Immunogenic compositions for use in pneumococcal vaccines

JP2024103612A5Pending Publication Date: 2026-05-15PFIZER INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
PFIZER INC
Filing Date
2024-05-29
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Existing pneumococcal vaccines face challenges in providing adequate protection against multiple serotypes of Streptococcus pneumoniae, particularly serotypes 15A, 15B, and 15C, due to interference between conjugates in multivalent vaccines, limiting the number of conjugates that can be included and affecting immunogenicity.

Method used

A method involving immunization with a combination of saccharide conjugates from S. pneumoniae serotypes 15A and 15C, without including the capsular saccharide from serotype 15B, or with serotype 15B conjugate and without 15C saccharide, to enhance cross-reactive antibody responses and provide broad protection.

Benefits of technology

This approach enhances immunogenicity and cross-reactivity, providing effective protection against serotypes 15A, 15B, and 15C by minimizing interference and optimizing the number of conjugates in the vaccine composition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

To provide immunogenic compositions for protection against S. pneumoniae, in particular against S. pneumoniae serogroup 15, while limiting the number of conjugates.SOLUTION: The present invention relates to new immunogenic compositions for use in pneumococcal vaccines and to vaccination of human subjects, in particular infants and elderly, against pneumococcal infections using the immunogenic compositions.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] It is an object of the present invention to provide an immunogenic composition for protection against S. pneumoniae serogroup 15. The immunogenic composition of the present invention typically comprises conjugated capsular saccharide antigens (saccharide conjugates), in which the saccharide is derived from a serotype of Streptococcus pneumoniae. The present invention relates to novel immunogenic compositions for use in pneumococcal vaccines. [Background technology]

[0002] Infections caused by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia and meningitis are the most common symptoms of invasive pneumococcal disease, while bacterial dissemination within the respiratory tract can lead to middle ear infections, sinusitis or recurrent bronchitis. Compared to invasive disease, non-invasive symptoms are usually less severe but are significantly more common.

[0003] Streptococcus pneumoniae (the pneumococcus), the causative agent of pneumococcal disease, is a Gram-positive encapsulated coccus surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow serological differentiation between the approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are rare. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; among the more common non-invasive symptoms are otitis media, sinusitis, and bronchitis.

[0004] Pneumococcal conjugate vaccine (PCV) is a pneumococcal vaccine used to protect against disease caused by S. pneumoniae (the pneumococcus). Currently, there are three PCV vaccines available on the global market: PREVNAR® (called Prevenar in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine) and PREVNAR13® (13-valent vaccine).

[0005] The specific serotypes causing the more than 13 diseases in PREVNAR13® vary by region, population, and may change over time due to the acquisition of antibiotic resistance, the introduction of pneumococcal vaccines, and secular trends of unknown origin.

[0006] Adding conjugates to an immunogenic composition is not a straightforward process, as combining conjugates into a single multivalent injection can result in competition between the different components, which can have deleterious effects on the immunogenicity of the individual conjugates.

[0007] This phenomenon of interference may limit the number of conjugates that can be included in a multivalent vaccine, and thus protection against multiple serotypes while limiting the number of conjugates in the composition, although of considerable value, may be very difficult to achieve.

[0008] S. pneumoniae serogroup 15 includes four serotypes: 15A, 15B, 15C, and 15F.

[0009] Serotypes 15A, 15B, and 15C are of particular concern, while 15F appears to be of less medical concern (see, e.g., Cui YA et al., Hum Vaccin Immunother. 2017;13(6):1-13).

[0010] It is an object of the present invention to provide an immunogenic composition or vaccine schedule for adequate protection against S. pneumoniae, in particular S. pneumoniae serotypes 15A, 15B and 15C, while limiting the number of conjugates. [Prior art documents] [Patent documents]

[0011] [Patent Document 1] WO2019 / 139692 [Patent Document 2] WO2004 / 083251 [Patent Document 3] WO2006 / 110381 [Patent Document 4] WO2008 / 118752 [Patent Document 5] US Patent Application Publication No. 2006 / 0228380 [Patent Document 6] US Patent Application Publication No. 2006 / 0228381 [Patent Document 7] US Patent Application Publication No. 2008 / 0102498 [Patent Document 8] US Patent Application Publication No. 2008 / 0286838 [Patent Document 9] WO2006 / 110352 [Patent Document 10] WO2015 / 110942 [Patent Document 11] WO2005 / 033148 [Patent Document 12] WO00 / 56357 [Patent Document 13] WO93 / 15760 [Patent Document 14] WO95 / 08348 [Patent Document 15] WO96 / 129094 [Patent Document 16] International Patent Application No. WO98 / 42721 [Patent Document 17] U.S. Patent Application Publication No. 2007 / 184072 [Patent Document 18] U.S. Patent Application Publication No. 2007 / 0231340 [Patent Document 19] U.S. Patent Application Publication No. 2007 / 0184071 [Patent Document 20] WO2008 / 079653 [Patent Document 21] WO2008 / 143709 [Patent Document 22] WO2014 / 097099 [Patent Document 23] WO2014 / 027302 [Patent Document 24] CN103495161 [Patent Document 25] U.S. Patent No. 4,709,017 [Patent Document 26] U.S. Patent No. 4,950,740 [Patent Document 27] U.S. Patent No. 5,917,017 [Patent Document 28] U.S. Patent No. 6,455,673 [Patent Document 29] U.S. Patent No. 5,843,711 [Patent Document 30] WO2004 / 081515 [Patent Document 31] WO2006 / 032499 [Patent Document 32] WO00 / 37105 [Patent Document 33] WO00 / 39299 [Patent Document 34] WO01 / 98334 [Patent Document 35] WO03 / 054007 [Patent Document 36] WO2009 / 000826 [Patent Document 37] EP0372501 [Patent Document 38] EP0594610B [Patent Document 39] EP0378881 [Patent Document 40] EP0427347 [Patent Document 41] WO93 / 17712 [Patent Document 42] WO94 / 03208 [Patent Document 43] WO98 / 58668 [Patent Document 44] EP0471177 [Patent Document 45] WO91 / 01146 [Patent Document 46] WO02 / 091998 [Patent Document 47] WO01 / 72337 [Patent Document 48] WO00 / 61761 [Patent Document 49] U.S. Patent No. 5,614,382 [Patent Document 50] WO90 / 03184 [Patent Document 51] WO96 / 11711 [Patent Document 52] WO00 / 48630 [Patent Document 53] WO98 / 36772 [Patent Document 54] WO00 / 41720 [Patent Document 55] WO2006 / 134423 [Patent Document 56] WO2007 / 026190 [Patent Document 57] WO00 / 07621 [Patent Document 58] WO99 / 44636 [Patent Document 59] GB-2220221 [Patent Document 60] EP0689454 [Patent Document 61] WO00 / 56358 [Patent Document 62] EP0835318 [Patent Document 63] EP0735898 [Patent Document 64] EP0761231 [Patent Document 65] WO99 / 52549 [Patent Document 66] WO01 / 21207 [Patent Document 67] WO01 / 21152 [Patent Document 68] WO00 / 62800 [Patent Document 69] WO00 / 23105 [Patent Document 70] WO99 / 11241 [Patent Document 71] WO98 / 57659 [Patent Document 72] U.S. Patent No. 6,194,388 [Patent Document 73] U.S. Patent No. 6,207,646 [Patent Document 74] U.S. Patent No. 6,214,806 [Patent Document 75] U.S. Patent No. 6,218,371 [Patent Document 76] U.S. Patent No. 6,239,116 [Patent Document 77] U.S. Patent No. 6,339,068 [Patent Document 78] WO2010 / 125480 [Patent Document 79] WO96 / 02555 [Patent Document 80] WO98 / 18810 [Patent Document 81] WO03 / 024480 [Non-patent literature]

[0012] [Non-Patent Document 1] Cui YA et al. Hum Vaccin Immunother.2017;13(6):1~13 [Non-Patent Document 2] Lemercinier et al. (1996) Carbohydrate Research 296:83~96 [Non-Patent Document 3] Jones et al. (2002) J.Pharmaceutical and Biomedical Analysis 30:1233~1247 [Non-Patent Document 4] Hestrin (1949) J. Biol. Chem. 180:249~261 [Non-Patent Document 5] Bethell et al. (1979) J. Biol. Chem. 254:2572-2574 [Non-Patent Document 6] Hearn et al. (1981) J. Chromatogr. 218:509-518 [Non-Patent Document 7] Uchida et al. (1973) J. Biol. Chem. 218:3838~3844 [Non-Patent Document 8] Nicholls and Youle, Genetically Engineered Toxins, edited by Frankel, Maecel Dekker Inc. (1992) [Non-Patent Document 9] Kuo et al. (1995) Infect Immun 63:2706-2713 [Non-Patent Document 10] Falugi et al. (2001) Eur J Immunol 31:3816~3824 [Non-Patent Document 11] Baraldoi et al. (2004) Infect Immun 72:4884-4887 [Non-Patent Document 12] Douglas et al. (1987) J.Bacteriol.169(11):4967~4971 [Non-Patent Document 13] Uchida et al. (1971) Nature New Biology 233:8-11 [Non-Patent Document 14] Sjolander et al. (1998) J. Leukocyte Biol. 64:713 [Non-Patent Document 15] Uhlmann et al. (1990) Chem. Rev. 90:543 [Non-Patent Document 16] S. Agrawal, ed., Humana Press, Totowa, USA, 1993 [Non-Patent Document 17] Crooke et al. (1996) Annu.Rev.Pharmacol.Toxicol., 36:107~129 [Non-Patent Document 18] Hunziker et al. (1995) Mod.Synth.Methods, 7:331~417 [Non-Patent Document 19] WHO, “Training Manual For Enzyme Linked Immunosorbent Assay For The Quantitation Of Streptococcus pneumoniae Serotype Specific IgG(Pn PS ELISA)” (https: / / www.vaccine.uab.edu / uploads / mdocs / ELISAProtocol(007sp).pdf [Non-Patent Document 20] https: / / clinicaltrials.gov / ct2 / show / NCT02955160 [Non-Patent Document 21] https: / / clinicaltrials.gov / ct2 / show / NCT03313037 [Non-Patent Document 22] Hu et al. (2005), Clin Diagn Lab Immunol 12:287~295 Summary of the Invention [Problem to be solved by the invention]

[0013] WO2019 / 139692 tests cross-protection across serogroup 15 (see, e.g., Example 42, pages 133-134). WO2019 / 139692 discloses that immunization with serotype 15A, 15B, or 15C monovalent pneumococcal conjugate vaccines resulted in comparable post-second dose IgG and OPA titers with homologous and heterologous polysaccharides and bacterial strains, respectively. WO2019 / 139692 discloses that rabbits immunized with 15A, 15B, or 15C conjugates all showed cross-reactivity to each pneumococcal polysaccharide (15A, 15B, and 15C) (see FIG. 17). WO2019 / 139692 concludes that there were no significant differences in IgG titers across serogroup 15, and that rabbits immunized with 15A, 15B, or 15C conjugates all showed cross-reactivity to each S. pneumoniae bacterial strain (15A, 15B, 15C) since all rabbit hyperimmune sera showed functional antibodies to each strain evaluated and killed bacteria (see Figure 18 and page 134, lines 9-13). WO2019 / 139692 found no significant differences in OPA titers across serogroup 15.

[0014] Contrary to what WO2019 / 139692 suggests, it was unexpectedly found that in humans, serotype 15B polysaccharide conjugates, in addition to inducing functionally reactive antibodies against serotype 15B, can also induce strong cross-functional responses against serotype 15C isolates, but only weaker cross-functional responses against serotype 15A.

[0015] Therefore, to achieve optimal protection against S. pneumoniae serotypes 15A, 15B, and 15C, it is preferred to immunize a subject with both serotype 15B and 15A polysaccharide conjugates, or with both serotype 15C and 15A polysaccharide conjugates.

[0016] To provide protection against S. pneumoniae serotypes 15A, 15B, and 15C, subjects can be immunized with serotype 15B polysaccharide conjugates, serotype 15C polysaccharide conjugates, and serotype 15A polysaccharide conjugates. [Means for solving the problem]

[0017] The present invention relates to an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B or 15C and a glycoconjugate from S. pneumoniae serotype 15A for use in a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C. Preferably, said composition does not comprise capsular saccharides from S. pneumoniae serotype 15C when a glycoconjugate from S. pneumoniae serotype 15B is present in the composition, and does not comprise capsular saccharides from S. pneumoniae serotype 15B when a glycoconjugate from S. pneumoniae serotype 15C is present in the composition.

[0018] The present invention relates to an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B and a glycoconjugate from S. pneumoniae serotype 15A for use in a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C. Preferably, said composition does not comprise capsular saccharides from S. pneumoniae serotype 15C.

[0019] The present invention also relates to an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C and a glycoconjugate from S. pneumoniae serotype 15A for use in a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C. Preferably, said composition does not include capsular saccharides from S. pneumoniae serotype 15B.

[0020] The present invention also relates to immunogenic compositions comprising glycoconjugates derived from S. pneumoniae serotype 15B, glycoconjugates derived from S. pneumoniae serotype 15B and glycoconjugates derived from S. pneumoniae serotype 15A for use in methods of immunizing human subjects against infection with S. pneumoniae serotypes 15A, 15B and 15C.

[0021] In one aspect, the invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, but not a capsular saccharide from S. pneumoniae serotype 15B, for use in a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C, wherein said compositions are for simultaneous, concurrent, concomitant or sequential administration.

[0022] In one aspect, the invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, and not a capsular saccharide from S. pneumoniae serotype 15C, for use in a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C, wherein said compositions are for simultaneous, concurrent, concomitant or sequential administration.

[0023] In one aspect, the present invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A and a glycoconjugate from S. pneumoniae serotype 15C, for use in a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B, and 15C, wherein the compositions are for simultaneous, concurrent, concomitant, or sequential administration.

[0024] In one aspect the invention relates to a method of immunising a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C comprising administering to the human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B or 15C and a glycoconjugate from S. pneumoniae serotype 15A, wherein the glycoconjugate from S. pneumoniae serotype 15B is present in the composition and wherein the glycoconjugate from S. pneumoniae serotype 15C is absent and wherein the glycoconjugate from S. pneumoniae serotype 15C is absent in the composition.

[0025] In one aspect the invention relates to a method of immunising a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C comprising administering to the human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B and a glycoconjugate from S. pneumoniae serotype 15A, and no capsular saccharide from S. pneumoniae serotype 15C.

[0026] In one aspect the invention relates to a method of immunising a human subject against infection with S. pneumoniae serotypes 15A, 15B and 15C comprising administering to the human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C and a glycoconjugate from S. pneumoniae serotype 15A, and not a capsular saccharide from S. pneumoniae serotype 15B.

[0027] In one aspect, the present invention relates to a method of immunizing a human subject against infection with S. pneumoniae serotypes 15A, 15B, and 15C, comprising administering to the human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate derived from S. pneumoniae serotype 15C, a glycoconjugate derived from S. pneumoniae serotype 15B, and a glycoconjugate derived from S. pneumoniae serotype 15A.

[0028] The present invention relates to an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B or 15C and a glycoconjugate from S. pneumoniae serotype 15A for use in a method of preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C in a human subject. Preferably, said composition does not comprise capsular saccharides from S. pneumoniae serotype 15C when a glycoconjugate from S. pneumoniae serotype 15B is present in the composition, and does not comprise capsular saccharides from S. pneumoniae serotype 15B when a glycoconjugate from S. pneumoniae serotype 15C is present in the composition.

[0029] The present invention relates to an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B and a glycoconjugate from S. pneumoniae serotype 15A for use in a method of preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C in a human subject. Preferably, said composition does not comprise capsular saccharide from S. pneumoniae serotype 15C.

[0030] The present invention also relates to an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C and a glycoconjugate from S. pneumoniae serotype 15A for use in a method of preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C in a human subject. Preferably, said composition does not include capsular saccharides from S. pneumoniae serotype 15B.

[0031] The present invention also relates to immunogenic compositions comprising a glycoconjugate derived from S. pneumoniae serotype 15B, a glycoconjugate derived from S. pneumoniae serotype 15C, and a glycoconjugate derived from S. pneumoniae serotype 15A for use in a method of preventing, treating, or ameliorating an infection, disease, or condition associated with infection by S. pneumoniae serotypes 15A, 15B, and 15C in a human subject.

[0032] In one aspect, the present invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, but not a capsular saccharide from S. pneumoniae serotype 15B, for use in a method of preventing, treating or ameliorating an infection, disease or condition associated with infection with S. pneumoniae serotypes 15A, 15B and 15C in a human subject, wherein said compositions are for simultaneous, concurrent, concomitant or sequential administration.

[0033] In one aspect, the present invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, and not a capsular saccharide from S. pneumoniae serotype 15C, for use in a method of preventing, treating or ameliorating an infection, disease or condition associated with infection with S. pneumoniae serotypes 15A, 15B and 15C in a human subject, wherein said compositions are for simultaneous, concurrent, concomitant or sequential administration.

[0034] In one aspect, the present invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C and a glycoconjugate from S. pneumoniae serotype 15A, for use in a method of preventing, treating, or ameliorating an infection, disease, or condition associated with infection with serotypes 15A, 15B, and 15C in a human subject, wherein the compositions are for simultaneous, concurrent, concomitant, or sequential administration.

[0035] In one aspect the invention relates to a method of preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C comprising administering to a human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B or 15C and a glycoconjugate from S. pneumoniae serotype 15A, wherein the glycoconjugate from S. pneumoniae serotype 15B is present in the composition and wherein the glycoconjugate from S. pneumoniae serotype 15C is absent and wherein the glycoconjugate from S. pneumoniae serotype 15C is absent in the composition.

[0036] In one aspect, the present invention relates to a method of preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C comprising administering to a human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B and a glycoconjugate from S. pneumoniae serotype 15A, and no capsular saccharide from S. pneumoniae serotype 15C.

[0037] In one aspect, the present invention relates to a method of preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C comprising administering to a human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C and a glycoconjugate from S. pneumoniae serotype 15A, and no capsular saccharide from S. pneumoniae serotype 15B.

[0038] In one aspect, the present invention relates to a method for preventing, treating or ameliorating an infection, disease or condition associated with infection by S. pneumoniae serotypes 15A, 15B and 15C, comprising administering to a human subject an immunologically effective amount of an immunogenic composition comprising a glycoconjugate derived from S. pneumoniae serotype 15B, a glycoconjugate derived from S. pneumoniae serotype 15C and a glycoconjugate derived from S. pneumoniae serotype 15A.

[0039] In one aspect, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 19F, and / or 23F.

[0040] In certain embodiments, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and / or 23F.

[0041] In certain embodiments, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate derived from S. pneumoniae serotypes 1, 5, and / or 7F.

[0042] In certain embodiments, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate derived from S. pneumoniae serotypes 6A and / or 19A.

[0043] In certain embodiments, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate from S. pneumoniae serotypes 3, 15B, 22F, 33F, 12F, 10A, 11A, and / or 8.

[0044] In a further aspect, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate derived from S. pneumoniae serotypes 2, 15C, 17F, and / or 20.

[0045] In certain embodiments, the immunogenic composition or set of immunogenic compositions further comprises at least one glycoconjugate derived from S. pneumoniae serotype 9N.

[0046] In a further aspect, the immunogenic composition or set of immunogenic compositions is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 valent pneumococcal conjugate composition.

[0047] In a further aspect, the glycoconjugate of the immunogenic composition or set of immunogenic compositions comprises a CRM 197 are individually conjugated to

[0048] In one aspect, the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of the immunogenic composition, if present, are individually conjugated to PD, the glycoconjugates from S. pneumoniae serotype 18C, if present, are conjugated to TT and the glycoconjugates from S. pneumoniae serotype 19F, if present, are conjugated to DT.

[0049] In one aspect, the glycoconjugates are prepared using reductive amination chemistry. In one aspect, the glycoconjugates are prepared using CDAP chemistry.

[0050] The immunogenic composition or set of immunogenic compositions may further comprise antigens from other pathogens, and / or at least one adjuvant, for example, aluminum phosphate, aluminum sulfate, aluminum hydroxide.

[0051] In one embodiment, the immunogenic composition or set of immunogenic compositions is capable of eliciting IgG antibodies in humans capable of binding to S. pneumoniae serotype 15A, 15B, and 15C polysaccharides at a concentration of at least 0.35 μg / ml as determined by an ELISA assay.

[0052] In one embodiment, the immunogenic composition or set of immunogenic compositions may elicit a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay (OPA).

[0053] In certain aspects, the immunogenic composition or suite of immunogenic compositions may significantly increase the rate of responders to S. pneumoniae serotypes 15A, 15B, and 15C compared to a pre-immunization population.

[0054] In certain aspects, the immunogenic composition or set of immunogenic compositions can significantly increase OPA titers in human subjects against S. pneumoniae serotypes 15A, 15B, and 15C compared to a pre-immunization population.

[0055] In one aspect, the invention relates to the use of the immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating or ameliorating an infection, disease or condition caused by S. pneumoniae serotypes 15A, 15B and 15C in a subject, for use in preventing serotype 15A, 15B and 15C S. pneumoniae infection in a subject, or for use in a method of protecting or treating humans susceptible to S. pneumoniae serotypes 15A, 15B and 15C by administration of said immunogenic composition by a systemic or mucosal route.

[0056] The present invention further relates to a kit comprising an immunogenic composition or a set of immunogenic compositions as disclosed herein and an information leaflet, said information leaflet referring to the ability of the composition or set of immunogenic compositions to induce functional antibodies against S. pneumoniae serotypes 15A, 15B, and 15C. [Brief description of the drawings]

[0057] [Figure 1] 1 is a graph showing the inverse cumulative distribution curve of OPA titers against serotype 15C (Example 3) of a panel of sera from administered vaccine 20vPnC containing 15B capsular polysaccharide conjugate or 13vPnC not containing 15B capsular polysaccharide conjugate (Study B7471002 (ClinicalTrials.gov Identifier: NCT03313037)). The plot represents the percent of sera with OPA positive titers (i.e., ≧1:8). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0058] 1 Immunogenic compositions comprising glycoconjugates derived from S. pneumoniae serotype 15B and / or 15C and glycoconjugates derived from S. pneumoniae serotype 15A of the present invention The immunogenic compositions of the invention typically comprise conjugated capsular saccharide antigens (also termed glycan conjugates), where the saccharide is derived from a serotype of S. pneumoniae.

