Peptides and other agents for treating pain and increasing pain sensitivity

Abstract

To provide peptides that can be used to treat pain or increase pain sensitivity in a subject in need of treatment, and compositions comprising peptides.SOLUTION: The present invention provides a peptide consisting of 15 amino acids with a specific sequence. The peptide has proline, tyrosine, and valine at the 7th, 9th, and 12th positions, respectively, with amino acids selected from specific amino acids at other positions, and undergoes acylation at specific locations. The peptide of the present disclosure can be administered with an analgesic agent and / or anesthetic agent. The peptide of the present disclosure is suitable for use when a subject in need of treatment has an injury, a chronic disease, a chronic inflammation, Morton's neuroma, operative / post-operative pain, or a combination thereof.SELECTED DRAWING: None

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 62 / 598,067, filed December 13, 2017, the disclosure of which is incorporated herein by reference.

[0002] This invention was made with Government support under Grant No. NS078184 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]

[0003] Nociceptive neurons possess a specific subset of voltage-gated sodium channels (Navs) that allow nerve cells (neurons) to respond uniquely to noxious and inflammatory stimuli. Thus, current strategies for the development of new analgesics rely on targeting nociceptor-specific sodium channels. For example, the Nav1.8 channel (SCN10A) has unique biophysical properties that allow nociceptive neurons to repeatedly fire action potentials (APs) under compromised conditions associated with tissue injury. This has led to clinical trials of Nav1.8 channel-specific blockers for pain relief. Because the channels also traffic to membranes during inflammatory signaling, an alternative approach to affect Nav1.8 channel function is to disrupt their trafficking. However, the exact molecular mechanisms that control Nav1.8 channel trafficking are not fully understood, and thus specific agents targeting Nav1.8 remain unknown.

[0004] There is a continuing need to develop agents that act on Nav1.8 channels to increase or decrease pain sensitivity in a subject. Summary of the Invention

[0005] The present invention provides peptides, compositions, and methods of using these peptides and / or compositions for treating pain, inducing analgesia, or increasing pain sensitivity. Additionally, the present disclosure provides methods of treating pain or inducing local analgesia by administering Magi-1 (Membrane-Associated Guanylate Kinase 1) targeting shRNA, or Magi-1 targeting siRNA. The present disclosure further provides peptides for use as research tools. The use of peptides having sequences of SEQ ID NOs: 1-35, Magi-1 targeting shRNA, or Magi-1 targeting siRNA will reduce or eliminate the need for narcotics to combat pain.

[0006] In one aspect, the disclosure provides a peptide comprising or consisting of the following sequence: X 1 X 2 X 3 X 4 X 5 X 6 PX 7 YX 8 X 9 VX 10 X 11 X 12 (SEQ ID NO: 75), Where X 1 is S, P, or A; X 2 is T, S, or A; X 3 is A or T; X 4 is A, T, I, or S; X 5 is C, S, or F; X 6 is P or L; X 7 is any amino acid residue, X 8 is E, D, or Y; X 9 is S or R; X 10 is T, A, E, or D, and T may be phosphorylated; X 11 is K or R; and X 12 is P, A, or G, and where X 1 , X2 , X 3 , X 9 , X 10 , X 11 or a combination thereof is acylated (For example, the following structure TIFF2024026109000001.tif16169, where n is 4 to 18 (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18). In further embodiments, the acyl group (e.g., the structure TIFF2024026109000002.tif16169 is a myristoyl group.

[0007] In one aspect, the present disclosure also provides a pharmaceutical composition comprising a pharma- ceutical carrier, a peptide of the present disclosure, optionally a Magi-1 targeting shRNA or Magi-1 targeting siRNA, and optionally one or more analgesics (e.g., non-steroidal anti-inflammatory drugs (NSAIDS)) and / or one or more anesthetics. Non-limiting examples of analgesics or anesthetics include bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or combinations thereof. Further examples of analgesics include acetaminophen, aspirin, ibuprofen, naproxen, and the like, and salts thereof. Using techniques and carriers known to those skilled in the art (e.g., Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, PA. Lippincott Williams & Wilkins), the compositions can be formulated as intramuscular, intradermal, intrathecal or nerve injections, topical creams or transdermal patches.

[0008] In one aspect, the peptides of the present disclosure or compositions thereof are used to alter (e.g., increase or decrease) the pain sensitivity of a subject (e.g., a subject in need of treatment for pain and pain sensitivity). In one example, the subject's pain is reduced (e.g., ameliorated) when the pain sensitivity of the subject is decreased. In another example, the subject's pain sensitivity is increased. In one example, the peptides of the present disclosure, compositions thereof, Magi-1 targeting shRNA, or Magi-1 targeting siRNA are used for pain management (e.g., pain control).

[0009] In one aspect, the present disclosure provides a method for inducing local analgesia in a subject, comprising administering to the subject an analgesic amount (e.g., a therapeutically effective amount) of a composition comprising a peptide having any one of the sequences of SEQ ID NOs: 1-7 or 15-21, a Magi-1 targeting shRNA, or a Magi-1 targeting siRNA.

[0010] The present disclosure further provides a method for increasing pain sensitivity in a subject, comprising administering to the subject a composition comprising a peptide having any one of SEQ ID NOs: 8-14 or 21-35 in an amount effective to increase pain sensitivity.

[0011] In one aspect, the present disclosure further provides peptides of SEQ ID NOs: 36-70 for use as research tools. As such, they can be administered to research subjects (e.g., mice and rats). The peptides are also useful for in vitro testing. [Brief description of the drawings]

[0012] For a fuller understanding of the nature and objects of the present disclosure, reference should be made to the following detailed description taken in conjunction with the accompanying drawings, in which:

[0013] [Figure 1] Figure 1 shows that the PDZ binding motif is Na 4 shows how channel expression is regulated. (A) Amino acid alignment of the distal C-terminus from orthologous Slack subunits (Xenopus, chicken, rat, human Slack) and the rat Slick subunit. The last four evolutionarily conserved amino acids (ETQL) (SEQ ID NO: 112) (long and short dashed lines on the C-terminus) represent a consensus type 1 PDZ motif (XS / TXV / L / I). (Bold box indicates AP-2 binding site; dotted box indicates putative PKA phosphorylation site; dashed box indicates putative PKC phosphorylation site.) (B) Representative current traces of Slack and mutant Slack channels (Mut) (in which the PDZ motif is truncated) recombinantly expressed in CHO cells with or without Magi-1 (top). Current density analysis for each experimental condition (bottom). For each experimental condition, currents from 20-25 cells were analyzed and values ​​are expressed as + / - SEM. *p<0.05 vs. respective control. (C) Co-immunoprecipitation assay of Magi-1 with wild-type and Slack mutants carrying a truncated PDZ motif. Truncation of the Slack PDZ motif prevented co-immunoprecipitation with Magi-1. (D) Representative immunoblots of surface biotinylation assays from CHO cells co-expressing Magi-1 and Slack or expressing Slack alone (left). Quantification of surface Slack expression is shown on the right (t6=4.276, *p<0.0129, n=4 per group, two-tailed t-test). Data were normalized to input to account for transfection efficiency. (E) Double immunolabeling experiment showing overlapping expression between Magi-1 and Slack, and between F.Magi-1 and Slick, when expressed in CHO cells. (F) Representative immunoblot of a co-immunoprecipitation assay between Magi-1 and Slack from intact DRG neurons from adult mice. (G) Double immunolabeling experiments showing colocalization between Magi-1 and Slack in cultured DRG neurons (top panel) and intact DRG neurons (bottom panel). Scale bar, 50 μm. The superficial layer of the spinal cord is at the bottom. Scale bar represents 50 μm. (H) Co-IP showing Magi-1 / Slack interaction in mouse DRG. DRG lysates were immunoprecipitated with either Magi-1 or Slack antibodies and immunoblotted with Slack or Magi-1 antibodies. This experiment was repeated at least three times. (I) Top, representative current-clamp traces of neurons treated with PDZ peptide derived from the Slack C-terminus. Scrambled peptide B (myristoyl-QPNTRLDETE) (sequence number 113) (23 / 23) (top left) and untreated neurons (17 / 17) (top center) fired one action potential followed by firing adaptation during suprathreshold stimulation (400 pA) for 1000 ms. Neurons treated with PDZ peptide showed repetitive firing (11 / 21) (top right). Surface biotinylation shows reduced Slack surface expression after 24 h of PDZ peptide incubation compared to scrambled peptide B in DRG neurons (bottom left). Quantification of surface Slack expression (bottom right). (n=3) *p<0.05 one-way ANOVA.

[0014] [Figure 2] FIG. 2 shows that Magi-1 regulates Slick channels in CHO cells. (A) Representative current traces of recombinantly expressed Slick currents with or without Magi-1 in CHO cells (top). (bottom) Current density analysis of Slick currents for each condition. 25 cells were analyzed and values ​​are expressed as + / - SEM. *p<0.05 vs. respective control. (B) Immunoblot showing increased Slick protein expression during co-expression with Magi-1. Results from three independent cultures and values ​​are expressed as mean + / - SEM (t4=6.152, **p<0.0021, n=3 cultures per group, two-tailed t-test). (C) Immunolabeling of recombinant Slick channels and Magi-1 when expressed alone or in combination in CHO cells. (D) Co-immunolabeling of recombinant Slick channels and Magi-1 when expressed in CHO cells.

[0015] [Figure 3] FIG. 3 shows that Magi-1 knockdown reduces ionic currents and excitability in DRG neurons. (A) Representative Magi-1 immunolabeling from cultured DRG neurons 3 days after transfection with Magi-1-targeting siRNA and non-targeting scrambled siRNA (left) was performed using a previously validated polyclonal Magi-1 antibody. Quantification of Magi-1 immunoreactivity is shown on the right. Integrated fluorescence intensity was calculated as the product of area and mean pixel intensity using Metamorph software (Molecular devices). For each experimental condition, values ​​from four independent DRG neuron cultures were analyzed and values ​​are expressed as mean + / - SEM (ANOVA, F (2,11) = 32.25, p < 0.0003, ***p < 0.001 versus respective controls). (B) Representative immunoblot showing Magi-1 expression after siRNA-mediated Magi-1 knockdown. Magi-1 antibodies typically detect multiple splice variants, as indicated by the multiple bands observed in Western blots. Quantification of Magi-1 knockdown in DRG neurons (right). For each experimental condition, three different cultures were analyzed and values ​​are expressed as mean + / - SEM (ANOVA, F (2,6) =42.94, p=0.0003, ***p<0.001 versus respective controls). (C) Representative immunoblots of surface biotinylation from DRG neurons after Magi-1 knockdown (left). Quantification of Slack channel surface expression is shown on the right. Three independent cultures were analyzed and values ​​are expressed as mean + / - SEM (ANOVA, F (2,6) = 10.84, p = 0.0102, ** p < 0.01 (vs. respective controls). (D) I in DRG neurons after Magi-1 knockdown K A typical current trace (top) of 11- ~12 neurons / experimental condition were analyzed and values ​​are expressed as mean + / - SEM. *p=<0.05 (E) Representative AP firing from neurons following siRNA-mediated Magi-1 during suprathreshold current stimulation (400 pA) for 1000 ms. 12 / 12 non-transduced (10 / 10), scrambled DRG neurons fired one AP, whereas 12 / 18 neurons transfected with Magi-1 siRNA did not fire a single AP.

[0016] [Figure 4] FIG. 4 shows that Magi-1 knockdown reduces Nav1.8 plasma membrane expression. (A) Total I in cultured DRG neurons 3 days after transfection with Magi-1-targeting siRNA or non-targeting scrambled siRNA. Na and TTX resistance I Na Representative whole-cell voltage-clamp current traces of . (B) I under different conditions Na Current density analysis of currents. Sodium currents in neurons were recorded either in the presence or absence of 25 nM TTX. Total I Na and TTX resistance I Na was significantly decreased after siRNA-mediated Magi-1 knockdown in cultured DRG neurons. A total of 9–12 cells / experimental group were analyzed and values ​​are expressed as the mean + / - SEM. (C) Peak I after Magi-1 knockdown Na and TTX resistance peak I Na Quantification of (voltage step -20 mV). 9-12 cells / experimental group were analyzed and values ​​are expressed as mean + / - SEM. F(3,26)=66.24, P<0.0001, *P<0.0106, ***p<0.001 versus respective controls (scrambled siRNA with or without TTX). (D) Representative immunoblot from a surface biotinylation experiment of DRG neurons showing a decrease in Nav1.8 surface expression after Magi-1 knockdown (left). Quantification of Nav1.8 surface expression is shown on the right. For quantification, four independent DRG cultures per experimental condition were analyzed and values ​​are expressed as + / - SEM (ANOVA, F (2,6)= 7.319, p = 0.0246, *p < 0.05 (vs. respective controls).

