify genetic disruptions that could increase CAR-T persistence in a leukemia mouse model. Leukemia induction was induced by transplanting NALM6-GL cells into NSG mice. Three days after induction, the Descartes-Lib CAR-T variant was injected into the mice by adoptive transfer. Bone marrow and spleen samples were collected on days 7, 11, and 14. Fourteen days after CAR-T injection, a higher CAR-T:cancer cell ratio was observed in recipients of Descartes-Lib CAR-T cells (Figure 3L). Subsequently, the crRNA library representation of the Descartes library in these in vivo samples was read, and deep sequencing data was analyzed to identify enriched crRNAs in the day 14 in vivo samples compared to the day 0 CAR-T cell pool before injection. The crRNA fraction was observed to be highly enriched in the 14-day in vivo sample at an FDR of 1.0%, including, for example, TNFRSF21, TBX21, SIRT7, GPR65, PRDM1, and PRDM4. Next, the results of in vivo CLASH were compared to in vitro long-term co-culture CLASH experiments using enriched gene sets obtained from independent time points derived from both in vitro and in vivo. Substantial duplication of enriched genes between in vitro day 32, in vitro day 54, in vivo day 7, in vivo day 11, and in vivo day 14 (Figure 3M). Eight genes, including LAMP3, FCRL4, MYH10, GATA3, ENTPD1, ​​PRMT1, BTN1A1, and PRDM1, were significantly enriched across all five gene sets at a 5% FDR (Figure 3M).

[0297] (Example 4) PRDM1 mutant CAR-T cells exhibit an increased memory cell population, stronger antigen-stimulated proliferation, and maintained cytotoxicity. material and method CAR-T purification CAR-positive T cells were purified using streptavidin microbeads (Miltenyi Biotec). In short, 1 × 10⁻¹⁶ 7 Each cell was suspended in 100 μL of labeling buffer and then incubated with 1 μg Pierce® recombinant biotinylated protein L (Thermo Fisher) and 10 μL of FcR blocking reagent (Miltenyi Biotec) at 4°C for 15 minutes. The cells were washed to remove unbound proteins and labeled with 10 μL of streptavidin microbeads on ice for 15 minutes. After washing, the suspension was loaded onto a MACS column for separation according to the manufacturer's protocol (Miltenyi Biotec).

[0298] Death assay (co-culture) Lentivirus was used to stably transduce GFP and firefly luciferase genes into the NALM6 cell line. 2 × 10⁻⁶ 4 Nine NALM6-GL cells were seeded in a 96-well plate. Manipulated CAR-T, vector-carried CAR-T, or normal CD8 T cells were co-cultured with NALM6-GL for 24 hours at the indicated E:T ratio. To examine luciferase expression in NALM6-GL, 150 μg / ml D-luciferin (PerkinElmer) was added to each well. After 10 minutes, luciferase intensity was measured using a plate reader (PerkinElmer). Direct tumor cell death was quantified by luminescence. Luminescence units were normalized to the control (NALM6-GL without any effector cells, LU). c ). Calculation formula: %Cytotoxity=100-LU 試料 / LU c ×100.

[0299] Western blot Cells were lysed with ice-cold RIPA buffer (Boston BioProducts) containing protease inhibitors (Roche, Sigma) and incubated on ice for 30 minutes. After centrifugation at 13,000 g at 4°C for 30 minutes, the protein supernatant was collected. Protein concentrations were determined using a BCA protein assay kit (Thermo Fisher). Protein samples were separated under reducing conditions on a 4-20% Tris-HCl gel (Bio-Rad) and analyzed by Western blotting using the primary antibody PRDM1 / Blimp-1 mouse mAb (R&D 1:1000) followed by the secondary anti-mouse HRP antibody (Sigma-Aldrich, 1:10,000). Blots were imaged using an Amersham Imager 600.

[0300] Immunoprecipitation PRDM1-deficient CD22 CAR-T cells or vector cells were lysed for 30 minutes with ice-cold RIPA buffer containing a protease inhibitor cocktail (Roche). BLIMP1 / PRDM1 antibody (CST) immobilized on NHS-activated agarose beads was added according to the manufacturer's protocol (Thermo Fisher). Cell lysates were incubated with beads at 4°C and rotated for 1 hour. The supernatant was discarded after spin-down at 3,000 RPM for 1 minute. The beads were washed four times with ice-cold TBS and boiled with SDS loading buffer for 10 minutes. Protein samples were loaded onto 4-20% Tris-HCl gels (Bio-Rad).

[0301] In-gel digestion and mass spectrometry Protein-containing gel slices were digested overnight with trypsin. The resulting peptide mixture was extracted from the gel and directly flushed into an Orbitrap Velos instrument (Thermo Fisher Scientific) for 120 minutes by liquid chromatography (buffer A: 0.1% aqueous formic acid; buffer B: 0.1% MeCN formic acid; gradient: 0%~95% buffer B; flow rate: 0.1 μl / min) and tandem mass spectrometry (LC-MS / MS) using the standard TOP20 method procedure. Briefly, the MS1 m / z region for 395~1,600 m / z ions was captured at 60 K resolution and used to induce MS / MS in an ion trap for the top 20 most abundant ions. Effective dynamic exclusion of 500 ions over 90 seconds was used in the LC-MS / MS method. Peptides were eluted at a flow rate of 300 nl / min using a NanoAcquity pump (Waters). The sample was trapped for 15 minutes at a flow rate of 2 μl / min in a 100 micron ID trapping column packed in-house with 5 μm Magic C18 AQ beads (Waters), and then eluted via gradient into a 20 cm 75 micron ID analysis column (New Objective) packed in-house with 3 μm Magic C18 AQ beads (Waters).

[0302] Mass spectra were analyzed against the Uniprot database using Scaffold Q+ / Q+S version 4.0. A mass deviation of 20 ppm was set for the MS1 peak, and a maximum acceptable MS / MS peak of 0.6 Da was set, allowing a maximum of 2 missed peaks. The maximum false detection rate (FDR) was set to 0.01 at both the peptide and protein levels. The minimum required peptide length was 5 amino acids.

[0303] CLASH-PRDM1 genome-wide AAV integration library preparation To perform genome-wide profiling of CLASH-PRDM1 off-target integration events, we developed a modified method from GUIDE-seq (Tsai, SQ. et al., Nat Biotechnol., 33:187-197 (2015)). Briefly, after 9 days of AAV transduction, genomic DNA (gDNA) was extracted from CAR-T cells. Adapters were prepared by annealing Miseq common oligonucleotides with sample barcode oligonucleotides (A01-A06) in TE buffer. The annealing program was set to 95°C for 1 second and then slowly decreased to 4°C (approximately -2°C / min). Using an S220 focused ultrasonicator (Covaris), gDNA was fragmented into approximately 1,500 bp fragments. End repair and dA-tailing were performed using the NEBNext® Ultra® End Repair / dA-tailing Module (NEB) according to the manufacturer's protocol. The repaired DNA was ligated with an annealed adapter by using T4 DNA ligase at room temperature for 1 hour. The sample was purified using 0.9× SPRI (Beckman). A genome-wide off-target integration library was constructed using a two-step PCR strategy with streptavidin bead purification. In this strategy, the first PCR was used to feed a fragment containing the integrated CAR gene from gDNA using biotinylated primers, and the biotinylated fragment was purified using streptavidin beads (Thermo). Next, the second PCR added an appropriate sequencing barcode to the product derived from the first PCR. Q5 was used for PCR (NEB). Thermocycling parameters for two-round PCR were 30 seconds at 98°C for 7 cycles, 10 seconds at 98°C, 70°C (-1°C / cycle), 1 minute at 72°C for 13 cycles, 10 seconds at 98°C, 30 seconds at 63°C, 1 minute at 72°C for 1 minute, and retention at 4°C. PCR products were normalized and pooled for each biological sample. DNA less than 1kb was selected.The samples were sequenced using custom sequencing primers and Miseq (2 × 300 bp paired ends).

