Methods for treating age-related macular disease using target sequences of AIMP2-DX2 and optionally miR-142 and compositions thereof

Abstract

Disclosed herein is a method for treating age-related macular disease (AMD), comprising administering to a subject in need of AMD treatment a vector comprising AIMP2-DX2 and, optionally, a target sequence of miR-142. The vector may further comprise a promoter operably linked to AIMP2-DX2. The target sequence of miR-142 may be located 3' to the AIMP2-DX2 gene. In some embodiments, the AMD is wet AMD. In some embodiments, the AMD is dry AMD.

Description

[Technical Field]

[0001] Cross-references to related applications This application claims the benefits as of the filing date of U.S. Application No. 63 / 085,922, filed on 30 September 2020. This disclosure is incorporated herein by reference in its entirety. Reference to electronically submitted sequence listings

[0002] The contents of the sequence listing submitted electronically in the ASCII text file (name: 2493-0005WO01_Sequence Listing_ST25.txt; size: 28KB; creation date: September 30, 2021) filed with this application are incorporated herein by reference in their entirety. Field of Invention

[0003] A method for treating age-related macular disease is disclosed herein, comprising administering a vector containing AIMP2-DX2 and, optionally, the target sequence of miR-142, to subjects requiring treatment for neurological disorders. [Background technology]

[0004] Background technology of the invention Age-related macular disease (AMD) is the leading cause of vision loss in Europe, the United States, and Australia. Nearly two-thirds of the population over 80 years of age exhibit signs of AMD, characterized by the presence of drusen and CNVs (subfoveal choroidal neovascularization), resulting in a wet, exudative form. AMD is a chronic, progressive disease characterized by damage to the central retina. Changes in choroidal capillaries, retinal pigment epithelium (RPE), and Bruch's membrane (typically associated with aging) underlie the pathogenesis of AMD; however, the mechanism that initiates the transmission of typical age-related changes in the pathological process is unknown. Photoreceptor death and irreversible vision loss result from pathological changes in the RPE and choroid. Recent studies have demonstrated that not only apoptosis, but also autophagy and necrosis signaling cascades are involved in retinal cell death (Telegina 2017).

[0005] The disease is classified into "dry" and "wet" types. Approximately 90% of cases are the "dry" atrophic type of AMD; currently, there is no treatment for it. In the "dry" type of AMD, drusen are diagnosed in the macular region, pigment redistribution occurs, defects appear in the pigment epithelium and choroidal capillary layer, and photoreceptor death occurs against a background of RPE cell atrophy. The "wet" (exudative) type develops in about 10% of AMD patients and is characterized by newly formed blood vessels extending into the interior through defects in Bruch's membrane beneath the retinal pigment epithelium or neuroepithelium. Increased permeability of these newly formed blood vessels leads to retinal edema, exudation, and hemorrhage in the vitreous humor and retina (which ultimately leads to vision loss).

[0006] Currently, the laser-induced Bruch's membrane photocoagulation model is the most widely accepted and frequently used experimental mouse model of CNV. The model described herein consists of laser-impact rupture of Bruch's membrane, leading to the growth of new blood vessels from the choroid to the subretinal space, mimicking the main features of the exudative form of human AMD and providing an opportunity to explore the molecular mechanisms of CNV using a large panel of transgenic mice. This model has proven suitable for testing the efficacy of novel drugs administered systemically or topically (intraocularly), and has shown predictive value of drug effects in AMD patients, for example, using vascular endothelial growth factor receptor (VEGFR) traps or anecoltar acetate (Telegina 2017).

[0007] There are three main drugs that provide indirect anti-angiogenic effects by blocking vascular endothelial growth factor (VEGF) in the retina. Ranibizumab (Lucentis, Genentech Inc., South San Francisco, CA; globally commercialized by Novartis) was approved by the Food and Drug Administration (FDA) in 2006 for the treatment of neovascular AMD (Hernandez-Zimbron 2018). It is a recombinant humanized immunoglobulin (Ig) G1 kappa isotype monoclonal antigen-binding fragment (Fab) that targets and binds to VEGF-A with high affinity. Aflibercept (Regeneron, Tarrytown, NY; globally commercialized by Bayer AG) was approved by the FDA in 2011. It is a fusion protein combining two key binding domains of human VEGF receptors 1 and 2 with a crystallizable fragment (Fc) region of human IgG1. Finally, bevacizumab (Genentech Inc., South San Francisco, CA; globally commercialized by Roche) is a full-length humanized antibody that binds to and blocks all VEGF isoforms.

[0008] Oxidative stress can induce apoptosis, which can activate and recruit macrophages and trigger inflammation. Apoptosis may be one of the triggers for choroidal inflammation and therefore angiogenesis in the CNV model (Du 2013).

[0009] AIMP2-DX2 is an alternative, competitive splicing variant of AIMP2, a multifactorial apoptotic gene. AIMP2-DX2 is known to suppress cellular apoptosis by inhibiting the function of AIMP2. Acting as a competitive inhibitor of AIMP2, AIMP2-DX2 suppresses TNF-α-mediated apoptosis by inhibiting TRAF2 ubiquitination / degradation. Furthermore, AIMP2-DX2 has already been identified as a lung cancer inducer, and existing studies have confirmed that AIMP2-DX2, widely present in cancer cells, induces cancer by interfering with the tumor suppressor function of AIMP2. Moreover, we discovered that while the presence of AIMP2-DX2 in normal cells promotes cell carcinogenesis, suppressing the presence of AIMP2-DX2 inhibits cancer growth, thereby exerting a therapeutic effect. AIMP2-DX2 has also been shown to be potentially useful in the treatment of neurological disorders (KR10-2015-0140723 (2017) and US2019 / 0298858 (2019)). [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Telegina, DV, OS Kozhevnikova, and NG Kolosova. "Molecular mechanisms of cell death in retina during development of age-related macular degeneration." Advances in Gerontology 7.1 (2017): 17-24. [Non-Patent Document 2] Hernaendez-Zimbroen, Luis Fernando, et al. "Age-related macular degeneration: new paradigms for treatment and management of AMD." Oxidative medicine and cellular longevity 2018 (2018). [Non-Patent Document 3] Du, Hongjun, et al. "JNK inhibition reduces apoptosis and neovascularization in a murine model of age-related macular degeneration." Proceedings of the National Academy of Sciences 110.6 (2013): 2377-2382. [Summary of the Invention] [Means for Solving the Problems]

[0011] Summary of the Invention A method of treating age-related macular disease (AMD) in a subject needing treatment of age-related macular disease, comprising administering to the subject a pharmaceutically effective amount of a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene is disclosed herein. In some embodiments, the AMD is wet AMD. In some embodiments, the AMD is dry AMD.

[0012] The recombinant vector may further comprise a miR-142 target sequence.

[0013] The vector may further include a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter or an opsin promoter.

[0014] The miR-142 target sequence may be on the 3' side with respect to the AIMP2-DX2 gene.

[0015] In some embodiments, the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0016] In some embodiments, the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0017] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.

[0018] In some embodiments, the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

[0019] The miR-142 target sequence may include a nucleotide sequence containing ACACTA. In some embodiments, the miR-142 target sequence includes ACACTA and 1 to 17 additional consecutive nucleotides from sequence number 5. In some embodiments, the miR-142 target sequence includes a nucleotide sequence that is at least 50% identical to the nucleotide sequence of sequence number 5 (TCCATAAAGTAGGAAACACTACA). In some embodiments, the miR-142 target sequence may include the nucleotide sequence of sequence number 5.

[0020] In some embodiments, the miR-142 target sequence includes ACTTTA. In some embodiments, the miR-142 target sequence includes ACTTTA and 1 to 15 additional consecutive nucleotides from SEQ ID NO: 7. In some embodiments, the miR-142 target sequence includes a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG). In some embodiments, the miR-142 target sequence includes the nucleotide sequence of SEQ ID NO: 7.

[0021] The miR-142 target sequence may be repeated 2 to 10 times in the vectors disclosed herein.

[0022] The vector may be a viral vector. Viral vectors may be adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), mouse leukemia virus (MLV), aerozoic sarcoma / leukemia (ASLV), splenic necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), herpes simplex virus, or vaccinia virus.

[0023] In some embodiments, the recombinant vector is administered to the subject locally, by intravitreal injection, subconjunctival injection, or into the subretinal space of the subject.

[0024] The methods disclosed herein may further include administering an additional therapeutic agent. In some embodiments, the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab. Brief explanation of the drawing [Brief explanation of the drawing]

[0025] [Figure 1] Figure 1 shows an exemplary recombinant vector.

[0026] [Figure 2] Figure 2 shows neuronal-specific expression of recombinant vectors in an in vitro environment.

[0027] [Figure 3] Figure 3 shows the miR142-3pT (target) sequence (SEQ ID NO: 6) which has four repeats of miR142-3pT (underlined).

[0028] [Figure 4] Figure 4A shows schematic diagrams of miR142-3pT with 1×, 2×, and 3× repeats and mutations. Figure 4B shows the inhibition of DX2 expression by miR142-3p by 1×, 2×, and 3× repeats of miR-142-3pT.