[0017] [Figure 5] FIG. 5 shows that Magi-1 is expressed in DRG neurons, spinal cord, sciatic nerve and at the nodes of Ranvier. (A) Representative immunoblots showing Magi-1 expression in intact DRG (left) and spinal cord (right). (B) Immunolabeling images showing Magi-1 expression in cultured DRG neurons (panel 1), DRG cross-sections (panels 2 and 3) and spinal cord (panels 4 and 5) using a previously validated monoclonal antibody. Panel 4 shows control immunolabeling stained with secondary antibody only. Dapi labels all nuclei of cells. Scale bar, 50 μm. (C) Double immunolabeling showing Magi-1 and the paranodal marker Caspr in sciatic nerve cross sections (top). Scale bar, 50 μm. Arrows indicate Magi-1 labeling at the nodes of Ranvier. Bottom, inset shows a higher magnification image of Magi-1 immunoreactivity at the nodes of Ranvier. Scale bar, 10 μm. (D) Frequency distribution of Magi-1 in intact DRG neurons of various soma sizes. A total of 735 neurons from 4 mice were analyzed (left: all neurons, right: Magi-1 positive neurons in each series).

[0018] [Figure 6] Figure 6 shows that Magi-1 inhibits Nav1.8 and Slack K channels in DRG neurons. Na This indicates that the channel is to be combined. (A) Representative whole immunoblot from a co-immunoprecipitation (Co-IP) assay using intact adult DRG tissue demonstrating binding between Magi-1 and Nav1.8. IP product samples were run in duplicate. The polyclonal Magi-1 antibody also recognized a 50 kDa band during blotting that was likely a degradation product (as described by the manufacturer). (B) Double immunolabeling experiments revealed that Magi-1 and Na V 1.8 demonstrated similar localization. Scale bar, 50 μm (C) Slack and Na from intact adult DRG neurons. V Representative immunoblot of Co-IP between 1.8. (D) CoIP showing the interaction between Magi-1 and Nav1.8 in mouse DRG. DRG lysates were immunoprecipitated with either anti-Magi-1 (left) or anti-Nav1.8 (right) antibodies and immunoblotted with anti-Nav1.8 or anti-Magi-1 antibodies as indicated. This experiment was repeated at least three times. (E) Double immunolabeling showing colocalization of Slack and Nav1.8 in intact DRG neurons. Scale bar represents 20 μm.

[0019] [Figure 7] FIG. 7 shows that in vivo Magi-1 knockdown attenuates thermal pain sensation (thermal nociception) and acute inflammatory pain behaviors. (A) Experimental timeline before and after Magi-1 knockdown (in vivo). (B) Hargreaves test for thermal nociception showed increased paw withdrawal latency in ipsilateral paws injected with Magi-1 targeting shRNA when compared to contralateral paws. No significant differences in paw withdrawal latency were observed between paws in mice injected with non-targeting shRNA. The behavior of 9 different animals (3 females, 6 males) per experimental condition was observed and analyzed. Values ​​are expressed as mean + / - SEM. ***p<0.001 vs. respective control. (C) Difference in withdrawal latency between ipsilateral and contralateral paws up to 3 s was measured after in vivo transfection with Magi-1 shRNA (days 7, 11, and 15) by score difference analysis. *p<0.05 vs. control. Values ​​are expressed as mean + / - SEM. (D) Formalin-induced phase II inflammatory pain, measured by three nocifensive behaviors (paw licking, lifting, and whole body flinches) each at 5 min intervals, was reduced in mice injected with Magi-1 targeting shRNA after 15 days compared to controls. The behavior of nine different animals (n=9) per experimental condition was analyzed and values ​​are expressed as mean + / - SEM. (ANOVA, licking: F (1,16) = 7.545, p = 0.0143, Lifting: F (1,16) = 11.67, p = 0.0035, flinching: F (1,16) =5.007, p=0.0398, *p<0.05, **p<0.01 (vs. respective controls). In each series, the left bar is "scrambled shRNA" and the right bar is "Magi-1 shRNA." (E) Representative Magi-1 immunolabeling in DRG cross sections obtained from one mouse injected with Magi-1-targeting shRNA (bottom left) compared with one mouse injected with non-targeting scrambled shRNA (top left). Magi-1 immunoreactivity was significantly reduced in the ipsilateral paw of mice injected with Magi-1 shRNA compared with the contralateral paw (right side). No significant changes in immunoreactivity were observed in mice injected with non-targeting scrambled shRNA. DRGs from three different animals were analyzed and values ​​are expressed as mean + / - SEM (ANOVA, F (3,20) = 9.872, p = 0.0003, ** p < 0.01 versus respective controls). (F) Western blot analysis confirmed Magi-1 knockdown in DRG 15 days after in vivo transfection of Magi-1-targeting shRNA (left). Quantification of the Western blot is shown on the right. Intact DRG from three different animals were analyzed and values ​​are expressed as mean + / - SEM (ANOVA, F (3,8) =5.161, *p=0.0282, *p<0.05 (vs. respective controls).

[0020] [Figure 8] FIG. 8 shows the reduction of Nav1.8 expression following Magi-1 knockdown in vivo. (A) Representative immunolabeling of sciatic nerves showing Nav1.8 expression in paws injected with non-targeting shRNA (after 15 days) (top), Nav1.8 expression at the nodes of Ranvier was detected using the paranodal marker Caspr. Boxed areas are shown below as high magnification images of Nav1.8 and Caspr immunoreactivity. Bottom: Nav1.8 immunoreactivity was absent in sciatic nerves and paw nodes injected with Magi-1 targeting shRNA (after 15 days). (B) Representative immunoblots of Nav1.8 expression from ipsilateral and contralateral DRG lysates of mice injected into the sciatic nerve with non-targeting Magi-1 shRNA (scrambled) or Magi-1 targeting shRNA. Representative blots shown for each condition are from the same mouse. Quantification of Nav1.8 expression is shown on the right. Lumbar DRG from three different animals were analyzed and values ​​are expressed as + / - SEM. *P<0.05 vs. representative control. (C) Western blot analysis showing the reduction of Nav1.8 expression after Magi-1 knockdown in vivo (left). Quantification of the Western blot is shown on the right (*p<0.05; one-way ANOVA, n=3).

[0021] [Figure 9] FIG. 9 shows that cell-permeable WW motif peptidomimetics alter neuronal excitability and affect pain behavior. (A) Representative voltage-clamp recordings of I in cultured DRG neurons after 24 h pretreatment with a peptidomimetic named "PY peptide." Na (arrow), whereas phospho-PY peptides are reduced in I Na (Top) Representative AP traces from cultured DRG neurons pretreated for 24 h with PY peptide or phospho-PY peptide during a 1000 ms suprathreshold stimulus (400 pA) (Bottom). (B) Peak I in DRG neurons with different peptide treatments Na (voltage step -20 mV). Neurons were treated with PY peptide or phospho-PY peptide for 6 or 24 h. 10-12 DRG neurons / experimental condition were analyzed and values ​​are expressed as mean + / - SEM. ANOVA, F (4,35) =19.11, P<0.0001, *P<0.05, ***p<0.001 (vs. respective controls) (C) Nav1.8 protein expression was altered after peptidomimetic treatment. Representative Western blots (left) of total and surface Nav1.8 membrane expression after 24 h treatment of DRG neurons with PY peptide, phospho-PY peptide, or scramble. Quantitation of the Western blots is shown on the right. Treatment with PY peptide significantly increased total and surface Nav1.8 expression compared to scrambled peptide. V Both resulted in a significant decrease in Nav1.1.8 expression. The phospho-PY peptide increased surface expression of Nav1.8 compared to the scrambled peptide. Data from three independent cultures were analyzed and values ​​are expressed as mean + / - SEM. *p<0.05, **p<0.01 vs. control; #p<0.01 vs. phospho-PY peptide. (D) Phase II formalin inflammatory pain was measured by nocifensive behaviors (paw licking (left), lifting (middle) and whole body flinching (right)) at 5 min intervals, which was reduced by intraplantar pretreatment (24 h) with 100 μM (20 μl) PY peptide, whereas phospho-PY peptide increased the nocifensive behavioral response compared to scrambled peptide control. Peptides were administered 24 h before formalin injection (5%, μl). Behaviors from 6 different animals per experimental condition were analyzed and values ​​are expressed as mean + / - SEM. *p<0.05, **p<0.01 vs. control, #p<0.05, #p<0.01 vs. phospho-PY peptide. (E) Magi-1 constitutes the sodium signalosome in DRG neurons. Slack K NaThe channel was previously shown to be internalized by adaptin 2-dependent clathrin-mediated endocytosis: AP-2-adaptin complex, CL-clathrin, ubiquitin ligase.

[0022] [Figure 10] Figure 10 shows additional images of neurons treated with scrambled siRNA and Magi-1 siRNA. Transfection of scrambled siRNA (upper panel) and Magi-1 siRNA (lower panel) in cultured DRG neurons was generally non-cytotoxic, and the same number of neurons was used for quantitative immunofluorescence analysis.

[0023] [Figure 11] FIG. 11 shows that Magi-1 knockdown DRG neurons have altered AP properties. (A) Representative traces of increasing current injections used to evoke APs. Magi-1 knockdown evoked stepwise potentials rather than the typical arrhythmic APs. (B) AP height measurements in untreated (n=10), scrambled siRNA (n=12), and Magi-1 siRNA (n=18) neurons. Corresponding rheobase measurements: untreated neurons 211+ / -27 pA; scrambled siRNA 142+ / -24 pA; Magi-1 siRNA 583+ / -76 pA p<0.05 vs. siRNA control (ANOVA). Input resistances for untreated and scrambled siRNA-treated neurons ranged from 200-300 MΩ, and for Magi-1 siRNA-treated neurons ranged from 400-500 MΩ. AP amplitudes were analyzed for these experimental conditions and values ​​are expressed as mean+ / -SEM. (ANOVA, F (2,32) =39.64, p<0.001, *p<0.0001 versus respective controls.

[0024] [Figure 12] FIG. 12 shows in vivo knockdown of Magi-1. (A) Time course of inflammatory pain response following 5% formalin injection from the entire cohort (6 males, 3 females). No animals were excluded. Nocifensive behavior was measured over 60 min in mice injected with Magi-1 shRNA or control shRNA. Formalin injection produced a biphasic response typical of this model for inflammatory pain. Mice injected with shRNA showed a significant reduction in phase II (10–60 min) inflammatory pain. (B) Non-quantitative qRT-PCR confirmed the reduction of Magi-1 RNA in the ipsilateral paw injected with Magi-1 shRNA compared with the contralateral paw of the same mice and with animals injected with control shRNA. (C) No changes in Nav1.8 transcripts were observed in the ipsilateral paw injected with Magi-1 shRNA compared with the contralateral paw of the same mice and with animals injected with control shRNA.

[0025] [Figure 13] Figure 13 shows evolutionarily conserved PY motifs in Nav channels. WW binding motifs in Nav channels. Sequence alignment of rat Nav channels with consensus WW binding motifs. PPSY (SEQ ID NO: 73) is the WW motif. PhosphoSitePlus on Nav1.8 channel (登録商標) Phosphoproteomic data from indicate that threonine 1924 in rats, which is threonine 1926 in mice, is phosphorylated (the third residue from the C-terminus).

[0026] [Figure 14] Figure 14 shows representative full blots for membrane biotinylation experiments: DRG neuron biotinylation; (A) Figure 3E, (B) Figure 4D, and (C) Figure 9C, and CHO cell biotinylation, (D) Figure 1E.

[0027] [Figure 15] Figure 15 shows representative complete blots for Western blot and co-immunoprecipitation assays. A: Figure 2C, B: Figure 5A, C: Figure 2B, D: Figure 6C, E: Figure 6F, F: Figure 8B

[0028] [Figure 16] FIG. 16 shows that Nav1.7 protein expression was reduced during in vivo Magi-1 knockdown, whereas surface expression was unchanged following treatment with the WW motif peptide mimetic. (A) Immunoblot of Nav1.7 expression from ipsilateral and contralateral DRG lysates of mice injected into the sciatic nerve with non-targeting Magi-1 shRNA (scrambled) or Magi-1 targeting shRNA. (B) Surface (biotinylated) Na+ after 24 h treatment of cultured DRG neurons with PY peptide, phospho-PY peptide or scrambled (left). V 1.7 Western blot of membrane expression (from two experiments). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] Although the claimed subject matter is described with respect to certain embodiments / examples, other embodiments / examples, including embodiments / examples that do not provide all of the advantages and features described herein, are also within the scope of this disclosure. Various structural, logical, and process step changes may be made without departing from the scope of the disclosure.

[0030] A range of values ​​is disclosed herein. The ranges are set forth with lower and upper limits. Unless otherwise stated, the ranges include all values ​​up to the minimum value (either the lower or upper limit) and ranges between the values ​​in the stated ranges.

[0031] Throughout this application, the singular encompasses the plural and vice versa. References cited in this application are hereby incorporated by reference. All sections of this application, including any supplementary sections or figures, are entirely part of this application.