[0304] CLASH-PRDM1 genome-wide AAV integration data analysis Paired-end reads were processed using Cutadapt 3.2, BWA 0.7.17, and SAMtools 1.12 to identify off-target integration events. R2 reads containing TRAC elements were first trimmed and selected using cutadapt -GGTTTACTCGATATAAGGCCTTGA(SEQ ID NO: 12,137) -e 0.2 -m 20 --discard-untrimmed. Then, R2 reads containing ITR reads were trimmed and selected using cutadapt -GAAAGGTCGCCCGACGCCCGG(SEQ ID NO: 12,138) -e 0.2 -m 20 -O 15 --discard-untrimmed. The ITR-trimmed reads were then mapped to the Homo sapiens genome assembly GRCh38 (hg38) using BWA. To understand where the mapped reads target the genome without double counting at position, the reads were converted to single base pair coordinates using the starting position, and then converted to bedGraph format. Reads were normalized to sequencing depth using R2 reads containing TRAC elements. Visualizations were generated using Integrative Genomics Viewer 2.9.2 and R packages including GenomicAlignments and ggbio.

[0305] TRAC-embedded PCR gDNA was extracted after 9 days of CLASH-vector AAV transduction. Using Phusion Flash High Fidelity master mix (Thermo Fisher), the thermocycling parameters for PCR were 35 cycles of 2 minutes at 98°C (1 second at 98°C, 5 seconds at 60°C, 1 minute at 72°C) and 2 minutes at 72°C. The DNA was purified and sequenced by Sanger sequencing.

[0306] result Based on strong persistence dynamics in both time-dependent co-culture and cancer models, scored by multiple independent crRNAs, PRDM1 variants represented promising candidates for CAR-T cell manipulation. PRDM1 has been previously identified as a major regulator of normal CD8 T cells (Rutishauser et al., Immunity, 31:296-308. (2009)). It was hypothesized that PRDM1 editing may have enhanced potential to enhance antitumor immunity in CAR-T cells. A series of experiments were conducted to further investigate whether targeting PRDM1 could improve CAR-T cell persistence and other antitumor effects. First, the cleavage efficiency of multiple PRDM1 crRNAs was individually measured in donor 2 anti-CD22 CAR-T cells (CD22 CARs) by T7E1 endonuclease assay and NGS. Most PRDM1 crRNAs showed highly efficient gene editing (6 / 8 over 80%; 7 / 8 over 78%; only 1 / 8 below 50% - PRDM1-cr7 at 47%). Next, we examined the PRDM1-cr1 cleavage efficiency in another healthy donor along with another form of PRDM1 mutant CAR-T cells (anti-CD19 CAR-T cells / CD19 CAR).

[0307] To further investigate the effects of PRDM1 crRNA on functional gene products (mRNA and protein) in CAR-T cells, we selected the top two crRNA scoring groups with high abundance at late stages in co-culture dynamics. These two PRDM1 crRNAs target different domains of the PRDM1 protein. The PRDM1 protein has three different isoforms produced by alternative splicing (UniProtKB - O75626; Figure 4A). To investigate whether these two PRDM1 crRNAs can disrupt PRDM1 mRNA expression, we designed three different probes specific to mRNA transcripts potentially encoding these isoforms (probe ISO1 targeting the 5-prime region of isoform 1, ISO2 targeting the PRDM1-cr1 cleavage site within the SET / PR domain, and ISO3 targeting the PRDM1-cr2 cleavage site within the zinc finger domain of PRDM1). We observed that disruption of the PRDM1 gene resulted in a rapid increase in PRDM1 mRNA transcripts, as detected by the ISO1 probe. This phenomenon is consistent with previous research suggesting that PRDM1 is self-regulated via a strong feedback mechanism (Magnusdottir E., et al., Proc Natl Acad Sci US A., 104(38):14988-93(2007); Martins G., and Calame K. Annu Rev Immunol., 26:133-169 (2008)). However, PRDM1 mRNA could not be detected by the ISO2 probe in PRDM1-cr1 CAR-T cells or by the ISO3 probe in PRDM1-cr2 CAR-T cells.

[0308] To further investigate this mechanism, PRDM1 protein expression was further examined in anti-CD22 CAR-T cells generated from different donors. Two different AAV-CLASH vectors targeting different domains of PRDM1 were generated using the top two crRNAs that scored as high abundances at the later stages of co-culture dynamics. Using these CLASH vectors, human primary CD8 T cells were transduced to generate two forms of PRDM1 mutant anti-CD22 CAR-T cells (PRDM1-cr1 and PRDM1-cr2), along with one form of anti-CD19 CAR-T cells (PRDM1-cr1 only) (Figure 4A). When tested 5 days after transduction in different donors, both crRNAs generated highly efficient PRDM1 gene editing at the target site (Figures 4B-4D). To further investigate how PRDM1 crRNA affects functional gene products (proteins and mRNA) in CAR-T cells, PRDM1 protein expression was examined in CAR22 T cells generated from different donors. It was observed that PRDM1-cr2 resulted in a strong reduction of PRDM1 protein, and, more interestingly, PRDM1-cr1 resulted in the production of a smaller-sized protein recognized by the same PRDM1-specific antibody. To examine the sequence of this size-reduced protein, immunoprecipitation was performed using an anti-PRDM1 antibody, and peptide identification was performed by mass spectrometry (IP-MS). The IP-MS results showed that, across all three replication cycles, the peptide near the PRDM1-cr1 cleavage site could not be detected in PRDM1-cr1-targeted PRDM1 mutant CAR-T cells compared to vector-controlled CAR-T cells. Therefore, PRDM1-cr1 generated a novel mutant variant that was neither isoform 2 nor isoform 3.

