Ammonia-oxidizing nitrosomonas eutropha strain d23

Abstract

To provide improved beneficial bacteria that can suppress the growth of pathogens.SOLUTION: The present disclosure provides, inter alia, an optimized strain of Nitrosomonas eutropha (N. eutropha) designated D23, D23-100, or AOB D23-100. N. eutropha bacteria disclosed in the present application have desirable properties, e.g., optimized properties, such as the ability to suppress growth of pathogenic bacteria, and an enhanced ability to produce nitric oxide and nitric oxide precursors. The N. eutropha herein may be used, for instance, to treat diseases associated with low nitrite levels, skin diseases, and diseases caused by pathogenic bacteria.SELECTED DRAWING: Figure 18

Description

[Technical Field]

[0001] This application claims priority to Greek Patent Application No. 20140100217, filed April 15, 2014, U.S. Provisional Patent Application No. 62 / 002084, filed May 22, 2014, U.S. Provisional Patent Application No. 62 / 012811, filed June 16, 2014, U.S. Provisional Patent Application No. 62 / 053588, filed September 22, 2014, and Greek Patent Application No. 20150100115, filed March 13, 2015, the contents of which are incorporated herein by reference in their entireties.

[0002] Sequence Listing This application has been submitted electronically in ASCII format and contains a Sequence Listing, which is incorporated herein by reference in its entirety. The ASCII copy, created on April 13, 2015, is named N2060-7001WO.txt and is 3,590,980 bytes in size. [Background technology]

[0003] Beneficial bacteria can be used to inhibit the growth of pathogenic bacteria. Bacteria and other microorganisms are ubiquitous in the environment. The discovery of pathogenic bacteria and the bacteriology of disease have a profound impact on health and disease states. Bacteria are a normal part of the environment of all living organisms. In the intestine, these bacteria are non-pathogenic under normal conditions and actually improve health by making normal intestinal contents more inhospitable to disease-causing organisms. Disease prevention is achieved in several ways: consuming nutrients, leaving few nutrients for pathogens; creating conditions such as pH and oxygen tension that are inhospitable to pathogens; producing compounds toxic to pathogens; consuming pathogens as food by these microorganisms; leaving little physical space available for pathogens; and occupying specific binding sites, leaving few available binding sites for pathogens. The presence of these desirable bacteria is considered useful in preventing disease states.

[0004] There is a need in the art for improved beneficial bacteria that can inhibit the growth of pathogenic bacteria. Summary of the Invention [Means for solving the problem]

[0005] The present disclosure provides, inter alia, optimized strains of Nitrosomonas eutropha (N. eutropha) designated D23, D23-100, or AOB D23-100, which terms may be used interchangeably throughout the disclosure.

[0006] Ammonia-oxidizing bacteria of the genus Nitrosomonas are ubiquitous, Gram-negative, obligate chemoautotrophic bacteria with the unique ability to generate energy solely from the conversion of ammonia to nitrite.

[0007] The N. eutropha bacteria disclosed in this application are known for their ability to inhibit the growth of pathogenic bacteria, as well as for their ability to produce nitric oxide (NO) and nitric oxide (NO2 - The N. eutropha herein, e.g., optimized N. eutropha, e.g., purified optimized N. eutropha preparations, can be used, for example, to treat diseases, e.g., diseases associated with low nitrite levels, skin disorders, and diseases caused by pathogenic bacteria. When referring to N. eutropha throughout this disclosure, it can refer to an optimized strain of N. eutropha or a purified optimized N. eutropha preparation.

[0008] The present disclosure provides, inter alia, Nitrosomonas eutropha (N. eutropha) bacteria, e.g., optimized N. eutropha, e.g., purified optimized N. eutropha preparations, having at least one property selected from the following: Optimized growth rate, Optimized NH4 + oxidation rate, and Ammonium ion (NH4 + ) optimization resistance.

[0009] The bacteria is optionally pure.

[0010] In some embodiments, the optimized growth rate is a rate that allows continuous cultivation of N. eutropha at an OD600 (optical density at 600 nm) of about 0.15-0.18 to reach an OD600 of about 0.5-0.6 in about 1-2 days. In some embodiments, the optimized growth rate is a doubling time of about 8 hours when cultivated under batch culture conditions. In some embodiments, the optimized NH4 + The oxidation rate is NH4 + NO2 - In some embodiments, NH4 + The optimal tolerance to NH4 is approximately 200 mM. + The ability to grow for at least about 48 hours in a medium containing

[0011] In some embodiments, the purified, optimized N. eutropha bacterial preparation (optionally pure) has an optimized growth rate, optimized NH4 + Oxidation rate and NH4 + In some embodiments, the purified, optimized N. eutropha bacterial preparation (optionally pure) has at least two properties selected from optimized growth rate, optimized resistance to NH4 + Oxidation rate and NH4 + In some embodiments, the purified, optimized N. eutropha bacterial preparation (optionally pure) comprises a chromosome that hybridizes to SEQ ID NO: 1 at very high stringency.

[0012] In some embodiments, the purified, optimized N. eutropha bacterial preparation (optionally pure) comprises an AmoA protein having identity to SEQ ID NO: 6 or 12, selected from among at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; an AmoB protein having identity to SEQ ID NO: 8 or 14, selected from among at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; an AmoB protein having identity to SEQ ID NO: 4, 10, or 16, selected from among at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; a hydroxylamine oxidoreductase protein having identity to SEQ ID NO: 18, 20, or 22 selected from at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; a cytochrome c protein having identity to SEQ ID NO: 24, 26, or 28 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; or a cytochrome c protein having identity to SEQ ID NO: 30 or 32 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5% and 100% identical. M Contains 552 proteins.

[0013] In some embodiments, a purified, optimized N. eutropha bacterial preparation (optionally pure) comprises 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of the sequence features in Table 2. For example, in some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 1 of N. eutropha strain C91, e.g., to V at position 1. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 160 of N. eutropha strain C91, e.g., to L at position 160. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 167 of N. eutropha strain C91, e.g., to A at position 167. In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or a gene encoding same) that has a mutation at position 33 of N. eutropha strain C91, e.g., to a V at position 33. In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or a gene encoding same) that has a mutation at position 165 of N. eutropha strain C91, e.g., to an I at position 165. In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or a gene encoding same) that has a mutation at position 79 of N. eutropha strain C91, e.g., to an A at position 79. In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or a gene encoding same) that has a mutation at position 271 of N. eutropha strain C91, e.g., to a V at position 271. In some embodiments, the bacterium or preparation comprises a Hao1, Hao2, or Hao3 protein (or a gene encoding same) with a mutation at position 85 of N. eutropha strain C91, for example, to S at position 85.In some embodiments, the bacterium or preparation comprises a Hao1, Hao2, or Hao3 protein (or a gene encoding same) that has a mutation at position 312 of N. eutropha strain C91, e.g., to E at position 312. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or a gene encoding same) that has a mutation at position 163 of N. eutropha strain C91, e.g., to A at position 163. In some embodiments, the bacterium or preparation comprises a c554 CycA1, c554 CycA2, or c554 CycA3 protein (or a gene encoding same) that has a mutation at position 65 of N. eutropha strain C91, e.g., to T at position 65. In some embodiments, the bacterium or preparation comprises a c554 CycA1 protein (or a gene encoding same) that has a mutation at position 186 of N. eutropha strain C91, e.g., to T at position 186. In some embodiments, the bacterium or preparation has a mutation at position 63 of N. eutropha strain C91, e.g., a mutation at position 63 to V. M 552 CycB1 or c M In some embodiments, the bacterium or preparation comprises a c 552 CycB2 protein (or a gene encoding it). In some embodiments, the bacterium or preparation comprises a c 552 CycB2 protein (or a gene encoding it) having a mutation at position 189 of N. eutropha strain C91, e.g., a c 552 CycB2 protein (or a gene encoding it). M 552 CycB1 or c M In some embodiments, the bacterium or preparation comprises a cDNA encoding a CycB2 protein (or a gene encoding the same) at position 206 of N. eutropha strain C91, e.g., a cDNA encoding a CycB2 protein (or a gene encoding the same). M 552 CycB1 or c M In some embodiments, the bacterium or preparation comprises a cDNA encoding a CycB2 protein (or a gene encoding the same) at position 207 of N. eutropha strain C91, e.g., a cDNA encoding a CycB2 protein (or a gene encoding the same). M 552 CycB1 or c MIn some embodiments, the bacterium or preparation comprises a cDNA encoding a CycB2 protein (or a gene encoding the same) at position 195 of N. eutropha strain C91, e.g., a cDNA encoding a CycB2 protein (or a gene encoding the same). M In some embodiments, the bacterium or preparation comprises a cDNA encoding a CycB1 protein (or a gene encoding the same) at position 196 of N. eutropha strain C91, e.g., a cDNA encoding a CycB1 protein (or a gene encoding the same). M In some embodiments, the bacterium or preparation comprises a cDNA encoding a CycB1 protein (or a gene encoding it) at position 197 of N. eutropha strain C91, e.g., a cDNA encoding a CycB1 protein (or a gene encoding it). M 552 containing the CycB1 protein (or the gene encoding it).

[0014] Combinations of two or more sequence features in Table 2 are also described. These two or more sequence features may be in the same gene or different genes. These two or more sequence features may be in the same protein or different proteins. For example, in some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding it) having a mutation at position 1 of N. eutropha strain C91, e.g., a V at position 1, and a mutation at position 160 of N. eutropha strain C91, e.g., an L at position 160. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding it) having a mutation at position 1 of N. eutropha strain C91, e.g., a V at position 1, and a mutation at position 167 of N. eutropha strain C91, e.g., an A at position 167. In some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding it) having a mutation at position 160 of N. eutropha strain C91, e.g., to L at position 160, and a mutation at position 167 of N. eutropha strain C91, e.g., to A at position 167.

[0015] In some embodiments, the bacterium or preparation comprises an AmoB1 or AmoB2 protein (or a gene encoding it) having a mutation at position 33 of N. eutropha strain C91, e.g., a mutation to V at position 33, and a mutation at position 165 of N. eutropha strain C91, e.g., a mutation to I at position 165.

[0016] In some embodiments, the bacterium or preparation comprises an AmoC3 protein (or a gene encoding it) having a mutation at position 79 of N. eutropha strain C91, e.g., to A at position 79, and a mutation at position 271 of N. eutropha strain C91, e.g., to V at position 271.

[0017] In some embodiments, the bacterium or preparation comprises a Hao1, Hao2, or Hao3 protein (or a gene encoding same) that has a mutation at position 85 of N. eutropha strain C91, e.g., to an S at position 85, and a mutation at position 312 of N. eutropha strain C91, e.g., to an E at position 312. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or a gene encoding same) that has a mutation at position 85 of N. eutropha strain C91, e.g., to an S at position 85, and a mutation at position 163 of N. eutropha strain C91, e.g., to an A at position 163. In some embodiments, the bacterium or preparation comprises a Hao1 protein (or a gene encoding same) that has a mutation at position 312 of N. eutropha strain C91, e.g., to an E at position 312, and a mutation at position 163 of N. eutropha strain C91, e.g., to an A at position 163.

[0018] In some embodiments, the bacterium or preparation comprises a c554 CycA1 protein (or a gene encoding it) having a mutation at position 65 of N. eutropha strain C91, e.g., a mutation to T at position 65, and a mutation at position 186 of N. eutropha strain C91, e.g., a mutation to T at position 186.

[0019] In some embodiments, the bacteria or preparation has a mutation at any two or more of the following amino acid positions: 63, 189, 194, 195, 196, 197, 206, and 207. M 552 CycB1 protein (or the gene encoding it). For example, these two or more amino acid positions are 63 and 189, 63 and 194, 63 and 195, 63 and 196, 63 and 197, 63 and 206, 63 and 207, 189 and 194, 189 and 195, 189 and 196, 189 and 194, 189 and 195, 189 and 196, 189 and 197, 189 and 206, 1 In some embodiments, the bacterium or preparation may comprise any two or more mutations selected from the group consisting of I63V, S189P, D194G, 195insD, 196insD, 197insD, 206insE, and 207insE. M552 CycB1 protein (or the gene encoding it). For example, these two or more mutations include I63V and S189P, I63V and D194G, I63V and 195insD, I63V and 196insD, I63V and 197insD, I63V and 206insE, I63V and 207insE, S189P and D194G, S189P and 195insD, S189P and 196insD, S189P and 197insD, S189P and 206insE, S189P and 207insE, D194G and 195insD, D194G and 196insD, It may be selected from the group consisting of D194G and 197insD, D194G and 206insE, D194G and 207insE, 195insD and 196insD, 195insD and 197insD, 195insD and 206insE, 195insD and 207insE, 196insD and 197insD, 196insD and 206insE, 196insD and 207insE, 197insD and 206insE, 197insD and 207insE, and 206insE and 207insE.

[0020] In some embodiments, the bacterium or preparation has a mutation at any two or more of the following amino acid positions: 63, 189, 206, and 207. M 552 CycB2 protein (or a gene encoding it). For example, these two or more amino acid positions may include 63 and 189, 63 and 206, 63 and 207, 189 and 206, 189 and 207, or 206 and 207. In some embodiments, the bacterium or preparation comprises a cB2 protein (or a gene encoding it) having any two or more mutations selected from the group consisting of I63V, S189P, 206insE, and 207insE. M 552 CycB2 protein (or the gene encoding it). For example, these two or more mutations may be selected from the group consisting of I63V and S189P, I63V and 206insE, I63V and 207insE, S189P and 206insE, S189P and 207insE, and 206insE and 207insE.

[0021] Combinations of three or more sequence features in Table 2 are also described. For example, in some embodiments, the bacterium or preparation comprises an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 1 of N. eutropha strain C91, e.g., to V at position 1, and a mutation at position 160 of N. eutropha strain C91, e.g., to L at position 160, and a mutation at position 167 of N. eutropha strain C91, e.g., to A at position 167.

[0022] In some embodiments, the bacterium or preparation comprises a Hao1 protein (or a gene encoding it) having a mutation at position 85 of N. eutropha strain C91, e.g., to S at position 85, and a mutation at position 312 of N. eutropha strain C91, e.g., to E at position 312, and a mutation at position 163 of N. eutropha strain C91, e.g., to A at position 163.