[0029] [Figure 5] Figure 5 shows that the core binding sequence is important for DX2 inhibition. Vectors and DX2 constructs containing Tseq x3 repeats (Figure 4B), which showed significant inhibition of DX2, were used as controls. Treatment with 100 pmol of miR-142-3p significantly inhibited the Tseq x3 vector, but not DX2 or the mutant sequence.

[0030] [Figure 6-1] Figures 6A to 6C show a comparison of the amino acid sequences of AIMP2-DX2 and its variant (Figures 6B and 6C are a continuation of Figure 6A). [Figure 6-2] Same as above. [Figure 6-3] Same as above.

[0031] [Figure 7] Figure 7 shows the prophylactic efficacy of DX2 in a CNV mouse model. Fluorescein and indocyanine green angiography images of laser photocoagulation sites after treatment with scAAV2-GFP or scAAV2-DX2. 21 days after viral injection laser-induced CNV.

[0032] [Figure 8] Figure 8 compares choroidal neovascularization area. The ratio of leakage area to CNV area is shown for GFP control and DX2 treatment. Leakage area was estimated by measuring total hyperfluorescence area using FA, and CNV area was calculated using ICGA. Changes in CNV area due to DX2 treatment are also shown. CNV volume was calculated based on the measured total isolectin B4 volume. For each group, n=12, *P<(0.05).

[0033] [Figure 9] Figure 9 shows VEGF expression in a laser-induced choroidal neovascularization (CNV) mouse model. Western blot results and VEGF multiplier changes are shown. VEGF multiplier changes were measured using Image J. For each group, n=6, *P<(0.05).

[0034] [Figure 10] Figure 10 shows a cross-sectional histological view of the retina (H&E staining).

[0035] [Figure 11-1]Figures 11A–11E show histological measurements of retinal thickness. Figure 11A is the thickness of the retina. Figure 11B is the thickness of the RPE (retinal pigment epithelium). Figure 11C is the thickness of the ONL (outer granular layer of photoreceptors). Figure 11D is the thickness of the outer segment. Figure 11E is the thickness of the OPL (outer plexiform layer). All samples were obtained from sections containing optic nerve with a thickness of 10 μm. Transfection of the DX2 gene into the retina resulted in recovery of the total thickness of the neuroretina (Figure 11A). Transfection of DX2 showed a thicker RPE layer (Figure 11B) and outer segment layer of photoreceptors (Figure 11C), indicating that DX2 expression prevents RPE degeneration and ciliary degradation of photoreceptors. Transfection of DX2 also showed a thicker outer granular layer of photoreceptors (Figure 11D) and outer plexiform layer (Figure 11E), indicating that DX2 expression reduces photoreceptor degeneration. [Figure 11-2] Same as above.

[0036] [Figure 12] Figure 12 shows the integrity and proliferation of the retinal pigment epithelium (RPE). Transfection with the DX2 gene resulted in the recovery of RPE integrity by activating RPE proliferation.

[0037] [Figure 13] Figure 13 shows the recovery of PR (photoreceptor). Transfection of the DX2 gene resulted in the recovery of the PR population by activating PR proliferation.

[0038] [Figure 14] Figures 14A and 14B show cell proliferation of RPE and PR. Ki67 expression was measured to analyze the proliferation of RPE and the photoreceptor layer. Proliferation of RPE (Figure 14A) and the outer segment layer of the photoreceptor (Figure 14B) was significantly higher in samples transfected with AAV2-DX2.

[0039] [Figure 15-1]Figures 15A–15F show functional recovery of the retina. Electroretinograms of AAV2-DX2 transfected samples showed increased regrowth of the normal ERG graph format (Figures 15A and 15B). AAV2-DX2 transfection showed increased a-wave amplitude (Figure 15C) and decreased latency (Figure 15D) compared to a dry AMD model (mdm1- / -) or a negative control (mdm1- / -+AAV-GFP), indicating that DX2 expression mitigates damage to photoreceptor electrophysiological function and visual impairment. AAV2-DX2 transfected samples did not alter b-wave amplitude (Figure 15E) or latency (Figure 15F). [Figure 15-2] Same as above. [Figure 15-3] Same as above. [Modes for carrying out the invention]

[0040] Detailed description of the invention AIMP2-DX2 is an alternative antagonistic splicing variant of AIMP2 (aminoacyl-tRNA synthase complex interacting multifunctional protein 2), a multifactorial apoptotic gene. AIMP2-DX2 is known to suppress cellular apoptosis by inhibiting the function of AIMP2.

[0041] AIMP2-DX2, acting as a competitive inhibitor of AIMP2, suppresses TNF-α-mediated apoptosis by inhibiting TRAF2 ubiquitination / degradation.

[0042] Furthermore, it has been shown that AIMP2-DX2 can treat neurological disorders (US2019 / 0298858 A1).

[0043] It has also been shown that inserting AIMP2-DX2 into adeno-associated virus and introducing the resulting material into the subretinal space effectively inhibits choroidal neovascularization.

[0044] Disclosed herein are methods for treating age-related macular disease (AMD) in subjects requiring treatment for AMD, comprising administering a pharmaceutically effective amount of a recombinant vector containing an exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject. In some embodiments, the AMD is wet AMD. In some embodiments, the AMD is dry AMD.

[0045] Disclosed herein are methods for reducing vascular leakage, reducing choroidal neovascularization, reducing choroidal neovascularization, or reducing VEGF expression in the eye or peripheral region of a subject affected by AMD, comprising administering a pharmaceutically effective amount of a recombinant vector containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene to the subject.

[0046] The recombinant vectors disclosed herein may further comprise the miR-142 target sequence. The vectors may further comprise a promoter operably ligated to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Roussarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

[0047] In some embodiments of the methods disclosed herein, the recombinant vector comprises an exon 2 deletion AIMP2 variant (AIMP2-DX2) gene and a miR-142 target sequence. The miR-142 target sequence may be 3' relative to the AIMP2-DX2 gene. The vectors described herein can express AIMP2-DX2 in neural cells but not in hematopoietic cells such as leukocytes and lymphoid cells.

[0048] The AIMP2-DX2 polypeptide (SEQ ID NO: 2) is a splice variant of AIMP2 (e.g., the aa sequence of SEQ ID NO: 12; e.g., the nt sequence of SEQ ID NO: 3), in which the second exon of AIMP2 (SEQ ID NO: 10; the nt sequence of SEQ ID NO: 4) is omitted. In some embodiments, the AIMP2-DX2 gene has the nucleotide sequence described in SEQ ID NO: 1, and the AIMP2-DX2 polypeptide has the amino acid sequence described in SEQ ID NO: 2. Variants or isoforms of the AIMP2-DX2 polypeptide are also known and can be determined by those skilled in the art (see, for example, SEQ ID NOs: 13-19). For example, Figures 6A-6C show a comparison of AIMP2 (SEQ ID NO: 2) and its variants, SEQ ID NOs: 13-19, as well as the consensus or core sequence of AIMP2 or AIMP2-DX2 (SEQ ID NO: 20).

[0049] In some embodiments, the AIMP2-DX2 gene may include a nucleotide sequence encoding an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any range of identity percentages within that range, to SEQ ID NOs: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

[0050] The AIMP2-DX2 gene may contain a nucleotide sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any range of identity percentages within that range, to the nucleotide sequence of Sequence ID No. 1. The AIMP2-DX2 gene may contain the nucleotide sequence of Sequence ID No. 1.

[0051] In some embodiments, the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 10 or 11. In some embodiments, the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 4.

[0052] The miR-142 target sequence (miR-142T) may include a nucleotide sequence containing ACACTA. The miR-142 target sequence may include a nucleotide sequence containing ACACTA and 1 to 17 additional consecutive nucleotides from Sequence ID No. 5. For example, the miR-142 target sequence may include a nucleotide sequence containing ACACTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides consecutive to the 5' or 3' end of ACACTA, as shown in Sequence ID No. 5.

[0053] The miR-142 target sequence may contain a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA;miR-142-3pT). The miR-142 target sequence may contain the nucleotide sequence of SEQ ID NO: 5.

[0054] The miR-142 target sequence may include a nucleotide sequence containing ACTTTA. The miR-142 target sequence may include a nucleotide sequence containing ACTTTA and 1 to 15 additional consecutive nucleotides from Sequence ID No. 7. For example, the miR-142 target sequence may include a nucleotide sequence containing ACTTTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additional nucleotides consecutive to the 5' or 3' end of ACTTTA, as shown in Sequence ID No. 7.

[0055] The miR-142 target sequence may contain a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG;miR-142-5pT). The miR-142 target sequence may contain the nucleotide sequence of SEQ ID NO: 7.