[0309] Because specific protein domains targeted by CRISPR-mediated gene editing using different guide RNAs can result in different functional mutants, elucidating specific mutations in functional domains is often crucial. To determine the nature of mutant variants of the PRDM1 gene product produced by PRDM1-cr1, two primers were designed near the PRDM1-cr1 cleavage site, and cDNA was identified using RT-PCR. Interestingly, two bands were presented in the PRDM1-cr1 group. The upper band represented a mixture of wild-type and similarly sized gene products with smaller indels (reflected by the "noise" peak), which was consistent with Nextera-NGS results. Furthermore, a lower DNA fragment contained a 120 bp in-frame deletion, which precisely corresponded to PRDM1 exon 3. Gene editing-induced exon skipping was observed in Kras and Ctnnb1 in mouse cell lines using CRISPR / Cas9 (Mou, H. et al., Genome Biol 18, 108, doi:10.1186 / s13059-017-1237-8 (2017)). PRDM1 exon 3 is the main region responsible for encoding the N-terminal PR domain in the PRDM1 (PRDI-BF1 or Blimp-1) protein. Previous studies have shown that disruption of the PR domain can result in a dramatic loss of repressive function in multiple target genes. These results demonstrate that CLASH PRDM1-cr1 generates a PRDM1 exon 3 skipping variant, producing a truncated PRDM1 protein in human primary T cells.

[0310] CD8 +To compare PRDM1-cr1 and PRDM2-cr2 functions in T cells and CD22 CAR-T cells, cells generated 5 days after transduction were analyzed by flow cytometry to evaluate phenotypes for effector-to-memory transition (CD62L, CCR7, CD28, and IL7R), cytotoxicity (IFNγ, TNFα, and granzyme B / GZMB), and T cell exhaustion (LAG3 and TIM3). The data showed that both PRDM1-cr1 and PRDM2-cr2 variants had similar phenotypes, including higher effector-to-memory transition markers (Figures 4E-4H), lower effector markers (however, human PBMC-derived CD8 T cells without CAR showed baseline effector cytokine levels across all groups) (Figures 4I-4K), as well as lower exhaustion markers (Figures 4L-4M), as evident in LAG3 and TIM3. Interestingly, the PRDM1-cr1 mutant CAR-T exhibits more pronounced effects on the CD62L, CD28, IL7R, TIM3, and LAG3 phenotypes compared to PRDM1-cr2 (Figures 4E-4F, 4L, and 4M).

[0311] To further confirm the effect of PRDM1 on CAR-T cells, memory markers CCR7 and CD62L were measured in different healthy donors 5 days after transduction. Consistent with previous results, editing of PRDM1-cr1 in all five donors increased both markers (Figures 4N-4O). Furthermore, PRDM1 mutant CAR-T cells were found to have significantly higher antigen-specific proliferative capacity and cytotoxicity than vector CAR-T cells in response to NALM6 cancer cell stimulation in two different donors, although only the proliferative effect became significant after d11 / d12 post-transduction (Figures 4P-4Q). Long-term cytokine release was also monitored for each round of stimulation. IFNγ production in PRDM1 CAR-T cells in response to specific antigens was initially observed to be lower than that of vector CAR-T cells. However, while vector CAR-T cells continued to lose the ability to produce IFNγ in each round, PRDM1 CAR-T cells were able to maintain this ability and, as a result, had a higher proportion of IFNγ-producing cells than vector CAR-T cells at the experimental endpoint (round 7) (Figure 4R). Little difference was observed between the two groups regarding TNFα. Granzyme B was consistently lower in PRDM1 CAR-T cells compared to vector cells. At the co-culture experimental endpoint, PRDM1 CAR-T cells that had been cultured for a long period and experienced the antigen were observed to have a significantly higher cytotoxic effect against NALM6 cancer cells across the total E:T ratio in CARs generated from three independent donors compared to vector cells (Figures 4S-4T). These data indicate that PRDM1 mutant CAR-T cells possess an enhanced memory phenotype and can maintain longer-lasting effector function under continuous antigen exposure.

[0312] Genome-wide profiling of CLASH-PRDM1-mediated AAV integration Previous studies have shown that the CRISPR / Cpf1 system exhibits higher editing specificity compared to Cas9 nucleases, using GUIDE-seq, Digenome-seq, and BLISS (Kleinstiver, BP. et al., Nature biotechnology 34, 869-874 (2016); Kim, D. et al., Nature biotechnology 34, 863-868 (2016); Yan, WX., et al., Nature communications 8, 1-9 (2017)). Recent studies have used deep profiling to reveal heterogeneity in integration outcomes in CRISPR knock-in experiments (Canaj, H. et al., bioRxiv 841098; doi: 10.1101 / 841098 (2019)). Considering these studies, a novel GUIDE-seq-based method (Tsai, SQ. et al., Nat Biotechnol., 33:187-197 (2015)) was developed to profile and quantify CLASH-PRDM1-mediated genome-wide AAV integration and applied to CLASH-PRDM1 CAR-T cells with AAV-only control without Cpf1 mRNA electroporation. Genomic DNA samples were replicated and collected three times, sheared by sonication, and the products were ligated with adapters after end repair and dA-tailing. 5' biotinylated primers targeting specific portions of the CLASH vector were designed to embed an unknown bait sequence into the integrated sequence. These junctions containing the CLASH-specific sequence were enriched via binding to streptavidin-coated magnetic beads. Sequencing barcodes were added in second-round nested PCR.

[0313] Using ITR-based query sequences, a computer processing pipeline was established to identify chimeric off-target reads and their locations in the human genome. Visualization of normalized reads across the human genome using Integrative Genomics Viewer (IGV) showed clean baseline levels in the AAV-only control and a few detectable peaks for the CLASH-PRDM1 sample. Circos plot visualizations showed similar patterns in the distribution and relative frequency of off-target integration events across the human genome, with peak locations labeled in the center. A mean genome-wide total frequency of off-target integration events in the CLASH-PRDM1 sample was observed to be 0.62%, compared to 0.15% in the sample receiving only the AAV vector without Cpf1 mRNA. Certain detectable off-target integration events were observed at genomic loci around CD8A, TUBA1B, PVT1, TRAC, and PRDM1. For example, the mean off-target integration frequency was 0.2% at the PRDM1 locus, 0.05% at the TRAC locus, and 0.1% at the CD8A locus. Further zoom-in views of IGV-based visualizations showed the location of off-target integration events at the individual gene level. These experiments measured genome-wide AAV off-target integration events associated with CLASH-PRDM1 CAR-T generation and estimated the overall total off-target integration rate of the genome at sub-percentage levels.

[0314] (Example 5) PRDM1 mutant CAR-T shows enhanced therapeutic efficacy in vivo. material and method PRDM1 vs. control CD22 CAR-T time-course mRNA-seq experiment T cells were infected with CLASH vector and PRDM1-cr1 CAR22 AAV6 after electroporation with NLS-LbCpf1 mRNA. After 5 days of electroporation, the percentage of positive CAR-T cells was determined by staining with CD3 and CAR-specific antibodies, as previously described. CAR-T cells were co-cultured with NALM6 at a low E:T (0.2:1) ratio every 4–7 days for a total of 5 rounds. After each round of stimulation, CAR-T cells were collected using TRIzol (Invitrogen). RNA was extracted using the RNeasy Plus mini isolation kit (Qiagen). mRNA libraries were prepared using the NEBNext® Ultra® RNA library prep kit for Illumina, and samples were multiplexed using barcoded primers (Index Primer Set 1) provided by the NEBNext® Multiplex Oligo for Illumina. Libraries were sequenced using the Novaseq system (Illumina).