[0023] In some embodiments, the bacterium or preparation has mutations at any three or more (e.g., four, five, six, seven, or all) of the following amino acid positions: 63, 189, 194, 195, 196, 197, 206, and 207. M 552 CycB1 protein (or a gene encoding it). For example, these three mutations can be at positions 195, 196, and 197. In some embodiments, the bacterium or preparation has any three or more (e.g., four, five, six, seven, or all) mutations selected from the group consisting of I63V, S189P, D194G, 195insD, 196insD, 197insD, 206insE, and 207insE. M 552 CycB1 protein (or the gene encoding it). For example, these three mutations can be 195insD, 196insD, and 197insD.

[0024] In some embodiments, the bacterium or preparation has mutations at any three or more (e.g., all) of the following amino acid positions: 63, 189, 206, and 207. M In some embodiments, the bacterium or preparation comprises a CycB2 protein (or a gene encoding the same) having any three or more (e.g., all) mutations selected from the group consisting of I63V, S189P, 206insE, and 207insE. M 552 containing the CycB2 protein (or the gene encoding it).

[0025] In some embodiments, the bacterium or preparation comprises a mutation relative to N. eutropha strain C91 in at least two genes, e.g., at least two genes listed in Table 2. These two genes include, for example, AmoA1 and AmoA2, AmoA1 and AmoB1, AmoA1 and AmoB2, AmoA1 and AmoC1, AmoA1 and AmoC2, AmoA1 and AmoC3, AmoA1 and Hao1, AmoA1 and Hao2, AmoA1 and Hao3, AmoA1 and c554 CycA1, AmoA1 and c554 CycA2, AmoA1 and c554 CycA3, AmoA1 and cM552 CycB1, AmoA1 and cM552 CycB2, AmoA2 and AmoB1, AmoA2 and AmoB2, AmoA2 and AmoC1, AmoA2 and AmoC2, AmoA2 and AmoC3, AmoA2 and Hao1, AmoA2 and Hao2, AmoA2 and Hao3, AmoA2 and c554 CycA1, AmoA2 and c554 CycA2, AmoA2 and c554 CycA3, AmoA2 and cM552 CycB1, AmoA2 and cM552 CycB2, AmoB1 and AmoB2, AmoB1 and AmoC1, AmoB1 and AmoC2, AmoB1 and AmoC3, AmoB1 and Hao1, AmoB1 and Hao2, AmoB1 and Hao3, AmoB1 and c554 CycA1, AmoB and c554 CycA2, AmoB1 and c554 CycA3, AmoB1 and cM552 CycB1, AmoB1 and cM552 CycB2, AmoB2 and AmoC1, AmoB2 and AmoC2, AmoB2 and AmoC3, AmoB2 and Hao1, AmoB2 and Hao2, AmoB2 and Hao3, AmoB2 and c554 CycA1, AmoB2 and c554 CycA2, AmoB2 and c554 CycA3, AmoB2 and cM552 CycB1, AmoB2 and cM552 CycB2, AmoC1 and AmoC2, AmoC1 and AmoC3, AmoC1 and Hao1, AmoC1 and Hao2, AmoC1 and Hao3, AmoC1 and c554 CycA1, AmoC1 and c554 CycA2, AmoC1 and c554 CycA3, AmoC1 and cM552 CycB1, AmoC1 and cM552CycB2, AmoC2 and AmoC3, AmoC2 and Hao1, AmoC2 and Hao2, AmoC2 and Hao3, AmoC2 and c554 CycA1, AmoC2 and c554 CycA2, AmoC2 and c554 CycA3, AmoC2 and cM552 CycB1, AmoC2 and cM552 CycB2, AmoC3 and Hao1, AmoC3 and Hao2, AmoC3 and Hao3, AmoC3 and c554 CycA1, AmoC3 and c554 CycA2, AmoC3 and c554 CycA3, AmoC3 and cM552 CycB1, AmoC3 and cM552 CycB2, Hao1 and Hao2, Hao1 and Hao3, Hao1 and c554 CycA1, Hao1 and c554 CycA2, Hao1 and c554 CycA3, Hao1 and cM552 CycB1, Hao1 and cM552 CycB2, Hao2 and Hao3, Hao2 and c554 CycA1, Hao2 and c554 CycA2, Hao2 and c554 CycA3, Hao2 and cM552 CycB1, Hao2 and cM552 CycB2, Hao3 and c554 CycA1, Hao3 and c554 CycA2, Hao3 and c554 CycA3, Hao3 and cM552 CycB1, Hao3 and cM552 CycB2, c554 CycA1 and c554 CycA2, c554 CycA3, c554 CycA1 and cM552 CycB1, c554 CycA1 and cM552 CycB2, c554 CycA2 and c554 CycA3, c554 CycA2 and cM552 CycB1, c554 CycA2 and cM552 CycB2, c554 CycA3 and cM552 CycB1, c554 CycA3 and cM552 CycB2, or cM552 CycB1 and cM552 It may be CycB2.

[0026] In some embodiments, the bacterium or preparation comprises mutations relative to N. eutropha strain C91 in at least three genes, e.g., at least three (e.g., four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or all) of the genes listed in Table 2. These three genes can be, for example, AmoA1 and AmoA2 and AmoA3, AmoC1 and AmoC2 and AmoC3, or Hao1 and Hao2 and Hao3.

[0027] In some embodiments, the bacterium or preparation comprises at least one structural difference, e.g., at least one mutation, relative to a wild-type bacterium, such as N. eutropha strain C91. In some embodiments, the bacterium or preparation comprises a nucleic acid that can be amplified using a pair of primers described herein, e.g., a primer comprising the sequence of SEQ ID NO: 64 and a primer comprising the sequence of SEQ ID NO: 65. In some embodiments, the bacterium or preparation comprises a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to a gene in Figure 6, 7, or 8 or a protein encoded by the gene in Figure 6, 7, or 8. In some embodiments, the bacterium or preparation comprises a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any of SEQ ID NOs: 64-66 or a protein encoded by any of SEQ ID NOs: 64-66.

[0028] In some aspects, the present disclosure relates to, among other things, ammonia monooxygenase genes, hydroxylamine oxidoreductase genes, cytochrome c554 genes, or cytochrome c mThe present invention provides a N. eutropha bacterium, or a purified preparation thereof, comprising a mutation in the 552 gene. The mutation can be relative to a wild-type bacterium, such as N. eutropha strain C91. The mutation can be in one or more of the amoA1 gene, the amoA2 gene, the amoB1 gene, the amoB2 gene, and the amoC3 gene. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation at a position described herein, e.g., a position described in Table 2. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation, wherein the mutation is a mutation described herein, e.g., a mutation described in Table 2.

[0029] In some embodiments, the mutation can be in one or more of the hao1 gene, the hao2 gene, or the hao3 gene. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation at a position described herein, e.g., a position described in Table 2. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation, wherein the mutation is a mutation described herein, e.g., a mutation described in Table 2.

[0030] In some embodiments, the mutation can be in one or more of the c554 cycA1 gene, the c554 cycA2 gene, and the c554 cycA3 gene. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation at a position described herein, e.g., a position described in Table 2. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation, wherein the mutation is a mutation described herein, e.g., a mutation described in Table 2.

[0031] In some embodiments, the mutation is c M 552 cycB1 gene and c M552 cycB2 gene. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation at a position described herein, e.g., a position described in Table 2. The N. eutropha bacterium, or a purified preparation thereof, can have a mutation, wherein the mutation is a mutation described herein, e.g., a mutation described in Table 2.

[0032] In certain embodiments, the N. eutropha bacterium, or purified preparation thereof, described in the previous four paragraphs can be based on an N. eutropha bacterium, e.g., an optimized N. eutropha, e.g., a purified optimized N. eutropha preparation, having at least one property selected from the following: Optimized growth rate, Optimized NH4 + oxidation rate, and Ammonium ion (NH4 + ) optimization resistance.

[0033] In certain embodiments, the N. eutropha bacterium, or purified preparation thereof, described in the preceding five paragraphs, contains the amoA1 gene, the amoA2 gene, the amoB1 gene, the amoB2 gene, the amoC3 gene, the hao1 gene, the hao2 gene, the hao3 gene, the c554 ...B1 gene, the amoB2 gene cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, c M The c552 cycB1 gene and the c554 cycB2 gene may have mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the c552 cycB1 gene and the c554 cycB2 gene.

[0034] In some embodiments, the N. eutropha bacterium has an optimized growth rate, e.g., an optimized growth rate described herein, and structural differences, e.g., mutations (e.g., relative to a wild-type strain such as N. eutropha strain C91), e.g., a mutation described herein, e.g., a mutation in Table 2. In some embodiments, the N. eutropha bacterium has an optimized NH4 + Oxidation rates, e.g., optimized NH4 as described herein + Oxidation rates and structural differences, e.g., mutations (e.g., relative to a wild-type strain such as N. eutropha strain C91), e.g., mutations described herein, e.g., mutations in Table 2. In some embodiments, the N. eutropha bacterium has an NH4 + Optimized resistance to, for example, NH4 + and structural differences, e.g., mutations (e.g., relative to a wild-type strain such as N. eutropha strain C91), e.g., mutations described herein, e.g., mutations in Table 2.

[0035] In some embodiments, the N. eutropha bacterium comprises a nucleic acid that can be amplified using a pair of primers described herein, for example, a primer comprising the sequence of SEQ ID NO:64 and a primer comprising the sequence of SEQ ID NO:65.

[0036] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally pure) comprising a chromosome that hybridizes to SEQ ID NO:1 at high stringency.

[0037] In embodiments, the chromosome hybridizes with very high stringency to SEQ ID NO: 1. In embodiments, the N. eutropha bacterium (optionally pure) includes genes that are at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to one or more genes in Figures 6-8 (e.g., 10, 20, 30, 40, 50, 100, or all of the genes in any one or more of Figures 6, 7, and 8).

[0038] In embodiments, the N. eutropha bacteria (optionally purified) are selected from the group consisting of N. eutropha, N. eutropha bacterium, N. eutropha var. eutropha ... eutropha C91: implications for niche adaptation. Environmental Microbiology (2007) 9(12), 2993-3007. In some embodiments, the N. eutropha (optionally purified) lacks any plasmid at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% identical to SEQ ID NO:2 (pNeut1) or SEQ ID NO:3 (pNeut2). In some embodiments, the N. eutropha (optionally purified) lacks one or more genes present on the plasmid of SEQ ID NO:2 or SEQ ID NO:3. For example, the N. eutropha (optionally purified) can lack at least 2, 3, 4, 5, 10, 15, or 20 genes present on either or both of pNeut1 and pNeut2. While pNeut1 contains 55 protein-coding sequences, pNeutP2 contains 52 protein-coding sequences. In embodiments, the N. eutropha bacterium (optionally pure) lacks any plasmids.

[0039] In certain aspects, the disclosure provides a N. eutropha bacterium (optionally purified) that includes one or more of an amoA1 gene that is at least about 98.9% identical to SEQ ID NO:7 and an amoA2 gene that is at least about 98.8% identical to SEQ ID NO:13.

[0040] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally purified) comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO:6 and an AmoA2 protein at least about 99.0% identical to SEQ ID NO:12.

[0041] In certain aspects, the disclosure provides a N. eutropha bacterium (optionally purified) that includes one or more of an amoB1 gene that is at least about 99.2% identical to SEQ ID NO:9 and an amoB2 gene that is at least about 99.2% identical to SEQ ID NO:15.

[0042] In embodiments, the N. eutropha bacterium (optionally purified) further comprises one or more of an amoA1 or amoA2 gene that is at least about 98.9% identical to SEQ ID NO:7 or 13.

[0043] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally purified) comprising one or more of an AmoB1 protein at least about 99.6% identical to SEQ ID NO:8 and an AmoB1 protein at least about 99.6% identical to SEQ ID NO:14.

[0044] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO:6 and an AmoA2 protein at least about 99.0% identical to SEQ ID NO:12.

[0045] In certain aspects, the disclosure provides a N. eutropha bacterium (optionally purified) that includes one or more of an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO:17.

[0046] In embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, and an amoB2 gene at least about 99.2% identical to SEQ ID NO:15.

[0047] In certain aspects, the disclosure provides a N. eutropha bacterium (optionally purified) comprising an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO:16.

[0048] In several embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO:6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO:12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:8, and an AmoB1 protein at least about 99.6% identical to SEQ ID NO:14.

[0049] In certain aspects, the disclosure provides a N. eutropha bacterium (optionally purified) comprising one or more of a hao1 gene at least about 99.1% identical to SEQ ID NO:19, a hao2 gene at least about 99.5% identical to SEQ ID NO:21, and a hao3 gene at least about 99.3% identical to SEQ ID NO:23.

[0050] In embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, an amoB2 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO:17.

[0051] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally purified) comprising one or more of a Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein at least about 99.7% identical to SEQ ID NO: 22.

[0052] In several embodiments, the N. eutropha bacterium (optionally pure) further comprises an AmoA1 protein at least about 99.0% identical to SEQ ID NO:6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO:12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:14, or an AmoC3 protein at least about 99.4% identical to SEQ ID NO:16.

[0053] In certain aspects, the present disclosure provides a N. eutropha bacterium (optionally pure) comprising one or more of a cycA1 gene at least about 98.1% identical to SEQ ID NO:25, a cycA2 gene at least about 98.8% identical to SEQ ID NO:27, and a cycA3 gene at least about 99.4% identical to SEQ ID NO:28.

[0054] In embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, an amoB2 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, an amoC3 gene at least about 99.0% identical to SEQ ID NO:17, a hao1 gene at least about 99.1% identical to SEQ ID NO:19, a hao2 gene at least about 99.5% identical to SEQ ID NO:21, and a hao3 gene at least about 99.3% identical to SEQ ID NO:23.

[0055] In certain aspects, the present disclosure provides a N. eutropha bacterium (optionally pure) comprising one or more of a CycA1 protein at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein at least about 99.7% identical to SEQ ID NO: 28.