[0032] The term "treatment" as used herein refers to a reduction in one or more symptoms or characteristics associated with the presence of the particular condition being treated. Treatment does not necessarily mean complete cure or remission, nor does it exclude recurrence or relapse. For example, treatment in this disclosure refers to reducing pain (e.g., reducing pain sensitivity) or increasing pain sensitivity.

[0033] The term "therapeutically effective amount" as used herein refers to an amount of an agent sufficient to achieve the intended purpose of treatment, in a single or multiple doses. Treatment need not lead to a complete cure, but may. Treatment can refer to the alleviation of one or more symptoms or markers of the indication. The exact amount desired or required will vary depending on the particular compound or composition used, its mode of administration, patient details, etc. An appropriate effective amount can be determined by the skilled artisan informed by this disclosure using only routine experimentation. Treatment can be performed symptomatically, for example, to suppress symptoms. It can be performed over a short period of time, over a medium period of time, or it can be a long-term treatment, for example, associated with maintenance therapy. Treatment can be continuous or intermittent.

[0034] Unless otherwise specified, nucleic acids are written left to right in 5' to 3' orientation, and amino acid sequences are written left to right in amino to carboxyl orientation. Numeric ranges described herein are inclusive of the numbers defining the range, and include each integer within the defined range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their commonly accepted single-letter codes.

[0035] Nav1.8 channels determine the depolarization phase of action potentials (APs) in nociceptive neurons. The plasma membrane localization, retention, and stability of Nav1.8 channels occur through direct interaction with a PDZ- and WW-domain containing scaffold protein called Magi-1. Furthermore, dorsal root ganglion (DRG)-specific knockdown of Magi-1 inhibits thermal and inflammatory pain, and inhibits Na V The peptides of the present disclosure induced a decrease in sodium current, a near complete loss of Nav1.8 expression, and suppression of AP firing in DRG neurons. The peptides of the present disclosure can also induce an increase in sodium current. A single intraplantar peptide mimetic injection caused a decrease in nocifensive behavior. Furthermore, Magi-1 inhibited Slack K through PDZ interactions. Na We describe that Magi-1 binds to Nav1.8 channels and forms a macrocomplex with Nav1.8 channels. These data indicate that Magi-1 is an essential scaffold for ion transport in DRG neurons and a central player in pain signaling.

[0036] In one aspect, the disclosure provides a peptide comprising or consisting of the following sequence: X 1 X 2 X 3 X 4 X 5 X 6 PX 7 YX 8 X 9 VX 10 X 11 X 12 (SEQ ID NO: 75), where X 1 is S, P, or A; X 2 is T, S, or A; X 3 is A or T; X 4 is A, T, I, or S; X 5 is C, S, or F; X6 is P or L; X 7 is any amino acid residue, X 8 is E, D, or Y; X 9 is S or R; X 10 is T, A, E, or D, where T may be phosphorylated; X 11 is K or R; X 12 is P, A, or G, and where X 1 , X 2 , X 3 , X 9 , X 10 , X 11 or a combination thereof is acylated (For example, the following structure TIFF2024026109000003.tif16169, where n is 4 to 18 (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18). In further embodiments, the acyl group (e.g., the structure TIFF2024026109000004.tif16169 is a myristoyl group.

[0037] In one embodiment, the peptides of the disclosure are acylated at the N-terminus, hi another embodiment, the peptides of the disclosure are acylated at a nucleophilic atom of an amino acid residue (e.g., the side chain oxygen atom of serine or threonine, the side chain nitrogen of lysine, etc.).

[0038] In one embodiment, X 1 is S or P, and X 1 The sequence is further acylated (e.g., myristoylated) at the N-terminal amine of the peptide sequence -X 6 PX 7 -PPX in Y-part 7 Y-, where X is any amino acid residue. 7 is S.

[0039] The present disclosure describes peptides comprising, consecutively: a) an acylated amino acid residue (e.g., TIFF2024026109000005.tif16169, where n is 4 to 18 (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18), such as myristoylated amino acid residues); b) at least one intervening amino acid residue; c) a first amino acid sequence; and d) Terminal amino acid sequence.

[0040] In one embodiment, the myristoylated amino acid residue is S, P, or A. In an embodiment for use in humans, the myristoylated amino acid residue is S or P.

[0041] In another embodiment, at least one intervening amino acid residue comprises a T, S, or A, where said T, S, or A directly (immediately) follows the myristoylated amino acid residue (i.e., proceeding from N-terminus to C-terminus). In a further embodiment, said T, S, or A is directly followed by A or T. In yet another embodiment, said A or T is directly followed by A, T, S, or I. In an embodiment for use in humans, said A or T is directly followed by A, T, or S. In a further embodiment, said A, T, S, or I is directly followed by C, S, or F. In a further embodiment for use in humans, said A, T, S is directly followed by C, S, or F.

[0042] In one embodiment, the first amino acid sequence comprises PXY, where X is any amino acid residue.

[0043] In another embodiment, the first amino acid sequence comprises UPXY (SEQ ID NO:71), where U is P or L and X is any amino acid residue.

[0044] In yet another embodiment, the terminal amino acid sequence comprises A, D, E, or an amino acid residue that can be phosphorylated and dephosphorylated. In one embodiment, the amino acid residue that can be phosphorylated and dephosphorylated is T. In a further embodiment, the amino acid residue that can be phosphorylated and dephosphorylated is phosphorylated. In yet another embodiment, the amino acid residue that can be phosphorylated and dephosphorylated is not phosphorylated.

[0045] In one embodiment, the terminal amino acid sequence comprises a D or E, wherein said D or E is directly following said first amino acid sequence. In one embodiment, said D or E is directly following R or S. In another embodiment, said R or S is directly following V. In a further embodiment, said V is directly following said A, D, E, or an amino acid residue that can be phosphorylated and dephosphorylated. In one embodiment, said A, D, E, or an amino acid residue that can be phosphorylated and dephosphorylated is directly following K or R. In another embodiment, said K or R is directly following P, A, or G.

[0046] In a preferred embodiment, the peptide has any one of the sequences in Table 1 or Table 2.

[0047] Table 1: Human peptides TIFF2024026109000006.tif209169Here, the underlined residues are myristoylated and ^ "teeth," ^ This indicates that the T immediately before is phosphorylated.

[0048] Table 2: Rat peptides TIFF2024026109000007.tif218169Here, the underlined residues are myristoylated and ^ "teeth," ^ This indicates that the T immediately before is phosphorylated.

[0049] Using sequence 1 of Table 1 as an example, the disclosure provides a peptide in which the myristoylated amino acid is S, at least one intervening amino acid residue is TAAC (SEQ ID NO: 72), the first amino acid sequence is PPSY (SEQ ID NO: 73), and the terminal amino acid sequence is DRVTKP (SEQ ID NO: 74).

[0050] The sequences in Table 1 are derived from the WW binding domains in the sodium channels SCN1A, SCN2A, SCN3A, SCN5A, SCN8A, SCN9A, SCN10A and have been further modified (e.g., acylation). The peptides SEQ ID NOs: 1-14 use threonine as the penultimate amino acid in the sequence. Threonine can be phosphorylated and dephosphorylated. In the peptides SEQ ID NOs: 15-21, alanine replaces threonine (negating putative in vivo phosphorylation of the peptides that may limit efficacy). In the peptides SEQ ID NOs: 22-28, glutamic acid replaces threonine. In the peptides SEQ ID NOs: 29-35, aspartic acid replaces glutamic acid. Glutamic acid and aspartic acid, respectively, mimic a permanently phosphorylated threonine (resistant to endogenous phosphatase action). Neither glutamic acid nor aspartic acid is actually phosphorylated. Without intending to be bound by any particular theory, these peptides may provide a longer duration of action due to the negative charge retained at this amino acid site that is resistant to phosphatase action.

[0051] In one embodiment, the peptides of the present disclosure increase or decrease the inward sodium current of neurons. The sodium current is typically measured at a peak. In one example, the peptides of the present disclosure increase or decrease the sodium current of neurons in a local / target area (e.g., a treatment area).

[0052] In one embodiment, the peptides of the present disclosure are not anesthetics. The peptides of the present disclosure that decrease sodium current do not act as sodium channel blockers, but rather induce degradation of sodium channels.

[0053] In one aspect, the present disclosure also provides a pharmaceutical composition comprising a pharma- ceutical acceptable carrier, a peptide of the present disclosure, optionally a Magi-1 targeting shRNA or Magi-1 targeting siRNA, and optionally one or more analgesics (e.g., non-steroidal anti-inflammatory drugs (NSAIDS)) and / or one or more anesthetics. Non-limiting examples of analgesics or anesthetics include bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or combinations thereof. Further examples of analgesics include acetaminophen, aspirin, ibuprofen, naproxen, and the like, and salts thereof. Using techniques and carriers known to those of skill in the art (e.g., Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, PA. Lippincott Williams & Wilkins), the compositions can be formulated as intramuscular, intradermal, intrathecal or nerve injections, topical creams or transdermal patches. Non-limiting examples of siRNAs include: GGAAAGACAGCCAGAAUAGUU (SEQ ID NO:88), GCCCAAGCUCCAGAUCAAACU (SEQ ID NO:89), GUGGAUGGGACGCCAGUAAUU (SEQ ID NO: 90), GAAGCAUUCUCGAGCUAUAGA (SEQ ID NO: 91), GUUUCCCCUAUUCACCAGUGU (SEQ ID NO:92), GCCUCUCGCACCAUGUGAUUA (SEQ ID NO:93), GACCAAGAGCGAAGGAAUGUU (SEQ ID NO:94), GUUCCUCAGAUCCAAUUGUUA (SEQ ID NO: 95), GACCAUCUGAGCCCACUACUA (SEQ ID NO:96), GGAAACAUGUGACUAUACCUU (SEQ ID NO:97), and GAUCUUUACAUAGCUUAGUGU (SEQ ID NO:98)

[0054] In one embodiment, the agent is an siRNA for use in RNA interference (RNAi)-mediated silencing or downregulation of MAGI-1 mRNA. RNAi agents are typically expressed in cells as short hairpin RNAs (shRNAs). shRNAs are RNA molecules that include a sense strand, an antisense strand, and a short loop sequence between the sense and antisense fragments. shRNAs are transported to the cytoplasm where they are processed by Dicer into short interfering RNAs (siRNAs). siRNAs are typically 20-23 nucleotide double-stranded RNA molecules that are recognized by the RNA-induced silencing complex (RISC). Once incorporated into the RISC, the siRNAs facilitate cleavage and degradation of the targeted mRNA. Thus, polynucleotide agents for use in RNAi-mediated silencing or downregulation of MAGI-1 expression can be either siRNAs or shRNAs. Representative (but non-limiting) shRNAs for use in various aspects of the present disclosure are shown in Example 1.

[0055] shRNA can be expressed from any suitable vector, such as a recombinant viral vector, as two separate complementary RNA molecules or as a single RNA molecule with two complementary regions. In this regard, any viral vector that can accept the coding sequence of the shRNA molecule(s) to be expressed can be used. Examples of suitable vectors include, but are not limited to, vectors derived from adenovirus, adeno-associated virus, retrovirus (e.g., lentivirus), rhabdovirus, murine leukemia virus, herpes virus, etc. A preferred virus is lentivirus. The tropism of viral vectors can also be modified by pseudotyping the vector with envelope proteins or other surface antigens from other viruses. As an alternative to expressing shRNA in cells from recombinant vectors, chemically stabilized shRNA or siRNA can also be administered as a drug in the method of the present invention. Vectors for expressing shRNA that produce siRNA once introduced into cells are commercially available. In addition, shRNA or siRNA that target virtually any known human gene are known and commercially available.

[0056] The present disclosure provides a composition comprising at least one peptide of the present disclosure. Non-limiting examples of the composition include solutions, suspensions, emulsions, solid injectable compositions that are dissolved or suspended in a solvent before use, and the like. Injectables can be prepared by dissolving, suspending or emulsifying one or more active ingredients in a diluent. Examples of diluents include, but are not limited to, distilled water for injection, physiological saline, vegetable oil, alcohol, and combinations thereof. In addition, the injectables may contain stabilizers, solubilizers, suspending agents, emulsifying agents, sedatives, buffers, preservatives, and the like. Injectables may be sterilized at the final formulation stage or prepared by a sterilization procedure. The compositions of the present disclosure can also be formulated into sterile solid preparations (e.g., by lyophilization) and used after sterilization or dissolved in sterile water for injection or other sterile diluents immediately before use.

[0057] The composition may contain one or more pharmaceutically acceptable carriers.Pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; celluloses including sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository wax; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer; and other non-toxic compatible substances used in pharmaceutical preparations.If desired, the composition may also contain a small amount of wetting or emulsifying agent, or pH buffering agent. Further non-limiting examples of pharma- ceutically acceptable carriers can be found in Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, PA. Lippincott Williams & Wilkins.