[0059] Preferably, the number of S. pneumoniae capsular saccharides may range from 2 serotypes (or "v", valence) to 25 different serotypes (25v). In one embodiment, 2 different serotypes are present. In one embodiment, 3 different serotypes are present. In one embodiment, 4 different serotypes are present. In one embodiment, 5 different serotypes are present. In one embodiment, 6 different serotypes are present. In one embodiment, 7 different serotypes are present. In one embodiment, 8 different serotypes are present. In one embodiment, 9 different serotypes are present. In one embodiment, 10 different serotypes are present. In one embodiment, 11 different serotypes are present. In one embodiment, 12 different serotypes are present. In one embodiment, 13 different serotypes are present. In one embodiment, 14 different serotypes are present. In one embodiment, 15 different serotypes are present. In one embodiment, 16 different serotypes are present. In one embodiment, 17 different serotypes are present. In one embodiment, 18 different serotypes are present. In one embodiment, 19 different serotypes are present. In one embodiment there are 20 different serotypes. In one embodiment there are 21 different serotypes. In one embodiment there are 22 different serotypes. In one embodiment there are 23 different serotypes. In one embodiment there are 24 different serotypes. In one embodiment there are 25 different serotypes. The capsular saccharide is conjugated to a carrier protein to form a saccharide conjugate as described herein below.

[0060] If the protein carrier is the same for two or more sugars in a composition, the sugars can be conjugated to the same molecule of the protein carrier (the carrier molecule to which two or more different sugars are conjugated) [see, e.g., WO2004 / 083251].

[0061] However, in a preferred embodiment, the saccharides are each individually conjugated to different molecules of the protein carrier (only each molecule of the protein carrier has one type of saccharide conjugated to it), in which embodiment the capsular saccharides are said to be individually conjugated to the carrier protein.

[0062] For the purposes of the present invention, the term "glycoconjugate" refers to a capsular saccharide covalently linked to a carrier protein. In one embodiment, the capsular saccharide is directly linked to the carrier protein. In a second embodiment, the bacterial saccharide is linked to the protein via a spacer / linker.

[0063] 1.1 Capsular saccharides of the invention Throughout this specification the term "saccharide" may refer to a polysaccharide or an oligosaccharide, and includes both polysaccharides and oligosaccharides. In frequent embodiments the saccharide is a polysaccharide, in particular a S. pneumoniae capsular polysaccharide.

[0064] Capsular polysaccharides are prepared by standard techniques known to those skilled in the art.

[0065] Typically, capsular polysaccharides are produced by growing the respective S. pneumoniae serotypes in a medium (e.g., a soy-based medium) and then preparing the polysaccharides from the bacterial culture. The bacterial strains of S. pneumoniae used to make the respective polysaccharides used in the glycoconjugates of the present invention can be obtained from established culture collections or clinical specimens.

[0066] Populations of organisms (respective S. pneumoniae serotypes) are often scaled up from seed vials to seed bottles and passaged through one or more large-volume seed fermenters until a production-scale fermentation volume is reached. At the end of the growth cycle, the cells are lysed and the lysis broth is then harvested for downstream (purification) processing (see, e.g., WO2006 / 110381, WO2008 / 118752, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0067] Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752).

[0068] The purified polysaccharides can be activated (e.g., chemically activated) as further described herein to render them capable of reacting (e.g., directly with a carrier protein or via a linker such as an eTEC spacer) and then incorporated into a glycoconjugate of the invention.

[0069] The S. pneumoniae capsular polysaccharide comprises repeating oligosaccharide units that may contain up to eight sugar residues.

[0070] In one embodiment the capsular saccharide of the invention may be a single oligosaccharide unit, or a saccharide chain that is shorter than the natural length of the repeating oligosaccharide unit, hi one embodiment the capsular saccharide of the invention is a single repeating oligosaccharide unit of the relevant serotype.

[0071] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide, which has a small number of repeating units (typically between 5 and 15 repeating units) and is typically derived synthetically or by hydrolysis of a polysaccharide.

[0072] In an embodiment, the capsular saccharide of the invention, and all capsular saccharides in the immunogenic compositions of the invention, are polysaccharides. Capsular polysaccharides of high molecular weight are capable of inducing a certain antibody immune response due to epitopes present on their antigenic surface. For use in the conjugates, compositions and methods of the invention, isolation and purification of high molecular weight capsular polysaccharides is preferably contemplated.

[0073] In certain embodiments, the purified polysaccharide prior to conjugation has a molecular weight of between 5 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 10 kDa and 4,000 kDa, 50 kDa and 4,000 kDa, 50 kDa and 3,000 kDa, 50 kDa and 2,000 kDa, 50 kDa and 1,500 kDa, 50 kDa and 1,000 kDa, 50 kDa and 750 kDa, 50 kDa and 500 kDa, 100 kDa and 4,000 kDa, 100 kDa and 3,000 kDa, 100 kDa and 4,000 kDa, 100 kDa and 5 ... The capsular polysaccharide has a molecular weight of Da to 2,000 kDa, 100 kDa to 1,500 kDa, 100 kDa to 1,000 kDa, 100 kDa to 750 kDa, 100 kDa to 500 kDa, 100 to 400 kDa, 200 kDa to 4,000 kDa, 200 kDa to 3,000 kDa, 200 kDa to 2,000 kDa, 200 kDa to 1,500 kDa, or 200 kDa to 1,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 200 kDa to 500 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 500 kDa.

[0074] In further embodiments, the capsular polysaccharide is from 5 kDa to 100 kDa, 7 kDa to 100 kDa, 10 kDa to 100 kDa, 20 kDa to 100 kDa, 30 kDa to 100 kDa, 40 kDa to 100 kDa, 50 kDa to 100 kDa, 60 kDa to 100 kDa, 70 kDa to 100 kDa, 80 and / or has a molecular weight of from 5 kDa to 100 kDa, 90 kDa to 100 kDa, 5 kDa to 90 kDa, 5 kDa to 80 kDa, 5 kDa to 70 kDa, 5 kDa to 60 kDa, 5 kDa to 50 kDa, 5 kDa to 40 kDa, 5 kDa to 30 kDa, 5 kDa to 20 kDa, or 5 kDa to 10 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0075] Polysaccharides may become slightly reduced in size during normal purification procedures. In addition, polysaccharides may be subjected to sizing techniques prior to conjugation. Mechanical or chemical sizing techniques can be used.

[0076] For example, serotype 15B saccharides can be mechanically sized (see, e.g., WO2015 / 110942). Serotype 15A saccharides can also be mechanically sized (see, e.g., WO2019 / 139692, examples 15-16). Serotype 15C saccharides can also be mechanically sized (see, e.g., WO2019 / 139692, examples 18-19).

[0077] Serotype 15A saccharides may also be chemically sized. Serotype 15C saccharides may also be chemically sized. Chemical hydrolysis may be performed using acetic acid. Serotype 15B saccharides are preferably not chemically sized in order to preserve an O-acetyl content close to that found in the native capsular polysaccharide.

[0078] Mechanical sizing may be performed by high pressure homogenization shear. The molecular weight ranges above refer to purified polysaccharides prior to conjugation (e.g., prior to activation).

[0079] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide from S. pneumoniae of serotype 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15A, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F or 33F, wherein the capsular polysaccharide has a molecular weight falling within one of the molecular weight ranges as described herein above.

[0080] In another preferred embodiment, the purified polysaccharide is a capsular polysaccharide from S. pneumoniae of serotype 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15A, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23B, 23F, 24F, 33F, or 35B, wherein the capsular polysaccharide has a molecular weight falling within one of the molecular weight ranges as described herein above.

[0081] As used herein, the term "molecular weight" of a polysaccharide, or a carrier protein-polysaccharide conjugate, refers to the weight average molecular weight (Mw), which can be measured by size exclusion chromatography (SEC) coupled with a multi-angle laser light scattering detector (MALLS).

[0082] In an embodiment pneumococcal saccharides of the invention from serotypes 9V, 18C, 11A, 15B, 22F and / or 33F are O-acetylated. In an embodiment pneumococcal saccharides of the invention from serotypes 9V, 11A, 15B, 22F and / or 33F are O-acetylated. In a preferred embodiment pneumococcal saccharides of the invention from serotype 18C are de-O-acetylated. For example serotype 18C saccharides can be de-O-acetylated by acid treatment (see for example WO2006 / 110381, page 37 lines 1-4).

[0083] The degree of O-acetylation of polysaccharides can be determined by any method known in the art, for example, proton NMR (see, for example, Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO2005 / 033148; and WO00 / 56357). Another commonly used method is described in Hestrin (1949) J. Biol. Chem. 180:249-261. The presence of O-acetyl groups is preferably determined by ionic HPLC analysis.

[0084] The purified polysaccharides described herein can be chemically activated to yield saccharides capable of reacting with carrier proteins. These pneumococcal conjugates are prepared by separate processes and formulated into single dose formulations as described below.

[0085] 1.2 Glycoconjugates of the Invention The purified saccharides are chemically activated to render them capable of reacting with a carrier protein, either directly or via a linker (i.e., activated saccharides). Once activated, each capsular saccharide is separately conjugated to a carrier protein to form a saccharide conjugate. In one embodiment, each capsular saccharide is conjugated to the same carrier protein. Chemical activation of the saccharides and subsequent conjugation to a carrier protein can be achieved by the activation and conjugation methods disclosed herein.

[0086] Capsular polysaccharide from S. pneumoniae is prepared as disclosed above.

[0087] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to a carrier protein, preferably a CRMP.197 The polysaccharide is coupled to the amino group on the carrier directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be linked to the carrier by a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyloxy]succinimide ester (GMBS)) or with a haloacetylated carrier protein (e.g., using iodoacetimide, N-succinimidyl bromoacetate (SBA, SIB), N-succinimidyl (4-iodoacetyl)aminobenzoate (SlAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]proprionate (SBAP)). Preferably, the cyanate ester (which may be made by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is attached to the carrier protein (e.g., CRMP) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier. 197 Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348, and WO 96 / 129094.

[0088] In one embodiment of the invention, glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F, and / or 33F are prepared using CDAP chemistry. In one embodiment of the invention, glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry. In one embodiment of the invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry. In one embodiment of the invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared using CDAP chemistry. In one embodiment of the invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared using CDAP chemistry. In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared using CDAP chemistry.

[0089] Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application WO98 / 42721. Conjugation may involve carbonyl linkers that can be generated by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518) and then reacting with the protein to create a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0090] In a preferred embodiment, at least one of the capsular polysaccharides from S. pneumoniae of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15A, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F is conjugated to a carrier protein by reductive amination (such as those described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 184072, 2007 / 0231340, and 2007 / 0184071, WO2006 / 110381, WO2008 / 079653, and WO2008 / 143709).

[0091] In another preferred embodiment, at least one of the capsular polysaccharides from S. pneumoniae of serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15A, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23B, 23F, 24F, 33F, and 35B is conjugated to a carrier protein by reductive amination.

[0092] In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 15A is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 15B is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 15C is prepared by reductive amination.

[0093] In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 18C is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 6A is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 19A is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotype 3 is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotypes 6A and 19A is prepared by reductive amination. In a preferred embodiment of the present invention, a glycoconjugate derived from S. pneumoniae serotypes 3, 6A, and 19A is prepared by reductive amination.

[0094] In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 6B, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In a preferred embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared by reductive amination. In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared by reductive amination. In a preferred embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are all prepared by reductive amination.

[0095] In another preferred embodiment, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, and 23F are all prepared by reductive amination.

[0096] In another preferred embodiment, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15B, 18C, 19A, 19F, 22F, and 23F are all prepared by reductive amination.

[0097] In another preferred embodiment, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, and 23F are all prepared by reductive amination.

[0098] In another preferred embodiment, glycoconjugates from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are all prepared by reductive amination.

[0099] In another embodiment, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23F, and 33F are all prepared by reductive amination.

[0100] In another preferred embodiment, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 14, 15A, 15B, 18C, 19A, 19F, 22F, and 23F are all prepared by reductive amination.

[0101] In another preferred embodiment, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, and 23F are all prepared by reductive amination.

[0102] In another embodiment, glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, and 33F are all prepared by reductive amination.

[0103] In another embodiment, glycoconjugates from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F are all prepared by reductive amination.

[0104] In another embodiment, glycoconjugates from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15A, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, and 33F are all prepared by reductive amination.

[0105] In another embodiment, glycoconjugates from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15A, 15B, 15C, 17F, 18C, 19A, 19F, 20, 22F, 23B, 23F, 24F, 33F, and 35B are all prepared by reductive amination.

[0106] Reductive amination involves two steps: (1) oxidation of the polysaccharide, and (2) reduction of the activated polysaccharide and carrier protein to the conjugate. The polysaccharide is optionally hydrolyzed prior to oxidation. Mechanical or chemical hydrolysis may be used. Chemical hydrolysis may be performed using acetic acid.

[0107] The oxidation step may involve reaction with periodate ions. For purposes of the present invention, the term "periodate ions" encompasses both periodate ions and periodic acid, as well as metaperiodate ions (IO 4 - ) and orthoperiodate ion (IO 6 5- ), as well as various salts of the periodate ion (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide is reacted with the capsular polysaccharide in the presence of metaperiodate ion, preferably sodium periodate (NaIO 4 In another embodiment, the capsular polysaccharide is oxidized in the presence of orthoperiodate ion, preferably in the presence of periodic acid.

[0108] In one embodiment, the oxidizing agent is a stable nitroxyl or nitroxide radical compound, such as a piperidine-N-oxy or pyrrolidine-N-oxy compound, in the presence of an oxidant that selectively oxidizes primary hydroxyls (as described in WO2014 / 097099). In the reaction, the actual oxidant is an N-oxoammonium salt in a catalytic cycle. In one aspect, the stable nitroxyl or nitroxide radical compound is a piperidine-N-oxy or pyrrolidine-N-oxy compound. In one aspect, the stable nitroxyl or nitroxide radical compound has a TEMPO (2,2,6,6-tetramethyl-1-piperidinyloxy) or PROXYL (2,2,5,5-tetramethyl-1-pyrrolidinyloxy) moiety. In one aspect, the stable nitroxyl radical compound is TEMPO or a derivative thereof. In one aspect, the oxidant is a molecule that has an N-halo moiety. In one embodiment, the oxidant is N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, dichloroisocyanuric acid, 1,3,5-trichloro-1,3,5-triazinane-2,4,6-trione, dibromoisocyanuric acid, 1,3,5-tribromo-1,3,5-triazinane-2,4,6-trione, diiodoisocyanuric acid, or 1,3,5-triiodo-1,3,5-triazinane-2,4,6-trione. In one embodiment, the oxidant is a molecule having an N-halo moiety. In one embodiment, the oxidant is selected from the group consisting of N-chlorosuccinimide, N-bromosuccinimide, N-iodosuccinimide, dichloroisocyanuric acid, 1,3,5-trichloro-1,3,5-triazinane-2,4,6-trione, dibromoisocyanuric acid, 1,3,5-tribromo-1,3,5-triazinane-2,4,6-trione, diiodoisocyanuric acid, and 1,3,5-triiodo-1,3,5-triazinane-2,4,6-trione. Preferably, the oxidant is N-chlorosuccinimide.

[0109] In a preferred embodiment, capsular polysaccharides from serotype 12F S. pneumoniae are conjugated to carrier proteins by reductive amination, the oxidizing agent being 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and N-chlorosuccinimide (NCS) as cooxidant (as described in WO2014 / 097099). Thus, in one aspect, saccharide conjugates from S. pneumoniae serotype 12F are obtainable by a method comprising: a) reacting 12F saccharides with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous medium to produce activated saccharides; and b) reacting the activated saccharides with a carrier protein containing one or more amine groups (hereinafter, said method is referred to as "TEMPO / NCS-reductive amination").

[0110] Optionally, the oxidation reaction is quenched by adding a quenching agent, which may be selected from vicinal diols, 1,2-amino alcohols, amino acids, glutathione, sulfites, bisulfates, dithiothionates, metabisulfites, thiosulfates, phosphites, hypophosphites, or phosphorous acids (e.g., glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol, butane-2,3-diol, ascorbic acid).

[0111] After the polysaccharide oxidation step, the polysaccharide is said to be activated, hereafter referred to as "activated polysaccharide". The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized separately.

[0112] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit.

[0113] The second step of the conjugation process is the reduction of the activated polysaccharide and the carrier protein to produce the conjugate (so-called reductive amination) using a reducing agent. Suitable reducing agents include cyanoborohydride salts (sodium cyanoborohydride, sodium triacetoxyborohydride, or sodium or zinc borohydride in the presence of a Bronsted or Lewis acid), amine boranes such as pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine borane, t-BuMe, i PrN-BH 3 , benzylamine-BH 3 , 5-ethyl-2-methylpyridine borane (PEMB), or a borohydride exchange resin. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0114] In one embodiment, the reduction reaction is carried out in an aqueous solvent (e.g., selected from PBS, MES, HEPES, Bis-Tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicine, or HEPB at a pH of 6.0-8.5, 7.0-8.0, or 7.0-7.5), while in another embodiment, the reaction is carried out in an aprotic solvent. In an embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0115] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped using a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH 4 After conjugation (reduction reaction and optional capping), the glycoconjugate can be purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration operations, tangential flow filtration sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration. In one embodiment, the glycoconjugate is purified by diafiltration, ion exchange chromatography, or size exclusion chromatography.

[0116] In one embodiment, the glycoconjugate is sterile filtered.

[0117] In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry, and glycoconjugates from S. pneumoniae serotype 6A are prepared by reductive amination.

[0118] In one embodiment of the present invention, glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry, and glycoconjugates derived from S. pneumoniae serotype 19A are prepared by reductive amination.

[0119] In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry, and glycoconjugates of S. pneumoniae serotypes 6A and 19A are prepared by reductive amination.

[0120] In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F are prepared using CDAP chemistry, and glycoconjugates of S. pneumoniae serotypes 3, 6A, and 19A are prepared by reductive amination.

[0121] In one embodiment of the present invention, glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 22F, and 23F are prepared using CDAP chemistry, and glycoconjugates derived from S. pneumoniae serotype 6A are prepared by reductive amination.

[0122] In one embodiment of the present invention, glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 22F, and 23F are prepared using CDAP chemistry, and glycoconjugates derived from S. pneumoniae serotype 19A are prepared by reductive amination.

[0123] In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 22F, and 23F are prepared using CDAP chemistry, and glycoconjugates of S. pneumoniae serotypes 6A and 19A are prepared by reductive amination.

[0124] In one embodiment of the present invention, glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 8, 9V, 14, 18C, 19F, 22F, and 23F are prepared using CDAP chemistry, and glycoconjugates of S. pneumoniae serotypes 3, 6A, and 19A are prepared by reductive amination.

[0125] In one embodiment, the glycoconjugates of the present invention are prepared using eTEC conjugation, such as those described in WO2014 / 027302. The glycoconjugates comprise a sugar covalently conjugated to a carrier protein via one or more eTEC spacers, the sugar being covalently conjugated to the eTEC spacer by a carbamate bond, and the carrier protein being covalently conjugated to the eTEC spacer by an amide bond. The eTEC-linked glycoconjugates of the present invention can be represented by the general formula (I):

[0126] [ka] In the formula, the atoms that make up the eTEC spacer are contained within the central box.

[0127] The eTEC spacer is a linear set of seven atoms (i.e., -C(O)NH(CH 2 ) 2 SCH 2C(O)-), providing stable thioether and amide bonds between the sugar and the carrier protein. Synthesis of eTEC-linked sugar conjugates involves reaction of an activated hydroxyl group of the sugar with an amino group of a thioalkylamine reagent, such as cystamine or cysteine ​​amine or a salt thereof, which forms a carbamate bond to the sugar to provide a thiolated sugar. Generation of one or more free sulfhydryl groups is achieved by reaction with a reducing agent to provide an activated thiolated sugar. Reaction of the free sulfhydryl group of the activated thiolated sugar with an activated carrier protein bearing one or more α-haloacetamide groups on an amine-containing residue generates a thioether bond to form the conjugate, and the carrier protein is attached to the eTEC spacer via an amide bond.

[0128] In the above-mentioned glycoconjugates of the present invention, the saccharide may be a polysaccharide or an oligosaccharide. The carrier protein may be selected from any suitable carrier described herein or known to those skilled in the art. In frequent embodiments, the saccharide is a polysaccharide. In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the eTEC-linked glycoconjugate comprises S. pneumoniae serotype 33F capsular polysaccharide.

[0129] In a particularly preferred embodiment, the eTEC-linked glycoconjugate is linked to a CRM via an eTEC spacer. 197 (serotype 33F eTEC-linked glycoconjugate).

[0130] In certain embodiments, glycoconjugates derived from S. pneumoniae serotypes 1, 7F, 9V, and / or 18C of the present invention are O-acetylated. In certain embodiments, glycoconjugates derived from S. pneumoniae serotypes 1, 7F, and 9V are O-acetylated and glycoconjugates derived from S. pneumoniae serotype 18C are de-O-acetylated.

[0131] In certain embodiments, the sugar conjugates of the invention comprise a saccharide having a molecular weight between 5 kDa and 2,000 kDa. In other such embodiments, the saccharide has a molecular weight between 50 kDa and 1,000 kDa. In other such embodiments, the saccharide has a molecular weight between 70 kDa and 900 kDa. In other such embodiments, the saccharide has a molecular weight between 100 kDa and 800 kDa. In other such embodiments, the saccharide has a molecular weight between 200 kDa and 600 kDa. In other such embodiments, the saccharide has a molecular weight between 100 kDa and 500 kDa. In other such embodiments, the saccharide has a molecular weight between 100 kDa and 400 kDa. In other such embodiments, the saccharide has a molecular weight between 150 kDa and 300 kDa. In further embodiments, the sugar has a molecular weight of from 5 kDa to 100 kDa, 10 kDa to 100 kDa, 20 kDa to 100 kDa, 30 kDa to 100 kDa, 40 kDa to 100 kDa, 50 kDa to 100 kDa, 60 kDa to 100 kDa, 70 kDa to 100 kDa, 80 kDa to 100 kDa, 90 kDa to 100 kDa, 5 kDa to 90 kDa, 5 kDa to 80 kDa, 5 kDa to 70 kDa, 5 kDa to 60 kDa, 5 kDa to 50 kDa, 5 kDa to 40 kDa, 5 kDa to 30 kDa, 5 kDa to 20 kDa, or 5 kDa to 10 kDa. Any natural integer within any of the above ranges is contemplated as being an embodiment of the present disclosure. In some such embodiments, the glycoconjugates are prepared using reductive amination.

[0132] In certain embodiments, the glycoconjugates of the present invention have a molecular weight of 100 kDa to 15,000 kDa. In certain embodiments, the glycoconjugates of the present invention have a molecular weight of 100 kDa to 10,000 kDa. In certain embodiments, the glycoconjugates of the present invention have a molecular weight of 2,000 kDa to 10,000 kDa. In certain embodiments, the glycoconjugates of the present invention have a molecular weight of 3,000 kDa to 8,000 kDa. In certain embodiments, the glycoconjugates of the present invention have a molecular weight of 3,000 kDa to 5,000 kDa. In other embodiments, the glycoconjugates of the present invention have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the glycoconjugates of the present invention have a molecular weight of 1,000 kDa to 8,000 kDa. In yet other embodiments, the glycoconjugate has a molecular weight of between 2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000 kDa.