[0056] Exemplary miR142-3pT variant sequence: Ccgctgcagtgtgacagtgccagccaatgtgcagaggtggatgaggtcttgtgaaaacctggctccttttaacacggccctcaagctccttaagtgaccagaagcttgctagctccataaagtag gaCCACTGCAatcactccataaagtaggaCCACTGCAagatatctccataaagtaggaCCACTGCAatcactccataaagtaggaCCACTGCAaaagcttgtagggatccgcc (SEQ ID NO: 25).

[0057] The mutant sequence refers to one or more regions of the miR142 3pT core sequence that are substituted as follows, e.g., four regions: (5'-AACACTAC-3'→5'-CCACTGCA-3'). Inhibition of DX2 expression in HEK293 cells transfected with the vector was observed with miR142-3p x1 repeats (100 pmol) miR142-3p target sequences, and the miR142-3p inhibition of DX2 expression increased as the number of core binding sequences in the miR142-3p target sequence increased. A Tseq x3 core sequence-containing vector showed significant inhibition, but no inhibition was observed with the mutant 3x sequence.

[0058] MicroRNAs (miRNAs) are non-coding RNA molecules that function to regulate gene expression. miRNAs function by base-pairing with complementary sequences within mRNA molecules, i.e., miRNA target sequences. miRNAs can bind to target messenger RNA (mRNA) transcripts of protein-coding genes, negatively regulating their translation or causing mRNA degradation. Currently, over 2000 human miRNAs have been identified, and the miRbase database is publicly available. Many miRNAs are expressed in tissue-specific ways and play a crucial role in maintaining tissue-specific function and differentiation.

[0059] miRNAs act at the post-transcriptional stage of genes, and it is known that in mammals, approximately 60% of gene expression is regulated by miRNAs. miRNAs play important roles in a variety of biological processes and have been disclosed to be correlated with cancer, cardiac disorders, and neurological disorders. For example, miR-142 exists as miR-142-3p and miR-142-5p, and either of their target sequences can be used. Therefore, "miR-142" or "miRNA-142" refers to, for example, miR-142-3p and / or miR-142-5p, and can bind to miR-142 target sequences, such as miR-142-3pT or miR-142-5pT.

[0060] The miR-142 target sequence may be located at the 5' or 3' end of the AIMP2-DX2 gene.

[0061] For example, it is known that "miR-142-3p" can be located in the region where the translocation of its gene occurs in aggressive B-cell leukemia, and that it is expressed in hematopoietic tissues (bone marrow, spleen, thymus, etc.). Furthermore, it is known that miR-142-3p has been confirmed to be expressed in the liver (hematopoietic tissue of mice) of fetal mice and is involved in the differentiation of the hematopoietic system.

[0062] In some embodiments, the miR-142-3p and / or miR-142-5p target sequences are repeated at least 2 to 10 times, at least 2 to 8 times, at least 2 to 6 times, at least 4 times, or any range or number of times.

[0063] For example, miR-142-3p having the nucleotide sequence of SEQ ID NO: 23 may have a corresponding target sequence, for example, the nucleotide sequence of SEQ ID NO: 5, but not limited to this, which is the miR-142-3p target sequence (miR-142-3pT). For example, miR-142-5p having the nucleotide sequence of SEQ ID NO: 24 may have a corresponding target sequence, for example, the nucleotide sequence of SEQ ID NO: 7, but not limited to this, which is the miR-142-5p target sequence (miR-142-5pT).

[0064] In some embodiments, miR-142-3p may have the nucleotide sequence of SEQ ID NO: 23, and miR-142-5p may have the nucleotide sequence of SEQ ID NO: 24.

[0065] This invention discloses a recombinant vector that can control the side effects of AIMP2-DX2 variant overexpression by inserting the miR-142-3p target sequence and / or miR-142-5p target sequence (miR-142-3pT and / or miR-142-5pT, respectively) into the terminal of AIMP2-DX2, thereby controlling the suppression of AIMP2-DX2 expression in CD45-derived cells, particularly lymphoid and leukocytes. Thus, the expression of the AIMP2-DX2 variant can be restricted to injected nervous system cells and tissues only, but not to non-nerve hematopoietic cells, which are the major population of the injected tissue region. miR142-3p is expressed only in hematopoietic cells.

[0066] Recombinant vectors containing the miR-142-3p and / or miR-142-5p target sequences are disclosed herein. Recombinant vectors containing the exon 2 deletion AIMP2 variant (AIMP2-DX2) gene and the miR-142-3p and / or miR-142-5p target sequences are disclosed herein.

[0067] The term "recombinant vector" refers to a gene construct that includes a vector that can be expressed as a target protein or RNA in a suitable host cell, and operably linked regulatory factors essential for enabling the inserted gene to be properly expressed.

[0068] The term "operatably linked" refers to a functional linkage between a regulatory sequence of nucleic acid expression and a nucleic acid sequence that codes for a target protein or RNA and performs a general function. For example, it can affect the expression of a nucleic acid sequence that codes for a promoter and a protein or RNA linked for the operability of the nucleic acid sequence. Operatable linkage with recombinant vectors is well known in the art and can be produced by using recombination techniques that utilize enzymes commonly known in the art for region-specific DNA cleavage and linking.

[0069] The recombinant vector may further include a promoter operably linked to AIMP2-DX2, as disclosed herein. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Roussarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, a Hb9 promoter, or an opsin promoter.

[0070] The recombinant vector may further include an exogenous promoter and an exogenous gene operably ligated to the promoter.

[0071] As used herein, “exogenous gene” may include a biologically appropriate activation protein or polypeptide, and the cryptographic sequence of a target product such as an immunogen or antigen protein or polypeptide, or a treatment-activated protein or polypeptide.

[0072] Polypeptides can compensate for deficiencies or absences in the expression of endogenous proteins in host cells. Gene sequences can be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof. Gene sequences may include genomic DNA with or without native introns. Furthermore, genomic DNA may be obtained together with promoter sequences or polyadenylated sequences. Genomic DNA or cDNA can be obtained by various methods. Genomic DNA may be extracted and purified from suitable cells by methods publicly known in the region. Alternatively, cDNA can be produced using mRNA by reverse transcription or by other methods such as isolation from cells. Alternatively, polynucleotide sequences may include sequences complementary to RNA sequences, such as antisense RNA sequences, and the expression of complementary polynucleotides in the cells of an individual can be suppressed by administering antisense RNA to the individual.

[0073] For example, the exogenous gene may be an AIMP-2 splicing variant lacking exon 2, and the miR-142-3p target sequence may be linked to the 3'UTR of the exogenous gene. The sequence of the AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC0 13630.1) is described in the literature (312aa version: Nicolaides, NC, Kinzler, KW and Vogelstein, B. Analysis of the 5' region of PMS2 reveals heterogeneous transcripts and a novel overlapping gene, Genomics 29(2), 329-334 (1995) / 320aa version: Generation and initial analysis of more 15,000 full-length human and mouse cDNA sequences, Proc. Natl. Acad. Sci. USA 99(26), 16899-16903 (2002)).

[0074] The term "AIMP2 splicing variant" refers to a variant generated due to the partial or complete loss of exon 2 of exons 1-4. Therefore, the variant implies interference with the normal function of AIMP2 by forming AIMP2 proteins and heterodimers. The injected AIMP2-DX2 gene is hardly expressed in tissues other than the injected tissue. However, as a further safety measure, it is possible to insert the miR142 target sequence to completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, the dominant population of non-neuronal cells in the injected tissue region.

[0075] Recombinant vectors may include sequence numbers 1 and 5.

[0076] The terms "percentage of sequence homology," "percentage of identity," or "percentage of identity" for nucleotide or amino acid sequences can be verified, for example, by comparing two optimally positioned sequences with a comparison domain, where some of the nucleotide sequences within the comparison domain may contain additions or deletions (i.e., gaps) compared to the reference sequence in the optimal position of the two sequences (without additions or deletions).

[0077] The proteins disclosed herein include not only those having their native amino acid sequence, but also those having variant amino acid sequences.

[0078] A protein variant refers to a protein having a different sequence resulting from the deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of one or more amino acid residues from the native amino acid sequence. Amino acid exchanges in proteins and peptides that do not alter the overall molecular activation are known in this area (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979).

[0079] The protein or its variants are obtained through natural extraction, synthesis (Merrifield, J. Amer. Chem. Soc. 85:2149-2156, 1963), or genetic modification based on DNA sequences (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2 nd It can be manufactured by Ed., 1989.

[0080] Amino acid mutations can occur based on the relative similarities of amino acid side-chain substituents, such as hydrophilicity, hydrophobicity, charge, and size. Analysis of the size, shape, and type of amino acid side-chain substituents reveals that arginine, lysine, and histidine are positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine, and histidine; alanine, glycine, and serine; as well as phenylalanine, tryptophan, and tyrosine, can be considered biologically functional equivalents.

[0081] In the introduction of one or more mutations, the hydrophobicity index of the amino acids may be considered. The hydrophobicity index is assigned to each amino acid according to its degree of hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine ​​(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

[0082] Hydrophobic amino acid indicators are crucial when assigning the interactive biological functions of proteins. Similar biological activation is only possible when substitutions are made with amino acids that have similar hydrophobic indicators. Examples of introducing mutations by referencing hydrophobic indicators include substitutions between amino acids where the difference in hydrophobic indicators is within ±2, ±1, or ±0.5.