[0056] In some embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO:6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO:12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:14, an AmoC3 protein at least about 99.4% identical to SEQ ID NO:16, a Hao1 protein at least about 99.6% identical to SEQ ID NO:18, a Hao2 protein at least about 99.7% identical to SEQ ID NO:20, and a Hao3 protein at least about 99.7% identical to SEQ ID NO:22.

[0057] In certain aspects, the present disclosure provides a N. eutropha bacterium (optionally purified) comprising one or more of a cycB1 gene at least about 96.8% identical to SEQ ID NO: 31 and a cycB2 gene at least about 97.2% identical to SEQ ID NO: 33.

[0058] In embodiments, the N. eutropha bacterium (optionally purified) comprises an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, an amoB2 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, an amoB1 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, an amoB2 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, an amoB1 gene at least about 99.2% identical to SEQ ID NO:1 ...1 gene at least about 99.9% identical to SEQ ID NO:15, an amoC2 gene at least about 99.9% identical to SEQ ID NO:1 17, a hao1 gene at least about 99.1% identical to SEQ ID NO:19, a hao2 gene at least about 99.5% identical to SEQ ID NO:21, a hao3 gene at least about 99.3% identical to SEQ ID NO:23, a cycA1 gene at least about 98.1% identical to SEQ ID NO:25, a cycA2 gene at least about 98.8% identical to SEQ ID NO:27, and a cycA3 gene at least about 99.4% identical to SEQ ID NO:28.

[0059] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally pure) comprising one or more of a CycB1 protein at least about 97.2% identical to SEQ ID NO: 30 or a CycB2 protein at least about 98.8% identical to SEQ ID NO: 32.

[0060] In embodiments, the N. eutropha bacterium (optionally pure) further comprises one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO:6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO:12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO:14, an AmoC3 protein at least about 99.4% identical to SEQ ID NO:16, a Hao1 protein at least about 99.6% identical to SEQ ID NO:18, a Hao2 protein at least about 99.7% identical to SEQ ID NO:20, a Hao3 protein at least about 99.7% identical to SEQ ID NO:22, a CycA1 protein at least about 99.2% identical to SEQ ID NO:24, a CycA2 protein at least about 99.7% identical to SEQ ID NO:26, and a CycA3 protein at least about 99.7% identical to SEQ ID NO:28.

[0061] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally purified) comprising one or more genes according to SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33.

[0062] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally purified) comprising one or more proteins according to SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32.

[0063] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally pure) comprising a protein that is mutant for at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the amino acid positions listed in Table 2 of N. eutropha strain C91.

[0064] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally purified) that contain proteins that are mutant for all of the amino acid positions listed in Table 2 of N. eutropha strain C91.

[0065] In certain aspects, the present disclosure provides N. eutropha bacteria (optionally pure) of strain D23, 25 vials of which bacteria, designated AOB D23-100, were deposited with the ATCC Patent Depository on April 8, 2014 under ATCC Accession No. PTA-121157.

[0066] In embodiments, the N. eutropha bacterium (optionally purified) is transgenic.

[0067] In some embodiments, the N. eutropha bacteria (optionally purified) are grown at an optimized growth rate, optimized NH4 + Oxidation rate and NH4 + Optimized resistance to

[0068] In some embodiments, the N. eutropha bacteria (optionally purified) are grown at an optimized growth rate, optimized NH4 + Oxidation rate and NH4 + and optimized resistance to.

[0069] In some embodiments, the N. eutropha bacteria (optionally purified) are grown at an optimized growth rate, optimized NH4 + Oxidation rate and NH4 + It has optimized resistance to

[0070] In several embodiments, the N. eutropha bacteria described herein (e.g., strain D23) are substantially free of bacteria, other ammonia-oxidizing bacteria, fungi, viruses, or pathogens (e.g., animal pathogens, e.g., human pathogens), or any combination thereof.

[0071] In certain aspects, the present disclosure provides compositions comprising a N. eutropha bacterium (e.g., strain D23) described herein, wherein the composition is substantially free of other organisms.

[0072] In certain aspects, the present disclosure provides compositions comprising a N. eutropha bacterium (e.g., strain D23) described herein and further comprising a second organism (e.g., a second strain or species), wherein the composition is substantially free of other organisms (e.g., strains or species). In some embodiments, the second organism is an ammonia-oxidizing bacterium. In some embodiments, the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof.

[0073] The present disclosure also provides compositions comprising a N. eutropha bacterium (e.g., strain D23) described herein and further comprising second and third organisms (e.g., of other strains or species), where the compositions are substantially free of other organisms (e.g., strains or species). The present disclosure also provides compositions comprising a N. eutropha bacterium (e.g., strain D23) described herein and further comprising 2, 3, 4, 5, 6, 7, 8, 9, or 10 other organisms (e.g., of other strains or species), where the compositions are substantially free of other organisms (e.g., strains or species).

[0074] In some embodiments, the present disclosure provides a composition comprising a cell suspension of an actively dividing culture of N. eutropha bacteria having an OD600 of at least about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.6, 0.7, or 0.8, wherein the composition is substantially free of other organisms.

[0075] In some aspects, the present disclosure provides a topical composition comprising a N. eutropha bacterium described herein (e.g., strain D23) and a pharmaceutically or cosmetically acceptable excipient suitable for topical administration. In embodiments, the composition is substantially free of other organisms. In embodiments, the composition further comprises a second organism (e.g., of another strain or species). In embodiments, the composition further comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 other organisms (e.g., of other strains or species). The second organism can be, for example, an ammonia-oxidizing bacterium. In embodiments, the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof.

[0076] In some embodiments, the composition is a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. In some embodiments, the composition further comprises a moisturizer, deodorant, fragrance, colorant, insect repellent, cleansing agent, or UV protection agent. In some embodiments, the excipient is an anti-adhesive, binder, coating, disintegrant, filler, flavor, color, glidant, glidant, adsorbent, preservative, or sweetener. In some embodiments, the concentration of N. eutropha in the composition is about 10 11 ~10 13 In some embodiments, the concentration of N. eutropha in the composition is about 10 CFU / L. 9CFU / ml. In embodiments, the mass ratio of N. eutropha to pharmaceutical excipients can be from about 0.1 grams / L to about 100 grams / L. In some embodiments, the mass ratio of N. eutropha to pharmaceutical excipients is 1 gram / L.

[0077] In some aspects, the compositions and / or excipients may be in one or more of the following forms: liquid, solid, or gel. For example, liquid suspensions may include, but are not limited to, water, saline, phosphate-buffered saline, or ammonia-oxidized storage buffer. Gel formulations may include, but are not limited to, agar, silica, polyacrylic acid (e.g., Carbopol®), carboxymethylcellulose, starch, guar gum, alginate, or chitosan. In some embodiments, the formulations may be supplemented with an ammonia source, including, but not limited to, ammonium chloride or ammonium sulfate. In some aspects, the present disclosure provides a method for preparing ammonia-containing suspensions, e.g., at about 10 11 CFU / L, 10 12 CFU / L, 10 13 Compositions are provided that comprise at least about 10, 20, 50, 100, 200, 500, 1,000, 2,000, or 10,000 CFU / L of N. eutropha bacteria described herein (e.g., strain D23). In some embodiments, the compositions comprise at least about 10 9 CFU / L, 10 10 CFU / L, 10 11 CFU / L, or 10 12 In some embodiments, the disclosure provides a composition comprising at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of the N. eutropha bacteria described herein, e.g., as a dry formulation such as a powder.

[0078] In some aspects, the present disclosure provides clothing comprising the N. eutropha (e.g., strain D23) described herein. In embodiments, the clothing is packaged. In embodiments, the clothing is packaged in a material that is resistant to gas exchange or a material that is resistant to water. The clothing may be provided at a concentration that provides, for example, one or more of the following: treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment to provide nitric oxide to a subject, or treatment to inhibit microbial growth.

[0079] In some aspects, the present disclosure provides fabrics comprising N. eutropha (e.g., strain D23) as described herein.

[0080] In some aspects, the present disclosure provides yarns comprising N. eutropha (e.g., strain D23) as described herein.

[0081] In some aspects, the present disclosure provides sutures comprising N. eutropha (e.g., strain D23) as described herein.

[0082] In some embodiments, the present disclosure provides methods for optimizing growth rates, optimizing NH4 + Oxidation rate, or NH4 + 1. A method for obtaining, e.g., producing, (optionally pure) N. eutropha bacteria having optimized resistance to (a) Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + culturing the bacterium under conditions that select for one or more of the optimized resistance to (b) Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + testing a sample from this culture for optimized resistance to (c) Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 +and repeating the culturing and testing steps until a bacterium having optimized resistance to the bacterium is obtained.

[0083] In some embodiments, the method includes obtaining N. eutropha bacteria from a source such as soil or the skin of an individual. In some embodiments, optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + Culturing the bacterium under conditions that select for one or more (e.g., two or three) of the optimized resistances to about 200 mM NH4 + In some embodiments, the method includes culturing the bacterium in a N. europaea medium containing: + Oxidation rate and NH4 + In some embodiments, step (c) includes optimizing growth rate, optimizing NH + Oxidation rate and NH4 + The method includes repeating the culturing and testing steps until a bacterium is obtained that has optimized resistance to at least two of the

[0084] In some aspects, the present disclosure provides a N. eutropha bacterium described herein (e.g., strain D23) produced by the above-described methods.

[0085] In some aspects, the present disclosure provides a method for testing an (optionally pure) N. eutropha preparation, comprising: Optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + assaying the N. eutropha for one or more of the optimized resistances to This N. eutropha has optimized growth rate and NH4 + Oxidation rate, or NH4+ and classifying the N. eutropha as acceptable if it has one or more of the optimized resistances to the N. eutropha.

[0086] In some embodiments, the method further comprises testing the preparation for contaminating organisms. In some embodiments, the method further comprises removing a sample from the preparation and conducting a test on the sample. In some embodiments, the method further comprises testing the medium in which the N. eutropha is cultured. In some embodiments, the method further comprises packaging the N. eutropha from the preparation into a package. In some embodiments, the method further comprises commercializing the N. eutropha from the preparation.

[0087] In some aspects, the disclosure provides a method of producing, e.g., manufacturing, N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until an OD of at least about 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 is reached. In some embodiments, the method comprises culturing the N. eutropha until an OD of about 0.3-0.4, 0.4-0.5, 0.5-0.6, 0.6-0.7, or 0.7-0.8 is reached.

[0088] In some embodiments, the method further comprises assaying the N. eutropha and the culture medium for contaminating organisms. In some embodiments, the method further comprises: optimizing growth rate; optimizing NH4 + Oxidation rate, or NH4 + In some embodiments, the method further comprises assaying the N. eutropha for one or more (e.g., two or three) of the optimized resistances to, for example, about 10 12In some embodiments, the N. eutropha is produced in an amount of at least about 10, 20, 50, 100, 200, 500, 1,000, 2,000, 5,000, or 10,000 L / day of N. eutropha. 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the N. eutropha is present at a concentration of at least about 10 CFU / L. 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 The concentration is CFU / L.

[0089] In some aspects, the present disclosure provides a method of producing, e.g., manufacturing, N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha for about 10 minutes. 12 and culturing the N. eutropha until about at least about 1,000 L of N. eutropha are produced in CFU / L.

[0090] In embodiments, the method includes optimizing growth rate, optimizing NH4 + Oxidation rate, or NH4 + The method further comprises assaying the N. eutropha for one or more (e.g., two or three) of the optimized resistances to:

[0091] In some embodiments, the method further comprises testing the N. eutropha or the culture medium for contaminating organisms. In some embodiments, the N. eutropha contacted with the culture medium exhibits an optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + and N. eutropha having one or more (e.g., two or three) of the optimized resistances to.

[0092] In some aspects, the present disclosure provides a method of producing, e.g., manufacturing, N. eutropha, comprising: (a) contacting N. eutropha with a culture medium; (b) culturing the N. eutropha for 1 to 2 days until the culture reaches an OD600 of about 0.5 to 0.6, thereby producing the culture.

[0093] In embodiments, the method includes optimizing growth rate, optimizing NH4 + Oxidation rate, or NH4 + In some embodiments, the method further comprises assaying the N. eutropha for one or more of the following: optimized growth rate, optimized resistance to NH4. In some embodiments, the method further comprises testing the culture for a contaminating organism, e.g., a bacterium, a virus, a fungus, or a pathogen, or a combination thereof. In some embodiments, the N. eutropha of step (a) is + Oxidation rate, or NH4 + In some embodiments, the N. eutropha has one or more (e.g., two or three) of the optimized resistances to 12 This includes producing at least about 1,000 L / day of N. eutropha in CFU / L.

[0094] In some aspects, the present disclosure provides N. eutropha bacteria produced by the above-described methods.

[0095] In some embodiments, the N. eutropha preparation is produced by the above-described method. In some aspects, the preparation may contain from about 0.1 milligrams to about 100 milligrams (mg) of N. eutropha.

[0096] In some embodiments, a reaction mixture containing N. eutropha at an optical density of about 0.5 to about 0.6 can be provided. In some embodiments, the present disclosure provides a method of producing apparel having N. eutropha, the method comprising contacting an item of apparel with N. eutropha described herein (e.g., strain D23).

[0097] In some embodiments, the method includes creating at least 10, 100, or 1000 clothing items. 10 In some embodiments, the method further comprises packaging the garment.

[0098] In certain aspects, the present disclosure provides a method for obtaining a formulation of N. eutropha, which combines contacting N. eutropha described herein (e.g., strain D23) with a pharmaceutically or cosmetically acceptable excipient.

[0099] In some embodiments, the method further comprises combining the N. eutropha with an excipient, hi some embodiments, the method is carried out under conditions that are substantially free of contaminating organisms, e.g., bacteria, viruses, fungi, or pathogens.

[0100] In certain aspects, the present disclosure provides methods of packaging N. eutropha, the methods comprising combining N. eutropha described herein (eg, strain D23) into a package.