[0058] In one embodiment, the peptides of the present disclosure or compositions thereof are used to alter (e.g., increase or decrease) the pain sensitivity of a subject (e.g., a subject in need of treatment for pain and / or pain sensitivity). In one example, the subject's pain is reduced (e.g., ameliorated) when the pain sensitivity of the subject is decreased. In another example, the subject's pain sensitivity is increased. In one example, the peptides of the present disclosure, compositions thereof, Magi-1 targeting shRNA or Magi-1 targeting siRNA are used for pain management (e.g., pain control).

[0059] The present disclosure further provides a method for treating a subject suffering from pain, comprising administering to the subject a peptide of the present disclosure, or a composition comprising a peptide having a sequence of SEQ ID NO: 1-7, 15-21, Magi-1 targeting shRNA, or Magi-1 targeting siRNA, in an amount effective to treat pain. Treating pain includes, but is not limited to, reducing the subject's sensitivity to pain. The subject in need of treatment may be a human or non-human mammal. Non-limiting examples of non-human mammals include cows, pigs, mice, rats, rabbits, cats, dogs, or other agricultural, pet, or service animals.

[0060] A subject's pain (e.g., pain sensitivity, pain intensity, pain relief (in response to intervention / treatment), patient assessment of improvement and satisfaction with intervention / treatment, pain interference with physical function, pain interference with emotional function) can be determined by subject description (e.g., determined at rest, during or after activity) based on pain assessment using a variety of validated pain measurement tools (e.g., visual analog pain scale (VAS), numeric rating pain scale (NRS), categorical verbal rating pain scale (VRS), multidimensional scales assessing sensory components, as well as cognitive and psychological dimensions of pain, health-related quality of life assessments, pain-related functional assessments).Non-limiting examples of pain measurement tools include VAS, NRS, VRS, McGill Pain Questionnaire (MPQ) and its shortened form, Brief Pain Inventory (BPI), Neuropathic Pain Score (NPS), Pain Self-Efficacy Questionnaire, Patient Global Impression of Change scale, European Quality of Life Instrument (EQ 5D), Pain Disability Index (PDI), Oswestry Disability Index (ODI), Beck Depression Inventory and Profile of Mood States, Wong-Baker faces pain scale, and the Pain Disability Index (PDI). scale), FLACC scale (facial expression, legs, activity, crying, and consolability), CRIES scale (crying, need for O2 for SaO2<95%, elevated vital signs (BP and HR), facial expression, insomnia), COMFORT scale, Mankoski pain scale, descriptor differential scale of pain intensity, etc., and combinations thereof. In one embodiment, the Magi-1 targeting shRNA or Magi-1 targeting siRNA may be a human Magi-1 targeting shRNA or a human Magi-1 targeting siRNA.

[0061] A subject's pain can be ameliorated if the subject's pain (e.g., pain sensitivity) is reduced. For example, a subject's pain is ameliorated when the subject's pain (e.g., pain sensitivity) is at a desired level (e.g., the pain is not unpleasant).

[0062] In additional embodiments, the subject is in need of the peptide, Magi-1 targeting shRNA, or Magi-1 targeting siRNA.

[0063] In one embodiment, the subject's pain is nociceptive. In another embodiment, the subject's pain is neuropathic. The subject's pain can be a symptom, condition, or occurrence of any disease, such as injury (e.g., spinal cord injury, nerve injury, or burn), chronic disease (e.g., diabetes, shingles, major depressive disorder, fibromyalgia arthritis, or cancer), chronic inflammation (e.g., chronic inflammation associated with repetitive stress, such as carpal tunnel syndrome), chemotherapy, radiation, or Morton's neuroma. The pain can also be post-operative pain.

[0064] In one embodiment, the subject is being preemptively treated for pain (e.g., prior to anticipated pain, such as pain caused during surgery, chemotherapy, dental work, radiation therapy, etc.). In another embodiment, the subject is being treated for pain following a pain-inducing procedure. Such procedures include, for example, surgery, chemotherapy, radiation therapy, etc., and combinations thereof.

[0065] In one embodiment, the subject has chronic pain and / or acute pain. Chronic pain is any pain that lasts for about 12 weeks or more. In another embodiment, chronic pain is pain that lasts beyond the expected healing period.

[0066] Acute pain is sharp and typically lasts no longer than about six months. Acute pain will cease once the underlying cause of the pain is resolved. Causes of acute pain include, but are not limited to, surgery, fractures, dental work, burns, cuts, labor / birth, and combinations thereof.

[0067] In embodiments, the subject is opioid-naive, opioid-unavailable, suffers from opioid dependence, or is at risk of relapse to opioid dependence.

[0068] In one aspect, the present disclosure provides a method for inducing local analgesia in a subject, comprising administering to the subject an analgesic amount (e.g., a therapeutically effective amount) of a composition comprising a peptide having any one of the sequences of SEQ ID NOs: 1-7 or 15-21, a Magi-1 targeting shRNA, or a Magi-1 targeting siRNA.

[0069] The present disclosure further provides a method for increasing pain sensitivity in a subject, comprising administering to the subject a composition comprising a peptide having any one of SEQ ID NOs: 8 to 14 or 21 to 35 in an amount effective to increase pain sensitivity.

[0070] As an example, the peptides of the present disclosure, compositions thereof, Magi-1 targeting shRNA, or Magi-1 targeting siRNA can be used to alter pain sensitivity locally (eg, in a treatment area).

[0071] The subject may suffer from a disease or condition having a symptom of reduced pain sensitivity, including, but not limited to, amyotrophic lateral sclerosis, multiple sclerosis, schizophrenia, autism spectrum disorder (such as Asperger's syndrome), congenital hyposensitivity to pain, and diabetes-induced nerve loss.

[0072] In one embodiment, one or more peptides of the present disclosure (e.g., one or more peptides of the present disclosure, which may be the same or different) may be administered or used. In another example, one or more compositions comprising a peptide of the present disclosure (e.g., one or more peptides of the present disclosure, which may be the same or different), a Magi-1 targeting shRNA, or a Magi-1 targeting siRNA may be administered or used in combination with one or more analgesics and / or one or more anesthetics (e.g., lidocaine), and / or an anti-inflammatory drug (e.g., a glucocorticoid).

[0073] When any of the above are used or administered in combination, the use or administration may be simultaneous or sequential. Any of the foregoing may be formulated in a combined preparation or in separate preparations.

[0074] An exemplary co-administration is the co-administration of i) a peptide having a sequence of any one of SEQ ID NOs: 1-7, 15-21, a Magi-1 targeting shRNA, or a Magi-1 targeting siRNA, and ii) a peptide having a sequence of any one of SEQ ID NOs: 8-14, 22-35, where i) is administered after ii), or ii) is administered after i). There may be a delay between the administration of i) and ii), or between the administration of ii) and i). In another example, i) is administered immediately (e.g., without delay) after ii), or ii) is administered immediately (e.g., without delay) after i). Co-administration may be used to reverse the peptide being added first. For example, a subject who has been treated for pain (e.g., the subject's pain sensitivity has been reduced) using a peptide having a sequence of any one of SEQ ID NOs: 1-7, 15-21 may be administered a peptide having a sequence of any one of SEQ ID NOs: 8-14, 22-35, such that the subject's pain sensitivity is increased. In another example, if an excess amount of SEQ ID NOs: 1-7, 15-21 is administered to a subject, the subject may be administered a peptide having any one of SEQ ID NOs: 8-14, 22-35 to increase pain sensitivity. Alternatively, if too much SEQ ID NOs: 8-14, 22-35 is administered to a subject, the subject may be administered a peptide having any one of SEQ ID NOs: 1-7, 15-21 to decrease the subject's pain sensitivity.

[0075] In one embodiment, the peptides of the present disclosure, compositions thereof, Magi-1 targeting shRNA, or Magi-1 targeting siRNA are used for pain management.

[0076] The peptide, Magi-1 targeting shRNA, or Magi-1 targeting siRNA of the present disclosure can be administered to a subject in various ways. For example, it can be injected into spinal nerve or nerve terminal during and / or after surgery. The peptide, Magi-1 targeting shRNA, or Magi-1 targeting siRNA can also be administered intramuscularly or intradermally. Furthermore, the peptide can be administered locally. Without intending to be bound by any particular theory, the most effective route or administration of shRNA is direct administration to nerve.

[0077] In one embodiment, one or more compounds and / or one or more compositions comprising one or more compounds described herein are administered to a subject in need of treatment using any known method and route, including but not limited to oral, parenteral, subcutaneous, intraperitoneal, intrapulmonary, intranasal and intracranial injection. Parenteral injection includes but is not limited to intramuscular, intravenous, intraarterial, intraperitoneal and subcutaneous administration. Topical and / or transdermal administration are also included. Also included are application methods including needleless injection.

[0078] In one embodiment, a subject in need of treatment is administered a therapeutically effective amount of a peptide of the present disclosure, a Magi-1 targeting shRNA, or a Magi-1 targeting siRNA. The therapeutically effective amount of the peptide of the present disclosure may have a concentration of 10 nM to 10 mM (e.g., 100 μM), including all 0.1 nM values ​​and ranges therebetween. In one embodiment, the therapeutically effective amount of the peptide of the present disclosure may have a concentration of 1 to 500 μM, 50 to 500 μM, 1 to 250 μM, 10 to 250 μM, 25 to 250 μM, 25 to 150 μM, 50 to 250 μM, or 50 to 150 μM.

[0079] In one embodiment, a subject in need of treatment is administered a peptide of the present disclosure, a composition thereof, a Magi-1 targeting shRNA, or a Magi-1 targeting siRNA as a single dose (e.g., a single administration step). After the single administration, the subject's pain is improved or the subject's pain sensitivity is increased for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all secondary values ​​and ranges therebetween. In another example, the subject's pain is improved or the subject's pain sensitivity is increased for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all secondary values ​​and ranges therebetween, in the absence of any other active ingredient (e.g., additional analgesic and / or anesthetic agent).

[0080] In one embodiment, a subject in need of treatment is administered multiple doses (e.g., multiple administration steps) of the peptides of the present disclosure, compositions thereof, Magi-1 targeting shRNA, or Magi-1 targeting siRNA. After multiple administrations, the subject's pain is improved or the subject's pain sensitivity is increased for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all secondary values ​​and ranges therebetween. In another example, the subject's pain is improved or the subject's pain sensitivity is increased for 1-120 hours (e.g., 24-120 hours, 1-48 hours, 12-48 hours, or 24-48 hours), including all secondary values ​​and ranges therebetween, in the absence of any other active ingredients (e.g., additional analgesics and / or anesthetics).

[0081] In one aspect, the disclosure further provides a kit.

[0082] In one embodiment, the kit comprises a pharmaceutical formulation containing any one or any combination of the compounds disclosed herein.

[0083] In one embodiment, the kit includes a package (e.g., a closed or sealed package) that contains the pharmaceutical formulation, such as, for example, one or more closed or sealed vials, bottles, blister (bubble) packs, or any other suitable package for selling, distributing, or using pharmaceutical compounds and compositions containing them.

[0084] In one embodiment, the printed matter includes, but is not limited to, printed information. The printed information may be provided on a label, or on an insert, or may be printed on the packaging material itself. The printed information may include, for example, information for identifying the amount and type of the composition, other active and / or inactive ingredients in the package, as well as instructions for taking the composition (e.g., number of doses to take over a given period of time, etc.), and / or information directed to another health care provider, such as a pharmacist and / or physician, or to the patient. The printed matter may include, for example, an indication that the pharmaceutical composition and / or any other medication provided therewith is for the treatment of a subject having a bacterial infection. In one example, the product includes a label that describes the contents of the container and provides indications and / or instructions regarding the use of the contents of the container to treat a subject having any bacterial infection.

[0085] In one aspect, the present disclosure further provides peptides of SEQ ID NOs: 36-70 for use as research tools. As such, they can be administered to research subjects (e.g., mice and rats). The peptides are also useful for in vitro testing.