[0083] On the other hand, it is well known that substitutions between amino acids with similar hydrophilicity values ​​can induce proteins with equivalent biological activity. As shown in U.S. Patent No. 4,554,101, the following hydrophilicity values ​​are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1); glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[0084] In cases where one or more mutations are introduced by referencing the hydrophilicity value, substitutions can be made between amino acids where the difference in hydrophilicity value is within ±2, ±1, or ±0.5, but is not limited to these limits.

[0085] Amino acid exchanges of proteins that do not alter the overall activation of the molecule are known in this field (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are between amino acid residues including Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. Vector systems can be constructed by a variety of methods published in the industry. Specific methods are described in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press.

[0086] The vectors disclosed herein can be constructed as typical vectors for cloning or expression. Furthermore, the vectors can be constructed using prokaryotic or eukaryotic cells as hosts. When the vector is an expression vector and prokaryotic cells are used as hosts, it typically contains a strong promoter for performing transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, 1pp promoter, pL X promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter), a ribosome binding site for decoding initiation, and a transcription / decode termination sequence. When using Escherichia coli (E. coli) (e.g., HB101, BL21, DH5a, etc.) as host cells, the promoter and operator sites of the E. coli tryptophan biosynthesis pathway (Yanofsky, C. (1984), J. Bacteriol., 158:1018-1024) and the left-directing promoter of phage X (pLX promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet. 14:399-445) can be used as control sites.

[0087] On the other hand, the vectors that can be used may be one or more types, such as viral vectors, linear DNA, or plasmid DNA.

[0088] A "viral vector" refers to a viral vector that can deliver genes or genetic material to desired cells, tissues, and / or organs.

[0089] The viral vector includes, but is not limited to, one or more selected from the group consisting of adenoviruses, adeno-associated viruses, lentiviruses, retroviruses, HIV (human immunodeficiency virus), MLV (mouse leukemia virus), ASLV (bird sarcoma / leukemia virus), SNV (splenic necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus), and herpes simplex virus. In some embodiments, the viral vector may be an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.

[0090] Retroviruses possess the ability to integrate into the genome of host cells and are harmless to humans, but they may have characteristics including the suppression of normal cell function upon integration, the ability to infect a variety of cells, easy replication, the ability to contain external genes of approximately 1-7 kb, and the production of replication-deficient viruses. However, retroviruses may also have drawbacks, including difficulty in infecting post-mitotic cells, gene delivery under in vivo conditions, and the need to grow somatic cells under in vitro conditions. Furthermore, retroviruses can integrate into proto-oncogenes, thereby potentially leading to cell necrosis, and thus carry the risk of spontaneous mutation.

[0091] On the other hand, adenoviruses offer several advantages as cloning vectors, including their ability to replicate even within the nuclei of medium-sized cells, their clinically non-toxic nature, their stability even after insertion of external genes, the absence of gene rearrangement or loss, their ability to transform eukaryotes, and their stable, high-level expression even after integration into the chromosomes of host cells. Good host cells for adenoviruses are those responsible for hematopoiesis, lymphoid systems, and myeloma in humans. However, proliferation is difficult due to their linear DNA and the low infection rate of the virus, making it difficult to recover infected viruses. Furthermore, gene expression is most significant during the first 1-2 weeks, and persists for 3-4 weeks in only some cells. Another challenge is their high immunogenicity.

[0092] Adeno-associated virus (AAV) has become popular in recent years because it can complement the aforementioned problems and has many advantages as a gene therapy agent. It is also called adenosatellite virus. Adeno-associated virus particles have a diameter of 20 nm and are known to be of little harm to the human body. For this reason, it has been approved for sale as a gene therapy agent in Europe.

[0093] AAV is a single-stranded provirus that requires an auxiliary virus for replication. The AAV genome has 4,680 bp and can be inserted into a specific region of chromosome 19 in infected cells. The transgene is inserted into plasma DNA ligated by two 145 bp inverted end repeat (ITR) sequence sections and a signal sequence section. Transfection is performed with other plasmid DNA expressing the AAV rep and cap sections, and adenovirus is added as an auxiliary virus. AAV has the advantages of delivering genes to a wide range of host cells, having few immunological side effects with repeated administration, and having a long gene expression period. Furthermore, even if the AAV genome is integrated into the host cell chromosome, it is safe without altering or rearranging host gene expression.

[0094] Adeno-associated virus (AAV) is known to have a total of four serotypes. Among the many AAV serotypes that can be used for target gene delivery, the most widely studied vector is AAV serotype 2, which is currently used for the delivery of clinical genes for cystic fibrosis, hemophilia, and Canavan disease. Furthermore, recombinant AAV (rAAV) has recently shown increasing potential in the field of oncogene therapy (Du 2013). AAV serotype 2 can be used in some embodiments. It is possible, but not limited to, selecting and applying an appropriate viral vector.

[0095] Furthermore, if the vector is an expression vector and eukaryotic cells are used as the host, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or promoters derived from mammalian viruses (e.g., post-adenovirus promoter, vaccine virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and HSV TK promoter) may be used. Specifically, this may include, but is not limited to, one or more promoters selected from the group consisting of retroviral LTRs, cytomegalovirus (CMV) promoters, Roussarcoma virus (RSV) promoters, MT promoters, EF-1α promoters, UB6 promoters, chicken β-actin promoters, CAG promoters, RPE65 promoters, and opsin promoters. In addition, it generally has a polyadenylated sequence as a transcription termination sequence.

[0096] The vectors disclosed herein may be fused with other sequences as needed to facilitate protein purification. For example, fused sequences such as glutathione S-transferase (Pharmacia, USA), maltose-binding protein (NEB, USA), FLAG (IBI, USA), and 6xHis (hexahistidine; Quiagen, USA) may be used, but are not limited to these. Furthermore, expression vectors may contain resistance genes to antibiotics commonly used in the industry as selection markers, such as ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, genethecin, neomycin, and tetracycline.

[0097] Furthermore, gene carriers comprising recombinant vectors containing the respective target sequences of miR-142, such as miR-142-3pT and / or miR-142-5pT, are disclosed herein.

[0098] The term "gene transfer" generally refers to the delivery of genetic material to cells for transcription and expression. The method is ideal for protein expression and treatment purposes. A variety of delivery methods have been described, including DNA transfection and viral transduction. Viral-mediated gene transfer refers to the high delivery efficiency and high levels of expression of the delivered gene, as well as the possibility of being environmentally friendly or targeting specific receptors and / or cell types by pseudotyping, if necessary.

[0099] Gene carriers can be transformants transformed with recombinant vectors, and transformation encompasses all methods of introducing nucleic acids into organisms, cells, tissues, or organs, and it is possible to select and perform appropriate standard techniques according to the host cell, as published in the field. Such methods include, but are not limited to, electroporation, protoplasmic fusion, calcium phosphate (CaP04) precipitation, calcium chloride (CaCl2) precipitation, mixing with the use of silicone carbide fibers, agribacteria-mediated transformation, PEG, dextran sulfate, and lipofectamine.

[0100] Gene carriers aim to suppress the expression of exogenous genes in neurons. Therefore, they can suppress the expression of exogenous genes in CD45-derived cells and increase the expression of exogenous genes in brain tissue. The majority of CD45 is a transmembrane protein tyrosine phosphatase located in hematopoietic cells. Cells can be defined according to molecules located on the cell surface, and CD45 is a cellular marker for all leukocytes and B lymphocytes. Gene carriers are not expressed in CD45-derived cells, particularly in cells ranging from lymphoids to leukocytes.

[0101] The gene carrier may further include carriers, excipients, or diluents that can be used pharmacologically.

[0102] Furthermore, a method for delivering and expressing an exogenous gene in a neuron is disclosed herein, which includes the step of introducing a recombinant vector into a corresponding entity.

[0103] The method may increase the expression of exogenous genes in brain tissue and control the expression of exogenous genes in other tissues.

[0104] Furthermore, vectors comprising an expression cassette containing 1) a promoter; 2) a nucleotide sequence encoding a target protein linked to the promoter to enable activation; and 3) a nucleotide sequence targeting miR-142-3p inserted at the 3'UTR of the nucleotide sequence are disclosed herein. In some embodiments, the vector may comprise an expression cassette containing 1) a promoter; 2) a nucleotide sequence encoding a target protein linked to the promoter to enable activation; and 3) a nucleotide sequence targeting miR-142-5p inserted at the 3'UTR of the nucleotide sequence.

[0105] The term "expression cassette" refers to a unit cassette that contains the gene encoding the target protein, as well as the promoter and nucleotide sequences encoding the signal peptide, and is capable of performing expression for the production and secretion of the target protein operably linked downstream of the signal peptide. Secretory expression cassettes can be used in combination with secretory systems. A variety of factors that can assist in the efficient production of the target protein may be included both inside and outside such expression cassettes.

