Chemical compositions and methods of using the same

Abstract

To provide rapid, amplification-free and enzyme-free nucleic acid sequencing methods.SOLUTION: The present disclosure provides sequencing probes, methods, kits and apparatuses that provide rapid, enzyme-free, amplification-free and library-free nucleic acid sequencing that has long read lengths and low error rates. The sequencing probes described herein include barcode domains in which each position corresponds to at least two nucleotides in a target binding domain.SELECTED DRAWING: Figure 53

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Application No. 62 / 671,091, filed May 14, 2018, and U.S. Provisional Application No. 62 / 836,327, filed April 19, 2019, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Array List This application contains a Sequence Listing that was submitted via EFS-Web in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on May 13, 2019, is named "NATE-039_001WO_SeqList.txt", and is 25,129 bytes in size. [Background technology]

[0003] A variety of methods currently exist for sequencing nucleic acids (i.e., the process of determining the exact order of nucleotides within a single nucleic acid molecule). Current methods require enzymatic amplification (e.g., PCR) and / or amplification by cloning of nucleic acids. Further enzymatic polymerization is required to generate a signal that can be detected by optical detection means. These amplification and polymerization steps can be costly and / or time-consuming. Therefore, there is a need in the art for a rapid, amplification-free, enzyme-free method for nucleic acid sequencing. The present disclosure addresses this need. Summary of the Invention

[0004] The present disclosure provides sequencing probes, methods, kits, and devices that provide long read lengths, low error rates, rapid, enzyme-free, amplification-free, and library-free nucleic acid sequencing. The sequencing probes described herein include a barcode domain, where each position within the barcode domain corresponds to at least two nucleotides within the target binding domain. Furthermore, the methods, kits, and devices are capable of rapidly obtaining results from samples. These features are particularly useful for sequencing in clinical settings. The present disclosure is an improvement over the disclosure disclosed in U.S. Patent Application Publication No. 2016 / 0194701, the entire contents of which are incorporated herein by reference.

[0005] The present disclosure provides a probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and comprises at least three attachment positions, each attachment position comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the synthetic backbone comprises L-DNA, and each attachment position of the at least three attachment positions is at least one nucleotide sequence in the target binding domain. corresponding to two nucleotides of the at least six nucleotides, each of the at least three attachment positions having a different nucleic acid sequence, wherein the nucleic acid sequence of each attachment position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid to which the target binding domain binds; a first complementary primary nucleic acid molecule hybridizes to a first attachment position of the at least three attachment positions, the first complementary primary nucleic acid molecule comprising at least two domains and a cleavable linker, wherein the first domain hybridizes to the first attachment position of the barcode domain and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and the linker modification is [ka] wherein the linker modification is located between the first domain and the second domain.

[0006] The probe can comprise approximately 60 nucleotides. The probe can comprise a single-stranded DNA synthesis backbone and a double-stranded DNA spacer between the targeting binding domain and the barcode domain. The single-stranded DNA synthesis backbone can comprise L-DNA. The single-stranded DNA synthesis backbone can comprise approximately 27 nucleotides. The double-stranded DNA spacer can comprise L-DNA. The double-stranded DNA spacer can comprise approximately 25 nucleotides in length.

[0007] The number of nucleotides in the target binding domain of the probe can be greater than the number of attachment positions in the barcode domain of the probe. The target binding domain can include 8 nucleotides, and the barcode domain can include 3 attachment positions. At least one of the nucleotides in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can be located before the at least six nucleotides in the target binding domain, and at least one of the nucleotides in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can be located after the at least six nucleotides in the target binding domain.

[0008] One attachment position within the barcode domain can comprise one attachment region. At least one nucleic acid sequence at each attachment position within the barcode domain can comprise approximately 9 nucleotides. At least one nucleic acid sequence at an attachment position can comprise a 3'-terminal guanosine nucleotide. At least one nucleic acid sequence at each attachment position can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3'-terminal guanosine nucleotide. Each nucleotide of the at least one nucleic acid sequence at an attachment position can be L-DNA. Each nucleotide of the at least eight nucleotides of the target binding domain can be D-DNA.

[0009] The complementary nucleic acid molecule can be a primary nucleic acid molecule, which can be directly bound to at least one attachment region within at least one attachment location of the barcode domain. The primary nucleic acid molecule can include at least two domains, where a first domain can bind to at least one attachment region within at least one attachment location of the barcode domain, and a second domain can bind to at least one complementary secondary nucleic acid molecule. The first domain of the primary nucleic acid molecule can include L-DNA. The second domain of the primary nucleic acid molecule can include D-DNA. The first domain of the primary nucleic acid molecule can include a 5'-terminal cytosine nucleotide. The first domain of the primary nucleic acid molecule can include at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof, and a 5'-terminal cytosine nucleotide. A cleavable linker can be located between the first domain of the primary nucleic acid molecule and the second domain of the primary nucleic acid molecule. The cleavable linker can include at least one cleavable moiety. The cleavable moiety can be a photocleavable moiety.

[0010] The primary nucleic acid molecule can hybridize to at least one attachment region within at least one attachment location of the barcode domain and to at least one secondary nucleic acid molecule. The primary nucleic acid molecule can hybridize to four secondary nucleic acid molecules.

[0011] The secondary nucleic acid molecule can comprise at least two domains, where the first domain can bind to a complementary sequence in at least one primary nucleic acid molecule, and the second domain can bind to (a) a first detectable label and at least a second detectable label, or (b) at least one complementary tertiary nucleic acid molecule, or (c) a combination thereof. The secondary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first domain and the second domain. The cleavable moiety can be cleaved with light. The secondary nucleic acid molecule can hybridize to at least one primary nucleic acid molecule and at least one tertiary nucleic acid molecule. The secondary nucleic acid molecule can hybridize to (a) at least one primary nucleic acid molecule, (b) at least one tertiary nucleic acid molecule, and (c) a first detectable label and at least a second detectable label. Each secondary nucleic acid molecule can hybridize to one tertiary nucleic acid molecule. The first detectable label and the at least second detectable label can have the same emission spectrum or can have different emission spectra.

[0012] The tertiary nucleic acid molecule can comprise at least two domains, where the first domain can bind to a complementary sequence in the secondary nucleic acid molecule and the second domain can bind to a first detectable label and at least a second detectable label. The tertiary nucleic acid molecule comprises a cleavable linker. The cleavable linker can be located between the first domain and the second domain. The cleavable linker can be cleaved by light. The tertiary nucleic acid molecule can be hybridized to at least one secondary nucleic acid molecule and can comprise a first detectable label and at least a second detectable label. The first detectable label and the at least second detectable label can have the same emission spectrum or different emission spectra.

[0013] At least the first and second detectable labels located on the secondary nucleic acid molecules can have the same emission spectrum, and at least the first and second detectable labels located on the tertiary nucleic acid molecules can have the same emission spectrum, and the emission spectrum of the detectable labels on the secondary nucleic acid molecules can be different from the emission spectrum of the detectable labels on the tertiary nucleic acid molecules.

[0014] The primary nucleic acid molecule can be hybridized to four secondary nucleic acid molecules, each of which contains four first detectable labels, and hybridized to one tertiary nucleic acid molecule, which contains five detectable labels. The emission spectrum of the first detectable label on the secondary nucleic acid molecule can be different from the emission spectrum of the second detectable label on the tertiary nucleic acid molecule.

[0015] The present disclosure provides a method for determining the nucleotide sequence of a nucleic acid, comprising: (1) hybridizing the target binding domain of at least one first probe of claim 1 to a first region of a target nucleic acid, the target nucleic acid being optionally immobilized at one or more locations on a substrate; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of the at least three attachment locations of the barcode domain; (3) identifying the at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) removing the at least one first detectable label and at least one second detectable label hybridized to the first attachment location; and (5) removing the at least one third detectable label and at least one third detectable label. (6) hybridizing a second complementary nucleic acid molecule comprising four detectable labels to a second attachment position of the at least three attachment positions of the barcode domain; (7) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position;and (10) determining the nucleotide sequence of at least six nucleotides of an optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the at least one first probe based on the attributes of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label, and the at least one sixth detectable label;

[0016] The method of the preceding paragraph may further comprise: (11) optionally removing at least one first probe from a first region of the immobilized target nucleic acid; (12) hybridizing a target binding domain of at least one second probe of claim 1 to a second region of the immobilized target nucleic acid, optionally with the target binding domains of the first and at least second probes being different; (13) hybridizing a fourth complementary nucleic acid molecule comprising at least one seventh detectable label and at least one eighth detectable label to a first attachment position of the at least three attachment positions of the barcode domain of the at least one second probe; (14) identifying the at least one seventh detectable label and the at least one eighth detectable label of the fourth complementary nucleic acid molecule hybridized to the first attachment position; (15) removing the at least one seventh detectable label and the at least one eighth detectable label of the fourth complementary nucleic acid molecule hybridized to the first attachment position; (16) hybridizing at least one (17) hybridizing a fifth complementary nucleic acid molecule comprising a ninth detectable label and at least one tenth detectable label to a second attachment position of the at least three attachment positions of the barcode domain of the at least one second probe; (18) identifying the at least one ninth detectable label and at least one tenth detectable label of the fifth complementary nucleic acid molecule hybridized to the second attachment position; (19) hybridizing a sixth complementary nucleic acid molecule comprising at least one eleventh detectable label and at least one twelfth detectable label to a third attachment position of the at least three attachment positions of the barcode domain of the at least one second probe; (20) identifying the at least one eleventh detectable label and at least one twelfth detectable label of the sixth complementary nucleic acid molecule hybridized to the third attachment position;(21) Determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the at least one second probe based on the attributes of the at least one seventh detectable label, the at least one eighth detectable label, the at least one ninth detectable label, the at least one tenth detectable label, the at least one eleventh detectable label, and the at least one twelfth detectable label;

[0017] The method can further include assembling the identified linear orders of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid, thereby identifying the sequence of the immobilized target nucleic acid.

[0018] Steps (4) and (5) can occur sequentially or simultaneously. Steps (7) and (8) can occur sequentially or simultaneously.

[0019] The first detectable label and the second detectable label can have the same or different emission spectra, the third detectable label and the fourth detectable label can have the same or different emission spectra, and the fifth detectable label and the sixth detectable label can have the same or different emission spectra.

[0020] The first complementary nucleic acid molecule, the second complementary nucleic acid molecule, and the third complementary nucleic acid molecule can comprise a cleavable linker, which can be cleaved with light.

[0021] The first complementary nucleic acid molecule can include one primary nucleic acid molecule, four secondary nucleic acid molecules, and four tertiary nucleic acid molecules, where the primary nucleic acid molecule hybridizes to the four secondary nucleic acid molecules, each of the four secondary nucleic acid molecules comprising four first detectable labels, and hybridizes to one tertiary nucleic acid molecule, each of the four tertiary nucleic acid molecules comprising five second detectable labels.

[0022] The primary nucleic acid molecule can include at least two domains: a first domain that hybridizes to a first attachment position of the barcode domain and a second domain that hybridizes to four secondary nucleic acid molecules. The primary nucleic acid molecule can include a cleavable linker located between the first and second domains.

[0023] The secondary nucleic acid molecule can comprise at least two domains: a first domain that hybridizes to a second domain of the primary nucleic acid molecule, and a second domain that comprises four first detectable labels and hybridizes to a tertiary nucleic acid molecule. The secondary nucleic acid molecule can comprise a cleavable linker located between the first and second domains.

[0024] Removal of the at least one first detectable label and the at least one second detectable label hybridized to the first attachment position can comprise cleaving a cleavable linker between the first domain and the second domain of the primary nucleic acid, or cleaving a cleavable linker between the first domain and the second domain of each secondary nucleic acid, or any combination thereof.

[0025] The present disclosure provides a composition comprising at least one molecular complex, the at least one molecular complex comprising: (A) a target nucleic acid molecule obtained from a biological sample; and (B) at least two nucleic acid molecular complexes, the first of the two nucleic acid molecular complexes comprising a partially double-stranded first nucleic acid molecule, one strand of the partially double-stranded first nucleic acid molecule comprising a target-specific domain that hybridizes to a first portion of the target nucleic acid molecule, a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule, and at least one first affinity moiety, the other strand of the partially double-stranded first nucleic acid molecule comprising a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one Compositions are provided that include a second affinity moiety, the second complex comprising a partially double-stranded second nucleic acid molecule, one strand of which comprises a target-specific domain that hybridizes to a second portion of the target nucleic acid molecule (the first and second portions do not overlap), a double-stranded domain that anneals to the other strand of the partially double-stranded second nucleic acid molecule, the other strand of which comprises a double-stranded domain that anneals to the other strand of the partially double-stranded second nucleic acid molecule, a sample-specific domain that identifies the biological sample from which the target nucleic acid was sourced, a first single-stranded purification sequence, a first cleavable moiety located between the double-stranded domain and the sample-specific domain, and a second cleavable moiety located between the sample-specific domain and the first single-stranded purification sequence.

[0026] The present disclosure provides a composition comprising at least one molecular complex, the at least one molecular complex comprising: (A) a target nucleic acid molecule obtained from a biological sample; and (B) at least two nucleic acid molecular complexes, wherein a first of the two nucleic acid molecular complexes comprises a partially double-stranded first nucleic acid molecule, one strand of which comprises a target-specific domain that hybridizes to a first portion of the target nucleic acid molecule, a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule, and at least one first affinity moiety, the other strand of which comprises a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule and is operably linked to the 3' end of the target nucleic acid molecule, and hybridizes to a complementary nucleic acid attached to a substrate. and at least one second affinity moiety, wherein the second complex comprises a partially double-stranded second nucleic acid molecule, one strand of which comprises a target-specific domain that hybridizes to a second portion of the target nucleic acid molecule (the first and second portions do not overlap) and a double-stranded domain that anneals to the other strand of the partially double-stranded second nucleic acid molecule, the other strand of which comprises a double-stranded domain that anneals to the other strand of the partially double-stranded second nucleic acid molecule and is operably linked to the 5' end of the target nucleic acid molecule; a sample-specific domain that identifies the biological sample from which the target nucleic acid was sourced; a first single-stranded purification sequence; and a first cleavable moiety located between the double-stranded domain and the sample-specific domain.

[0027] The present disclosure provides a composition comprising at least one molecular complex, the at least one molecular complex comprising: (A) a target nucleic acid molecule obtained from a biological sample; and (B) at least two nucleic acid molecular complexes, wherein a first of the two nucleic acid molecular complexes comprises a partially double-stranded first nucleic acid molecule, one strand of the partially double-stranded first nucleic acid molecule comprising a target-specific domain that hybridizes to a first portion of the target nucleic acid molecule, a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule, and at least one first affinity moiety, and the other strand of the partially double-stranded first nucleic acid molecule anneals to the other strand of the partially double-stranded first nucleic acid molecule and hybridizes to a third portion of the target nucleic acid molecule. a double-stranded domain operably linked to the 5' end of the target nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety; wherein the second complex comprises a partially double-stranded second nucleic acid molecule, one strand of which comprises a target-specific domain that hybridizes to a second portion of the target nucleic acid molecule (the first and second portions do not overlap) and a double-stranded domain that anneals to the other strand of the partially double-stranded second nucleic acid molecule, and the other strand of the partially double-stranded second nucleic acid molecule comprises a double-stranded domain operably linked to the 5' end of the target nucleic acid molecule.

[0028] The present disclosure also provides a composition comprising: a flat solid support substrate; a first layer on the flat solid support substrate; and a second layer on the first layer, the second layer comprising a plurality of nanowells, each nanowell providing access to an exposed portion of the first layer, and each nanowell comprising a plurality of first oligonucleotides covalently bound to the exposed portion of the first layer.

[0029] The present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, wherein the nucleic acid sequences of the at least three attachment positions determine the positions and attributes of the at least six nucleotides in the target nucleic acid to which the target binding domain binds, and each of the at least three attachment positions has a different nucleic acid sequence.

[0030] The present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule, and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and comprises at least three attachment positions, each of which comprises at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, each of which corresponds to two of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and the nucleic acid sequence of each of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0031] The present disclosure provides a complex comprising a composition comprising: a) a target binding domain and a barcode domain, wherein the target binding domain comprises at least eight nucleotides and hybridizes to a target nucleic acid, wherein at least six nucleotides in the target binding domain identify corresponding nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; and the barcode domain comprises a synthetic backbone and at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule. wherein the nucleic acid sequence of each attachment position of the at least three attachment positions determines the position and attributes of corresponding two nucleotides of the at least six nucleotides in the target nucleic acid to which the target binding domain binds, and each of the at least three attachment positions has a different nucleic acid sequence; a first complementary primary nucleic acid molecule hybridizes to a first attachment position of the at least three attachment positions, the first complementary primary nucleic acid molecule comprising at least two domains and a cleavable linker, the first domain hybridizes to the first attachment position of the barcode domain, and the second domain is capable of hybridizing to at least one complementary secondary nucleic acid molecule, and the cleavable linker is [ka] and is located between the first domain and the second domain.

[0032] According to the present disclosure, a method for determining the nucleotide sequence of a nucleic acid includes: (1) hybridizing a target binding domain of a first sequencing probe of the present disclosure to a first region of a target nucleic acid, which target nucleic acid is optionally immobilized at one or more locations on a substrate; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of the at least three attachment locations of the barcode domain; (3) identifying the at least one first detectable label and at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) removing the at least one first detectable label and at least one second detectable label hybridized to the first attachment location; and (5) removing the at least one third detectable label and at least one third detectable label. (6) hybridizing a second complementary nucleic acid molecule comprising four detectable labels to a second attachment position of the at least three attachment positions of the barcode domain; (7) identifying at least one third detectable label and at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; (9) identifying at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position;(10) A method is provided, comprising determining a nucleotide sequence of at least six nucleotides of an optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of a first sequencing probe based on attributes of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label, and the at least one sixth detectable label;

[0033] The present disclosure provides a method for determining the nucleotide sequence of a nucleic acid, comprising: (1) hybridizing a target binding domain of a first sequencing probe of claim 113 or 114 to a first region of a target nucleic acid, the target nucleic acid optionally being immobilized at one or more locations on a substrate; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of the at least three attachment locations of the barcode domain; and (3) hybridizing a second complementary nucleic acid molecule hybridized to the first attachment location. (4) identifying the position and the attribute of a first nucleotide and a second nucleotide in the optionally immobilized target nucleic acid that hybridize to two of the at least six nucleotides of the target binding domain based on the attribute of the at least one first detectable label and the at least one second detectable label; (5) identifying the position and the attribute of the at least one first detectable label and the at least one second detectable label hybridized to the first attachment position. (6) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; (7) identifying the at least one third detectable label and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment position; (8) identifying a target binding domain based on the attributes of the at least one third detectable label and the at least one fourth detectable label. (9) identifying the positions and identities of a third nucleotide and a fourth nucleotide within the optionally immobilized target nucleic acid that hybridize to two of the at least six nucleotides; (10) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (11) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain;(11) identifying at least one fifth detectable label and at least one sixth detectable label of a third complementary nucleic acid molecule hybridized to the third attachment position; and (12) identifying the positions and attributes of a fifth nucleotide and a sixth nucleotide in the optionally immobilized target nucleic acid hybridized to two of the at least six nucleotides of the target binding domain based on the attributes of the at least one fifth detectable label and the at least one sixth detectable label; thereby determining the nucleotide sequence of at least six nucleotides of the optionally immobilized target nucleic acid hybridized to the at least six nucleotides of the target binding domain of the first sequencing probe.

[0034] The present disclosure provides a method for identifying the presence of a predetermined nucleotide sequence in a target nucleic acid, comprising: (1) hybridizing a target binding domain of a first sequencing probe of the present disclosure to a first region of a target nucleic acid, the target nucleic acid optionally being immobilized at one or more locations on a substrate; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment location of the at least three attachment locations of the barcode domain; and (3) hybridizing a first complementary nucleic acid molecule to the first attachment location. (4) identifying at least one first detectable label and at least one second detectable label of the hybridized first complementary nucleic acid molecule; (5) removing at least one first detectable label and at least one second detectable label hybridized to the first attachment position; (6) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second attachment position of the at least three attachment positions of the barcode domain; and (7) removing at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position. (7) identifying at least one third detectable label and at least one fourth detectable label of the hybridized second complementary nucleic acid molecule; (8) removing the at least one third detectable label and at least one fourth detectable label hybridized to the second attachment position; (9) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; and (10) identifying the at least one fifth detectable label and at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment position, thereby revealing the presence of a predetermined nucleotide sequence based on the attributes of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label, and the at least one sixth detectable label.

[0035] The present disclosure provides a kit comprising: (A) a first nucleic acid molecule complex comprising a partially double-stranded first nucleic acid molecule, one strand of which comprises a target-specific domain that hybridizes to a first portion of a target nucleic acid molecule, a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule, and at least one first affinity moiety; and (B) a second nucleic acid molecule complex comprising a partially double-stranded second nucleic acid molecule, one strand of which comprises a double-stranded domain that anneals to the other strand of the partially double-stranded first nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety; a target-specific domain that hybridizes to a second portion of the target nucleic acid molecule (the first and second portions do not overlap); a double-stranded domain that anneals to the other strand of the partially double-stranded second nucleic acid molecule, the other strand of which anneals to the other strand of the partially double-stranded second nucleic acid molecule; a sample-specific domain that identifies the biological sample from which the target nucleic acid was obtained; a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate; a first single-stranded purification sequence; a first cleavable moiety located between the double-stranded domain and the sample-specific domain; and a second cleavable moiety located between the sample-specific domain and the first single-stranded purification sequence.

[0036] The present disclosure provides a kit comprising: (A) a first single-stranded nucleic acid molecule comprising a target-specific domain that hybridizes to a first portion of a target nucleic acid molecule, a double-stranded domain that anneals to a double-stranded domain of a second nucleic acid molecule, and at least one first affinity moiety; (B) a second single-stranded nucleic acid molecule comprising a double-stranded domain that anneals to the double-stranded domain of the first single-stranded nucleic acid molecule, a substrate-specific domain that hybridizes to a complementary nucleic acid attached to a substrate, and at least one second affinity moiety; and (C) a target-specific domain that hybridizes to a second portion of the target nucleic acid (wherein the first portion and the second portion do not overlap), a third single-stranded nucleic acid molecule comprising a double-stranded domain that anneals to the double-stranded domain of the fourth single-stranded nucleic acid molecule; and (D) a fourth single-stranded nucleic acid molecule comprising a double-stranded domain that anneals to the double-stranded domain of the third single-stranded nucleic acid molecule, a sample-specific domain that identifies the biological sample from which the target nucleic acid was obtained, a first single-stranded purification sequence, a first cleavable portion located between the double-stranded domain and the sample-specific domain, and a second cleavable portion located between the sample-specific domain and the first single-stranded purification sequence.

[0037] Any of the above aspects can be combined with any other aspect.

[0038] Unless otherwise defined, all scientific and technical terms have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. As used herein, the singular includes the plural unless the context clearly dictates otherwise, e.g., "an" or "the" is understood to be singular or plural, and the term "or" is understood to be inclusive. For example, "an element" means one or more elements. Throughout this specification, "comprising" or its variation "comprises" is understood to include a stated element, integer, step, or group of elements, integers, or steps, but not to exclude any other element, integer, step, or group of elements, integers, or steps. "About" can be understood to mean within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated numerical value. Unless otherwise clear from the context, all numerical values ​​presented herein are modified by the term "about."

[0039] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not admitted to be prior art to the claimed invention. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. Other features and advantages of the present disclosure will become apparent from the following detailed description and claims.

[0040] The patent or application file contains at least one drawing of color. Copies of this patent or application publication with color drawing(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee.