[0086] In the following statement, various examples of peptides, compositions, and methods of using the peptides of the present disclosure are described: Statement 1: A peptide comprising the sequence: X 1 X 2 X 3 X 4 X 5 X 6 PX 7 YX 8 X 9 VX 10 X11 X 12 (SEQ ID NO:75), wherein X 1 is selected from S, P, A; X 2 is selected from T, S, A; X 3 is selected from A, T; X 4 is selected from A, T, I, S; X 5 is selected from C, S, F; X 6 is selected from P, L; X 7 is any amino acid residue; X 8 is selected from E, D, Y; X 9 is selected from S, R; X 10 is selected from T, A, E, D, where T is optionally phosphorylated; X 11 is selected from K, R; and X 12 is selected from P, A, and G. where X 1 , X 2 , X 3 , X 4 , X 10 , X 11 or a combination thereof is acylated (For example, the following structure TIFF2024026109000008.tif16169Here, n is 4 to 18 (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18), such as a myristoyl group. Statement 2:X 1 is selected from S and P. Statement 3: The peptide of statement 2, wherein the peptide has a sequence selected from SEQ ID NOs: 1-7, 15-21. Statement 4: The peptide of statement 2, wherein the peptide has a sequence selected from SEQ ID NOs: 8-14, 22-35. Statement 5: The peptide of any one of the preceding statements, wherein the peptide has the following sequence: X 1 X 2 X 3 X 4 X 5 PPSYX 8 X 9 VX 10 X 11 X 12 (SEQ ID NO: 75, X 6 is S and X 7 is S), where X 1 is myristoylated. Statement 6: The peptide of any one of the preceding statements, wherein the peptide has the following sequence: SX 2 X 3 X 4 X 5 PPSYX 8 X 9 VX 10 X 11 X 12 (SEQ ID NO: 75, X 1 is S and X 6 is P and X 7 is S), where S is myristoylated. Statement 7: The peptide of any one of the preceding statements, wherein the peptide has the following sequence: S STTSPPSYDSVTKP (SEQ ID NO:6), S ATSFPPSYESVTRG (SEQ ID NO: 7), S STTSPPSYDSV T KP (SEQ ID NO: 13), S ATSFPPSYESV T RG (SEQ ID NO: 14), S STTSPPSYDSVAKP (SEQ ID NO: 20), S ATSFPPSYESVARG (SEQ ID NO: 21), S STTSPPSYDSVEKP (SEQ ID NO:27), SATSFPPSYESVERG (SEQ ID NO:28), S STTSPPSYDSVDKP (SEQ ID NO: 34), or S ATSFPPSYESVDRG (SEQ ID NO: 35) Here, the underlined S is myristoylated and the underlined T is phosphorylated. Statement 8: A composition comprising one or more peptides according to any one of the preceding statements and a carrier. Statement 9: The composition of statement 8, comprising at least two peptides according to any one of statements 1 to 7, said at least two peptides being the same or different. Statement 10: The composition of statements 8 or 9, further comprising one or more analgesics and / or one or more anesthetics. Statement 11: The composition of statement 10, wherein the one or more analgesic agents and / or the one or more anesthetic agents are bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamizole, or combinations thereof. Statement 12: The composition of any one of statements 8 to 11, wherein the carrier is a pharma- ceutically acceptable carrier. Statement 13: A method of treating pain or increasing pain sensitivity in a subject in need of treatment, comprising: administering to a subject in need of treatment one or more peptides according to any one of statements 1-7 and / or one or more compositions according to any one of statements 8-12 in a therapeutically effective amount; A method in which pain in a subject in need of treatment is ameliorated or pain sensitivity in a subject in need of treatment is increased. Statement 14: The method of statement 13, wherein the subject's pain is chronic pain. Statement 15: The method of statement 13, wherein the subject's pain is acute pain. Statement 16: The method of any one of statements 13 to 15, wherein the administering step is performed in anticipation of pain. Statement 17: The method of any one of statements 14 to 16, wherein the subject in need of treatment has an injury, a chronic disease, chronic inflammation, Morton's neuroma, post-surgical pain, or a combination thereof. Statement 18: The method of statement 17, wherein the injury is a spinal cord injury, a nerve injury, a burn, or a combination thereof. Statement 19: The method of statement 17, wherein the chronic disease is diabetes, shingles, major depressive disorder, fibromyalgia arthritis, amyotrophic lateral sclerosis, multiple sclerosis, schizophrenia, autism spectrum disorder, cancer, or a combination thereof. Statement 20: The method of any one of statements 14 to 19, wherein the administration step induces an increase or decrease in sodium current. Statement 21: The method of any one of statements 14 to 20, wherein the peptide administered to the subject has a sequence selected from SEQ ID NOs: 1-7, 15-21, and combinations thereof. Statement 22: The method of any one of statements 14-21, wherein the subject's pain is ameliorated (e.g., the subject's pain sensitivity is reduced). Statement 23: The method of any one of statements 14 to 22, wherein the subject's pain is improved (e.g., the subject's pain sensitivity is reduced) for 1 to 120 hours after a single administration step. Statement 24: The method of any one of statements 14 to 23, wherein the subject's pain is improved (e.g., the subject's pain sensitivity is reduced) for 24 to 120 hours following a single administration step. Statement 25: The method of any one of statements 14 to 20, wherein the subject's pain sensitivity is increased. Statement 26: The method of any one of statements 14 to 20 or 25, wherein the peptide administered to the subject has a sequence selected from SEQ ID NOs: 8 to 14, 22 to 35, and combinations thereof. Statement 27: The method of any one of statements 14-20, 25 or 26, wherein the subject's pain sensitivity is increased for 1 to 120 hours following a single administration step. Statement 28: The method of any one of statements 14 to 20, 25 to 27, wherein the subject's pain sensitivity is increased for 24 to 120 hours after a single administration step. Statement 29: The method of any one of statements 14 to 20 or 25 to 28, wherein the subject is administered a peptide having a sequence selected from SEQ ID NOs: 1 to 7, 15 to 21, and combinations thereof, followed by administration of a peptide having a sequence selected from SEQ ID NOs: 8 to 14, 22 to 35, and combinations thereof. Statement 30: The method of any one of statements 14-20 or 25-29, wherein the subject is administered a peptide having a sequence selected from SEQ ID NOs: 8-14, 22-35, and combinations thereof, followed by administration of a peptide having a sequence selected from SEQ ID NOs: 1-7, 15-21, and combinations thereof. Statement 31: The method of any one of statements 14-30, wherein the administering step comprises administering one or more of the following sequences: S STTSPPSYDSVTKP (SEQ ID NO:6), S ATSFPPSYESVTRG (SEQ ID NO:7), S STTSPPSYDSV T KP (SEQ ID NO: 13), S ATSFPPSYESV T RG (SEQ ID NO: 14), S STTSPPSYDSVAKP (SEQ ID NO:20), S ATSFPPSYESVARG (SEQ ID NO:21), S STTSPPSYDSVEKP (SEQ ID NO:27), S ATSFPPSYESVERG (SEQ ID NO:28), S STTSPPSYDSVDKP (SEQ ID NO:34), or S ATSFPPSYESVDRG (SEQ ID NO:35) Here, the underlined S is myristoylated and the underlined T is phosphorylated.

[0087] The following examples are presented to illustrate the present disclosure and are not intended to be limiting in any respect.

[0088] [Example 1] This example provides a description of the peptides of the disclosure and their uses.

[0089] Disclosed is the effect of Magi-1 deficiency on pain sensitivity. Na It was demonstrated that membrane targeting of the channel is dependent on Magi-1. The expression and distribution of Magi-1 in DRG neurons was determined, and knockdown of Magi-1 reduced sodium current (I Na ) and potassium current (I K ) and reduced excitability in neurons. Na It was also confirmed that the channels form a complex together. In vivo knockdown of Magi-1 suppressed pain behavior and produced a significant reduction in NaV1.8 channel protein expression. Finally, it is described that NaV1.8 channel trafficking can be pharmacologically manipulated using WW motif cell-penetrating peptide mimetics.

[0090] K Na Channel expression is influenced by PDZ-binding motifs. Slack and Slick channels contain a type 1 PDZ-binding motif at their respective disaccharide C-termini (Fig. 1A). By inputting the Slack amino acid sequence using the PDZ protein interaction predictor (PDZPedInt, University of Freiburg), Magi-1 was identified as a Slack channel interactor (particularly the second and fifth PDZ domains of Magi-1). Heterologous co-expression of Magi-1 and Slack-B subunits increased Slack current density (Fig. 1B), whereas co-expression of Magi-1 with a mutant Slack construct carrying a truncated PDZ motif did not affect Slack current density (Fig. 1B). We confirmed that Magi-1 interacts with Slack channels in Chinese hamster ovary (CHO) cells and in DRG neurons using co-immunoprecipitation (Co-IP) assays (Fig. 1C,F). Double immunolabeling studies demonstrated that Magi-1 and Slack K are expressed in cultured and intact DRG neurons, and in CHO cells.Na The colocalization between the β-amino acid and the β-amino acid channel was observed (Figure 1E, G). Na Co-IP confirmed that the channel interacted with Magi-1 through its C-terminal PDZ motif (ETQL (SEQ ID NO: 99)) (Figure 1C). To verify the role of Magi-1 on Slack channel membrane expression, we performed a surface biotinylation assay and confirmed that co-expression of Slack and Magi-1 increased Slack channel surface expression (Figure 1D). K, which shares approximately 74% sequence homology with Slack, Na Another member of the channel family, Slick, has the same evolutionarily conserved class 1 PDZ-binding motif (ETQL) (Fig. 1A). By coexpressing Magi-1 and Slick, we assessed whether Magi-1 also regulates Slick current activity in CHO cells. Patch-clamp recordings revealed that Magi-1 similarly enhanced Slick current density (Fig. 2A), but not Slack-B. Western analysis surprisingly showed increased total Slick protein expression (8-fold) (Fig. 2C). Magi-1 was also found to colocalize with Slick channels when heterologously expressed in CHO cells (Fig. 2D). Thus, Magi-1 may regulate K by increasing membrane expression of Slack channels. Na For Slick channels: Magi-1 appeared to serve an additional protein stabilizing function, since expression of Magi-1 led to an increase in total Slick channel protein expression.

[0091] Magi-1 knockdown induces I in cultured DRG neurons K but resulted in decreased excitability. The neurophysiological function of Magi-1 was investigated in cultured DRG neurons using a previously validated knockdown strategy with small interfering RNA (siRNA). Magi-1 knockdown was confirmed by immunolabeling and Western blot analysis (Figure 3A,B) using a previously validated polyclonal Magi-1 antibody. Large-scale Magi-1 knockdown was achieved, as Magi-1 protein was observed to be reduced by approximately 70-75% compared to non-translating scrambled control siRNA 72 h after transfection (Figure 3A,B). Further immunofluorescence images showing the knockdown are shown in Figure 10. Magi-1 knockdown was consistent with the K Na We investigated the effect on surface expression of Slack channels. Membrane biotinylation assays revealed a significant decrease (~70%) in membrane Slack channel expression compared to controls (Figure 3C). Voltage-clamp recordings also revealed a significant decrease in outward I expression after Magi-1 knockdown. K A significant decrease in density was observed, but only transient I K Strikingly, Magi-1 knockdown resulted in DRG hypoexcitability, in which neurons did not fire APs (Fig. 3E and Fig. S11A). Surface Slack K Na A reduction in channels would be expected to lead to repetitive firing, but the severely disrupted action potentials observed suggested that Magi-1 deficiency also affected sodium channel function.

[0092] Magi-1 knockdown inhibits I Na and also reduced Nav1.8 cell membrane expression. Using whole-cell voltage clamp recordings, inward sodium currents (I Na We investigated the effect of Magi-1 knockdown on total I Na was significantly decreased (Fig. 4A-C). NaBoth the peaks of tetrodotoxin (TTX)-sensitive and TTX-resistant components of the action potential were significantly reduced (despite the reduced membrane Slack expression) compared to neurons treated with control siRNA (explaining the hypoexcitability phenotype seen in DRG neurons during Magi-1 knockdown). Notably, the culture conditions of these DRG neurons favor TrkA-positive nociceptive DRG neurons (see Methods), which express high levels of Nav1.8 channels. In most mature nociceptive DRG neurons, Nav1.8 channels account for up to 90% of the upstroke of the action potential. Magi-1 knockdown revealed that Nav1.8 is a significant contributor to the I Na Since Magi-1 knockdown reduced the TTX-resistant component of the IL-1 receptor, we focused our investigation on the surface expression of Nav1.8. Using a surface biotinylation assay, we found that after Magi-1 knockdown, Na V We confirmed that the membrane expression of Nav1.8 was decreased (~50%) (Figure 4D). Collectively, these results suggested that Magi-1 is an essential scaffold for the membrane localization of both Nav1.8 and Slack channels in DRG neurons.

[0093] Magi-1 is expressed in small and medium sized DRG neurons, in their axon tracts, and at some nodes of Ranvier. The expression of Magi-1 in intact DRG neurons was confirmed to indicate a broader physiological function. The Allen Mouse Spinal Cord Atlas and BioGPS support the high Magi-1 message in DRG neurons. According to BioGPS, DRG tissue has the second highest Magi-1 mRNA tissue expression profile, with the hypothalamus accounting for the highest expression. Furthermore, the Allen Spinal Cord Atlas shows differential Magi-1 expression in small and medium-sized, likely nociceptive DRG neurons. Magi-1 immunolabeling has previously been shown in the growth cones of cultured DRG neurons and dorsal root entry sites of the embryonic spinal cord. Western blotting (Figure 5A) and immunohistochemical analysis (Figure 5B) confirmed the expression of Magi-1 in adult mouse DRG neurons and spinal cord tissue. Immunohistochemistry was performed using a previously validated monoclonal anti-Magi-1 antibody. Histological examination of the sciatic nerve showed high Magi-1 immunoreactivity along axonal fibers and at some nodes of Ranvier (using the paranodal marker Caspr) (Figure 5C). Cell size analysis revealed small and medium-sized DRG neurons (<600 μm). 2 ) range of DRG neurons (Fig. 5D), similar to the data found in the Allen Mouse Spinal Cord Atlas. The preferential tissue expression profile of Magi-1 in small and medium-sized DRG neurons and the dorsal horn of the spinal cord indicated a potential function of Magi-1 in pain signaling.