[0106] Furthermore, prophylactic or therapeutic formulations for AMD are disclosed herein, comprising a nucleotide sequence encoding an AIMP-2 splicing variant lacking exon 2, and a nucleotide sequence targeting miR-142-3p ligated to the 3'UTR of the nucleotide sequence.

[0107] Accordingly, methods for treating AMD in a subject requiring it, comprising administering one of the vectors disclosed herein, are also disclosed herein. In some embodiments, the AMD is wet AMD. In some embodiments, the AMD is dry AMD.

[0108] The vectors disclosed herein, but not limited to them, can induce inhibition of apoptosis, improvement of dyskinesia, and / or inhibition of oxidative stress, and thus can prevent or treat AMD.

[0109] The term "treatment" includes not only the complete treatment of AMD, but also the partial treatment, improvement, and / or reduction of the overall symptoms of AMD as a result of the application of any of the pharmacological agents disclosed herein.

[0110] The term "prevention" means preventing the onset of the overall symptoms of AMD by applying the pharmacological agents disclosed herein to entities of degenerative brain disorder, thereby suppressing or blocking symptoms or phenomena such as cognitive impairment, behavioral disorders, and neuronal destruction.

[0111] Adjuvants other than the active ingredient may be included in addition to the pharmacological agents disclosed herein. Adjuvants may be used without limitation as long as they are known in the art, but the immune response can be enhanced by further including, for example, Freund's complete and incomplete adjuvants.

[0112] The pharmacological agents disclosed herein may be prepared in the form of a mixture of the active ingredient with a pharmacologically acceptable carrier. Here, pharmacologically acceptable carriers include carriers, excipients, and diluents commonly used in the field of pharmacology. Pharmacologically acceptable carriers that may be used with the pharmacological agents disclosed herein include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0113] The pharmacological agents disclosed herein may be used by being manufactured in various forms, including for oral administration such as powders, granules, pills, capsules, suspensions, emulsions, syrups, and aerosols, as well as for topical use, suppositories, or antiseptic injections, according to their respective common manufacturing methods.

[0114] When manufactured into formulations, diluents or excipients such as commonly used fillers, bulking agents, binders, humectants, disintegrants, and surfactants can be used in the manufacture. Solid formulations for oral administration include pills, tablets, powders, granules, and capsules, which can be manufactured by mixing one or more excipients such as starch, calcium carbonate, sucrose, lactose, and gelatin with the active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral administration include suspensions, oral solutions, oils, and syrups containing various excipients such as humectants, sweeteners, and flavorings / preservatives, in addition to water and liquid paraffin, which are commonly used diluents. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, oils, lyophilized agents, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, and vegetable oils such as olive oil, and injection esters such as ethylates. The medications used in suppositories include witepsol, tween® 61, cocoa oil, lauric acid oil, and glycerogelatin.

[0115] The pharmacological agents disclosed herein can be administered to entities through a variety of channels. All modes of administration, including oral administration, as well as intravenous, intramuscular, subcutaneous, and intraperitoneal injections, may be used.

[0116] In some embodiments, the recombinant vector is administered to the subject locally, by intravitreal injection, subconjunctival injection, or into the subretinal space of the subject.

[0117] The methods disclosed herein may further include administering additional therapeutic agents. In some embodiments, the additional therapeutic agents are ranibizumab, aflibercept, and / or bevacizumab.

[0118] The desirable dosage of administration of the therapeutic agents disclosed in this specification varies depending on various factors including the production method of the formulation, mode of administration, age, weight and gender of the patient, degree of symptoms of the disease, diet, administration period, administration route, excretion rate and reaction sensitivity, etc. Nevertheless, it can be appropriately selected by the corresponding manufacturer.

[0119] However, regarding the treatment effect, a skilled physician can determine and prescribe the effective dosage for the targeted treatment. For example, the treatment agents include intravenous, subcutaneous and intramuscular injections, as well as directional injections into the ventricle or spinal cord using micro needles. Multiple injections and repeated administrations are possible. For example, the effective dosage is 0.05 - 15 mg / kg in the case of vectors, 5×10 11 ~3.3×10 14 virus particles (2.5×10 12 ~1.5×10 16 IU) / kg, and 5×10 2 ~5×10 7 cells / kg in the case of cells. Desirably, the dosage is 0.1 - 10 mg / kg in the case of vectors, 5×10 12 ~3.3×10 13 particles (2.5×10 13 to 1.5×10 15 IU) / kg, and 5×10 3 ~5×10 6 cells / kg in the case of cells, and the administration rate is 2 - 3 times a week. The dosage is not strictly limited. Rather, it can be modified according to the patient's symptoms and the degree of manifestation of the neuropathy. The effective dosage for other subcutaneous fat and intramuscular injections as well as direct administration to the affected area is 9×10 10 ~3.3×10 14 recombinant virus particles, and the rate is 2 - 3 times a week at an interval of 10 cm. The dosage is not strictly limited. Rather, it can be modified according to the patient's symptoms and the degree of manifestation of the neuropathy. More specifically, the pharmacological agents disclosed in this specification are 1×10 10 ~1×10 12It may contain recombinant adeno-associated virus at vg(viral genome) / mL, and is generally administered once every two days for two weeks, 1 × 10⁶ times. 12 It is advisable to inject vg. It can be administered once daily or by dividing the dose for several doses throughout the day. In some embodiments, the vector is 0.1 × 10⁶ 8 vg~500×10 8 vg, 1×10 8 vg~100×10 8 vg, 1×10 8 vg~10×10 8 vg, for example 5×10 8 It may be administered in VG or any range of doses derived therefrom. For IV injection, for example, VG can be converted to a human dose based on body weight for IV injection. For local tissue injection, for example, VG can also be converted to a human dose based on target cell count and effective MOI (multiple doses of infection).

[0120] In some embodiments, the vectors disclosed herein may be injected into a subject, for example, by subretinal injection, intravitreous injection, or subchoroidal injection. The injection may be in liquid form. In other embodiments, the vectors disclosed herein may be administered to a subject in the form of eye drops or ointment.

[0121] Pharmacological formulations can be produced in a variety of forms for oral and parenteral administration. In some embodiments, the vectors disclosed herein can be administered to the brain or spinal cord. In some embodiments, the vectors disclosed herein can be administered to the brain by stereotactic injection.

[0122] Orally administered drugs include pills, tablets, hard and soft capsules, liquids, suspensions, oils, syrups, and granules. These drugs, in addition to the active ingredient, may contain diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and / or glycine) and flow enhancers (glydents) (e.g., silica, talc, and stearic acid and its magnesium or calcium salts, and / or polyethylene glycol). Furthermore, pills may contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanthine, methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidine, and, depending on the situation, disintegrants such as starch, agar, alginic acid or its sodium salts, or similar mixtures, and / or absorbents, colorants, flavorings, and sweeteners. Drugs can be manufactured by general mixing, granulation, or coating methods.

[0123] In addition, injectable preparations are a typical form of parenterally administered formulations. Solvents for such injectable preparations include water, Ringer's solution, isotonic saline, and suspensions. Sterile fixative oils can be used as solvents or suspension media for injectable preparations, and any non-irritating fixative oil, including mono- and di-glycerides, can be used for such purposes. Furthermore, fatty acids such as oleic acid can be used in injectable preparations.

[0124] The present invention will be described in more detail using the following examples. However, the following examples are for the purpose of illustrating the content of the invention and do not limit the application of the present invention to these examples. [Examples]

[0125] Examples Example 1. Preparation of recombinant vectors The majority of CD45s are transmembrane protein tyrosine phosphatases in hematopoietic cells and can be used to define cells according to molecules on their cell surface. CD45 is a marker for all leukocytes and B lymphocytes. Recombinant vectors have been created that are not expressed in CD45-derived cells, particularly lymphoid and leukocytes, but are specifically expressed only in neurons. These recombinant vectors contain a splicing variant of aminoacyl-tRNA synthetase complex interacting pluripotent protein 2 (AIMP2) with exon 2 deleted, and miRNAs that can regulate the expression of the AIMP2 splicing variant.

[0126] Recombinant vectors were prepared as a distribution safety measure to induce specific expression of AIMP2 splicing variants in injected nervous system tissue. This was also done to completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, the dominant non-nerve cell population in the injected tissue region. Example 1.1. Preparation of AIMP2 variant

[0127] AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARS) and acts as a multifactorial apoptotic protein. To construct a plasmid expressing a variant of AIMP2 lacking exon 2, the cDNA of the AIMP2 splicing variant was cloned into pcDNA3.1-myc. After amplifying the AIMP2 splicing variant using primers with EcoR1 and Xho1 linkers bound to H322 cDNA, subcloning was performed into pcDNA3.1-myc using EcoR1 and Xho1.

[0128] An AIMP2 variant having the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 was used. Example 1.2. Selection of miRNAs and their target sequences

[0129] As described above, as a safety measure for distribution, the recombinant vector was prepared as described to limit the expression of the AIMP2 variant in injected nervous system cells and to completely block the possibility of AIMP2-DX2 expression in hematopoietic cells, which are the major population of non-nerve cells in the injected tissue region.