[0101] In embodiments, the package is resistant to gas exchange or water resistant. In embodiments, the package is resistant to gas exchange, NH3, NH4 + , or NO2 - is transparent to

[0102] In certain aspects, the present disclosure provides a method for inhibiting microbial growth on the skin of a subject, the method comprising topically administering to a subject in need thereof an effective dose of a N. eutropha bacterium (e.g., strain D23) described herein.

[0103] In embodiments, the effective dose is approximately 1 x 10 9 CFU, 2 × 10 9 CFU, 5 × 10 9 CFU, 1 × 10 10 CFU, 1.5 × 10 10 CFU, 2 × 10 10 CFU, 5 × 10 10 CFU, or 1 x 10 11 In some embodiments, the effective dose is at least about 1 x 10 CFU. 9 CFU, 2 × 10 9 CFU, 5 × 10 9 CFU, 1 × 10 10 CFU, 1.5 × 10 10 CFU, 2 × 10 10 CFU, 5 × 10 10 CFU, or 1 x 10 11 In some embodiments, the effective dose is approximately 1 x 10 CFU. 9 CFU ~ 2 × 10 9 CFU, 2 × 10 9 CFU ~ 5 × 10 9 CFU, 5 × 10 9 CFU ~ 1 × 10 10 CFU, 1 × 10 10 CFU ~ 1.5 x 10 10 CFU, 1 × 10 10 CFU ~ 2 × 10 10 CFU, 1.5 × 10 10 CFU ~ 2 × 10 10 CFU, 2 × 10 10 CFU ~ 5 × 10 10 CFU, or 5 x 10 10 CFU ~ 1 × 10 11 In some embodiments, the bacteria is about 1 x 10 CFU. 8 , 2 × 10 8 , 5×10 8 , 1×10 9, 2 × 10 9 , 5×10 9 , or 1 × 10 10 In some embodiments, the bacteria are administered at a concentration of at least about 1 x 10 CFU / ml. 8 , 2 × 10 8 , 5×10 8 , 1×10 9 , 2 × 10 9 , 5×10 9 , or 1 × 10 10 In some embodiments, the bacteria are administered at a concentration of about 1 x 10 CFU / ml. 8 ~2×10 8 , 2 × 10 8 ~5×10 8 , 5×10 8 ~1×10 9 , 1×10 9 ~2×10 9 , 2 × 10 9 ~5×10 9 , or 5 × 10 9 ~1×10 10 CFU / ml. In some embodiments, administration is twice daily. In some embodiments, the subject is a human. In some embodiments, the microbial growth inhibited is growth of Pseudomonas aeruginosa or Staphylococcus aureus (S. aureus or SA), Streptococcus pyogenes (S. pyogenes or SP), or Acinetobacter baumannii (A. baumannii or AB).

[0104] In certain aspects, the present disclosure provides a method of delivering nitric oxide to a subject, the method comprising positioning an effective dose of a N. eutropha bacterium described herein (e.g., strain D23) in close proximity to the subject.

[0105] In certain aspects, the present disclosure provides a method for reducing body odor, comprising topically administering to a subject in need thereof an effective dose of a N. eutropha bacterium (e.g., strain D23) described herein.

[0106] In certain aspects, the present disclosure provides a method for treating a disease associated with low nitrite levels, comprising topically administering to a subject in need thereof a therapeutically effective dose of a N. eutropha bacterium (e.g., strain D23) described herein.

[0107] In embodiments, the disease is HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart disease, atherosclerosis, baldness, leg ulcers secondary to diabetes or bed restraint, angina, particularly chronic stable angina, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, or cancer.

[0108] In certain aspects, the present disclosure provides methods of treating a skin disorder, comprising topically administering to a subject in need thereof a therapeutically effective dose of a N. eutropha bacterium (e.g., strain D23) described herein. In related aspects, the present disclosure provides a N. eutropha bacterium (e.g., strain D23) described herein for treating a disorder, such as a skin disorder. In related aspects, the present disclosure provides a N. eutropha bacterium (e.g., strain D23) described herein for the manufacture of a medicament, e.g., a medicament for treating a skin disorder.

[0109] In some embodiments, the skin disorder is acne, e.g., acne vulgaris, rosacea, eczema, or psoriasis. In some embodiments, the skin disorder is an ulcer, e.g., a venous ulcer, e.g., a leg ulcer, e.g., a venous leg ulcer, e.g., a diabetic foot ulcer. In some embodiments, the topical administration comprises pre-treating the subject with N. eutropha, e.g., a N. eutropha described herein. In some embodiments, the topical administration comprises topical administration before the onset of the skin disorder. In some embodiments, the topical administration comprises topical administration after the onset of the skin disorder.

[0110] In certain aspects, the present disclosure provides methods for promoting wound healing or closure, the methods comprising administering to a wound an effective dose of a N. eutropha bacterium (e.g., strain D23) described herein. In related aspects, the present disclosure provides a N. eutropha bacterium (e.g., strain D23) described herein for promoting wound healing. In related aspects, the present disclosure provides a N. eutropha bacterium (e.g., strain D23) described herein for the manufacture of a medicament, e.g., a medicament for promoting wound healing.

[0111] In some embodiments, the wound contains one or more unwanted bacteria, such as pathogenic bacteria, hi some embodiments, the wound contains S. aureus, P. aeruginosa, P. aeroginosa, or A. baumannii.

[0112] In some embodiments, the N. eutropha is administered to a subject prior to the development of a wound. In some embodiments, administering to a wound comprises administering to a subject prior to the development of a wound. In some embodiments, the method further comprises administering N. eutropha (e.g., a N. eutropha described herein, e.g., strain D23) to the wound after the development of a wound. In some aspects, the present disclosure provides a method of killing or inhibiting the growth of pathogenic bacteria comprising contacting, e.g., applying, to skin, N. eutropha bacteria (e.g., a N. eutropha described herein, e.g., strain D23).

[0113] In embodiments, the pathogen contributes to one or more of the following conditions: HIV dermatitis, ulcers, e.g., venous ulcers, e.g., leg ulcers, e.g., venous leg ulcers, e.g., infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, hives, rosacea, skin infections, vascular disease, vaginal yeast infections, sexually transmitted diseases, heart disease, atherosclerosis, baldness, leg ulcers secondary to diabetes or bed restraint, angina, particularly chronic stable angina, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer.

[0114] In embodiments, the condition is an infection in an ulcer, e.g., a venous ulcer, e.g., a leg ulcer, e.g., a venous leg ulcer, e.g., a diabetic foot ulcer. In embodiments, the condition is a venous leg ulcer. In embodiments, the condition is acne, e.g., acne vulgaris. In embodiments, the condition is acne vulgaris. In embodiments, the pathogen is one or more of Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. In embodiments, the method further comprises determining whether the subject is in need of killing or inhibiting the growth of the pathogen, e.g., determining that the subject is in need of killing or inhibiting the growth of the pathogen. In embodiments, the method further comprises selecting a subject in need of killing or inhibiting the growth of the pathogen.

[0115] In some embodiments, the N. eutropha catalyzes the following reaction:

[0116] At neutral pH, ammonia generated from ammonium under approximately neutral pH conditions is the initial reaction substrate. The conversion of ammonia to nitrite occurs in two steps catalyzed by ammonia monooxygenase (Amo) and hydroxylamine oxidoreductase (Hao), respectively: [ka]

[0117] In some instances, reaction B is reported to show nitrous acid (HNO2) formation at low pH as follows: [ka]

[0118] In certain embodiments, the N. eutropha has a doubling time of less than 4, 5, 6, 7, 8, 9, or 10 hours, e.g., about 8 hours, e.g., 7-9 hours or 6-10 hours, when grown under batch culture conditions. In some embodiments, the doubling time is at least 3, 4, 5, or 6 hours under batch culture conditions. In some embodiments, the N. eutropha has a doubling time of less than 16, 18, 20, 22, 24, or 26 hours, e.g., about 20 hours, e.g., 19-21 hours or 18-22 hours, when grown under chemostat (i.e., continuous culture) conditions. In some embodiments, the doubling time is at least 10, 12, 14, 16, or 18 hours under chemostat conditions.

[0119] In certain embodiments, a continuous culture of N. eutropha from an OD of about 0.15-0.18 can reach an OD of about 0.5-0.6 in about 1-2 days. For example, in some embodiments, a continuous culture of N. eutropha can grow from an OD of about 0.15 to an OD of at least 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 over about 1 day, and in some embodiments, the culture can reach an OD in the range of 0.4-0.6 or 0.3-0.7 over about 1 day. In some embodiments, a continuous culture of N. eutropha can grow from an OD of about 0.15 to an OD of at least 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 over about 2 days, and in some embodiments, the culture can reach an OD in the range of 0.4-0.6 or 0.3-0.7 over about 2 days. In some embodiments, the continuous culture conditions include about 200 mM NH + In some embodiments, the continuous culture conditions are those set forth in Example 2.

[0120] In certain embodiments, the N. eutropha has at least about 50, 75, 125, or 150 micromolar NO. - / min, e.g., about 100-150, 75-175, 75-125, 100-125, 125-150, or 125-175 micromoles / min, e.g., about 125 micromoles NO2 - / min, NH4 + (e.g., about 200 mM) to nitrite (e.g., reaching a maximum of about 180 mM). In some embodiments, the reaction rate is about 10 9 CFU / ml measured in approximately 1 L chemostat cultures.

[0121] In certain embodiments, the N. eutropha is cultured in a medium containing at least 50 mM, 75 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 275 mM, or 300 mM, e.g., about 150-200, 175-225, 200-250, 225-275, 250-300 mM, e.g., about 200 mM or about 250 mM NH4. + (or NH3). In certain embodiments, the N. eutropha is grown in a bioreactor at these ammonium concentrations. In some embodiments, when the N. eutropha is grown at these ammonium concentrations, the nitrate or nitrite concentration can reach at least 60, 80, 100, 120, 140, 160, or 180 mM, e.g., about 140-180, 160-200, or 140-200 mM, e.g., about 160 mM or 180 mM.

[0122] In certain embodiments, the present disclosure provides high-density cultures of N. eutropha, e.g., N. eutropha strain D23. For example, a high-density culture composition can include a cell suspension of an actively dividing culture of N. eutropha bacteria having an OD of at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, e.g., about 0.2-0.6, 0.3-0.6, 0.4-0.6, 0.5-0.6, or 0.4-0.7, wherein the composition is substantially free of other organisms.

[0123] In some embodiments, the N. eutropha is stable for at least 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months when stored at 4° C. In some embodiments, the storage method includes resuspending the cells in a buffer containing one or more of NaHPO and MgCl, e.g., 50 mM NaHPO and 2 mM MgCl, e.g., the storage buffer described in Example 2. For example, the storage conditions can be those specified in Example 2. In some embodiments, the N. eutropha is resuspended in 200 mM NH4 +(pH 6-8, e.g., 7) continuously cultured. Stability may include one or more of: 1) retention of viability; 2) retention of relevant properties, such as the ability to produce a given level of nitrite.

[0124] In certain embodiments, NH + and NH3 may be used interchangeably throughout this disclosure.

[0125] The present disclosure provides, inter alia, a method for altering the composition of a subject's skin microbiome, the method comprising administering, e.g., applying, to the surface of the skin, a preparation comprising ammonia-oxidizing bacteria, the amount and frequency of administration, e.g., application, being sufficient to reduce the proportion of pathogenic bacteria on the surface of the skin.

[0126] Ammonia-oxidizing bacteria, in some embodiments, are ubiquitous, gram-negative, obligate chemoautotrophic bacteria that have the unique ability to generate energy solely from the conversion of ammonia to nitrite.

[0127] In some embodiments, the method may further include selecting a subject based on the subject needing a reduction in the rate of pathogenic bacteria on the surface of the skin.

[0128] In some embodiments, the preparation comprising ammonia-oxidizing bacteria comprises at least one of ammonia, an ammonium salt, and urea.

[0129] In some embodiments, the preparation comprising ammonia oxidizing bacteria comprises a controlled release material, for example, a slow release material.

[0130] In some embodiments, the ammonia-oxidizing bacteria preparation includes an excipient, such as one of a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. The excipient, such as one of a pharmaceutically acceptable excipient and a cosmetically acceptable excipient, can be suitable for one of topical, nasal, pulmonary, and gastrointestinal administration. The excipient, such as one of a pharmaceutically acceptable excipient and a cosmetically acceptable excipient, can be a surfactant. The surfactant may be selected from the group consisting of cocamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol esters (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium laureth sulfate / lauryl glucoside / cocamidopropyl betaine (Plantapon 611 L UP), sodium laureth sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucosides (e.g., Plantaren 2000 N UP), sodium laureth sulfate (Plantaren 200), Dr. Bronner's Castile Soap, lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), polysulfonic acid alkyl polyglucoside (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. Dr. Bronner's Castile Soap includes water, organic coconut oil, potassium hydroxide, organic olive oil, fair trade organic hemp oil, organic jojoba oil, citric acid, and tocopherol. In some embodiments, the excipient includes one or more, for example, all, of water, organic coconut oil, potassium hydroxide, organic olive oil, fair trade organic hemp oil, organic jojoba oil, citric acid, and tocopherol.

[0131] In some embodiments, the preparation may be substantially free of other organisms.

[0132] In some embodiments, the preparation is disposed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. The preparation can be provided as a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage.

[0133] In some embodiments, the preparation may include a moisturizer, deodorizer, fragrance, colorant, insect repellent, cleanser, or UV blocker.

[0134] In some embodiments, excipients, e.g., pharmaceutically acceptable excipients or cosmetically acceptable excipients, can include anti-adherents, binders, coatings, disintegrants, fillers, flavors, colors, glidants, glidants, adsorbents, preservatives, or sweeteners.

[0135] In some embodiments, the preparation comprising ammonia-oxidizing bacteria comprises about 10 8 ~about 10 14 In certain embodiments, the preparation may contain about 1 x 10 CFU / L. 9 CFU / L ~ approx. 10 x 10 9 CFU / L.

[0136] In some embodiments, the preparation comprising ammonia-oxidizing bacteria may contain from about 50 milligrams (mg) to about 1000 mg of ammonia-oxidizing bacteria.