[0315] mRNA-seq processing For transcript quantification, we analyzed FASTQ files obtained from mRNA sequencing using the Kallisto quant algorithm with setting b 100 (Bray NL., et al., Nature biotechnology, 34:525-527 (2016)). Differential expression analysis was performed using Sleuth (Pimental H., et al., Nat. Methods, 14(7):687-690 (2017)). 1×10 -3Genes that were differentially upregulated and downregulated were selected for DAVID analysis using the Q-value cutoff (Sherman BT., and Lempicki RA., Nat. Protoc., 4(1):44-57 (2009)). Z-scores for time-course heatmaps were calculated by log2-normalization of gene counts followed by scaling by the gene, and genes differentially expressed over time were determined by limma using contrasts set up to compare PRDM1 vs vector-controlled CAR-T cells at each time point. Time-course cluster analysis was performed using the R package maSigPro with the stepwise method "two.ways.forward" and otherwise default settings. Visualizations of differentially expressed genes, such as volcano plots and heatmaps, were generated using standard R packages such as ggplot2 and Venn diagrams.

[0316] In vivo CAR-T efficacy testing in mouse models NOD.Cg-Prkdc from Jackson Laboratory scid Il2rg tm1Wjl We purchased / SzJ(NSG) mice and bred them in-house. We used both male and female NSG mice between 6 and 8 weeks of age, producing 5 × 10⁶ mice. 5 1.2 × 10⁶ NALM6-GL cells were inoculated intravenously. Prior to treatment, mice were randomly assigned to different groups. After 3 days, 1.2 × 10⁶ mice were inoculated. 6Individual normal CD8 T cells, vector CAR-T cells, or PRDM1 mutant CAR-T cells were injected into mice. Bioluminescent signals were captured per mouse every 3–5 days using the In Vivo Imaging System (IVIS). Briefly, to generate bioluminescent signals, mice were intraperitoneally injected with 150 mg / kg of XenoLight D-luciferin (Perkin Elmer), and images were analyzed using bioimaging software. NSG mice were euthanized on day 18 to examine the T cell phenotype in vivo after treatment. Peripheral blood, spleen, and bone marrow were immediately collected. Erythrocytes were lysed by 2-minute incubation with ACK (ammonium chloride potassium) lysis buffer (Thermo Fisher). After washing, cell surface markers were labeled for FACS as described above and measured by BD FACSAria II.

[0317] Randomization In animal experiments, mice were randomized by sex, cage, and littermate status. In vitro experiments were not randomized.

[0318] Blinding When measuring tumor burden, researchers were blinded regarding the identity of the animals and the treatment group. Researchers were not blinded in in vitro experiments. In NGS data analysis, researchers were blinded to the initial processing of the original data using keycoded metadata.

[0319] result Next, the preclinical therapeutic efficacy of PRDM1 mutant CAR-T cells compared to their vector counterparts was examined in vivo. (Immunodeficiency NOD.Prkdc) (SCID) / Il2rγ - / -In a NALM6-GL leukemia tumor model in (NSG) mice, efficacy testing was performed by adoptive transfer of anti-CD22 CAR-T cells, followed by monitoring of tumor burden (Figure 5A). Before use for tumor induction, NALM6 cells were first confirmed to be CD19;CD22 bipositive. IVIS imaging was performed to track tumor burden in leukemic animals treated with untransduced CD8 T cells, vector-transduced anti-CD22 CAR-T cells, and PRDM1-edited anti-CD22 CAR-T cells. It was observed that PRDM1 mutant anti-CD22 CAR-T cells showed significantly enhanced leukemia suppression compared to vector CAR-T cells. A substantial difference in tumor burden was observed between vector-treated and PRDM1 anti-CD22 CAR-T cell-treated mice, starting 19 days after T cell adoptive transfer (22 days after tumor induction) (Figure 5B). These data demonstrated that the PRDM1 mutant CD22 CAR-T has stronger in vivo efficacy against cancer in a mouse model of leukemia.

[0320] To further validate the results, independent AAV-CLASH vectors with different CAR constructs against the CD19 antigen (anti-CD19 CAR-T, CD19 CAR, CAR19) were constructed. PRDM1 mutant CD19 CAR-T cells were similarly generated along with vector-control CD19 CAR-T cells, followed by in vivo efficacy testing using similar cancer induction and adoptive transfer treatment regimens. Similar results were observed in vivo with CD19 CAR-T cells, and PRDM1 CD19 CAR-T cells showed significantly enhanced leukemia suppression compared to vector CAR-T cells (Figure 5C). Blood and organs were isolated from treated animals in both groups, and the abundance of sustained CAR-T cells in vivo was quantified. Two weeks after CAR-T infusion, a greater number of CAR-T cells and a higher CAR-T to tumor ratio were observed in the blood, bone marrow, and spleen of PRDM1 CAR-T cell recipients (Figures 5D-5F). Consistent with in vitro findings, bone marrow and spleen-derived CAR-T cells showed significantly higher levels of CD45RO in mice treated with PRDM1 CAR-T cells compared to the vector group. + CD62L + (Tcm) was shown (Figures 5G to 5I). These data indicate that PRDM1 mutant CAR-T cells have enhanced efficacy in vivo, along with increased persistence and memory marker expression.

[0321] The preclinical therapeutic efficacy of PRDM1 mutant CAR-T cells (compared to vector counterparts) was further evaluated in vivo in the context of survival in animals with cancer. Using a NALM6-GL leukemia tumor model in immunodeficient NOD.Prkdc(SCID) / Il2rγ- / -(NSG) mice, efficacy testing of anti-CD22 CAR-T adoptive transfer and subsequent evaluation of endpoint survival were performed. Endpoint survival was recorded as either an insufficient body condition score (BCS<=1) or actual death, whichever came first. Two experiments were conducted: one using CAR-T cell adoptive transfer on day 3 after tumor induction, and the other using adoptive transfer on day 8. In both experiments, animals with leukemia treated with PRDM1 mutant CD22 CAR-T cells showed significantly longer survival than animals treated with vector CAR-T cells (Figures 5J-5K). These data demonstrate that the PRDM1 mutant CD22 CAR-T has stronger in vivo efficacy against cancer in a mouse model of leukemia.

[0322] To further validate these results, PRDM1 mutant CD19 CAR-T cells were similarly examined along with vector-controlled anti-CD19 CAR-T cells. For anti-CD22 CARs, in vivo efficacy testing was performed as described above, but using adoptive transfer of CAR-T cells only on day 3 after tumor induction. The results showed that animals with leukemia treated with PRDM1 mutant anti-CD19 CAR-T cells had significantly longer survival than animals treated with vector CAR-T cells (Figure 5L). These data suggest that PRDM1 mutant anti-CD19 CAR-T cells have stronger in vivo efficacy against cancer in a mouse model of leukemia.