[0041] The above and further features will become more apparent from the following detailed description when taken in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0042] [Figure 1] FIG. 1 is a diagram of one representative sequencing probe of the present disclosure. [Figure 2] FIG. 2 shows the design of the standard probe, the three-part sequencing probe, and the one-part linker probe of the present disclosure. [Figure 3] FIG. 3 is a diagram of a representative reporter complex of the present disclosure hybridized to a representative sequencing probe of the present disclosure. [Figure 4] FIG. 4 shows a schematic diagram of an exemplary reporter probe of the present disclosure. [Figure 5] FIG. 5 is a schematic diagram of several representative reporter probes of the present disclosure that include tertiary nucleic acids of various configurations. [Figure 6] FIG. 6 is a schematic diagram of some representative reporter probes of the present disclosure that contain branched tertiary nucleic acids. [Figure 7] FIG. 7 shows possible locations for cleavable linker modification in representative reporter probes of the present disclosure. [Figure 8] FIG. 8 is a schematic diagram showing the capture of a target nucleic acid using the two capture probe system of the present disclosure. [Figure 9] FIG. 9 shows results from an experiment utilizing the methods of the present invention to capture and detect a multi-cancer panel of 100 targets using FFPE samples. [Figure 10] FIG. 10 is a schematic diagram of one cycle of the sequencing method of the present disclosure. [Figure 11-1] FIG. 11 is a schematic diagram of one cycle of the disclosed sequencing method and the corresponding imaging data collected during this cycle. [Figure 11-2]FIG. 11 is a schematic diagram of one cycle of the disclosed sequencing method and the corresponding imaging data collected during this cycle. [Figure 12] FIG. 12 shows the configuration of a representative sequencing probe pool of the present disclosure, in which eight different sequencing probe pools are designed using eight different color combinations. [Figure 13] FIG. 13 compares the barcode domain designs disclosed in US Patent Application Publication No. 2016 / 0194701 with the barcode domain designs of the present disclosure. [Figure 14] FIG. 14 is a schematic diagram of the sequencing cycle of the present disclosure, utilizing a cleavable linker modification to darken one position within the barcode. [Figure 15] FIG. 15 is a schematic diagram of a representative sequencing cycle of the present disclosure, in which one position within the barcode domain is darkened by substitution of the primary nucleic acid. [Figure 16] FIG. 16 is a schematic diagram of how the sequencing methods of the present disclosure allow for sequencing of the same base of a target nucleic acid using different sequencing probes. [Figure 17] Figure 17 shows how multiple base calls at a specific nucleotide position on a target nucleic acid are recorded from one or more sequencing probes and combined to create a consensus sequence, thereby increasing the accuracy of the final base call. [Figure 18-1] 18 shows results from a sequencing experiment obtained using the sequencing method of the present disclosure and analyzed using the Assembly Algorithm. For the graph, the sequences shown correspond clockwise, starting from the graph in the upper left, to SEQ ID NOs: 3, 4, 6, 8, 7, and 5. For the table on the right, the sequences correspond from top to bottom to SEQ ID NOs: 3, 4, 7, 8, 6, and 5. [Figure 18-2]18 shows results from a sequencing experiment obtained using the sequencing method of the present disclosure and analyzed using the Assembly Algorithm. For the graph, the sequences shown correspond clockwise, starting from the graph in the upper left, to SEQ ID NOs: 3, 4, 6, 8, 7, and 5. For the table on the right, the sequences correspond from top to bottom to SEQ ID NOs: 3, 4, 7, 8, 6, and 5. [Figure 19] Figure 19 shows a schematic of the experimental design for multiplexed capture and sequencing of cancer gene targets from FFPE samples. [Figure 20] FIG. 20 shows a schematic of direct RNA sequencing and results from an experiment using the sequencing methods of the present disclosure to test the suitability of RNA molecules. [Figure 21] FIG. 21 shows the results of sequencing RNA and DNA molecules with the same nucleotide sequence using the sequencing methods of the present disclosure. [Figure 22] FIG. 22 shows a comparison of the performance of standard and three-part sequencing probes of the present disclosure. [Figure 23] FIG. 23 shows the effect of LNA substitutions within representative target binding domains of the present disclosure using individual probes. [Figure 24] Figure 24 shows the effect of LNA substitutions in representative target binding domains of the present disclosure using a pool of nine probes. [Figure 25] FIG. 25 shows the effect of modified nucleotide and nucleic acid analog substitutions in representative target binding domains of the present disclosure. [Figure 26] FIG. 26 shows results from an experiment quantifying the raw accuracy of the sequencing method of the present disclosure. [Figure 27] FIG. 27 shows results from an experiment to determine the accuracy of the sequencing method of the present disclosure when nucleotides in a target nucleic acid are sequenced with two or more sequencing probes. [Figure 28]FIG. 28 is a schematic diagram of a sequencing probe of the present disclosure that includes a pocket oligo. [Figure 29] FIG. 29 is a schematic diagram of a sequencing probe of the present disclosure that includes a PEG linker region between each attachment position. [Figure 30] FIG. 30 is a schematic diagram of a sequencing probe of the present disclosure that includes an abasic region between each attachment position. [Figure 31] FIG. 31 is a diagram of a representative reporter complex of the present disclosure indirectly hybridized through a connector oligo to a representative sequencing probe of the present disclosure. [Figure 32] FIG. 32 is an illustration of a parity scheme used in the method of the present disclosure. [Figure 33] FIG. 33 is a schematic diagram of a complex of the present invention consisting of a capture probe, an adapter oligonucleotide, and a lawn oligonucleotide. [Figure 34] FIG. 34 is a schematic diagram of the c5 and c3 probe complexes of the present disclosure hybridizing to a target nucleic acid. [Figure 35] FIG. 35 is a schematic diagram of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure after digestion with FEN1. [Figure 36] FIG. 36 is a schematic diagram of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure after ligation. [Figure 37] FIG. 37 is a schematic diagram showing the cleavage of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure, mediated by a user. [Figure 38] FIG. 38 is a schematic diagram of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure after cleavage by USER. [Figure 39] FIG. 39 is a schematic diagram showing cleavage of the target nucleic acid-c3 probe-c5 probe complex of the present disclosure by UV. [Figure 40] FIG. 40 is a schematic diagram of a target nucleic acid-c3 probe-c5 probe complex of the present disclosure attached to a substrate via a complementary nucleic acid after cleavage by UV. [Figure 41] FIG. 41 is a schematic diagram of the c3.2 and c5.2 probe complexes of the present disclosure hybridized to a target nucleic acid. [Figure 42] FIG. 42 is a schematic diagram of a target nucleic acid complex of the present disclosure after ligation of the c3.2 probe complex and the c5.2 probe complex. [Figure 43] FIG. 43 is a schematic representation of the cleavage and release of single-stranded purified sequences within a nucleic acid complex of the present disclosure. [Figure 44] FIG. 44 is a schematic diagram of a target nucleic acid complex of the present disclosure immobilized on a substrate of the present disclosure. [Figure 45] FIG. 45 is a schematic diagram of cleavage and release of the substrate-specific domain after immobilization of a target nucleic acid complex of the present disclosure on a substrate of the present disclosure. [Figure 46] FIG. 46 is a schematic diagram of a target nucleic acid complex of the present disclosure after release of a substrate-specific domain immobilized on a substrate of the present disclosure. [Figure 47] FIG. 47 is a schematic diagram of a cross section of a representative array of the present invention. [Figure 48] Figure 48 is a schematic diagram of a cross section of a representative array of the present invention containing pyramidal nanowells. [Figure 49] FIG. 49 is a schematic diagram of a representative array of the present disclosure comprising a plurality of cylindrical nanowells arranged in a random pattern. [Figure 50] FIG. 50 is a schematic diagram of a representative array of the present disclosure containing cylindrical nanowells arranged in a regular grid of constant pitch. [Figure 51] FIG. 51 is a schematic diagram of a representative array of the present disclosure, in which a single target nucleic acid complex is immobilized in each nanowell. [Figure 52] FIG. 52 is a schematic diagram of a representative array of the present disclosure, in which a single target nucleic acid complex is immobilized in each nanowell, thereby preventing the immobilization of other target nucleic acid complexes. [Figure 53] FIG. 53 is a schematic diagram of a sequencing probe of the present disclosure that includes an attachment region composed entirely of L-DNA and having a 3′ terminal L-dG nucleotide. [Figure 54] Figure 54 is a schematic diagram of a sequencing probe of the present disclosure that is composed entirely of D-DNA and contains pocket oligos between attachment region 1 (spot 1) and attachment region 2 (spot 2) and between attachment region 2 (spot 2) and attachment region 3 (spot 3). [Figure 55] Figure 55 is a schematic diagram of a synthetic target nucleic acid immobilized on the surface of a solid substrate using a capture probe and a lawn oligonucleotide in combination with a protein lock. [Figure 56] Figure 56 is a series of charts showing the results of sequencing experiments using LG-mediated and D-pocket sequencing probes of the present disclosure. The x-axis represents the specific nucleotide of the target nucleic acid being sequenced. The top chart shows the theoretical sequencing diversity, observed sequencing diversity, and observed sequencing coverage for the LG-mediated and D-pocket sequencing probes. Red boxes indicate predicted problem areas for sequencing. [Figure 57] Figure 57 is a series of charts showing the results of sequencing experiments using LG-mediated and D-pocket sequencing probes of the present disclosure. The x-axis represents the specific nucleotide of the target nucleic acid being sequenced. The top chart shows the theoretical sequencing diversity, observed sequencing diversity, and observed sequencing coverage for the LG-mediated and D-pocket sequencing probes. Red boxes indicate predicted problem areas for sequencing. [Figure 58]Figure 58 is a series of charts showing the results of sequencing experiments using LG-mediated and D-pocket sequencing probes of the present disclosure. The x-axis represents the specific nucleotide of the target nucleic acid being sequenced. The top chart shows the theoretical sequencing diversity, observed sequencing diversity, and observed sequencing coverage for the LG-mediated and D-pocket sequencing probes. Red boxes indicate predicted problem areas for sequencing. [Figure 59] Figure 59 is a series of charts showing the results of sequencing experiments using LG-mediated and D-pocket sequencing probes of the present disclosure. The x-axis represents the specific nucleotide of the target nucleic acid being sequenced. The top chart shows the observed sequencing diversity and observed sequencing coverage for the LG-mediated and D-pocket sequencing probes. [Figure 60] Figure 60 is a series of charts showing the results of sequencing experiments using LG-mediated and D-pocket sequencing probes of the present disclosure. The x-axis represents the specific nucleotide of the target nucleic acid being sequenced. The top chart shows the observed sequencing diversity and observed sequencing coverage for the LG-mediated and D-pocket sequencing probes. [Figure 61] Figure 61 is a series of charts showing the results of sequencing experiments using LG-mediated and D-pocket sequencing probes of the present disclosure. The x-axis represents the specific nucleotide of the target nucleic acid being sequenced. The top chart shows the observed sequencing diversity and observed sequencing coverage for the LG-mediated and D-pocket sequencing probes. [Figure 62]Figure 62 is a series of histograms showing the total number of barcode events and the number of valid 3-spot reads in a sequencing experiment using LG-interposed and D-pocket sequencing probes of the present disclosure. [Figure 63] Figure 63 is a series of graphs showing the total number of on-target events, invalid events, off-target events, events with 1 error in b1-b6, events with 2 errors in b1-b6, events with 3 errors in b1-b6, events with 4 errors in b1-b6, events with 5 errors in b1-b6, and events with 6 errors in b1-b6 in a sequencing experiment using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. [Figure 64-1] Figure 64 is a series of graphs showing the total number of on-target events, invalid events, off-target events, events with 1 error in b1-b6, events with 2 errors in b1-b6, events with 3 errors in b1-b6, events with 4 errors in b1-b6, events with 5 errors in b1-b6, and events with 6 errors in b1-b6 in a sequencing experiment using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. [Figure 64-2] Figure 64 is a series of graphs showing the total number of on-target events, invalid events, off-target events, events with 1 error in b1-b6, events with 2 errors in b1-b6, events with 3 errors in b1-b6, events with 4 errors in b1-b6, events with 5 errors in b1-b6, and events with 6 errors in b1-b6 in a sequencing experiment using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. [Figure 64-3]Figure 64 is a series of graphs showing the total number of on-target events, invalid events, off-target events, events with 1 error in b1-b6, events with 2 errors in b1-b6, events with 3 errors in b1-b6, events with 4 errors in b1-b6, events with 5 errors in b1-b6, and events with 6 errors in b1-b6 in a sequencing experiment using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. [Figure 65] Figure 65 is a chart showing 1 spotter event (only 1 of 3 possible reporter probes successfully recorded), 2 spotter events (only 2 of 3 possible reporter probes successfully recorded), and 3 spotter events (all 3 possible reporter probes successfully recorded) in each cycle of a sequencing experiment using the D-pocket sequencing probes (cycles 1-50) and LG-interposed sequencing probes (cycles 51-100) of the present disclosure. [Figure 66-1] Figure 66 is a series of charts showing the results of sequencing experiments using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost chart shows the number of on-target events, novel hexamer events, redundant hexamer events, off-target events, and invalid events for each cycle of the sequencing experiment. Cycles 1-50 were performed using the D-pocket sequencing probes of the present disclosure, and cycles 51-100 were performed using the LG-mediated sequencing probes of the present disclosure. [Figure 66-2]Figure 66 is a series of charts showing the results of sequencing experiments using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost chart shows the number of on-target events, novel hexamer events, redundant hexamer events, off-target events, and invalid events for each cycle of the sequencing experiment. Cycles 1-50 were performed using the D-pocket sequencing probes of the present disclosure, and cycles 51-100 were performed using the LG-mediated sequencing probes of the present disclosure. [Figure 66-3] Figure 66 is a series of charts showing the results of sequencing experiments using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost chart shows the number of on-target events, novel hexamer events, redundant hexamer events, off-target events, and invalid events for each cycle of the sequencing experiment. Cycles 1-50 were performed using the D-pocket sequencing probes of the present disclosure, and cycles 51-100 were performed using the LG-mediated sequencing probes of the present disclosure. [Figure 66-4] Figure 66 is a series of charts showing the results of sequencing experiments using LG-mediated sequencing probes and D-pocket sequencing probes of the present disclosure. The leftmost chart shows the number of on-target events, novel hexamer events, redundant hexamer events, off-target events, and invalid events for each cycle of the sequencing experiment. Cycles 1-50 were performed using the D-pocket sequencing probes of the present disclosure, and cycles 51-100 were performed using the LG-mediated sequencing probes of the present disclosure. [Figure 67] Figure 67 is a schematic diagram of a target nucleic acid immobilized on a solid substrate using the methods and compositions of the present disclosure. The target nucleic acid is immobilized using a protein lock between a biotin moiety located on the capture probe, a lawn oligonucleotide, and a neutravidin moiety. DETAILED DESCRIPTION OF THE INVENTION

[0043] The present disclosure provides sequencing probes, reporter probes, methods, kits, and devices that are enzyme-free, amplification-free, library-free, and provide rapid nucleic acid sequencing with long read lengths and low error rates.

[0044] Compositions of the present disclosure

[0045] The present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises any of the constructs listed in Table 1. A typical target binding domain comprises at least eight nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; any of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analog, and the at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four types of regular bases, universal bases, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain. A typical barcode domain comprises a synthetic backbone and includes at least three attachment positions, each of which comprises at least one attachment region comprising at least one nucleic acid sequence to which a complementary nucleic acid molecule can bind, each of the at least three attachment positions corresponding to two of the at least six nucleotides in the target binding domain, each of the at least three attachment positions having a different nucleic acid sequence, and the nucleic acid sequence at each of the at least three attachment positions determining the position and identity of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0046] In another embodiment, a typical target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, and these at least six nucleotides in the target binding domain can identify corresponding (complementary) nucleotides in the target nucleic acid molecule; any nucleotide of these at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analog.

[0047] The present disclosure also provides a sequencing probe comprising a target binding domain and a barcode domain; the target binding domain comprises at least 10 nucleotides and is capable of binding to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in a target nucleic acid molecule, and at least four nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and at least three attachment positions, each of which comprises at least one attachment region comprising at least one nucleic acid sequence to which a complementary nucleic acid molecule can bind, wherein each attachment position of the at least three attachment positions corresponds to two nucleotides of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and the nucleic acid sequence of each attachment position of the at least three attachment positions determines the position and identity of the corresponding two nucleotides of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0048] The present disclosure also provides a population of sequencing probes comprising a plurality of any of the sequencing probes disclosed herein.

[0049] The target binding domains, barcode domains, and scaffolds of the disclosed sequencing probes, as well as complementary nucleic acid molecules (eg, reporter molecules or reporter complexes), are described in more detail below.

[0050] The sequencing probes of the present disclosure include a target domain and a barcode domain. FIG. 1 is a schematic diagram of a representative sequencing probe of the present disclosure. FIG. 1 shows that the target domain can bind to a target nucleic acid. The target nucleic acid can be any nucleic acid to which the sequencing probes of the present disclosure can hybridize. The target nucleic acid can be DNA or RNA. The target nucleic acid can be obtained from a biological sample derived from a subject. The terms "target binding domain" and "sequencing domain" are used interchangeably herein.

[0051] The target binding domain can comprise a series of nucleotides (e.g., a polynucleotide). The target binding domain can comprise DNA, RNA, or a combination thereof. When the target binding domain is a polynucleotide, it binds to the target nucleic acid by hybridizing to a portion of the target nucleic acid that is complementary to the target binding domain of the sequencing probe, as shown in Figure 1.

[0052] The target binding domain of a sequencing probe can be designed to control the probability and rate at which the hybridization and / or dehybridization of the sequencing probe occurs. Generally, the lower the Tm of a probe, the faster and more likely the probe will dehybridize from the target nucleic acid. Therefore, using a probe with a lower Tm will result in fewer probes binding to the target nucleic acid.

[0053] The length of the target binding domain partially influences the likelihood that a probe will hybridize to and remain hybridized to a target nucleic acid. Generally, the longer the target binding domain (the greater the number of nucleotides), the less likely a complementary sequence will be present in the target nucleotide. Conversely, the shorter the target binding domain, the greater the likelihood that a complementary sequence will be present in the target nucleotide. For example, the probability that a tetramer sequence will be located in a target nucleic acid is 1 / 256, while the probability that a hexamer sequence will be located in a target nucleic acid is 1 / 4096. Consequently, a set of shorter probes will likely bind to more positions in a nucleic acid of a given length compared to a set of longer probes.

[0054] In several situations, for example when detecting mutations or SNP alleles, it is preferable to increase the coverage of a target nucleic acid, or a portion of a target nucleic acid (particularly a portion of interest), by having probes with shorter target binding domains, thereby increasing the number of reads within a given length of nucleic acid.

[0055] The target binding domain can be any amount or number of nucleotides in length: it can be at least 12 nucleotides in length, at least 10 nucleotides in length, at least 8 nucleotides in length, at least 6 nucleotides in length, or at least 3 nucleotides in length.

[0056] Each nucleotide in the target binding domain can identify (or code for) a complementary nucleotide in the target molecule, or some nucleotides in the target binding domain can identify (or code for) complementary nucleotides in the target molecule and some nucleotides in the target binding domain do not identify (or code for) a complementary nucleotide in the target molecule.

[0057] The target binding domain can comprise at least one natural base. The target binding domain can be free of natural bases. The target binding domain can comprise at least one modified nucleotide or nucleic acid analog. The target binding domain can be free of modified nucleotides or nucleic acid analogs. The target binding domain can comprise at least one universal base. The target binding domain can be free of universal bases. The target binding domain can comprise at least one degenerate base. The target binding domain can be free of degenerate bases.

[0058] A target binding domain can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural bases), modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified nucleotides or nucleic acid analogs), universal bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more universal bases), degenerate bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more degenerate bases). The natural bases, modified nucleotides or nucleic acid analogs, universal bases, and degenerate bases of the individual target binding domains, when present in combination, can be arranged in any order.

[0059] Non-limiting examples of the term "modified nucleotide" or "nucleic acid analog" include locked nucleic acids (LNA), bridged nucleic acids (BNA), propyne-modified nucleic acids, zip nucleic acids (ZNA®), isoguanine, isocytosine, 6-amino-1-(4-hydroxy-5-hydroxymethyl-tetrahydrofuran-2-yl)-1,5-dihydro-pyrazolo[3,4-d]pyrimidin-4-one (PPG), and 2'-modified nucleic acids (e.g., 2'-O-methyl nucleic acids). The target binding domain can contain 0 to 6 (e.g., 0, 1, 2, 3, 4, 5, 6) modified nucleotides or nucleic acid analogs. Preferably, the modified nucleotide or nucleic acid analog is a locked nucleic acid (LNA).

[0060] As used herein, non-limiting examples of the term "locked nucleic acids (LNA)" include modified RNA nucleotides in which the ribose moiety contains a methylene bridge connecting the 2' oxygen and 4' carbon. This methylene bridge locks the ribose into the 3'-end conformation (also known as the north conformation) found in A-form RNA duplexes. The term inaccessible RNA can be used interchangeably with LNA. As used herein, non-limiting examples of the term "bridged nucleic acids (BNA)" include modified RNA molecules containing a five- or six-membered bridge structure with a fixed 3'-end conformation (also known as the north conformation). The bridge structure connects the 2' oxygen of the ribose to the 4' carbon of the ribose. A variety of different bridge structures are possible, including carbon, nitrogen, and hydrogen atoms. As used herein, non-limiting examples of the term "propyne-modified nucleic acid" include pyrimidines containing a propyne modification at the C5 position of the nucleobase, i.e., cytosine and thymine / uracil. As used herein, non-limiting examples of the term "Zip Nucleic Acid (ZNA®)" include oligonucleotides conjugated to a cationic spermine moiety.

[0061] As used herein, non-limiting examples of the term "universal base" include a nucleotide base that does not follow the Watson-Crick base pairing rules but can bind to any of the four canonical bases (A, T / U, C, G) present on a target nucleic acid. As used herein, non-limiting examples of the term "degenerate base" include a nucleotide base that does not follow the Watson-Crick base pairing rules but can bind to at least two, but not all four, of the four canonical bases (A, T / U, C, G) present on a target nucleic acid. Degenerate bases may also be referred to as wobble bases, and these terms are used interchangeably herein.

[0062] The representative sequencing probe shown in Figure 1 shows a target binding domain containing a six-nucleotide (hexamer) sequence (b1-b2-b3-b4-b5-b6) that specifically hybridizes to complementary nucleotides 1 through 6 of the target nucleic acid to be sequenced. This hexamer portion (b1-b2-b3-b4-b5-b6) of the target binding domain identifies (or encodes) the complementary nucleotide (1-2-3-4-5-6) within the target sequence. This hexamer sequence is flanked on each side by bases (N). The bases designated by (N) can independently be universal or degenerate bases. Typically, the bases designated by (N) are independently one of the canonical bases. The bases designated by (N) do not identify (or code for) the complementary nucleotide to which they bind in the target sequence and are independent of the nucleic acid sequence of the (hexamer) sequence (b1-b2-b3-b4-b5-b6).

[0063] The sequencing probes shown in Figure 1 can be used in conjunction with the sequencing methods of the present disclosure to sequence target nucleic acids, which utilize only a hybridization reaction and do not require covalent chemistry, enzymes, or amplification. A total of 4096 sequencing probes are required to sequence all possible hexamer sequences within a target nucleic acid molecule (46 =4096).

[0064] FIG. 1 shows an example of a target-binding domain configuration for a sequencing probe according to the present disclosure. Table 1 lists several other target-binding domain configurations of the present disclosure. One preferred target-binding domain is referred to as a "6 LNA" target-binding domain, which contains six LNAs at positions b1-b6 of the target-binding domain. These six LNAs are flanked on each side by bases (N). As used herein, the bases (N) can be universal / degenerate bases independent of the nucleic acid sequence of the (hexameric) sequence (b1-b2-b3-b4-b5-b6), or canonical bases. In other words, while bases b1-b2-b3-b4-b5-b6 can be specific for any given target sequence, the (N) bases can be universal / degenerate bases or can be any of the four canonical bases that are not specific for the target specified by b1-b2-b3-b4-b5-b6. For example, if the target sequence being interrogated is CAGGCATA, then bases b1-b2-b3-b4-b5-b6 of the target binding domain would be TCCGTA, while each of the (N) bases of the target binding domain could independently be A, C, T, or G, such that the resulting target binding domain could be any of the sequences ATCCGTAG, TTCCGTAC, GTCCGTAG, or any other of 16 possible sequences. Alternatively, two (N) bases could precede the six LNAs. Alternatively, two (N) bases could follow the six LNAs.

[0065] [Table 1]

[0066] Table 1 also lists "10-mer" target binding domains containing 10 target-specific natural bases. Table 1 also lists "8-mer" target binding domains containing 8 target-specific natural bases.

[0067] Table 1 further describes a "Natural I" target binding domain that includes six natural bases at positions b1-b6. These six natural bases are flanked on each side by two (N) bases. Alternatively, all four (N) bases could precede the six natural bases. Alternatively, all four (N) bases could follow the six natural bases. Any number of the four (N) bases (i.e., 1, 2, 3, 4) could precede the six natural bases, and the remaining (N) bases would follow the six natural bases.

[0068] Table 1 further describes a "Natural II" target binding domain that includes six natural bases at positions b1-b6. These six natural bases are flanked on each side by one (N) base. Alternatively, both (N) bases could be located before the six natural bases. Alternatively, both (N) bases could be located after the six natural bases. Typically, the (N) bases of a Natural II target binding domain are degenerate bases.

[0069] Table 1 also lists a "2LNA" target binding domain, which includes a combination of two LNAs and four natural bases at positions b1-b6 of the target binding domain. The two LNAs and four natural bases can appear in any order. For example, positions b3 and b4 can be LNAs, while positions b1, b2, b5, and b6 are natural bases. Bases b1-b6 are flanked on each side by one (N) base. Alternatively, bases b1-b6 can be preceded by two (N) bases. Alternatively, bases b1-b6 can be followed by two (N) bases.

[0070] Table 1 further describes a "4LNA" target binding domain, which includes a combination of four LNAs and two natural bases at positions b1-b6 of the target binding domain. The four LNAs and two natural bases can appear in any order. For example, positions b2-b5 can be LNAs, while positions b1 and b6 are natural bases. Bases b1-b6 are flanked on each side by one (N) base. Alternatively, bases b1-b6 can be preceded by two (N) bases. Alternatively, bases b1-b6 can be followed by two (N) bases.

[0071] Table 1 further describes a "6LNA" target binding domain that contains six LNAs at positions b1-b6 of the target binding domain. Bases b1-b6 can be flanked on each side by one (N) base.

[0072] Table 1 further describes "octameric" target binding domains that individually contain a natural base or an LNA at any of positions b1-b6 of the target binding domain. Bases b1-b6 can be flanked on each side by one (N) base.

[0073] The target binding domain can also include a minor-groove binder moiety. A minor groove binder moiety is a chemical modification of an oligonucleotide that adds a chemical moiety that can bind to the minor groove of a target nucleotide to which the oligonucleotide hybridizes. Without being bound by theory, the inclusion of a minor groove binder moiety increases the affinity of the target binding domain for the target nucleic acid, thereby increasing the melting temperature of the target binding domain-target nucleic acid duplex. Greater binding affinity allows for the use of smaller target binding domains.

[0074] The target binding domain can also contain one or more twisted intercalating nucleic acids (TINAs). TINAs are nucleic acid molecules that stabilize the formation of Hoogsteen triplex DNA from double-stranded oligonucleotides and triplex-forming oligonucleotides. Using TINAs to stabilize double-stranded oligonucleotides can improve the specificity and sensitivity of oligonucleotide probes for target nucleic acids.

[0075] The target binding domain can also include nucleic acid molecules containing 2'-O-methyl modified bases. 2'-O-methyl modified bases are RNA nucleoside modifications in which a methyl group is added to the 2' hydroxyl group of the ribose to generate a 2' methoxy group. 2'-O-methyl modified bases provide superior protection against base hydrolysis and digestion by nucleases. Without being bound by theory, the addition of 2'-O-methyl modified bases also increases the melting temperature of nucleic acid duplexes.

[0076] The target binding domain can also include covalently attached stilbene modifications, which can increase the stability of nucleic acid duplexes.

[0077] The sequencing probes of the present disclosure include a synthetic scaffold. The target-binding domain (also referred to herein as a sequencing domain) and the barcode domain are operably linked. The target-binding domain and the barcode domain can be covalently linked to form a single synthetic scaffold. The target-binding domain and the barcode domain can be linked via a linker (e.g., a nucleic acid linker, a chemical linker). The synthetic scaffold can comprise any material (e.g., a polysaccharide, a polynucleotide, a polymer, a plastic, a fiber, a peptide, a peptide nucleic acid, or a polypeptide). The synthetic scaffold is preferably rigid. The synthetic scaffold can comprise a single-stranded DNA molecule. The scaffold can comprise a "DNA origami" consisting of six DNA double helices (see, e.g., Lin et al., "Submicron Geometrically Encoded Fluorescent Barcodes Self-Assembled from DNA," Nature Chemistry; October 2012; Vol. 4(10): 832-839). Barcodes can be created from DNA origami tiles (Jungmann et al., "Multiplexed 3D cellular super-resolution imaging with DNA-PAINT and Exchange-PAINT," Nature Methods, Vol. 11, No. 3, 2014).

[0078] The sequencing probe of the present disclosure can include a partially double-stranded synthetic backbone. The sequencing probe can include a single-stranded DNA synthetic backbone and a double-stranded DNA spacer between the target binding domain and the barcode domain. The double-stranded DNA spacer can include at least one modified nucleotide or nucleic acid analog. Exemplary modified nucleotides or nucleic acid analogs useful in double-stranded DNA spacers are isoguanine and isocytosine. Alternatively, each of the nucleic acids comprising the double-stranded DNA spacer can independently be L-DNA. In some embodiments, the double-stranded DNA spacer can include L-DNA. The double-stranded DNA spacer can consist of L-DNA. The double-stranded DNA spacer can consist primarily of L-DNA.

[0079] The double-stranded DNA spacer can comprise from about 1 to about 100 nucleotides in length. The double-stranded DNA spacer can comprise about 25 nucleotides in length.

[0080] The synthetic backbone can comprise L-DNA. The synthetic backbone can consist of L-DNA. The synthetic backbone can consist primarily of L-DNA. The single-stranded DNA synthetic backbone can comprise about 10 to about 100 nucleotides in length. The single-stranded DNA synthetic backbone can comprise about 52 nucleotides in length. The single-stranded DNA synthetic backbone can comprise about 27 nucleotides in length.

[0081] The barcode domain can comprise L-DNA. The barcode domain can consist of L-DNA. The barcode domain can consist primarily of L-DNA. The barcode domain can comprise about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotides, or about 74 nucleotides. The barcode domain can comprise about 27 nucleotides, or about 52 nucleotides, or about 99 nucleotides, or about 74 nucleotides in length.

[0082] The sequencing probe can comprise a single-stranded DNA synthetic backbone and a polymeric spacer between the target-binding domain and the barcode domain that has mechanical properties similar to those of double-stranded DNA. Typical polymeric spacers include polyethylene glycol (PEG)-based polymers.