[0094] Magi-1 inhibits Slack K in DRG neurons Na It mediated the coupling between the channel and Nav1.8. Previous studies have shown that blocking sodium entry pathways reduces the K Na The channel activity is decreased, and the Nav channel is Na Furthermore, in DRG neurons, Slack K NaCo-immunolocalization between the channel and Nav1.8 was previously observed. These data also suggested the possibility of coupling, as shown by the reduced membrane localization of Nav1.8 and Slack channels after Magi-1 knockdown. We investigated the possibility that Magi-1 interacts with Nav1.8 in DRG neurons and found that Magi-1 interacts with Nav1.8 and Slack K channels. Na We investigated whether Magi-1 promotes coupling with the Na channel in Co-IP assays. V Magi-1 and Nav1.8 interacted with the Nav1.8 channel (Fig. 6A). Double immunolabeling studies also demonstrated colocalization between Magi-1 and Nav1.8 in cultured and intact DRG neurons and in the spinal cord (Fig. 6B). Co-IP experiments using Slack and Nav1.8 specific antibodies from intact DRG lysates were performed, and Nav1.8 and Slack were successfully co-immunoprecipitated (Fig. 6C), indicating that Nav1.8 and Slack K channels interact with each other. Na The channels were shown to form a complex together in DRG neurons. These findings suggested scaffolding of Slack and Nav1.8 in sensory neurons by Magi-1.

[0095] In vivo Magi-1 knockdown in DRG neurons reduced pain sensitivity. We investigated the attenuating ability of in vivo knockdown of Magi-1 on pain behavior. We used a novel spinal nerve injection technique of a non-viral vector containing a short hairpin RNA (shRNA) sequence. This disclosure is the first to describe this in vivo transfection method in mice, which allows uptake of shRNA plasmids by DRG sensory neurons via axonal retrograde transport, but without the invasive paraspinal muscle incision required in rats. The experimental outline is shown diagrammatically in Figure 7A. Intraspinal nerve injection of Magi-1 shRNA in untreated male and female mice induced a marked and sustained reduction in thermal nociception compared to control shRNA (Figure 7B,C). To assess intra-animal differences in withdrawal time, the time to withdraw the contralateral (non-injected) paw (PWL) was subtracted from the ipsilateral (injected) PWL. In individual animals, a significant ~3 s increase in PWL was observed in mice injected with Magi-1 shRNA compared to paws injected with non-targeting shRNA. We next examined the effect of Magi-1 knockdown in an acute inflammatory pain model (formalin assay). Intraplantar (i.pl.) injection of 5% formalin induced the typical biphasic inflammatory pain response associated with this acute inflammatory pain model. Fifteen days after in vivo transfection of Magi-1 shRNA, phase I flinching behavior and phase II licking, lifting, and flinching behavior were all significantly reduced (Figure 7D).

[0096] In vivo Magi-1 silencing in the DRG and sciatic nerve of shRNA-injected mice 15 days after transfection was confirmed by immunohistochemical and biochemical analysis. A significant loss of Magi-1 immunoreactivity was observed in the ipsilateral DRG and sciatic nerve of mice injected with Magi-1 shRNA compared to the contralateral DRG of the same mice and mice injected with control shRNA (Figure 7E). Magi-1 transcript knockdown was also verified using RT-PCR (Figure 12B). Magi-1 protein knockdown was confirmed by immunoblotting (~70-75%) (Figure 7F) and was comparable to the knockdown achieved in vitro (Figure 3A,B). Taken together, these results suggest that Magi-1 regulates nociception and acute inflammatory pain.

[0097] Nav1.8 expression was decreased following Magi-1 knockdown in vivo. Immunohistochemical analysis in the sciatic nerve and nodes of Ranvier also revealed an unexpected but significant decrease in Nav1.8 immunoreactivity after Magi-1 shRNA treatment when compared to non-coding scrambled shRNA controls (Figure 8A). This finding is consistent with the Nav1.8 immunoreactivity observed in DRG neurons after in vivo knockdown of Magi-1 as determined by Western blot analysis. V This was supported by a 75% reduction in Nav1.8 protein expression (Figure 8B). These data revealed that in addition to scaffolding channels in the membrane, Magi-1 is required for Nav1.8 protein stability. Recent studies have demonstrated a protective role for Magi-2, preventing Nedd4-2-mediated proteolysis of dendrins through WW-mediated interactions. Furthermore, the loss of Nav1.8 protein and the concomitant reduction in phase II inflammatory pain behaviors are consistent with the reduced phase II behaviors seen in Nav1.8 knockout mice. RT-PCR confirmed that Nav1.8 message was unchanged during Magi-1 knockdown, reinforcing the notion that Magi-1 regulates Nav1.8 protein stability (Figure 12C). These results suggested that Magi-1 plays a crucial role in regulating the stability of ion channel proteins.

[0098] PY motif mimicking peptides regulate Nav1.8 trafficking, DRG neuron excitability and pain behavior. PDZ-mediated interaction was demonstrated to be an absolute requirement for Slack / Magi-1 interaction (Figure 1D). Nav1.8 channels contain multiple internal putative PDZ-binding motifs and were reported to bind to the PDZ domain-containing protein Pdzd2. However, no changes in pain behavior were observed in Pdzd2 knockout mice. On the other hand, Nav1.8 channels also contain a PY motif (PPXY (SEQ ID NO: 76)) on their C-terminal side (Figure 13), which was hypothesized to regulate the interaction with Nedd4-2 ubiquitin ligase for target protein degradation. Interestingly, the WW domain of Nedd4-2 shares high sequence homology with the WW domain of Magi-1. Furthermore, Magi proteins have been shown to protect Nedd4-2 target proteins from degradation via WW interaction. Therefore, it was chosen to compete off the WW domain binding of Nav1.8 using a cell-permeable PY motif peptide mimetic. Based on the Nav1.8 WW binding motif, we engineered two peptides with identical sequences (except that one of the peptides was phosphorylated (Thr1926 in the channel)). This was done using PhosphoSitePlus (登録商標) This was done because scanning Nav1.8 with a post-translational modification resource tool revealed that Thr1926, the fourth amino acid adjacent to the PPXY (SEQ ID NO: 76) domain, is putatively phosphorylated (Figure 13). Primary DRG neurons were then treated with 10 μM of the non-phosphorylated peptide (PY, myristoyl-SATSFPPSYDSVTRG (SEQ ID NO: 77)) or the phosphorylated peptide (phospho-PY, myristoyl-SATSFPPSYDSV[pT]RG (SEQ ID NO: 77, where T is phosphorylated)) to outcompete Nav1.8 channel WW domain binding. Neurons exposed to the PY peptide for 24 hours showed increased total I Na In contrast, phospho-PY peptides resulted in almost complete loss of peak I Na PY and phospho-PY peptides strongly increased INa The Nav1.8 channels showed a time-dependent decrease or increase (6 and 24 h) in the WW-binding motif (Fig. 9A,B). PY peptide treatment (24 h) almost completely abolished AP firing (10 out of 11 neurons), whereas phospho-PY produced contrasting repetitive AP firing (7 out of 12) (Fig. 9B). When evaluating the surface expression of Nav1.8 channels after treatment with PY peptide, we found a substantial decrease in Nav1.8 channels at the plasma membrane, whereas a significant increase in Nav1.8 membrane expression was found with phospho-PY peptide (Fig. 9C). Furthermore, a substantial decrease in total Nav1.8 protein was observed after incubation with PY peptide, suggesting that the stability of Nav1.8 protein depends on this WW-binding motif. These results indicate that the phosphorylation state of the competing Nav1.8 PY motif peptide is essential for the stabilization of Nav1.8 channels. Furthermore, these data suggest that other sodium channels are potentially regulated by PY motif interactions (Fig. 9A, B).

[0099] To evaluate the potential analgesic effect of disruption of sodium channel membrane localization on pain behavior, the impact of competing peptides was examined in the formalin model of inflammatory pain. Mice received a single i.pl injection of either PY, phospho-PY, or scrambled PY peptide (100 μM, 20 μl) into the right hind paw 24 h before injection of 5% formalin into the same paw. Pretreatment with PY peptide significantly reduced phase II acute inflammatory pain, with phospho-PY peptide pretreated mice showing a contrasting increase in phase II responses when compared to scrambled peptide treated mice (Figure 9D). These data corroborate what was observed during in vitro experiments and demonstrate the ability to route Nav1.8 channels in and out of the neuronal membrane using peptide mimetics based on the PY motif. Furthermore, these data suggest that the phosphorylation state of Thr1926 determines Nav1.8 channel trafficking, neuronal excitability, and acute pain behavior.

[0100] Consideration Herein, it is described that Magi-1 is expressed along the pain transmission pathway: high expression of Magi-1 was observed in the cell bodies and axons of nociceptive DRG neurons and in the superficial dorsal horn of the spinal cord. Furthermore, Magi-1 was shown to regulate the membrane localization of Nav1.8 and Slack K in DRG neurons. Na It has proven to be an important scaffold for channels. Nav1.8 and Slack K Na Both channels have been implicated in rodent models of inflammatory and neuropathic pain, and it has been further shown that Magi-1 interacts with both Slack and Nav1.8 channels. Furthermore, it was found that Magi-1 silencing reduced membrane expression of both types of ion channels and resulted in a net lack of DRG neuronal excitability, suggesting that Magi-1 is a key regulator of ion channel function in neurons. To evaluate the importance of Magi-1 in pain processing, in vivo-silencing Magi-1 shRNA was transfected into DRG neurons of naive mice using spinal nerve injection. This is a novel and rapid technique to manipulate genes that function in DRG neurons of naive rodents, particularly mice. It allows for internal control testing of ipsilateral altered DRG neurons versus unaltered contralateral DRG neurons in the same mouse. Using this in vivo transfection method, it was found that Magi-1 knockdown resulted in a significant lack of thermal nociception and acute inflammatory pain behavior.

[0101] In addition to localizing ion channels to neuronal membranes, these findings are the first to show that Magi-1 is also important for the stability of ion channel proteins. Indeed, unlike other scaffold proteins, the Magi family of proteins may serve a broader function of protecting proteins from degradation. For example, it was shown that non-UL YAP1 proteins that thread through its WW domain are protected against Nedd4-2-mediated protein degradation. Subsequently, it was reported that Magi-2 also protects the protein dendrin from Nedd4-2-mediated ubiquitination through WW domain interaction with a conserved PY motif in dendrin. Similar to dendrin, Nav1.8 possesses an evolutionarily conserved PY motif, which has been demonstrated to be a binding site for Nedd4-2, targeting Nav1.8 for subsequent proteasomal degradation. During extended in vivo Magi-1 knockdown, a substantial and statistically significant decrease in Nav1.8 immunolabeling and protein expression was observed as determined by immunoblot (Figure 8A,B). Similarly, after 24 h of PY peptide incubation in DRG neurons, a near complete loss of Nav1.8 expression was observed. Na The density was reduced by 50% after only 6 hours, suggesting that both TTX-resistant and TTX-sensitive Nav channel membrane expression depend on the PY motif. However, subsequent immunoblot analysis of Nav1.7 protein showed that surface Nav1.7 protein levels were unchanged after peptidomimetic treatment, although some protein reduction was observed during long-term in vivo Magi-1 shRNA knockdown (Figure 16). It should be noted that embryonic DRG neurons also express the Nav1.3 channel, which contains the WW binding domain (Figure 13). Thus, some of the in vitro effects on the TTX-sensitive channel that we observed may be due to this channel. Nonetheless, these data suggest that Nav1.7 protein levels on scaffolding and protein stability (by Magi-1) are not altered by the PY motif. VThese results suggest that there is a difference in sensitivity between isoforms. Furthermore, Slick K, which has a putative PY motif on its N-terminal side at amino acids 12 to 15 (-PPRY- (SEQ ID NO: 78)), Na It was observed that the subunits, when recombinantly expressed with Magi-1, generated approximately 5-fold larger currents, accompanied by increased Slick channel protein levels, compared to when the subunits were expressed alone (Figure 2). This was in contrast to the Slack-B subunit, which does not have this PY motif at its N-terminus; the membrane current was increased to a lesser extent (2-fold) and no increase in Slack-B protein expression was observed. Indeed, the difficulty in expressing Slick channels compared to Slack channels in heterologous expression systems could be attributed to this WW binding motif and their susceptibility to UL-dependent degradation. Thus, these results suggest that targeting Magi-1 in addition to the membrane protects ion channels from degradation pathways and, indeed, that targeting Magi-1 represents a novel pharmacological approach to affect ion channel levels and function.