[0323] To further understand the molecular basis of the PRDM1 phenotype and, in particular, the basis of its enhanced efficacy in CAR-T cells, time-course transcriptomics experiments were performed in PRDM1 CAR-T cells, vector-control CAR-T cells, and untransduced human CD8 T cells as baseline, with three biological replications. These transcriptome profiles revealed a systematic landscape of CAR-T gene expression induced by continuous syncytial cancer antigen stimulation over time. In direct comparisons between PRDM1 and vector-control CAR-T cells, distinct sets of differentially expressed genes were identified (Figure 6A), revealing a panel of highly significant downstream targets. PRDM1 CAR-T showed significant induction of genes such as PCDH8, SELL / CD62L, PTPN14, RASA3, KLF2, STAT6, STAT1, PRDM1 itself, IRF4, and NFKB1; as well as suppression of genes such as CCL5, BATF, CXCR6, IL13, PRF1, IFIT13, ID2, and RUNX3 (Figure 6A).

[0324] Interestingly, the changes in gene expression showed a gradient pattern in both directions; increasing expression of PRDM1-inducible genes and decreasing expression of PRDM1-repressive genes over time (and thus along with additional rounds of stimulation). Time-series cluster analysis was performed to rigorously quantify and deconvolve the time-factor effect. MaSigPro time-series cluster analysis revealed expression profiles across the experiment of different gene clusters containing genes that had similar expression patterns and behaviors over time between the PRDM1 mutant vs. control CAR-T group.This analysis revealed nine distinct clusters of genes that exhibited completely different behaviors over time between the two groups: Cluster 1 genes decreased over time (and therefore by stimulation) in both PRDM1 and vector-controlled CAR-T cells; Cluster 2, the largest cluster of all, contained genes that increased strongly over time in control CAR-T cells but not in PRDM1 CAR-T cells (representative examples include HAVCR2 and WNT11); Cluster 3 contained genes that decreased over time in controls but, in contrast, behaved the opposite way and increased in PRDM1 CAR-T cells (representative examples include STAT1, STAT6, NFKB1, and IRF4); Cluster 4 contained genes that remained stable over time in controls but rapidly decreased in PRDM1 CAR-T cells; Cluster 5 contained genes that remained stable over time in controls but rapidly increased in PRDM1 CAR-T cells; Cluster 6 contained genes that decreased rapidly over time in controls but rapidly increased in PRDM1 Cluster 7 contains genes that remain stable in CAR-T cells (representative examples include KLF2, FOXO1, CD28, CD226, and CDCA7); Cluster 7 also contains dichotomy genes, where the two groups move in opposite directions over time, increasing in the control group but decreasing in the PRDM1 group; Cluster 8 contains genes that increase over time in the control group but first rapidly decline in the PRDM1 group before stabilizing at low levels (representative examples include LAG3 and ID2); and Cluster 9, the last and smallest cluster, contains genes that have a shared and consistent induction pattern in both PRDM1 and vector-controlled CAR-T cells.

[0325] To gain a comprehensive picture of which pathways are enriched in different gene clusters, we performed gene ontology analyses of enriched biological processes of gene sets in each cluster. Two clusters with similar gene set behavior (clusters 1 and 9) both show enrichment of transcription factors. Interestingly, clusters in which PRDM1 and vector-controlled CAR-T cells behave differently have distinct signatures: genes in cluster 2, where PRDM1 editing inhibits time-dependent induction, are enriched in signal transduction, cell adhesion, and inflammatory responses; similarly, genes in cluster 4, where PRDM1 editing results in rapid downregulation, are enriched in chemokine-mediated signaling pathways, positive regulation of inflammatory responses, negative regulation of type I interferon production, and immune responses. Consistently, in clusters 7 and 8, where genes are repressed rather than induced in PRDM1 CAR-T cells, enriched pathways include negative regulation of T cell receptor signaling pathways, regulation of T cell activation, and again, inflammatory responses. In contrast, in cluster 6, where PRDM1 prevented a decrease in gene expression over time, strong signatures were found in proliferation, including mitotic division, cell division, chromosome segregation, sister chromatid adhesion, cell proliferation, G1 / S transition of the mitotic cell cycle, and DNA replication, which is consistent with the phenotype of PRDM1 CAR-T cells maintaining strong proliferative capacity even after continuous antigen stimulation and multiple rounds of cancer cell death. Differential expression analysis was also performed on the same dataset using pairwise group comparisons. Although differential expression analysis that is not based on clustering inherently cannot capture cluster-specific signatures, these differential expression results obtained from three time points also examined the collective signatures of T cell proliferation and apoptosis, T cell differentiation, signal transduction, inflammatory response, and immune response in PRDM1 CAR-T cells (Figures 6B-6C).

[0326] (Example 6) PRDM1 mutant CAR-T rewired multiple immunological programs. material and method RT-PCR RNA was extracted as described in the RNA-seq protocol. cDNA for qPCR was generated using M-MLV reverse transcriptase (Sigma) and oligo-dT (Thermo Fisher) according to the manufacturer's protocol. For PRDM1 mutant sequencing analysis, PCR was performed using cDNA as a template and primers located near the PRDM1-cr1 cleavage site. For RNA-seq validation, cDNA was subjected to qPCR using TaqMan real-time PCR master mix and Taqman gene assay probe (Thermo Fisher). Samples were processed using an Applied Bioscience Step One Plus real-time instrument, and relative mRNA expression was normalized to the GAPDH control. ΔΔC t Relative mRNA expression was determined using the specified method.

[0327] result Gene expression signatures in PRDM1-edited CAR-T cells prompted investigations into underlying immunological programs, including T cell differentiation, memory features, T cell exhaustion, T cell activation, cytokine and chemokine production, and signaling pathways. Several cluster 6 genes, CD28 and IL7R (two of the T cell memory surface markers), were observed to be significantly upregulated in PRDM1-edited CAR-T cells over all three time points (rounds of NALM6 stimulation) compared to vector controls (Figures 7A-7B). Consistent with time-course RNA-seq, upstream regulators such as KLF2 and S1PR1, also cluster 6 genes, tended to decrease with continuous antigen exposure, but this effect was reversed by PRDM1 editing in CAR-T cells (Figures 7C-7D). Next, transcription factors (TFs) that regulate the differentiation of effector and memory T cells were tested (Chang JT., et al., Nat Immunol., 15(12):1104-15 (2014); Michelini RH., et al., J Exp Med. 210(6):1189-200 (2013)). Effector-driven TFs such as TBX21, ID2, and RUNX3 were observed to be significantly downregulated in PRDM1 mutant CAR-T cells. In contrast, FOXO1, a factor essential for the formation of long-lived memory cells, was upregulated in PRDM1 CAR-T cells after the first two rounds of stimulation (Figures 7E-7F). In addition, NFκB1, STAT1, STAT6, and CDCA7, as well as related genes, which are major regulators of T and other immune cell proliferation, were significantly increased in PRDM1 CAR-T cells compared to vector-controlled cells and gradually decreased over time with continuous antigen stimulation (Figures 7G-7J). On the other hand, IFIT3 and SOCS1, genes that inhibit T cell proliferation, were downregulated in a time-dependent manner in PRDM1 CAR-T cells compared to vector controls. These underlying major pathway changes are consistent with the increased persistence and sustained proliferation of PRDM1 CAR-T cells.