[0083] The double-stranded DNA spacer can be about 1 to about 100 nucleotides in length, or about 2 to about 50 nucleotides in length, or about 20 to about 40 nucleotides in length. Preferably, the double-stranded DNA spacer is about 36 nucleotides in length.

[0084] One sequencing probe of the present disclosure is designated the "standard probe" and is shown in the left diagram of Figure 2. The standard probe in Figure 2 contains a barcode domain covalently linked to a target binding domain, such that the target binding domain and barcode domain reside within the same single-stranded oligonucleotide. In the left diagram of Figure 2, the single-stranded oligonucleotide is linked to a stem oligonucleotide to create a double-stranded spacer region 36 nucleotides in length, referred to as the stem sequence. Utilizing this architecture, each sequencing probe in a pool of probes can hybridize to the same stem sequence.

[0085] In another embodiment, the nucleic acids contained in the barcode domain and the region binding to the stem oligonucleotide of the standard probe can be normal bases, modified nucleotides, or nucleic acid analogs. Typical modified nucleotides or nucleic acid analogs useful in the barcode domain and the region binding to the stem oligonucleotide of the standard probe are isoguanine and isocytosine. Alternatively, the nucleic acids contained in the barcode domain and the region binding to the stem oligonucleotide of the standard probe can be L-DNA. For example, the barcode domain and the region binding to the stem oligonucleotide of the standard probe can be entirely composed of L-DNA. In another example, the barcode domain and the region binding to the stem oligonucleotide of the standard probe can be composed of a segment of abasic single-stranded nucleic acid or multiple segments of L-DNA separated by segments of a polymer (such as PEG, described in more detail below) with mechanical properties similar to double-stranded DNA.

[0086] Another sequencing probe of the present disclosure is termed a "three-part probe" and is shown in the center diagram of Figure 2. The three-part probe in Figure 2 contains a barcode domain attached to a target-binding domain via a linker. In this example, the linker is a single-stranded stem oligonucleotide that hybridizes to a single-stranded oligonucleotide containing the target-binding domain and a single-stranded oligonucleotide containing the barcode domain, creating a 36-nucleotide double-stranded spacer region bridging the barcode domain (18 nucleotides) and the target-binding domain (18 nucleotides). Using this exemplary probe configuration, each barcode can be designed to hybridize to only one stem sequence, with the goal of preventing barcode domain exchange. Furthermore, different sequencing probes can be pooled together after each barcode domain has hybridized to its corresponding stem oligonucleotide.

[0087] In another embodiment, each nucleic acid contained in the single-stranded stem oligonucleotide can be a normal nucleic acid, or a modified nucleotide, or a nucleic acid analog. Typical modified nucleotides or nucleic acid analogs useful in the single-stranded stem oligonucleotide are isoguanine and isocytosine. Alternatively, each nucleic acid contained in the single-stranded stem oligonucleotide can be independently L-DNA.

[0088] In another embodiment, each nucleic acid contained in the region on the barcode domain to which the single-stranded stem oligonucleotide hybridizes can be a normal base, a modified nucleotide, or a nucleic acid analog. Typical modified nucleotides or nucleic acid analogs useful in single-stranded stem oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid contained in the region on the barcode domain to which the single-stranded stem oligonucleotide hybridizes can independently be L-DNA.

[0089] In another embodiment, each nucleic acid contained in the region of the single-stranded oligonucleotide containing the target binding domain to which the single-stranded stem oligonucleotide hybridizes can be a normal base, or a modified nucleotide, or a nucleic acid analog. Typical modified nucleotides or nucleic acid analogs useful in single-stranded stem oligonucleotides are isoguanine and isocytosine. Alternatively, each nucleic acid contained in the region of the single-stranded oligonucleotide containing the target binding domain to which the single-stranded stem oligonucleotide hybridizes can be independently L-DNA.

[0090] Another sequencing probe of the present disclosure is termed a "1-Part Linker Probe" and is shown in the right diagram of Figure 2. The 1-Part Linker Probe of Figure 2 comprises a barcode domain attached to a target binding domain via a linker. In this example, the linker is a PEG molecule. Alternatively, the linker could be a trans-stilbene. Alternatively, the linker can be any polymer with mechanical properties similar to double-stranded DNA. Exemplary polymer spacers include polyethylene glycol (PEG)-type polymers.

[0091] The sequencing probes of the present disclosure can comprise about 60 nucleotides. The sequencing probes of the present disclosure can comprise about 10 nucleotides. The sequencing probes of the present disclosure can be about 60 nucleotides in length or about 10 nucleotides in length. The nucleotides comprising the sequencing probes can be individual normal bases, modified nucleotides, or nucleic acid analogs, including L-DNA and D-DNA.

[0092] The barcode domain comprises multiple attachment positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more attachment positions). The number of attachment positions can be less than, equal to, or greater than the number of nucleotides in the target binding domain. The target binding domain can comprise a greater number of nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides) than the number of attachment positions in the scaffold domain. The target binding domain can comprise 8 nucleotides, and the barcode domain comprises three attachment positions. The target binding domain can comprise 10 nucleotides, and the barcode domain comprises three attachment positions.

[0093] The barcode domain can be of any length, as long as there is enough space for at least three attachment positions, as described below. The terms "attachment position," "position," and "spot" are used interchangeably herein. The terms "barcode domain" and "reporting domain" are used interchangeably herein.

[0094] Each attachment position in the barcode domain corresponds to two nucleotides (dinucleotides) in the target binding domain, and therefore corresponds to the complementary dinucleotide in the target nucleic acid that hybridizes to that dinucleotide in the target binding domain. As a non-limiting example, the first attachment position in the barcode domain corresponds to the first and second nucleotides in the target binding domain (e.g., in Figure 1, R1 is the first attachment position in the barcode domain, and R1 corresponds to dinucleotides b1 and b2 in the target binding domain, which in turn identify dinucleotides 1 and 2 in the target nucleic acid). The second attachment position in the barcode domain corresponds to the third and fourth nucleotides in the target binding domain (e.g., in Figure 1, R2 is the second attachment position in the barcode domain, and R2 corresponds to dinucleotides b3 and b4 in the target binding domain, which in turn identify dinucleotides 3 and 4 in the target nucleic acid). The third attachment position in the barcode domain corresponds to the fifth and sixth nucleotides in the target binding domain (e.g., in Figure 1, R3 is the third attachment position in the barcode domain, and R3 corresponds to dinucleotides b5 and b6 in the target binding domain, which in turn identify dinucleotides 5 and 6 in the target nucleic acid). In yet another non-limiting example, the first attachment position in the barcode domain, the second attachment position in the barcode domain, and the third attachment position in the barcode domain together correspond to the first through sixth nucleotides in the target binding domain (e.g., nucleotides b1-b6 in Figure 1 in the target binding domain, which in turn identify six nucleotides in the target nucleic acid).

[0095] Each attachment location within a barcode domain contains at least one attachment region (e.g., 1 to 50 attachment regions, or more). Some locations within a barcode domain can have more attachment regions than other locations (e.g., a first attachment location can have three attachment regions, while a second attachment location can have two attachment regions). Alternatively, each attachment location within a barcode domain can have the same number of attachment regions. Each attachment location within a barcode domain can contain one attachment region. Each attachment location within a barcode domain can contain two or more attachment regions. At least one of at least three attachment locations within a barcode domain contains a different number of attachment regions than the other two attachment locations within the barcode domain. In some embodiments, each attachment location within a barcode domain contains one attachment region.

[0096] Each attachment region contains at least one copy (i.e., 1-50, e.g., 10-30) of a nucleic acid sequence to which a complementary nucleic acid molecule (e.g., DNA or RNA) can reversibly bind. The nucleic acid sequences of multiple attachment regions at one attachment location can be identical to each other, and thus complementary nucleic acid molecules that bind to these attachment regions are identical to each other. Alternatively, the nucleic acid sequences of multiple attachment regions at one location are not identical to each other, and thus complementary nucleic acid molecules that bind to these attachment regions are not identical to each other.

[0097] The nucleic acid sequence comprising each attachment region within the barcode domain can be about 6 nucleotides to about 20 nucleotides in length. The nucleic acid sequence comprising each attachment region within the barcode domain can be about 12 nucleotides in length. The nucleic acid sequence comprising each attachment region within the barcode domain can be about 16 nucleotides in length. The nucleic acid sequence comprising each attachment region within the barcode domain can be about 14 nucleotides in length. The nucleic acid sequence comprising each attachment region within the barcode domain can be about 8 nucleotides in length. The nucleic acid sequence comprising each attachment region within the barcode domain can be about 9 nucleotides in length.

[0098] The attachment position, or the attachment region, or at least one nucleic acid sequence in the attachment region can contain at least one super T base (5-hydroxybutyl-2'-deoxyuridine). The attachment position, or the attachment region, or at least one nucleic acid sequence in the attachment region can contain at least one 3'-terminal super T base (5-hydroxybutyl-2'-deoxyuridine). The attachment position, or the attachment region, or at least one nucleic acid sequence in the attachment region can contain at least one 5'-terminal super T base (5-hydroxybutyl-2'-deoxyuridine).

[0099] Each nucleic acid contained in each attachment region within a barcode domain can independently be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the attachment region within a barcode domain can be modified nucleotides or nucleotide analogs. The typical ratio of modified nucleotides or nucleotide analogs to normal bases within a barcode domain is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in attachment regions within a barcode domain are isoguanine or isocytosine. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of reporter binding to the appropriate attachment region within the barcode domain while minimizing binding to other locations (including the target).

[0100] One or more attachment regions within a barcode domain can comprise L-DNA. L-DNA is left-handed and is a mirror image version of naturally occurring right-handed D-DNA. L-DNA is more stable and resistant to enzymatic digestion. Because L-DNA cannot hybridize to D-LNA, L-DNA can improve the efficiency and accuracy of reporter binding to the appropriate attachment region within the barcode domain while preventing reporter binding to other locations on the sequencing probe. In some embodiments, each nucleotide of at least one nucleic acid sequence at an attachment position can be L-DNA.

[0101] Each nucleic acid contained in each attachment region within a barcode domain can independently contain an adenine base, a cytosine base, a guanine base, or a thymine base, or each nucleic acid contained in each attachment region within a barcode domain can independently contain an adenine base, a guanine base, or a thymine base.

[0102] Each nucleic acid sequence contained in each attachment region within a barcode domain can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3'-terminal guanosine nucleotide. Each nucleic acid sequence contained in each attachment region within a barcode domain can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3'-terminal guanosine nucleotide. Each nucleic acid sequence contained in each attachment region within a barcode domain can consist primarily of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3'-terminal guanosine nucleotide.

[0103] Each nucleic acid sequence contained in each attachment region within a barcode domain can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 5'-terminal guanosine nucleotide. Each nucleic acid sequence contained in each attachment region within a barcode domain can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 5'-terminal guanosine nucleotide. Each nucleic acid sequence contained in each attachment region within a barcode domain can consist primarily of at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 5'-terminal guanosine nucleotide.

[0104] In some embodiments, at least one attachment region among at least one attachment position of the barcode domain can comprise a 3'-terminal guanosine nucleotide. In some embodiments, at least one attachment region among at least two attachment positions of the barcode domain can comprise a 3'-terminal guanosine nucleotide. In some embodiments, at least one attachment region among at least three attachment positions of the barcode domain can comprise a 3'-terminal guanosine nucleotide. The 3'-terminal guanosine nucleotide can be L-DNA.

[0105] In some embodiments, at least one attachment region within at least one attachment position of a barcode domain can comprise a 5'-terminal guanosine nucleotide. In some embodiments, at least one attachment region within at least two attachment positions of a barcode domain can comprise a 5'-terminal guanosine nucleotide. In some embodiments, at least one attachment region within at least three attachment positions of a barcode domain can comprise a 5'-terminal guanosine nucleotide. The 5'-terminal guanosine nucleotide can be L-DNA (e.g., L-deoxyguanosine (L-dG)). The terminal L-dG nucleotide reduces cross-junctional hybridization between attachment regions and / or attachment positions and maintains stability by providing base-stacking interactions.

[0106] One or more attachment regions can be integrated into the polynucleotide backbone; i.e., the backbone is a single polynucleotide and the attachment regions are part of the sequence of that single polynucleotide. One or more attachment regions can be linked to modified monomers (e.g., modified nucleotides) within the synthetic backbone, and the attachment regions can be branched from the synthetic backbone. One attachment site can contain two or more attachment regions, some of which are branched from the synthetic backbone while some of the attachment regions are integrated into the synthetic backbone. At least one attachment region within at least one attachment site can be integrated into the synthetic backbone. Each attachment region within each of the at least three attachment sites can be integrated into the synthetic backbone. At least one attachment region within at least one attachment site can be branched from the synthetic backbone. Each attachment region within each of the at least three attachment sites can be branched from the synthetic backbone.

[0107] Each attachment position within a barcode domain corresponds to one of 16 dinucleotides: adenine-adenine, adenine-thymine / uracil, adenine-cytosine, adenine-guanine, thymine / uracil-adenine, thymine / uracil-thymine / uracil, thymine / uracil-cytosine, thymine / uracil-guanine, cytosine-adenine, cytosine-thymine / uracil, cytosine-cytosine, cytosine-guanine, guanine-adenine, guanine-thymine / uracil, guanine-cytosine, and guanine-guanine. Thus, one or more attachment regions located within a single attachment position of a barcode domain correspond to one of the 16 dinucleotides and contain a nucleic acid sequence specific to the dinucleotide to which the attachment region corresponds. Attachment regions located within different attachment positions of a barcode domain contain unique nucleic acid sequences, even if these attachment positions within the barcode region correspond to the same dinucleotide. For example, given a sequencing probe of the present disclosure containing a target-binding domain with a hexamer encoding the sequence AGAGAC, the barcode domain of the sequencing probe would contain three attachment positions, with the first attachment position corresponding to an adenine-guanine dinucleotide, the second attachment position corresponding to an adenine-guanine dinucleotide, and the third attachment position corresponding to an adenine-cytosine dinucleotide. The attachment region located at position 1 of the probe in this example would contain a unique nucleic acid sequence that differs from the nucleic acid sequence of the attachment region located at position 2, even if both attachment positions 1 and 2 correspond to an adenine-guanine dinucleotide. The sequences of specific attachment positions are designed to ensure that complementary nucleic acids at each attachment position do not interact with different attachment positions. Additionally, there are no constraints on the nucleotide sequence of the complementary nucleic acid. It is preferred that the nucleotide sequence not share substantial homology (e.g., 50% to 99.9%) with known nucleotide sequences. This limits undesired hybridization of the complementary nucleic acid with the target nucleic acid.

[0108] Figure 1 shows a diagram of one exemplary sequencing probe of the present disclosure, including a representative barcode domain. The barcode domain illustrated in Figure 1 includes three attachment positions: R1, R2, and R3. Each attachment position corresponds to a specific dinucleotide present in the hexameric sequence (b1-b6) of the target binding domain. In this example, R1 corresponds to positions b1 and b2, R2 corresponds to positions b3 and b4, and R3 corresponds to positions b5 and b6. Each position therefore decodes a specific dinucleotide present in the hexameric sequence of the target binding domain, thereby enabling the identification of the two specific bases (A, C, G, or T) present in each dinucleotide.

[0109] In the representative barcode domain shown in Figure 1, each attachment position contains a single attachment region integrated into a synthetic scaffold. Each attachment region of the three attachment positions contains a specific nucleotide sequence corresponding to an individual dinucleotide encoded by each attachment position. For example, attachment position R1 contains an attachment region having a specific sequence corresponding to the attributes of dinucleotides b1-b2.

[0110] The barcode domain can further comprise one or more binding regions. The barcode domain can comprise at least one single-stranded nucleic acid sequence adjacent to or adjacent to at least one attachment location. The barcode domain can comprise at least two single-stranded nucleic acid sequences adjacent to or adjacent to at least two attachment locations. The barcode domain can comprise at least three single-stranded nucleic acid sequences adjacent to or adjacent to at least three attachment locations. These adjacent portions are known as "toe-holds" and can be used to increase the exchange rate of oligonucleotides hybridized adjacent to the toe-holds by providing additional binding sites for single-stranded oligonucleotides (e.g., "toe-hold" probes; see, e.g., Seeling et al., "Catalyzed Relaxation of Metastable DNA Fuels"; J. Am. Chem. Soc. 2006, 128(37), 12211-12220).

[0111] At least one attachment region within a barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least two attachment regions within a barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence. At least three attachment regions within a barcode domain can be flanked on at least one side by a double-stranded nucleic acid sequence.

[0112] Any attachment region within a barcode domain can be separated from any adjacent attachment position by a double-stranded nucleic acid sequence called a "pocket oligo." Figure 28 shows an example of a sequencing probe having a barcode domain containing three attachment positions. Attachment position 1 is separated from adjacent attachment position 2 by a pocket oligo. Attachment position 2 is further separated from adjacent attachment position 3 by another pocket oligo.

[0113] Each nucleic acid contained in a pocket oligo can be a normal base, a modified nucleotide, or a nucleic acid analog. Exemplary modified nucleotides or nucleic acid analogs useful in pocket oligos are isoguanine and isocytosine. Alternatively, each nucleic acid contained in a pocket oligo can independently be L-DNA. The pocket oligo can include at least one super T base (5-hydroxybutyl-2'-deoxyuridine). The pocket oligo can be approximately 25 nucleotides in length.

[0114] In some embodiments, at least one, at least two, or at least three attachment positions within the barcode domain can be adjacent to at least one flanking double-stranded polynucleotide. At least one flanking double-stranded polynucleotide can contain at least one modified nucleotide or nucleic acid analog. At least one flanking double-stranded polynucleotide can contain L-DNA. At least one flanking double-stranded polynucleotide can contain at least one super-T base (5-hydroxybutyl-2'-deoxyuridine). The at least one adjacent double-stranded polynucleotide can be about 25 nucleotides in length.

[0115] At least one attachment region within a barcode domain can be flanked on at least one side by any polymer with mechanical properties similar to double-stranded DNA. Exemplary polymer spacers include polyethylene glycol (PEG)-type polymers. At least two attachment regions within a barcode domain can be flanked on at least one side by any polymer with mechanical properties similar to double-stranded DNA. At least three attachment regions within a barcode domain can be flanked on at least one side by any polymer with mechanical properties similar to double-stranded DNA.

[0116] Any attachment region within a barcode domain can be separated from any adjacent attachment site by any polymer with mechanical properties similar to double-stranded DNA. Typical polymer spacers include polyethylene glycol (PEG)-based polymers. Figure 29 shows an example of a sequencing probe containing three attachment sites. Attachment site 1 is separated from adjacent attachment site 2 by a PEG linker. Attachment site 2 is further separated from adjacent attachment site 3 by another PEG linker.

[0117] At least one attachment region within the barcode domain can be flanked on at least one side by abasic single-stranded nucleic acid molecules. Abasic nucleic acid molecules are nucleic acid molecules that have no purine or pyrimidine bases. At least two attachment regions within the barcode domain can be flanked on at least one side by abasic single-stranded nucleic acid molecules. At least three attachment regions within the barcode domain can be flanked on at least one side by abasic single-stranded nucleic acid molecules.

[0118] Any attachment region within a barcode domain can be separated from any adjacent attachment position by an abasic single-stranded nucleic acid molecule. Figure 30 shows an example of a sequencing probe having a barcode domain containing three attachment positions. Attachment position 1 is separated from adjacent attachment position 2 by an abasic single-stranded nucleic acid molecule. Attachment position 2 is further separated from adjacent attachment position 3 by an abasic single-stranded nucleic acid molecule.

[0119] Any attachment region within a barcode domain can be separated from any adjacent attachment position by a 3'-terminal guanosine nucleotide. In some embodiments, at least one attachment region among the at least two attachment positions of a barcode domain can comprise a 3'-terminal guanosine nucleotide. Figure 53 shows an example of a sequencing probe having a barcode domain containing three attachment positions, each separated by a terminal LG nucleotide. Attachment position 1 is separated from adjacent attachment position 2 by an LG nucleotide. Attachment position 2 is further separated from adjacent attachment position 3 by an LG nucleotide. Attachment position 3 terminates at its 3' end with an LG nucleotide.

[0120] The sequencing probes of the present disclosure can have a total length of about 20 nanometers to about 50 nanometers (including the target binding domain, barcode domain, and optional domains). The backbone of the sequencing probe can be a polynucleotide molecule containing about 120 nucleotides, about 60 nucleotides, about 52 nucleotides, or about 27 nucleotides.

[0121] Sequencing probes can include cleavable linker modifications. The cleavable linker modifications can include at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or any number of cleavable moieties. Any cleavable linker modification or cleavable moiety known to those of skill in the art can be used. Non-limiting examples of cleavable linker modifications and cleavable moieties include UV light-cleavable linkers, reducing agent-cleavable linkers, and enzyme-cleavable linkers. One example of an enzyme-cleavable linker is the insertion of deoxyuracil for cleavage by the USER™ enzyme. The cleavable linker modification can be located anywhere along the length of the sequencing probe, including, but not limited to, the region between the target binding domain and the barcode domain. The right panel of Figure 7 shows representative cleavable linker modifications that can be incorporated into the probes of the present disclosure.

[0122] Reporter Probe

[0123] The nucleic acid molecule that binds (e.g., hybridizes) to a complementary nucleic acid sequence in at least one attachment region within at least one attachment location of the barcode domain of a sequencing probe according to the present disclosure comprises a detectable label (directly or indirectly). This detectable label is referred to herein as a "reporter probe" or a "reporter probe complex," and these terms are used interchangeably herein. The reporter probe can be DNA, RNA, or PNA. Preferably, the reporter probe is DNA.

[0124] A reporter probe can include at least two domains, a first domain capable of binding to at least one first complementary nucleic acid molecule, and a second domain capable of binding to a first detectable label and at least a second detectable label. Figure 3 shows a schematic diagram of a representative reporter probe of the present disclosure attached to a first attachment site of a barcode domain of a representative sequencing probe. In Figure 3, the first domain of the reporter probe (shown in maroon checkerboard pattern) binds to a complementary nucleic acid sequence within attachment site R1 of the barcode domain, and the second domain of the reporter probe (shown in gray) is attached to two detectable labels (one green label and one red label).

[0125] Alternatively, the reporter probe can comprise at least two domains, a first domain capable of binding to at least one first complementary nucleic acid molecule and a second domain capable of binding to at least one second complementary nucleic acid molecule, where the at least one first and second complementary nucleic acid molecules can be different (have different nucleic acid sequences).

[0126] A "primary nucleic acid molecule" is a reporter probe that includes at least two domains, a first domain capable of binding (e.g., hybridizing) to a complementary nucleic acid sequence within at least one attachment region within at least one attachment location of a barcode domain of a sequencing probe, and a second domain capable of binding (e.g., hybridizing) to at least one additional complementary nucleic acid. A primary nucleic acid molecule can directly bind to a complementary nucleic acid sequence within at least one attachment region within at least one attachment location of a barcode domain of a sequencing probe. A primary nucleic acid molecule can indirectly bind to a complementary nucleic acid sequence within at least one attachment region within at least one attachment location of a barcode domain of a sequencing probe via a nucleic acid linker. The nucleic acid linker is referred to as a "connector oligo."

[0127] The connector oligo can comprise at least two domains, a first domain capable of binding (e.g., hybridizing) to at least one first complementary nucleic acid sequence within at least one attachment region within at least one attachment location of the barcode domain, and a second domain capable of binding (e.g., hybridizing) to the first domain of the primary nucleic acid molecule. Figure 31 shows a sequencing probe attached to a reporter probe via a connector oligo.

[0128] Each nucleic acid contained in the first or second domain of the connector oligo can be a normal base, a modified nucleotide, or a nucleic acid analog. Exemplary modified nucleotides or nucleotide analogs useful in the first or second domain of the connector oligo are isoguanine or isocytosine. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of binding of the first domain of the connector oligo to an appropriate complementary nucleic acid sequence within at least one attachment region within at least one attachment position of the barcode domain of a sequencing probe, while minimizing binding to other locations (including the target). The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of binding of the second domain of the connector oligo to an appropriate first domain of a reporter probe, while minimizing binding to other locations (including the target). Alternatively, each nucleic acid contained in the first or second domain of the connector oligo can independently be L-DNA. In one example of a connector oligo, the first domain comprises D-DNA and the second domain comprises L-DNA. In another example of a connector oligo, the first domain comprises D-DNA and the second domain comprises isoguanine and / or isocytosine.

[0129] The first domain of the connector oligo can be about 8 to about 16 nucleotides in length. Preferably, the first domain of the connector oligo is 14 nucleotides in length. The second domain of the connector oligo can be about 4 to 12 nucleotides in length. Preferably, the second domain of the connector oligo is about 8 nucleotides in length.

[0130] In some embodiments, including connector oligos, the attachment region can be referred to as a partially double-stranded attachment region. A partially double-stranded attachment region can include a double-stranded region and a single-stranded region. The single-stranded region of a partially double-stranded attachment region can include at least one nucleic acid sequence that binds to (e.g., hybridizes with) at least one complementary nucleic acid sequence. The at least one complementary nucleic acid sequence that binds to (e.g., hybridizes with) the single-stranded region of a partially double-stranded attachment region can be a primary nucleic acid molecule.

[0131] Each nucleic acid in the double-stranded region of a partially double-stranded attachment region can independently be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, two, three, four, five, six, seven, or eight nucleotides in the double-stranded region of a partially double-stranded attachment region can be modified nucleotides or nucleic acid analogs. The typical ratio of modified nucleotides or nucleotide analogs to normal bases in the double-stranded region is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in the double-stranded region of a partially double-stranded attachment region are isoguanine and isocytosine. Alternatively, each nucleic acid in the double-stranded region of a partially double-stranded attachment region can independently be L-DNA.

[0132] Each nucleic acid in the single-stranded region of a partially double-stranded attachment region can independently be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleotides in the single-stranded region of a partially double-stranded attachment region can be a modified nucleotide or nucleic acid analog. The typical ratio of modified nucleotides or nucleotide analogs to normal bases in the single-stranded region is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in the single-stranded region of a partially double-stranded attachment region are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of binding of the single-stranded region of a partially double-stranded attachment region to an appropriate complementary nucleic acid sequence in a primary nucleic acid molecule, while minimizing binding to other locations (including the target). Alternatively, each nucleic acid contained in the single-stranded region of the partially double-stranded attachment region can independently be L-DNA.

[0133] The primary nucleic acid molecule may comprise a cleavable linker. The cleavable linker may be located between the first domain and the second domain. Preferably, the cleavable linker is cleavable by light. The cleavable linker may comprise at least one or at least two cleavable moieties. The at least one or at least two cleavable moieties may be cleavable by light.

[0134] The first domain of the primary nucleic acid molecule can be about 6 to 16 nucleotides in length. Preferably, the first domain of the primary nucleic acid molecule is about 8 nucleotides in length.

[0135] Each nucleic acid contained in the first domain of a primary nucleic acid molecule can be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight nucleotides in the first domain of a primary nucleic acid molecule can be a modified nucleotide or nucleic acid analog. The typical ratio of modified nucleotides or nucleotide analogs to normal bases in the first domain is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in the first domain of a primary nucleic acid molecule are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of binding of the first domain of a primary nucleic acid molecule to an appropriate complementary nucleic acid sequence in at least one attachment region within at least one attachment position of a barcode domain of a sequencing probe, while minimizing binding to other locations (including the target). Alternatively, each nucleic acid contained in the first domain of the primary nucleic acid molecule can independently be L-DNA.