[0137] In some embodiments, the mass ratio of the ammonia-oxidizing bacteria to the excipient, e.g., a pharmaceutically acceptable excipient or a cosmetically acceptable excipient, ranges from about 0.1 grams / L to about 1 gram / L.

[0138] In some embodiments, the ammonia-oxidizing bacteria preparations are useful in the treatment or prevention of diseases or conditions associated with low nitrite levels, the treatment or prevention of body odor, the treatment for providing nitric oxide to a subject, or the treatment for inhibiting microbial growth, e.g., pathogenic microbial growth.

[0139] In some embodiments, the ammonia-oxidizing bacteria are selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof. The preparation may further comprise an organism selected from the group consisting of Lactobacillus, Streptococcus, Bifidobacter, and combinations thereof. In certain aspects, the preparation is substantially free of organisms other than ammonia-oxidizing bacteria.

[0140] In some embodiments, the preparation comprising ammonia-oxidizing bacteria may comprise ammonia-oxidizing bacteria in a growth state. In some embodiments, the preparation comprising ammonia-oxidizing bacteria may comprise ammonia-oxidizing bacteria in a storage state.

[0141] In some embodiments, the methods of the present disclosure can be used to provide cosmetic products. In some embodiments, the methods of the present disclosure can be used to provide therapeutic products. The preparations can be useful for treating at least one of HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne (e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, hives, rosacea, skin infections, vascular disease, vaginal yeast infections, sexually transmitted diseases, heart disease, atherosclerosis, baldness, leg ulcers secondary to diabetes or bed restraint, angina pectoris, particularly chronic stable angina pectoris, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer.

[0142] In certain embodiments, the preparation may be useful in treating at least one of acne, e.g., acne vulgaris, eczema, psoriasis, hives, rosacea, and skin infections.

[0143] In some embodiments, the preparation may be provided in a container, and the preparation and container have a weight of less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams.

[0144] In some embodiments, the preparation has from about 0.1% to less than about 10% surfactant. In certain aspects, the preparation can be substantially free of surfactant.

[0145] In some embodiments, the preparation may include a chelating agent. In some embodiments, the preparation may be substantially free of a chelating agent.

[0146] In some embodiments, the method can include applying the preparation about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times daily. In certain aspects, the preparation can be applied once daily. In certain other aspects, the preparation can be applied twice daily.

[0147] In some embodiments, the preparation may be applied for about 1 to 3, 3 to 5, 5 to 7, 7 to 9, 5 to 10, 10 to 14, 12 to 18, 12 to 21, 21 to 28, 28 to 35, 35 to 42, 42 to 49, 49 to 56, 46 to 63, 63 to 70, 70 to 77, 77 to 84, or 84 to 91 days. In certain aspects, the preparation may be applied for about 16 days.

[0148] In some embodiments, the method may further comprise obtaining a sample from the surface of the skin. In certain aspects, the method may further comprise isolating bacterial DNA in the sample. In certain aspects, the method may further comprise sequencing the bacterial DNA in the sample.

[0149] In some embodiments, administration of ammonia-oxidizing bacteria provides an increase in the proportion of non-pathogenic bacteria on a surface. In certain aspects, the non-pathogenic bacteria can be commensal non-pathogenic bacteria. In certain aspects, the non-pathogenic bacteria can be commensal non-pathogenic bacteria of the genus Staphylococcus. In certain aspects, the non-pathogenic bacteria can be the commensal non-pathogenic bacteria Staphylococcus epidermidis.

[0150] In some embodiments, the proportion of non-pathogenic Staphylococcus increases or is identified as increasing after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. In certain aspects, the proportion of non-pathogenic Staphylococcus epidermidis Staphylococcus increases or is identified as increasing after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.

[0151] In some embodiments, potentially pathogenic or disease-associated Propionibacteria are reduced or identified as being reduced after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.

[0152] In some embodiments, potentially pathogenic or disease-associated Stenotrophomonas is reduced or identified as being reduced after about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks.

[0153] In some embodiments, the surface of the skin comprises a wound.

[0154] In some embodiments, a method for treating acne, e.g., acne vulgaris, may be provided by one or more methods of the present disclosure. In some embodiments, a method for treating eczema may be provided by one or more methods of the present disclosure. In some embodiments, a method for treating psoriasis may be provided by one or more methods of the present disclosure. In some embodiments, a method for treating urticaria may be provided by one or more methods of the present disclosure. In some embodiments, a method for treating rosacea may be provided by one or more methods of the present disclosure. In some embodiments, a method for treating skin infections may be provided by one or more methods of the present disclosure. In some embodiments, a method for reducing the amount of unwanted bacteria on the surface of a subject is provided.

[0155] In some embodiments, the methods herein (e.g., methods of administering N. eutropha bacteria, e.g., strain D23 bacteria, to a subject in need thereof) further include treating the subject with an antibiotic. In embodiments, the antibiotic is a tetracycline, a lincosamide (e.g., clindamycin), a macrolide (e.g., erythromycin), an aminoglycoside (e.g., gentamicin), a β-lactam (e.g., piperacillin), a β-lactamase inhibitor (e.g., tazobactam), or any combination thereof (e.g., a combination of a β-lactam (e.g., piperacillin) and a β-lactamase inhibitor (e.g., tazobactam)). In some embodiments, the antibiotic is one to which the bacteria is susceptible. In embodiments, the antibiotic is administered after the bacteria has achieved the desired therapeutic effect. In embodiments, the antibiotic is one to which the bacteria is resistant. In embodiments, the antibiotic is administered before or while the bacteria is achieving its therapeutic effect.

[0156] It is understood that the compositions and methods herein involving bacteria can also involve multiple bacteria, for example, a method of administering N. eutropha bacteria can also involve administering multiple N. eutropha bacteria.

[0157] In certain aspects, the present disclosure also provides nucleic acids comprising a sequence of contiguous nucleotides (e.g., 15-100 nucleotides) from the D23 genome, e.g., the sequence of a gene provided herein, e.g., a gene set forth in Table 1, Figures 6-8, or Supplementary Table 1, or SEQ ID NO: 66, or the reverse complement of any of the foregoing. In related aspects, the present disclosure provides nucleic acids comprising a sequence of contiguous nucleotides (e.g., 15-100 nucleotides) from SEQ ID NO: 1 or its reverse complement. In related aspects, the present disclosure provides nucleic acids comprising a sequence of contiguous nucleotides (e.g., 15-100 nucleotides) from a gene in Table 1 (e.g., the sequence of SEQ ID NO: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33), or the reverse complement thereof.

[0158] In some embodiments, the nucleic acid comprises a non-naturally occurring sequence, another modification such as a label, or both. In some embodiments, the sequence of contiguous nucleotides is not a sequence found in N. eutropha strain C91. In some embodiments, the nucleic acid comprises a heterologous sequence 5' to the sequence of 15-100 contiguous nucleotides, a heterologous sequence 3' to the sequence of 15-100 contiguous nucleotides, or both. In some embodiments, the nucleic acid has a length of 10-15, 15-20, 20-25, 25-30, 30-24, or 35-40 nucleotides. In some embodiments, the nucleic acid is conjugated, e.g., covalently linked, to a detectable label, e.g., a fluorescent label. In some embodiments, the nucleic acid comprises 10-15, 15-20, 20-25, 25-30, 30-24, 35-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 contiguous nucleotides from the D23 genome. In some embodiments, the nucleic acid comprises at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides from the D23 genome. In some embodiments, the nucleic acid is DNA.

[0159] In some aspects, the disclosure provides compositions or kits comprising a first nucleic acid and a second nucleic acid. In some embodiments, the first nucleic acid comprises contiguous nucleotides (e.g., 15-100 nucleotides) from SEQ ID NO:1, SEQ ID NO:66, a gene in Figures 6-8, or a gene in Table 1, or a reverse complement thereof. In some embodiments, the second nucleic acid comprises contiguous nucleotides (e.g., 15-100 nucleotides) from SEQ ID NO:1, SEQ ID NO:66, a gene in Figures 6-8, or a gene in Table 1, or a reverse complement thereof. In some embodiments, the nucleic acid has a non-naturally occurring sequence, e.g., a sequence not found in N. eutropha strain C91. In some embodiments, the first nucleic acid and the second nucleic acid define an amplicon of a gene in Table 1, e.g., the sequence of SEQ ID NO:5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33, or a reverse complement thereof.

[0160] In some embodiments, the first nucleic acid has a sequence corresponding to a first region of SEQ ID NO:1, and the reverse complement of the second nucleic acid has a sequence corresponding to a second region of SEQ ID NO:1, and the first and second regions are separated by a distance suitable for PCR. In some embodiments, the reverse complement of the first nucleic acid has a sequence corresponding to the first region of SEQ ID NO:1, and the second nucleic acid has a sequence corresponding to the second region of SEQ ID NO:1, and the first and second regions are separated by a distance suitable for PCR. In one embodiment, the distance suitable for PCR is no more than 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides of SEQ ID NO:1. In some embodiments, the first nucleic acid and the second nucleic acid describe an amplicon of SEQ ID NO:1. In some embodiments, the first nucleic acid and the second nucleic acid each have a melting temperature (Tm) suitable for PCR, for example, a Tm of about 55-65° C. or about 60-65° C. In some embodiments, the Tm of the first nucleic acid is within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1° C. of the Tm of the second nucleic acid.

[0161] In some embodiments, the first nucleic acid, the second nucleic acid, or the first and second nucleic acids each further comprise a heterologous sequence 5' of the contiguous nucleotide sequence. Alternatively, or in combination, in some embodiments, the first nucleic acid, the second nucleic acid, or the first and second nucleic acid each further comprise a heterologous sequence 3' of the contiguous nucleotide sequence from SEQ ID NO: 1 or SEQ ID NO: 66. In some embodiments, the first nucleic acid, the second nucleic acid, or the first and second nucleic acid each has a length of 15-20, 20-25, 25-30, 30-24, or 35-40 nucleotides. In some embodiments, the first nucleic acid, the second nucleic acid, or the first and second nucleic acid each is linked, e.g., covalently linked, to a detectable label, e.g., a fluorescent label. In some embodiments, the first nucleic acid comprises or consists of the sequence of SEQ ID NO: 64. In some embodiments, the second nucleic acid comprises or consists of the sequence of SEQ ID NO: 65. In some embodiments, the first nucleic acid, the second nucleic acid, or both, are DNA.

[0162] In some embodiments, the composition or kit comprises at least two pairs of primers (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 pairs), each pair recognizing an amplicon of a gene in Table 1 (e.g., the sequence of SEQ ID NO: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, or 33), or its reverse complement. In some embodiments, a first pair of primers recognizes an amplicon of an Amo gene (e.g., AmoA1, AmoA2, AmoB1, AmoB2, AmoC1, AmoC2, or AmoC3), and a second pair of primers recognizes an amplicon of an Amo gene (e.g., AmoA1, AmoA2, AmoB1, AmoB2, AmoC1, AmoC2, or AmoC3). In some embodiments, the first pair of primers recognizes an amplicon of the AmoA gene (e.g., AmoA1 or AmoA2). In some embodiments, the second pair of primers recognizes an amplicon of the AmoB gene (e.g., AmoB1 or AmoB2). In some embodiments, the third pair of primers recognizes an amplicon of the AmoC gene (e.g., AmoC1, AmoC2, or AmoC3).

[0163] In some embodiments, the kit includes a first container having a first nucleic acid disposed therein and a second container having a second nucleic acid disposed therein. The kit may include additional containers for, for example, a third, fourth, fifth, or sixth nucleic acid. In some embodiments, a pair of primers that recognize the amplicon are stored in a single container.

[0164] In some embodiments, the present disclosure also provides a nucleic acid comprising or consisting of the sequence of SEQ ID NO: 64. In some embodiments, the present disclosure also provides a nucleic acid comprising or consisting of the sequence of SEQ ID NO: 65. In some embodiments, the present disclosure also provides a molecule comprising a nucleic acid described herein and a detectable label, for example, a fluorescent label. The nucleic acid can consist of, for example, the sequence of SEQ ID NO: 64 or SEQ ID NO: 65.

[0165] In some aspects, the present disclosure provides a composition comprising a first molecule and a second molecule. In some embodiments, the first molecule comprises a nucleic acid described herein, e.g., a nucleic acid consisting of the sequence of SEQ ID NO: 64, and optionally comprises a detectable label, e.g., a fluorescent label. In some embodiments, the second molecule comprises a nucleic acid described herein, e.g., a nucleic acid consisting of the sequence of SEQ ID NO: 65, and optionally comprises a detectable label, e.g., a fluorescent label.

[0166] In some embodiments, the kit comprises a first container having a first molecule disposed therein and a second container having a second molecule disposed therein.

[0167] In some embodiments, the kits described herein further comprise one or more of a buffer, an enzyme (e.g., a polymerase, e.g., a thermostable polymerase such as Taq), a nucleotide (e.g., dNTP), and an optionally dye-labeled chain-terminating nucleotide (e.g., dideoxynucleotide), which components may be provided separately or as part of a single composition.

[0168] In certain aspects, the present disclosure provides methods for detecting the presence of D23 N. eutropha nucleic acid in a sample, the methods comprising performing a polymerase chain reaction (PCR) on the sample using primers specific for D23 N. eutropha and determining whether a PCR product is produced, wherein the presence of a PCR product indicates the presence of D23 N. eutropha nucleic acid in the sample. In some embodiments, at least two PCR reactions are performed, e.g., 3, 4, 5, 6, 7, 8, 9, or 10 PCR reactions. In some embodiments, the PCR reactions are performed in separate reaction volumes. In some embodiments, two or more PCR reactions are performed in multiplex.

[0169] In some embodiments, the primers specific for D23 N. eutropha are a first and second nucleic acid described herein, e.g., a first and second nucleic acid from a composition or kit described herein. In some embodiments, the first primer comprises or consists of the sequence of SEQ ID NO:65, and the second primer comprises or consists of the sequence of SEQ ID NO:66.