[0133] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0134] Another means for characterizing the glycoconjugates of the invention is to characterize the carrier protein (e.g., CRMP) that is conjugated to the sugar. 197) and can be characterized as the extent of conjugated lysines (degree of conjugation). Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. As a result of conjugation, the number of lysine residues recovered is reduced compared to the carrier protein starting material used to generate the conjugated material. In a preferred embodiment, the degree of conjugation of the glycoconjugates of the present invention is 2-15. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is 2-13. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is 2-10. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is 2-8. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is 2-6. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is 3-10. In one embodiment, the degree of conjugation of the glycoconjugates of the present invention is 3-6. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is 5 to 10. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is 8 to 12. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 2. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 3. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 4. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 5. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 6. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 8. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 10. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 12. In certain embodiments, the conjugation degree of the sugar conjugate of the present invention is about 15. In a preferred embodiment, the degree of conjugation of the glycoconjugates of the present invention is 4-7.In some such embodiments, the carrier protein is a CRM. 197 It is.

[0135] The glycoconjugates of the present invention can also be characterized by the sugar to carrier protein ratio (w / w). In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is 0.5 to 3. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is about 0.8. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is about 0.9. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is about 1.0. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is about 1.2. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is about 1.5. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is about 1.8. In certain embodiments, the ratio of polysaccharide to carrier protein (w / w) in the glycoconjugate is about 2.0. In certain embodiments, the ratio of polysaccharide to carrier protein (w / w) in the glycoconjugate is about 2.5. In certain embodiments, the ratio of polysaccharide to carrier protein (w / w) in the glycoconjugate is about 3.0. In other embodiments, the ratio of saccharide to carrier protein (w / w) is between 0.5 and 2.0. In other embodiments, the ratio of saccharide to carrier protein (w / w) is between 0.5 and 1.5. In further embodiments, the ratio of saccharide to carrier protein (w / w) is between 0.8 and 1.2. In preferred embodiments, the ratio of capsular polysaccharide to carrier protein in the conjugate is between 0.9 and 1.1. In some such embodiments, the carrier protein is CRM. 197 It is.

[0136] The glycoconjugates and immunogenic compositions of the invention may include free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or encapsulated within or together with the glycoconjugate).

[0137] In preferred embodiments, the saccharide conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free polysaccharide based on the total amount of polysaccharide. In preferred embodiments, the saccharide conjugate comprises less than about 25% free polysaccharide based on the total amount of polysaccharide. In preferred embodiments, the saccharide conjugate comprises less than about 20% free polysaccharide based on the total amount of polysaccharide. In preferred embodiments, the saccharide conjugate comprises less than about 15% free polysaccharide based on the total amount of polysaccharide.

[0138] The glycoconjugates are characterized by their molecular size distribution (K d ) can also be characterized. A size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from small pores in the medium elute more quickly than smaller molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically with a sugar assay. K d For the determination of 0 ), (K d =0), and the fraction showing maximum retention (V i ), (K d The column is calibrated to establish the fraction at which a particular sample attribute is reached (V e ) into the formula K d =(V e -V 0 ) / (V i -V 0 ) by K dand associate it with.

[0139] In a preferred embodiment, at least 30% of the glycoconjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, at least 40% of the glycoconjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the glycoconjugates have a K of 0.3 or less in CL-4B. d In a preferred embodiment, at least 60% of the glycoconjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, 50% to 80% of the glycoconjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, 65% to 80% of the glycoconjugates have a K of 0.3 or less on a CL-4B column. d has.

[0140] The frequency with which glycans are attached to lysines on the carrier protein is another parameter for characterizing the glycoconjugates of the invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 4 saccharide repeating units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every 10 saccharide repeating units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every 15 saccharide repeating units of the polysaccharide. In a further embodiment, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every 25 saccharide repeating units of the polysaccharide.

[0141] In frequent embodiments, the carrier protein is a CRM 197 And CRM 197 The covalent bond between the polysaccharide and the eTEC spacer occurs every 4, 10, 15, or 25 saccharide repeat units of the polysaccharide.

[0142] In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 5-10 saccharide repeating units. In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 2-7 saccharide repeating units. In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 7-12 saccharide repeating units. In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 10-15 saccharide repeating units. In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 4-8 saccharide repeating units. In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 10-20 saccharide repeating units. In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 2-25 saccharide repeating units. In frequent embodiments, the carrier protein is a CRM. 197 It is.

[0143] In another embodiment, at least one bond between the carrier protein and the saccharide is present every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 saccharide repeat units of the polysaccharide. 197 Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0144] 1.4 Carrier Proteins of the Invention A component of the glycoconjugate of the present invention is a carrier protein to which a sugar is conjugated. The terms "protein carrier" or "carrier protein" or "carrier" can be used interchangeably herein. The carrier protein should be suitable for standard conjugation procedures.

[0145] In a preferred embodiment, the carrier protein of the glycoconjugate is DT (diphtheria toxin), TT (tetanus toxoid) or fragment C of TT, CRM 197(a non-toxic but antigenically identical variant of diphtheria toxin), diphtheria toxin mutant CRM 197(CN103495161), other DT mutants (e.g., CRM176, CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM9, CRM102, CRM103, CRM107; Nicholls and Youle, Genetically Engineered Toxins, edited by Frankel, Maecel Dekker and other mutations described in U.S. Pat. Nos. 4,709,017 and 4,950,740; deletions or mutations of Glu148 to Asp, Gln, or Ser and / or Ala158 to GIy, and other mutations; mutations of at least one or more residues Lys516, Lys526, Phe530, and / or Lys534, and other mutations, as disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or fragments as disclosed in U.S. Pat. No. 5,843,711), detoxified in some manner, such as pneumococcal pneumolysin (ply), including dPLY-GMBS (WO 2004 / 081515 and WO 2006 / 032499) and dPLY-formol (Kuo et al. (1995) Infect Immunol. 63:2706-2713), PhtX, including PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD, or PhtE are disclosed in WO00 / 37105 and WO00 / 39299) and fusions of Pht proteins, e.g., PhtDE fusions, PhtBE fusions, PhtA-E (WO01 / 98334, WO03 / 054007, WO2009 / 000826), OMPC (Meningococcal outer membrane protein - commonly extracted from Neisseria meningitidis serovar B (EP0372501), PorB (N.meningitidis), PD (Haemophilus influenzae protein D, see e.g. EP 0594610B), or immunologically functional equivalents thereof, synthetic peptides (EP 0378881, EP 0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO 98 / 58668, EP 0471177), cytokines, lymphokines, growth factors or hormones (WO 91 / 01146), artificial proteins comprising multiple human CD4+ T cell epitopes from various pathogen-derived antigens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), e.g. N19 protein (Baraldoi et al. (2004) Infect Immunol 29:1311-1315), 72:4884-4887), pneumococcal surface protein PspA (WO02 / 091998), iron uptake protein (WO01 / 72337), Clostridium difficile toxin A or B (WO00 / 61761), transferrin binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa aeruginosa exotoxin A (particularly non-toxic mutants thereof, such as exotoxin A with a substitution at glutamic acid 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or purified protein derivative of tuberculin (PPD), can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins, such as cholera toxoid (described, for example, in WO 2004 / 083251), Escherichia coli LT, E. coli ST, and exotoxin A from P. aeruginosa.

[0146] Another suitable carrier protein is C5a peptidase (SCP) from Streptococcus.

[0147] In a preferred embodiment, the carrier protein of the glycoconjugate is selected from the group consisting of TT, DT, DT mutants (CRM 197 etc.), H. influenzae protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO01 / 98334 and WO03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, C. difficile toxin A or B, and PsaA.

[0148] In one embodiment, the carrier protein of the glycoconjugate of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is TT (tetanus toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is C5a peptidase (SCP) from Streptococcus. In one embodiment, the carrier protein of the glycoconjugate of the invention is enzymatically inactive Streptococcal C5a peptidase (SCP).

[0149] In another embodiment, the carrier protein of the glycoconjugate of the invention is PD (H. influenzae protein D; see, for example, EP0594610B).

[0150] CRM 197 The protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM 197 The nontoxigenic phage β197 was generated by nitrosoguanidine mutagenesis of the toxigenic corynebacterium β. tox- CRM is produced by Corynebacterium diphtheriae infected with β-lactamase (Uchida et al. (1971) Nature New Biology 233:8-11). 197The protein has the same molecular weight as diphtheria toxin but differs from it by a single base change in the structural gene (guanine to adenine) that causes an amino acid substitution in the mature protein (glutamic acid to glycine) and eliminates the toxicity of diphtheria toxin. 197 Proteins are safe and effective T cell-dependent carriers for sugars. CRM 197 and further details regarding its production can be found, for example, in US Pat. No. 5,614,382.

[0151] In one embodiment the capsular saccharide of the invention may be 197 Protein or CRM 197 (See CN103495161). In one embodiment, the capsular saccharide of the invention is conjugated to the A chain of CRM obtained via expression in recombinant E. coli. 197 (see CN103495161). In a preferred embodiment, the capsular saccharide of the invention is conjugated to the A chain of CRM 197 In one embodiment, the capsular saccharide of the invention is all conjugated to a CRM 197 Conjugate to.

[0152] Thus, in frequent embodiments, the glycoconjugates of the invention comprise a CRM 197 as a carrier protein, and the capsular polysaccharide is 197 is covalently linked to

[0153] 1.5 Serotype 15B glycoconjugates of the invention In one embodiment, the 15B glycoconjugate of the present invention is as defined in this section.

[0154] Capsular polysaccharide from serotype 15B S. pneumoniae is prepared as described above (see also WO2015 / 110942).

[0155] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to generate a cyanate ester. The activated polysaccharide is then coupled to a carrier protein, preferably a CRMP. 197 The polysaccharide can be linked to the amino group on the carrier, either directly or via a spacer (linker). For example, the spacer can be cystamine or cysteamine, to obtain a thiolated polysaccharide, which can be linked to the carrier by a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyloxy]succinimide ester (GMBS)) or with a haloacetylated carrier protein (e.g., using iodoacetimide, N-succinimidyl bromoacetate (SBA, SIB), N-succinimidyl (4-iodoacetyl)aminobenzoate (SlAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]proprionate (SBAP)). The cyanate ester (optionally generated by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH) and the amino-derivatized sugar is attached to a carrier protein (e.g., CRMP) using carbodiimide (e.g., EDAC or EDC) chemistry. 197 ) via carboxyl groups on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348, and WO 96 / 129094.

[0156] In one embodiment of the present invention, glycoconjugates derived from S. pneumoniae serotype 15B are prepared using CDAP chemistry.

[0157] Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application WO98 / 42721. Conjugation may involve a carbonyl linker that can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0158] In a preferred embodiment, capsular polysaccharides from serotype 15B S. pneumoniae are conjugated to carrier proteins by reductive amination (such as those described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 184072, 2007 / 0231340, and 2007 / 0184071, WO2006 / 110381, WO2008 / 079653, WO2008 / 143709, WO2015 / 110942, and WO2019 / 139692). Thus, in a preferred embodiment, the serotype 15B glycoconjugates of the invention are prepared by reductive amination.

[0159] The reductive amination, as described above, involves two steps.

[0160] In certain embodiments, the S. pneumoniae serotype 15B derived saccharide conjugates of the invention comprise a saccharide having a molecular weight between 5 kDa and 2,000 kDa. In other such embodiments, the saccharide has a molecular weight between 20 kDa and 800 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 1000 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 800 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 500 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 400 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 300 kDa. In a preferred embodiment, the saccharide has a molecular weight between 100 kDa and 350 kDa. In another preferred embodiment, the saccharide has a molecular weight between 100 kDa and 300 kDa. In a more preferred embodiment, the saccharide has a molecular weight of between 150 kDa and 300 kDa.

[0161] In further embodiments, the saccharide has a molecular weight of 5 kDa to 100 kDa, 10 kDa to 100 kDa, 20 kDa to 100 kDa, 50 kDa to 100 kDa, or 90 kDa to 100 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, the saccharide conjugate is prepared using reductive amination.

[0162] In some embodiments, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of between 100 kDa and 20,000 kDa. In other such embodiments, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of between 200 kDa and 10,000 kDa. In other such embodiments, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of between 2000 kDa and 5,000 kDa. In further embodiments, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of between 1000 kDa and 5,000 kDa. In a further embodiment, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of 1500 kDa to 4,500 kDa. In a further embodiment, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of 2000 kDa to 4,500 kDa. In a further embodiment, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of 500 kDa to 2,000 kDa.

[0163] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0164] Another means for characterizing the glycoconjugates of the invention is to characterize the carrier protein (e.g., CRMP) that is conjugated to the sugar. 197) and can be characterized as the extent of conjugated lysines (degree of conjugation). Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. As a result of conjugation, the number of lysine residues recovered is reduced compared to the carrier protein starting material used to generate the conjugated material. In a preferred embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 2-15. In an embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 2-13. In an embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 2-10. In an embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 2-8. In an embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 2-6. In an embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 3-10. In one embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 3 to 6. In one embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 5 to 10. In one embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 8 to 12. In a preferred embodiment, the conjugation degree of the 15B sugar conjugate of the present invention is 2 to 8. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 2. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 3. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 4. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 5. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 6. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 8. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 10. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 12.In certain embodiments, the degree of conjugation of the glycoconjugates of the invention is about 15. In preferred embodiments, the degree of conjugation of the 15B glycoconjugates of the invention is between 4 and 7. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0165] The glycoconjugates of the present invention may also be characterized by the saccharide to carrier protein ratio (w / w). In some embodiments, the polysaccharide to carrier protein ratio (w / w) in a 15B glycoconjugate is 0.5-3.

[0166] In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is 0.4 to 2. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is about 0.8. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is about 0.9. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is about 1.0. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is about 1.2. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is about 1.5. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15B glycoconjugate is about 1.8. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15B glycoconjugate is about 2.0. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15B glycoconjugate is about 2.5. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15B glycoconjugate is about 3.0. In other embodiments, the saccharide to carrier protein ratio (w / w) is between 0.5 and 2.0. In other embodiments, the saccharide to carrier protein ratio (w / w) is between 0.5 and 1.5. In further embodiments, the saccharide to carrier protein ratio (w / w) is between 0.8 and 1.2. In preferred embodiments, the capsular polysaccharide to carrier protein ratio in the conjugate is between 0.9 and 1.1. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0167] The frequency with which glycans are attached to lysines on a carrier protein is another parameter for characterizing the S. pneumoniae serotype 15B derived glycoconjugates of the invention. For example, in one embodiment, there is at least one covalent bond between a carrier protein and a 15B saccharide for every 4 saccharide repeat units of the 15B saccharide. In another embodiment, a covalent bond between a carrier protein and a 15B saccharide occurs at least once for every 10 saccharide repeat units of the 15B saccharide. In another embodiment, a covalent bond between a carrier protein and a 15B saccharide occurs at least once for every 15 saccharide repeat units of the 15B saccharide. In a further embodiment, a covalent bond between a carrier protein and a 15B saccharide occurs at least once for every 25 saccharide repeat units of the 15B saccharide.

[0168] In other embodiments, the 15B saccharide conjugate comprises at least one covalent bond between a carrier protein and a 15B saccharide for every 5-10 saccharide repeat units. In other embodiments, the 15B saccharide conjugate comprises at least one covalent bond between a carrier protein and a 15B saccharide for every 2-7 saccharide repeat units. In other embodiments, the 15B saccharide conjugate comprises at least one covalent bond between a carrier protein and a 15B saccharide for every 7-12 saccharide repeat units. In other embodiments, the 15B saccharide conjugate comprises at least one covalent bond between a carrier protein and a 15B saccharide for every 10-15 saccharide repeat units. In other embodiments, the 15B saccharide conjugate comprises at least one covalent bond between a carrier protein and a 15B saccharide for every 4-8 saccharide repeat units. In other embodiments, the 15B saccharide conjugate comprises at least one covalent bond between a carrier protein and a 15B saccharide for every 10-20 saccharide repeat units. In other embodiments, the 15B glycoconjugate comprises at least one covalent bond between the carrier protein and the 15B sugar for every 2-25 saccharide repeat units. 197 It is.

[0169] In another embodiment, at least one bond between the carrier protein and the saccharide is present every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 saccharide repeat units of the polysaccharide. 197 Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0170] In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.5 mM acetate per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.6 mM acetate per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.65 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugates of the invention comprise at least 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B glycoconjugates of the invention comprise between 0.5 mM and 0.85 mM acetate per mM serotype 15B capsular polysaccharide. In one embodiment, the serotype 15B glycoconjugates of the invention comprise between 0.6 mM and 0.85 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise between 0.7 mM and 0.85 mM acetate per mM serotype 15B capsular polysaccharide. In one embodiment, the serotype 15B glycoconjugates of the invention comprise between 0.8 mM and 0.85 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is revealed by ion HPLC analysis.

[0171] In an embodiment, the serotype 15B saccharide conjugates of the invention comprise at least 0.1 mM glycerol per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B saccharide conjugates of the invention comprise at least 0.2 mM glycerol per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B saccharide conjugates of the invention comprise at least 0.5 mM glycerol per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B saccharide conjugates of the invention comprise at least 0.8 mM glycerol per mM serotype 15B capsular polysaccharide. In an embodiment, the serotype 15B saccharide conjugates of the invention comprise at least 0.9 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugate of the invention comprises 0.6 mM to 1 mM glycerol per mM serotype 15B capsular polysaccharide. In a further preferred embodiment, the serotype 15B glycoconjugate of the invention comprises 0.7 mM to 1 mM glycerol per mM serotype 15B capsular polysaccharide. In a most preferred embodiment, the serotype 15B glycoconjugate of the invention comprises 0.8 mM to 1 mM glycerol per mM serotype 15B capsular polysaccharide.

[0172] In one embodiment, the serotype 15B glycoconjugate of the invention comprises 0.5 mM to 0.7 mM glycerol per mM serotype 15B capsular polysaccharide. In a further preferred embodiment, the serotype 15B glycoconjugate of the invention comprises about 0.7 mM glycerol per mM serotype 15B capsular polysaccharide.

[0173] In a preferred embodiment, the S. pneumoniae serotype 15B derived saccharide conjugates of the invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free polysaccharides relative to the total amount of polysaccharides. In an embodiment, the 15B saccharide conjugates comprise less than about 25% free polysaccharides relative to the total amount of polysaccharides. In an embodiment, the 15B saccharide conjugates comprise less than about 20% free polysaccharides relative to the total amount of polysaccharides. In a preferred embodiment, the 15B saccharide conjugates comprise less than about 15% free polysaccharides relative to the total amount of polysaccharides.

[0174] The glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. A size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from small pores in the medium elute more quickly than smaller molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically with a sugar assay. K d For the determination of 0 ), (K d =0), and the fraction showing maximum retention (V i ), (K d The column is calibrated to establish the fraction at which a particular sample attribute is reached (V e ) into the formula K d =(V e -V 0 ) / (V i -V 0 ) by K d Associate with.

[0175] In a preferred embodiment, at least 30% of the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a K of 0.3 or less on a CL-4B column. dIn one embodiment, at least 40% of the 15B glycoconjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the 15B glycoconjugates have a K of 0.3 or less in CL-4B. d In one embodiment, at least 60% of the 15B glycoconjugates have a K of less than or equal to 0.3 in a CL-4B column. d In one embodiment, 50% to 80% of the 15B glycoconjugates have a Kd of 0.3 or less on a CL-4B column. In a preferred embodiment, 65% to 80% of the 15B glycoconjugates have a Kd of 0.3 or less on a CL-4B column.

[0176] 1.6 Serotype 15C glycoconjugates of the invention In one embodiment, the 15C glycoconjugate of the present invention is as defined in this section.

[0177] Capsular polysaccharide from serotype 15C S. pneumoniae is prepared as described above (see also WO2019 / 139692).

[0178] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to generate a cyanate ester. The activated polysaccharide is then coupled to a carrier protein, preferably a CRMP. 197The polysaccharide can be linked to the amino group on the carrier, either directly or via a spacer (linker). For example, the spacer can be cystamine or cysteamine, to obtain a thiolated polysaccharide, which can be linked to the carrier by a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyloxy]succinimide ester (GMBS)) or with a haloacetylated carrier protein (e.g., using iodoacetimide, N-succinimidyl bromoacetate (SBA, SIB), N-succinimidyl (4-iodoacetyl)aminobenzoate (SlAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]proprionate (SBAP)). Preferably, the cyanate ester (which may be made by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is attached to the carrier protein (e.g., CRMP) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier. 197 Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0179] In one embodiment of the invention, glycoconjugates derived from S. pneumoniae serotype 15C are prepared using CDAP chemistry.

[0180] Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application WO98 / 42721. Conjugation may involve a carbonyl linker that can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0181] In a preferred embodiment, capsular polysaccharides from serotype 15C S. pneumoniae are conjugated to carrier proteins by reductive amination (such as those described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 184072, 2007 / 0231340, and 2007 / 0184071, WO2006 / 110381, WO2008 / 079653, WO2008 / 143709, WO2015 / 110942, and WO2019 / 139692). Thus, in a preferred embodiment, the serotype 15C glycoconjugates of the invention are prepared by reductive amination.

[0182] The reductive amination, as described above, involves two steps.

[0183] In certain embodiments, the S. pneumoniae serotype 15C derived saccharide conjugates of the invention comprise a saccharide having a molecular weight between 5 kDa and 2,000 kDa. In other such embodiments, the saccharide has a molecular weight between 20 kDa and 800 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 1000 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 800 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 500 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 400 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 300 kDa. In a preferred embodiment, the saccharide has a molecular weight between 100 kDa and 350 kDa. In another preferred embodiment, the saccharide has a molecular weight between 100 kDa and 300 kDa. In a more preferred embodiment, the saccharide has a molecular weight of between 150 kDa and 300 kDa.

[0184] In further embodiments, the saccharide has a molecular weight of 5 kDa to 100 kDa, 10 kDa to 100 kDa, 20 kDa to 100 kDa, 50 kDa to 100 kDa, or 90 kDa to 100 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, the saccharide conjugate is prepared using reductive amination.