[0136] In some embodiments, a first domain of a primary nucleic acid molecule can be composed entirely of L-DNA and a second domain of a primary nucleic acid molecule can be composed entirely of D-DNA.

[0137] In some embodiments, the first domain of the primary nucleic acid molecule can comprise a 3'-terminal cytosine nucleotide. In some embodiments, the first domain of the primary nucleic acid molecule can comprise a 3'-terminal cytosine nucleotide, and this 3'-terminal cytosine nucleotide is L-DNA.

[0138] In some embodiments, the first domain of the primary nucleic acid molecule can comprise a 5'-terminal cytosine nucleotide. In some embodiments, the first domain of the primary nucleic acid molecule can comprise a 5'-terminal cytosine nucleotide, wherein the 5'-terminal cytosine nucleotide is L-DNA.

[0139] In some embodiments, the first domain of the primary nucleic acid molecule can comprise at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof, and a 3'-terminal cytosine nucleotide. In some embodiments, the first domain of the primary nucleic acid molecule can consist of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof, and a 3'-terminal cytosine nucleotide. In some embodiments, the first domain of the primary nucleic acid molecule can consist primarily of at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof, and a 3'-terminal cytosine nucleotide.

[0140] In some embodiments, the first domain of the primary nucleic acid molecule can comprise a 5'-terminal cytosine nucleotide with at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof. In some embodiments, the first domain of the primary nucleic acid molecule can consist of a 5'-terminal cytosine nucleotide with at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof. In some embodiments, the first domain of the primary nucleic acid molecule can consist primarily of a 5'-terminal cytosine nucleotide with at least one adenine nucleotide, at least one thymine nucleotide, at least one guanine nucleotide, or any combination thereof.

[0141] At least one additional, complementary nucleic acid that binds to a primary nucleic acid molecule is referred to herein as a "secondary nucleic acid molecule." A primary nucleic acid molecule can bind (e.g., hybridize) to at least one, or at least two, or at least three, or at least four, or at least five, or more secondary nucleic acid molecules. Preferably, a primary nucleic acid molecule binds (e.g., hybridizes) to four secondary nucleic acid molecules.

[0142] A secondary nucleic acid molecule can comprise at least two domains, the first of which can bind (e.g., hybridize) to at least one complementary sequence in at least one primary nucleic acid molecule, and the second of which can bind (e.g., hybridize) to (a) a first detectable label and at least a second detectable label; or (b) at least one additional complementary nucleic acid; or (c) a combination thereof. In some embodiments, the first domain of the secondary nucleic acid molecule can be composed entirely of L-DNA, and the second domain of the secondary nucleic acid molecule can be composed entirely of D-DNA. In some embodiments, both the first and second domains of the secondary nucleic acid molecule can be composed entirely of D-DNA.

[0143] The secondary nucleic acid molecule may comprise a cleavable linker. The cleavable linker may be located between the first domain and the second domain. Preferably, the cleavable linker is cleavable by light.

[0144] Each nucleic acid in the first domain of a secondary nucleic acid molecule can independently be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the first domain of a secondary nucleic acid molecule can be a modified nucleotide or nucleic acid analog. The typical ratio of modified nucleotides or nucleotide analogs to normal bases in the first domain of a secondary nucleic acid molecule is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in the first domain of a secondary nucleic acid molecule are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of binding of the first domain of a secondary nucleic acid molecule to an appropriate complementary nucleic acid sequence in the second domain of the secondary nucleic acid molecule, while minimizing binding to other locations (including the target).

[0145] At least one additional, complementary nucleic acid that binds to a secondary nucleic acid molecule is referred to herein as a "tertiary nucleic acid molecule." A secondary nucleic acid molecule can bind (e.g., hybridize) to at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or more tertiary nucleic acid molecules. Preferably, the at least one secondary nucleic acid molecule binds (e.g., hybridizes) to one tertiary nucleic acid molecule.

[0146] The tertiary nucleic acid molecule comprises at least two domains, the first of which is capable of binding (e.g., hybridizing) to at least one complementary sequence in at least one secondary nucleic acid molecule, and the second of which is capable of binding (e.g., hybridizing) to a first detectable label and at least a second detectable label. Alternatively, the second domain may comprise a first detectable label and at least a second detectable label, for example, by attaching these labels directly or indirectly during oligonucleotide synthesis using phosphoramidite or NHS chemistry. In some embodiments, the first domain of the tertiary nucleic acid molecule can be composed entirely of L-DNA, and the second domain of the tertiary nucleic acid molecule can be composed entirely of D-DNA. In some embodiments, both the first and second domains of the tertiary nucleic acid molecule can be composed entirely of D-DNA. The tertiary nucleic acid molecule can comprise a cleavable linker. The cleavable linker can be located between the first and second domains. Preferably, the cleavable linker is cleavable by light.

[0147] Each nucleic acid contained in the first domain of a tertiary nucleic acid molecule can independently be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the first domain of a tertiary nucleic acid molecule can be a modified nucleotide or nucleic acid analog. The typical ratio of modified nucleotides or nucleotide analogs to normal bases in the first domain of a tertiary nucleic acid molecule is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in the first domain of a tertiary nucleic acid molecule are isoguanine and isocytosine. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine) can improve the efficiency and accuracy of binding of the first domain of a tertiary nucleic acid molecule to an appropriate complementary nucleic acid sequence in, for example, the second domain of a secondary nucleic acid molecule, while minimizing binding to other locations (including the target).

[0148] The reporter probe is conjugated to a first detectable label and at least a second detectable label to produce a two-color combination. This dual combination of fluorescent dyes can include a single color overlap (e.g., blue-blue). As used herein, the term "label" includes a single moiety capable of producing a detectable signal or multiple moieties capable of producing the same or substantially the same detectable signal as each other. For example, a label can include a single yellow fluorescent dye (e.g., ALEXA FLUOR™ 532) or multiple yellow fluorescent dyes (e.g., ALEXA FLUOR™ 532).

[0149] The reporter probe can be conjugated to a first detectable label and at least a second detectable label, each detectable label being one of four fluorescent dyes: blue (B), green (G), yellow (Y), and red (R). Using these four dyes results in ten possible two-color combinations (BB; BG; BR; BY; GG; GR; GY; RR; RY; YY). In some embodiments, as shown in FIG. 3, reporter probes of the present disclosure are labeled with one of eight possible color combinations: BB, BG, BR, BY, GG, GR, GY, and YY. The detectable label and the at least second detectable label can have the same emission spectrum or different emission spectra.

[0150] In embodiments including a sequencing probe and a primary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises any of the constructs listed in Table 1. Exemplary target binding domains comprise at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogs, and the at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four regular bases, universal bases, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain. A typical barcode domain comprises a synthetic backbone and at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence to which at least one complementary primary nucleic acid molecule binds, the complementary primary nucleic acid molecule comprising a first detectable label and at least one second detectable label, each attachment position of the at least three attachment positions corresponding to two of the at least six nucleotides in the target binding domain, each of the at least three attachment positions having a different nucleic acid sequence, and the at least one first detectable label and the at least one second detectable label of each complementary primary nucleic acid molecule bound to each of the at least three attachment positions determining the position and identity of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.The at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four regular bases, universal bases, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain.

[0151] In some embodiments, at least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can precede a nucleotide in the target binding domain that identifies a corresponding nucleotide in the target nucleic acid molecule. In some embodiments, at least one nucleotide in the target binding domain that does not identify a corresponding nucleotide in the target nucleic acid molecule can follow a nucleotide in the target binding domain that identifies a corresponding nucleotide in the target nucleic acid molecule.

[0152] In another embodiment, a representative target binding domain can include at least six nucleotides capable of hybridizing to a target nucleic acid, and the at least six nucleotides in the target binding domain can identify corresponding (complementary) nucleotides in the target nucleic acid molecule; none of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleic acid analog, or any of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleic acid analog.

[0153] In embodiments including a sequencing probe and a primary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises at least 10 nucleotides and is capable of hybridizing to a target nucleic acid, at least 6 nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and at least 4 nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and includes at least three attachment positions, each attachment position including at least one attachment position comprising at least one nucleic acid sequence to which at least one complementary primary nucleic acid molecule binds. Also provided is a sequencing probe comprising a region, the complementary primary nucleic acid molecule of which comprises at least one first detectable label and at least one second detectable label, each of the at least three attachment positions corresponding to two of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions having a different nucleic acid sequence, and the at least one first detectable label and the at least one second detectable label of each complementary primary nucleic acid molecule bound to each of the at least three attachment positions determine the positions and identities of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0154] In embodiments including a sequencing probe, a primary nucleic acid molecule, and a secondary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises any of the constructs listed in Table 1. Exemplary target binding domains comprise at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogs, and the at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four regular bases, universal bases, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain. A typical barcode domain comprises a synthetic backbone and includes at least three attachment locations, each attachment location comprising at least one attachment region comprising at least one nucleic acid sequence to which at least one complementary primary nucleic acid molecule binds, and the complementary primary nucleic acid molecule is further bound by at least one complementary primary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label, each of the at least three attachment locations corresponds to two of the at least six nucleotides in the target binding domain, each of the at least three attachment locations has a different nucleic acid sequence, and the at least one first detectable label and the at least one second detectable label of each complementary secondary nucleic acid molecule bound to each of the at least three attachment locations determine the positions and attributes of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0155] In another embodiment, a representative target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain can identify corresponding (complementary) nucleotides in the target nucleic acid molecule; none of the at least six nucleotides are modified nucleotides or nucleotide analogs, or any of the at least six nucleotides are modified nucleotides or nucleotide analogs.

[0156] In an embodiment comprising a sequencing probe, a primary nucleic acid molecule, and a secondary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises at least 10 nucleotides and is capable of hybridizing to a target nucleic acid, at least 6 nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and at least 4 nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and comprises at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence to which at least one complementary primary nucleic acid molecule binds; Also provided is a sequencing probe in which the complementary primary nucleic acid molecule is further bound to at least one complementary secondary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label, wherein each of the at least three attachment positions corresponds to two of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and the at least one first detectable label and the at least one second detectable label of each complementary secondary nucleic acid molecule bound to each of the at least three attachment positions determine the positions and attributes of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0157] In embodiments including a sequencing probe, a primary nucleic acid molecule, a secondary nucleic acid molecule, and a tertiary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises any of the constructs listed in Table 1. Exemplary target binding domains comprise at least eight nucleotides and are capable of hybridizing to a target nucleic acid, wherein at least six nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogs, and the at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four regular bases, universal bases, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain.A typical barcode domain comprises a synthetic backbone and includes at least three attachment locations, each attachment location comprising at least one attachment region comprising at least one nucleic acid sequence to which at least one complementary primary nucleic acid molecule binds, which is further bound by at least one complementary secondary nucleic acid molecule, which is further bound by at least one complementary tertiary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label, each of the at least three attachment locations corresponding to two of the at least six nucleotides in the target binding domain, each of the at least three attachment locations having a different nucleic acid sequence, and the at least one first detectable label and the at least one second detectable label of each complementary tertiary nucleic acid molecule bound to each of the at least three attachment locations defining the positions and identities of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0158] In another embodiment, a representative target binding domain can comprise at least six nucleotides capable of hybridizing to a target nucleic acid, wherein the at least six nucleotides in the target binding domain can identify corresponding (complementary) nucleotides in the target nucleic acid molecule; none of the at least six nucleotides are modified nucleotides or nucleotide analogs, or any of the at least six nucleotides are modified nucleotides or nucleotide analogs.

[0159] In embodiments including a sequencing probe, a primary nucleic acid molecule, a secondary nucleic acid molecule, and a tertiary nucleic acid molecule, the present disclosure provides a sequencing probe comprising a target binding domain and a barcode domain, wherein the target binding domain comprises at least 10 nucleotides and is capable of hybridizing to a target nucleic acid, at least 6 nucleotides in the target binding domain are capable of identifying corresponding (complementary) nucleotides in the target nucleic acid molecule, and at least 4 nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule; the barcode domain comprises a synthetic backbone and comprises at least three attachment positions, each attachment position comprising at least one attachment region comprising at least one nucleic acid sequence to which at least one complementary primary nucleic acid molecule binds, and the complementary primary nucleic acid molecule comprises at least one Also provided is a sequencing probe having a complementary secondary nucleic acid molecule further bound thereto, wherein the at least one complementary secondary nucleic acid molecule is further bound to at least one complementary tertiary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label, wherein each of the at least three attachment positions corresponds to two of the at least six nucleotides in the target binding domain, and each of the at least three attachment positions has a different nucleic acid sequence, and wherein the at least one first detectable label and the at least one second detectable label of each complementary tertiary nucleic acid molecule bound to each of the at least three attachment positions determine the positions and attributes of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0160] The present disclosure also provides sequencing probes and reporter probes having detectable labels on both secondary and tertiary nucleic acid molecules. For example, the secondary nucleic acid molecule can be bound to a primary nucleic acid molecule, and the secondary nucleic acid molecule can contain both a first detectable label and at least a second detectable label, and can also be bound to at least one tertiary nucleic acid molecule containing the first detectable label and at least a second detectable label. The first detectable label and at least a second detectable label located on the secondary nucleic acid molecule can have the same or different emission spectra. The first detectable label and at least a second detectable label located on the tertiary nucleic acid molecule can have the same or different emission spectra. The emission spectrum of the detectable label on the secondary nucleic acid molecule can be the same as or different from the emission spectrum of the detectable label on the tertiary nucleic acid molecule.

[0161] Figure 4 is a schematic diagram of an exemplary reporter probe of the present disclosure, including an exemplary primary, secondary, and tertiary nucleic acid molecule. The primary nucleic acid molecule includes a first domain at its 3' end, which includes a 12-nucleotide sequence that hybridizes to a complementary attachment region within the attachment position of the barcode domain of the sequencing probe. The 5' end includes a second domain that hybridizes to six secondary nucleic acid molecules. The exemplary secondary nucleic acid molecule shown includes a first domain at its 5' end that hybridizes to the primary nucleic acid molecule and domains at its 3' end that hybridize to five tertiary nucleic acid molecules.

[0162] Tertiary nucleic acid molecules contain at least two domains. The first domain is capable of binding to a secondary nucleic acid molecule. The second domain of the tertiary nucleic acid molecule is capable of binding to a first detectable label and at least a second detectable label. The second domain of the tertiary nucleic acid molecule can be bound to the first detectable label and at least a second detectable label by directly incorporating one or more fluorescently labeled nucleotide monomers into the sequence of the second domain of the tertiary nucleic acid molecule. The second domain of the tertiary nucleic acid molecule can be bound to the first detectable label and at least a second detectable label by hybridizing a short polynucleotide that serves as a label for the second domain of the tertiary nucleic acid molecule. These short polynucleotides are called "labeled oligos" and can be labeled by direct incorporation of fluorescently labeled nucleotide monomers or by other nucleic acid labeling methods known to those of skill in the art. The exemplary tertiary nucleic acid molecule shown in Figure 4 can be considered a "labeled oligo" and includes a first domain that hybridizes to a secondary nucleic acid molecule and a second domain that is fluorescently labeled, for example, by indirectly attaching the label during oligonucleotide synthesis using NHS chemistry or by incorporating one or more fluorescently labeled nucleotide monomers during synthesis of the tertiary nucleic acid molecule. The labeled oligo can be DNA, RNA, or PNA.

[0163] The labeled oligo can include a cleavable linker between the fluorescent moiety and the polynucleotide molecule. The cleavable linker is preferably cleavable with light. The cleavable linker can also be cleaved chemically or enzymatically.

[0164] In another embodiment, the second domain of the secondary nucleic acid can be conjugated to a first detectable label and at least a second detectable label. The second domain of the secondary nucleic acid can be conjugated to a first detectable label and at least a second detectable label by directly incorporating one or more fluorescently labeled nucleotide monomers into the second domain of the secondary nucleic acid. The first detectable label and at least a second detectable label can be conjugated to the second domain of the secondary nucleic acid molecule by hybridizing a short polynucleotide that serves as a label for the second domain of the secondary nucleic acid. These short polynucleotides, called labeled oligos, can be labeled by direct incorporation of fluorescently labeled nucleotide monomers or by other nucleic acid labeling methods known to those of skill in the art.

[0165] A primary nucleic acid molecule can contain about 100, or about 95, or about 90, or about 85, or about 80, or about 75 nucleotides. A primary nucleic acid molecule can contain about 100 to about 80 nucleotides. A primary nucleic acid molecule can contain about 90 nucleotides. A secondary nucleic acid molecule can contain about 90, or about 85, or about 80, or about 75, or about 70 nucleotides. A secondary nucleic acid molecule can contain about 90 to about 80 nucleotides. A secondary nucleic acid molecule can contain about 87 nucleotides. A secondary nucleic acid molecule can contain about 25, or about 20, or about 15, or about 10 nucleotides. A tertiary nucleic acid molecule can contain about 20 to about 10 nucleotides. A tertiary nucleic acid molecule can contain about 15 nucleotides.

[0166] The reporter probes of the present disclosure can have a variety of designs. For example, a primary nucleic acid molecule can be hybridized to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) secondary nucleic acid molecule. Each secondary nucleic acid molecule can be hybridized to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) tertiary nucleic acid molecule. To create a reporter probe labeled with a specific two-color combination, a reporter probe is designed that includes secondary nucleic acid molecules, tertiary nucleic acid molecules, or labeled oligos labeled with each color of the specific two-color combination, or any combination of secondary nucleic acid molecules, tertiary nucleic acid molecules, and labeled oligos. For example, Figure 4 shows a reporter probe of the present disclosure that includes a total of 30 dyes (15 dyes color 1 and 15 dyes color 2). To prevent color switching or cross-hybridization between different fluorescent dyes, each tertiary nucleic acid or labeled oligo attached to a particular label or fluorescent dye contains a unique nucleotide sequence.

[0167] In some embodiments, the present disclosure provides a 5x5 reporter probe. The 5x5 reporter probe includes a primary nucleic acid molecule, the primary nucleic acid molecule including a first domain of 12 nucleotides. The primary nucleic acid molecule also includes a second domain, the second domain including a nucleotide sequence capable of hybridizing to five secondary nucleic acid molecules. Each secondary nucleic acid molecule includes a nucleotide sequence such that five tertiary nucleic acids, each having a detectable label attached thereto, can hybridize to each secondary nucleic acid.

[0168] In some embodiments, the present disclosure provides a 4x3 reporter probe. The 4x3 reporter probe includes a primary nucleic acid molecule, the primary nucleic acid molecule including a first domain of 12 nucleotides. The primary nucleic acid molecule also includes a second domain, the second domain including a nucleotide sequence capable of hybridizing to four secondary nucleic acid molecules. Each secondary nucleic acid molecule includes a nucleotide sequence such that three tertiary nucleic acids, each having a detectable label attached thereto, can hybridize to each secondary nucleic acid.

[0169] In some embodiments, the present disclosure provides a 3x4 reporter probe. The 3x4 reporter probe includes a primary nucleic acid molecule, the primary nucleic acid molecule including a first domain of 12 nucleotides. The primary nucleic acid molecule also includes a second domain, the second domain including a nucleotide sequence capable of hybridizing to three secondary nucleic acid molecules. Each secondary nucleic acid molecule includes a nucleotide sequence such that four tertiary nucleic acids, each having a detectable label attached thereto, can hybridize to the respective secondary nucleic acid.

[0170] In some embodiments, the present disclosure provides a spacer 3x4 reporter probe. The spacer 3x4 reporter probe comprises a primary nucleic acid molecule, the primary nucleic acid molecule comprising a first domain consisting of 12 nucleotides. A spacer region consisting of 20 to 40 nucleotides is located between the first and second domains of the primary nucleic acid molecule. The spacer is identified as having a length of 20 to 40 nucleotides, but the length of the spacer is not limited and can be shorter than 20 nucleotides or longer than 40 nucleotides. The second domain of the primary nucleic acid molecule comprises a nucleotide sequence capable of hybridizing to three secondary nucleic acid molecules. Each secondary nucleic acid comprises a nucleotide sequence such that four tertiary nucleic acids, each having a detectable label attached thereto, can hybridize to the respective secondary nucleic acid.

[0171] In some embodiments, the primary nucleic acid can include a first domain that is 12 nucleotides in length. However, the length of the first domain of the primary nucleic acid is not limited and can be less than 12 nucleotides or greater than 12 nucleotides. In one example, the first domain of the primary nucleic acid is 14 nucleotides. In another example, the first domain of the primary nucleic acid is 9 nucleotides. In yet another example, the first domain of the primary nucleic acid is 8 nucleotides. Nine-nucleotide first domains of the primary nucleic acid of the reporter probe include those shown in Table 15.

[0172] [Table 2]

[0173] Any feature of one particular reporter probe design according to the present disclosure can be combined with any feature of another reporter probe design according to the present disclosure. For example, a 5x5 reporter probe can be modified to include a spacer region of about 20-40 nucleotides between the complementary nucleic acid and the primary nucleic acid. In another example, a 4x3 reporter probe can be modified to create a 4x5 reporter probe in which four secondary nucleic acids contain nucleotide sequences that allow five tertiary nucleic acids, each linked to a detectable label, to hybridize to each secondary nucleic acid.

[0174] Without being bound by theory, a 5x5 reporter probe contains more fluorescent labels (25) than a 4x3 reporter probe (12), resulting in a greater fluorescence intensity for the 5x5 reporter probe. The fluorescence detected in any given FOV is a function of many variables, including the fluorescence intensity of a given reporter probe and the number of optionally bound target molecules within that FOV. The number of optionally bound target molecules per field of view (FOV) can range from 1 million to 2.5 million targets per FOV. Typical values ​​for the number of bound target molecules per FOV are 20,000 to 40,000, or 220,000 to 440,000, or 1 million to 2 million target molecules. A typical FOV is 0.05 mm. 2 ~1 mm 2 A further example of a typical FOV is 0.05 mm 2 ~0.65 mm 2 is.

[0175] In some embodiments, the present disclosure provides reporter probe designs in which the secondary nucleic acid molecule includes an "extra-handle" that is not hybridized to the tertiary nucleic acid molecule and is distal to the primary nucleic acid molecule. In some embodiments, the "extra-handle" can be 12 nucleotides in length (a "12-mer"), but is not limited to that length and can be fewer or more than 12 nucleotides. Each "extra-handle" can comprise the nucleotide sequence of a first domain of the primary nucleic acid molecule to which the secondary nucleic acid molecule hybridizes. Thus, when a reporter probe includes an "extra-handle," the reporter probe can hybridize to a sequencing probe via the first domain of the primary nucleic acid molecule or via the "extra-handle." This increases the probability that the reporter probe will bind to the sequencing probe. This design of the "extra-handle" can also improve hybridization kinetics. Without being bound by theory, the "extra-handle" can increase the effective concentration of the reporter probe's complementary nucleic acid. The 5x4 "additional handle" reporter probe is expected to produce approximately 4750 fluorescent counts per standard FOV. The 5x3 "additional handle", 4x4 "additional handle", 4x3 "additional handle", and 3x4 "additional handle" reporter probes are all expected to produce approximately 6000 fluorescent counts per standard FOV. The design of any of the reporter probes disclosed herein can be modified to include an "additional handle".

[0176] Each secondary nucleic acid molecule of a reporter probe can hybridize to a tertiary nucleic acid molecule that is all labeled with the same detectable label. For example, the left diagram in Figure 5 shows a "5x6" reporter probe. The 5x6 reporter probe includes a primary nucleic acid containing a second domain, which contains a nucleotide sequence that hybridizes to six secondary nucleic acid molecules. Each secondary nucleic acid contains a nucleotide sequence that allows five tertiary nucleic acid molecules bound to a detectable label to hybridize to each secondary nucleic acid. Each of the five tertiary nucleic acid molecules bound to a particular secondary nucleic acid molecule is labeled with the same detectable label. For example, three secondary nucleic acid molecules are bound to tertiary nucleic acid molecules labeled with a yellow fluorescent dye, and the other three secondary nucleic acid molecules are bound to tertiary nucleic acid molecules labeled with a red fluorescent dye.

[0177] Each secondary nucleic acid molecule of a reporter probe can hybridize to a tertiary nucleic acid molecule labeled with a different detectable label. For example, the center diagram in Figure 5 shows a "3x2x6" reporter probe design. The 3x2x6 reporter probe includes one primary nucleic acid containing a second domain, which contains a nucleotide sequence that hybridizes to six secondary nucleic acid molecules. Each secondary nucleic acid contains a nucleotide sequence that allows five tertiary nucleic acid molecules, each linked to a detectable label, to hybridize to the respective secondary nucleic acid. Each secondary nucleic acid binds to both a tertiary nucleic acid molecule labeled with a yellow fluorescent dye and a tertiary nucleic acid molecule labeled with a red fluorescent dye. In this specific example, three secondary nucleic acid molecules bind to two red tertiary nucleic acid molecules and three yellow tertiary nucleic acid molecules, while the other three secondary nucleic acid molecules bind to two red tertiary nucleic acid molecules and three yellow tertiary nucleic acid molecules. Each secondary nucleic acid molecule can bind to any number of tertiary nucleic acid molecules linked to different detectable labels. In the central diagram of Figure 5, tertiary nucleic acid molecules bound to individual secondary nucleic acid molecules are arranged in alternating label colors (i.e., red-yellow-red-yellow-red or yellow-red-yellow-red-yellow).

[0178] In any of the described reporter probe designs, tertiary nucleic acids labeled with different detectable labels can be arranged in any order along the secondary nucleic acid. For example, the right diagram in Figure 5 shows a "FRET-resistant 3x2x6" reporter probe, which is similar to the 3x2x6 reporter probe design, but differs in the arrangement (e.g., linear order or grouping) of the red and yellow tertiary nucleic acid molecules along each secondary nucleic acid molecule.

[0179] Figure 6 shows a more representative reporter probe design of the present disclosure, which includes individual secondary nucleic acid molecules that bind to various tertiary nucleic acid molecules. The left diagram shows a "6x1x4.5" reporter probe containing one primary nucleic acid molecule. This primary nucleic acid molecule contains a second domain containing a nucleotide sequence that hybridizes to six secondary nucleic acid molecules. Each secondary nucleic acid molecule hybridizes to five tertiary nucleic acid molecules. Four of the five tertiary nucleic acid molecules hybridized to each secondary nucleic acid molecule are directly labeled with a detectable label of the same color. The fifth tertiary nucleic acid (designated branched tertiary nucleic acid) is bound to five labeled oligos of the other color of the two-color combination. Three of the six secondary nucleic acids are bound to branched tertiary nucleic acids labeled with one color of the two-color combination (red in this example), while the remaining three secondary nucleic acids are bound to branched tertiary nucleic acids labeled with the other color of the two-color combination (yellow in this example). In total, the 6x1x4.5 reporter probe is labeled with a total of 54 dyes (27 dyes for each color). The center diagram in Figure 6 shows the "4x1x4.5" reporter probe. This 4x1x4.5 reporter probe shares the same overall architecture as the 6x1x4.5 reporter probe, except that the primary nucleic acid binds only four secondary nucleic acids, resulting in a total of 36 dyes, 18 for each color.

[0180] A reporter probe can contain the same number of dyes for each color in a two-color combination. A reporter probe can contain a different number of dyes for each color in a two-color combination. The choice of which color dye to have more of in a reporter probe is based on the energy levels of light absorbed by the two dyes. For example, the right diagram in Figure 6 shows a "5x5 energy-optimized" reporter probe design. This reporter probe design contains 15 yellow dyes (higher energy) and 10 red dyes (lower energy). In this example, the 15 yellow dyes can constitute the first label, and the 10 red dyes can constitute the second label.