[0170] In some embodiments, the PCR reaction is a quantitative PCR reaction or a real-time PCR reaction. In some embodiments, the PCR reaction comprises a TaqMan reaction. In some embodiments, the PCR reaction comprises cycling the temperature of the reaction mixture between a denaturation temperature (e.g., about 95°C), an annealing temperature (e.g., 45-68, 55-65, or 60-65°C), and an extension temperature (e.g., about 68°C) for a number of cycles sufficient to generate a detectable PCR product, e.g., about 10, 15, 20, 25, or 30 cycles. In some embodiments, detecting the PCR product comprises detecting fluorescence from the PCR product. In some embodiments, a positive control is performed, e.g., using a known D23 N. eutropha nucleic acid as a template. In some embodiments, a negative control is used, e.g., without a template or using another bacterial nucleic acid as a template.

[0171] In certain aspects, the present disclosure provides methods for detecting the presence of D23 N. eutropha nucleic acid in a sample, comprising detecting binding of a nucleic acid described herein to the sample, the presence of binding indicating the presence of D23 N. eutropha nucleic acid in the sample. In some embodiments, binding is detected by primer extension or RNase protection.

[0172] In some embodiments of the methods herein, the sample contains at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 bacterial strains. In some embodiments, the sample is derived from the skin of a subject, e.g., a human subject. In some embodiments, the methods herein include detecting one or more additional types of bacteria in the sample, e.g., Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. The present invention provides, for example, the following items. (Item 1) Optimized growth rate, Optimized NH4+ oxidation rate, and A purified, optimized Nitrosomonas eutropha (N. eutropha) bacterial preparation having at least one property selected from optimized tolerance to NH4+. (Item 2) The N. eutropha bacterial preparation according to Item 1, wherein the optimized growth rate is a rate that allows continuous cultivation of N. eutropha at an OD600 (optical density at 600 nm) of about 0.15 to 0.18 to reach an OD600 of about 0.5 to 0.6 in about 1 to 2 days. (Item 3) 3. The N. eutropha bacterial preparation according to item 1 or 2, wherein the optimized growth rate is a doubling time of about 8 hours when cultured under batch culture conditions. (Item 4) 4. The N. eutropha bacterial preparation according to any one of items 1 to 3, wherein the optimized NH4+ oxidation rate is a rate of at least about 125 micromoles / min that oxidizes NH4+ to NO2-. (Item 5) 5. The N. eutropha bacterial preparation according to any one of items 1 to 4, wherein the optimized resistance to NH4+ is the ability to grow for at least about 48 hours in a medium containing about 200 mM NH4+. (Item 6) 6. A N. eutropha bacterial preparation according to any one of items 1 to 5, having at least two properties selected from an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. (Item 7) 7. The N. eutropha bacterial preparation according to items 1 to 6, having an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. (Item 8) 8. A N. eutropha bacterial preparation according to any one of items 1 to 7, comprising a chromosome that hybridizes to SEQ ID NO: 1 at very high stringency. (Item 9) an AmoA protein having identity to SEQ ID NO: 6 or 12 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; an AmoB protein having identity to SEQ ID NO: 8 or 14 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; an amoC gene having identity to SEQ ID NO: 4, 10, or 16 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; and 100% identical; a cytochrome c554 protein having identity to SEQ ID NO: 24, 26, or 28 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; or a cytochrome cM552 protein having identity to SEQ ID NO: 30 or 32 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical. (Item 10) 10. The N. eutropha bacterial preparation of any of items 1-9, comprising 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of the sequence characteristics in Table 2. (Item 11) 11. The N. eutropha bacterial preparation according to item 10, comprising an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 1, e.g., V at position 1, of N. eutropha strain C91. (Item 12) 12. The N. eutropha bacterial preparation according to any of items 10 to 11, comprising an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 160 of N. eutropha strain C91, for example, to L at position 160. (Item 13) 13. The N. eutropha bacterial preparation according to any of items 10 to 12, comprising an AmoA1 or AmoA2 protein (or a gene encoding same) having a mutation at position 167 of N. eutropha strain C91, for example, to A at position 167. (Item 14) 14. The N. eutropha bacterial preparation according to any of items 10 to 13, comprising an AmoB1 or AmoB2 protein (or a gene encoding same) having a mutation at position 33 of N. eutropha strain C91, for example to V at position 33. (Item 15) 15. The N. eutropha bacterial preparation according to any of items 10 to 14, comprising an AmoB1 or AmoB2 protein (or a gene encoding same) having a mutation at position 165 of N. eutropha strain C91, for example to I at position 165. (Item 16) 16. A N. eutropha bacterial preparation according to any of items 10 to 15, comprising an AmoC3 protein (or a gene encoding it) having a mutation at position 79 of N. eutropha strain C91, for example to A at position 79. (Item 17) 17. The N. eutropha bacterial preparation according to any of items 10 to 16, comprising an AmoC3 protein (or a gene encoding same) having a mutation at position 271 of N. eutropha strain C91, for example, to V at position 271. (Item 18) 18. The N. eutropha bacterial preparation according to any of items 10 to 17, comprising a Hao1, Hao2, or Hao3 protein (or a gene encoding same) having a mutation at position 85 of N. eutropha strain C91, for example, to S at position 85. (Item 19) 19. The N. eutropha bacterial preparation according to any of items 10 to 18, comprising a Hao1, Hao2, or Hao3 protein (or a gene encoding same) having a mutation at position 312 of N. eutropha strain C91, for example, to E at position 312. (Item 20) 20. The N. eutropha bacterial preparation according to any of items 10 to 19, comprising a Hao1 protein (or a gene encoding same) having a mutation at position 163 of N. eutropha strain C91, for example, to A at position 163. (Item 21) 21. The N. eutropha bacterial preparation according to any of items 10 to 20, comprising a c554 CycA1, c554 CycA2, or c554 CycA3 protein (or a gene encoding same) having a mutation at position 65 of N. eutropha strain C91, for example to T at position 65. (Item 22) 22. The N. eutropha bacterial preparation according to any of items 10 to 21, comprising a c554 CycA1 protein (or a gene encoding same) having a mutation at position 186 of N. eutropha strain C91, for example to T at position 186. (Item 23) 23. The N. eutropha bacterial preparation according to any of items 10 to 22, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding same) having a mutation at position 63 of N. eutropha strain C91, for example to V at position 63. (Item 24) 24. The N. eutropha bacterial preparation according to any of items 10 to 23, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding same) having a mutation at position 189 of N. eutropha strain C91, for example to P at position 189. (Item 25) 25. The N. eutropha bacterial preparation according to any of items 10 to 24, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding same) having a mutation at position 206 of N. eutropha strain C91, for example, at position 206 insE. (Item 26) 26. The N. eutropha bacterial preparation according to any of items 10 to 25, comprising a cM552 CycB1 or cM552 CycB2 protein (or a gene encoding same) having a mutation at position 207 of N. eutropha strain C91, for example, at position 207 insE. (Item 27) 27. The N. eutropha bacterial preparation according to any of items 10 to 26, comprising a cM552 CycB1 protein (or a gene encoding same) having a mutation at position 195 of N. eutropha strain C91, for example, to insD at position 195. (Item 28) 28. The N. eutropha bacterial preparation according to any of items 10 to 27, comprising a cM552 CycB1 protein (or a gene encoding same) having a mutation at position 196 of N. eutropha strain C91, for example, to insD at position 196. (Item 29) 29. The N. eutropha bacterial preparation according to any of items 10 to 28, comprising a cM552 CycB1 protein (or a gene encoding same) having a mutation at position 197 of N. eutropha strain C91, for example, at position 197 insD. (Item 30) 10. The N. eutropha bacterial preparation of any of the preceding items, comprising at least one structural difference relative to wild-type bacteria, such as N. eutropha strain C91, e.g., at least one mutation. (Item 31) A N. eutropha bacterial preparation according to any of the preceding items, comprising nucleic acids that can be amplified using a pair of primers described herein, for example, a primer comprising the sequence of SEQ ID NO: 64 and a primer comprising the sequence of SEQ ID NO: 65. (Item 32) 6. A N. eutropha bacterial preparation according to any of the preceding items, comprising a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to the gene of FIG. 6 or the protein encoded by the gene of FIG. 6. (Item 33) 10. The N. eutropha bacterial preparation of any of the preceding items, comprising a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any of SEQ ID NOs: 64-66 or a protein encoded by any of SEQ ID NOs: 64-66. (Item 34) A N. eutropha bacterium, or a purified preparation thereof, containing a mutation in the ammonia monooxygenase gene, the hydroxylamine oxidoreductase gene, the cytochrome c554 gene, or the cytochrome cm552 gene relative to a wild-type bacterium, such as N. eutropha strain C91. (Item 35) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the amoA1 gene. (Item 36) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the amoA2 gene. (Item 37) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the amoB1 gene. (Item 38) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the amoB2 gene. (Item 39) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the amoC3 gene. (Item 40) 40. The N. eutropha bacterium or purified preparation thereof according to any of items 34 to 39, wherein the mutation is at a position described herein, for example at a position described in Table 2. (Item 41) 40. The N. eutropha bacterium or a purified preparation thereof according to any of items 34 to 39, wherein the mutation is a mutation described herein, for example a mutation described in Table 2. (Item 42) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the hao1 gene. (Item 43) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the hao2 gene. (Item 44) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the hao3 gene. (Item 45) 45. The N. eutropha bacterium or a purified preparation thereof according to any of items 42 to 44, wherein the mutation is at a position described herein, for example at a position described in Table 2. (Item 46) 45. The N. eutropha bacterium, or a purified preparation thereof, according to any of items 42 to 44, wherein the mutation is a mutation described herein, for example a mutation described in Table 2. (Item 47) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the c554 cycA1 gene. (Item 48) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the c554 cycA2 gene. (Item 49) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the c554 cycA3 gene. (Item 50) 50. The N. eutropha bacterium or purified preparation thereof according to any of items 47 to 49, wherein the mutation is at a position described herein, for example at a position described in Table 2. (Item 51) 50. The N. eutropha bacterium or purified preparation thereof according to any of items 47 to 49, wherein the mutation is a mutation described herein, for example a mutation described in Table 2. (Item 52) 35. The N. eutropha bacterium or a purified preparation thereof according to item 34, wherein the mutation is in the cM552 cycB1 gene. (Item 53) 35. The N. eutropha bacterium, or a purified preparation thereof, according to item 34, wherein the mutation is in the c554 cycB2 gene. (Item 54) 54. The N. eutropha bacterium according to any of items 52 to 53, or a purified preparation thereof, wherein the mutation is at a position described herein, for example, at a position described in Table 2. (Item 55) 54. The N. eutropha bacterium or a purified preparation thereof according to any of items 52 to 53, wherein the mutation is a mutation described herein, for example a mutation described in Table 2. (Item 56) 2. The purified, optimized N. eutropha bacterial preparation according to item 1, comprising a mutation in the ammonia monooxygenase gene, the hydroxylamine oxidoreductase gene, the cytochrome c554 gene, or the cytochrome cm552 gene. (Item 57) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the amoA1 gene. (Item 58) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the amoA2 gene. (Item 59) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the amoB1 gene. (Item 60) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the amoB2 gene. (Item 61) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the amoC3 gene. (Item 62) 63. The purified, optimized N. eutropha bacterial preparation according to any one of Items 57 to 61, wherein the mutation is at a position described herein, for example, at a position described in Table 2. Item 64. The purified, optimized N. eutropha bacterial preparation according to any one of Items 57 to 61, wherein the mutation is a mutation described herein, for example, a mutation described in Table 2. 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the hao1 gene. (Item 65) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the hao2 gene. (Item 66) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the hao3 gene. (Item 67) Item 68. The purified, optimized N. eutropha bacterial preparation according to any one of Items 64 to 66, wherein the mutation is at a position described herein, for example, at a position described in Table 2. Item 69. The purified, optimized N. eutropha bacterial preparation according to any one of Items 64 to 66, wherein the mutation is a mutation described herein, for example, a mutation described in Table 2. 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the c554 cycA1 gene. (Item 70) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the c554 cycA2 gene. (Item 71) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the c554 cycA3 gene. (Item 72) Item 73. The purified, optimized N. eutropha bacterial preparation according to any one of Items 69 to 71, wherein the mutation is at a position described herein, for example, at a position described in Table 2. Item 74. The purified, optimized N. eutropha bacterial preparation according to any one of Items 69 to 71, wherein the mutation is a mutation described herein, for example, a mutation described in Table 2. 