[0185] In certain embodiments, the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a molecular weight of between 100 kDa and 20,000 kDa. In other such embodiments, the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a molecular weight of between 200 kDa and 10,000 kDa. In other such embodiments, the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a molecular weight of between 2000 kDa and 5,000 kDa. In further embodiments, the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a molecular weight of between 1000 kDa and 5,000 kDa. In a further embodiment, the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a molecular weight of 1500 kDa to 4,500 kDa. In a further embodiment, the S. pneumoniae serotype 15B derived glycoconjugates of the invention have a molecular weight of 2000 kDa to 4,500 kDa. In a further embodiment, the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a molecular weight of 500 kDa to 2,000 kDa.

[0186] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0187] Another method for characterizing the glycoconjugates of the present invention is to characterize the extent of conjugated lysines (degree of conjugation) of the carrier protein (e.g., CRMP) that becomes conjugated to the sugar. 197) depending on the number of lysine residues in the 15C sugar conjugate. Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. As a result of conjugation, the number of lysine residues recovered is reduced compared to the carrier protein starting material used to generate the conjugated material. In a preferred embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 2-15. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 2-13. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 2-10. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 2-8. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 2-6. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 3-10. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 3-6. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 5 to 10. In one embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 8 to 12. In a preferred embodiment, the conjugation degree of the 15C sugar conjugate of the present invention is 2 to 8. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 2. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 3. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 4. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 5. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 6. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 8. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 10. In one embodiment, the conjugation degree of the sugar conjugate of the present invention is about 12. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 15.In a preferred embodiment, the conjugation degree of the 15C glycoconjugate of the present invention is 4 to 7. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0188] The glycoconjugates of the present invention may also be characterized by the sugar to carrier protein ratio (w / w). In some embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15C glycoconjugate is 0.5-3.

[0189] In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is 0.4 to 2. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is about 0.8. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is about 0.9. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is about 1.0. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is about 1.2. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is about 1.5. In some embodiments, the ratio (w / w) of polysaccharide to carrier protein in the 15C sugar conjugate is about 1.8. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15C glycoconjugate is about 2.0. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15C glycoconjugate is about 2.5. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15C glycoconjugate is about 3.0. In other embodiments, the saccharide to carrier protein ratio (w / w) is 0.5-2.0. In other embodiments, the saccharide to carrier protein ratio (w / w) is 0.5-1.5. In further embodiments, the saccharide to carrier protein ratio (w / w) is 0.8-1.2. In preferred embodiments, the capsular polysaccharide to carrier protein ratio in the conjugate is 0.9-1.1. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0190] The frequency with which glycans are attached to lysines on a carrier protein is another parameter for characterizing the S. pneumoniae serotype 15C derived glycoconjugates of the invention. For example, in one embodiment, there is at least one covalent bond between a carrier protein and a 15C saccharide for every 4 saccharide repeat units of the 15C saccharide. In another embodiment, a covalent bond between a carrier protein and a 15C saccharide occurs at least once for every 10 saccharide repeat units of the 15C saccharide. In another embodiment, a covalent bond between a carrier protein and a 15C saccharide occurs at least once for every 15 saccharide repeat units of the 15C saccharide. In a further embodiment, a covalent bond between a carrier protein and a 15C saccharide occurs at least once for every 25 saccharide repeat units of the 15C saccharide.

[0191] In another embodiment, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and the 15C sugar for every 5-10 sugar repeat units. In another embodiment, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and the 15C sugar for every 2-7 sugar repeat units. In another embodiment, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and the 15C sugar for every 7-12 sugar repeat units. In another embodiment, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and the 15C sugar for every 10-15 sugar repeat units. In another embodiment, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and the 15C sugar for every 4-8 sugar repeat units. In another embodiment, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and the 15C sugar for every 10-20 sugar repeat units. In other embodiments, the 15C sugar conjugate comprises at least one covalent bond between the carrier protein and a 15C sugar for every 2-25 sugar repeat units. 197 It is.

[0192] In another embodiment, at least one bond between the carrier protein and the saccharide is present every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 saccharide repeat units of the polysaccharide. 197 Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0193] In an embodiment, the serotype 15C saccharide conjugates of the invention comprise at least 0.1 mM glycerol per mM serotype 15C capsular polysaccharide. In an embodiment, the serotype 15C saccharide conjugates of the invention comprise at least 0.2 mM glycerol per mM serotype 15C capsular polysaccharide. In an embodiment, the serotype 15C saccharide conjugates of the invention comprise at least 0.5 mM glycerol per mM serotype 15C capsular polysaccharide. In an embodiment, the serotype 15C saccharide conjugates of the invention comprise at least 0.8 mM glycerol per mM serotype 15C capsular polysaccharide. In an embodiment, the serotype 15C saccharide conjugates of the invention comprise at least 0.9 mM glycerol per mM serotype 15C capsular polysaccharide. In a preferred embodiment, the serotype 15C glycoconjugate of the invention comprises 0.6 mM to 1 mM glycerol per mM serotype 15C capsular polysaccharide. In a further preferred embodiment, the serotype 15C glycoconjugate of the invention comprises 0.7 mM to 1 mM glycerol per mM serotype 15C capsular polysaccharide. In a most preferred embodiment, the serotype 15C glycoconjugate of the invention comprises 0.8 mM to 1 mM glycerol per mM serotype 15C capsular polysaccharide.

[0194] In one embodiment, the serotype 15C glycoconjugate of the invention comprises 0.5 mM to 0.7 mM glycerol per mM serotype 15C capsular polysaccharide. In a further preferred embodiment, the serotype 15C glycoconjugate of the invention comprises about 0.7 mM glycerol per mM serotype 15C capsular polysaccharide.

[0195] In a preferred embodiment, the S. pneumoniae serotype 15C derived saccharide conjugate of the present invention comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free polysaccharide based on the total amount of polysaccharide. In a preferred embodiment, the 15C saccharide conjugate comprises less than about 25% free polysaccharide based on the total amount of polysaccharide. In a preferred embodiment, the 15C saccharide conjugate comprises less than about 20% free polysaccharide based on the total amount of polysaccharide. In a preferred embodiment, the 15C saccharide conjugate comprises less than about 15% free polysaccharide based on the total amount of polysaccharide.

[0196] The glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. A size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from small pores in the medium elute more quickly than smaller molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically with a sugar assay. K d For the determination of 0 ), (K d =0), and the fraction showing maximum retention (V i ), (K d The column is calibrated to establish the fraction at which a particular sample attribute is reached (V e ) into the formula K d =(V e -V 0 ) / (V i -V 0 ) by K d and associate it with.

[0197] In a preferred embodiment, at least 30% of the S. pneumoniae serotype 15C derived glycoconjugates of the invention have a K of 0.3 or less on a CL-4B column. dIn a preferred embodiment, at least 40% of the 15C glycoconjugates have a K of 0.3 or less on a CL-4B column. d In certain embodiments, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the 15C glycoconjugates have a K of 0.3 or less in CL-4B. d In one embodiment, at least 60% of the 15C glycoconjugates have a K of 0.3 or less on a CL-4B column. d In one embodiment, 50% to 80% of the 15C sugar conjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, 65% to 80% of the 15C sugar conjugates have a K of 0.3 or less on the CL-4B column. d has.

[0198] 1.7 Serotype 15A glycoconjugates of the invention In certain embodiments, the 15A glycoconjugate of the present invention is as defined in this section.

[0199] Capsular polysaccharide from serotype 15A S. pneumoniae is prepared as described above (see also WO2019 / 139692).

[0200] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to generate a cyanate ester. The activated polysaccharide is then coupled to a carrier protein, preferably a CRMP. 197The polysaccharide can be linked to the amino group on the carrier, either directly or via a spacer (linker). For example, the spacer can be cystamine or cysteamine, to obtain a thiolated polysaccharide, which can be linked to the carrier by a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyloxy]succinimide ester (GMBS)) or with a haloacetylated carrier protein (e.g., using iodoacetimide, N-succinimidyl bromoacetate (SBA, SIB), N-succinimidyl (4-iodoacetyl)aminobenzoate (SlAB), sulfosuccinimidyl (4-iodoacetyl)aminobenzoate (sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]proprionate (SBAP)). Preferably, the cyanate ester (which may be made by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is attached to the carrier protein (e.g., CRMP) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier. 197 Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0201] In one embodiment of the invention, glycoconjugates derived from S. pneumoniae serotype 15A are prepared using CDAP chemistry.

[0202] Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application WO98 / 42721. Conjugation may involve a carbonyl linker that can be formed by reacting the free hydroxyl group of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0203] In a preferred embodiment, capsular polysaccharides from serotype 15A S. pneumoniae are conjugated to carrier proteins by reductive amination (such as those described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 184072, 2007 / 0231340, and 2007 / 0184071, WO2006 / 110381, WO2008 / 079653, WO2008 / 143709, WO2015 / 110942, and WO2019 / 139692). Thus, in a preferred embodiment, the serotype 15A glycoconjugates of the invention are prepared by reductive amination.

[0204] The reductive amination, as described above, involves two steps.

[0205] In certain embodiments, the S. pneumoniae serotype 15A derived saccharide conjugates of the invention comprise a saccharide having a molecular weight between 5 kDa and 2,000 kDa. In other such embodiments, the saccharide has a molecular weight between 20 kDa and 800 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 1000 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 800 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 500 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 400 kDa. In further such embodiments, the saccharide has a molecular weight between 100 kDa and 300 kDa. In a preferred embodiment, the saccharide has a molecular weight between 100 kDa and 350 kDa. In another preferred embodiment, the saccharide has a molecular weight between 100 kDa and 300 kDa. In a more preferred embodiment, the saccharide has a molecular weight of between 150 kDa and 300 kDa.

[0206] In further embodiments, the saccharide has a molecular weight of 5 kDa to 100 kDa, 10 kDa to 100 kDa, 20 kDa to 100 kDa, 50 kDa to 100 kDa, or 90 kDa to 100 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, the saccharide conjugate is prepared using reductive amination.

[0207] In certain embodiments, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 100 kDa to 20,000 kDa. In other such embodiments, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 200 kDa to 10,000 kDa. In other such embodiments, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 2000 kDa to 5,000 kDa. In further embodiments, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 1000 kDa to 5,000 kDa. In a further embodiment, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 1500 kDa to 4,500 kDa. In a further embodiment, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 2000 kDa to 4,500 kDa. In a further embodiment, the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a molecular weight of 500 kDa to 2,000 kDa.

[0208] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0209] Another method for characterizing the glycoconjugates of the present invention is to characterize the extent of conjugated lysines (degree of conjugation) of the carrier protein (e.g., CRMP) that becomes conjugated to the sugar. 197) depending on the number of lysine residues in the 15A glycoconjugate. Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. As a result of conjugation, the number of lysine residues recovered is reduced compared to the carrier protein starting material used to generate the conjugated material. In a preferred embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 2-15. In an embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 2-13. In an embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 2-10. In an embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 2-8. In an embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 2-6. In an embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 3-10. In an embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 3-6. In certain embodiments, the conjugation degree of the 15A glycoconjugate of the present invention is 5 to 10. In certain embodiments, the conjugation degree of the 15A glycoconjugate of the present invention is 8 to 12. In a preferred embodiment, the conjugation degree of the 15A glycoconjugate of the present invention is 2 to 8. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 2. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 3. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 4. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 5. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 6. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 8. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 10. In certain embodiments, the conjugation degree of the glycoconjugate of the present invention is about 12. In one embodiment, the degree of conjugation of the glycoconjugate of the present invention is about 15.In preferred embodiments, the degree of conjugation of the 15A glycoconjugates of the invention is between 4 and 7. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0210] Glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (w / w). In some embodiments, the polysaccharide to carrier protein ratio (w / w) in a 15A glycoconjugate is 0.5-3.

[0211] In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is 0.4 to 2. In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is about 0.8. In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is about 0.9. In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is about 1.0. In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is about 1.2. In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is about 1.5. In some embodiments, the ratio of polysaccharide to carrier protein (w / w) in the 15A glycoconjugate is about 1.8. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15A glycoconjugate is about 2.0. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15A glycoconjugate is about 2.5. In certain embodiments, the polysaccharide to carrier protein ratio (w / w) in the 15A glycoconjugate is about 3.0. In other embodiments, the saccharide to carrier protein ratio (w / w) is between 0.5 and 2.0. In other embodiments, the saccharide to carrier protein ratio (w / w) is between 0.5 and 1.5. In further embodiments, the saccharide to carrier protein ratio (w / w) is between 0.8 and 1.2. In preferred embodiments, the capsular polysaccharide to carrier protein ratio in the conjugate is between 0.9 and 1.1. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0212] The frequency with which glycans are attached to lysines on a carrier protein is another parameter for characterizing the S. pneumoniae serotype 15A derived glycoconjugates of the invention. For example, in one embodiment, there is at least one covalent bond between a carrier protein and a 15A saccharide for every 4 saccharide repeat units of the 15A saccharide. In another embodiment, a covalent bond between a carrier protein and a 15A saccharide occurs at least once for every 10 saccharide repeat units of the 15A saccharide. In another embodiment, a covalent bond between a carrier protein and a 15A saccharide occurs at least once for every 15 saccharide repeat units of the 15A saccharide. In a further embodiment, a covalent bond between a carrier protein and a 15A saccharide occurs at least once for every 25 saccharide repeat units of the 15A saccharide.

[0213] In other embodiments, the 15A glycoconjugate comprises at least one covalent bond between a carrier protein and a 15A saccharide for every 5-10 saccharide repeat units. In other embodiments, the 15A glycoconjugate comprises at least one covalent bond between a carrier protein and a 15A saccharide for every 2-7 saccharide repeat units. In other embodiments, the 15A glycoconjugate comprises at least one covalent bond between a carrier protein and a 15A saccharide for every 7-12 saccharide repeat units. In other embodiments, the 15A glycoconjugate comprises at least one covalent bond between a carrier protein and a 15A saccharide for every 10-15 saccharide repeat units. In other embodiments, the 15A glycoconjugate comprises at least one covalent bond between a carrier protein and a 15A saccharide for every 4-8 saccharide repeat units. In other embodiments, the 15A glycoconjugate comprises at least one covalent bond between a carrier protein and a 15A saccharide for every 10-20 saccharide repeat units. In other embodiments, the 15A sugar conjugate comprises at least one covalent bond between the carrier protein and the 15A sugar for every 2-25 sugar repeat units. 197 It is.

[0214] In another embodiment, at least one bond between the carrier protein and the saccharide is present every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 saccharide repeat units of the polysaccharide. 197 Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0215] In an embodiment, the serotype 15A saccharide conjugates of the invention comprise at least 0.1 mM glycerol per mM serotype 15A capsular polysaccharide. In an embodiment, the serotype 15A saccharide conjugates of the invention comprise at least 0.2 mM glycerol per mM serotype 15A capsular polysaccharide. In an embodiment, the serotype 15A saccharide conjugates of the invention comprise at least 0.5 mM glycerol per mM serotype 15A capsular polysaccharide. In an embodiment, the serotype 15A saccharide conjugates of the invention comprise at least 0.8 mM glycerol per mM serotype 15A capsular polysaccharide. In an embodiment, the serotype 15A saccharide conjugates of the invention comprise at least 0.9 mM glycerol per mM serotype 15A capsular polysaccharide. In a preferred embodiment, the serotype 15A glycoconjugate of the invention comprises 0.6 mM to 1 mM glycerol per mM serotype 15A capsular polysaccharide. In a further preferred embodiment, the serotype 15A glycoconjugate of the invention comprises 0.7 mM to 1 mM glycerol per mM serotype 15A capsular polysaccharide. In a most preferred embodiment, the serotype 15A glycoconjugate of the invention comprises 0.8 mM to 1 mM glycerol per mM serotype 15A capsular polysaccharide.

[0216] In one embodiment, the serotype 15A glycoconjugate of the invention comprises 0.5 mM to 0.7 mM glycerol per mM serotype 15A capsular polysaccharide, in a further preferred embodiment, the serotype 15A glycoconjugate of the invention comprises about 0.7 mM glycerol per mM serotype 15A capsular polysaccharide.

[0217] In a preferred embodiment, the S. pneumoniae serotype 15A derived saccharide conjugates of the invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free polysaccharide based on the total amount of polysaccharide. In an embodiment, the 15A saccharide conjugate comprises less than about 25% free polysaccharide based on the total amount of polysaccharide. In an embodiment, the 15A saccharide conjugate comprises less than about 20% free polysaccharide based on the total amount of polysaccharide. In a preferred embodiment, the 15A saccharide conjugate comprises less than about 15% free polysaccharide based on the total amount of polysaccharide.

[0218] The glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. A size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from small pores in the medium elute more quickly than smaller molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically with a sugar assay. K d For the determination of 0 ), (K d =0), and the fraction showing maximum retention (V i ), (K d The column is calibrated to establish the fraction at which a particular sample attribute is reached (V e ) into the formula K d =(V e -V 0 ) / (V i -V 0 ) by K d and associate it with.

[0219] In one embodiment, at least 30% of the S. pneumoniae serotype 15A derived glycoconjugates of the invention have a K of 0.3 or less on a CL-4B column. dIn one embodiment, at least 40% of the 15A glycoconjugates have a K of 0.3 or less on a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the 15A glycoconjugates have a K of 0.3 or less in CL-4B. d In one embodiment, at least 60% of the 15A glycoconjugates have a K of less than or equal to 0.3 in a CL-4B column. d In one embodiment, 50% to 80% of the 15A glycoconjugates have a Kd of 0.3 or less on a CL-4B column. In a preferred embodiment, 65% to 80% of the 15A glycoconjugates have a Kd of 0.3 or less on a CL-4B column.

[0220] 1.8 Combinations of Glycoconjugates of the Invention In certain embodiments, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B, a glycoconjugate derived from S. pneumoniae serotype 15C, and a glycoconjugate derived from S. pneumoniae serotype 15A.

[0221] In an embodiment the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15B or 15C and a glycoconjugate from S. pneumoniae serotype 15A. Preferably the composition does not comprise capsular saccharides from S. pneumoniae serotype 15C when a glycoconjugate from S. pneumoniae serotype 15B is present in the composition and does not comprise capsular saccharides from S. pneumoniae serotype 15B when a glycoconjugate from S. pneumoniae serotype 15C is present in the composition.

[0222] In one embodiment the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15B and a glycoconjugate from S. pneumoniae serotype 15A. Preferably said composition does not comprise capsular saccharide from S. pneumoniae serotype 15C.

[0223] In one embodiment the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15C and a glycoconjugate from S. pneumoniae serotype 15A. Preferably said composition does not comprise capsular saccharide from S. pneumoniae serotype 15B.

[0224] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and / or 23F.

[0225] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.

[0226] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of each of the following eight S. pneumoniae serotypes: (1, 4, 6B, 9V, 14, 18C, 19F, and 23F), (4, 5, 6B, 9V, 14, 18C, 19F, and 23F), or (4, 6B, 7F, 9V, 14, 18C, 19F, and 23F).

[0227] In certain embodiments, any of the above immunogenic compositions comprises at least one glycoconjugate for each of the following ten S. pneumoniae serotypes: 1, 5, 4, 6B, 7F, 9V, 14, 18C, 19F, and 23F.

[0228] In certain embodiments, any of the above immunogenic compositions comprises at least one glycoconjugate of each of the following eleven S. pneumoniae serotypes: (1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19F, and 23F) or (1, 4, 5, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F).

[0229] In certain embodiments, any of the above immunogenic compositions comprises at least one glycoconjugate for each of the following 12 S. pneumoniae serotypes: 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.

[0230] In certain embodiments, any of the above immunogenic compositions comprises at least one glycoconjugate for each of the following 13 S. pneumoniae serotypes: 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.

[0231] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotype 22F.

[0232] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotype 33F.

[0233] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotype 8.

[0234] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotype 10A.

[0235] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotype 11A.

[0236] In certain embodiments, any of the above immunogenic compositions further comprise at least one glycoconjugate of S. pneumoniae serotype 12F.

[0237] In one embodiment, any of the above immunogenic compositions is directed against the following two S. pneumoniae serotypes: 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and 8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A, 12F and 11A, 12F and 8, 10A and 11A, 10A and 8, or 11A and 8 The compound comprises at least one glycoconjugate of each of the above.

[0238] In one embodiment, any of the above immunogenic compositions is directed against the following three S. pneumoniae serotypes: 22F, 33F, and 12F, 22F, 33F, and 10A, 22F, 33F, and 11A, 22F, 33F, and 8, 22F, 12F, and 10A, 22F, 12F, and 11A, 22F, 12F, and 8, 22F, 10A, and 11A, 22F, 10A, and 8, 22F, 11A, and 8, 33F, 12F, and 10A, 33F, 12F, and 11A, 33F, 12F, and 8, 33F, 10A, and 11A, 33F, 10A, and 8, 33F, 11A, and 8, 12F, 10A, and 11A, 12F, 10A, and 8, 12F, 11A, and 8, or 10A, 11A, and 8 The compound comprises at least one glycoconjugate of each of the above.

[0239] In one embodiment, any of the above immunogenic compositions is directed against the following four S. pneumoniae serotypes: 22F, 33F, 12F, and 10A, 22F, 33F, 12F, and 11A, 22F, 33F, 12F, and 8, 22F, 33F, 10A, and 11A, 22F, 33F, 10A, and 8, 22F, 33F, 11A, and 8, 22F, 12F, 10A, and 11A, 22F, 12F, 10A, and 8, 22F, 12F, 11A, and 8, 22F, 10A, 11A, and 8, 33F, 12F, 10A, and 11A, 33F, 12F, 10A, and 8, 33F, 12F, 11A, and 8, 33F, 10A, 11A, and 8, or 12F, 10A, 11A, and 8 The compound comprises at least one glycoconjugate of each of the above.

[0240] In one embodiment, any of the above immunogenic compositions is directed against the following five S. pneumoniae serotypes: 22F, 33F, 12F, 10A, and 11A, 22F, 33F, 12F, 10A, and 8, 22F, 33F, 12F, 11A, and 8, 22F, 33F, 10A, 11A, and 8, 22F, 12F, 10A, 11A, and 8, or 33F, 12F, 10A, 11A, and 8 The compound comprises at least one glycoconjugate of each of the above.

[0241] In certain embodiments, any of the above immunogenic compositions comprises at least one glycoconjugate for each of the following six S. pneumoniae serotypes: 22F, 33F, 12F, 10A, 11A, and 8.

[0242] In certain embodiments, any of the above immunogenic compositions further comprise a glycoconjugate derived from S. pneumoniae serotype 2.

[0243] In certain embodiments, any of the above immunogenic compositions further comprise a glycoconjugate derived from S. pneumoniae serotype 17F.

[0244] In certain embodiments, any of the above immunogenic compositions further comprise a glycoconjugate derived from S. pneumoniae serotype 20.

[0245] Preferably, all glycoconjugates of the immunogenic composition are individually conjugated to a carrier protein.