[0181] Detectable moieties, or labels, or reporters, can be attached to either secondary nucleic acid molecules, tertiary nucleic acid molecules, or labeled oligos in a variety of ways, including direct or indirect attachment of a detectable moiety (e.g., fluorescent moiety, colorimetric moiety, etc.). Those skilled in the art can refer to references on labeling nucleic acids. For example, non-limiting examples of fluorescent moieties include yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, cyanine, dansyl chloride, phycocyanin, phycoerythrin, and the like.

[0182] Fluorescent labels and their attachment to nucleotides and / or oligonucleotides are well described in numerous publications, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, 9th Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd Edition (Stockton Press, New York, 1993); Eckstein, ed., Oligonucleotides and Analogues: A Practical Approach (IRL Press, Oxford, 1991); Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26:227-259 (1991). Specific methods applicable to the present disclosure are described in U.S. Patent Nos. 4,757,141, 5,151,507, and 5,091,519, a sample of which is incorporated herein by reference. One or more fluorescent dyes can be used as labels for labeled target sequences, examples of which are disclosed, for example, in U.S. Pat. Nos. 5,188,934 (4,7-dichlorofluorescein dyes); 5,366,860 (spectrally resolvable rhodamine dyes); 5,847,162 (4,7-dichlororhodamine dyes); 4,318,846 (ether-substituted fluorescein dyes); 5,800,996 (energy transfer dyes); Lee et al., 5,066,580 (xanthine dyes); and 5,688,648 (energy transfer dyes). Labeling can also be performed using quantum dots, which are disclosed in the following patents and patent publications: U.S. Patent Nos. 6,322,901; 6,576,291; 6,423,551; 6,251,303; 6,319,426; 6,426,513; 6,444,143; 5,990,479; 6,207,392; U.S. Patent Application Publication Nos. 2002 / 0045045; and 2003 / 0017264.As used herein, the term "fluorescent label" includes signaling moieties that convey information through one or more molecular fluorescent absorption and / or emission properties, including fluorescence intensity, fluorescence lifetime, emission spectral characteristics, energy transfer, etc.

[0183] Non-limiting examples of commercially available fluorescent nucleotide analogs that are easy to incorporate into nucleotide and / or oligonucleotide sequences include Cy3-dCTP, Cy3-dUTP, Cy5-dCTP, Cy5-dUTP (Amersham Biosciences, Piscataway, NJ), fluorescein-12-dUTP, tetramethylrhodamine-6-dUTP, TEXAS RED™-5-dUTP, CASCADE BLUE™-7-dUTP, BODIPY TMFL-14-dUTP, BODIPY TMR-14-dUTP, BODIPY TMTR-14-dUTP, RHODAMINE GREEN™-5-dUTP, OREGON GREEN™ 488-5-dUTP, TEXAS RED™-12-dUTP, BODIPY TM 630 / 650-14-dUTP, BODIPY™ 650 / 665-14-dUTP, ALEXA FLUOR™ 488-5-dUTP, ALEXA FLUOR™ 532-5-dUTP, ALEXA FLUOR™ 568-5-dUTP, ALEXA FLUOR™ 594-5-dUTP, ALEXA FLUOR™ 546-14-dUTP, fluorescein-12-UTP, tetramethylrhodamine-6-UTP, TEXAS RED™-5-UTP, mCherry, CASCADE BLUE™-7-UTP, BODIPY™ FL-14-UTP, BODIPY TMR-14-UTP, BODIPY™ TR-14-UTP, RHODAMINE Examples of suitable fluorophores include GREEN™-5-UTP, ALEXA FLUOR™ 488-5-UTP, and LEXA FLUOR™ 546-14-UTP (Molecular Probes, Inc., Eugene, Oregon). Alternatively, the fluorophores listed above and those referred to herein can be added during oligonucleotide synthesis using, for example, phosphoramidite or NHS chemistry. Protocols for custom synthesis of nucleotides bearing other fluorophores are known in the art (see Henegariu et al. (2000) Nature Biotechnol. 18:345).2-Aminopurine is a fluorescent base that can be directly incorporated into oligonucleotide sequences during their synthesis. Nucleic acids may also be pre-stained with intercalating dyes such as DAPI, YOYO-1, ethidium bromide, or cyanine dyes such as SYBR Green.

[0184] Non-limiting examples of other fluorophores that can be used for post-synthesis attachment include ALEXA FLUOR™ 350, ALEXA FLUOR™ 405, ALEXA FLUOR™ 430, ALEXA FLUOR™ 532, ALEXA FLUOR™ 546, ALEXA FLUOR™ 568, ALEXA FLUOR™ 594, ALEXA FLUOR™ 647, BODIPY 493 / 503, BODIPY FL, BODIPY R6G, BODIPY 530 / 550, BODIPY TMR, BODIPY 558 / 568, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY TR, BODIPY 630 / 650, BODIPY 650 / 665, Cascade Blue, Cascade Yellow, Dansyl, Lissamine Rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, Pacific Orange, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Tetramethylrhodamine, Texas Red (available from Molecular Probes, Inc., Eugene, OR), Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7 (Amersham Biosciences, Piscataway, NJ), and the like. FRET tandem fluorophores can also be used, non-limiting examples of which include PerCP-Cy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, APC-Cy7, PE-Alexa dyes (610, 647, 680), APC-Alexa dyes, and the like.

[0185] Metallic silver or gold particles can be used to enhance the signal from fluorescently labeled nucleotide and / or oligonucleotide sequences (Lakowicz et al. (2003) BioTechniques 34:62).

[0186] Other suitable labels for oligonucleotide sequences may include fluorescein (FAM, FITC), digoxigenin, dinitrophenol (DNP), dansyl, biotin, bromodeoxyuridine (BrdU), hexahistidine (6xHis), phospho-amino acids (e.g., P-tyr, P-ser, P-thr), etc. The following hapten / antibody pairs can be used for detection: biotin / α-biotin, digoxigenin / α-digoxigenin, dinitrophenol (DNP) / α-DNP, 5-carboxyfluorescein (FAM) / α-FAM, in which each antibody is derivatized with a detectable label.

[0187] The detectable labels described herein are spectrally resolvable. "Spectrally resolvable," with respect to multiple fluorescent labels, means that the fluorescent emission bands of the multiple labels are sufficiently distinct (i.e., sufficiently non-overlapping) from one another so that the molecular tags to which each label is attached can be distinguished based on the fluorescent signals emitted by each label using a standard optical detection system (e.g., a bandpass filter and photomultiplier system). Examples of such systems are described in U.S. Pat. Nos. 4,230,558 and 4,811,218, or in Wheeless et al., "Flow Cytometry: Instrumentation and Data Analysis," Academic Press, New York, 1985, pp. 21-76. Spectrally resolvable organic dyes (e.g., fluorescein, rhodamine, etc.) mean that the emission wavelength maxima are at least 20 nm apart, and in another embodiment, at least 40 nm apart. With respect to chelating lanthanide compounds, quantum dots, etc., spectrally resolvable means that the emission wavelength maxima are at least 10 nm apart, or at least 15 nm apart.

[0188] The presence of three attachment positions within the barcode domain allows for up to 10 possible two-color combinations at each attachment position, allowing for up to 1000 possible color combinations. When pooling reporter probes with fewer than 1000 probes per pool, the ability to use parity checks to overcome errors can be utilized. Many potential parity schemes exist to enable parity checking, and one scheme is shown in Figure 32. In this example, the actual colors present are not used for the parity check; instead, the presence of a single-color (S) reporter probe (e.g., red) and a multicolor (M) reporter probe (e.g., red / yellow) at each attachment position within the barcode domain is used. As seen in the parity design, knowledge of the state (S or M) of any two reporter positions allows for the prediction of the third position. In the example shown, observing S at any two positions implies that the unobserved position must be M; observing S and M at any two positions implies that the other position must be S; observing two M reporter probes implies that the other position must be M. This means that two incorrect readings must be made to obtain a code for three reporter probes where the detected reporter color is incorrect. Figure 32 shows the results of a simulation with a 5% reporter probe error, showing that error rejection increases when parity checking is applied. There are many parity systems that can be applied, and this is just one example.

[0189] Another error correction routine is to swap the color palette for each pool of reporter probes. The color palette is the set of reporter probes actually used to measure a pool. If there are many reporter probes not used in any pool and 500 reporter probes are present in one pool, only half of the possible color combinations are needed. The simplest way to achieve this is to have two palettes: Palette A contains 500 reporter probes and Palette B contains another 500 reporter probes. Thus, if sequencing pools 1, 3, 5, and 7 have Palette A and pools 2, 4, 6, and 8 have Palette B, then a running pool order of 1, 2, 3, 4, 5, 6, 7, and 8 means that each successive sequencing pool has a different palette. Thus, a barcode from pool 2 would not be present in the immediately preceding and following pools (e.g., pools 1 and 3). This allows for easy automation of troubleshooting and limited error detection.

[0190] A reporter probe can include one or more cleavable linker modifications. The one or more cleavable linker modifications can be located anywhere within the reporter probe. The cleavable linker modification can be located between the first and second domains of a primary nucleic acid molecule of the reporter probe. The cleavable linker modification can be located between the first and second domains of a secondary nucleic acid molecule of the reporter probe. The cleavable linker modification can be located between the first and second domains of a primary nucleic acid molecule and a secondary nucleic acid molecule of the reporter probe. The left diagram of Figure 7 shows a representative reporter probe of the present disclosure, including a cleavable linker modification between the first and second domains of a primary nucleic acid and a cleavable linker modification between the first and second domains of a secondary nucleic acid. In cases such as those illustrated in the left diagram of Figure 7, the cleavable linker modification can include one or more cleavable moieties (as illustrated in the left diagram of Figure 7).

[0191] Modifications of the cleavable linker include compounds of formula (I): [ka] or a stereoisomer thereof, or a salt thereof, wherein R1 is hydrogen, halogen, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl is one of the C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Each alkynyl independently optionally contains at least one substituent R 10 and R2 is substituted with O, NH, N(C 1-6 alkyl); R3 is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each of which is optionally bound to at least one substituent R 10 each R4 and R7 is independently substituted with C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, in which C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Each alkynyl independently optionally contains at least one substituent R 10 R5 and R9 are each independently cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each of which is optionally substituted with at least one substituent R 10 R6 is substituted with O, NH, N(C 1-6 alkyl); R8 is O, NH, N(C 1-6 alkyl); each R 10 are independently hydrogen, halogen, -C 1-6 Alkyl, -C 2-6 Alkenyl, -C 2-6 Alkynyl, HaloC 1-6 Alkyl, HaloC 2-6 Alkenyl, HaloC 2-6Alkynyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -CN, -NO2, oxo, -OR 11 , -SO2R 11 , -SO3 - , -COR 11 , -CO2R 11 , -CONR 11 R 12 , -C(=NR 11 )NR 12 R 13 , -NR 11 R 12 , -NR 12 COR 12 , -NR 11 CONR 12 R 13 , -NR 11 CO2R 12 , -NR 11 SONR 12 R 13 , -NR 11 SO2NR 12 R 13 , -NR 11 SO2R 12 R 11 , R 12 , R 13 may be the same or different, and each independently represents hydrogen, -C 1-6 Alkyl, -C 2-6 Alkenyl, -C 2-6 Alkynyl, HaloC 1-6 Alkyl, HaloC 2-6 Alkenyl, HaloC 2-6 Alkynyl, C 1-6 Alkyloxy C 1-6 It is either alkyl-, cycloalkyl, heterocyclyl, aryl or heteroaryl.

[0192] In one embodiment, R is C 1-6 Alkyl, preferably C 1-3 alkyl (methyl, ethyl, propyl, isopropyl, etc.); R2 is NH or N(C 1-6 alkyl); R3 is a 5- to 6-membered cycloalkyl, preferably cyclohexyl; R4 is C 1-6 Alkylene, preferably C1-3 alkylene (e.g., methylene, ethylene, propylene, isopropylene); R5 is a 5- to 6-membered heterocyclyl containing one nitrogen atom and zero or one additional heteroatom selected from N, O, and S, and the heterocyclyl optionally contains one or two R 10 R6 is O; R7 is C 1-6 Alkylene, preferably C 1-3 alkylene (e.g., methylene, ethylene, propylene, isopropylene); R8 is O; R9 is a 5- to 6-membered heterocyclyl containing one nitrogen atom and zero or one additional heteroatom selected from N, O, and S, and the heterocyclyl optionally contains one or two R 10 and each R 10 are independently halogen, C 1-6 Alkyl, HaloC 1-6 Alkyl, oxo, -SO2H, -SO3 - Either:

[0193] In one embodiment, R3 is cyclohexyl, R4 is methylene, R5 is 1H-pyrrole-2,5-dione, and R9 is optionally SO3 - substituted pyrrolidine-2,5-dione.

[0194] As a linker compound, [ka] or a stereoisomer thereof, or a salt thereof.

[0195] As a linker compound, [ka] or a stereoisomer thereof, or a salt thereof.

[0196] As a linker compound or modification of a linker, [ka] Either of the following is possible.

[0197] As a linker compound or modification of a linker, [ka] Either of the following is possible.

[0198] As a modification or cleavable moiety of the cleavable linker, [ka] is possible.

[0199] Reporter probes can be constructed by mixing three stock solutions with water. One stock solution contains a primary nucleic acid molecule, one stock solution contains a secondary nucleic acid molecule, and the final stock solution contains a tertiary nucleic acid molecule. Table 2 shows representative amounts of each stock solution that can be mixed to construct a reporter probe of a particular design.

[0200] [Table 3]

[0201] target nucleic acid

[0202] The present disclosure provides methods for sequencing nucleic acids using the sequencing probes disclosed herein. Nucleic acids sequenced using the methods of the present disclosure are referred to herein as "target nucleic acids." The term "target nucleic acid" refers to a nucleic acid molecule (DNA, RNA, PNA) whose sequence is determined by the probes, methods, and devices of the present disclosure. In general, the terms "target nucleic acid," "target nucleic acid molecule," "target nucleic acid sequence," "target nucleic acid fragment," "target oligonucleotide," and "target polynucleotide" are used interchangeably, and non-limiting examples include polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides) or analogs thereof, which can be of various lengths. Non-limiting examples of nucleic acids include genes, gene fragments, exons, introns, intergenic DNA (non-limiting examples of which include heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, small interfering RNA (siRNA), non-coding RNA (ncRNA), cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from a sequence, RNA isolated from a sequence, nucleic acid probes, and primers. Prior to sequencing using the disclosed methods, the identity and / or sequence of the target nucleic acid may be known. Alternatively, the identity and / or sequence may be unknown. Prior to sequencing using the disclosed methods, a portion of the sequence of the target nucleic acid may be known. For example, this method can be applied to identify point mutations in a known target nucleic acid molecule.

[0203] The methods of the present disclosure directly sequence nucleic acid molecules obtained from a sample (e.g., a sample from an organism), and preferably there is no conversion (or amplification) step. As an example, in direct RNA-based sequencing, the methods of the present disclosure do not require the conversion of RNA molecules to DNA molecules (i.e., through cDNA synthesis) before the sequence can be obtained. Because no amplification or conversion is required, the nucleic acids sequenced in the present disclosure will retain any unique bases and / or epigenetic markers present in the nucleic acid when it is present in the sample or when it is obtained from the sample. Such unique bases and / or epigenetic markers are lost in sequencing methods known in the art.

[0204] The disclosed method allows sequencing at single molecule resolution, in other words, the disclosed method allows the user to generate a final sequence based on data collected from a single target nucleic acid molecule, without having to combine data from different target nucleic acid molecules, thus preserving all the unique characteristics of that particular target.

[0205] The target nucleic acid can be obtained from any sample or source of nucleic acid (e.g., any cell, tissue, organism, in vitro, chemical synthesizer, etc.). The target nucleic acid can be obtained by any method known in the art. The nucleic acid can be obtained from a blood sample of a clinical subject. The nucleic acid can be extracted, isolated, or purified from a source or sample using methods and kits well known in the art.

[0206] The target nucleic acid can be fragmented by any means known in the art. Fragmentation is preferably carried out by enzymatic or mechanical means. Mechanical means can include sonication or physical shearing. Enzymatic means can be carried out by digestion with a nuclease (e.g., deoxyribonuclease I (DNase I)) or one or more restriction endonucleases.

[0207] When the nucleic acid molecule comprising the target nucleic acid is a complete chromosome, steps must be taken to avoid fragmenting the chromosome.

[0208] As is well known in the art, target nucleic acids can contain natural or non-natural nucleotides, including modified nucleotides or nucleic acid analogs.

[0209] Target nucleic acid molecules can include DNA, RNA, or PNA molecules up to several hundred kilobases in length (e.g., 1 kilobase, 2 kilobases, 3 kilobases, 4 kilobases, 5 kilobases, 10 kilobases, 20 kilobases, 30 kilobases, 40 kilobases, 50 kilobases, 100 kilobases, 200 kilobases, 500 kilobases, or more). Target nucleic acid molecules can include from about 50 to about 400 nucleotides, or from about 90 to about 350 nucleotides.

[0210] Capture probe

[0211] The target nucleic acid molecules can be immobilized on the substrate (eg, at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more positions).

[0212] Representative examples of useful substrates include those containing a binding moiety, where the binding moiety is selected from the group consisting of ligands, antigens, carbohydrates, nucleic acids, receptors, lectins, and antibodies. Capture probes contain a substrate-binding moiety capable of binding to a binding moiety on the substrate. Non-limiting examples of useful substrates containing reactive moieties include surfaces containing epoxy, aldehyde, gold, hydrazide, sulfhydryl, NHS-ester, amine, alkyne, azide, thiol, carboxylate, maleimide, hydroxymethylphosphine, imidoester, isocyanate, hydroxyl, pentafluorophenyl-ester, psoralen, pyridyl disulfide or vinyl sulfone, polyethylene glycol (PEG), hydrogel, or mixtures thereof. Such surfaces can be obtained from commercial suppliers or prepared according to standard techniques. Non-limiting examples of useful representative substrates containing reactive moieties include OptArray-DNA NHS group (Accler), Nexterion Slide AL (Schott), and Nexterion Slide E (Schott).

[0213] The substrate can be any solid support known in the art that can immobilize a target nucleic acid (e.g., a coated slide, a microfluidic device). The substrate can be a surface, a membrane, a bead, a porous material, an electrode, or an array. The substrate can be, for example, a polymer material, a metal, silicon, glass, or quartz. The target nucleic acid can be immobilized on the surface of any substrate that is apparent to those skilled in the art.

[0214] When the substrate is an array, the substrate can include a plurality of wells. The size and spacing of the wells varies depending on the target nucleic acid molecules to be attached. In one example, the substrate is configured to attach target nucleic acids in an ultra-high density ordered array. Examples of the density of the array of target nucleic acids on the substrate include densities of 1 mm 2 500,000 to 10,000,000 target nucleic acid molecules per mm 2 1,000,000 to 4,000,000 target nucleic acid molecules per mm2 The number of target nucleic acid molecules per sample is 850,000 to 3,500,000.

[0215] The wells in the substrate are the locations where target nucleic acid molecules are attached. The surface of the wells can be functionalized with the reactive moieties described above to attract, immobilize, and bind target nucleic acid molecules by attracting and binding specific chemical groups present on the surface of the target nucleic acid molecules or on the surface of capture probes bound to the target nucleic acid molecules. It is well known that these functional groups can specifically attract and bind biomolecules through a variety of conjugation chemistries.

[0216] To sequence a single nucleic acid molecule on a substrate (such as an array), a universal capture probe, or a universal sequence complementary to the substrate-binding portion of the capture probe, is attached to each well. Sequencing can then begin once a single target nucleic acid molecule is bound to the universal capture probe, or to the universal sequence complementary to the substrate-binding portion of the capture probe and bound to the capture probe.

[0217] To sequence a single nucleic acid molecule on a substrate (such as an array), a single target nucleic acid molecule can be attached to a capture probe. The substrate-binding portion of the capture probe can then be attached to an adapter oligonucleotide. The adapter oligonucleotide can then be attached to a lawn oligonucleotide attached to each well, and sequencing can begin. Representative sequences for lawn oligonucleotides are shown in Table 8.

[0218] [Table 4] [ka]

[0219] Each nucleic acid contained in a loan or adaptor oligonucleotide can independently be a normal base, a modified nucleotide, or a nucleic acid analog. Exemplary modified nucleotides or nucleic acid analogs useful in a loan or adaptor oligonucleotide are isoguanine and isocytosine. Alternatively, each nucleic acid contained in a loan oligonucleotide can independently be L-DNA. In some embodiments, a lawn oligonucleotide can comprise L-DNA. A lawn oligonucleotide can consist of L-DNA. A lawn oligonucleotide can consist primarily of L-DNA. The use of modified nucleotides or nucleotide analogs (e.g., isoguanine, isocytosine, L-DNA) can, for example, improve the efficiency and accuracy of binding of an adaptor oligonucleotide to the appropriate complementary nucleic acid sequence within the loan oligonucleotide while minimizing binding elsewhere.

[0220] The loan oligonucleotide further comprises a 5' amine with a six carbon linker (referred to herein as 5AmMC6). 5AmMC6 can be used to attach the loan oligonucleotide to a substrate.

[0221] An example of a complex of a capture probe, adapter oligonucleotide, and loan oligonucleotide is shown in Figure 33. In this figure, the sequence of a representative adapter and a representative capture probe that hybridize to a target nucleic acid (in this example, the gene TP53.1) are in green, the sequence that is the reverse complement of a representative loan oligo is in blue, and the representative sequence on the capture probe that hybridizes to the target nucleic acid is in red. The sequence of a representative capture probe is 3'-CCGGTCAACCGTTTTGTAGAACAACTCCCGTCCCCTCACTCACTAGCCTCCAGTACCGAAAGC-5' (SEQ ID NO: 111). The sequence of a representative adapter is 5'-GAGTGATCGGAG GTCATGGCTTTCGAC / iMe-isodC / CTA / iMe-isodC / AAA / iMe-isodC / TCA / iMe-isodC / TA / iMe-isodC / TA / iMe-isodC / CAA / iMe-isodC / AAC / iMe-isodC / TCA / iMe-isodC / CA-3' (SEQ ID NO: 110). The sequence of a representative loan oligonucleotide is TG / iisodG / GAT / iisodG / TTT / iisodG / AGT / iisodG / AT / iisodG / AT / iisodG / GTT / iisodG / TTG / iisodG / AGT / iisodG / GT / 5AmMC6 (SEQ ID NO: 108).

[0222] In some embodiments, a loan oligonucleotide can contain at least one affinity moiety, or at least two affinity moieties, or at least three affinity moieties, or at least four affinity moieties, or at least five affinity moieties, or at least six affinity moieties, or at least seven affinity moieties, or at least eight affinity moieties, or at least nine affinity moieties, or at least ten affinity moieties. The affinity moiety can be biotin. Thus, a loan oligonucleotide can contain at least one biotin moiety, or at least two biotin moieties, or at least three biotin moieties, or at least four biotin moieties, or at least five biotin moieties, or at least six biotin moieties, or at least seven biotin moieties, or at least eight biotin moieties, or at least nine biotin moieties, or at least ten biotin moieties.

[0223] In some embodiments, a capture probe of the present disclosure that hybridizes to a target nucleic acid can include at least one affinity moiety, a non-limiting example of which is a biotin moiety. The capture probe that hybridizes to the target nucleic acid can then hybridize, directly or indirectly, to at least one loan oligonucleotide on a substrate. The at least one loan oligonucleotide includes at least one affinity moiety, a non-limiting example of which is a biotin moiety. After the capture probe hybridizes to the loan oligonucleotide, the resulting capture probe-target nucleic acid-loan oligonucleotide complex can be incubated with a second affinity moiety, which can bind to the first affinity moiety located on the capture probe and the first affinity moiety located on the loan oligonucleotide. In one non-limiting example, when both the first affinity moiety located on the capture probe and the first affinity moiety located on the loan oligonucleotide are biotin, neutravidin can be used as the second affinity moiety. This second affinity moiety binds to the first affinity moiety located on the capture probe and the first affinity moiety located on the lawn oligonucleotide, creating a protein bridge referred to herein as a "protein lock." The protein lock can be used to more stably immobilize target nucleic acids on a substrate. Figure 67 shows a schematic diagram of a protein lock using a biotinylated capture probe, lawn oligonucleotide, and neutravidin.

[0224] One or more capture probes (i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more capture probes) can be bound to the target nucleic acid. The capture probe includes a domain complementary to a portion of the target nucleic acid and a domain including a substrate-binding moiety. The portion of the target nucleic acid complementary to the capture probe can be at or near one end of the target nucleic acid. The capture probe can include a cleavable portion between the domain complementary to a portion of the target nucleic acid and the domain including the substrate-binding moiety.

[0225] Alternatively, the capture probe can include a first domain complementary to a portion of the target nucleic acid, a second domain including a substrate-binding moiety, and a third domain including a different substrate-binding moiety. The capture probe can include a cleavable moiety between any of the domains.

[0226] The capture probe can be phosphorylated at the 5' end. Alternatively, the capture probe can include at least one phosphorothioate bond. The capture probe can include at least two phosphorothioate bonds. Preferably, these at least two phosphorothioate bonds are located at the 5' end of the capture probe.

[0227] The substrate-binding moiety of the capture probe can be biotin, and the substrate can be avidin (e.g., streptavidin). Useful avidin-containing substrates are commercially available, including TB0200 (Accelr8), SAD6, SAD20, SAD100, SAD500, and SAD2000 (Xantec), SuperAvidin (Array-It), Streptavidin Slide (Cat. No. MPC 000, Xenopore), and STREPTAVIDIN Slide (Cat. No. 439003, Greiner Bio-one). The substrate-binding moiety of the capture probe can be avidin (e.g., streptavidin), and the substrate can be biotin. Non-limiting examples of commercially available useful substrates containing biotin include Optiarray-Biotin (Accler), BD6, BD20, BD100, BD500, BD2000 (Xantec).

[0228] The substrate-binding portion of the capture probe can be a reactive moiety that can be bound to the substrate by photoactivation. The substrate can include a photoactivatable moiety, or the first portion of the nanoreporter can include a photoactivatable moiety. Some examples of photoactivatable moieties include aryl azides (e.g., 4-azido-2,3,5,6-tetrafluorobenzoic acid); benzophenone-based reagents (e.g., 4-benzoylbenzoic acid succinimidyl ester); and 5-bromo-deoxyuridine.

[0229] The substrate binding portion of the capture probe can be a nucleic acid capable of hybridizing to a complementary binding portion of the substrate. Each nucleic acid contained in the substrate binding portion of the capture probe can independently be a normal base, a modified nucleotide, or a nucleic acid analog. At least one, at least two, at least three, at least four, at least five, or at least six nucleotides in the substrate binding portion of the capture probe can be modified nucleotides or nucleic acid analogs. The typical ratio of modified nucleotides or nucleotide analogs to normal bases in the substrate binding portion of the capture probe is 1:2 to 1:8. Typical modified nucleotides or nucleotide analogs useful in the substrate binding portion of the capture probe are isoguanine and isocytosine.

[0230] The substrate-binding portion of the capture probe can be immobilized on the substrate via other binding pairs apparent to those skilled in the art. After binding to the substrate, the target nucleic acid can be elongated by applying a force sufficient to elongate the target nucleic acid (e.g., gravity, hydrodynamic force, electromagnetic force "electrostretching", flow-stretching, receding meniscus techniques, or a combination thereof). The capture probe can include or be associated with a labelable label (i.e., a reference spot).