[0130] For this purpose, we selected miR-142-3p as a target, as it is specifically expressed only in hematopoietic cells that produce leukocytes and lymphoid-related cells. To construct a sequence that targets only miR-142-3p, we used microarray data of mouse B cells and miR - The target gene for 142-3p was programmed using computer programming (mirSVR score). miR-142-3p is the nucleotide sequence indicated by the sequence number. The miR-142-3p target sequence, sequence number 5, binds to miR-142-3p.

[0131] The miR-142-3p target sequence includes the Nhe1 and Hind III, Bmt1 site sequence (ccagaagcttgctagc; SEQ ID NO: 21), and Hind H site sequence (aagcttgtag; SEQ ID NO: 22). miR-142-3pT may contain the nucleotide sequence of SEQ ID NO: 5 repeated four times using linkers (tcac and gatatc) to connect them (Figure 4; SEQ ID NO: 6). Examples 1-3. Preparation of recombinant vectors

[0132] To prepare the recombinant vector, the miR-142-3p target sequence (SEQ ID NO: 5) was inserted into the 3'UTR of the AIMP2 variant (SEQ ID NO: 1). The linkage between the AIMP-2 variant and the miR-142-3p target sequence is shown in nucleotide sequence number 6, specifically, by cleavage and insertion using the Nhe I and Hind III sites. The recombinant vector is shown in Figure 1. Example 2. Confirmation of neuronal-specific expression of recombinant vector in vitro.

[0133] Since miR142-3p is specifically expressed only in hematopoietic cells, we confirmed the degree of AIMP2 variant expression in specific cells by knocking down the AIMP2 variant through the expression of the miR142-3p target sequence in a recombinant vector.

[0134] Specifically, the study included a group that did not receive recombinant vector treatment (SHAM), a group treated with an empty / control vector (NC vector), a group treated with a single AIMP2 variant vector (pscAAV_DX2), and a group treated with a recombinant vector (pscAAV-DX2-miR142-3pT). All vector concentrations were in ug / ul units, with each group treated with 2.5 ul (2.5 ug). In each treatment group, THP-1 cell lines (human monocytic leukemia cells) and SH-SY5Y cell lines (neuroblastoma) were treated while confirming AIMP2 variant knockdown. qPCR was performed using the primers shown in Table 1 below (15 seconds of denaturation, annealing and extension over 40 cycles of 30 seconds each at 60°C). Table 1 [Table 1]

[0135] As a result, it was confirmed that the AIMP2 variant was not expressed in the SHAM and NC vector groups. Furthermore, expression was confirmed in both the THP-1 cell line and the SH-SY5Y cell line in the group treated with a single AIMP2 variant vector (pscAAV-DX2), confirming that neuronal-specific expression was not induced. On the other hand, in the group treated with the recombinant vector, it was confirmed that the AIMP2 variant was specifically expressed only in the SH-SY5Y cell line (Figure 2). Example 3. Materials and Methods Example 3.1. qRT-PCR

[0136] Total RNA was isolated from the spinal cord using TRIzol (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. The extracted RNA was quantified using a spectrophotometer (ASP-2680, ACTgene, USA) for quantitative analysis. Reverse transcription was performed using SuperScript III First-Strand (Invitrogen) according to the manufacturer's protocol to prepare cDNA. The resulting cDNA was used for real-time PCR using SYBR Green PCR Master Mix (ThermoFisher Scientific, USA). For 2-ΔΔCt statistical analysis, expression data from the denominations were used, and GADPH expression was used for normalization. Example 3-2. miR142-3p inhibition experiment

[0137] miR-142-3p inhibition of DX2 expression was observed from the x1 miR-142-3p target sequence. HEK293 cells were transiently transfected with x1, x2, and x3 repeat miR-142-3p target sequence vectors, plus 100 pmol of miR-142-3p, using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. miR142-3p inhibition of DX2 expression was observed from the Tseq x1 repeat miR142-3p target sequence (Figure 4B). Example 4 Example 4.1. Three types of vectors created for the inhibitory effect on core binding sequences.

[0138] Tseq x1 contains one core binding sequence, Tseq x2 contains two core binding sequences, and Tseq x3 contains three core binding sequences (Figure 4A).

[0139] miR142-3p (100 pmol) inhibition of DX2 expression was initially observed from the x1 repeat miR142-3p target sequence. HEK293 cells were transiently transfected with x1, x2, and x3 repeat miR-142-3p Tseq vectors, plus 100 pmol of miR-142-3p, using lipofectamine 2000 (invitrogen, US), and then incubated for 48 hours. DX2 mRNA levels were analyzed by PCR. As the number of core binding sequences in the miR142-3p target sequence increased, so did the inhibition of DX2 expression by miR142-3p. Vectors containing the Tseq x3 core sequence showed significant inhibition (Figure 4B). Example 4-2. Core sequence mutation.

[0140] The core sequence was predicted using mouse B cell microarray data and mirSVR scores for miR-142-3p target genes. Four regions of the core sequence were substituted as follows: (5'-AACACTAC-3'→5'-CCACTGCA-3') (see Figure 3 for the original sequence and Figure 4A for the schematic diagram). Example 4.3. The core binding sequence is an important DX2 inhibitor.

[0141] Four core sequences were substituted (Figure 4A). HEK293 cells were transiently transfected with DX2-miR-142-3p Tseq x3 repeat vector (Tseq3x) or core sequence mutant vector (mut) and 100 pmol of miR-142-3p using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. DX2 mRNA expression was analyzed by PCR. Tseq x3 repeat vectors (Figure 4B) and DX2 constructs that showed significant inhibition of DX2 were used as controls. Treatment with 100 pmol of miR142-3p significantly inhibited the Tseq x3 vector, but not DX2 or the mut sequence (Figure 5).

[0142] Example 5. Wet AMD Mouse Model

[0143] material and method

[0144] 5-1. Animal Experiments

[0145] The animals were housed in individual cages under specific pathogen-free conditions and constant environmental conditions (temperature 21°C–23°C, humidity 50–60%, and a 12-hour light / dark cycle). The left eye (Ocular sinister) (OS, left eye) of each group of mice was treated with AAV-GFP, and the right eye (Ocular Dexter) (OD, right eye) was treated with AAV-DX2 (injection: 5 × 10⁻¹⁰⁻¹ 8 (vg). One week and ten weeks after subretinal injection, the RPE layer of the fundus was treated with a laser photocoagulator to create wet AMD models at three weeks and three months, respectively. Two weeks and two months after laser treatment, the mouse eyeballs were isolated.

[0146] 5-1-1. Subretinal injections were performed using the following protocol.

[0147] Anesthetize the rodent. Use intraperitoneal injection of 100 mg / ml ketamine and 10 mg / ml xylazine (20 μl / 10 g body weight) via isoflurane inhalation. Ensure the animal is deeply anesthetized by clamping one of its legs. If flinching occurs, wait a few more minutes and try again before initiating the subretinal injection. Position the rodent in that position so that the eye to be injected faces the ceiling. Under a dissecting microscope, gently stretch the skin so that the eye protrudes slightly above the socket (temporary protrusion), hold the head with two fingers just above the ears, making it more accessible by the jaw, and gently stretch the skin parallel to the eyelid so that the eye protrudes slightly above the socket. Using a 38G sterile microtip needle (INCYTO, KR), make a hole just below the limbus at an angle that avoids touching the lens with the needle. While maintaining a grasp of the head, withdraw the disposable sharp needle from the eye. Attach the pre-loaded blunt needle syringe to the micromanipulator, or hold it by hand, then insert the tip of the blunt needle syringe through the hole, taking care not to touch the lens again, and very gently push it into the eye until resistance is felt. Keeping all movements to a minimum, carefully and slowly inject the virus into the subretinal space. AAV2-GFP was injected into the OS (left). AAV2-DX2 was injected into the OD (right). Slowly withdraw the syringe. Administer moisturizing eye drops to keep the eye hydrated. Continue monitoring the animal until it is again in a prone position.

[0148] 5-1-2. A mouse laser-induced CNV model was obtained using the following protocol.

[0149] Before induced laser treatment on mice, position the laser and slit lamp in an easily accessible location. Turn on the laser and set it to the specified parameters. Anesthetize the rodents. Use intraperitoneal injection of 100 mg / ml ketamine and 10 mg / ml xylazine (20 μl / 10 g body weight) via isoflurane inhalation. Lay the mice on their sides and place one drop (approximately 30 μl) of tetracaine hydrochloride into each eye for local anesthesia. Wait 2 minutes for the solution to take effect.

[0150] Repeat the previous step with one drop of topical tropicamide to dilate the pupils. Alternatively, use phenylephrine hydrochloride (2.5%) for dilation. After an appropriate amount of time has elapsed, quickly place the mouse on the mouse stage and place the stage on the chin rest of the slit lamp. Turn on the slit lamp at its lowest brightness and check the degree of pupil dilation. If the pupils are not sufficiently dilated (approximately 2.5-3 mm), return the mouse to the animal warmer and wait. Alternatively, administer another drop of tropicamide. Once the eyes are sufficiently dilated, proceed to the laser procedure.