[0246] In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15B is 197In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15C is conjugated to a CRMP. 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15A is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 22F is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 33F is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 12F is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 10A is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 11A is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 8 is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugates from S. pneumoniae serotypes 1, 5, and 7F are conjugated to a CRM 197In certain embodiments of any of the above immunogenic compositions, the glycoconjugates from S. pneumoniae serotypes 6A and 19A are conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 3 is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 2 is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 17F is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 20 is conjugated to a CRM 197 In certain embodiments of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15C is conjugated to a CRMP. 197 is conjugated to

[0247] In one embodiment, the glycoconjugate of the immunogenic composition is 197 All are individually conjugated to

[0248] In one embodiment, the glycoconjugates derived from S. pneumoniae serotype 18C of any of the above immunogenic compositions are individually conjugated to TT.

[0249] In certain embodiments, the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and / or 23F of any of the above immunogenic compositions are individually conjugated to PD.

[0250] In certain embodiments, the S. pneumoniae serotype 19F derived glycoconjugate of any of the above immunogenic compositions is conjugated to DT.

[0251] In an embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are individually conjugated to PD, the glycoconjugates derived from S. pneumoniae serotype 18C are conjugated to TT and the glycoconjugates derived from S. pneumoniae serotype 19F are conjugated to DT.

[0252] In one embodiment, the immunogenic composition comprises glycoconjugates from between 2 and 25 different serotypes of S. pneumoniae, hi one embodiment, the immunogenic composition comprises glycoconjugates from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different pneumococcal serotypes.

[0253] In one embodiment, the immunogenic composition comprises glycoconjugates from two different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from three different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from four different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from five different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from six different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from seven different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from eight different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from nine different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from ten different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 11 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 12 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 13 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 14 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 15 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 17 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 18 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 19 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 20 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 21 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 22 different pneumococcal serotypes.In one embodiment, the immunogenic composition comprises glycoconjugates from 23 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 24 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 25 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 or 20 different serotypes.

[0254] In one embodiment, the immunogenic composition is a 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 21-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 22-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 2"valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 23-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 24-valent pneumococcal conjugate composition.

[0255] It is preferred that all glycoconjugates of the immunogenic composition of the invention are individually conjugated to a carrier protein. In one embodiment, the glycoconjugates of the immunogenic composition of the invention are conjugated to a carrier protein. 197 In one embodiment, the glycoconjugate of the immunogenic composition of the invention is individually conjugated to CRM 197 All are individually conjugated to

[0256] 1.9 A set of immunogenic compositions of the present invention One aspect of the invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, and not comprising a capsular saccharide from S. pneumoniae serotype 15B, for simultaneous, concurrent, combined or sequential administration. In a preferred embodiment, said immunogenic compositions are for simultaneous, concurrent or sequential administration. In a preferred embodiment, said S. pneumoniae serotype 15C is as defined in section 1.6. In a preferred embodiment, said S. pneumoniae serotype 15A is as defined in section 1.7. In a further preferred embodiment, said S. pneumoniae serotype 15C is as defined in section 1.6 and said S. pneumoniae serotype 15A is as defined in section 1.7.

[0257] In another embodiment, the present invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, and not comprising a capsular saccharide from S. pneumoniae serotype 15C, for simultaneous, concurrent, combined or sequential administration. In a preferred embodiment, said immunogenic compositions are for simultaneous, concurrent or sequential administration. In a preferred embodiment, said S. pneumoniae serotype 15B is as defined in section 1.5. In a preferred embodiment, said S. pneumoniae serotype 15A is as defined in section 1.7. In a further preferred embodiment, said S. pneumoniae serotype 15B is as defined in section 1.5 and said S. pneumoniae serotype 15A is as defined in section 1.7.

[0258] In another embodiment, the present invention relates to a set of immunogenic compositions comprising (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B, and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A and a glycoconjugate from S. pneumoniae serotype 15C, for simultaneous, concurrent, combined or sequential administration. In a preferred embodiment, said immunogenic compositions are for simultaneous, concurrent or sequential administration. In a preferred embodiment, said S. pneumoniae serotype 15B is as defined in section 1.5. In a preferred embodiment, said S. pneumoniae serotype 15A is as defined in section 1.7. In a preferred embodiment, the S. pneumoniae serotype 15C is as defined in Section 1.6. In a further preferred embodiment, the S. pneumoniae serotype 15B is as defined in Section 1.5, the S. pneumoniae serotype 15C is as defined in Section 1.6, and the S. pneumoniae serotype 15A is as defined in Section 1.7.

[0259] One aspect of the invention relates to a set of immunogenic compositions consisting of (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15C and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, which does not comprise a capsular saccharide from S. pneumoniae serotype 15B, for simultaneous, concurrent, combined or sequential administration. In a preferred embodiment, said immunogenic compositions are for simultaneous, concurrent or sequential administration. In a preferred embodiment, said S. pneumoniae serotype 15C is as defined in section 1.6. In a preferred embodiment, said S. pneumoniae serotype 15A is as defined in section 1.7. In a further preferred embodiment, said S. pneumoniae serotype 15C is as defined in section 1.6 and said S. pneumoniae serotype 15A is as defined in section 1.7. In one embodiment, said glycoconjugate derived from S. pneumoniae serotype 15C is selected from the group consisting of the CRM 197 In one embodiment, the glycoconjugate from S. pneumoniae serotype 15A is conjugated to a CRM 197 In one embodiment, the glycoconjugates from S. pneumoniae serotypes 15A and 15C are conjugated to a CRM 197 is conjugated to

[0260] In another embodiment, the present invention relates to a set of immunogenic compositions consisting of (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A, which does not comprise a capsular saccharide from S. pneumoniae serotype 15C, for simultaneous, concurrent, combined or sequential administration. In a preferred embodiment, said immunogenic compositions are for simultaneous, concurrent or sequential administration. In a preferred embodiment, said S. pneumoniae serotype 15B is as defined in section 1.5. In a preferred embodiment, said S. pneumoniae serotype 15A is as defined in section 1.7. In a further preferred embodiment, said S. pneumoniae serotype 15B is as defined in Section 1.5 and said S. pneumoniae serotype 15A is as defined in Section 1.7. In one embodiment, said glycoconjugate derived from S. pneumoniae serotype 15B is a glycoconjugate derived from a CRM 197 In one embodiment, the glycoconjugate from S. pneumoniae serotype 15A is conjugated to a CRM 197 In one embodiment, the glycoconjugates from S. pneumoniae serotypes 15A and 15B are conjugated to a CRM 197 is conjugated to

[0261] One embodiment of the present invention relates to a set of immunogenic compositions consisting of (a) a first immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15B and (b) a second immunogenic composition comprising a glycoconjugate from S. pneumoniae serotype 15A and a glycoconjugate from S. pneumoniae serotype 15C, for simultaneous, concurrent, combined or sequential administration. In a preferred embodiment, said immunogenic compositions are for simultaneous, concurrent or sequential administration. In a preferred embodiment, said S. pneumoniae serotype 15B is as defined in section 1.5. In a preferred embodiment, said S. pneumoniae serotype 15C is as defined in section 1.6. In a preferred embodiment, the S. pneumoniae serotype 15A is as defined in section 1.7. In a further preferred embodiment, the S. pneumoniae serotype 15B is as defined in section 1.5, the S. pneumoniae serotype 15C is as defined in section 1.6 and the S. pneumoniae serotype 15A is as defined in section 1.7. In one embodiment, the glycoconjugate from S. pneumoniae serotype 15B is selected from the group consisting of the CRM 197 In one embodiment, the S. pneumoniae serotype 15C derived glycoconjugate is conjugated to a CRM 197 In one embodiment, the glycoconjugate from S. pneumoniae serotype 15A is conjugated to a CRM 197 In one embodiment, the glycoconjugates from S. pneumoniae serotypes 15A, 15B, and 15C are conjugated to a CRM 197 is conjugated to

[0262] By "co-administration" is meant administration of therapeutically effective doses of the first and second immunogenic compositions in a single unit dosage form.

[0263] "Concurrent administration" refers to administering a therapeutically effective dose of a first and a second immunogenic composition through the same access site, but in separate unit dosage forms, within a short period of each other. Concurrent administration is essentially administering two immunogenic compositions through the same access site at approximately the same time, but in separate dosage forms. Concurrent administration of the first and the second immunogenic compositions often occurs during the same physician's outpatient visit.

[0264] "Concomitant administration" means administering a therapeutically effective dose of a first and a second immunogenic composition in separate unit dosage forms, within a short time period of each other, at different anatomical sites.Concomitant administration is essentially administering two immunogenic compositions at approximately the same time, but in separate dosage forms, and at different anatomical sites.Concomitant administration of a first and a second immunogenic composition often occurs during the same physician's outpatient treatment.

[0265] "Sequential administration" refers to administering a therapeutically effective dose of the first or second immunogenic composition alone, and then administering a therapeutically effective dose of the remaining immunogenic composition after an interval of at least about one month.For example, in one embodiment, the first immunogenic composition is administered in a single dosage form, and then after an interval of at least about one month, the second immunogenic composition is administered in a separate single dosage form.In an alternative embodiment, the second immunogenic composition is administered in a single dosage form, and then after an interval of at least about one month, the first immunogenic composition is administered in a separate single dosage form.The sequential administration of the first and second immunogenic compositions often occurs in different physician's outpatient clinics.

[0266] 1. In one embodiment, said first immunogenic composition further comprises glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F in addition to glycoconjugates from S. pneumoniae serotypes 15B or 15C.

[0267] 2. In another embodiment, said first immunogenic composition further comprises, as described above in item 1, glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F.

[0268] 3. In another embodiment, said first immunogenic composition comprises, in addition to item 1 or 2 above, glycoconjugates derived from S. pneumoniae serotypes 6A and 19A.

[0269] 4. In another embodiment, said first immunogenic composition comprises, in addition to item 1, 2 or 3 above, a glycoconjugate derived from S. pneumoniae serotype 3.

[0270] 5. In another embodiment, said first immunogenic composition comprises, in addition to item 1, 2, 3 or 4 above, a glycoconjugate derived from S. pneumoniae serotype 22F.

[0271] 6. In another embodiment, said first immunogenic composition comprises, in addition to item 1, 2, 3, 4, or 5 above, a glycoconjugate derived from S. pneumoniae serotype 33F.

[0272] In one embodiment, the first immunogenic composition further comprises glycoconjugates from S. pneumoniae serotypes 8, 10A, 11A, 12F, 22F, and 33F in addition to glycoconjugates from S. pneumoniae serotypes 15B or 15C.

[0273] Preferably, all glycoconjugates of said first immunogenic composition are individually conjugated to a carrier protein.

[0274] In one embodiment of any of the above first immunogenic compositions, glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugates from S. pneumoniae serotypes 1, 5, and 7F are conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugates from S. pneumoniae serotypes 6A and 19A are conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 3 is conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 22F is conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 33F is conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 10A is conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 11A is conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 12F is conjugated to CRM 197 In one embodiment of any of the above first immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 8 is conjugated to CRM 197 is conjugated to

[0275] In one embodiment, all of the glycoconjugates of any of the first immunogenic compositions are 197 are individually conjugated to

[0276] In one embodiment, the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and / or 23F of any of the first immunogenic compositions are individually conjugated to PD.

[0277] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 18C of any of the above first immunogenic compositions is conjugated to TT.

[0278] In one embodiment, the S. pneumoniae serotype 19F derived glycoconjugate of any of the above first immunogenic compositions is conjugated to DT.

[0279] In one embodiment, the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the first immunogenic compositions are individually conjugated to PD, the glycoconjugate from S. pneumoniae serotype 18C is conjugated to TT and the glycoconjugate from S. pneumoniae serotype 19F is conjugated to DT.

[0280] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the first immunogenic compositions are individually conjugated to PD, the glycoconjugates derived from S. pneumoniae serotype 18C are conjugated to TT, the glycoconjugates derived from S. pneumoniae serotype 19F are conjugated to DT and the glycoconjugates derived from S. pneumoniae serotype 22F are conjugated to CRM. 197 and a glycoconjugate derived from S. pneumoniae serotype 33F was conjugated to CRM 197 is conjugated to

[0281] In one embodiment, the first immunogenic composition comprises glycoconjugates from 7-25 different serotypes of S. pneumoniae. In one embodiment, the first immunogenic composition comprises glycoconjugates from 7-20 different serotypes of S. pneumoniae. In one embodiment, the first immunogenic composition comprises glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different serotypes. In one embodiment, the first immunogenic composition comprises glycoconjugates from 7 different serotypes. In one embodiment, the first immunogenic composition comprises glycoconjugates from 8 different serotypes. In one embodiment, the first immunogenic composition comprises glycoconjugates from 10 different serotypes. In one embodiment, the first immunogenic composition comprises glycoconjugates from 15 different serotypes. In one embodiment, the first immunogenic composition comprises glycoconjugates from 16 different serotypes. In one embodiment, the first immunogenic composition comprises glycoconjugates from 20 different serotypes. In one embodiment, the first immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 7-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is an 8-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 9-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 10-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is an 11-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 12-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 13-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 14-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 15-valent pneumococcal conjugate composition.In one embodiment, the first immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 17-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is an 18-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 20-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 21-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 22-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 23-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 24-valent pneumococcal conjugate composition. In one embodiment, the first immunogenic composition is a 25-valent pneumococcal conjugate composition.

[0282] In one embodiment, the first immunogenic composition is an octavalent pneumococcal conjugate composition, which in addition to a glycoconjugate derived from S. pneumoniae serotype 15B or 15C, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F individually conjugated to:

[0283] In one embodiment, the first immunogenic composition is a 14-valent pneumococcal conjugate composition, which in addition to the glycoconjugate from S. pneumoniae serotype 15B or 15C, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to

[0284] In one embodiment, the first immunogenic composition is a 15-valent pneumococcal conjugate composition, which in addition to the glycoconjugate from S. pneumoniae serotype 15B or 15C, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 22F individually conjugated to:

[0285] In one embodiment, the first immunogenic composition is a 15-valent pneumococcal conjugate composition, which in addition to the glycoconjugate from S. pneumoniae serotype 15B or 15C, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F individually conjugated to

[0286] In one embodiment, the first immunogenic composition is a 16-valent pneumococcal conjugate composition, which in addition to the glycoconjugate from S. pneumoniae serotype 15B or 15C, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0287] In one embodiment, the first immunogenic composition is a 20-valent pneumococcal conjugate composition, which in addition to the glycoconjugate from S. pneumoniae serotype 15B or 15C, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0288] In one embodiment, the first immunogenic composition further comprises one or more adjuvants as disclosed in Section 4 below.

[0289] In one embodiment, the first immunogenic composition is formulated as disclosed in Section 5 below.

[0290] 1. In one embodiment, said second immunogenic composition further comprises glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F in addition to glycoconjugates from S. pneumoniae serotype 15A.

[0291] 2. In another embodiment, said second immunogenic composition comprises, in addition to item 1 above, glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F.

[0292] 3. In another embodiment, said second immunogenic composition comprises, in addition to item 1 or 2 above, glycoconjugates derived from S. pneumoniae serotypes 6A and 19A.

[0293] 4. In another embodiment, said second immunogenic composition comprises, in addition to item 1, 2 or 3 above, a glycoconjugate derived from S. pneumoniae serotype 3.

[0294] 5. In another embodiment, said second immunogenic composition comprises, in addition to item 1, 2, 3 or 4 above, a glycoconjugate derived from S. pneumoniae serotype 22F.

[0295] 6. In another embodiment, said second immunogenic composition comprises, in addition to item 1, 2, 3, 4, or 5 above, a glycoconjugate derived from S. pneumoniae serotype 33F.

[0296] Preferably, all glycoconjugates of said second immunogenic composition are individually conjugated to a carrier protein.

[0297] In one embodiment of any of the above second immunogenic compositions, glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugates from S. pneumoniae serotypes 1, 5, and 7F are conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugates from S. pneumoniae serotypes 6A and 19A are conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 3 is conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 22F is conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 33F is conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 10A is conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 11A is conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 12F is conjugated to CRM197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 8 is conjugated to CRM 197 is conjugated to

[0298] In one embodiment, the glycoconjugate of any of the above second immunogenic compositions is 197 All are individually conjugated to

[0299] In one embodiment, the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and / or 23F of any of the above second immunogenic compositions are individually conjugated to PD.

[0300] In one embodiment, the S. pneumoniae serotype 18C derived glycoconjugate of any of the above second immunogenic compositions is conjugated to TT.

[0301] In one embodiment, the S. pneumoniae serotype 19F derived glycoconjugate of any of the above second immunogenic compositions is conjugated to DT.

[0302] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above second immunogenic compositions are individually conjugated to PD, the glycoconjugates derived from S. pneumoniae serotype 18C are conjugated to TT and the glycoconjugates derived from S. pneumoniae serotype 19F are conjugated to DT.

[0303] In one embodiment, the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the second immunogenic compositions are individually conjugated to PD, the glycoconjugate from S. pneumoniae serotype 18C is conjugated to TT, the glycoconjugate from S. pneumoniae serotype 19F is conjugated to DT and the glycoconjugate from S. pneumoniae serotype 22F is conjugated to CRM. 197 and a glycoconjugate derived from S. pneumoniae serotype 33F was conjugated to CRM 197 is conjugated to

[0304] In one embodiment, the second immunogenic composition comprises glycoconjugates from 7-25 different serotypes of S. pneumoniae. In one embodiment, the second immunogenic composition comprises glycoconjugates from 7-20 different serotypes of S. pneumoniae. In one embodiment, the second immunogenic composition comprises glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates from 7 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates from 8 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates from 10 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates from 15 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates from 16 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates from 20 different serotypes. In one embodiment, the second immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 7-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is an 8-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 9-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 10-valent pneumococcal conjugate composition. In some embodiments, the second immunogenic composition is an 11-valent pneumococcal conjugate composition. In some embodiments, the second immunogenic composition is a 12-valent pneumococcal conjugate composition. In some embodiments, the second immunogenic composition is a 13-valent pneumococcal conjugate composition. In some embodiments, the second immunogenic composition is a 14-valent pneumococcal conjugate composition. In some embodiments, the second immunogenic composition is a 15-valent pneumococcal conjugate composition.In one embodiment, the second immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 17-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is an 18-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 20-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 21-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 22-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 23-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 24-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 25-valent pneumococcal conjugate composition.

[0305] In one embodiment, the second immunogenic composition is an octavalent pneumococcal conjugate composition, which in addition to the glycoconjugate derived from S. pneumoniae serotype 15A, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F individually conjugated to:

[0306] In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition, which in addition to the glycoconjugate derived from S. pneumoniae serotype 15A, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to

[0307] In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition, which in addition to the glycoconjugate derived from S. pneumoniae serotype 15A, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 22F individually conjugated to:

[0308] In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition, which in addition to the glycoconjugate derived from S. pneumoniae serotype 15A, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F individually conjugated to

[0309] In one embodiment, the second immunogenic composition is a 16-valent pneumococcal conjugate composition, which in addition to the glycoconjugate from S. pneumoniae serotype 15A, comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0310] In one embodiment, the second immunogenic composition is a 20-valent pneumococcal conjugate composition, wherein in addition to the glycoconjugate derived from S. pneumoniae serotype 15A, the composition comprises a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0311] In one embodiment, the second immunogenic composition is a 9-valent pneumococcal conjugate composition, comprising in addition to a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F individually conjugated to:

[0312] In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition, comprising in addition to a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to

[0313] In one embodiment, the second immunogenic composition is a 16-valent pneumococcal conjugate composition, comprising in addition to a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 22F individually conjugated to:

[0314] In one embodiment, the second immunogenic composition is a 16-valent pneumococcal conjugate composition, comprising in addition to a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, a CRMP 197The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F individually conjugated to

[0315] In one embodiment, the second immunogenic composition is a 17-valent pneumococcal conjugate composition, comprising in addition to a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0316] In one embodiment, the second immunogenic composition is a 21-valent pneumococcal conjugate composition, comprising in addition to a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, a CRMP 197 The present invention further includes glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0317] In one embodiment, the second immunogenic composition further comprises one or more adjuvants as disclosed in Section 4 below.

[0318] In certain embodiments, the second immunogenic composition is formulated as disclosed in Section 5 below.

[0319] 1.10 Complementary Vaccines for Achieving Optimal Protection Against S. pneumoniae Serotypes 15A, 15B, and 15C of the Present Invention In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A but does not include glycoconjugates derived from S. pneumoniae serotypes 15B and 15C.

[0320] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15B but does not include glycoconjugates from S. pneumoniae serotypes 15A and 15C.

[0321] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15C but does not include glycoconjugates derived from S. pneumoniae serotypes 15A and 15B.

[0322] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include a glycoconjugate derived from S. pneumoniae serotype 15B.

[0323] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15B, but does not include a glycoconjugate derived from S. pneumoniae serotype 15C.

[0324] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include a glycoconjugate derived from S. pneumoniae serotype 15A.

[0325] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 15B, 15C, 18C, 19F, and 23F.

[0326] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 15A, 15C, 18C, 19F, and 23F.

[0327] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 15A, 15B, 18C, 19F, and 23F.

[0328] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 15B, 18C, 19F, and 23F.

[0329] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 15C, 18C, 19F, and 23F.

[0330] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 15A, 18C, 19F, and 23F.

[0331] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 15B, 15C, 18C, 19F, and 23F.

[0332] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 15A, 15C, 18C, 19F, and 23F.

[0333] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 15A, 15B, 18C, 19F, and 23F.

[0334] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 15B, 18C, 19F, and 23F.

[0335] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 15C, 18C, 19F, and 23F.

[0336] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 15A, 18C, 19F, and 23F.

[0337] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 15C, 18C, 19A, 19F, and 23F.

[0338] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15C, 18C, 19A, 19F, and 23F.

[0339] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15B, 18C, 19A, 19F, and 23F.

[0340] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, and 23F.

[0341] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15C, 18C, 19A, 19F, and 23F.

[0342] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 18C, 19A, 19F, and 23F.

[0343] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 15C, 18C, 19A, 19F, and 23F.

[0344] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15C, 18C, 19A, 19F, and 23F.

[0345] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15B, 18C, 19A, 19F, and 23F.

[0346] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, and 23F.

[0347] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15C, 18C, 19A, 19F, and 23F.

[0348] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 18C, 19A, 19F, and 23F.

[0349] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0350] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0351] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0352] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0353] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0354] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 18C, 19A, 19F, 22F, 23F, and 33F.

[0355] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0356] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0357] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0358] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0359] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0360] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15A, 18C, 19A, 19F, 22F, 23F, and 33F.

[0361] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0362] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0363] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0364] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0365] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0366] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15B and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 18C, 19A, 19F, 22F, 23F, and 33F.