[0328] In PRDM1 CAR-T cells, other central markers for T cell function pathways were further tested. BATF (Kurachi M., et al., Nat. Immunol., 15(4):373-83(2014)), a cluster 7 gene encoding the AP-1 / ATF superfamily of transcription factors that regulate effector CD8 T cell differentiation, was rapidly induced by antigen stimulation in normal vector-controlled CAR-T cells, but this induction was abolished in PRDM1 mutant CAR-T cells (Figure 7J), consistent with time-course RNA-seq. Several genes encoding inflammatory chemokines / cytokines, including CXCR6 (cluster 7), IL13 (cluster 7), and PRF1 (cluster 8), were also observed to be dramatically downregulated in PRDM1 mutant CAR-T cells compared to vector controls, also consistent with time-course RNA-seq. PTPN14 (Pike KA. and Tremblay ML., Front. Immunol., 9:2504 (2018)), a cluster 5 gene encoding a member of the tyrosine phosphatase (PTP) family of proteins that regulate various cellular processes including cell growth, differentiation, mitotic cycles, and oncogenic transformation, was highly induced in PRDM1 CAR-T cells compared to vector controls. In contrast, WNT11 (Van Loosdregt, J., and Coffer, PJ., J. Immunol., 201(8):2193-2200 (2018)), a cluster 2 gene encoding the WNT / beta-catenin pathway signaling receptor, was rapidly induced by NALM6 stimulation in vector-control T cells, but this induction was completely abolished in PRDM1 CAR-T cells, which is a signature of cluster 2 gene behavior. In addition, PCDH8 showed strong induction in PRDM1 CAR-T cells but not in vector-controlled CAR-T cells, and RIN3 showed strong induction in vector-controlled cells but not in PRDM1 CAR-T cells.

[0329] It was hypothesized that disruption of PRDM1 could reduce T cell exhaustion in CAR-T cells. Consistent with time-course RNA-seq, flow cytometry analysis showed that PRDM1 CAR-T cells had reduced levels of TIM3, a canonical immune checkpoint encoded by the HAVCR2 gene, which is also included in cluster 2 of the RNA-seq time-course results (Figure 7L). Additional surface checkpoints such as LAG3, 2B4 / CD244, and CD39 / ENTPD1 were also significantly and consistently reduced on the T cell surface (Figures 7M-7O), indicating a robust attenuation of exhaustion in PRDM1 CAR-T cells. Taken together, these data demonstrate that PRDM1 CAR-T cells showed improvement over control CAR-T cells with increased memory phenotype, reduced T cell terminal differentiation, enhanced cell proliferation, and reduced T cell exhaustion after chronic cancer antigen exposure (Figure 7P).

[0330] CLASH is a versatile platform for large-scale manipulation of CAR-T cells, which are currently considered a “living drug” in immunotherapy. In contrast to non-viral, DNA-based cDNA transgene knock-in, the CLASH system utilizes AAV vectors that enable large-scale disruption along with highly efficient human T cell transduction by simply creating viral vectors in a pooled manner. CRISPR / Cas9 gene editing for targeted delivery of CAR genes to specific loci such as TRAC can enhance T cell efficacy and increase tumor rejection compared to random integration in retroviral or lentiviral vectors (Eyquem J., et al., Nature 543, 113-117 (2017)). Nonviral DNA electroporation was used to create an intermediate number (36) of transgenes that could be knocked into the genome of normal human T cells (Roth TL., et al., Cell, 181(3):728-744.e21 (2020)), but this was not possible with CAR-T cells.

[0331] The CLASH system facilitates the introduction of AAV-HDR-mediated CAR-T knock-in and a third disruption into TRAC by carrying a different user-defined crRNA in the same vector. In contrast to the limitations of cDNA, which differs between constructs and is difficult to scale up to a high degree, the flexibility of wildcard crRNAs, along with the simplicity of easily scaling up a large number of crRNAs in a pool, makes CLASH simple for performing ultra-parallel disruption. Therefore, CLASH enables the simultaneous transduction of a large number of human T cells to manipulate stably knocked-in CAR constructs with large-scale targeted diversity. Thus, the resulting T cell variant pool allows for immediate, high-throughput selection or screening of desired phenotypes from the pool in an unbiased and quantitative manner. As demonstrated in the examples, the expression of the knock-in pool can be directly read by next-generation sequencing (NGS).

[0332] Large-scale CRISPR screening has been applied to human and mouse primary T cells using lentiviral vectors (Dong MB., et al., Cell, 178(5):1189-1204.e23 (2019); Shifrut M., et al., Cell, 175:1958-1971.e1915 (2018); Ting PY., et al., Nat. Methods, 15(11):941-946 (2018); Ye L., et al., Nat Biotechnol., 37(11):1302-1313 (2019)), and more recently, transposon systems. However, unlike existing lentiviral vectors or transposon-based CRISPR libraries that randomly integrate into the genome, the CLASH system precisely targets all CAR-T variants to the same locus, thus controlling positional effects to create a set of variants and thereby avoiding insertional mutagenesis in the CAR-T cell genome. The same polymerase III promoter drives crRNA strings (e.g., crTRAC-crWildcard) to comfortably fit the entire knock-in / knockout construct within the 4.7kb packaging limit of the AAV vector, so the tracr-independent Cas12a / Cpf1 system also facilitates multiplexed, targeted mutagenesis. In addition to T cells, the CLASH technology can be applied to many other cell types, such as other primary immune cells or stem cells.

[0333] Using the CLASH system, we comprehensively investigated immunologically relevant genetic disruptions that enhance CAR-T cell persistence after prolonged cancer antigen stimulation. To maximize the probability of hitting clinically relevant targets, we designed Rene and Descartes, immuno-focused, T-cell-centric libraries. The AAV-CLASH-Descartes libraries efficiently generated a large, functionally diverse CD22 CAR-T cell pool, which was subjected to long-term CAR-T culture in antigen-specific cancer cell co-culture. The co-culture system itself exhibited a phenotype consistent with exhausted CAR-T cells, with increased T cell terminal differentiation, low proliferation, and insufficient cytokine release capacity (Wherry EJ., Nature immunology 12, 492-499 (2011)). The selective pressure of long-term co-culture enriched a set of genes that can promote CAR-T cell survival by increasing death capacity, cell proliferation, or overcoming T cell exhaustion. Among these genes, TET2, one of the top hits, has been shown to improve the efficacy and persistence of CAR-T cells after disruption (Fraietta et al., 2018), demonstrating the validity of the platform.

[0334] Systematic deconvolution of the CLASH CAR-T time-course library dynamics using NGS and analysis revealed a comprehensive map of the quantitative effects of individual genes in the Descartes library. This identified several candidates that modulate function in CAR-T cells. PRDM1 CAR-T cells exhibited a central memory phenotype that mediated potent antitumor effects in progressive leukemia. Finally, time-course RNA-seq analysis enabled a dynamic assessment of the functional significance of PRDM1 disruption.