[0231] A second capture probe can be bound to the target nucleic acid, the second capture probe comprising a domain complementary to a second portion of the target nucleic acid. The second portion of the target nucleic acid bound to the second capture probe is different from the first portion of the target nucleic acid bound to the first capture probe. This portion can be at or near one end of the target nucleic acid. The binding of the second capture probe can occur after the target nucleic acid is extended, during the extension, or to a target nucleic acid that has not been extended. The second capture probe can have the above-described binding.

[0232] A third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth capture probe can bind to a target nucleic acid, comprising a domain complementary to a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth portion of the target nucleic acid. This portion can be at one end of the target nucleic acid or a non-terminal portion. Binding of the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth capture probe can occur after extension of the target nucleic acid, during extension, or to a target nucleic acid that has not been extended. The third capture probe, or the fourth capture probe, or the fifth capture probe, or the sixth capture probe, or the seventh capture probe, or the eighth capture probe, or the ninth capture probe, or the tenth capture probe can have a linkage as described above.

[0233] A capture probe can isolate a target nucleic acid from a sample. The capture probe is added to a sample containing the target nucleic acid. The capture probe binds to the target nucleic acid through a region of the capture probe that is complementary to a region of the target nucleic acid. When the target nucleic acid contacts a substrate that contains a portion that binds to the substrate-binding portion of the capture probe, the nucleic acid is immobilized on the surface of the substrate.

[0234] Figure 8 illustrates the capture of a target nucleic acid using a two-capture probe system according to the present disclosure. Genomic DNA is denatured at 95°C and hybridized to a pool of capture reagents. This pool of capture reagents contains oligonucleotides: Probe A, Probe B, and an antisense block probe. Probe A contains a biotin moiety at its 3' end and a sequence complementary to the 5' end of the target nucleic acid. Probe B contains a purification binding sequence that can be bound to the 5' end of the probe by paramagnetic beads and a nucleotide sequence complementary to the 3' end of the target nucleic acid. The antisense block probe contains a nucleotide sequence complementary to the antisense strand of the portion of the target nucleic acid to be sequenced. After hybridization to the capture reagents, a sequencing window is created on the target nucleic acid between the hybridized probes A and B. The target nucleic acid is purified using paramagnetic beads that bind to the 5' sequence of Probe B. Any excess capture reagent or complementary antisense DNA strand is washed away, resulting in the purified target nucleic acid. The purified target nucleic acid is then passed through a flow cell containing a surface capable of binding to a biotin moiety (e.g., streptavidin) on hybridized probe A, resulting in one end of the target nucleic acid being attached to the surface of the flow cell. To capture the other end, the target nucleic acid is flow-stretched and a biotinylated probe complementary to the purified binding sequence of probe B is added. The biotinylated probe is capable of binding to the surface of the flow cell upon hybridization to the purified binding sequence of probe B, resulting in a captured target nucleic acid that is elongated and attached at both ends to the surface of the flow cell.

[0235] To ensure that users "capture" as many target nucleic acid molecules as possible from a highly fragmented sample, it is useful to include multiple capture probes, each complementary to a different region of the target nucleic acid. For example, there could be three pools of capture probes: one pool complementary to a region near the 5' end of the target nucleic acid, a second pool complementary to a central region of the target nucleic acid, and a third pool complementary to a region near the 3' end of the target nucleic acid. This can be generalized to "n regions of interest" per target nucleic acid. In this example, each pool of fragmented target nucleic acid binds to a capture probe containing or bound to a biotin tag. 1 / n of the input sample (where n is the number of distinct regions in the target nucleic acid) is isolated for each pool chamber. The capture probes bind to the target nucleic acids of interest. The target nucleic acids are then immobilized via the biotin on the capture probes to avidin molecules attached to a substrate. Optionally, the target nucleic acids are elongated, for example, via hydrodynamic or electrostatic forces. All n pools can be extended and bound simultaneously, or to maximize the number of fully extended molecules, pool 1 (capturing the 5'-most region) can be extended and bound first, followed by pool 2 (capturing the central region of the target), and finally pool 3.

[0236] A target nucleic acid can be captured using the disclosed "bead-based two-step purification" system. Four capture probes are present: Probe A, Probe B, Probe C, and Probe D. Probe A contains an OA sequence, which is a nucleic acid sequence complementary to the 5' end of the target nucleic acid, and a nucleic acid sequence attached to a biotin moiety. The OA sequence can contain the nucleotide sequence CGAAAGCCATGACCTCCGATCACTC (SEQ ID NO: 109) and can be bound to a loan oligonucleotide. The nucleic acid sequence attached to the biotin moiety is connected to the nucleic acid sequence complementary to the 5' end of the target nucleic acid via a cleavable linker. Probes B and C contain a nucleic acid sequence complementary to the target nucleic acid and a nucleic acid sequence attached to a biotin moiety. The nucleic acid sequence attached to the biotin moiety is connected to the nucleic acid sequence complementary to the target nucleic acid via a cleavable linker. Probe D contains a nucleic acid sequence complementary to the 3' end of the target nucleic acid (a purification binding sequence designated as the G sequence) and a biotin moiety. The biotin moiety is connected to the G sequence via a cleavable linker. The four capture probes described above are first hybridized to the target nucleic acid. All probes hybridize to non-overlapping positions along the target nucleic acid, with probes B and C hybridizing between probes A and D. The target nucleic acid is then purified using streptavidin paramagnetic beads bound to biotin moieties on the capture probes. Excess non-target genomic DNA is washed away from the beads. The target nucleic acid-capture probe complexes are then released from the streptavidin magnetic beads by cleavage of the cleavable linker within each capture probe. The target nucleic acid-capture probe complexes are further purified using paramagnetic beads bound to the purification G sequence on probe D. Excess capture probes are washed away, and the target nucleic acid-capture probe complexes are eluted from the paramagnetic beads.

[0237] Target nucleic acids can be captured using the disclosed "bead-based one-step purification using lambda exonuclease" system. Four capture probes, namely, Probe A, Probe B, Probe C, and Probe D, are present. Probe A contains a sequence complementary to the 5' end of the target nucleic acid. The 5' end of Probe A contains two phosphorothioate linkages. Probes B, C, and D contain a nucleic acid sequence attached to a biotin moiety at their 3' end and a nucleic acid sequence complementary to the target nucleic acid at their 5' end. The 5' ends of Probes B, C, and D are phosphorylated. Probes A, B, C, and D hybridize to non-overlapping positions along the target nucleic acid. After the probes hybridize to the target nucleic acid, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess gDNA and capture probes are washed away. The target nucleic acid-capture probe complex is eluted from the beads. Thereafter, probes B, C, and D are digested with λ exonuclease, which selectively degrades double-stranded DNA phosphorylated at the 5' end.

[0238] Target nucleic acids can be captured using the disclosed "one-step bead-based purification using FEN1" system. Four capture probes are available: Probe A, Probe B, Probe C, and Probe D. Probe A contains a 3' nucleic acid sequence that does not hybridize to the target nucleic acid, a nucleic acid sequence complementary to the 5' end of the nucleic acid sequence, and a 5' nucleic acid sequence containing a biotin moiety that does not hybridize to the target nucleic acid. Probes B and C contain a 3' nucleic acid sequence that does not hybridize to the target nucleic acid, a nucleic acid sequence complementary to the nucleic acid sequence, and a 5' nucleic acid sequence containing a biotin moiety that does not hybridize to the target nucleic acid. Probe D contains a 3' sequence that does not hybridize to the target nucleic acid and a 5' sequence complementary to the target nucleic acid. When probes A, B, C, and D hybridize to a target nucleic acid, probe A is adjacent to probe B, and the 5' nucleic acid sequence on probe A that contains a biotin moiety and does not hybridize to the target nucleic acid sequence and the 3' nucleic acid sequence on probe B that does not hybridize to the target nucleic acid form a branched double-stranded DNA substrate with a 5' DNA flap. When probe B is adjacent to probe C, the 5' nucleic acid sequence on probe B that contains a biotin moiety and does not hybridize to the target nucleic acid sequence and the 3' nucleic acid sequence on probe C that does not hybridize to the target nucleic acid form a branched double-stranded DNA substrate with a 5' DNA flap. When probe C is adjacent to probe D, the 5' nucleic acid sequence on probe C that contains a biotin moiety and does not hybridize to the target nucleic acid sequence and the 3' nucleic acid sequence on probe D that does not hybridize to the target nucleic acid form a branched double-stranded DNA substrate with a 5' DNA flap. After the probes hybridize to the target nucleic acid sequence, the target nucleic acid is purified using streptavidin paramagnetic beads. Excess genomic DNA and excess probe are washed off the beads. The target nucleic acid is eluted from the beads by incubation with thermostable flap endonuclease 1 (FEN1). FEN1 cleaves the 5' DNA flap, thereby separating the biotin moiety from the hybridized capture probe and releasing the target nucleic acid-capture probe complex.

[0239] The present disclosure also allows users to capture and simultaneously sequence multiple target nucleic acids, by hybridizing multiple capture probes to a sample containing a mixture of multiple target nucleic acids. The multiple target nucleic acids can include a group of two or more nucleic acids, each containing the same sequence, or a group of two or more nucleic acids, each containing different sequences. Similarly, the multiple capture probes can include a group of two or more capture probes with the same sequence, or a group of two or more capture probes with different sequences. For example, using multiple capture probes that all contain the same sequence, users can capture multiple target nucleic acids, each containing the same sequence. Sequencing these multiple target nucleic acids containing the same sequence can achieve a high level of sequencing accuracy due to data redundancy. In another example, a group of capture probes, each containing a capture probe complementary to each gene of interest, can be used to capture and simultaneously sequence two or more specific genes of interest. This allows users to perform multiplexed sequencing of specific genes. FIG. 9 shows results from an experiment using the disclosed methods to capture and detect a multi-cancer panel of 100 targets using FFPE samples.

[0240] The capture probe can also include a domain that binds (hybridizes) to a "multiplexing oligo." The multiplexing oligo can include at least three domains. The first domain can include a nucleic acid sequence that hybridizes to the capture probe. The second domain can include a unique nucleic acid sequence that identifies the sample. The third domain can include a substrate binding moiety. Multiple multiplexing oligos can be used in combination with the capture probes of the present disclosure to simultaneously sequence multiple target nucleic acids from at least two samples. Multiplexing oligos can be used to sequence multiple target nucleic acids from at least three samples, or at least four samples, or at least five samples, or at least six samples, or at least seven samples, or at least eight samples, or at least nine samples, or at least ten samples, or at least 100 samples, or at least 1000 samples.

[0241] An example of simultaneously sequencing three target nucleic acid molecules from three samples using multiplexed oligos is as follows: target nucleic acids from each of three samples (sample 1, sample 2, and sample 3) are hybridized to two capture probes (probe A and probe B). Probe A contains two domains: the first domain contains a substrate-binding moiety; and the second domain contains a sequence complementary to the 5' end of the target nucleic acid. Probe B contains two domains: the first domain contains a sequence complementary to the 3' end of the target nucleic acid; and the second domain contains a sequence complementary to the multiplexed oligo. After these two capture probes are hybridized to the target nucleic acids, the second domain of probe B is hybridized to the multiplexed oligo. The multiplexed oligo contains three domains: the first domain contains a sequence complementary to the second domain of probe B; the second domain contains a unique nucleic acid sequence that identifies the sample; and the third domain contains a substrate-binding moiety. After hybridization of the multiplexed oligos, a cleavage step using an endonuclease is performed to remove any overhanging DNA on the target nucleic acid, so that probe A hybridizes to the 5' end of the target nucleic acid and probe B hybridizes to the 3' end of the target nucleic acid. After endonuclease treatment, the multiplexed oligo is ligated to the 3' end of the target nucleic acid, and then probe B is removed. The target nucleic acid-probe A complex is further purified and then sequenced. Because each target nucleic acid from each sample is ligated to a multiplexed oligo, the sample from which the target nucleic acid originated can be identified by sequencing the multiplexed oligo.

[0242] If full-range sequencing is desired, the number of independent capture probes required will be inversely related to the size of the target nucleic acid fragments. In other words, more capture probes will be required for highly fragmented target nucleic acids. For sample types containing highly fragmented and degraded target nucleic acids (e.g., formalin-fixed, paraffin-embedded tissues), it may be useful to include multiple pools of capture probes. Conversely, for samples containing long target nucleic acid fragments (e.g., isolated nucleic acids obtained in vitro), a single capture probe at the 5' end may be sufficient.

[0243] The region of a target nucleic acid between two capture probes, or the region after one capture probe and before the end of the target nucleic acid, is referred to herein as a "sequencing window." Figure 8 shows the labeled sequencing window that results when two capture probes are used to capture a single target nucleic acid. The sequencing window is the portion of the target nucleic acid available for binding to a sequencing probe. The minimum sequencing window is the length of the target binding domain (e.g., 4-10 nucleotides), and the maximum sequencing window is the majority of an entire chromosome.

[0244] When sequencing large target nucleic acid molecules using the methods of the present disclosure, a single "blocker oligo" or multiple blocker oligos can be hybridized along the length of the target nucleic acid to control the size of the sequencing window. Blocker oligos hybridize to specific positions on the target nucleic acid, thereby preventing sequencing probes from binding to these positions and creating a smaller sequencing window of interest. Creating a smaller sequencing window limits the sequencing reaction to specific regions of interest on the target DNA molecule, thereby increasing the speed and accuracy of sequencing. The use of blocker oligos is particularly useful when sequencing specific mutations at known positions within the target nucleic acid, since it is not necessary to sequence the entire target nucleic acid. In one non-limiting example, the methods of the present disclosure can be used to target two heterozygous sites for sequencing to distinguish between two different haplotypes.

[0245] The capture probe can comprise a nucleic acid molecule complex. The nucleic acid molecule complex can comprise a partially double-stranded nucleic acid molecule. In some embodiments, the partially double-stranded nucleic acid molecule can comprise a target-specific domain, a double-stranded domain, a single-stranded purification sequence, a cleavable portion, a single-stranded overhang domain, a sample-specific domain, a substrate-specific domain, or any combination thereof.

[0246] In some embodiments, any one strand of a partially double-stranded nucleic acid molecule can contain about 40 to 150 nucleotides, or about 60 to 135 nucleotides, or about 10 to 90 nucleotides, or about 25 to 75 nucleotides, or about 60 nucleotides, or about 50 to 100 nucleotides.

[0247] In some embodiments, any one strand of the partially double-stranded nucleic acid molecule can comprise at least 1 affinity moiety, or at least 2 affinity moieties, or at least 3 affinity moieties, or at least 4 affinity moieties, or at least 5 affinity moieties, or at least 6 affinity moieties, or at least 7 affinity moieties, or at least 8 affinity moieties, or at least 9 affinity moieties, or at least 10 affinity moieties.

[0248] In some embodiments, any one strand of a partially double-stranded nucleic acid molecule can include at least one cross-linking moiety, which can be a chemical cross-linking moiety or a photoactivatable cross-linking moiety.

[0249] The capture probe can comprise a single-stranded nucleic acid molecule, hi some embodiments, the single-stranded nucleic acid molecule can comprise a target-specific domain, a double-stranded domain, a single-stranded purification sequence, a cleavable portion, a single-stranded overhang domain, a sample-specific domain, a substrate-specific domain, or any combination thereof.

[0250] The target-specific domain, double-stranded domain, single-stranded purification sequence, cleavable portion, single-stranded overhang domain, sample-specific domain, and substrate-specific domain can comprise at least one natural base or no natural bases. In some embodiments, the target-specific domain, double-stranded domain, single-stranded purification sequence, cleavable portion, single-stranded overhang domain, sample-specific domain, and substrate-specific domain can comprise at least one modified nucleotide or nucleic acid analog or no modified nucleotides.

[0251] The target-specific domain, double-stranded domain, single-stranded purification sequence, cleavable portion, single-stranded overhang domain, sample-specific domain, and substrate-specific domain can comprise any combination of natural bases (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more natural bases) and modified nucleotides or nucleic acid analogs (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more modified nucleotides or nucleic acid analogs). When present in combination, the natural bases and modified nucleotides or nucleic acid analogs can be arranged in any order.

[0252] The target-specific domain can comprise a nucleic acid sequence that is complementary to a portion of a target nucleic acid molecule and hybridizes to the target nucleic acid molecule. In some embodiments, the target-specific domain can comprise about 10 to about 150 nucleotides, or about 25 to about 100 nucleotides, or about 35 to about 100 nucleotides, or about 25 to about 125 nucleotides, or about 15 to about 100 nucleotides.

[0253] In some embodiments, the target specific domain can hybridize within at least about 100 base pairs of the 3' end of the target nucleic acid molecule. In some embodiments, the target specific domain can hybridize within at least about 100 base pairs of the 5' end of the target nucleic acid molecule.

[0254] A double-stranded domain can comprise a nucleic acid sequence that can anneal to another nucleic acid strand to form a partially or completely double-stranded nucleic acid molecule. In some embodiments, the double-stranded domain can comprise about 14 to about 45 nucleotides, or about 25 to about 35 nucleotides, or about 30 nucleotides, or about 10 to about 60 nucleotides, or about 30 to about 50 nucleotides.

[0255] The single-stranded purification sequence can comprise a nucleic acid sequence suitable for use in purification. The single-stranded purification sequence can comprise an F-tag. The single-stranded purification sequence can comprise an F-like tag. The single-stranded purification sequence can comprise the nucleotide sequence AACATCACACAGACC (SEQ ID NO: 112). The single-stranded purification sequence can comprise the nucleotide sequence GTCTATCATCACAGC (SEQ ID NO: 113).

[0256] The single-stranded purification sequence can comprise at least one affinity moiety, or at least two affinity moieties, or at least three affinity moieties, or at least four affinity moieties, or at least five affinity moieties, or at least six affinity moieties, or at least seven affinity moieties, or at least eight affinity moieties, or at least nine affinity moieties, or at least ten affinity moieties. The affinity moiety can be biotin. Thus, in some embodiments, the single-stranded purification sequence can comprise at least one biotin moiety, or at least two biotin moieties, or at least three biotin moieties, or at least four biotin moieties, or at least five biotin moieties, or at least six biotin moieties, or at least seven biotin moieties, or at least eight biotin moieties, or at least nine biotin moieties, or at least ten biotin moieties.

[0257] The single-stranded purification sequence can comprise at least 50 nucleotides, or from about 15 to about 50 nucleotides.

[0258] The cleavable moiety may comprise an enzymatically cleavable moiety, an enzymatically cleavable moiety may comprise a USER sequence for cleavage by a USER enzyme, or the cleavable moiety may comprise a photocleavable moiety.

[0259] The single-stranded overhang domain can comprise a single-stranded nucleic acid sequence that can combine with a target nucleic acid molecule to form a 5' overhang flap structure.

[0260] The sample-specific domain can comprise a nucleic acid sequence that identifies the biological sample from which the target nucleic acid molecule was derived. The sample-specific domain can comprise L-DNA. The sample-specific domain can comprise D-DNA. The sample-specific domain can comprise a combination of L-DNA and D-DNA. The sample-specific domain can hybridize to any of the probes disclosed herein. The sample-specific domain can comprise approximately 28 nucleotides.

[0261] In some embodiments, the sample-specific domain can comprise at least one attachment position, or at least two attachment positions. In embodiments where the sample-specific domain comprises at least one attachment position, or at least two attachment positions, the attachment positions can comprise about 14, or about 10, or about 8 nucleotides.

[0262] The substrate-specific domain can include a nucleic acid sequence that hybridizes to a complementary nucleic acid molecule attached to a substrate. The substrate can be an array. The substrate-specific domain can include a nucleic acid sequence that hybridizes to a lawn oligonucleotide.

[0263] The substrate-specific domain can comprise a poly-A sequence. The substrate-specific domain can comprise a poly-T sequence. The substrate-specific domain can comprise an L-poly-A sequence, and the nucleotides of the poly-A sequence are L-DNA. The substrate-specific domain can comprise an L-poly-T sequence, and the nucleotides of the poly-T sequence are L-DNA. The substrate-specific domain can comprise L-DNA. The substrate-specific domain can comprise approximately 30 nucleotides.

[0264] Figure 34 shows a schematic diagram of an exemplary capture probe, designated a "c5 probe complex," containing a nucleic acid molecule complex that binds to a target nucleic acid. The c5 probe complex includes a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule includes a target-specific domain that hybridizes to the target nucleic acid, a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a first single-stranded purification sequence, and a cleavable portion located between the target-specific domain and the double-stranded domain. In this non-limiting example, the single-stranded purification sequence includes an F-like tag, and the cleavable portion includes an enzymatically cleavable USER sequence. The other strand of the partially double-stranded nucleic acid molecule includes a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule and a single-stranded overhang domain. In this non-limiting example, the single-stranded overhang domain and the target nucleic acid molecule form a 5' overhang flap structure.

[0265] Figure 34 also shows a schematic diagram of an exemplary capture probe, designated a "c3 probe complex," that contains a nucleic acid molecule complex that binds to a target nucleic acid. The c3 probe complex includes a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule includes a target-specific domain that hybridizes to the target nucleic acid, a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, and a cleavable moiety located between the target-specific domain and the double-stranded domain. In this non-limiting example, the cleavable moiety includes an enzymatically cleavable USER sequence. The other strand of the partially double-stranded nucleic acid molecule includes a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, a substrate-specific domain, a single-stranded purification sequence, and a cleavable moiety located between the single-stranded purification sequence and the substrate-specific domain. In this non-limiting example, the sample-specific domain includes L-DNA, the substrate-specific domain includes L-DNA, the single-stranded purification sequence includes an F-tag, and the cleavable moiety includes a photocleavable moiety.

[0266] Figure 41 shows a schematic diagram of an exemplary capture probe, designated a "c3.2 probe complex," comprising a nucleic acid molecule complex that binds to a target nucleic acid. The c3.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes to the target nucleic acid and a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule. In some embodiments, the strand optionally comprises at least one first affinity moiety. In some embodiments, the strand optionally comprises a cleavable moiety located between the target-specific domain and the double-stranded domain. The other strand of the partially double-stranded nucleic acid molecule comprises a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule and a substrate-specific domain. In some embodiments, the strand optionally comprises at least one, at least two, or at least three second affinity moieties.

[0267] Figure 41 also shows a schematic diagram of an exemplary capture probe, designated a "c5.2 probe complex," comprising a nucleic acid molecule complex that binds to a target nucleic acid. The c5.2 probe complex comprises a partially double-stranded nucleic acid molecule. One strand of the partially double-stranded nucleic acid molecule comprises a target-specific domain that hybridizes to the target nucleic acid and a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule. In some embodiments, the strand optionally comprises a cleavable moiety located between the target-specific domain and the double-stranded domain. The other strand of the partially double-stranded nucleic acid molecule comprises a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, a first single-stranded purification sequence, a first cleavable moiety located between the double-stranded domain and the sample-specific domain, and a second cleavable moiety located between the sample-specific domain and the first single-stranded purification sequence. In some embodiments, the first single-stranded purification sequence comprises at least one affinity moiety, e.g., at least one biotin moiety. In some embodiments, the first single-stranded purification sequence can be replaced with at least one biotin moiety, such that the other strand of the partially double-stranded nucleic acid molecule comprises a double-stranded domain that anneals to the other strand of the partially double-stranded nucleic acid molecule, a sample-specific domain, at least one biotin moiety, a first cleavable moiety located between the double-stranded domain and the sample-specific domain, and a second cleavable moiety located between the sample-specific domain and the at least one biotin moiety.

[0268] Sample Preparation Methods of the Present Disclosure

[0269] The present disclosure provides a sample preparation method that includes immobilizing a target nucleic acid molecule on a substrate.

[0270] The sample preparation methods of the invention can include a CRISPR-based fragmentation step (see, e.g., Baker and Mueller, "CRISPR-Mediated Isolation of Specific Megabase Segments of Genomic DNA," Nucleic Acids Research 2017, vol. 45(19), p. e165; Tsai et al., "Amplification-Free CRISPR-Cas9 Enrichment and SMRT Sequencing of Genomic Regions Causing Repeat Expansion Diseases," bioRxiv 203919; doi: https: / / doi.org / 10.1101 / 203919; Nachmanson et al., "CRISPR / Cas9-Based Targeted Genomic Fragmentation Improves Hybridization Capture of Small Targets, Reduces PCR Bias, and Enables Efficient High-Fidelity Sequencing," bioRxiv 207027; doi: https: / / doi.org / 10.1101 / 207027). CRISPR-based fragmentation can be used in vitro to fragment genomic DNA (gDNA) from a biological sample by cleaving it proximal to a protospacer adjacent motif (PAM) site located within the gDNA. The PAM site can contain the nucleotide sequence NGG (where N is any nucleobase). Alternatively, the PAM site can contain the nucleotide sequence NGA (where N is any nucleobase). Fragments generated by CRISPR-based fragmentation can be purified using biotinylated CRISPR complexes or anti-CAS9 antibodies.

[0271] The method for capturing a target nucleic acid includes: (1) fragmenting gDNA using a CRISPR-based fragmentation process; (2) contacting the fragmented gDNA with at least two capture probes, at least one of which is the c5 probe complex described above, and at least one of which is the c3 probe complex described above, wherein the c3 probe complex and the c5 probe complex hybridize to the target nucleic acid to form the complex shown in FIG. 34; (3) contacting the complex with FEN1 to remove the 5' overhang flap structure; and (4) contacting the 3' of the target nucleic acid with FEN1. (5) binding the single-stranded purification sequence of the c5 probe complex to a first substrate; (6) cleaving the cleavable portion located between the double-stranded domain and the target-specific domain of each of the c3 probe complex and the c5 probe complex; (7) binding the single-stranded purification sequence of the c3 probe complex to a second substrate; (8) cleaving the cleavable portion located between the single-stranded purification sequence and the substrate-specific domain of the linked c3 probe complex; and (9) hybridizing the substrate-specific domain to a complementary nucleic acid molecule attached to a third substrate.

[0272] In some embodiments of the above method, step (9) can be performed before step (8).

[0273] In some embodiments of the above method, steps (3) and (4) can be performed together. In some embodiments of the above method, steps (3) and (4) can be performed simultaneously.

[0274] In some embodiments, the above methods can optionally include a step in steps (6) and (7) in which target nucleic acid-capture probe complexes from different biological samples are pooled together. In this embodiment, target nucleic acid-capture probe complexes from different biological samples will contain c3 probe complexes that contain unique sample-specific domains, such that the target-specific domains identify the biological sample from which each captured target nucleic acid originated.