[0367] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0368] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0369] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0370] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15B, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0371] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0372] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15C, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0373] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from S. pneumoniae serotype 15A and glycoconjugates derived from S. pneumoniae serotype 15B, but does not include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15C, 18C, 19A, 19F, 22F, 23F, and 33F.

[0374] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate from S. pneumoniae serotype 15B and a glycoconjugate from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 18C, 19A, 19F, 22F, 23F, and 33F.

[0375] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15A, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0376] In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from S. pneumoniae serotype 15C, but does not include glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0377] Preferably, all glycoconjugates of the immunogenic composition are individually conjugated to a carrier protein.

[0378] In one embodiment of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15C is 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15B is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate from S. pneumoniae serotype 15A is conjugated to CRM 197 is conjugated to

[0379] In one embodiment, the immunogenic composition comprises glycoconjugates from 2 to 25 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition comprises glycoconjugates from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different pneumococcal serotypes.

[0380] In one embodiment, the immunogenic composition comprises glycoconjugates from two different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from three different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from four different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from five different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from six different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from seven different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from eight different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from nine different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from ten different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 11 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 12 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 13 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 14 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 15 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 17 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 18 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 19 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 20 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 21 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 22 different pneumococcal serotypes.In one embodiment, the immunogenic composition comprises glycoconjugates from 23 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 24 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 25 different pneumococcal serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 or 20 different serotypes.

[0381] In one embodiment, the immunogenic composition is a 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 21-valent pneumococcal conjugate composition.

[0382] It is preferred that all glycoconjugates of the immunogenic composition of the invention are individually conjugated to a carrier protein. In one embodiment, the glycoconjugates of the immunogenic composition of the invention are conjugated to a carrier protein. 197 In one embodiment, the glycoconjugate of the immunogenic composition of the invention is individually conjugated to CRM 197 All are individually conjugated to

[0383] The immunogenic compositions of this section are also particularly useful for complementing prior art vaccines to provide optimal protection against S. pneumoniae serotypes 15A, 15B, and 15C.

[0384] In particular, the immunogenic compositions of this section are particularly useful in complementing prior art vaccines such as Prevnar®, Prevnar 13®, and Synflorix® to provide optimal protection against S. pneumoniae serotypes 15A, 15B, and 15C.

[0385] In one embodiment, the immunogenic compositions of this section are for use in complementing a 10-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F are conjugated to PD, the glycoconjugate from S. pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate from S. pneumoniae serotype 19F is conjugated to DT.

[0386] In one embodiment, the immunogenic compositions of this section are for use to complement a vaccine comprising glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.

[0387] In one embodiment, the immunogenic compositions of this section are for use in complementing a 12-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are selected from the group consisting of the CRM 197 is conjugated to

[0388] In one embodiment, the immunogenic compositions of this section are for use to complement a vaccine comprising glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.

[0389] In one embodiment, the immunogenic compositions of this section are for use in complementing a 13-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are selected from the group consisting of the CRM 197 is conjugated to

[0390] In one embodiment, the immunogenic compositions of this section are for use to complement a vaccine comprising glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.

[0391] In one embodiment, the immunogenic compositions of this section are for use in complementing a 14-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F are selected from the group consisting of the CRM 197 is conjugated to

[0392] In one embodiment, the immunogenic compositions of this section are for use to complement a vaccine comprising glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.

[0393] In one embodiment, the immunogenic compositions of this section are for use in complementing a 15-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F are selected from the group consisting of CRM 197 is conjugated to

[0394] In one embodiment, the immunogenic compositions of this section are for use to complement a vaccine comprising glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0395] In one embodiment, the immunogenic compositions of this section are for use in complementing a 19-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F are selected from the group consisting of the CRM 197 is conjugated to

[0396] In one embodiment, the immunogenic compositions of this section are for use to complement a vaccine comprising glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.

[0397] In one embodiment, the immunogenic compositions of this section are for use in complementing a 20-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F are selected from the group consisting of CRM 197 is conjugated to

[0398] In one embodiment, the immunogenic compositions of this section are for use in complementing a 22-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 10A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 10A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B are selected from the group consisting of the CRM 197 is conjugated to

[0399] In one embodiment, the immunogenic compositions of this section are for use in complementing a 23-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B are selected from the group consisting of the CRM 197 is conjugated to

[0400] In one embodiment, the immunogenic compositions of this section are for use in complementing a 24-valent pneumococcal conjugate vaccine consisting of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B. In one embodiment, said glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15C, 18C, 19A, 19F, 22F, 23B, 23F, 24F, 33F, and 35B are selected from the group consisting of the CRM 197 is conjugated to

[0401] "For use in complementing" or "complementing" a particular vaccine refers to the use of an immunogenic composition to extend the protection of the vaccine to S. pneumoniae serotypes for which the vaccine does not provide meaningful protection. In particular, the immunogenic compositions of this section are useful for complementing a vaccine to provide meaningful protection against S. pneumoniae serotypes 15A, 15B, and / or 15C, preferably S. pneumoniae serotypes 15A, 15B, and 15C.

[0402] Thus, in an embodiment, the immunogenic compositions of this section comprising glycoconjugates from S. pneumoniae serotypes 15B and 15C are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate from S. pneumoniae serotype 15A but not from S. pneumoniae serotypes 15B and 15C.

[0403] In an embodiment, the immunogenic compositions of this section comprising glycoconjugates from S. pneumoniae serotypes 15A and 15C are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate from S. pneumoniae serotype 15B but not a glycoconjugate from S. pneumoniae serotypes 15A and 15C.

[0404] In an embodiment, the immunogenic compositions of this section comprising glycoconjugates from S. pneumoniae serotypes 15A and 15B are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate from S. pneumoniae serotype 15C but not a glycoconjugate from S. pneumoniae serotypes 15A and 15B.

[0405] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15C are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15B, but not a glycoconjugate derived from S. pneumoniae serotype 15C.

[0406] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15C are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15A but not a glycoconjugate derived from S. pneumoniae serotype 15C.

[0407] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15C are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15B but not a glycoconjugate derived from S. pneumoniae serotype 15C.

[0408] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15B are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15A and a glycoconjugate derived from S. pneumoniae serotype 15C, but not a glycoconjugate derived from S. pneumoniae serotype 15B.

[0409] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15B are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15A but not a glycoconjugate derived from S. pneumoniae serotype 15B.

[0410] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15B are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15C but not a glycoconjugate derived from S. pneumoniae serotype 15B.

[0411] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15A are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15B and a glycoconjugate derived from S. pneumoniae serotype 15C, but not a glycoconjugate derived from S. pneumoniae serotype 15A.

[0412] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15A are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15B but not a glycoconjugate derived from S. pneumoniae serotype 15A.

[0413] In an embodiment, the immunogenic compositions of this section comprising a glycoconjugate derived from S. pneumoniae serotype 15A are for use to complement a pneumococcal conjugate vaccine comprising a glycoconjugate derived from S. pneumoniae serotype 15C but not a glycoconjugate derived from S. pneumoniae serotype 15A.

[0414] 2. Dosage of Immunogenic Composition 2.1 Polysaccharide content The amount of glycoconjugate in each dose is selected as an amount that induces an immunoprotective response without significant adverse side effects in a typical vaccine recipient, and such amount will vary depending on which particular immunogen is used and how it is presented.

[0415] The amount of a particular saccharide conjugate in an immunogenic composition can be calculated based on the total polysaccharide (conjugated and unconjugated) of that conjugate. For example, a saccharide conjugate containing 20% ​​free polysaccharide contains about 80 μg of conjugated polysaccharide and about 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of saccharide conjugate can vary depending on the streptococcus serotype. The saccharide concentration can be determined by uronic acid assay.

[0416] The "immunogenic amounts" of the various polysaccharide components in the immunogenic composition may vary and may each comprise about 1.0 μg, about 2.0 μg, about 3.0 μg, about 4.0 μg, about 5.0 μg, about 6.0 μg, about 7.0 μg, about 8.0 μg, about 9.0 μg, about 10.0 μg, about 15.0 μg, about 20.0 μg, about 30.0 μg, about 40.0 μg, about 50.0 μg, about 60.0 μg, about 70.0 μg, about 80.0 μg, about 90.0 μg, or about 100.0 μg of any particular polysaccharide antigen.

[0417] Generally, each dose contains between 0.1 μg and 100 μg, specifically between 0.5 μg and 20 μg, more specifically between 1 μg and 10 μg, and even more specifically between 2 μg and 5 μg of polysaccharide of a given serotype. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0418] In certain embodiments, each dose contains 1 μg, 2 μg, 3 μg, 4 μg, 5 μg, 6 μg, 7 μg, 8 μg, 9 μg, 10 μg, 15 μg, or 20 μg of polysaccharide for a given serotype.

[0419] 2.2 Amount of support Typically, each dose comprises between 5 μg and 150 μg of carrier protein, specifically between 10 μg and 100 μg of carrier protein, more specifically between 15 μg and 100 μg of carrier protein, more specifically between 25 and 75 μg of carrier protein, more specifically between 30 μg and 70 μg of carrier protein, more specifically between 30 and 60 μg of carrier protein, more specifically between 30 and 50 μg of carrier protein, and even more specifically between 40 and 60 μg of carrier protein. In one embodiment, the carrier protein is CRM 197 It is.

[0420] In certain embodiments, each dose is about 25 μg, about 26 μg, about 27 μg, about 28 μg, about 29 μg, about 30 μg, about 31 μg, about 32 μg, about 33 μg, about 34 μg, about 35 μg, about 36 μg, about 37 μg, about 38 μg, about 39 μg, about 40 μg, about 41 μg, about 42 μg, about 43 μg, about 44 μg, about 45 μg, about 46 μg, about 47 μg, about 48 μg, about 49 μg, In one embodiment, the carrier protein comprises about 50 μg, about 51 μg, about 52 μg, about 53 μg, about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg, or about 75 μg of carrier protein. 197 It is.

[0421] 3. Further antigens The immunogenic composition of the invention comprises conjugated S. pneumoniae saccharide antigens (saccharide conjugates). The immunogenic composition of the invention may also further comprise antigens from other pathogens, in particular from bacteria and / or viruses. Preferred further antigens are selected from diphtheria toxoid (D), tetanus toxoid (T), pertussis antigens (P), which are usually acellular (Pa), Hepatitis B virus (HBV) surface antigen (HBsAg), Hepatitis A virus (HAV) antigens, conjugated Haemophilus influenzae type b capsular saccharide (Hib), inactivated poliovirus vaccine (IPV).

[0422] In an embodiment, the immunogenic composition of the invention comprises DT-Pa. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In an embodiment, the immunogenic composition of the invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In an embodiment, the immunogenic composition of the invention comprises DT-Pa-HBsAg-IPV-Hib.

[0423] 4. Adjuvants In an embodiment, the immunogenic composition disclosed herein may further comprise at least one adjuvant (e.g., one, two, or three adjuvants). The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An antigen may act primarily as a delivery system, may act primarily as an immunomodulator, or may have both strong features. Suitable adjuvants include those suitable for use in mammals, including humans.

[0424] Examples of known suitable delivery system type adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween™ 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.

[0425] In an embodiment, the immunogenic compositions disclosed herein comprise an aluminum salt (alum) as an adjuvant (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In a preferred embodiment, the immunogenic compositions disclosed herein comprise aluminum phosphate or aluminum hydroxide as an adjuvant. In an embodiment, the immunogenic compositions disclosed herein comprise 0.1 mg / mL to 1 mg / mL or 0.2 mg / mL to 0.3 mg / mL of elemental aluminum in the form of aluminum phosphate. In an embodiment, the immunogenic compositions disclosed herein comprise about 0.25 mg / mL of elemental aluminum in the form of aluminum phosphate.

[0426] Examples of known suitable immune modulating adjuvants that can be used in humans include, but are not limited to, saponin extracted from the bark of the Aquilla tree (QS21, Quil A®), TLR4 agonists such as MPL (monophosphoryl lipid A), 3DMPL (3-O-deacylated MPL) or GLA-AQ, LT / CT mutants, cytokines such as various interleukins (e.g., IL-2, IL-12) or GM-CSF, and the like.

[0427] Examples of known suitable immune modulating adjuvants that have both delivery and immune modulating features that can be used in humans include, but are not limited to, ISCOMS (see, e.g., Sjolander et al. (1998) J. Leukocyte Biol., 64:713, WO90 / 03184, WO96 / 11711, WO00 / 48630, WO98 / 36772, WO00 / 41720, WO2006 / 134423, and WO2007 / 026190), or GLA-EM, which is a combination of a TLR4 agonist and an oil-in-water emulsion.

[0428] For veterinary applications, including but not limited to animal testing, Freund's complete adjuvant (CFA), Freund's incomplete adjuvant (IFA), Emulsigen, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetyl-muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 11637, referred to as nor-MDP), and N-acetyl-muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 11637, referred to as nor-MDP). 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria: monophosphoryl lipid A, trehalose dimycolate, and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene / TWEEN™ 80 emulsion, can be used.

[0429] Additional exemplary adjuvants for enhancing the efficacy of the pneumococcal vaccines disclosed herein include, but are not limited to, (1) for example, (a) SAF containing 10% squalane, 0.4% TWEEN™ 80, 5% Pluronic™ block polymer L121, and thr-MDP that has been microfluidized into a submicron emulsion or vortexed to create a larger particle size emulsion, and (b) the RIBI™ Adjuvant System (RAS) (Ribi™) containing 2% squalene, 0.2% TWEEN™ 80, and one or more bacterial cell wall components such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™). (2) oil-in-water emulsion formulations (with or without muramyl peptides (see below) or other specific immunostimulants such as bacterial cell wall components), such as QS21, STIMULON™ (Cambridge Bioscience, Worcester, Massachusetts), ABISCO® (Isconova, Sweden), or ISCOMATRIX® (Commonwealth Serum (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) cytokines such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (WO99 / 44636)), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), and the like; (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL), optionally in the substantial absence of alum when used with pneumococcal saccharide (e.g., GB-2220221,(see, for example, WO 00 / 56358), (6) combinations of 3dMPL with, for example, QS21 and / or oil-in-water emulsions (see, for example, EP 0835318, EP 0735898, EP 0761231), (7) polyoxyethylene ethers or polyoxyethylene esters (see, for example, WO 99 / 52549), (8) polyoxyethylene sorbitan ester surfactants in combination with octoxynol (WO 01 / 21207), or polyoxyethylene sorbitan ester surfactants in combination with at least one additional non-ionic surfactant such as octoxynol. (9) saponin and an immunostimulatory oligonucleotide (e.g., CpG oligonucleotide) (WO00 / 62800); (10) an immunostimulant and a metal salt particle (see, for example, WO00 / 23105); (11) saponin and an oil-in-water emulsion, e.g., WO99 / 11241; (12) saponin (e.g., QS21) + 3dMPL + IM2 (optionally + sterol), e.g., WO98 / 57659; (13) other substances which act as immunostimulants to enhance the effectiveness of the composition. Examples of muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), and N-acetyl-muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE).

[0430] In an embodiment of the present invention, the immunogenic composition disclosed herein comprises a CpG oligonucleotide as an adjuvant.As used herein, CpG oligonucleotide refers to immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and thus, unless otherwise specified, these terms are used interchangeably.

[0431] The immunostimulatory CpG oligodeoxynucleotides optionally contain one or more immunostimulatory CpG motifs that are unmethylated cytosine-guanine dinucleotides within certain preferred basic contexts. The methylation state of the CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide that contains a 5' unmethylated cytosine linked to a 3' guanine by a phosphate bond and activates the immune system through binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides that activate the immune system through TLR9, but not as strongly as if the CpG motif was unmethylated. The CpG immunostimulatory oligonucleotide may contain one or more palindromic structures, and the palindromic structure may encompass a CpG dinucleotide. CpG oligonucleotides are described in several issued patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068.

[0432] In one embodiment of the invention, the immunogenic composition disclosed herein comprises any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO2010 / 125480.

[0433] Various classes of CpG immunostimulatory oligonucleotides have been identified. They are referred to as A, B, C, and P classes, and are described in more detail in WO2010 / 125480, p. 3, line 22 to p. 12, line 36. The methods of the present invention encompass the use of these various classes of CpG immunostimulatory oligonucleotides.

[0434] In certain embodiments of the invention, the immunogenic compositions disclosed herein comprise A class CpG oligonucleotides.In certain embodiments of the invention, the immunogenic compositions disclosed herein comprise B class CpG oligonucleotides.

[0435] The B class CpG oligonucleotide sequences of the present invention are as generally described above and as disclosed in published WO96 / 02555, WO98 / 18810, U.S. Patent Nos. 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116, and 6,339,068. Exemplary sequences include, but are not limited to, those disclosed in these latter applications and patents.

[0436] In one embodiment, the "B class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 1), or 5'TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO: 2), or 5'TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEQ ID NO: 3), or 5'TCGTCGTTTCGTCGTTTTGTCGTT 3' (SEQ ID NO: 4), or 5'TCGTCGTTTTGTCGTTTTTTTCGA 3' (sequence number 5).

[0437] In any of these sequences, all linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, making a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may replace the 5'T. Examples of halogen replacements include, but are not limited to, bromo-uridine or iodo-uridine replacements.

[0438] Some non-limiting examples of B class oligonucleotides include: 5'T * C * G * T * C * G * T * T * T * T * T * C * G * G * T * G * C * T * T * T * T 3' (SEQ ID NO:6), or 5'T * C * G * T * C * G * T * T * T * T * T * C * G * G * T * C * G * T * T * T * T 3' (SEQ ID NO: 7), or 5'T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T * T * T * G * T * C * G* T * T 3' (SEQ ID NO: 8), or 5'T * C * G * T * C * G * T * T * T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T 3' (SEQ ID NO: 9), or 5'T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T * T * T * T * T * T * C * G * A 3' (SEQ ID NO: 10) [where "*" refers to a phosphorothioate bond].

[0439] In certain embodiments of the present invention, the immunogenic compositions disclosed herein comprise C class CpG oligonucleotides.

[0440] In certain embodiments of the invention, the immunogenic compositions disclosed herein comprise a P class CpG oligonucleotide.

[0441] In one embodiment, the oligonucleotide comprises at least one phosphorothioate linkage. In another embodiment, all internucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like linkage. In another embodiment, the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0442] In one embodiment, all internucleotide linkages of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides as described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are rendered resistant to degradation (e.g., stabilized). "Stabilized oligonucleotides" refer to oligonucleotides that are relatively resistant to in vivo degradation (e.g., via exo- or endonucleases). Nucleic acid stabilization can be achieved through backbone modifications. Oligonucleotides with phosphorothioate linkages provide the greatest activity and protect the oligonucleotide from degradation by intracellular exo- or endonucleases.

[0443] The immunostimulatory oligonucleotide may have a chimeric backbone with a combination of phosphodiester and phosphorothioate linkages. For the purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone in which at least one internucleotide linkage is phosphodiester or phosphodiester-like and at least one other internucleotide linkage is a stabilized internucleotide linkage, and at least one phosphodiester or phosphodiester-like linkage and at least one stabilized linkage are different. When the phosphodiester linkages are preferentially located within CpG motifs, such molecules are called "semi-soft" as described in WO2007 / 026190.

[0444] Other modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methyl phosphorothioate, phosphorodithioate, and / or p-ethoxy linkages.

[0445] Mixed backbone modified ODNs can be synthesized as described in WO2007 / 026190.

[0446] The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) may also contribute to the stimulatory activity of the oligonucleotide. To facilitate intracellular uptake, the CpG oligonucleotides of the invention preferably have a minimum length of six nucleotide residues. Since larger oligonucleotides are degraded intracellularly, oligonucleotides of any size greater than six nucleotides (even many kb in length) can induce an immune response if sufficient immunostimulatory motifs are present. In certain embodiments, the CpG oligonucleotides are 6-100 nucleotides in length, preferentially 8-30 nucleotides in length. In important embodiments, the nucleic acids and oligonucleotides of the invention are not plasmids or expression vectors.

[0447] In certain embodiments, the CpG oligonucleotides disclosed herein contain substitutions or modifications, such as bases and / or sugars, as described in paragraphs 134-147 of WO2007 / 026190.

[0448] In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known and are described, for example, in Uhlmann et al. (1990) Chem.Rev., 90:543, S.Agrawal, ed., Humana Press, Totowa, USA, 1993, Crooke et al. (1996) Annu.Rev.Pharmacol.Toxicol., 36:107-129, and Hunziker et al. (1995) Mod.Synth.Methods, 7:331-417. The oligonucleotide according to the present invention may have one or more modifications, each modification being located at a specific phosphodiester internucleoside bridge, and / or a specific β-D-ribose unit, and / or a specific natural nucleoside base position compared to the oligonucleotide of the same sequence composed of natural DNA or RNA.

[0449] In some embodiments of the invention, the CpG-containing nucleic acid may simply be mixed with an immunogenic carrier according to methods known to those of skill in the art (see, for example, WO03 / 024480).

[0450] In a specific embodiment of the invention, any immunogenic composition disclosed herein comprises 2 μg to 100 mg of CpG oligonucleotide, preferably 0.1 mg to 50 mg of CpG oligonucleotide, preferably 0.2 mg to 10 mg of CpG oligonucleotide, preferably 0.3 mg to 5 mg of CpG oligonucleotide, preferably 0.3 mg to 5 mg of CpG oligonucleotide, more preferably 0.5 mg to 2 mg of CpG oligonucleotide, more preferably 0.75 mg to 1.5 mg of CpG oligonucleotide. In a preferred embodiment, any immunogenic composition disclosed herein comprises about 1 mg of CpG oligonucleotide.

[0451] 5. Preparation The immunogenic compositions of the invention may be formulated in liquid form (i.e., solution or suspension) or in lyophilized form. Liquid formulations can be conveniently administered directly from their packaged form and are therefore ideal for injection without the need for reconstitution in an aqueous medium, as is otherwise required for the lyophilized compositions of the invention.

[0452] The formulation of the immunogenic composition of the present invention can be achieved using art-recognized methods.For example, the individual pneumococcal conjugates can be formulated with a physiologically acceptable vehicle to prepare the composition.Examples of such vehicles include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solutions.

[0453] The present disclosure provides immunogenic compositions comprising any of the glycoconjugates disclosed herein in combination with a pharma- ceutically acceptable excipient, carrier, or diluent.

[0454] In certain embodiments, the immunogenic compositions of the invention are in liquid form, preferably in aqueous liquid form.

[0455] The immunogenic compositions of the present disclosure may include one or more of a buffering agent, a salt, a divalent cation, a non-ionic surfactant, a cryoprotectant such as a sugar, and an antioxidant such as a free radical scavenger or a chelating agent, or any complex combination thereof.

[0456] In one embodiment, the immunogenic composition of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is phosphate, succinate, histidine, or citrate. In one particular embodiment, the buffer is succinate at a final concentration of 1 mM to 10 mM. In one particular embodiment, the final concentration of the succinate buffer is about 5 mM.