[0335] PRDM1 was previously known as a transcription factor of significant importance for B cell and T cell differentiation (Rutishauser et al., 2009). Recent studies have revealed that PRDM1 mediates T cell exhaustion by upregulating TIGIT and PD-1 in patients (Zhu L., et al., J Hematol Oncol., 10(1):124 (2017)). However, these studies were performed in normal primary cells, not CAR-T cells. Therefore, this investigation was conducted directly in a CAR-T setting. In an interesting case of PRDM1-cr1, this construct can generate a unique exon 3 skipping mutant of PRDM1 resulting in a truncated protein product. With CLASH-engineered CAR-T cells, PRDM1 disruption in CAR-T cells was observed to manifest increased proliferative capacity and a central memory phenotype in vitro and in vivo, in both CD22 CAR and CD19 CAR settings. Both the PRDM1 CD22 CAR and the CD19 CAR showed superior efficacy compared to their respective control CARs. This example demonstrates that PRDM1 CAR-T is superior to its control counterpart in a leukemia model.

[0336] PRDM1 has been previously reported to modify histones and repress transcription by recruiting proteins or corepressor complexes, such as G9a histone methyltransferase (Gyory I., et al., Nature immunology 5:299-308 (2004)). Additional studies have identified several differentially expressed genes containing predicted PRDM1 binding sites, including BCL6, ID3, and cMYC (Crotty S., et al., Nature immunology 11, 114-120 (2010); Martins G. and Calame K. Annu Rev Immunol., 26:133-169 (2008)). Knockout of PRDM1 in CD8 T cells resulted in continued cytokine responsiveness and increased proliferation due to increased expression of CD25 and CD27 (Shin HM., et al., Immunity 39, 661-675 (2013)). The aforementioned studies on the mechanisms of PRDM1 disruption in CAR-T cells indicated certain conserved pathways, but these were not identical to those in previous studies, likely due to CAR-T specific configurations. BCL6, CD25, and CD27 did not increase after PRDM1 editing in CAR-T cells. It is possible that the PRDM1-targeting crRNA altered only the PR domain, and therefore left the zinc finger domain unchanged. Previous studies have reported that promoter hypermethylation-mediated silencing of PRDM1 may contribute to the pathogenesis of natural killer / T-cell lymphoma (NKTCL) (Iqbal J., et al., Leukemia 23, 1139-1151 (2009)). However, loss-of-function mutations in PRDM1 are rarely observed in NKTCL (Kucuk C., et al., Ther Adv Med Oncol. 12:1758835919900856 (2020)).Given that no pathogenic or oncogenic transformation of PRDM1-modified CAR-T cells was observed, and that the majority of CAR-T cells weaken in vivo due to a lack of persistence rather than overgrowth, it seems reasonable to conclude that PRDM1 editing may allow for enhanced CAR-T therapeutic efficacy by conferring a favorable therapeutic range, with manageable toxicity or other side effect risks.

[0337] The examples demonstrate the CAR-T CLASH system in a leukemia model, but this system can also be applied to other tumor types and forms of CAR-T by simply switching the knock-in CAR construct. Successful application of CAR-T cells to solid tumors is challenging due to insufficient T cell transport capacity and the immunosuppressive environment in many advanced solid tumors (Lim, WA., and June, CH., Cell 168:724-740 (2017)). These challenges can be addressed by using in vivo models of CAR-T cell tumor invasion or time-dependent persistence, by selecting novel variants of CAR-T to enhance solid tumor CAR-T persistence, or, in certain more sophisticated settings, by utilizing multiple transgenic reporters or immunomarkers for massively parallel manipulation of novel CAR-Ts to overcome suppressive components in the tumor microenvironment. To overcome various immune deficiencies associated with cancer treatment and simplify CAR-T cell production, the application of CLASH to allogeneic or universal CAR-T cell models can expand this method by facilitating the development of new strategies, such as the use of gene editing to remove functional endogenous TCRs. The versatility of the CLASH system opens up several new avenues for on-demand manipulation of CAR-T cells with efficiency and precision.

[0338] Unless otherwise specified, all technical and scientific terms used have the same meaning as those commonly understood by those skilled in the art in which the inventions of this disclosure pertain. The cited publications and materials from which they are cited are incorporated herein by special reference.

[0339] Those skilled in the art will recognize many equivalents to specific embodiments of the described methods and compositions, or can verify them using mere routine experimental methods. Such equivalents are intended to be covered by the following claims.

Claims

The crRNA expression cassette and the CAR expression cassette are located between the 5' homology arm and the 3' homology arm, the 5' homology arm and the 3' homology arm are homologous to the target site, the crRNA expression cassette independently encodes a first guide RNA and a second guide RNA, the first guide RNA targets the target site, the second guide RNA targets a target gene, a vector. Claim 2 The library according to claim 2, wherein the second guide RNA is specific to each vector across the plurality of vectors. Claim 4 The library according to any one of claims 2 to 4, wherein one or more sequences encoding one or more of the encoded guide RNAs of the library are selected from the group consisting of SEQ ID NOs: 3 to 12, 134. The library according to any one of claims 2 to 5, comprising in total about 100 to about 300,000, about 1,000 to about 5,000, or about 5,000 to about 10,000 distinct guide RNAs. or (ii) SEQ ID NOs: 4,088 to 12,134, or or (iii) SEQ ID NOs: 3 to 12,134 The library according to any one of claims 2 to 6, comprising in total the guide RNAs encoded thereby. Claim 9 The vector according to claim 1 or 8, or the library according to any one of claims 2 to 8, wherein the CAR expression cassette comprises an EFS promoter. ​ ​ ​ ​ ​ ​ **Claim 10**: The vector according to claim 1, 8 or 9, or the library according to any one of claims 2 to 9, wherein the polyadenylation signal sequence is operably linked to the sequence encoding the CAR. **Claim 11** The vector according to any one of claims 1 or 8 to 10, or the library according to any one of claims 2 to 10, wherein the 5' and 3' homologous arms are homologous to the TRAC locus. **Claim 12**: The vector according to any one of claims 1 or 8 to 11, or the library according to any one of claims 2 to 11, wherein the vector encodes at least one guide RNA targeting the TRAC locus. **Claim 13** The vector according to any one of claims 1 or 8 to 12, or the library according to any one of claims 2 to 12, wherein the CAR targets one or more cancer-specific antigens or cancer-related antigens. **Claim 14** The vector according to any one of claims 1 or 8 to 13, or the library according to any one of claims 2 to 13, wherein the CAR is an anti-CD19 CAR or an anti-CD22 CAR. **Claim 15** The vector according to any one of claims 1 or 8 to 14, or the library according to any one of claims 2 to 14, wherein the second guide RNA targets a gene involved in T cell exhaustion, T cell proliferation, T cell co-stimulation, memory T cell differentiation, T cell receptor signaling, epigenetic regulation, adaptive immune response, immune response to tumor cells, other immune functions, or combinations thereof. **Claim 16** The vector is with or without a sequence encoding a TRAC-targeting crRNA, with or without one or more additional crRNA coding sequences inserted into the BbsI cloning site as needed, and / or with an existing CAR coding sequence or another CAR coding sequence used in its place, the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence variant having a sequence identity of 75% or higher to any of the above The vector according to any one of claims 1 or 8 to 15, or the library according to any one of claims 2 to 15, comprising.