[0275] An example of a sample preparation method of the present disclosure is shown in Figures 34-40. In this non-limiting example, gDNA obtained from a biological sample is first fragmented using CRISPR-based fragmentation. After fragmentation, the target nucleic acid hybridizes to two capture probes, as shown in Figure 34. In this non-limiting example, the two capture probes are the c3 probe complex and the c5 probe complex described above. The c3 probe complex and the c5 probe complex hybridize to the target nucleic acid at non-overlapping positions along the target nucleic acid. The c3 probe complex hybridizes to the target nucleic acid via its target-specific domain within 8 nucleotides from the 3' end of the target nucleic acid, and the c5 probe complex hybridizes to the target nucleic acid via its target-specific domain, resulting in the c5 probe complex hybridizing to the 5' side of the c3 probe complex. The single-stranded overhang domain of the c5 probe complex and the target nucleic acid molecule form a 5' overhang flap structure. After these two capture probes hybridize, the target nucleic acid-capture probe complex is incubated with FEN1 and ligase. As shown in Figure 35, FEN1 removes the 5' overhang flap structure, and the ligase joins the 3' end of the target nucleic acid to the strand of the c3 probe complex containing the substrate-specific domain. The resulting complex, shown in Figure 36, binds to F-like beads that hybridize to the F-like tag present in the c5 probe complex. The beads are washed, and USER enzyme is added. As shown in Figure 37, the USER enzyme cleaves the cleavable moiety located between the target-specific domain and the double-stranded domain of both the c3 and c5 probe complexes, thereby releasing the target nucleic acid from the F-like beads. As shown in Figure 38, the eluted complex is further purified using SPRI beads. The purified complex then binds to F-beads that hybridize to the F-tag present in the c3 probe complex. After washing, the target nucleic acid is eluted from the F-beads by exposing the F-beads to UV light to cleave the photocleavable moiety located between the substrate-specific domain and the F-tag in the c3 probe complex, as shown in Figure 39.The resulting complex is then bound to a substrate by hybridizing the substrate-specific domain of the ligated c3 probe complex to a complementary nucleic acid attached to the substrate, as shown in Figure 40.

[0276] Another example of a sample preparation method of the present disclosure is shown in Figures 41-46. In this non-limiting example, gDNA obtained from a biological sample is first fragmented using CRISPR-based fragmentation. After fragmentation, the target nucleic acid is hybridized to two capture probes, as shown in Figure 41. In this non-limiting example, the two capture probes are the c3.2 probe complex and the c5.2 probe complex described above. The c3.2 probe complex and the c5.2 probe complex hybridize to the target nucleic acid at non-overlapping positions along the target nucleic acid. The c5.2 probe complex hybridizes to the target nucleic acid via the target-specific domain, resulting in the c5.2 probe complex hybridizing to the 5' side of the c3.2 probe complex. After these two capture probes hybridize, the target nucleic acid is ligated to one strand of the c3.2 probe complex and one strand of the c5.2 probe complex, as shown in Figure 42. Ligation can include enzymatic ligation, self-ligation, chemical ligation, or any combination thereof. In embodiments involving enzymatic ligation, enzymatic ligation can be performed using a high-fidelity template-dependent nick ligase. The resulting complex, shown in Figure 42, can then be bound to beads containing at least one oligonucleotide hybridized to the single-stranded purification sequence. As shown in Figure 43, the beads can be washed and the target nucleic acid can be released from the beads by cleaving the cleavable moiety located between the sample-specific domain and the single-stranded purification sequence. The resulting complex can then be immobilized on the surface of a substrate by hybridizing the substrate-specific domain to an oligonucleotide attached to the substrate, as shown in Figure 44. The substrate / oligonucleotide complex can be any array of the present disclosure.

[0277] The method can further include hybridizing at least one reporter probe comprising a first detectable label and a second detectable label to the sample-specific domain, where the first and second detectable labels can then be identified to identify the sample from which the target nucleic acid originated based on the identity of the first and second detectable labels.

[0278] Alternatively, the method can further include hybridizing a first reporter probe comprising a first detectable label and a second detectable label to the sample-specific domain. The first detectable label and the second detectable label can then be identified. The first detectable label and the second detectable label can then be removed, and a second reporter probe comprising a third detectable label and a fourth detectable label can then be hybridized to the sample-specific domain. The third detectable label and the fourth detectable label can then be identified, thereby identifying the sample from which the target nucleic acid originated based on the attributes of the first detectable label, the second detectable label, the third detectable label, and the fourth detectable label.

[0279] After identifying the sample from which the target nucleic acid originates, the sample-specific domain can be released by cleaving the cleavable portion located between the sample-specific domain and the double-stranded domain, as shown in Figure 45.

[0280] Methods of the present disclosure

[0281] The sequencing methods of the present disclosure involve reversibly hybridizing at least one sequencing probe disclosed herein to a target nucleic acid.

[0282] A method for sequencing a nucleic acid can include (1) hybridizing a sequencing probe described herein to a target nucleic acid. The target nucleic acid can optionally be immobilized at one or more locations on a substrate. Exemplary sequencing probes can include a target binding domain and a barcode domain; the target binding domain can include any of the constructs listed in Table 1. A typical target binding domain comprises at least eight nucleotides that hybridize to a target nucleic acid, wherein at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., these six nucleotides identify six nucleotides complementary to the target molecule to which the target binding domain hybridizes) and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule (e.g., these at least two nucleotides do not identify two nucleotides complementary to the target molecule to which the target binding domain hybridizes); any of the at least six nucleotides in the target binding domain can be a modified nucleotide or a nucleotide analog; and the at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four regular, universal, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain. A typical barcode domain comprises a synthetic backbone and includes at least three attachment positions, each of which comprises at least one attachment region comprising at least one nucleic acid sequence to which a complementary nucleic acid molecule can bind, each of the at least three attachment positions corresponding to two of the at least six nucleotides in the target binding domain, each of the at least three attachment positions having a different nucleic acid sequence, and the nucleic acid sequence at each of the at least three attachment positions determining the position and identity of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0283] In another embodiment, a representative target binding domain can include at least six nucleotides that hybridize to a target nucleic acid, and these at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., when the target binding domain sequence is exactly six nucleotides, these six nucleotides identify six nucleotides complementary to the hybridizing target molecule); none of these at least six nucleotides in the target binding domain can be modified nucleotides or nucleic acid analogs, or any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleic acid analogs.

[0284] The method includes hybridizing a sequencing probe to the target nucleic acid, followed by (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first of the at least three attachment positions of the barcode domain; (3) detecting the first detectable label and the at least second detectable label of the bound first complementary nucleic acid molecule; and (4) identifying the positions and identities of at least two nucleotides in the immobilized target nucleic acid. For example, when the first complementary nucleic acid molecule comprises two detectable labels, the two detectable labels identify the at least two nucleotides in the immobilized nucleic acid molecule.

[0285] After detecting the at least two detectable labels, the at least two detectable labels are removed from the first complementary nucleic acid molecule. Thus, the method further includes (5) freeing the first complementary nucleic acid molecule containing a detectable label by binding a first hybridizing nucleic acid molecule lacking a detectable label to the first attachment location, or contacting the first complementary nucleic acid molecule containing a detectable label with a force sufficient to release the first detectable label and at least a second detectable label. Thus, after step (5), no detectable label is bound to the first attachment location. The method further includes (6) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second of the at least three attachment locations of the barcode domain; (7) detecting the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (8) optionally identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (9) identifying a linear order of at least six nucleotides for at least a first region of the immobilized target nucleic acid hybridized to the target binding domain of the sequencing probe by repeating steps (5) through (8) until a complementary nucleic acid molecule comprising two detectable labels is bound to each of the at least three attachment locations in the barcode domain and the two detectable labels of the bound complementary nucleic acid molecule are detected; and (10) optionally removing the sequencing probe from the immobilized target nucleic acid.

[0286] The method further includes (11) hybridizing a second sequencing probe to a target nucleic acid, optionally immobilized at one or more locations on a substrate, where the target binding domains of the first sequencing probe and the second sequencing probe are different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first of the at least three attachment locations of the barcode domain; (13) detecting the first detectable label and at least a second detectable label of the bound first complementary nucleic acid molecule; (14) optionally identifying the location and identity of at least two nucleotides within the immobilized target nucleic acid; and (15) freeing the first complementary nucleic acid molecule or complex comprising the detectable label by binding a first hybridizing nucleic acid molecule lacking the detectable label to the first attachment location, or releasing the first detectable label and at least a second detectable label from the first complementary nucleic acid molecule or complex comprising the detectable label. (16) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second of the at least three attachment locations of the barcode domain; (17) detecting the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (18) optionally identifying the location and identity of at least two nucleotides within the immobilized target nucleic acid; (19) identifying a linear order of at least six nucleotides for at least a second region of the immobilized target nucleic acid hybridized to the target binding domain of the second sequencing probe by repeating steps (15) through (18) until a complementary nucleic acid molecule comprising two detectable labels binds to each of the at least three attachment locations within the barcode domain and the two detectable labels of the bound complementary nucleic acid molecule are detected; and (20) optionally removing the second sequencing probe from the immobilized target nucleic acid.

[0287] The method can further include identifying the sequence of the immobilized target nucleic acid by assembling the identified respective linear orders of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid.

[0288] Steps (5) and (6) can occur sequentially or simultaneously. The first detectable label and the at least second detectable label can have the same or different emission spectra. The third detectable label and the at least fourth detectable label can have the same or different emission spectra.

[0289] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. The cleavable linker is preferably cleavable by light. The emitting power can be light. UV light is preferred. The light can be provided by a light source selected from the group consisting of an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0290] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence as the portion of the first complementary nucleic acid molecule that binds to the first attachment position of the at least three attachment positions of the barcode domain. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the first attachment position in the barcode domain.

[0291] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the second attachment position in the barcode domain.

[0292] The present disclosure also provides a method for sequencing a nucleic acid, comprising: (1) hybridizing a sequencing probe described herein to a target nucleic acid. The target nucleic acid can optionally be immobilized at one or more locations on a substrate. Exemplary sequencing probes can include a target-binding domain and a barcode domain; the target-binding domain can include any of the constructs listed in Table 1. A typical target binding domain comprises at least eight nucleotides that hybridize to a target nucleic acid, wherein at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., these six nucleotides identify six nucleotides complementary to the hybridized target molecule) and at least two nucleotides in the target binding domain do not identify corresponding nucleotides in the target nucleic acid molecule (e.g., these at least two nucleotides do not identify two nucleotides complementary to the hybridized target molecule); any of the at least six nucleotides in the target binding domain can be modified nucleotides or nucleotide analogs, and the at least two nucleotides in the target binding domain that do not identify corresponding nucleotides in the target nucleic acid molecule can be any of four regular bases, universal bases, or degenerate bases that are not specific to the target specified by the at least six nucleotides in the target binding domain. A typical barcode domain comprises a synthetic backbone and includes at least three attachment positions, each of which comprises at least one attachment region comprising at least one nucleic acid sequence to which a complementary nucleic acid molecule can bind, each of the at least three attachment positions corresponding to two of the at least six nucleotides in the target binding domain, each of the at least three attachment positions having a different nucleic acid sequence, and the nucleic acid sequence at each of the at least three attachment positions determining the position and identity of the corresponding two of the at least six nucleotides in the target nucleic acid to which the target binding domain binds.

[0293] In another embodiment, a representative target binding domain can comprise at least six nucleotides that hybridize to a target nucleic acid, and these at least six nucleotides in the target binding domain can identify corresponding nucleotides in the target nucleic acid molecule (e.g., when the target binding domain sequence is exactly six nucleotides, these six nucleotides identify six nucleotides complementary to the hybridizing target molecule); none of the at least six nucleotides in the target binding domain can be a modified nucleotide or nucleotide analog, or any of the at least six nucleotides can be a modified nucleotide or nucleotide analog.

[0294] The method includes hybridizing a sequencing probe to the target nucleic acid, and then (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first of the at least three attachment positions of the barcode domain; and (3) detecting and recording the first detectable label and at least a second detectable label of the bound first complementary nucleic acid molecule.

[0295] After detecting and recording the at least two detectable labels, the at least two detectable labels are removed from the first complementary nucleic acid molecule. Thus, the method further includes (4) freeing the first complementary nucleic acid molecule containing the detectable label by binding to the first attachment location a first hybridizing nucleic acid molecule lacking a detectable label, or contacting the first complementary nucleic acid molecule containing the detectable label with a force sufficient to release the first detectable label and at least a second detectable label. Thus, after step (4), no detectable label is bound to the first attachment location. The method further includes (5) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second of the at least three attachment locations of the barcode domain; (6) detecting and recording the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until a complementary nucleic acid comprising two detectable labels is bound to each of the at least three attachment locations in the barcode domain, and the two detectable labels of the bound complementary nucleic acid molecule are detected and recorded; (8) using the detectable labels recorded in steps (3), (6), and (7) to identify the positions and identities of the at least six nucleotides of at least a first region of the immobilized target nucleic acid hybridized to the target binding domain of the sequencing probe; and (9) optionally removing the sequencing probe from the immobilized target nucleic acid.

[0296] The method further includes (10) hybridizing a second sequencing probe to a target nucleic acid immobilized on a substrate, optionally at one or more locations, where the target binding domains of the first sequencing probe and the second sequencing probe are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment location of the at least three attachment locations of the barcode domain; (12) detecting and recording the first detectable label and at least a second detectable label of the bound first complementary nucleic acid molecule; and (13) binding a first hybridizing nucleic acid molecule lacking a detectable label to the first attachment location, thereby freeing the first complementary nucleic acid molecule or complex comprising the detectable label, or freeing the first complementary nucleic acid molecule or complex comprising the detectable label and the first detectable label. (14) contacting the barcode domain with a force sufficient to release at least a second detectable label; (15) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second of the at least three attachment locations of the barcode domain; (16) detecting and recording the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (17) repeating steps (13) to (15) until a complementary nucleic acid molecule comprising two detectable labels is bound to each of the at least three attachment locations in the barcode domain, and the two detectable labels of the bound complementary nucleic acid molecule are detected and recorded; (18) using the detectable labels recorded in steps (12), (15), and (16) to sequence at least a third of the immobilized target nucleic acid to which the target binding domain of the second sequencing probe is hybridized. (18) identifying the location and identity of the at least six nucleotides of the second region; and (19) optionally removing the second sequencing probe from the immobilized target nucleic acid.

[0297] The method can further include identifying the sequence of the immobilized target nucleic acid by assembling the identified respective linear orders of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid.

[0298] Steps (4) and (5) can occur sequentially or simultaneously. The first detectable label and the at least second detectable label can have the same or different emission spectra. The third detectable label and the at least fourth detectable label can have the same or different emission spectra.

[0299] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. The cleavable linker is preferably cleavable by light. The emitting power can be light. UV light is preferred. The light can be provided by a light source selected from the group consisting of an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0300] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. For example, the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence as the portion of the first complementary nucleic acid molecule that binds to the first attachment position of the at least three attachment positions of the barcode domain. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the first attachment position in the barcode domain.

[0301] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the second attachment position in the barcode domain.

[0302] The above method may further include a medium suitable for recording the detectable label, which may be a suitable computer-readable medium.

[0303] The present disclosure further provides methods for sequencing nucleic acids using multiple sequencing probes disclosed herein, for example, a target nucleic acid is hybridized to two or more sequencing probes, each of which is capable of sequencing the portion of the nucleic acid to which it is hybridized.

[0304] The present disclosure provides a method for sequencing nucleic acids, comprising: (1) hybridizing at least one first population of first sequencing probes, the first population comprising a plurality of sequencing probes described herein, to a target nucleic acid, optionally immobilized at one or more locations on a substrate; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first of the at least three attachment locations of the barcode domain; (3) detecting the first detectable label and the at least a second detectable label of the bound first complementary nucleic acid molecule; (4) identifying the location and identity of at least two nucleotides within the immobilized target nucleic acid; and (5) binding a first hybridizing nucleic acid molecule lacking a detectable label to the first attachment location, thereby freeing the first complementary nucleic acid molecule comprising the detectable label, or releasing the first detectable label and the at least a second detectable label from the first complementary nucleic acid molecule comprising the detectable label. (6) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second of the at least three attachment locations of the barcode domain; (7) detecting the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (8) optionally identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (9) identifying the linear order of at least one nucleotide of the immobilized target nucleic acid to which the target binding domain of the sequencing probe is hybridized by repeating steps (5)-(8) until a complementary nucleic acid comprising two detectable labels is bound to each of the at least three attachment locations of the barcode domain and the two detectable labels of the bound complementary nucleic acid molecule are detected; and (10) optionally removing at least one first population of first sequencing probes from the immobilized target nucleic acid.

[0305] The method further includes (11) hybridizing at least one second population of second sequencing probes, the second population comprising a plurality of sequencing probes disclosed herein, to a target nucleic acid optionally immobilized at one or more locations on a substrate, with the target binding domains of the first and second sequencing probes being different; (12) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first attachment location of the at least three attachment locations of the barcode domain; and (13) binding the first detectable label and at least a second detectable label of the bound first complementary nucleic acid molecule to a first attachment location of the at least three attachment locations. (14) optionally identifying the location and identity of at least two nucleotides within the immobilized target nucleic acid; (15) freeing a first complementary nucleic acid molecule or complex containing a detectable label by binding a first hybridizing nucleic acid molecule lacking a detectable label to a first attachment location, or contacting the first complementary nucleic acid molecule or complex containing a detectable label with a force sufficient to release the first detectable label and at least a second detectable label; (16) attaching a second complementary nucleic acid molecule containing a third detectable label and at least a fourth detectable label to a second of the at least three attachment locations within the barcode domain. (17) detecting the third detectable label and at least a fourth detectable label of the bound second complementary nucleic acid molecule; (18) identifying the position and identity of at least two nucleotides in the immobilized target nucleic acid; (19) identifying a linear order of at least six nucleotides for at least one second region of the immobilized target nucleic acid to which the target binding domain of the sequencing probe hybridizes by repeating steps (15) to (18) until a complementary nucleic acid comprising two detectable labels is bound to each of the at least three attachment positions in the barcode domain and these two detectable labels of the bound complementary nucleic acid molecule are detected; and (20) optionally removing at least one second population of sequencing probes from the immobilized target nucleic acid.

[0306] The method can further include identifying the sequence of the immobilized target nucleic acid by assembling the identified respective linear orders of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid.

[0307] Steps (5) and (6) can occur sequentially or simultaneously. The first detectable label and the at least second detectable label can have the same or different emission spectra. The third detectable label and the at least fourth detectable label can have the same or different emission spectra.

[0308] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. The cleavable linker is preferably cleavable by light. The emitting power can be light. UV light is preferred. The light can be provided by a light source selected from the group consisting of an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0309] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the first attachment position in the barcode domain.

[0310] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the second attachment position in the barcode domain.

[0311] The present disclosure provides a method for sequencing nucleic acids, comprising: (1) hybridizing at least one first population of first sequencing probes, the first population comprising a plurality of sequencing probes described herein, to a target nucleic acid, optionally immobilized at one or more locations on a substrate; (2) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first of the at least three attachment locations within a barcode domain; (3) detecting and recording the first detectable label and at least a second detectable label of the bound first complementary nucleic acid molecule; (4) binding a first hybridizing nucleic acid molecule lacking a detectable label to the first attachment location, thereby freeing the first complementary nucleic acid molecule comprising the detectable label, or contacting the first complementary nucleic acid molecule comprising the detectable label with a force sufficient to release the first detectable label and at least one second detectable label; (5) binding a third detectable label and (6) detecting and recording the third detectable label and the at least fourth detectable label of the bound second complementary nucleic acid molecule; (7) repeating steps (4) to (6) until a complementary nucleic acid molecule comprising two detectable labels is bound to each of the at least three attachment locations in the barcode domain, and the two detectable labels of the bound complementary nucleic acid molecule are detected and recorded; (8) using the detectable labels recorded in steps (3), (6), and (7), identifying the positions and identities of the at least six nucleotides of the at least one first region of the immobilized target nucleic acid to which the target binding domain of the sequencing probe is hybridized; and (9) optionally removing the at least one first population of first sequencing probes from the immobilized target nucleic acid.

[0312] The method further includes (10) hybridizing at least one second population of second sequencing probes comprising a plurality of sequencing probes described herein to target nucleic acids optionally immobilized at one or more locations on a substrate, wherein the target binding domains of the first and second sequencing probes are different; (11) binding a first complementary nucleic acid molecule comprising a first detectable label and at least a second detectable label to a first of the at least three attachment locations of the barcode domain; (12) detecting and recording the first detectable label and the at least second detectable label of the bound first complementary nucleic acid molecule; and (13) hybridizing the first hybridizing nucleic acid molecule lacking a detectable label to a target nucleic acid optionally immobilized at one or more locations on a substrate. (14) binding a second complementary nucleic acid molecule comprising a third detectable label and at least a fourth detectable label to a second attachment site of the at least three attachment sites of the barcode domain; (15) detecting and recording the third detectable label and at least a fourth detectable label of the bound second complementary nucleic acid molecule; (16) binding a complementary nucleic acid molecule comprising two detectable labels to each attachment site of the at least three attachment sites in the barcode domain; Repeating steps (13) through (15) until the two detectable labels of the bound complementary nucleic acid molecules are detected and recorded; (17) using the detectable labels recorded in steps (12), (15), and (16) to identify the location and identity of the at least six nucleotides of the at least one second region of the immobilized target nucleic acid to which the target binding domain of the second sequencing probe hybridizes; and (18) optionally removing at least one second population of second sequencing probes from the immobilized target nucleic acid.

[0313] The method can further include identifying the sequence of the immobilized target nucleic acid by assembling the identified respective linear orders of nucleotides in at least the first region and at least the second region of the immobilized target nucleic acid.

[0314] Steps (4) and (5) can occur sequentially or simultaneously. The first detectable label and the at least second detectable label can have the same or different emission spectra. The third detectable label and the at least fourth detectable label can have the same or different emission spectra.

[0315] The first complementary nucleic acid molecule can comprise a cleavable linker. The second complementary nucleic acid molecule can comprise a cleavable linker. The first complementary nucleic acid molecule and the second complementary nucleic acid molecule can each comprise a cleavable linker. The cleavable linker is preferably cleavable by light. The emitting power can be light. UV light is preferred. The light can be provided by a light source selected from the group consisting of an arc lamp, a laser, a focused UV light source, and a light emitting diode.

[0316] The first complementary nucleic acid molecule and the first hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The first hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the first attachment position in the barcode domain.

[0317] The second complementary nucleic acid molecule and the second hybridizing nucleic acid molecule lacking a detectable label can comprise the same nucleic acid sequence. The second hybridizing nucleic acid molecule lacking a detectable label can comprise a nucleic acid sequence complementary to the single-stranded nucleotide adjacent to the second attachment position in the barcode domain.

[0318] The above method may further include a medium suitable for recording the detectable label, which may be a suitable computer-readable medium.

[0319] This sequencing method is further described herein.

[0320] Figure 10 shows a schematic diagram of one exemplary complete sequencing cycle of the present disclosure. While the disclosed methods do not require immobilization of the target nucleic acid prior to sequencing, in this example, the method begins with the target nucleic acid being captured using a capture probe and bound to the surface of a flow cell, as shown in the top left diagram. A pool of sequencing probes is then flowed into the flow cell, allowing the sequencing probes to hybridize to the target nucleic acid. In this example, the sequencing probes are those shown in Figure 1. These sequencing probes contain a hexamer sequence within the target binding domain that hybridizes to the target nucleic acid. The hexamer is flanked on each side by (N) bases. The (N) bases can be universal / degenerate bases or can be composed of any of the four canonical bases that are not specific to the target other than those specified by bases b1-b2-b3-b4-b5-b6. Utilizing a hexamer sequence allows for 4096 (4 6 ) allows for sequencing of any target nucleic acid. For this example, 4096 sets of sequencing probes hybridize to target nucleic acids in eight pools of 512 sequencing probes each. The hexamer sequences in the target binding domains of the sequencing probes will hybridize to positions along the length of the target nucleic acid where there is a perfect match of complementarity between the hexamer and the target nucleic acid, as shown in the upper center diagram of Figure 10. In this example, a single sequencing probe hybridizes to the target nucleic acid. Any unbound sequencing probes are washed out of the flow cell.

[0321] These sequencing probes also contain a barcode domain with three attachment positions R1, R2, and R3, as described above. The attachment region within attachment position R1 contains one or more nucleotide sequences corresponding to the first dinucleotide of the sequencing probe's hexamer. Therefore, only reporter probes containing a complementary nucleic acid corresponding to the attribute of the first dinucleotide present in the sequencing probe's target binding domain will hybridize to attachment position R1. Similarly, the attachment region within attachment position R2 of the sequencing probe corresponds to the second dinucleotide present in the target binding domain, and the attachment region within attachment position R3 of the sequencing probe corresponds to the third dinucleotide present in the target binding domain.

[0322] This method continues in the top right diagram of Figure 10. A pool of reporter probes is flowed into a flow cell. Each reporter probe in the pool contains a detectable label in the form of a two-color combination and a complementary nucleic acid that can hybridize to a corresponding attachment site in attachment site R1 of a sequencing probe. The two-color combination and complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides, as described above. Each pool of reporter probes is designed so that the two-color combination corresponding to a particular dinucleotide is established prior to sequencing. For example, in the sequencing experiment shown in Figure 10, for the first pool of reporter probes that hybridize to attachment site R1, the two-color combination yellow-red can correspond to the dinucleotide adenine-thymine. After the reporter probe hybridizes to attachment position R1 as shown in the upper right panel of Figure 10, any unbound reporter probe is washed away from the flow cell, and the detectable label of the bound reporter probe is recorded to reveal the identity of the first dinucleotide of the hexamer.

[0323] The detectable label belonging to the reporter probe hybridized to attachment position R1 is removed. To remove the detectable label, the reporter probe can be provided with a cleavable linker and an appropriate cleavage reagent can be added. Alternatively, a complementary nucleic acid lacking a detectable label can be hybridized to attachment position R1 of the sequencing probe, replacing it with a reporter probe bearing a detectable label. Regardless of the method used to remove the detectable label, attachment position R1 no longer generates a detectable signal. The method of rendering an attachment position of a barcode domain that previously generated a detectable signal no longer capable of generating a detectable signal is referred to herein as "darkening."

[0324] A second pool of reporter probes is flowed into the flow cell. Each reporter probe in the pool of reporter probes contains a detectable label in the form of a two-color combination and a complementary nucleic acid capable of hybridizing to a corresponding attachment region in attachment position R2 of the sequencing probe. The two-color combination and the complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. A particular two-color combination can correspond to one dinucleotide in the context of the first pool of reporter probes and to a different dinucleotide in the context of the second pool of reporter probes. As shown in the bottom right diagram of Figure 10, after the reporter probes hybridize to attachment position R2, any unbound reporter probes are washed out of the flow cell, and the detectable labels of the bound reporter probes are recorded to reveal the identity of the second dinucleotide of the hexamer present in the sequencing probe.

[0325] To remove the detectable label at position R2, the reporter probe can include a cleavable linker and additionally include an appropriate cleavage reagent. Alternatively, a complementary nucleic acid lacking the detectable label can be hybridized to attachment position R2 of the sequencing probe, replacing it with a reporter probe bearing a detectable label. Regardless of the method for removing the detectable label, attachment position R2 no longer generates a detectable signal.

[0326] A third pool of reporter probes is then flowed into the flow cell. Each reporter probe in the third pool of reporter probes contains a detectable label in the form of a two-color combination and a complementary nucleic acid capable of hybridizing to a corresponding attachment region in attachment position R3 of the sequencing probe. The two-color combination and complementary nucleic acid of a particular reporter probe correspond to one of 16 possible dinucleotides. After the reporter probe hybridizes to position R3, as shown in the lower center diagram of Figure 10, any unbound reporter probes are washed out of the flow cell, and the detectable labels of the bound reporter probes are recorded to reveal the identity of the third dinucleotide of the hexamer present in the sequencing probe. In this way, all three dinucleotides of the target binding domain are identified and can be assembled together to reveal the sequence of the target binding domain and, therefore, the sequence of the target nucleic acid.