[0457] In certain embodiments, the immunogenic composition of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In one particular embodiment, the salt is sodium chloride. In one particular embodiment, the salt is sodium chloride. In one particular embodiment, the immunogenic composition of the present invention comprises 150 mM sodium chloride.

[0458] In certain embodiments, the immunogenic composition of the invention comprises a surfactant, which in certain embodiments is selected from the group consisting of polysorbate 20 (TWEEN™ 20), polysorbate 40 (TWEEN™ 40), polysorbate 60 (TWEEN™ 60), polysorbate 65 (TWEEN™ 65), polysorbate 80 (TWEEN™ 80), polysorbate 85 (TWEEN™ 85), TRITON™ N-101, TRITON™ X-100, oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H15), polyoxyethylene-35-ricinoleate (CREMOPHOR® EL), soy lecithin, and poloxamer. In one particular embodiment, the surfactant is polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% weight to weight (w / w) of polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% weight to weight (w / w) of polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% weight to weight (w / w) of polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% polysorbate 80 (w / w). In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.02% polysorbate 80 (w / w). In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.01% polysorbate 80 (w / w). In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.03% polysorbate 80 (w / w). In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.04% polysorbate 80 (w / w).In another embodiment, the final concentration of polysorbate 80 in the formulation is 0.05% (w / w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% (w / w) polysorbate 80.

[0459] In one particular embodiment, the surfactant is polysorbate 20. In some of the embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.0001% to 10% weight to weight (w / w) of polysorbate 20. In some of the embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.001% to 1% weight to weight (w / w) of polysorbate 20. In some of the embodiments, the final concentration of polysorbate 20 in the formulation is at least 0.01% to 1% weight to weight (w / w) of polysorbate 20. In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.02% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.01% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.03% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.04% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 0.05% polysorbate 20 (w / w). In another embodiment, the final concentration of polysorbate 20 in the formulation is 1% polysorbate 20 (w / w).

[0460] In one particular embodiment, the surfactant is polysorbate 40. In some of the embodiments, the final concentration of polysorbate 40 in the formulation is at least 0.0001% to 10% weight to weight (w / w) of polysorbate 40. In some of the embodiments, the final concentration of polysorbate 40 in the formulation is at least 0.001% to 1% weight to weight (w / w) of polysorbate 40. In some of the embodiments, the final concentration of polysorbate 40 in the formulation is at least 0.01% to 1% weight to weight (w / w) of polysorbate 40. In other embodiments, the final concentration of polysorbate 40 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% polysorbate 40 (w / w). In another embodiment, the final concentration of polysorbate 40 in the formulation is 1% polysorbate 40 (w / w).

[0461] In one particular embodiment, the surfactant is polysorbate 60. In some of the embodiments, the final concentration of polysorbate 60 in the formulation is at least 0.0001% to 10% weight to weight (w / w) of polysorbate 60. In some of the embodiments, the final concentration of polysorbate 60 in the formulation is at least 0.001% to 1% weight to weight (w / w) of polysorbate 60. In some of the embodiments, the final concentration of polysorbate 60 in the formulation is at least 0.01% to 1% weight to weight (w / w) of polysorbate 60. In other embodiments, the final concentration of polysorbate 60 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% polysorbate 60 (w / w). In another embodiment, the final concentration of polysorbate 60 in the formulation is 1% polysorbate 60 (w / w).

[0462] In one particular embodiment, the surfactant is polysorbate 65. In some of the embodiments, the final concentration of polysorbate 65 in the formulation is at least 0.0001% to 10% weight to weight (w / w) of polysorbate 65. In some of the embodiments, the final concentration of polysorbate 65 in the formulation is at least 0.001% to 1% weight to weight (w / w) of polysorbate 65. In some of the embodiments, the final concentration of polysorbate 65 in the formulation is at least 0.01% to 1% weight to weight (w / w) of polysorbate 65. In other embodiments, the final concentration of polysorbate 65 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% polysorbate 65 (w / w). In another embodiment, the final concentration of polysorbate 65 in the formulation is 1% polysorbate 65 (w / w).

[0463] In one particular embodiment, the surfactant is polysorbate 85. In some of the embodiments, the final concentration of polysorbate 85 in the formulation is at least 0.0001% to 10% weight to weight (w / w) of polysorbate 85. In some of the embodiments, the final concentration of polysorbate 85 in the formulation is at least 0.001% to 1% weight to weight (w / w) of polysorbate 85. In some of the embodiments, the final concentration of polysorbate 85 in the formulation is at least 0.01% to 1% weight to weight (w / w) of polysorbate 85. In other embodiments, the final concentration of polysorbate 85 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% polysorbate 85 (w / w). In another embodiment, the final concentration of polysorbate 85 in the formulation is 1% polysorbate 85 (w / w).

[0464] In certain embodiments, the immunogenic compositions of the invention have a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, and even more preferably a pH of 5.8 to 6.0.

[0465] In one embodiment, the present invention provides a container filled with any of the immunogenic compositions disclosed herein. In one embodiment, the container is selected from the group consisting of a vial, a syringe, a flask, a fermenter, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.

[0466] In some embodiments, the containers of the present invention are made from glass, metal (e.g., steel, stainless steel, aluminum, etc.), and / or polymer (e.g., thermoplastic, elastomer, thermoplastic elastomer). In some embodiments, the containers of the present invention are made from glass.

[0467] In one embodiment, the present invention provides a syringe filled with any of the immunogenic compositions disclosed herein. In certain embodiments, the syringe is siliconized and / or made from glass.

[0468] A typical dose of the immunogenic composition of the invention for injection is from 0.1 mL to 2 mL, more preferably from 0.2 mL to 1 mL in volume, and even more preferably about 0.5 mL in volume.

[0469] Thus, a container or syringe as defined above is filled with any of the immunogenic compositions defined herein in a volume of between 0.1 mL and 2 mL, more preferably between 0.2 mL and 1 mL, and even more preferably in a volume of about 0.5 mL.

[0470] 6. Ability of an immunogenic composition or set of immunogenic compositions of the invention to induce cross-reactive antibodies In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention can induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15A, 15B, and 15C polysaccharides as determined by an ELISA assay.

[0471] In the ELISA (enzyme-linked immunosorbent assay) method, antibodies from the serum of vaccinated subjects are incubated with polysaccharide adsorbed to a solid support, and bound antibodies are detected using a secondary detection antibody conjugated to an enzyme.

[0472] In one embodiment, the ELISA assay is a standardized ELISA assay as defined by the WHO in the Training Manual For Enzyme Linked Immunosorbent Assay For The Quantitation Of Streptococcus pneumoniae Serotype Specific IgG (Pn PS ELISA) (available at: https: / / www.vaccine.uab.edu / uploads / mdocs / ELISAProtocol(007sp).pdf, accessed June 16, 2020).

[0473] The ELISA measures type-specific IgG anti-S. pneumoniae capsular polysaccharide (PS) antibodies present in human serum. When dilutions of human serum are added to a microtiter plate coated with type-specific capsular PS, antibodies specific for that capsular PS bind to the microtiter plate. Plate-bound antibodies are detected using a goat anti-human IgG alkaline phosphatase-labeled antibody followed by p-nitrophenyl phosphate substrate. The optical density of the colored end product is proportional to the amount of anti-capsular PS antibodies present in the serum.

[0474] In certain embodiments, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15A polysaccharide at a concentration of at least 0.05 μg / ml, 0.1 μg / ml, 0.2 μg / ml, 0.3 μg / ml, 0.35 μg / ml, 0.4 μg / ml, or 0.5 μg / ml as determined by an ELISA assay. In certain embodiments, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15A polysaccharide at a concentration of at least 0.3 μg / ml as determined by an ELISA assay. In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15A polysaccharide at a concentration of at least 0.35 μg / ml as determined by an ELISA assay.

[0475] In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15B polysaccharide at a concentration of at least 0.05 μg / ml, 0.1 μg / ml, 0.2 μg / ml, 0.3 μg / ml, 0.35 μg / ml, 0.4 μg / ml, or 0.5 μg / ml as determined by an ELISA assay. In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15B polysaccharide at a concentration of at least 0.3 μg / ml as determined by an ELISA assay. In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15B polysaccharide at a concentration of at least 0.35 μg / ml as determined by an ELISA assay.

[0476] In certain embodiments, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15C polysaccharide at a concentration of at least 0.05 μg / ml, 0.1 μg / ml, 0.2 μg / ml, 0.3 μg / ml, 0.35 μg / ml, 0.4 μg / ml, or 0.5 μg / ml as determined by an ELISA assay. In certain embodiments, an immunogenic composition or set of immunogenic compositions of the invention may induce IgG antibodies in humans capable of binding S. pneumoniae serotype 15C polysaccharide at a concentration of at least 0.3 μg / ml as determined by an ELISA assay. In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention is capable of inducing IgG antibodies in humans capable of binding S. pneumoniae serotype 15C polysaccharide at a concentration of at least 0.35 μg / ml as determined by an ELISA assay.

[0477] In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce functional antibodies in humans capable of killing S. pneumoniae serotypes 15A, 15B, and 15C as determined by an in vitro opsonophagocytosis assay (OPA) (see Example 1). In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce functional antibodies in humans capable of killing S. pneumoniae serotype 15A as determined by an in vitro opsonophagocytosis assay (OPA). In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce functional antibodies in humans capable of killing S. pneumoniae serotype 15B as determined by an in vitro opsonophagocytosis assay (OPA). In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention can induce functional antibodies in humans capable of killing S. pneumoniae serotype 15C as determined by an in vitro opsonophagocytosis assay (OPA).

[0478] The pneumococcal opsonophagocytosis assay (OPA), which measures the killing of S. pneumoniae cells by phagocytic effector cells in the presence of functional antibodies and complement, is considered an important surrogate method for evaluating the efficacy of pneumococcal vaccines.

[0479] The in vitro opsonophagocytosis assay (OPA) can be performed by incubating together a mixture of Streptococcus pneumoniae cells, heat-inactivated human serum to be tested, differentiated HL-60 cells (phagocytes), and an exogenous complement source (e.g., baby rabbit complement). Opsonophagocytosis proceeds during the incubation, and bacterial cells coated with antibody and complement are killed during opsonophagocytosis. The colony forming units (cfu) of surviving bacteria that escape opsonophagocytosis are determined by plating the assay mixture. The OPA titer is defined as the reciprocal of the dilution that results in a 50% reduction in bacterial counts relative to control wells without test serum. The OPA titer is interpolated from the two dilutions that encompass this 50% killing cutoff.

[0480] An endpoint titer of 1:8 or greater is considered a positive result for these deadly OPAs.

[0481] In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 50% of subjects as determined by an in vitro opsonophagocytic killing assay (OPA). In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 60% of subjects as determined by an in vitro opsonophagocytic killing assay (OPA).

[0482] In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 80% of subjects as determined by an in vitro opsonophagocytic killing assay (OPA). In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 90% of subjects as determined by an in vitro opsonophagocytic killing assay (OPA). In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 95% of subjects as determined by an in vitro opsonophagocytic killing assay (OPA).

[0483] In an embodiment, an immunogenic composition or set of immunogenic compositions of the invention may induce a titer of at least 1:8 against S. pneumoniae serotypes 15A, 15B, and 15C in at least 98% of subjects as determined by an in vitro opsonophagocytosis killing assay (OPA).

[0484] In certain embodiments, a subject may have a serotype-specific OPA titer prior to pneumococcal vaccination, for example, due to natural exposure to S. pneumoniae (eg, in the case of an adult subject).

[0485] Thus, a comparison of OPA activity in sera before and after immunization with the immunogenic compositions of the invention can be performed and compared for their responses to serotypes 15A, 15B, and 15C to assess potential increases in responders (see Example 1).

[0486] In one embodiment, an immunogenic composition or set of immunogenic compositions of the invention significantly increases the proportion of responders (i.e., individuals with sera having a titer of at least 1:8 as determined by in vitro OPA) compared to the pre-immunization population.

[0487] Thus, in one embodiment, an immunogenic composition or suite of immunogenic compositions of the invention may significantly increase the proportion of responders (i.e., individuals with sera having titers of at least 1:8 as determined by in vitro OPA) to S. pneumoniae serotypes 15A, 15B, and 15C compared to a pre-immunization population.

[0488] A comparison of OPA activity in serum before and after immunization with the immunogenic compositions of the invention may be made by comparing the potential increase in OPA titer.

[0489] Thus, a comparison of OPA activity in serum before and after immunization with an immunogenic composition or set of immunogenic compositions of the invention can be performed and their responses to serotypes 15A, 15B, and 15C can be compared to assess the potential for increased OPA titers (see Example 1).

[0490] In certain embodiments, an immunogenic composition or set of immunogenic compositions of the invention may significantly increase OPA titers in human subjects compared to a pre-immunization population.

[0491] Thus, in an embodiment, the immunogenic composition or set of immunogenic compositions of the present invention can significantly increase the OPA titer of a human subject against S. pneumoniae serotypes 15A, 15B, and 15C compared to a pre-immunization population. In an embodiment, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, or 8.0. In an embodiment, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 2.0. In an embodiment, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 3.0. In some embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 4.0. In some embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, or 8.0. In some embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 2.0. In some embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 3.0. In some embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 4.0. In certain embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, or 8.0. In certain embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 2.0. In certain embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 3.0. In certain embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 4.0.

[0492] In one embodiment, an immunogenic composition or a set of immunogenic compositions of the invention can significantly increase OPA titers in human subjects against S. pneumoniae serotypes 15A, 15B, and 15C compared to pre-immunization populations. In certain embodiments, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, or 8.0, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, or 8.0, and the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 7.5, or 8.0. In one embodiment, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 2.0, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 2.0, and the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 2.0. In one embodiment, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 3.0, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 3.0, and the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 3.0. In one embodiment, the fold increase in OPA titer against S. pneumoniae serotype 15A is at least 4.0, the fold increase in OPA titer against S. pneumoniae serotype 15B is at least 4.0, and the fold increase in OPA titer against S. pneumoniae serotype 15C is at least 4.0.

[0493] 7. Use of the Immunogenic Composition and Set of Immunogenic Compositions of the Invention In certain embodiments, the immunogenic composition or set of immunogenic compositions disclosed herein is used as a medicament.

[0494] In particular, the immunogenic composition or set of immunogenic compositions described herein may be used to prevent, treat, or ameliorate a S. pneumoniae infection, disease, or condition in a subject.

[0495] Thus, in one aspect, the invention provides a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention.

[0496] In one aspect, the invention provides a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae in a subject comprising administering to the subject an immunologically effective amount of a set of immunogenic compositions of the invention.

[0497] In one aspect, the invention provides a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 15A, 15B, and 15C in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention.

[0498] In one aspect, the invention provides a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 15A, 15B, and 15C in a subject comprising administering to the subject an immunologically effective amount of a set of immunogenic compositions of the invention.

[0499] In one aspect, the invention provides a method of inducing an immune response against S. pneumoniae serotypes 15A, 15B, and 15C in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention.

[0500] In one aspect, the invention provides a method of inducing an immune response against S. pneumoniae serotypes 15A, 15B, and 15C in a subject, comprising administering to the subject an immunologically effective amount of a set of immunogenic compositions of the invention.

[0501] In one aspect, the immunogenic compositions of the invention are for use in a method for preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 15A, 15B, and 15C in a subject.

[0502] In one aspect, the pair of immunogenic compositions of the invention are for use in a method for preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 15A, 15B, and 15C in a subject.

[0503] In an embodiment, any of the immunogenic compositions disclosed herein are for use in a method of immunizing a subject against infection with S. pneumoniae serotypes 15A, 15B, and 15C.

[0504] In an embodiment, any of the suite of immunogenic compositions disclosed herein is for use in a method of immunizing a subject against infection with S. pneumoniae serotypes 15A, 15B, and 15C.

[0505] In one aspect, the present invention is directed to the use of an immunogenic composition disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 15A, 15B, and 15C in a subject.

[0506] In one aspect, the present invention is directed to the use of a set of immunogenic compositions disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition caused by S. pneumoniae serotypes 15A, 15B, and 15C in a subject.

[0507] In one embodiment, the present invention is directed to the use of the immunogenic compositions disclosed herein for the manufacture of a medicament for immunizing a subject against infection with S. pneumoniae serotypes 15A, 15B, and 15C.

[0508] In one embodiment, the present invention is directed to the use of a set of immunogenic compositions disclosed herein for the manufacture of a medicament for immunizing a subject against infection with S. pneumoniae serotypes 15A, 15B, and 15C.

[0509] In one aspect, the invention provides a method for inducing an immune response against S. pneumoniae serotypes 15A, 15B, and 15C in a subject. In an embodiment, the method comprises administering to the subject an immunogenic composition disclosed herein. In another embodiment, the method comprises administering to the subject a set of immunogenic compositions disclosed herein.

[0510] In some embodiments, the immunogenic compositions disclosed herein are vaccines. In some embodiments, the set of immunogenic compositions disclosed herein are a set of vaccines (i.e., the immunogenic compositions of the set of immunogenic compositions are vaccines).

[0511] In an embodiment, the immunogenic composition disclosed herein is for use as a vaccine. In an embodiment, the set of immunogenic compositions disclosed herein is for use as a vaccine. More specifically, the immunogenic composition or set of immunogenic compositions described herein can be used to prevent serotype 15A, 15B, and 15C S. pneumoniae infection in a subject. Thus, in one aspect, the present invention provides a method for preventing infection by serotype 15A, 15B, and 15C S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition or set of immunogenic compositions of the present invention. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In some such embodiments, the infection is pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, or brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cow, or dog. Preferably, the subject is a human subject.

[0512] In one aspect, the immunogenic composition or set of immunogenic compositions disclosed herein is for use in a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 15A, 15B, and 15C in a subject. In some such embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In some such embodiments, the infection, disease, or condition is pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, or brain abscess. In one aspect, the subject is a mammal, such as a human, cat, sheep, pig, horse, cow, or dog. Preferably, the subject is a human subject.

[0513] In an aspect, the immunogenic composition or set of immunogenic compositions disclosed herein is for use in a method of preventing infection with serotypes 15A, 15B, and 15C S. pneumoniae in a subject. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, septicemia, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cow, or dog. Preferably, the subject is a human subject.

[0514] In one aspect, the invention is directed to the use of an immunogenic composition or a set of immunogenic compositions disclosed herein for the manufacture of a medicament for preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae serotypes 15A, 15B, and 15C in a subject. Preferably, the subject is a human subject. In some such embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, septicemia, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In some such embodiments, the infection, disease, or condition is pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, or brain abscess.

[0515] In one aspect, the invention is directed to the use of an immunogenic composition or a set of immunogenic compositions disclosed herein for the manufacture of a medicament for preventing infection with serotypes 15A, 15B, and 15C S. pneumoniae in a subject. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, septicemia, pleural empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cow, or dog. Preferably, the subject is a human subject.

[0516] The immunogenic composition or set of immunogenic compositions of the present invention can be used to protect or treat humans susceptible to S. pneumoniae serotypes 15A, 15B, and 15C infections by administering the immunogenic composition or set of immunogenic compositions by systemic or mucosal routes. In an embodiment, the immunogenic composition or set of immunogenic compositions disclosed herein is administered by intramuscular, intraperitoneal, intradermal, or subcutaneous route. In an embodiment, the immunogenic composition or set of immunogenic compositions disclosed herein is administered by intramuscular, intraperitoneal, intradermal, or subcutaneous injection. In an embodiment, the immunogenic composition or set of immunogenic compositions disclosed herein is administered by intramuscular or subcutaneous injection. In an embodiment, the immunogenic composition or set of immunogenic compositions disclosed herein is administered by intramuscular injection. In an embodiment, the immunogenic composition or set of immunogenic compositions disclosed herein is administered by subcutaneous injection.

[0517] 8. Subjects to be treated with the immunogenic composition or set of immunogenic compositions of the present invention As disclosed herein, the immunogenic compositions or sets of immunogenic compositions described herein may be used in a variety of therapeutic or prophylactic methods for preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject.

[0518] In a preferred embodiment, the subject is a human. In a most preferred embodiment, the subject is a newborn (i.e., under 3 months of age), an infant (i.e., between 3 months and 1 year of age), or a toddler (i.e., between 1 and 4 years of age).

[0519] In certain embodiments, the immunogenic compositions disclosed herein are for use as a vaccine.

[0520] In such embodiments, the subject to be vaccinated may be less than 1 year old. For example, the subject to be vaccinated may be about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 months old. In certain embodiments, the subject to be vaccinated is about 2, 4, or 6 months old. In other embodiments, the subject to be vaccinated is less than 2 years old. For example, the subject to be vaccinated may be about 12 to about 15 months old. In some cases, as little as one dose of an immunogenic composition or set of immunogenic compositions according to the invention is required, although in some circumstances, a second, third, or fourth dose may be given (see Section 9 below).

[0521] In certain embodiments of the invention, the subject to be vaccinated is a human adult aged 50 years or older, more preferably a human adult aged 55 years or older. In certain embodiments, the subject to be vaccinated is a human adult aged 65 years or older, 70 years or older, 75 years or older, or 80 years or older.

[0522] In certain embodiments, the subject to be vaccinated is an immunocompromised individual, particularly a human. An immunocompromised individual is generally defined as a human having a diminished or reduced ability to mount normal humoral or cellular defenses induced by infectious agents.

[0523] In certain embodiments of the invention, the immunocompromised subject to be vaccinated suffers from a disease or condition that compromises the immune system and results in an insufficient antibody response to protect against or treat pneumococcal disease.

[0524] In one embodiment, the disease is a primary immunodeficiency disorder.Preferably, the primary immunodeficiency disorder is selected from the group consisting of combined T and B cell immunodeficiency, antibody deficiency, well-defined syndrome, immune dysregulation disease, phagocyte disorder, innate immune deficiency, autoinflammatory disorder, and complement deficiency.In one embodiment, the primary immunodeficiency disorder is combined T and B cell immunodeficiency, antibody deficiency, well-defined syndrome, immune dysregulation disease, phagocyte disorder, innate immune deficiency, autoinflammatory disorder, or complement deficiency.In one embodiment, the primary immunodeficiency disorder is selected from those disclosed in WO2010 / 125480, page 24, line 11 to page 25, line 19.

[0525] In certain embodiments of the invention, the immunocompromised subject to be vaccinated suffers from a disease selected from the group consisting of HIV infection, acquired immune deficiency syndrome (AIDS), cancer, chronic heart or lung disorders, congestive heart failure, diabetes mellitus, chronic liver disease, alcoholism, cirrhosis, cerebrospinal fluid leak, cardiomyopathy, chronic bronchitis, emphysema, chronic obstructive pulmonary disease (COPD), splenic insufficiency (such as sickle cell disease), lack of splenic function (asplenia), hematological malignancies, leukemia, multiple myeloma, Hodgkin's disease, lymphoma, renal failure, nephrotic syndrome, and asthma.