[0151] Adjust the mouse's position on the mouse stage to achieve an ideal configuration for visualizing the optic nerve. Orient the mouse over its holder and lay it horizontally so that it is perpendicular to the slit lamp beam, with its head on one side and its tail on the other.

[0152] Rotate the mouse slightly so that its head is closer to the laser operator, at an angle of approximately 170°.

[0153] After positioning the mouse ideally, place one drop of artificial tear on a 25mm x 25mm glass coverslip. Place one drop of artificial tear on the mouse's other eye—this ensures the eye is properly lubricated and helps delay cataract formation.

[0154] Hold the corner of the coverslip between your thumb and index finger; position the glass so that it is compressed between the tips of both fingers. Gently wrap the remaining three fingers around the animal's body for support and hand stabilization. Position your hand so that the glass coverslip can be easily placed over the mouse's eye. Once a stable position is achieved, carefully press the glass coverslip over the mouse's eye (with the artificial tear droplet still attached). Ensure the coverslip is positioned as perpendicular as possible to the laser beam to prevent scattering or reflection of the laser beam. The coverslip acts as a contact lens to flatten the cornea. Switch focus by looking freehand through the slit lamp until the retina can be visualized. The retina will be pale yellow / red depending on the visualized location, and distinct red blood vessels may be visible. Slowly and carefully manipulate the mouse's head and / or the coverslip until the optic nerve is visualized. The optic nerve will be yellow, with multiple blood vessels radiating from it. Once the operator confirms visualization of the optic nerve, turn on the laser focused beam. Once the laser beam is turned on, move the focused laser beam to the desired position (approximately 1 disk diameter from the optic nerve). Focus the laser beam to the RPE in the fundus. Proper focusing is achieved by having the sharpest and clearest laser beam. If the aiming beam appears elliptical or out of focus, switch the focus of the slit lamp or reposition the glass coverslip. Once the aiming beam is focused to the RPE, start laser projection using the laser's foot trigger. Note the appearance of bubbles immediately after laser projection. The outline of the laser shot should be clear and never blurred. Repeat the previous three steps for all desired CNV positions (typically at the 3, 6, 9, and 12 o'clock positions around the optic nerve).

[0155] Record the location and result of each laser shot, as well as the result of each shot on the eye (success, blur, bleeding, etc.), in a notebook. Ensure the laser is in standby mode when not in use. Repeat all previous steps for the other eye of the mouse, using the other hand and a new coverslip for stabilization as needed. Turn off the laser and slit lamp after all desired laser shots have been fired.

[0156] Discard the coverslip and place the mouse in a warming chamber for recovery from anesthesia. Acroscopically inspect for injuries and add one drop of artificial tear to keep the eye moist and potentially prevent future cataracts. Once the mouse has recovered from anesthesia, return it to its cage.

[0157] 5-1-3. Fluorescein angiography

[0158] After removal of the cornea and lens, the eye was fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 2 hours. The posterior ocular cup of the RPE / choroidal / scleral incision was made and the vitreous humor was removed. The posterior ocular cup was incubated overnight at 4°C with (AlexaFluor647 or FITC) conjugated isolectin B4 (1:200, Invitrogen, Carlsbad, CA) to label infiltrating choroidal vessels.

[0159] 5-1-4. Expression of angiogenic factors

[0160] Cells were harvested and lysed in PBS containing 1% Triton® X-100. Equal volumes of protein were loaded into wells of an SDS-PAGE gel and transferred to a nitrocellulose membrane filter at 100V for 2 hours. The membrane was blocked at room temperature for 1 hour with PBST (phosphate-buffered saline containing Tween® 20) containing 1% BSA, and probed with anti-VEGF and anti-β-actin antibodies at room temperature for 1 hour. The membrane was washed three times with PBST and subsequently incubated with secondary antibodies at room temperature for 1 hour. After three washes with PBST, immunoreactive bands were detected. Data were quantified using ImageJ software. Example 5-2. Results

[0161] Mice treated with scAAV2-DX2 show reduced laser-induced choroidal neovascularization.

[0162] Laser-induced choroidal neovascularization (CNV) is a widely used animal model for wet AMD. In this model, a laser is used to disrupt Bruch's membrane, allowing underlying choroidal vessels to invade and grow in the space beneath the pigment epithelium. Male C57BL / 6 mice (n=12) at 5 weeks of age were subretinally injected with scAAV2-GFP (control) or scAAV2-DX2 (day 0). Twenty-one days after injection, CNVs were induced by laser photocoagulation (day 21). Fourteen days after laser treatment, fluorescein angiography and ICG angiography were performed (day 35). The following day, the mice were sacrificed, choroidal flat mounts were prepared, and stained with (FITC)-conjugated isolectin B4 (Figure 7) (day 36). Vascular leakage caused by new angiogenesis was clearly observed at the laser-induced photocoagulation sites by fluorescein angiography. Choroidal angiography was obtained using ICG angiography. The presence and area of ​​clearly defined isolectin-positive CNVs were assessed using flat mounts. Injection with DX2 showed a reduction in vascular leakage on fluorescein angiography compared to GFP-injected controls (Figure 7). Similarly, mice injected with DX2 showed a reduction in CNV area on ICG angiography compared to mice injected with GFP (Figure 7). In addition, choroidal flat mounts stained with isolectin-B4 demonstrated a significant reduction in the CNV-forming area in mice injected with DX2 (Figure 7).

[0163] The ratio of leakage area to CNV area was estimated by measuring the total hyperfluorescence area using fluorescein angiography (FA) and the CNV area using ICGA (Figure 8). The mean CNV area of ​​the Bruch membrane using isolectin B4 staining was also significantly smaller in mice injected with DX2 compared to GFP controls (n=12) (Figure 8). Based on these results, DX2 had a prophylactic effect in the CNV mouse model.

[0164] Inflammatory cells, particularly macrophages, have been histologically demonstrated near / within AMD lesions, including Bruch's membrane disruption, RPE atrophy, and CNV areas. Macrophages in CNV lesions have been shown to secrete pro-angiogenic factors such as VEGF and pro-inflammatory cytokines such as TNF. In Figure 8, the number of inflammatory cells in mice injected with DX2 is significantly lower compared to GFP-controlled CNV cells.

[0165] Excessive levels of vascular endothelial growth factor (VEGF) cause abnormal submacular vascular growth and leakage, leading to irreversible loss of central vision. In this context, much effort has been made to develop VEGF-targeted anti-angiogenic therapies for the treatment of wet AMD. These drugs have been shown to improve vision by slowing the progression of AMD and, in some cases, suppressing angiogenesis. Here, we pre-treated laser-induced choroidal neovascular mice with DX2 and compared their VEGF expression to that of mice treated with GFP (n=6) (Figure 9). Interestingly, mice treated with DX2 showed lower expression compared to mice treated with GFP. This data also demonstrated the prophylactic effect of DX2 on CNV model mice. Example 6. Dry AMD Mouse Model

[0166] material and method

[0167] 6-1. Animal Experiments

[0168] In dry AMD mouse model experiments, Mdm1- / -(CRISPR / Cas9 KO) mice exhibit progressive photoreceptor and RPE degeneration for both dry AMD and hereditary retinal degeneration. Animals were housed in individual cages under specific pathogen-free conditions and constant environmental conditions (temperature 21°C–23°C, humidity 50–60%, and 12-hour light / dark cycles). Injection of AAV2-DX2 and a negative control (AAV2-GFP) into the subretinal space was performed at 3 weeks of age. Histological measurements of the retina and functional recovery were performed at 3 months of age.

[0169] 6-2. Therapeutic effects of DX2 on dry AMD and retinal degeneration

[0170] Three-week-old Mdm1- / - mice were injected with 4 μl of AAV2-DX2 / AAV2-GFP into the subretinal space via transscleral injection using a 38G sterile microtip needle (INCYTO, KR) to minimize retinal damage. AAV2-GFP / DX2 was injected into the same animals. AAV2-GFP was injected into the OS (left). AAV2-DX2 was injected into the OD (right).

[0171] 6-2-3. Electrophysiological Functional Assessment

[0172] Three-month-old mice were used. For final measurement, wild-type (n=11), mdm1- / - (n=6), mdm1- / -(AAV2+GFP) (n=6), and mdm1- / -(AAV2+DX2) (n=7) were evaluated.