[0327] To continue sequencing the target nucleic acid, any bound sequencing probe can be removed from the target nucleic acid. The sequencing probe can be removed from the target nucleic acid even if the reporter probe remains hybridized to position R3 of the barcode domain. Alternatively, the reporter probe hybridized to position R3 can be removed from the barcode domain prior to removing the sequencing probe from the target binding domain, e.g., using the darkening procedure described above for reporters at positions R1 and R2.

[0328] The sequencing cycle shown in Figure 10 can be repeated any number of times, with each sequencing cycle beginning with hybridizing the same pool of sequencing probes to the target nucleic acid molecule or beginning with hybridizing a different pool of sequencing probes to the target nucleic acid molecule. A first sequencing probe, or a second pool of sequencing probes, can bind to the target nucleic acid at a position that overlaps with the position at which the first pool of sequencing probes bound to the target nucleic acid during the first sequencing cycle. In this way, some nucleotides in the target nucleic acid can be sequenced more than once, and more than one sequencing probe can be used.

[0329] Figure 11 shows a schematic diagram of one complete cycle of the disclosed sequencing method and the corresponding imaging data collected during this cycle. In this example, the sequencing probe used is the one shown in Figure 1, and the sequencing process is the same as that shown in Figure 10 and described above. After the sequencing domain of the sequencing probe hybridizes to the target nucleic acid, a reporter probe is hybridized to the first attachment position (R1) of the sequencing probe. An image of the first reporter probe is then acquired to record a color dot. In Figure 11, the color dot is represented by a dotted circle. A color dot corresponds to a single sequencing probe recorded during one complete cycle. In this example, seven sequencing probes are recorded (1-7). The first attachment position of the barcode domain is then darkened, and a dual-fluorescent reporter probe is hybridized to the second attachment position (R2) of the sequencing probe. Next, an image of the second reporter probe is acquired and a color dot is recorded. The second attachment site of the barcode domain is then darkened, and a dual-fluorescent reporter probe is hybridized to the third attachment site (R3) of the sequencing probe. Next, an image of the third reporter probe is acquired and a color dot is recorded. The three color dots from each of sequencing probes 1-7 are then ordered. A decoding matrix is ​​then used to map each color dot to a specific dinucleotide to determine the sequence of the target binding domain of sequencing probes 1-7.

[0330] The number of pools of reporter probes required to determine the sequence of the target binding domain of any sequencing probe bound to the target nucleic acid during one sequencing cycle is equal to the number of attachment positions in the barcode domain, so a barcode domain with three positions would cycle three reporter probes on the sequencing probe.

[0331] A pool of sequencing probes can contain multiple sequencing probes that all have the same sequence, or multiple sequencing probes that do not all have the same sequence. When a pool of sequencing probes contains multiple sequencing probes that do not all have the same sequence, there can be equal numbers of each different sequencing probe, or there can be different numbers of different sequencing probes.

[0332] Figure 12 shows an example of a pool of sequencing probes according to the present disclosure, where the sequencing probes contain (a) a target-binding domain containing six nucleotides (a hexamer) that specifically binds to a target nucleic acid, and (b) three attachment positions (R1, R2, and R3) within the barcode domain. Therefore, eight different pools of sequencing probes are designed using the eight color combinations specified above. There are 4,096 possible hexamer sequences (4 x 4 x 4 x 4 x 4 = 4,096). Because each of the three attachment positions within the barcode domain can hybridize to a complementary nucleic acid bound with one of eight different color combinations, there are 512 possible sets of three color combinations (8 x 8 x 8 = 512). For example, for a probe in which R1 hybridizes to a complementary nucleic acid bound to the color combination GG, R2 hybridizes to a complementary nucleic acid bound to the color combination BG, and R3 hybridizes to a complementary nucleic acid bound to the color combination YR, the set of three color combinations is GG-BG-YR. Within a pool of sequencing probes, each different set of three color combinations would correspond to a different hexamer in the target-binding domain. Since each pool contains 512 different hexamers, for a total of 4096 possible hexamers, eight pools are required to sequence all possible hexamers (4096 / 512=8). The specific sequencing probes in each of the eight pools are determined to optimally hybridize each sequencing probe to the target nucleic acid. Several precautions must be taken to ensure optimal hybridization. These considerations include: (a) separating the full complement of hexamers into different pools; (b) separating hexamers with high and low Tm into different pools; and (c) separating hexamers into different pools based on empirically learned hybridization patterns.

[0333] Figure 13 illustrates the differences between the sequencing probes described in U.S. Patent Application Publication No. 20160194701 and the sequencing probes of the present disclosure. As shown in the left diagram of Figure 13, U.S. Patent Application Publication No. 2016 / 0194701 describes a sequencing probe with a barcode domain containing six attachment positions that hybridize to complementary nucleic acids. Each complementary nucleic acid binds to one of four different fluorescent dyes. In this configuration, each color (red, blue, green, yellow) corresponds to one nucleotide (A, T, C, G) in the target binding domain. By designing the probes in this manner, 4096 different probes (4 6 ) is generated. As shown in the right diagram of Figure 13, in one example of the present disclosure, the barcode domain of each sequencing probe contains three attachment positions that hybridize to complementary nucleic acids. Unlike U.S. Patent Application Publication No. 2016 / 0194701, these complementary nucleic acids are bound by one of eight color combinations (GG, RR, GY, RY, YY, RG, BB, RB). Each color combination corresponds to a specific dinucleotide in the target binding domain. In this configuration, 512 (8 3 ) different probes. To cover all possible hexamer combinations (4096) within a target nucleic acid domain, eight separate pools of these 512 different probes are required to sequence an entire target nucleic acid. Because eight color combinations are used to label complementary nucleic acids and there are 16 possible dinucleotides, some color combinations will correspond to different dinucleotides depending on which pool of sequencing probes is used. For example, in Figure 13, in the first, second, third, and fourth pools of sequencing probes, the color combination BB corresponds to the dinucleotide AA, and the color combination GG corresponds to the dinucleotide AT. In the fifth, sixth, seventh, and eighth pools of sequencing probes, the color combination BB corresponds to the dinucleotide CA, and the color combination CT corresponds to the dinucleotide AT.

[0334] Multiple sequencing probes (i.e., two or more sequencing probes) can be hybridized within a sequencing window. During sequencing, the identity and spatial location of the detectable label attached to each of the hybridized sequencing probes is recorded. This allows both the location and identity of multiple dinucleotides to be subsequently identified. In other words, by simultaneously hybridizing multiple sequencing probes to a single target nucleic acid molecule, multiple locations along the target nucleic acid can be sequenced simultaneously, thereby increasing the speed of sequencing.

[0335] In some embodiments, a single sequencing probe can be hybridized to a single captured target nucleic acid. In some embodiments, multiple sequencing probes can be hybridized to a single captured target nucleic acid. The sequencing window between two hybridized 5' and 3' capture probes allows a single sequencing probe or multiple sequencing probes to hybridize along the length of the target nucleic acid molecule. Hybridizing multiple sequencing probes along the length of the target nucleic acid molecule allows for simultaneous sequencing of two or more locations on the target nucleic acid molecule, thereby increasing the speed of sequencing. The fluorescent signals from individual probes of multiple probes bound along the length of the target nucleic acid can be spatially separated.

[0336] In some embodiments, the sequencing probes can be evenly spaced along the length of the target nucleic acid. In some embodiments, the sequencing probes do not need to be evenly spaced along the length of the target nucleic acid. By spatially separating signals from multiple sequencing probes bound along the length of the target nucleic acid, sequencing information can be obtained simultaneously at multiple locations on the target nucleic acid.

[0337] The distribution of probes along the length of the target nucleic acid is crucial for the resolution of the detectable signal. Having too many probes in one region can result in overlapping detectable labels, preventing the separation of two closely spaced probes. This can be explained as follows: Because a single nucleotide is 0.34 nm long and the lateral (xy) spatial resolution of a sequencing instrument is approximately 200 nm, the resolution limit of the sequencing instrument is approximately 588 base pairs (i.e., 1 nucleotide / 0.34 nm × 200 nm). Therefore, if two probes are located within approximately 588 base pairs of each other, the sequencing instrument would not be able to separate the signals from two probes hybridized to the target nucleic acid. Therefore, depending on the resolution of the sequencing instrument, the two probes would need to be separated by approximately 600 base pairs to allow the detectable labels to be separated as separate "spots." Therefore, optimal spacing should be one probe for every 600 bp of target nucleic acid. Preferably, each sequencing probe in a probe population is bound no closer than 600 nucleotides to each other. Various software approaches (e.g., using fluorescence intensity values ​​and wavelength-dependent ratios) can be used to monitor, limit, and potentially analyze the number of probes hybridizing to a single separable region of the target nucleic acid, allowing the probe population to be designed accordingly. Furthermore, detectable labels (e.g., fluorescent labels) that provide more distinct signals can be selected. Furthermore, methods described in the literature (Small and Parthasarthy, "Super-Resolution Localization," Annu. Rev. Phys Chem., 2014; 65:107-125) include structured illumination and various super-resolution approaches that reduce the resolution limit of sequencing microscopes to a few tens of nanometers. Higher resolution sequencing devices allow the use of probes with shorter target-binding domains.

[0338] As mentioned above, the Tm of the probe can affect the number of probes that hybridize to the target nucleic acid. Alternatively, or in addition, the concentration of sequencing probes in a population can be increased to increase the coverage of the probes in a specific region of the target nucleic acid. For example, to exceed the resolution limit of the sequencing instrument, the concentration of sequencing probes can be decreased to decrease the coverage of the probes in a specific region of the target nucleic acid.

[0339] Although the resolution limit for two detectable labels is approximately 600 nucleotides, this does not impede the robust sequencing methods of the present disclosure. In some embodiments, multiple sequencing probes in a given population will not be 600 nucleotides apart on a target nucleic acid. However, statistically (following a Poisson distribution), there will be target nucleic acids bound to only one sequencing probe, and therefore the sequencing probes can be optically separated. For target nucleic acids with multiple probes within 600 nucleotides (and therefore not optically separable), data related to these inseparable sequencing probes can be discarded. Importantly, the methods of the present disclosure provide multiple rounds of binding and detection of multiple sequencing probes. Thus, it is possible to detect signal from all sequencing probes in some rounds, signal from only a subset of the sequencing probes in some rounds, and signal from none of the sequencing probes in some rounds. In some embodiments, the distribution of the sequencing probes bound to the target nucleic acids can be controlled (e.g., by controlling concentration or dilution) so that only one sequencing probe binds to one target nucleic acid.

[0340] Randomly, but depending in part on the length of the target binding domain, the Tm of the probe, and the concentration of the probe applied, two distinct sequencing probes in a population may bind within 600 nucleotides of each other.

[0341] Alternatively, or in addition, the concentration of sequencing probes in a population can be reduced to reduce the coverage of the probes in a particular region of the target nucleic acid, for example to exceed the resolution limit of the sequencing instrument, thereby generating a single readout from a resolution-limited spot.

[0342] If the sequence, or a portion of the sequence, of a target nucleic acid is known prior to sequencing the target nucleic acid using the methods of the present disclosure, sequencing probes can be designed and selected such that no two sequencing probes bind to the target nucleic acid within 600 nucleotides of each other.

[0343] Prior to hybridizing the sequencing probe to the target nucleic acid, one or more complementary nucleic acid molecules can be conjugated with a first detectable label, and at least a second detectable label can be hybridized to one or more attachment positions within the barcode domain of the sequencing probe. For example, prior to hybridization to the target nucleic acid, one or more complementary nucleic acid molecules conjugated with a first detectable label and at least a second detectable label can be hybridized to the first attachment position of each sequencing probe. Thus, upon contact with the target nucleic acid, the sequencing probe can generate a detectable signal from the first attachment position, eliminating the need for a first pool of complementary nucleic acids or reporter probes directed to the first position on the barcode domain. In another example, one or more complementary nucleic acid molecules conjugated with a first detectable label and at least a second detectable label can be hybridized to all attachment positions within the barcode domain of the sequencing probe. Thus, in this example, a sequence of six nucleotides can be read without the need to sequentially exchange complementary nucleic acids. The use of this prehybridized sequencing probe-reporter probe complex would eliminate many steps in the described method, thereby reducing the time to obtain sequence information. However, this probe would be beneficial if the detectable labels were non-overlapping. For example, fluorophores are excited by non-overlapping wavelengths of light, or the fluorophores emit light at non-overlapping wavelengths.

[0344] In some embodiments of the disclosed methods, the signal intensities from the recorded color dots can be used to accurately sequence the target nucleic acid. In some embodiments, the spot intensities of specific colors within a color dot can be used to determine the probability that a specific color dot corresponds to a color combination that is a single color overlap (i.e., BB, GG, YY, RR).

[0345] Darkening of a location within a barcode domain can be achieved by cleaving the strand at the cleavable linker modification present in the reporter probe hybridized to that location. Figure 14 illustrates the use of a cleavable linker modification to darken a barcode location during a single sequencing cycle. The first step, shown in the leftmost diagram in Figure 14, involves hybridizing the primary nucleic acid of the reporter probe to the first attachment location of the sequencing probe. The primary nucleic acid hybridizes to a specific complementary sequence within the attachment region of the first location of the barcode domain. The first and second domains of the primary nucleic acid are covalently linked by the cleavable linker modification. In the second step, the detectable label is recorded to determine the identity and location of a specific dinucleotide within the target binding domain of the sequencing probe. In the third step, the first location of the barcode domain is darkened by cleaving the reporter probe at the cleavable linker modification, thereby releasing the second domain of the primary nucleic acid and, thereby, the detectable label. Because the first domain of the primary nucleic acid molecule now remains hybridized to the first attachment position of the barcode domain, completely devoid of any detectable label, the first position of the barcode domain no longer generates a detectable signal and will not be able to hybridize to any other reporter probe in subsequent sequencing steps. In the final step, shown in the right-most diagram in Figure 14, a reporter probe hybridizes to the second position of the barcode domain and sequencing continues.

[0346] The attachment position of the barcode domain can be darkened by displacing any secondary or tertiary nucleic acid in the reporter probe that is bound to a detectable label, while leaving the primary nucleic acid of the reporter probe hybridized to the sequencing probe. This substitution can be achieved by hybridizing a secondary or tertiary nucleic acid without a detectable label to the primary nucleic acid. Figure 15 shows an example of a representative sequencing cycle of the present disclosure, in which one position in the barcode domain is darkened by displacing a secondary nucleic acid bearing a label. The leftmost diagram in Figure 15 shows the start of the sequencing cycle, with the primary nucleic acid molecule of the reporter probe hybridized to the first attachment position of the barcode domain of the sequencing probe. Next, a secondary nucleic acid molecule bound to a detectable label hybridizes to the primary nucleic acid molecule, and the detectable label is recorded. To darken the first position of the barcode domain, the secondary nucleic acid molecule bound to a detectable label is replaced with a secondary nucleic acid molecule lacking a detectable label. In the next step of the sequencing cycle, a reporter probe containing a detectable label is hybridized to a second position of the barcode domain. The attachment positions of the barcode domain can be darkened by hybridizing a nucleic acid without a detectable label to the sequencing probe at the corresponding attachment position of the barcode domain, thereby displacing any primary nucleic acid molecule of the reporter probe. When the barcode domain contains at least one single-stranded nucleic acid sequence adjacent to or adjacent to at least one attachment position, the nucleic acid without a detectable label can displace the primary nucleic acid molecule by hybridizing to its flanking sequence and the portion of the barcode domain occupied by the primary nucleic acid molecule. If necessary, the exchange rate of the detectable label can be increased by incorporating small single-stranded oligonucleotides that increase the exchange rate of the detectable label (e.g., "toe-hold" probes; see, e.g., Seeling et al., "Catalyzed Relaxation of Metastable DNA Fuels"; J. Am. Chem. Soc. 2006, 128(37), 12211-12220).

[0347] The complementary nucleic acid containing the detectable label, i.e., the reporter probe, can be removed from the attachment region but cannot be replaced with a hybridizing nucleic acid lacking the detectable label. This can be achieved, for example, by adding a chaotropic agent, increasing the temperature, changing the salt concentration, adjusting the pH, and / or applying hydrodynamic forces. In these instances, fewer reagents (i.e., hybridizing nucleic acids lacking the detectable label) are required.

[0348] The methods of the present disclosure can be used to simultaneously capture and sequence RNA molecules and DNA molecules (including mRNA and gDNA) from the same sample. Capture and sequencing of both RNA molecules and DNA molecules from the same sample can be performed in the same flow cell. In some embodiments, the methods of the present disclosure can be used to simultaneously capture, detect, and sequence both gDNA and mRNA from FFPE samples.

[0349] The disclosed sequencing method further includes identifying the sequence of the immobilized target nucleic acid by assembling the linear order of each identified nucleotide for each region of the immobilized target nucleic acid, thereby optionally identifying a sequence for the immobilized target nucleic acid. The assembling step utilizes a non-transitory computer-readable storage medium having an executable program stored thereon. The program instructs a microprocessor to assemble the linear order of each identified nucleotide for each region of the target nucleic acid, thereby obtaining the sequence of the nucleic acid. The assembling operation can be performed in "real time," i.e., while data is being collected from the sequencing probe, rather than after all data has been collected or after complete data acquisition.

[0350] The raw specificity of the disclosed sequencing method is approximately 94%. The accuracy of the disclosed sequencing method can be increased to nearly 99% by using two or more sequencing probes to sequence the same base in a target nucleic acid. Figure 16 illustrates how the disclosed sequencing method enables sequencing of the same base in a target nucleic acid using different sequencing probes. The target nucleic acid in this example is a fragment of NRAS exon 2 (SEQ ID NO: 1). The specific base of interest is a cytosine (C) highlighted in the target nucleic acid. This base of interest will hybridize to two sequencing probes with different hybridization footprints to the target nucleic acid. In this example, sequencing probes 1-4 (barcodes 1-4) bind three nucleotides to the left of the base of interest, while sequencing probes 5-8 (barcodes 5-8) bind five nucleotides to the left of the base of interest. The target base is then sequenced by two different probes, increasing the amount of base reads at that particular position, thereby increasing the overall accuracy at that particular position. Figure 17 shows how multiple different base reads at a particular nucleotide position on the target nucleotide are recorded from one or more sequencing probes and then combined to create a consensus sequence (SEQ ID NO: 2), thereby improving the accuracy of the final base read.

[0351] The terms "Hyb & Seq chemistry," "Hyb & Seq sequencing," and "Hyb & Seq" refer to the methods of the present disclosure described above.

[0352] Arrays of the present disclosure and methods of using the arrays

[0353] As described in detail herein, the present disclosure provides compositions and methods for immobilizing nucleic acid molecules, including arrays and methods that utilize the arrays.

[0354] The present disclosure provides a composition comprising: a flat solid support substrate; a first layer on the flat solid support substrate; and a second layer on the first layer; the second layer comprising a plurality of nanowells, each nanowell providing access to an exposed portion of the first layer, and each nanowell comprising a plurality of first oligonucleotides bound to the exposed portion of the first layer.

[0355] The present disclosure provides a composition comprising: a flat solid support; a first layer on the flat solid support and in contact with a first surface of the flat solid support; and a second layer on the first layer and in contact with a second surface of the first layer; the second surface of the first layer is not in contact with the surface of the flat solid support, the second layer comprising a plurality of nanowells, each nanowell providing access to an exposed portion of the first layer, and each nanowell comprising a plurality of first oligonucleotides bound to the exposed portion of the first layer.

[0356] The first layer can include a first surface in contact with the surface of the flat solid support substrate and a second surface in contact with the second layer but not in contact with the surface of the flat solid support substrate.

[0357] The second layer can include a first surface in contact with the surface of the first layer and a second surface exposed to the environment.

[0358] Figure 47 is a cross-sectional schematic diagram of a representative array of the present invention. The array includes a flat solid support substrate 101, a first layer 102 on the flat solid support substrate 101, and a second layer 103 on the first layer 102. The second layer 103 includes a plurality of nanowells 104. Each nanowell 104 is open on two sides, so that a portion 105 of the first layer is exposed within each nanowell. A plurality of first oligonucleotides 106 are covalently bound to the exposed first layer 105 within each nanowell.

[0359] In some embodiments, the flat solid support substrate can be a surface, a membrane, a bead, a porous material, or an electrode. Non-limiting examples of flat solid support substrates include, for example, polymeric materials, metals, silicon, glass, and quartz.

[0360] In some embodiments, the first layer 102 can include an oxide film, a non-limiting example of which is silicon dioxide.

[0361] In some embodiments, the first layer 102 can have a thickness of about 50 to about 150 nm. The first layer 102 can have a thickness of about 90 nm.

[0362] In some embodiments, the second layer 103 can include, by way of non-limiting example, bis(trimethylsilyl)amine (also known as hexamethyldisilazane (HMDS or HDMS)).

[0363] In some embodiments, the second layer 103 can include a material that is chemically unreactive so that the second layer does not bind to biopolymers.

[0364] In some embodiments, the second layer 103 can have a thickness of about 1 nm to about 10 nm. The second layer 103 can have a thickness of about 3 nm to about 4 nm.

[0365] In some embodiments, the flat solid support substrate comprises silicon, the first layer comprises silicon dioxide, and the second layer comprises HMDS.

[0366] In some embodiments, the flat solid support substrate comprises glass, the first layer comprises silicon dioxide, and the second layer comprises HMDS.

[0367] In some embodiments, the second layer has a density of about 0.1 x 10 per square millimeter. 5 ~About 100×10 7 The second layer may contain about 0.1 x 10 nanowells per square millimeter. 6~About 100×10 6 The second layer can contain about 1 x 10 nanowells per square millimeter. 6 ~About 10×10 6 The second layer can contain approximately 2 x 10 nanowells per square millimeter. 6 ~Approx. 5×10 6 The second layer can contain approximately 3 x 10 nanowells per square millimeter. 6 The nanowells may include nanowells.

[0368] As used herein, "nanowell density" refers to the number of nanowells present within a specific surface area. For example, if the surface area is 1.0 mm 2 is 1.0 × 10 6 The second layer containing nanowells has a nanowell density of 1.0 × 10 6 nanowells / mm 2 It is said that...

[0369] In some embodiments, the density of the nanowells is about 0.1 x 10 5 and approximately 100 x 10 7 nanowells / mm 2 The density of the nanowells can be between approximately 0.1 x 10 6 and approximately 100 x 10 6 nanowells / mm 2 The density of the nanowells can be betwe...

Claims

1. 1. A method for identifying the presence of a target nucleic acid, comprising: (1) hybridizing a target binding domain of a first probe to a first region of a target nucleic acid, the probe comprising a target binding domain and a barcode domain; the target binding domain is at least 12 nucleotides in length; the barcode domain is made of L-DNA, the barcode domain comprises at least three attachment sites, each attachment site comprises at least one attachment region comprising at least one nucleic acid sequence that hybridizes to a complementary nucleic acid molecule, each of the at least three attachment positions has a different nucleic acid sequence; and each attachment position of said barcode domain is 6 to 20 nucleotides in length; (2) hybridizing a first complementary nucleic acid molecule comprising at least one first detectable label and at least one second detectable label to a first attachment position of the at least three attachment positions of the barcode domain; (3) identifying the at least one first detectable label and the at least one second detectable label of the first complementary nucleic acid molecule hybridized to the first attachment location; (4) removing the at least one first detectable label and the at least one second detectable label hybridized to the first attachment location; (5) hybridizing a second complementary nucleic acid molecule comprising at least one third detectable label and at least one fourth detectable label to a second of the at least three attachment positions of the barcode domain; (6) identifying the at least one third detectable label and the at least one fourth detectable label of the second complementary nucleic acid molecule hybridized to the second attachment location; (7) removing the at least one third detectable label and the at least one fourth detectable label hybridized to the second attachment location; (8) hybridizing a third complementary nucleic acid molecule comprising at least one fifth detectable label and at least one sixth detectable label to a third attachment position of the at least three attachment positions of the barcode domain; and (9) identifying the at least one fifth detectable label and the at least one sixth detectable label of the third complementary nucleic acid molecule hybridized to the third attachment location, thereby determining the presence of the target nucleic acid based on the attributes of the at least one first detectable label, the at least one second detectable label, the at least one third detectable label, the at least one fourth detectable label, the at least one fifth detectable label, and the at least one sixth detectable label; A method comprising:

2. 2. The method of claim 1, wherein the probe comprises a double-stranded DNA spacer between the target binding domain and the barcode domain.

3. 2. The method of claim 1, wherein the number of nucleotides in the target binding domain is greater than the number of attachment positions in the barcode.

4. The method of claim 3, wherein the barcode domain comprises at least four attachment positions.

5. The method of claim 1, wherein each attachment position within the barcode domain comprises one attachment region.

6. each attachment position within said barcode domain comprises: a) 9 nucleotides in length; b) 12 nucleotides in length; c) 14 nucleotides in length; or d) 16 nucleotides in length; The method of claim 1, wherein

7. The method of claim 1, wherein the at least one nucleic acid sequence at each attachment position comprises a 3' terminal guanosine nucleotide.

8. 2. The method of claim 1, wherein the at least one nucleic acid sequence at each attachment position comprises at least one adenine nucleotide, at least one thymine nucleotide, at least one cytosine nucleotide, or any combination thereof, and a 3'-terminal guanosine nucleotide.

9. 2. The method of claim 1, wherein each nucleotide of the at least 12 nucleotides of the target binding domain is D-DNA.

10. 2. The method of claim 1, wherein steps (4) and (5) occur sequentially or simultaneously.

11. 2. The method of claim 1, wherein steps (7) and (8) occur sequentially or simultaneously.

12. 2. The method of claim 1, wherein the first detectable label and the second detectable label have the same emission spectrum or have different emission spectra.

13. 2. The method of claim 1, wherein the third detectable label and the fourth detectable label have the same emission spectrum or have different emission spectra.

14. 2. The method of claim 1, wherein the fifth detectable label and the sixth detectable label have the same emission spectrum or have different emission spectra.

15. 2. The method of claim 1, wherein each of the first complementary nucleic acid molecule, the second complementary nucleic acid molecule, and the third complementary nucleic acid molecule comprises a cleavable linker.

16. the first complementary nucleic acid molecule comprises a reporter probe comprising one primary nucleic acid molecule; the primary nucleic acid molecule comprises at least two domains, a first domain hybridizes to the first attachment position of the barcode domain; and the second domain hybridizes to six secondary nucleic acid molecules; each of these secondary nucleic acid molecules hybridizes to five tertiary nucleic acid molecules, each of said tertiary nucleic acid molecules comprising a detectable label; The method of claim 1.

17. 17. The method of claim 16, wherein the primary nucleic acid molecule comprises a cleavable linker located between the first domain and the second domain.

18. The method of claim 17, wherein the cleavable linker is a photocleavable linker.

19. each of said secondary nucleic acid molecules comprises at least two domains; the first domain hybridizes to a second domain of said primary nucleic acid molecule; The method of claim 16, wherein the second domain hybridizes to the five tertiary nucleic acid molecules.

20. 20. The method of claim 19, wherein each of the secondary nucleic acid molecules comprises a cleavable linker located between the first domain and the second domain.

21. The method of claim 20, wherein the cleavable linker is a photocleavable linker.

22. removing said at least one first detectable label and said at least one second detectable label hybridized to said first attachment location, cleavage of a cleavable linker between the first and second domains of said primary nucleic acid, cleavage of a cleavable linker between the first and second domains of each secondary nucleic acid, or any combination thereof; 22. The method of any one of claims 17, 18, 20 and 21, comprising:

Images