[0526] In certain embodiments of the invention, the immunocompromised subject to be vaccinated suffers from malnutrition.

[0527] In a particular embodiment of the invention, the immunocompromised subject to be vaccinated is receiving a drug or treatment that reduces the body's resistance to infection, hi one embodiment, said drug is selected from those disclosed in WO2010 / 125480, page 26, line 33 to page 26, line 4.

[0528] In a particular embodiment of the invention, the immunocompromised subject to be vaccinated is a smoker.

[0529] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated is 5×10 9cells / liter, or less than 4 x 10 9 cells / liter, or less than 3 x 10 9 cells / liter, or less than 2 x 10 9 cells / liter, or less than 1 x 10 9 cells / liter, or less than 0.5 x 10 9 cells / liter, or less than 0.3 x 10 9 cells / liter, or less than 0.1 x 10 9 Have a white blood cell count (leukocyte count) of less than cells / liter.

[0530] White blood cell count (leukocyte count): The number of white blood cells (WBC) in the blood. WBC is usually measured as part of a CBC (complete blood count). White blood cells are the infection-fighting cells in the blood and are distinct from the red (oxygen-carrying) blood cells known as erythrocytes. There are various types of white blood cells, including neutrophils (polymorphonuclear leukocytes, PMNs), band cells (slightly immature neutrophils), T-type lymphocytes (T cells), B-type lymphocytes (B cells), monocytes, eosinophils, and basophils. All types of white blood cells are reflected in the white blood cell count. The normal range for white blood cell count is usually 4,300 to 10,800 cells per cubic millimeter of blood. This can also be called the leukocyte count, and is measured in international units of 4.3 to 10.8 × 10 9 It can be expressed as cells / liter.

[0531] In certain embodiments of the invention, the immunocompromised subject to be vaccinated suffers from neutropenia. In certain embodiments of the invention, the immunocompromised subject to be vaccinated suffers from neutropenia. 9 cells / liter, or less than 1 x 10 9 cells / liter, or less than 0.5 x 10 9 cells / liter, or less than 0.1 x 10 9 cells / liter, or less than 0.05 x 10 9 Have a neutrophil count of less than 10 cells / liter.

[0532] Low white blood cell count or "neutropenia" is a condition characterized by abnormally low levels of neutrophils in the circulating blood. Neutrophils are a special type of white blood cell that help prevent and fight infection. The most common reason cancer patients experience neutropenia is as a side effect of chemotherapy. Chemotherapy-induced neutropenia increases a patient's risk of infection and disrupts cancer treatment.

[0533] In a specific embodiment of the invention, the immunocompromised subject to be vaccinated has a immunization rate of 500 / mm 3 CD4+ cell count less than 300 / mm 3 CD4+ cell count less than 200 / mm 3 CD4+ cell count less than 100 / mm 3 CD4+ cell count less than 75 / mm 3 CD4+ cell count less than 50 / mm 3 Have a CD4+ cell count less than

[0534] CD4 cell testing is usually 3 Normal CD4 counts are between 500 and 1600, and CD8 counts are between 375 and 1100. CD4 counts fall dramatically in people with HIV.

[0535] In some embodiments of the invention, any of the immunocompromised subjects disclosed herein is a male human or a female human. In some embodiments of the invention, any of the immunocompromised subjects disclosed herein is a male human. In some embodiments of the invention, any of the immunocompromised subjects disclosed herein is a female human.

[0536] 9. Administration regimens for the immunogenic compositions of the present invention In some cases, as little as one dose of the immunogenic composition according to the invention is necessary, although under some circumstances, such as in states of greater immunodeficiency, a second, third, or fourth dose may be given. After an initial vaccination, subjects may receive one or several booster immunizations, spaced sufficiently apart.

[0537] In one embodiment, the vaccination schedule for the immunogenic composition according to the invention is a single dose, hi a particular embodiment, said single dose schedule is for a healthy individual of at least 2 years of age.

[0538] In one embodiment, the vaccination schedule of the immunogenic composition according to the invention is a multiple dose schedule. In a particular embodiment, the multiple dose schedule comprises a two dose series separated by an interval of about one month to about two months. In a particular embodiment, the multiple dose schedule comprises a two dose series separated by an interval of about one month, or a two dose series separated by an interval of about two months.

[0539] In another embodiment, the multiple dose schedule comprises a series of three doses separated by intervals of about one month to about two months, hi another embodiment, the multiple dose schedule comprises a series of three doses separated by intervals of about one month, or a series of three doses separated by intervals of about two months.

[0540] In another embodiment, the multiple dose schedule comprises a three dose series separated by about one month to about two month intervals, followed by a fourth dose about 10 months to about 13 months after the first dose. In another embodiment, the multiple dose schedule comprises a three dose series separated by about one month intervals, followed by a fourth dose about 10 months to about 13 months after the first dose, or a three dose series separated by about two month intervals, followed by a fourth dose about 10 months to about 13 months after the first dose.

[0541] In certain embodiments, the multiple dose schedule consists of at least one dose (eg, 1, 2, or 3 doses) at 1 year of age, followed by at least one toddler dose.

[0542] In one embodiment, the multiple dose schedule consists of a two or three dose series separated by about one to about two month intervals (e.g., 28-56 days between doses) starting at 2 months of age, followed by an infant dose at 12-18 months of age. In one embodiment, the multiple dose schedule consists of a three dose series separated by about one to two month intervals (e.g., 28-56 days between doses) starting at 2 months of age, followed by an infant dose at 12-15 months of age. In another embodiment, the multiple dose schedule consists of a two dose series separated by about two month intervals starting at 2 months of age, followed by an infant dose at 12-18 months of age.

[0543] In one embodiment, the multiple dose schedule consists of a four dose series of the vaccine at 2, 4, 6, and 12-15 months of age.

[0544] In one embodiment, a prime dose is given on day 0, and one or more boosts are given at intervals ranging from about 2 to about 24 weeks, preferably at dosing intervals of 4 to 8 weeks.

[0545] In one embodiment, the prime dose is given on day 0 and the boost is given about 3 months later.

[0546] 10. Immunization schedule for a set of immunogenic compositions of the present invention In some cases, as little as one dose of a set of immunogenic compositions according to the invention may be necessary, although in some circumstances, such as in more immunocompromised or immuno-immature states, a second, third or fourth dose may be given. After the initial vaccination, subjects may receive one or several booster immunizations, well spaced apart.

[0547] In one embodiment, the vaccination schedule for a set of immunogenic compositions according to the invention is a single dose, hi a particular embodiment, said single dose schedule is for a healthy individual of at least 2 years of age.

[0548] In certain embodiments, the vaccination schedule of the set of immunogenic compositions according to the invention is a multiple dose schedule. Multiple dose schedules are often used in conditions such as immunocompromised (such as elderly human individuals or immunocompromised human individuals) or immunomature (such as human newborns (i.e., under 3 months of age), infants (i.e., between 3 months and 1 year of age), or toddlers (i.e., between 1 and 4 years of age). In certain embodiments, the multiple dose schedule comprises a two-dose series separated by an interval of about 1 month to about 12 months. In certain embodiments, the multiple dose schedule comprises a two-dose series separated by an interval of about 1 month to about 6 months. In certain embodiments, the multiple dose schedule comprises a two-dose series separated by an interval of about 1 month. In certain embodiments, the multiple dose schedule comprises a two-dose series separated by an interval of about 2 months.

[0549] In another embodiment, the multiple dose schedule consists of a series of three doses, each dose separated by an interval of about 1 month to about 12 months.

[0550] In certain embodiments, the multiple dose schedule consists of a series of three doses, each dose separated by an interval of about one month to about six months.

[0551] In another embodiment, the multiple dose schedule consists of a series of four doses, each dose separated by intervals of about 1 month to about 12 months.

[0552] In certain embodiments, the multiple dose schedule consists of a series of four doses, each dose separated by intervals of about one month to about six months.

[0553] In another embodiment, the multiple dose schedule consists of a series of three doses, each dose separated by an interval of about 1 month to about 4 months, followed by a fourth dose about 10 months to about 13 months after the first dose.

[0554] In another embodiment, the multiple dose schedule consists of a series of three doses, each dose separated by an interval of about 1 month to about 2 months, followed by a fourth dose about 10 months to about 13 months after the first dose.

[0555] In certain embodiments, the multiple dose schedule consists of at least one dose (eg, 1, 2, or 3 doses) at 1 year of age, followed by at least one toddler dose.

[0556] In one embodiment, the multiple dose schedule consists of a two or three dose series beginning at 2 months of age, each dose separated by about one month to about two months intervals (e.g., 28-56 days between doses), followed by an infant dose at 12-18 months of age. In one embodiment, the multiple dose schedule consists of a three dose series beginning at 2 months of age, each dose separated by about one month to about two months intervals (e.g., 28-56 days between doses), followed by an infant dose at 12-15 months of age. In another embodiment, the multiple dose schedule consists of a two dose series beginning at 2 months of age, each dose separated by about two months intervals, followed by an infant dose at 12-18 months of age.

[0557] In one embodiment, the multiple dose schedule consists of a four dose series of the vaccine at 2, 4, 6, and 12-15 months of age.

[0558] In one embodiment, a prime dose is given on day 0, and one or more booster doses are given at intervals ranging from about 2 to about 24 weeks between doses, preferably at dosing intervals of 4 to 8 weeks.

[0559] In one embodiment, the prime dose is given on day 0 and the boost is given about 3 months later.

[0560] In another embodiment, the multiple dose schedule consists of a series of five doses, each dose separated by intervals of about 1 month to about 12 months.

[0561] In certain embodiments, the multiple dose schedule comprises a five dose series, each of which is separated by an interval of about one month to about six months. In certain embodiments, the multiple dose schedule comprises a five dose series, each of which is separated by an interval of about one, two, three, four, five, or six months. In certain embodiments, the multiple dose schedule comprises a five dose series, each of which is separated by an interval of about one month, or a five dose series, each of which is separated by an interval of about two months.

[0562] Certain aspects of the invention pertain to any pair of immunogenic compositions of the invention for simultaneous, concurrent, concomitant or sequential administration with a second immunogenic composition.

[0563] In one embodiment of the invention, a first immunogenic composition of a set of immunogenic compositions according to the invention is administered simultaneously, concurrently, concomitantly, or sequentially with a second immunogenic composition.

[0564] In one embodiment of the invention, a first immunogenic composition of a set of immunogenic compositions according to the invention is administered simultaneously with a second immunogenic composition.

[0565] In one embodiment of the invention, a first immunogenic composition of a set of immunogenic compositions according to the invention is administered concurrently with a second immunogenic composition.

[0566] In one aspect of the invention, a first immunogenic composition of a set of immunogenic compositions according to the invention is administered in combination with a second immunogenic composition.

[0567] In one embodiment of the invention, a first immunogenic composition of a set of immunogenic compositions according to the invention is administered sequentially with a second immunogenic composition.

[0568] In some cases, as little as one dose of each of the immunogenic compositions may be necessary, although under some circumstances, a second, third, or fourth dose of one or each of the immunogenic compositions may be given. After an initial vaccination, subjects may receive one or several booster immunizations, spaced sufficiently apart.

[0569] In one embodiment, the invention pertains to a set of immunogenic compositions disclosed herein for use in the combined administration of a first and a second immunogenic composition.

[0570] In certain embodiments, the combined administration vaccination schedule is a single dose (the administration of the first and second immunogenic compositions are in separate unit dosage forms but are considered as a single dose for the purposes of defining the immunization schedule). In certain embodiments, the single dose schedule is for a healthy individual of at least 2 years of age.

[0571] In certain embodiments, the vaccination schedule for combined administration is a multiple dose schedule (the administration of the first and second immunogenic compositions are in separate unit dosage forms but are considered as a single dose for the purpose of defining the immunization schedule). In certain embodiments, the multiple dose schedule comprises a two-dose series separated by an interval of about 1 month to about 12 months. In certain embodiments, the schedule comprises a two-dose series separated by an interval of about 1 month to about 6 months. In certain embodiments, the schedule comprises a two-dose series separated by an interval of about 1 month. In certain embodiments, the schedule comprises a two-dose series separated by an interval of about 2 months.

[0572] In another embodiment, the multiple dose schedule comprises a three dose series, each of which is separated by an interval of about one month to about twelve months. In a particular embodiment, the schedule comprises a three dose series, each of which is separated by an interval of about one month to about six months. In another embodiment, the schedule comprises a three dose series, each of which is separated by an interval of about one month. In another embodiment, the schedule comprises a three dose series, each of which is separated by an interval of about two months.

[0573] In certain embodiments, the multiple dose schedule comprises a four dose series separated by intervals of about 1 month to about 12 months. In certain embodiments, the multiple dose schedule comprises a four dose series separated by intervals of about 1 month to about 6 months. In certain embodiments, the multiple dose schedule comprises a four dose series separated by intervals of about 1 month. In certain embodiments, the multiple dose schedule comprises a four dose series separated by intervals of about 2 months.

[0574] In another embodiment, the multiple dose schedule comprises a three dose series, each dose separated by an interval of about 1 month to about 4 months, followed by a fourth dose about 10 months to about 13 months after the first dose. In another embodiment, the schedule comprises a three dose series, each dose separated by an interval of about 1 month to about 2 months, followed by a fourth dose about 10 months to about 13 months after the first dose. In another embodiment, the schedule comprises a three dose series, each dose separated by an interval of about 1 month, followed by a fourth dose about 10 months to about 13 months after the first dose. In another embodiment, the schedule comprises a three dose series, each dose separated by an interval of about 2 months, followed by a fourth dose about 10 months to about 13 months after the first dose.

[0575] In certain embodiments, the multiple dose schedule consists of at least one dose (eg, 1, 2, or 3 doses) at 1 year of age, followed by at least one toddler dose.

[0576] In one embodiment, the multiple dose schedule consists of a two or three dose series beginning at 2 months of age, each dose separated by about one month to about two months intervals (e.g., 28-56 days between doses), followed by an infant dose at 12-18 months of age. In one embodiment, the schedule consists of a three dose series beginning at 2 months of age, each dose separated by about one month to about two months intervals (e.g., 28-56 days between doses), followed by an infant dose at 12-15 months of age. In another embodiment, the schedule consists of a two dose series beginning at 2 months of age, each dose separated by about two months intervals, followed by an infant dose at 12-18 months of age.

[0577] In one embodiment, the multiple dose schedule consists of a four dose series of vaccine administered at 2, 4, 6, and 12-15 months of age.

[0578] In one embodiment, a prime dose is given on day 0, and one or more booster doses are given at intervals ranging from about 2 to about 24 weeks, preferably at dosing intervals of 4 to 8 weeks.

[0579] In one embodiment, the prime dose is given on day 0 and the boost is given about 3 months later.

[0580] In another embodiment, the invention pertains to a set of immunogenic compositions disclosed herein for use in the concurrent administration of a first and a second immunogenic composition.

[0581] In certain embodiments, the vaccination schedule of said concurrent administration is a single dose (the administration of the first and second immunogenic compositions are in separate unit dosage forms but are considered as a single dose for the purpose of defining the immunization schedule). In certain embodiments, the single dose schedule is for a healthy person of at least 2 years of age.

[0582] In certain embodiments, the vaccination schedule for concurrent administration is a multiple dose schedule, in particular any of the multiple schedules disclosed above for concomitant administration.

[0583] In one embodiment, the invention pertains to a set of immunogenic compositions disclosed herein for use in sequential administration of a first and a second immunogenic composition.

[0584] In one embodiment, a first immunogenic composition according to the invention is administered a first time and a second immunogenic composition according to the invention is administered a second time, in another embodiment, a second immunogenic composition is administered a first time and a first immunogenic composition according to the invention is administered a second time.

[0585] In one embodiment, the sequential administration vaccination schedule consists of a 2, 3, 4, 5, 6, 7, or 8 dose series.

[0586] In one embodiment, the sequential administration vaccination schedule comprises a two dose series. In one embodiment, the sequential administration vaccination schedule comprises a four dose series. In one embodiment, the sequential administration vaccination schedule comprises a six dose series. In one embodiment, the sequential administration vaccination schedule comprises an eight dose series.

[0587] In certain embodiments, the sequential administration vaccination schedule comprises a two dose series. In certain embodiments, the sequential administration vaccination schedule comprises a two dose series separated by an interval of about 1 month to about 12 months. In certain embodiments, the multiple dose schedule comprises a two dose series separated by an interval of about 1 month to about 6 months. In certain embodiments, the multiple dose schedule comprises a two dose series separated by an interval of about 1 month. In certain embodiments, the multiple dose schedule comprises a two dose series separated by an interval of about 2 months.

[0588] In one embodiment of the two dose schedule, the first immunogenic composition according to the invention is administered first and the second immunogenic composition according to the invention is administered second, in another embodiment, the second immunogenic composition is administered first and the first immunogenic composition according to the invention is administered second.

[0589] In certain embodiments, the sequential administration vaccination schedule comprises a three dose series. In certain embodiments, the schedule comprises a three dose series, with each dose separated by an interval of about 1 to about 12 months. In certain embodiments, the schedule comprises a three dose series, with each dose separated by an interval of about 1 to about 6 months. In certain embodiments, the schedule comprises a three dose series, with each dose separated by an interval of about 1 to about 2 months.

[0590] In one embodiment of the three dose schedule, a first immunogenic composition according to the invention is administered as the first two doses and a second immunogenic composition is administered as the third dose.

[0591] In another embodiment of the three dose schedule, the second immunogenic composition is administered as the first two doses and the first immunogenic composition according to the invention is administered as the third dose.

[0592] In another embodiment of the three dose schedule, a first immunogenic composition according to the invention is administered as a first dose, a second immunogenic composition according to the invention is administered as a second dose, and a first immunogenic composition according to the invention is administered as a third dose.

[0593] In yet another embodiment of the three dose schedule, the second immunogenic composition is administered as the first dose, the first immunogenic composition according to the invention is administered as the second dose, and the second immunogenic composition is administered as the third dose.

[0594] In yet another embodiment of the three dose schedule, a first immunogenic composition according to the invention is administered as the first dose and a second immunogenic composition according to the invention is administered as the second and third doses.

[0595] In another embodiment of the three dose schedule, the second immunogenic composition is administered as the first dose and the first immunogenic composition according to the invention is administered as the second and third doses.

[0596] In one embodiment, the sequential administration vaccination schedule consists of a four dose series.

[0597] In certain embodiments, the schedule comprises a series of four doses, each of which is separated by an interval of about 1 to about 12 months. In certain embodiments, the schedule comprises a series of four doses, each of which is separated by an interval of about 1 to about 6 months. In certain embodiments, the schedule comprises a series of four doses, each of which is separated by an interval of about 1 to about 2 months.

[0598] In one embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as the first three doses and a second immunogenic composition is administered as the fourth dose.

[0599] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first three doses and the first immunogenic composition according to the invention is administered as the fourth dose.

[0600] In another embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as the first and second doses, and a second immunogenic composition according to the invention is administered as the third and fourth doses.

[0601] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first and second doses, and the first immunogenic composition according to the invention is administered as the third and fourth doses.

[0602] In another embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as the first and second doses, a second immunogenic composition according to the invention is administered as the third dose, and a first immunogenic composition according to the invention is administered as the fourth dose.

[0603] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first and second doses, the first immunogenic composition according to the invention is administered as the third dose, and the second immunogenic composition is administered as the fourth dose.

[0604] In another embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as the first dose and a second immunogenic composition according to the invention is administered as the second, third, and fourth doses.

[0605] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first dose and the first immunogenic composition according to the invention is administered as the second, third, and fourth doses.

[0606] In another embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as a first dose, a second immunogenic composition according to the invention is administered as a second dose, a first immunogenic composition according to the invention is administered as a third dose, and a second immunogenic composition according to the invention is administered as a fourth dose.

[0607] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first dose, the first immunogenic composition according to the invention is administered as the second dose, the second immunogenic composition is administered as the third dose, and the first immunogenic composition according to the invention is administered as the fourth dose.

[0608] In another embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as the first dose, a second immunogenic composition according to the invention is administered as the second dose, and a first immunogenic composition according to the invention is administered as the third and fourth doses.

[0609] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first dose, the first immunogenic composition according to the invention is administered as the second dose, and the second immunogenic composition is administered as the third and fourth doses.

[0610] In another embodiment of the four dose schedule, a first immunogenic composition according to the invention is administered as the first dose, a second immunogenic composition according to the invention is administered as the second and third doses, and a first immunogenic composition according to the invention is administered as the fourth dose.

[0611] In another embodiment of the four dose schedule, the second immunogenic composition is administered as the first dose, the first immunogenic composition according to the invention is administered as the second and third doses, and the second immunogenic composition is administered as the fourth dose.

[0612] In one embodiment, the sequential administration vaccination schedule consists of a five dose series.

[0613] In certain embodiments, the schedule comprises a series of five doses, each of which is separated by an interval of about 1 to about 12 months. In certain embodiments, the schedule comprises a series of five doses, each of which is separated by an interval of about 1 to about 6 months. In certain embodiments, the schedule comprises a series of five doses, each of which is separated by an interval of about 1 to about 2 months.

[0614] In one embodiment of the five dose schedule, the first immunogenic composition (referred to as the first IC in the table below) and the second immunogenic composition (referred to as the second IC in the table below) are administered in the following order:

[0615] [Table 1]

[0616] The above table provides the order of administration of the first and second immunogenic compositions (denoted as first IC and second IC, respectively) for various doses, for example, Schedule No. 1 reads as follows: In said 5 dose schedule embodiment, the second immunogenic composition is adminis...

Claims

1. Serotypes of Streptococcus pneumoniae for immunizing human subjects against infection by serotypes 15A, 15B and 15C, and serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 18C, 19A, 19F, 22F, 23F, and 33F of Streptococcus pneumoniae A composition comprising sugar conjugates derived from 15A and 15B, but not from sugar conjugates derived from serotype 15C of Streptococcus pneumoniae, and further comprising sugar conjugates derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 18C, 19A, 19F, 22F, 23F, and 33F of Streptococcus pneumoniae.

2. The composition according to claim 1, wherein the composition comprises 21 to 25 different serotypes of Streptococcus pneumoniae (S. pneumoniae) sugar conjugates.

3. A kit comprising the composition according to claim 1 or 2, and an information leaflet, for immunizing a human subject against infection with serotypes 15A, 15B and 15C of Streptococcus pneumoniae and serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 18C, 19A, 19F, 22F, 23F and 33F of Streptococcus pneumoniae.