[0102] Both Magi-1 knockdown and PY peptides inhibited the I Na induced a decrease in the IL-1 receptor agonist activity, decreased the stability of Nav1.8 channels, and reduced pain behavior, whereas the opposite effects produced by phospho-PY peptides, especially I Na The increase in schizophrenia, increased repetitive firing, and exacerbated nocifensive responses were unexpected. (登録商標)Phosphoproteomic data available online from determined that Thr1926 in Nav1.8 channels is putatively phosphorylated. Because Thr1926 is the fourth amino acid downstream of the PY motif, we used this information to design a second peptide (Figure 13). Using Scansite (MIT) web-based software, Thr1926 is predicted to be either a casein II kinase or a GSK-3β kinase consensus phosphorylation site. Both kinases are constitutively active kinases, suggesting that Thr1926 is likely basally phosphorylated. Without intending to be bound by any particular theory, we speculate that the phospho-PY peptide competes with phosphorylated Nav1.8 channels in the UL, preventing a significant proportion of Nav1.8 channels from being ubiquitinated and retained in the cytosol (Figure 9E). Moreover, no statistically significant increase in input levels of Nav1.8 protein was observed over 24 hours, indicating that at least during this time window, the majority of internally localized channels are likely in a monoubiquitinated state. Without intending to be bound by any particular theory, it is further speculated that dephosphorylated Thr1926 has a higher affinity for Magi-1, which explains why competing PY peptides caused defects in Nav1.8 channel membrane expression. In this case, a substantial decrease in total Nav1.8 channel protein levels was observed, suggesting that within 24 hours, the ultimate fate of the channel was degradation. Nevertheless, these results strongly suggest that the PY motif is a major determinant of Nav1.8 channel trafficking and that Magi-1 is a critical component of the sodium signalosome in DRG neurons (Figure 9E).

[0103] It is demonstrated herein that a single intradermal injection of PY peptide mimetics produced significant analgesia 24 hours after administration (Figure 9D). PY peptides may have therapeutic value for invasive procedures requiring prolonged analgesia and / or for reducing the need for postoperative opioids, acting as local long-lasting analgesics. In contrast, phospho-PY peptides drive Nav1.8 channels into the DRG neuron membrane, exacerbating nocifensive behaviors and therefore of potential value against pain insensitivity-related disorders. Although myristoylation allows the peptides to partition through the membrane (possibly by a flip-flop mechanism), the majority of the peptides remain tethered to the inner surface of the membrane. This membrane-delimited feature may enhance the ability of peptides to exert their mimetic effects (especially for membrane-associated proteins). In addition to causing cell permeability and fixation of the peptides within the inner phospholipid bilayer, the myristoylation of peptides and their inherent hydrophobicity likely ensure that the peptides are localized at the injection site. Furthermore, the metabolism of these peptides requires phospholipid membrane turnover, which likely contributes to their long-lasting effects in vivo. Previous studies using a similar intradermal injection approach of a peptide mimetic against the T-mem100 protein, which is important for the TRPA1-TRPV1 complex, demonstrated analgesic effects in paclitaxel-induced chronic pain. Thus, the use of myristoylated cell-penetrating peptides offers a potential therapeutic approach to manipulate nerve terminal activity.

[0104] In addition to the high expression of Magi-1 in peripheral DRG neurons, Magi-1 is also robustly expressed within the central nervous system. Thus, the upregulation of Nav1.8 and Slack K by Magi-1 in DRG neurons Na Scaffolding and membrane stabilization of the Na channel V This may also occur with TTX-sensitive WW-binding motif-containing channels (in the central nervous system). Indeed, these data suggest that knockdown of Magi-1 in cultured DRG neurons inhibits TTX-sensitive I NaWe also showed that Magi-1 also results in a significant decrease in NF-κB, likely because many Nav channel isoforms contain WW-binding domains (Figure 13). Loss-of-function mutations in Nav channels are associated with mental health disorders. These findings may help to address why Magi-1 deficiency is also associated with multiple psychiatric syndromes, as Magi-1 deficiency causes reduced sodium transport and reduced excitability. Phospho-PY peptides are expected to serve as a novel therapeutic platform to increase excitability in neurological disorders associated with hypoexcitability.

[0105] Experimental procedure All animals used in this study were housed in the University at Buffalo (UB) Laboratory Animal Facility with a 12 / 12 light / dark cycle and free access to food and water. All experimental procedures conformed to the guidelines in the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by the University at Buffalo Animal Care and Use Committee.

[0106] Primary DRG neuron culture Pregnant Sprague-Dawley rats (Harlan, Indianapolis, IN) were used for neuronal culture. On the day of dissection, rats were euthanized by CO2 asphyxiation and E15 embryos were extracted. DRG neurons were dissected from the embryos and enzymatically digested with trypsin (2.5 mg / ml) at 37°C for 45 min, followed by dissociation and plating. DRG neurons were plated on poly-D-lysine (Sigma; 100 μg / ml) and laminin (Invitrogen; 3 μg / ml) coated coverslips. Neurons were maintained at 37 °C in a 7% CO2 humidified incubator in serum-free medium containing trophic factors N2 (Gemini Bio products; 1%), l-glutamine (Invitrogen; 200 μg / ml), and nerve growth factor (NGF) (Harlan; 100 ng / ml; essential for embryonic neuronal survival) in 50% DMEM and 50% F-12. The dependency of embryonic DRG neurons on NGF selects for a small-diameter population that is thought to underlie pain and temperature sensation. For two consecutive days after DRG dissection, DRG neurons were cultured in C2 medium containing the antimitotic agent cytosine β-d-arabinofuranoside hydrochloride (Sigma; 3 μM). This was followed by a 2-day recovery period, during which neurons were fed with regular serum-free medium before being used in experiments. All subsequent experiments with embryonic cultures were performed on days 5–10 of neuronal culture.

[0107] cell culture Chinese hamster ovary (CHO) cells were cultured in Iscove's modified Dulbecco's medium (IMDM) supplemented with 10% FBS, 1% hypoxanthine / thymidine (HT) supplement (Life Technologies), and 1% penicillin-streptomycin at 37°C in 5% CO2. CHO cells were plated on 12 mm coverslips for immunolabeling experiments, in 35 mm dishes for all electrophysiology experiments, and in 6-well culture plates for biochemistry experiments. Cells were cotransfected with either 0.5 μg Slick (pTRACER) or 0.5 μg Slack (pTRACER) + 0.5 μg Magi-1 (pcDNA3.1; Addgene), or 0.5 μg empty vector using Lipofectamine (ThermoScientific) according to the manufacturer's guidelines. Magi-1 clones were mutated to include a Kozak sequence at the 5' end to enhance protein expression.

[0108] DRG siRNA transfection Small interfering RNA (siRNA) against Magi-1 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Negative control siRNA consisting of a scrambled sequence was obtained from the same vendor. For each experiment, neurons were transfected with Magi-1 siRNA or non-targeting control siRNA. Cultured DRG neurons (above) were transfected using Lipofectamine 2000 (ThermoScientific) according to the manufacturer's protocol. Briefly, 1.5 μl of Lipofectamine 2000 was diluted in 50 μl of Opti-mem medium, and the mixture was left at room temperature for 5 min. After 5 min, the mixture was combined with 50 μl of Opti-mem containing 40 pmol of scrambled or Magi-1 siRNA (three different siRNA duplexes were pooled), and the mixture was incubated at room temperature for 30 min before being added to cells plated on 12 mm coverslips in 24-well plates. The siRNA mixture added to the DRG culture medium was used for electrophysiological recordings after 48–72 h of incubation with DRG neurons. For Western blotting, 300 pmol of siRNA was used in each 6-well plate. siRNA-transfected DRG neurons were used in the experiments 48–72 h after transfection. For electrophysiological experiments, DRG neurons were co-transfected with the GFP-containing plasmid pTRACER and siRNA duplexes (a positive indicator of transfection). Immunofluorescence on cultured neurons was performed as previously described. The investigators were blinded to the transfection conditions.

[0109] Electrophysiology All data were acquired, digitized, and filtered at 5 kHz using an Axopatch 200B amplifier (Molecular Devices) and Multiclamp-700B (Molecular Devices, Sunnyvale, CA). Data collection was monitored and controlled using pClamp 10 (Molecular Devices). Whole-cell patch-clamp recordings were performed on cultured DRG neurons and CHO cells transiently transfected with WT or mutant Slack (for Magi-1). Glass electrodes were pulled using a vertical pipette puller (Narishige International USA, Amityville, NY) and the tips were fire-polished to 5–8 MΩ resistance. For neuronal recordings, pipettes were filled with a solution containing (in mM) 124 K-gluconate, 2 MgCl2, 13.2 NaCl, 1 EGTA, 10 HEPES, 4 Mg-ATP, and 0.3 Na-GTP (pH 7.2), and for CHO cells Slack and Slick, 32.5 mM KCl, 97.5 mM potassium gluconate, 5 mM EGTA, and 10 mM HEPES (pH 7.2). The bath solution for all cells contained (in mM) 140 NaCl, 5.4 KCl, 1 CaCl2, 1 MgCl2, 10 HEPES, and 10 glucose (pH 7.4). The same bath solution and pipette solution were used in both voltage-clamp and current-clamp modes. In voltage-clamp mode, macroscopic currents were recorded at voltages ranging from -120 to +120. Cells were clamped at -70 mV and voltage steps of 20 mV were applied for 200 ms. The cell capacitance of CHO cells was 10–15 pF, and in cultured DRG neurons it was 20–25 pF (recorded under these conditions). Action potential firing was tested using a current clamp protocol consisting of depolarizing steps of 10–200 pA (20 ms duration) in 10 pA increments. The firing frequency of individual neurons was assessed by measuring repetitive discharges during 1000 ms suprathreshold stimuli of 400 pA. NaFor recording, the pipette solution contained (in mM): 130 CsCl, 13 CsF, 10 tetraethylammonium chloride, 1 MgCl2, 1 EGTA, 2.5 Na2ATP, 10 HEPES, pH adjusted to 7.2 with CsOH. The bath solution contained (in mM): 140 NaCl, 5.4 KCl, 1 CaCl2, 1 MgCl2, 10 HEPES, 10 glucose (pH 7.4). TTX-resistant I Na For the study, DRG neurons were recorded in a bath solution containing 250 nM TTX. DRG neurons were recorded at voltages ranging from -60 to +60 mV. Cells were held at -70 mV and I Na was evoked by incremental 10 mV depolarizing steps for 50 ms.

[0110] immunohistochemistry Sciatic nerves (SN), lumbar spinal cord (SC), lumbar, and thoracic DRG were isolated from adult mice. Briefly, animals were anesthetized with fetal plus and perfused transcardially with ice-cold PBS containing heparin (50 μg / ml) and sodium nitrite (5 mg / ml), followed by ice-cold 4% paraformaldehyde (PFA). DRG, SN, and SC were then removed, the surrounding tissues washed, and postfixed in 4% PFA overnight at 4°C. The next day, SN and DRG were transferred to 20% sucrose (Cryoprotect). Two days later, SN and SC were removed from sucrose, embedded in freezing medium, and stored at -80°C for future use. 16 μm sections of DRG, 10 μm sections of SN, and 20 μm sections of SC were made using a cryostat. Slices were permeabilized with a PBS solution containing 0.4% Triton X-100. The sections were then blocked with PBS containing 5% BSA for 2 hours at room temperature. The sections were then incubated overnight at 4° C. with a mixture of primary antibodies in PBS containing 5% BSA. Mouse anti-Na VAll primary antibodies, including 1.8 antibody (1:250; NeuroMab), rabbit anti-Magi-1 antibody (1:100; Abcam), mouse anti-Magi-1 antibody (1:100; Novus Biochemical), rabbit anti-Caspr (1:250; Abcam), and chicken anti-Slack antibody (1:750), have been previously validated. After several rinses, secondary antibodies Alexa Fluor 633 goat anti-mouse, Alexa Fluor 488 goat anti-rabbit, and Alexa Fluor 546 goat anti-chicken were added overnight (1:1000). Coverslips were then mounted onto slides using Prolong Gold antifade reagent containing 4',6'-diamidino-2-phenylindole dihydrochloride. Cell size characteristics of Magi-1 immunolabeling were analyzed using MetaMorph software (Molecular Devices).

[0111] Western blot analysis Total protein was collected from transfected CHO cells, spinal cord and DRG. Tissues were homogenized in RIPA buffer supplemented with protease inhibitor cocktail (Sigma). Immunoblotting was performed as previously described. Briefly, proteins were separated on 4-15% Mini-PROTEAN TGX Precast Gel (Bio-Rad) and transferred to 0.45 μm nitrocellulose membranes (BioRad). Membranes were stained with Slack anti-mouse (1:500; NeuroMab), rabbit anti-β-actin (1:500; Millipore), rabbit anti-Magi-1 (1:100; Abcam), mouse anti-Magi-1 (1:100; Novus Biochemical), mouse anti-Nav1.8 (1:200; NeuroMab), mouse anti-Na in 5% milk prepared in 1X Tris-buffered saline tween (TBST). VThe membranes were probed overnight at 4°C with antibodies against mouse anti-Flag (1:500; Sigma), mouse anti-1.7 (1:200; NeuroMab), and mouse anti-Flag (1:500; Sigma). The next day, the membranes were washed three times for 5 min in 1× TBST and then incubated for 1 h at room temperature in anti-mouse or anti-rabbit horseradish peroxidase conjugates (1:5000; Promega) prepared in 1× PBS and 0.1% BSA. The membranes were washed again three times (5 min) before being developed and imaged. Bands were visualized by enhanced chemiluminescence (Thermo Scientific) and quantified with Image J Software (NIH). Each experiment was repeated at least three times.