[0173] For electroretinography to evaluate photoreceptor function, OcuScience® HMsERG was used. Mice were anesthetized with aveltin (1%), anesthesia was maintained with 3% isoflurane inhalation, and they were placed on a heated pad to maintain physiological conditions. One drop of 2% hypromellose was placed on a rodent contact lens with a silver-embedded suture electrode to maintain contact with the cornea and keep it moist. For darkness and uniform illumination of the eye, the mice were placed in a 76 mm diameter Ganzfeld dome. Measurements were performed according to the ISCEV-Extended full-field ERG standard protocol. Data were analyzed using ERGVIEW at 3000 mcd.s / m 2 Combined standard Rod & Cone response values ​​were selected for analysis at a flash intensity of 0.10 Hz. Wave a analysis was performed for the function of photoreceptor cells. Wave b analysis was performed for the function of bipolar and horizontal cells. Wave a and wave b amplitude and latency values ​​were analyzed.

[0174] 6-2-4.Histological measurement

[0175] After ERG, all mice were euthanized and their eyes were collected. The eyes were fixed overnight in 4% PFA at 4°C. The eyes were dehydrated with 30% sucrose and embedded in OCT compound for tissue freezing sections. All retinal freezing section samples were obtained from the optic nerve, including 10 μm thick sections.

[0176] Frozen sections of the retina were analyzed. Hemofluorescence and fluorescein (H&E) were used for thickness analysis. Thickness analysis was performed using the Leica LAS program. Immunofluorescence was used for RPE65 and opsin expression, as well as for proliferation assessment (Ki67). Immunofluorescence ROI sets and overlap coefficient measurements were measured in Image J.

[0177] 6-2-5.Statistical analysis

[0178] Student's t-test was used for the primary analysis. P-values ​​were compared to mdm1- / -(AAV2+DX2). For recovery assessment, P-values ​​were compared to the wild type. Rubin's test of homogeneity of variances, ANOVA, and post-hoc (Dunnett (T3), Tukey HSD) assessments were performed on all data using IBM SPSS Statistics 23.

[0179] 6-2-6.Results

[0180] Figure 10 shows a cross-sectional histological view (H&E staining) of the retina.

[0181] Figures 11A–11E show histological measurements of retinal thickness. Figure 11A shows the thickness of the retina. Figure 11B shows the thickness of the RPE (retinal pigment epithelium). Figure 11C shows the thickness of the ONL (outer granular layer of photoreceptors). Figure 11D shows the thickness of the outer segment. Figure 11E shows the thickness of the OPL (outer plexiform layer). All samples were obtained from sections containing optic nerve with a thickness of 10 μm. Transfection of the DX2 gene into the retina resulted in recovery of the total thickness of the neuroretina (Figure 11A). Transfection of DX2 showed a thicker RPE layer (Figure 11B) and outer segment layer of photoreceptors (Figure 11C), suggesting that DX2 expression prevents RPE degeneration and ciliary degradation of photoreceptors. Transfection of DX2 also showed a thicker outer granular layer of photoreceptors (Figure 11D) and outer plexiform layer (Figure 11E), indicating that DX2 expression reduces photoreceptor degeneration.

[0182] Figure 12 shows the integrity and proliferation of RPE (retinal pigment epithelium). Transfection with the DX2 gene resulted in the recovery of RPE integrity by activating RPE proliferation.

[0183] Figure 13 shows the recovery of PR (photoreceptor). Transfection of the DX2 gene resulted in the recovery of the PR population by activating PR proliferation.

[0184] Figures 14A and 14B show the cell proliferation of RPE and PR. Ki67 expression was measured to analyze the proliferation of RPE and the photoreceptor layer. Proliferation of RPE (Figure 14A) and the outer segment layer of the photoreceptor (Figure 14B) was significantly higher in samples transfected with AAV2-DX2.

[0185] Figures 15A–15D show functional recovery of the retina. Transfection with AAV2-DX2 showed increased a-wave amplitude (Figure 15A) and decreased latency (Figure 15B) compared to the dry AMD model (mdm1- / -) or negative control (mdm1- / -+AAV-GFP), indicating that DX2 expression mitigates electrophysiological function of photoreceptors and damage to visual acuity. Samples transfected with AAV2-DX2 did not show changes in b-wave amplitude compared to the dry AMD model (mdm1- / -) (Figure 15C), but showed reduced latency (Figure 15D). This suggests that DX2 affects only RPE and photoreceptors, and not bipolar cells (post-photoreceptor neurons).

[0186] Electroretinograms of samples transfected with AAV2-DX2 showed increased regrowth of the normal ERG graph format (Figures 15A and 15B). Samples transfected with AAV2-DX2 showed a slight increase in wave a amplitude (Figure 15C) and a decrease in latency (Figure 15D) compared to the dry AMD model (mdm1- / -), indicating that DX2 expression mitigates damage to the electrophysiological function of photoreceptors. Samples transfected with AAV2-DX2 did not change the amplitude of wave b (Figure 15E), but showed a decrease in latency compared to the dry AMD model (mdm1- / -) (Figure 15F).

[0187] References KR10-1067816(2011). Telegina, DV, OS Kozhevnikova, and NG Kolosova. "Molecular mechanisms of cell death in retina during development of age-related macular degeneration." Advances in Gerontology 7.1 (2017): 17-24. Hernaendez-Zimbroen, Luis Fernando, et al. "Age-related macular degeneration: new paradigms for treatment and management of AMD." Oxidative medicine and cellular longevity 2018 (2018). Du, Hongjun, et al. "JNK inhibition reduces apoptosis and neovascularization in a murine model of age-related macular degeneration." Proceedings of the National Academy of Sciences 110.6 (2013): 2377-2382. Brown et al., Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer, Nature Med. 12:585-591 (2006). Brown et al., Endogenous microRNA can broadly exploited to regulate transggene expression acording to tissue, lineage and diffferentiation state, Nature Biotech. 25:12457-1467 (2007).

[0188] The foregoing description of specific embodiments is sufficient to illustrate the general nature of the invention, and others can readily modify and / or adapt it for various applications by applying their knowledge of the art without departing from the general concept of the invention. Such adaptations and modifications are therefore intended to be within the meaning and scope of equivalents of the disclosed embodiments, based on the teachings and guidance presented herein. It should be understood that the expressions or terms herein are for illustrative purposes only, and not limiting, so that they may be interpreted by those skilled in the art in light of the teachings and guidance herein.

[0189] The breadth and scope of the present invention should not be limited by any of the exemplary embodiments described above, but should be defined solely in accordance with the following claims and their equivalents.

[0190] All of the various aspects, embodiments, and options described herein can be combined in any and all possible variations.

[0191] All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference.

Claims

1. A composition for treating age-related macular disease (AMD) in a subject in need of such treatment, comprising a pharma- tically effective amount of a recombinant vector comprising an exon 2 deleted AIMP2 variant (AIMP2-DX2) gene.

2. The composition of claim 1 , wherein the AMD is wet AMD.

3. The composition of claim 1 , wherein the AMD is dry AMD.

4. The composition according to any one of claims 1 to 3, wherein the vector further comprises a miR-142 target sequence.

5. The composition according to any one of claims 1 to 4, wherein the vector further comprises a promoter operably linked to the AIMP2-DX2.

6. The composition of claim 5, wherein the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, a synapsin promoter, a MeCP2 promoter, a CaMKII promoter, an Hb9 promoter, or an opsin promoter.

7. The composition according to any one of claims 4 to 6, wherein the miR-142 target sequence is 3' to the AIMP2-DX2 gene.

8. The composition of any one of claims 1 to 7, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

9. The composition of claim 8, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, 13, 14, 15, 16, 17, 18, 19, or 20.

10. The composition according to any one of claims 1 to 9, wherein the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11.

11. The composition according to any one of claims 1 to 10, wherein the AIMP2-DX2 gene does not have an exon containing a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10 or 11.

12. The composition of any one of claims 4 to 11, wherein the miR-142 target sequence comprises ACACTA.

13. The composition of claims 4 to 11, wherein the miR-142 target sequence comprises ACACTA and 1 to 17 additional consecutive nucleotides of SEQ ID NO:

5.

14. The composition of any one of claims 4 to 11, wherein the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA).

15. The composition of claim 14, wherein the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:

5.

16. The composition of any one of claims 4 to 11, wherein the miR-142 target sequence comprises ACTTTA.

17. The composition of claims 4-11, wherein the miR-142 target sequence comprises ACTTTA and 1 to 15 additional consecutive nucleotides of SEQ ID NO:

7.

18. The composition of any one of claims 4 to 11, wherein the miR-142 target sequence comprises a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG).

19. The composition of claim 18, wherein the miR-142 target sequence comprises the nucleotide sequence of SEQ ID NO:

7.

20. The composition according to any one of claims 4 to 19, wherein the miR-142 target sequence is repeated 2 to 10 times.

21. The composition according to any one of claims 1 to 20, wherein the vector is a viral vector.

22. 22. The composition of claim 21, wherein the viral vector is an adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), avian sarcoma / leukosis virus (ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), vaccinia virus, or herpes simplex virus vector.

23. The composition of any one of claims 1 to 22, wherein the composition is administered to the subject topically, by intravitreal injection, by subconjunctival injection, or into the subretinal space of the subject.

24. A composition described in any one of claims 1 to 23, characterized in that the composition is administered to the subject in combination with an additional therapeutic agent.

25. 25. The composition of claim 24, wherein the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab.

Images