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the cM552 cycB1 gene. (Item 75) 57. The purified, optimized N. eutropha bacterial preparation of item 56, wherein the mutation is in the cM552 cycB2 gene. (Item 76) 76. The purified, optimized N. eutropha bacterial preparation of any of items 56, 74, and 75, wherein the mutation is at a position described herein, e.g., at a position described in Table 2. (Item 77) 76. The purified, optimized N. eutropha bacterial preparation of any of items 56, 74, and 75, wherein the mutation is a mutation described herein, e.g., a mutation described in Table 2. (Item 78) 35. The N. eutropha bacterium of item 34, or a purified preparation thereof, having a mutation at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, cM552 cycB1 gene, and c554 cycB2 gene. (Item 79) 57. The purified, optimized N. eutropha bacterial preparation of item 56, having mutations at at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 positions in one or more of the amoA1 gene, amoA2 gene, amoB1 gene, amoB2 gene, amoC3 gene, hao1 gene, hao2 gene, hao3 gene, c554 cycA1 gene, c554 cycA2 gene, c554 cycA3 gene, cM552 cycB1 gene, and c554 cycB2 gene. (Item 80) A N. eutropha bacterium containing a chromosome that hybridizes to SEQ ID NO:1 at high stringency. (Item 81) 81. The N. eutropha bacterium according to item 80, wherein the chromosome hybridizes to SEQ ID NO: 1 with very high stringency. (Item 82) 82. The N. eutropha bacterium according to item 80 or 81, comprising at least one of the genes in Figures 6 to 8 or a gene having at least 80% identity thereto. (Item 83) 82. The N. eutropha bacterium according to item 80 or 81, comprising at least one of the genes in Figures 6 to 8. (Item 84) 83. The N. eutropha bacterium according to any of items 80 to 82, which lacks any plasmid that is at least about 80% identical to SEQ ID NO:2 or SEQ ID NO:3. (Item 85) 85. The N. eutropha bacterium according to any one of items 80 to 84, which lacks any plasmid. (Item 86) A N. eutropha bacterium comprising one or more of an AmoA1 gene that is at least about 98.9% identical to SEQ ID NO:7 and an amoA2 gene that is at least about 98.8% identical to SEQ ID NO:13. (Item 87) A N. eutropha bacterium comprising one or more of an AmoA1 protein that is at least about 99.0% identical to SEQ ID NO:6 and an AmoA2 protein that is at least about 99.0% identical to SEQ ID NO:12. (Item 88) A N. eutropha bacterium comprising one or more of an amoB1 gene that is at least about 99.2% identical to SEQ ID NO:9 and an amoB2 gene that is at least about 99.2% identical to SEQ ID NO:15. (Item 89) 89. The N. eutropha bacterium of item 88, further comprising one or more of an AmoA1 gene or an amoA2 gene that is at least about 98.9% identical to SEQ ID NO: 7 or 13. (Item 90) A N. eutropha bacterium comprising one or more of an AmoB1 protein at least about 99.6% identical to SEQ ID NO:8 or an AmoB1 protein at least about 99.6% identical to SEQ ID NO:14. (Item 91) 91. The N. eutropha bacterium according to item 90, further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6 and an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12. (Item 92) A N. eutropha bacterium comprising one or more of an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO:17. (Item 93) 93. The N. eutropha bacterium of item 92, further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, and an amoB2 gene at least about 99.2% identical to SEQ ID NO:15. (Item 94) A N. eutropha bacterium comprising an AmoC3 protein that is at least about 99.4% identical to SEQ ID NO:16. (Item 95) 95. The N. eutropha bacterium of item 94, further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, and an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14. (Item 96) A N. eutropha bacterium comprising one or more of a hao1 gene that is at least about 99.1% identical to SEQ ID NO: 19, a hao2 gene that is at least about 99.5% identical to SEQ ID NO: 21, and a hao3 gene that is at least about 99.3% identical to SEQ ID NO: 23. (Item 97) 97. The N. eutropha bacterium of item 96, further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, an amoB2 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, and an amoC3 gene at least about 99.0% identical to SEQ ID NO:17. (Item 98) Item 99: A N. eutropha bacterium comprising one or more of a Hao1 protein that is at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein that is at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein that is at least about 99.7% identical to SEQ ID NO: 22. 99. The N. eutropha bacterium of item 98, further comprising an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, or an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16. (Item 100) A N. eutropha bacterium comprising one or more of a cycA1 gene that is at least about 98.1% identical to SEQ ID NO:25, a cycA2 gene that is at least about 98.8% identical to SEQ ID NO:27, and a cycA3 gene that is at least about 99.4% identical to SEQ ID NO:28. (Item 101) 101. The N. eutropha bacterium of paragraph 100, further comprising one or more of an amoA1 gene at least about 98.9% identical to SEQ ID NO:7, an amo2 gene at least about 98.9% identical to SEQ ID NO:13, an amoB1 gene at least about 99.2% identical to SEQ ID NO:9, an amoB2 gene at least about 99.2% identical to SEQ ID NO:15, an amoC1 gene at least about 99.9% identical to SEQ ID NO:5, an amoC2 gene at least about 99.9% identical to SEQ ID NO:11, an amoC3 gene at least about 99.0% identical to SEQ ID NO:17, a hao1 gene at least about 99.1% identical to SEQ ID NO:19, a hao2 gene at least about 99.5% identical to SEQ ID NO:21, and a hao3 gene at least about 99.3% identical to SEQ ID NO:23. (Item 102) A N. eutropha bacterium comprising one or more of a CycA1 protein that is at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein that is at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein that is at least about 99.7% identical to SEQ ID NO: 28. (Item 103) 103. The N. eutropha bacterium of item 102, further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, and a Hao3 protein at least about 99.7% identical to SEQ ID NO: 22. (Item 104) A N. eutropha bacterium comprising one or more of a cycB1 gene that is at least about 96.8% identical to SEQ ID NO: 31 and a cycB2 gene that is at least about 97.2% identical to SEQ ID NO: 33. (Item 105) an amoA1 gene at least about 98.9% identical to SEQ ID NO:7; an amo2 gene at least about 98.9% identical to SEQ ID NO:13; an amoB1 gene at least about 99.2% identical to SEQ ID NO:9; an amoB2 gene at least about 99.2% identical to SEQ ID NO:15; an amoC1 gene at least about 99.9% identical to SEQ ID NO:5; an amoC2 gene at least about 99.9% identical to SEQ ID NO:11; an amoC3 gene at least about 99.0% identical to SEQ ID NO:17; 19, a hao2 gene at least about 99.5% identical to SEQ ID NO: 21, a hao3 gene at least about 99.3% identical to SEQ ID NO: 23, a cycA1 gene at least about 98.1% identical to SEQ ID NO: 25, a cycA2 gene at least about 98.8% identical to SEQ ID NO: 27, and a cycA3 gene at least about 99.4% identical to SEQ ID NO: 28. (Item 106) A N. eutropha bacterium comprising one or more of a CycB1 protein that is at least about 97.2% identical to SEQ ID NO: 30 or a CycB2 protein that is at least about 98.8% identical to SEQ ID NO: 32. (Item 107) 107. The N. eutropha bacterium of item 106, further comprising one or more of an AmoA1 protein at least about 99.0% identical to SEQ ID NO: 6, an AmoA2 protein at least about 99.0% identical to SEQ ID NO: 12, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 8, an AmoB1 protein at least about 99.6% identical to SEQ ID NO: 14, an AmoC3 protein at least about 99.4% identical to SEQ ID NO: 16, a Hao1 protein at least about 99.6% identical to SEQ ID NO: 18, a Hao2 protein at least about 99.7% identical to SEQ ID NO: 20, a Hao3 protein at least about 99.7% identical to SEQ ID NO: 22, a CycA1 protein at least about 99.2% identical to SEQ ID NO: 24, a CycA2 protein at least about 99.7% identical to SEQ ID NO: 26, and a CycA3 protein at least about 99.7% identical to SEQ ID NO: 28. (Item 108) A N. eutropha bacterium comprising one or more genes according to SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, and 33. (Item 109) A N. eutropha bacterium comprising one or more proteins according to SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, and 32. (Item 110) A N. eutropha bacterium comprising a protein that is mutant for at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the amino acid positions listed in Table 2 of N. eutropha strain C91. (Item 111) A N. eutropha bacterium comprising a protein that is mutant for all of the amino acid positions listed in Table 2 of N. eutropha strain C91. (Item 112) 112. The N. eutropha bacterium of any one of items 1 to 111, which is transgenic. (Item 113) 113. The N. eutropha bacterium according to any one of items 80 to 112, having at least one property selected from an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. (Item 114) Item 115. The N. eutropha bacterium according to Item 113, having at least two properties selected from an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. 114. The N. eutropha bacterium according to item 113, having an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. (Item 116) 116. A composition comprising the N. eutropha bacterium according to any one of items 1 to 115, wherein the composition is substantially free of other organisms. (Item 117) 116. A composition comprising the N. eutropha bacterium according to any one of items 1 to 115 and further comprising a second organism, wherein the composition is substantially free of other organisms. (Item 118) 118. The composition of claim 117, wherein the second organism is an ammonia-oxidizing bacterium. (Item 119) 118. The composition of claim 117, wherein the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof. (Item 120) Item 121. A composition comprising a cell suspension of an actively dividing culture of N. eutropha bacteria having an OD600 of at least about 0.2, the composition being substantially free of other organisms. A composition for topical administration, comprising the N. eutropha bacterium according to any one of items 1 to 115 and a pharmaceutically or cosmetically acceptable excipient suitable for topical administration. (Item 122) 122. The composition of item 121, which is substantially free of other organisms. (Item 123) 122. The composition of claim 121, further comprising a second organism. (Item 124) Item 124. The composition of item 123, wherein the second organism is an ammonia-oxidizing bacterium. (Item 125) Item 124. The composition of item 123, wherein the second organism is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, Lactobacillus, Streptococcus, and Bifidobacter, and combinations thereof. (Item 126) 126. The composition according to any of items 121 to 125, provided as or disposed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. (Item 127) 127. The composition according to any of items 121 to 126, further comprising a moisturizer, a deodorizer, a fragrance, a colorant, an insect repellent, a cleansing agent, or an ultraviolet light blocking agent. (Item 128) 128. The composition according to any of items 121 to 127, wherein the excipient comprises an anti-adherent, a binder, a coating agent, a disintegrant, a filler, a flavoring, a color, a glidant, a glidant, an adsorbent, a preservative, or a sweetener. (Item 129) 129. The composition according to any of items 121 to 128, wherein the concentration of N. eutropha in the composition is about 10 to 10 CFU / L. (Item 130) 130. The composition according to any of items 121 to 129, wherein the concentration of N. eutropha in the composition is about 10 CFU / ml. (Item 131) 131. The composition according to any of items 121 to 130, wherein the mass ratio of N. eutropha to pharmaceutical excipient is in the range of about 0.1 gram / L to about 1 gram / L. (Item 132) 116. A composition comprising at least about 1,000 L of the N. eutropha bacteria of any one of items 1 to 115 at about 10 CFU / L. (Item 133) A composition comprising at least about 1, 2, 5, 10, 20, 50, 100, 200, or 500 g of the N. eutropha bacterium of any one of items 1 to 115, for example as a dry formulation such as a powder. (Item 134) For example, an article of clothing comprising N. eutropha according to any one of items 1 to 115 at a concentration that provides one or more of the following: treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment to supply nitric oxide to a subject, or treatment to inhibit microbial growth. (Item 135) Item 135. The article of clothing of item 134, packaged. (Item 136) 136. The article of clothing according to items 134 to 135, packaged in a material resistant to gas exchange or a material resistant to water. (Item 137) A fabric comprising N. eutropha according to any one of items 1 to 115. (Item 138) A knitted yarn comprising N. eutropha according to any one of items 1 to 115. (Item 139) A sewing thread comprising N. eutropha according to any one of items 1 to 115. (Item 140) 1. A method for obtaining, e.g., producing, a N. eutropha bacterium having an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+, comprising: (a) culturing the bacterium under conditions that select for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+, thereby producing a culture; (b) testing a sample from the culture for an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+; (c) repeating the culturing step and the testing step until a bacterium having an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+ is obtained. (Item 141) 141. The method of claim 140, further comprising obtaining N. eutropha bacteria from a source. (Item 142) Item 142. The method of item 141, wherein the source is soil or the skin of an individual. (Item 143) Item 144. The method of Item 142, wherein culturing the bacterium under conditions that select for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized resistance to NH4+ comprises culturing the bacterium in an N. europae medium containing about 200 mM NH4+. 144. The method of claim 143, comprising the step of producing a pure culture. (Item 145) 145. The method according to item 143 or 144, comprising co-cultivating the N. eutropha together with at least one other type of ammonia-oxidizing bacteria. (Item 146) 146. The method according to any of items 140 to 145, wherein the N. eutropha in step (a) lacks an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized tolerance to NH4+. (Item 147) The method according to any one of Items 140 to 146, wherein step (c) comprises repeating the culturing step and the testing step until a bacterium having at least two of an optimized growth rate, an optimized NH4+ oxidation rate, and an optimized resistance to NH4+ is obtained. (Item 148) N. eutropha bacteria produced by the method according to any one of items 140 to 147. (Item 149) 1. A method for testing a N. eutropha preparation, comprising: assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+; and classifying the N. eutropha as permissive if the N. eutropha has one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 150) 150. The method of claim 149, further comprising testing the preparation for contaminating organisms. (Item 151) 151. The method according to any one of items 149 to 150, further comprising the steps of removing a sample from the preparation and performing a test on the sample. (Item 152) 152. The method according to any one of items 149 to 151, further comprising testing the medium in which the N. eutropha is cultured. (Item 153) 153. The method of any of items 149 to 152, further comprising packaging N. eutropha from the preparation into a package. (Item 154) 154. The method of any of items 149 to 153, further comprising commercializing N. eutropha from the preparation. (Item 155) A method for producing, e.g., manufacturing, N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until an OD600 of at least about 0.5 is reached. (Item 156) 156. The method of claim 155, further comprising assaying the N. eutropha and the culture medium for contaminating organisms. (Item 157) 157. The method of any of items 155-156, further comprising assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 158) 158. The method of any of items 155 to 157, comprising producing at least about 1,000 L / day of N. eutropha at about 10 CFU / L. (Item 159) A method for producing, e.g., manufacturing, N. eutropha, comprising contacting N. eutropha with a culture medium and culturing the N. eutropha until about at least about 1,000 L of N. eutropha is produced at about 1012 CFU / L. (Item 160) Item 159. The method of item 159, further comprising assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 161) 161. The method of any of items 159 to 160, further comprising the step of testing the N. eutropha or the culture medium for contaminating organisms. (Item 162) 162. The method according to any one of items 159 to 161, wherein the N. eutropha contacted with the culture medium is N. eutropha having one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 163) 1. A method of producing, e.g., producing, N. eutropha, comprising: (a) contacting N. eutropha with a culture medium; (b) culturing the N. eutropha for 1 to 2 days until the culture reaches an OD600 of about 0.5 to 0.6, thereby producing the culture. Item 164. The method of item 163, further comprising assaying the N. eutropha for one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 165) 165. The method according to any of items 163 to 164, further comprising the step of testing the culture for contaminating organisms. (Item 166) 166. The method according to any of items 163 to 165, wherein the N. eutropha in step (a) is N. eutropha having one or more of an optimized growth rate, an optimized NH4+ oxidation rate, or an optimized tolerance to NH4+. (Item 167) 167. The method of any of items 163 to 166, comprising producing at least about 1,000 L / day of N. eutropha at