17. The vector according to any one of claims 1 or 8 to 16, or the library according to any one of claims 2 to 16, wherein the vector is a viral vector, preferably an adeno-associated virus (AAV) vector.

18. The vector according to any one of claims 1 or 8 to 17, or the library according to any one of claims 2 to 17, wherein the AAV is AAV6.

19. A cell comprising the vector according to any one of claims 1 or 8 to 18.

20. A population of cells comprising, as a whole, the library according to any one of claims 2 to 18, wherein each cell, optionally, contains at most one or two vectors contained in the library.

21. A method for identifying one or more genes that enhance a desired phenotype of a cell comprising a CAR, comprising: (a) contacting the population of cells according to claim 20 with an RNA-guided endonuclease under conditions suitable for genomic integration and expression of the guide RNA and CAR contained in the vector; and (b) selecting cells that exhibit the desired phenotype The method comprising.

22. The method according to claim 21, wherein the crRNA expression cassette and the CAR expression cassette are integrated into the TRAC locus.

23. The method according to claim 21 or 22, wherein the RNA-guided endonuclease is provided as an mRNA encoding the RNA-guided endonuclease, a viral vector encoding the RNA-guided endonuclease, or an RNA-guided endonuclease protein, or a complex of the RNA-guided endonuclease protein and RNA.

24. The method according to claim 23, wherein the RNA-guided endonuclease is provided by electroporation.

25. The method according to any one of claims 21 to 24, wherein the RNA-guided endonuclease is Cpf1, or an active variant, derivative or fragment thereof.

26. The method according to any one of claims 21 to 25, wherein the desired phenotype is selected from the group consisting of an increase in tumor / tumor microenvironment infiltration, an increase or optimization of target cell affinity, an increase in cytotoxicity to target cells, an increase in persistence, an increase in expansion / proliferation, a reduction in exhaustion, an improvement in anti-cancer metabolic function, an increase in the ability to prevent immune evasion, a reduction in non-specific cytokine production, a reduction in off-target toxicity, a reduction in cytokine release syndrome (CRS), and combinations thereof.

27. The method according to any one of claims 21 to 26, wherein the step of selecting comprises co-culturing the population of cells with target cells comprising one or more antigens recognized by the CAR for a defined period of time, selection based on flow cytometry or affinity, selection based on immune markers, in vivo tumor infiltration, CAR-antigen interaction, directed evolution, or combinations thereof.

28. The method according to claim 27, wherein the population of cells is repeatedly co-cultured with the target cells.

29. The method according to claim 27 or 28, wherein the period comprises from about 1 to about 60 days.

30. The method according to any one of claims 27 to 29, wherein the target cells comprise cancer cells.

31. The method according to any one of claims 21 to 30, further comprising the step of identifying a crRNA expression cassette present in the selected cells.

32. The method according to claim 31, wherein the step of identifying the crRNA expression cassette comprises sequencing the genomic DNA of the selected cells.

33. The method according to claim 31 or 32, wherein the one or more genes that enhance the desired phenotype are identified as the genes targeted by the guide RNA encoded by the crRNA expression cassette.

34. The method according to any one of claims 21 to 33, wherein the population of cells comprises effector T cells, memory T cells, central memory T cells, effector memory T cells, Th1 cells, Th2 cells, Th3 cells, Th9 cells, Th17 cells, Tfh cells, Treg cells, gamma-delta T cells, hematopoietic stem cells (HSCs), macrophages, natural killer cells (NKs), B cells, dendritic cells (DCs), or other immune cells.

35. The T cell is CD4 ＋ or CD8 ＋ The method according to claim 34, which is a T cell.

36. An isolated CAR T cell comprising a CAR and one or more mutations of one or more genes identified by the method according to any one of claims 21 to 35.

37. The CAR T cell according to claim 36, wherein the one or more mutations cause a decrease in the function of the one or more genes or their gene products.

38. The CAR T cell according to claim 36 or 37, wherein the one or more genes are selected from the group consisting of PRDM1, DPF3, SLAMF1, TET2, HFE, PELI1, PDCD1, HAVCR2 / TIM3, TET2, NR4A2, LAIR1, and USB1.

39. The CAR T cell according to any one of claims 36 to 38, which shows an increase in memory, an increase in cell proliferation, an increase in persistence, an increase in cytotoxicity against target cells, a decrease in T cell terminal differentiation, and / or a reduction in T cell exhaustion as compared to a CAR T cell that does not contain the one or more mutations in the one or more genes.

40. A population of CAR T cells obtained by expanding the CAR T cell according to any one of claims 36 to 39.

41. A pharmaceutical composition comprising the population of CAR T cells according to claim 40 and a pharmaceutically acceptable buffer, carrier, diluent or excipient.

42. The pharmaceutical composition according to claim 41, for treating a subject having a disease, disorder or condition.

43. The pharmaceutical composition according to claim 42, wherein the disease, disorder or condition is associated with high or specific expression of an antigen.

44. The pharmaceutical composition according to claim 43, wherein the CAR T cell targets the antigen.

45. The pharmaceutical composition according to any one of claims 42 to 44, wherein the cells are isolated from a healthy donor or from the subject having the disease, disorder or condition before introduction of the one or more mutations into the one or more genes.

46. The pharmaceutical composition according to any one of claims 42 to 45, wherein the disease, disorder or condition is cancer, an inflammatory disease, a neuronal disorder, HIV / AIDS, diabetes, a cardiovascular disease, an infectious disease, or an autoimmune disease.

47. The pharmaceutical composition according to claim 46, wherein the cancer is leukemia or lymphoma selected from the group consisting of chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), mantle cell lymphoma, non-Hodgkin lymphoma, and Hodgkin lymphoma.

48. The pharmaceutical composition according to any one of claims 42 to 47, wherein the subject is human.

49. A cell comprising one or more crRNA expression cassettes encoding one or more guide RNAs selected from the group consisting of SEQ ID NOs: 3 to 12, 134 and a chimeric antigen receptor (CAR) expression cassette, the cassettes being contained in a heterologous nucleic acid construct.

50. A cell comprising a heterologous nucleic acid construct encoding a chimeric antigen receptor (CAR) expression cassette and a reduction or loss of expression at one or more gene loci targeted by one or more guide RNAs selected from the group consisting of SEQ ID NOs: 3 to 12, 134.

51. The cell according to claim 49 or 50, wherein the heterologous nucleic acid construct is present at the TRAC gene locus within the genome of the cell, and optionally, the CAR is an anti-CD19 or anti-CD22 CAR.

Images