[0112] Co-immunoprecipitation CHO cells in 6-well plates were transiently transfected with WT or mutant Slack with or without Magi-1 plasmid, respectively. Cells were then lysed with 100 μl / well ice-cold RIPA buffer supplemented with protease inhibitor cocktail (Sigma). 60 μl / well Protein G-linked Sepharose bead slurry (GE Healthcare) was washed three times with ice-cold lysis buffer and incubated with 4 μg rabbit Magi-1 antibody (Abcam) or mouse anti-Slack antibody (neuroMab) in PBS containing 0.1% Tween-20 and cell lysates overnight at 4 °C on a rotator (3 wells / sample). The next day, samples were centrifuged and the supernatants were kept separately. Pellets were washed three times with cold lysis buffer and bound proteins were eluted by boiling three times for 8 min each at 9 °C. Samples were centrifuged to separate proteins into supernatants, which were then denatured with sodium dodecyl sulfate (SDS) and loaded onto Ready Gels (Bio-Rad) (4-15% Tris-HCl) as immunoprecipitates. Recovered supernatants and whole cell lysates (total input) were also denatured with SDS and run as controls. Samples were probed for Slack or Nav1.8 and actin proteins by Western blot as described above.

[0113] Surface protein biotinylation Plasma membrane protein expression was detected using a protein biotinylation assay. Briefly, CHO cells or DRG neurons in 6-well plates were used 48 hours after transient transfection of plasmid constructs or Magi-1 targeting siRNA, respectively. For peptide incubation, neurons were incubated for 24 hours. 160 μl of 10 mM Sulfo-NHS-SS-biotin (Thermo Scientific) was added to each well and incubated at room temperature for 45 minutes. Biotinylation reactions were terminated with 10 mM glycine (quenching solution). Cells were harvested, washed in TBS, and lysed in lysis buffer / protease inhibitor cocktail for 30 minutes on ice. Lysates were collected and incubated with 500 uL NeutrAvidin Agarose for 60 minutes at room temperature with rotation. Following incubation, columns were centrifuged to collect non-biotinylated proteins. To elute biotinylated proteins, sodium dodecyl sulfate (SDS) and dithiothreitol (DDT) were added to the column membrane and incubated with rotation at room temperature for 1 h. Biotinylated and non-biotinylated samples were probed for Slack or Nav1.8 and actin proteins by Western blot as described above.

[0114] Nociception (pain) testing Baseline thermal nociceptive behavior was measured using an automated Hargreaves Apparatus by Ugo Basile (Varese, Italy). Naïve C57Bl / 6 mice (8-10 weeks) (Envigo) were allowed to acclimate for 2 days, followed by measurements over 3 days. On days 1 and 2 (acclimatization), mice spent 30 min in their home cages adapted to the testing room, then were transferred to the testing chamber for 1 h. On days 3 to 5, mice were tested. The plantar surface of the hind paw was stimulated with infrared light (IR 40) through a plexiglass floor, and withdrawal latencies were measured automatically. For each subject, 3-6 measurements were made per hind paw, which were used to calculate the mean withdrawal latency (seconds). A maximum IR exposure time of 15 seconds was established to ensure that no tissue damage occurred, allowing at least 5 minutes between measurements made on the same mouse.

[0115] jetPEI (登録商標) In vivo transfection with / Magi-1 shRNA plasmid DNA polyplexes A spinal nerve injection protocol was adopted and optimized for spinal nerve injection in mice. Three days after baseline thermal behavior was established, mice were anesthetized using isoflurane (induction: 4%, maintenance: 2%) and placed in a prone position. A 3 cm posterior longitudinal skin incision was made at the lumbar region of the spine. The ipsilateral paraspinal muscles were carefully separated from their attachments at the L4-S1 levels of the spine using a pair of sterile toothpicks. 1.5 μl of PEI / shRNA plasmid DNA polyplex (N / P ratio: 6) was slowly injected directly into the spinal nerve of the right hind leg using a syringe connected to a 26-gauge needle (Hamilton 80030, Hamilton, Reno, NV). Magi-1 shRNA and control shRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and were identical to the siRNA sequences. After injection, the needle was held in the spinal nerve for 1 min to prevent leakage. Complete hemostasis was confirmed and the wounds were sutured with wound clips. Mice were allowed to recover for 7 days before being tested again for thermal nociceptive behavior.

[0116] Formalin test Prior to formalin injection, mice were habituated for 15 min in a behavioral observation room and then for 30 min in a formalin chamber. Twenty microliters of 5% formalin (in sterile saline) was injected intraplantarly into the right hind paw, and the mice were returned to the chamber for video recording. The total time spent lifting, the total number of licks, and the number of flinches were recorded at 5-min intervals for 60 min. For each video recording, measurements from two observers blinded to the experimental conditions were averaged to obtain the final measurements at each time point.

[0117] RNA extraction and cDNA synthesis RNeasy Micro Kit (Qian) was used for total RNA extraction from mouse lumbar DRG neurons. RNA was reverse transcribed with SuperScript III reverse transcriptase (Life Technologies). Polymerase chain reaction was performed using this cDNA as template with previously validated primers for Magi-1 and Na V 1.8. Transcription levels were measured by thermocycling using SYBR Green PCR Master Mix. For quantification, a two-step denaturation-annealing protocol of 50 cycles was used with a 15 second absorbance read (on a BioRad iQ5 cycler). Each sample was repeated three times.

[0118] peptide The N-terminal myristoylated PDZ peptide mimetic NPETRDETQL (SEQ ID NO: 79) was designed based on the C-terminal sequence of the rat Slack channel. This peptide and a scrambled variant peptide, QPNTRLDETE (SEQ ID NO: 80), were synthesized by GenScript. Similarly, the PY peptide SATSFPPSYDSVTRG (SEQ ID NO: 77) and the phospho-PY peptide SATSFPPSYDSV(pT)RG (SEQ ID NO: 77, where T is phosphorylated) were designed based on the WW binding domain in the rat Nav1.8 channel. These peptides and the scrambled peptide SDRPVTSYSFSAPG (SEQ ID NO: 81) were also synthesized by GenScript. The peptides were first dissolved in DMSO and diluted to final working concentrations in saline. A peptide concentration of 10 μM was used in primary neurons as previously described; the final DMSO concentration was 0.05%. Intraplantar administration was chosen based on previous studies demonstrating the analgesic effect of hindpaw intradermal injections of different myristoylated peptides.

[0119] For any phospho-threonine peptide, threonine is protected by trityl ether [Fmoc-Thr(Trt)-OH]. The trityl-protected derivative can be selectively deprotected on the resin, which is useful for the preparation of phosphothreonine-containing peptides by global phosphorylation methodology. Global phosphorylation involves selective phosphorylation of the appropriate hydroxyl threonine with a protected phosphoramidite on the solid phase, followed by oxidation of the resulting P(III) triester to a P(V) triester. Finally, myristoylation was achieved by N-myristoyltransferase, an enzyme that catalyzes (at the N-terminus) the N-myristoylation of proteins.

[0120] statistics Clampfit (Molecular Devices) and Origin 8.0 (Origin Lab) software were used for all electrophysiology data analysis. Densitometric analysis of Western blots was performed using Image J (NIH) software. Statistical analysis was performed using GraphPad Prism 4 (GraphPad, San Diego, CA). Single between-group comparisons were performed using Student's t-test. To detect pairwise between-group differences, one- or two-way ANOVA followed by multiple comparisons using Bonferroni's test were used. Data are presented as mean + / - SEM.

[0121] RNA extraction and cDNA synthesis for real-time PCR For RNA extraction from neuronal cultures, the RNeasy Micro Kit (Qiagen) was used. RNA was reverse transcribed with SuperScript III reverse transcriptase (Life Technologies) to cDNA for subsequent RT-PCR. Transcription levels were measured in a thermocycler using SYBR Green PCR Master Mix. For quantification, 50 cycles of two-step denaturation-annealing were used with a 15 s absorbance read (on a BioRad iQ5 cycler). Each sample was repeated three times. The primers for RT-PCR were as follows: Magi-1 primer 5 -GTCTTCGAGGGGGCCGAGAATATAACATGG-3 (SEQ ID NO:82) 5-GGTGGAGGGGCCGTTCCTGTCG-3 (SEQ ID NO:83) Na V 1.8 Primer 5' CCCAAAGGGCAG CAG GAGCTG-3' (SEQ ID NO:84) 5'-CGGCGAGTGCAGCCTTCTGTGA-3' (SEQ ID NO: 85) 5'-CTGCCACAAGTCCAAAAGTGTGAA-3' (SEQ ID NO: 86) 5'-AGTCATCGGGCTCGTCCAGATC-3' (SEQ ID NO: 87)

[0122] Plasmid DNA encoding MAGI-1 shRNA for human To create therapeutic shRNAs for pain treatment, we screen the human Magi-1 mRNA sequence for three unique interfering RNA sequences, then insert each one of those sequences (in DNA form) into a plasmid containing a minimal promoter for the human Nav1.8 channel, thereby creating three plasmids. Expression of the shRNAs driven under the minimal Nav1.8 channel promoter will ensure that the shRNAs targeting Magi-1 are expressed only in pain-sensing neurons.

[0123] Although the present disclosure has been described with reference to one or more particular embodiments and / or examples, it will be understood that other embodiments and / or examples of the present disclosure may be made without departing from the scope of the present disclosure.

Claims

1. The peptide consists of the following sequence: X 1 X 2 X 3 X 4 X 5 X 6 PX 7 YX 8 X 9 VX 10 X 11 X 12 (Array number 75), here, X 1 S is; X 2 is selected from S and A; X 3 is T; X 4 S is; X 5 is F; X 6 P is; X 7 S is; X 8 It is selected from E and D; X 9 S is; X 10 is selected from T and A, and T may be phosphorylated; X 11 is R; and X 12 The options are selected from P, A, and G. Here, X1 is acylated.

2. The acyl group The peptide according to claim 1, wherein n is 4 to 18.

3. The peptide according to claim 2, wherein the acyl group is a myristoyl group.

4. The peptide according to claim 3, wherein the peptide has a sequence selected from SEQ ID NOs: 4, 7, 18, and 21.

5. The peptide according to claim 3, wherein the peptide has a sequence selected from SEQ ID NOs: 11 and 14.

6. The peptide according to claim 1, wherein the peptide is selected from the group consisting of the following sequences: SATSFPPSYDSVTRG (SEQ ID NO: 42), SATSFPPSYDSVTRG (Sequence ID 49), SATSFPPSYDSVARG (SEQ ID NO: 56), or SATSFPPSYESVARG (Sequence ID 21) Here, the underlined S is myristoylated, and the underlined T is phosphorylated.

7. A composition comprising one or more peptides according to claim 1, and a pharmaceutically acceptable carrier.

8. The composition according to claim 7, further comprising one or more analgesics and / or one or more anesthetics.

9. The composition according to claim 8, wherein one or more analgesics and / or one or more anesthetics are bupivacaine, etidocaine, levobupivacaine, lidocaine, mepivacaine, prilocaine, ropivacaine, procaine, chloroprocaine, meloxicam, ketorolac, diclofenac, ketoprofen, piroxicam, metamisole, or a combination thereof.

10. A composition for use in pain treatment, comprising one or more peptides as described in Claim 1.

11. The composition according to claim 10, to be used in conjunction with one or more analgesics and / or one or more anesthetics.

12. The composition according to claim 10, to be used before expected pain.

13. The composition according to claim 10, wherein the peptide has a sequence selected from SEQ ID NOs: 4, 7, 21, and combinations thereof.

14. The composition according to claim 10, wherein the peptide has a sequence selected from SEQ ID NOs: 42, 56, and combinations thereof.

15. The composition according to claim 7, comprising one or more peptides having the following sequence: SATSFPPSYDSVTRG (Sequence ID 42), SATSFPPSYDSVTRG (Sequence ID 49), SATSFPPSYDSVARG (SEQ ID NO: 56), or SATSFPPSYESVARG (Sequence ID 21) Here, the underlined S is myristoylated, and the underlined T is phosphorylated.

16. A peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70.

17. A composition for treating pain, comprising a peptide selected from the group consisting of SEQ ID NOs: 7, 21, 42, and 56.

18. A composition for enhancing pain sensitivity, comprising a peptide selected from the group consisting of SEQ ID NOs: 14, 28, 35, 49, 63, and 70.

Images