about 10 CFU / L. (Item 168) N. eutropha bacteria produced by the method according to any one of items 155 to 167. (Item 169) A N. eutropha preparation produced by the method described in any one of items 155 to 167. (Item 170) 169. The preparation of claim 169, wherein the preparation comprises at least about 0.1 to about 100 milligrams (mg) of N. eutropha. (Item 171) The reaction mixture contained N. eutropha at an optical density of about 0.5 to about 0.6. (Item 172) 116. A method of producing clothing having N. eutropha, the method comprising contacting an item of clothing with N. eutropha according to any one of items 1 to 115. (Item 173) Item 173. The method of item 172, comprising creating at least 10, 100, or 1000 clothing items. (Item 174) Item 173. The method of item 172, comprising contacting the clothing item with at least 10 CFU of N. eutropha. (Item 175) Item 173. The method of item 172, further comprising packaging the garment. (Item 176) A method for obtaining a preparation of N. eutropha, which method combines contacting N. eutropha according to any of items 1 to 115 with a pharmaceutically or cosmetically acceptable excipient. (Item 177) 177. The method of claim 176, further comprising mixing the N. eutropha with the excipient. (Item 178) 177. The method of claim 176, carried out under conditions that are substantially free of contaminating organisms. (Item 179) 116. A method for packaging N. eutropha, the method comprising combining N. eutropha according to any one of items 1 to 115 into a package. (Item 180) Item 179. The method of item 179, wherein the package is resistant to gas exchange or resistant to water. (Item 181) Item 179. The method of item 179, wherein the package is permeable to gas exchange, NH3, NH4+, or NO2-. (Item 182) 116. A method for inhibiting microbial growth on the skin of a subject, the method comprising topically administering to a subject in need thereof an effective dose of the N. eutropha bacterium of any one of items 1 to 115. (Item 183) 183. The method of claim 182, wherein the effective dose is approximately 1.5 x 10 CFU. (Item 184) 184. The method according to any of items 182 to 183, wherein the administration is performed twice a day. (Item 185) 185. The method according to any of items 182 to 184, wherein the subject is a human. (Item 186) 186. The method of any of items 182 to 185, wherein the microbial growth that is inhibited is growth of Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. (Item 187) 116. A method for providing nitric oxide to a subject, the method comprising placing an effective dose of the N. eutropha bacterium according to any one of items 1 to 115 in close proximity to the subject. (Item 188) 116. A method for reducing body odor, comprising topically administering to a subject in need thereof an effective dose of the N. eutropha bacterium according to any one of items 1 to 115. (Item 189) 116. A method for treating a disease associated with low nitrite levels, comprising topically administering to a subject in need thereof a therapeutically effective dose of the N. eutropha bacterium of any of items 1 to 115. (Item 190) 189. The method of claim 189, wherein the disease is HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, leg ulcers secondary to diabetes or bed restraint, angina pectoris, in particular chronic stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, or cancer. (Item 191) A method for treating a skin disorder, the method comprising topically administering to a subject in need thereof a therapeutically effective dose of the N. eutropha bacterium according to any one of items 1 to 115. (Item 192) 192. The method of claim 191, wherein the skin disorder is acne, e.g., acne vulgaris, rosacea, eczema, or psoriasis. (Item 193) 192. The method of claim 191, wherein the skin disorder is an infection in an ulcer, such as a venous ulcer, such as a leg ulcer, such as a venous leg ulcer, such as a diabetic foot ulcer. (Item 194) 194. The method of any one of items 191 to 193, wherein the topical administration comprises pre-treating the subject with N. eutropha, such as an N. eutropha according to any of items 1 to 115. (Item 195) 195. The method of any one of items 191 to 194, wherein topical administration comprises topical administration before the onset of said skin disorder. (Item 196) 196. The method of any one of items 191 to 195, wherein topical administration comprises topical administration after onset of said skin disorder. (Item 197) A method for promoting wound healing or closure, the method comprising administering to the wound an effective dose of the N. eutropha bacterium described in any of items 1 to 115. (Item 198) 198. The method of claim 197, wherein the wound contains one or more unwanted bacteria, e.g., pathogenic bacteria. (Item 199) The wound is infected with Staphylococcus aureus, Pseudomonas 198. The method of claim 197, comprising Bacillus subtilis, Bacillus aeruginosa, or Bacillus subtilis. (Item 200) Item 198. The method of item 197, wherein the N. eutropha is administered to the subject prior to the development of the wound. (Item 201) 198. The method of claim 197, wherein administering to the wound comprises administering to the subject prior to the development of the wound. (Item 202) 202. The method of any one of items 197 to 201, further comprising administering N. eutropha to the wound after the development of the wound. (Item 203) 116. A method for killing or inhibiting the growth of pathogenic bacteria, the method comprising contacting, e.g. applying, to skin, a N. eutropha bacterium, such as a N. eutropha bacterium according to any of items 1 to 115. (Item 204) 204. The method of claim 203, wherein the pathogen contributes to one or more of the following conditions: HIV dermatitis, ulcers, e.g., venous ulcers, e.g., leg ulcers, e.g., venous leg ulcers, e.g., infections in diabetic foot ulcers, atopic dermatitis, acne, e.g., acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, hives, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, leg ulcers secondary to diabetes or bed restraint, angina pectoris, particularly chronic stable angina pectoris, ischemic disease, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer. (Item 205) 205. The method of item 204, wherein the condition is an infection in an ulcer, such as a venous ulcer, such as a leg ulcer, such as a venous leg ulcer, such as a diabetic foot ulcer. (Item 206) 205. The method of claim 204, wherein the condition is a venous leg ulcer. (Item 207) 205. The method of claim 204, wherein the condition is acne, e.g., acne vulgaris. (Item 208) Item 205. The method of item 204, wherein the condition is acne vulgaris. (Item 209) 209. The method of any one of items 203 to 208, wherein the pathogenic bacteria is one or more of Propionibacterium acnes, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pyogenes, or Acinetobacter baumannii. (Item 210) 209. The method of any one of items 203 to 209, further comprising determining whether the subject is in need of killing or inhibiting the growth of a pathogen, e.g., determining that the subject is in need of killing or inhibiting the growth of a pathogen. (Item 211) 211. The method of any one of items 203 to 210, further comprising selecting said subject in need of killing or inhibiting the growth of a pathogen. (Item 212) 1. A method of altering the composition of the skin microbiome in a subject, comprising: administering, e.g., applying, to the surface of the skin a preparation comprising ammonia-oxidizing bacteria; The method, wherein the amount and frequency of administration, e.g., application, is sufficient to reduce the proportion of pathogenic bacteria on the surface of the skin. (Item 213) 213. The method of claim 212, further comprising selecting the subject based on the subject needing a reduction in the rate of pathogenic bacteria on the surface of the skin. (Item 214) 214. The method according to any one of items 212 to 213, wherein the preparation comprises at least one of ammonia, an ammonium salt, and urea. (Item 215) 215. The method according to any one of items 212 to 214, wherein the preparation comprises a controlled release material, such as a sustained release material. (Item 216) 216. The method of any one of items 212 to 215, wherein the ammonia oxidizing bacteria preparation further comprises an excipient, such as one of a pharmaceutically acceptable excipient or a cosmetically acceptable excipient. (Item 217) Item 217. The method of item 216, wherein the excipient, e.g., one of the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is suitable for one of topical, nasal, pulmonary, and gastrointestinal administration. (Item 218) 218. The method according to any one of items 216 to 217, wherein the excipient, for example one of the pharmaceutically acceptable excipient and the cosmetically acceptable excipient, is a surfactant. (Item 219) Item 219. The method of item 218, wherein the surfactant is selected from the group consisting of cocamidopropyl betaine (ColaTeric COAB), polyethylene sorbitol esters (e.g., Tween 80), ethoxylated lauryl alcohol (RhodaSurf 6 NAT), sodium laureth sulfate / lauryl glucoside / cocamidopropyl betaine (Plantapon 611 L UP), sodium laureth sulfate (e.g., RhodaPex ESB 70 NAT), alkyl polyglucosides (e.g., Plantaren 2000 N UP), sodium laureth sulfate (Plantaren 200), Dr. Bronner's Castile Soap, lauramine oxide (ColaLux Lo), sodium dodecyl sulfate (SDS), polysulfonic acid alkyl polyglucoside (PolySufanate 160 P), sodium lauryl sulfate (Stepanol-WA Extra K), and any combination thereof. (Item 220) 219. The method according to any one of items 212 to 219, wherein the preparation is substantially free of other organisms. (Item 221) 221. The method according to any one of items 212 to 220, wherein the preparation is disposed in a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. (Item 222) 222. The method according to any one of items 212 to 221, wherein the preparation is provided as a powder, cosmetic, cream, stick, aerosol, ointment, wipe, or bandage. (Item 223) 223. The method according to any one of items 212 to 222, wherein the preparation comprises a moisturizer, a deodorant, a fragrance, a colorant, an insect repellent, a cleansing agent, or an ultraviolet light blocking agent. (Item 224) 218. The method according to any one of items 216 to 217, wherein the excipient, such as the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, comprises an anti-adherent, a binder, a coating agent, a disintegrant, a filler, a flavoring, a color, a glidant, a glidant, an adsorbent, a preservative, or a sweetener. (Item 225) 225. The method according to any one of items 212 to 224, wherein the preparation comprising ammonia-oxidizing bacteria comprises about 10 to about 10 CFU / L. (Item 226) 226. The method of claim 225, wherein the preparation contains about 1 x 10 CFU / L to about 10 x 10 CFU / L. (Item 227) 227. The method according to any one of items 212 to 226, wherein the preparation comprising ammonia oxidizing bacteria comprises from about 50 milligrams (mg) to about 1000 mg of ammonia oxidizing bacteria. (Item 228) 228. The method according to any one of items 216 to 227, wherein the mass ratio of the ammonia-oxidizing bacteria to the excipient, for example, the pharmaceutically acceptable excipient or the cosmetically acceptable excipient, is in the range of about 0.1 gram / L to about 1 gram / L. (Item 229) 229. The method according to any one of items 212 to 228, wherein the ammonia oxidizing bacteria preparation is useful for the treatment or prevention of skin disorders, for the treatment or prevention of diseases or conditions associated with low nitrite levels, for the treatment or prevention of body odor, for supplying nitric oxide to a subject, or for the treatment of inhibiting microbial growth, e.g., pathogenic bacterial growth. (Item 230) 229. The method according to any one of items 212 to 229, wherein the ammonia oxidizing bacteria is selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof. (Item 231) 231. The method of any one of items 212 to 230, wherein the preparation comprises an organism selected from the group consisting of Lactobacillus, Streptococcus, Bifidobacter, and combinations thereof. (Item 232) 231. The method according to any one of items 212 to 230, wherein the preparation is substantially free of organisms other than ammonia oxidizing bacteria. (Item 233) 233. The method of any one of items 212 to 232, wherein the ammonia oxidizing bacteria preparation comprises ammonia oxidizing bacteria in a growing state. (Item 234) 233. The method of any one of items 212 to 232, wherein the ammonia oxidizing bacteria preparation comprises ammonia oxidizing bacteria in a storage state. (Item 235) 5. The method according to any one of items 212 to 234 for providing a cosmetic product. (Item 236) 235. The method according to any one of items 212 to 234 for providing a therapeutic drug product. (Item 237) 237. The method according to any one of items 212 to 236, wherein the preparation is useful for treating at least one of HIV dermatitis, infections in diabetic foot ulcers, atopic dermatitis, acne, e.g. acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, hives, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, heart diseases, atherosclerosis, baldness, leg ulcers secondary to diabetes or bed restraint, angina pectoris, in particular chronic stable angina pectoris, ischemic diseases, congestive heart failure, myocardial infarction, ischemia-reperfusion injury, laminitis, hypertension, hypertrophic organ degeneration, Raynaud's phenomenon, fibrosis, fibrotic organ degeneration, allergies, autoimmune sensitization, end-stage renal disease, obesity, impotence, pneumonia, primary immunodeficiency, epidermolysis bullosa, or cancer. (Item 238) 238. The method of claim 237, wherein the preparation is useful for treating at least one of acne, e.g., acne vulgaris, eczema, psoriasis, urticaria, rosacea, and skin infections. (Item 239) 239. The method of any one of items 212 to 238, wherein the preparation is provided in a container, and the preparation and the container have a weight of less than about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 grams. (Item 240) 239. The method of any one of items 212 to 239, wherein the preparation has from about 0.1% to less than about 10% surfactant. (Item 241) 241. The method according to any one of items 212 to 240, wherein the preparation is substantially free of surfactants. (Item 242) 242. The method according to any one of items 212 to 241, wherein the preparation comprises a chelating agent. (Item 243) 243. The method of any one of items 212 to 242, wherein the preparation is applied about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per day. (Item 244) The method according to any one of Items 212 to 243, wherein the preparation is applied once a day. (Item 245) The method according to any one of items 212 to 243, wherein the preparation is applied twice a day. (Item 246) 246. The method according to any one of items 212 to 245, wherein the preparation is applied for about 1 to 3, 3 to 5, 5 to 7, 7 to 9, 5 to 10, 10 to 14, 12 to 18, 12 to 21, 21 to 28, 28 to 35, 35 to 42, 42 to 49, 49 to 56, 46 to 63, 63 to 70, 70 to 77, 77 to 84, or 84 to 91 days. (Item 247) 247. The method according to any one of items 212 to 246, wherein the preparation is applied for about 16 days. (Item 248) 248. The method of any one of items 212 to 247, further comprising obtaining a sample from said surface of the skin. (Item 249) 249. The method of claim 248, further comprising isolating bacterial DNA in the sample. (Item 250) 240. The method of any one of items 248 to 249, further comprising sequencing the DNA of bacteria in the sample. (Item 251) 251. The method of any one of items 212 to 250, wherein administration of the ammonia oxidizing bacteria provides an increase in the proportion of non-pathogenic bacteria on the surface. (Item 252) 252. The method of claim 251, wherein the non-pathogenic bacteria are commensal non-pathogenic bacteria. (Item 253) 253. The method of claim 252, wherein the non-pathogenic bacteria are commensal non-pathogenic bacteria of the genus Staphylococcus. (Item 254) 254. The method of claim 253, wherein the non-pathogenic bacterium is the commensal non-pathogenic bacterium Staphylococcus epidermidis. (Item 255) 255. The method according to any one of items 252 to 254, wherein the non-pathogenic bacteria of the genus Staphylococcus increase after about two weeks or are identified as increasing after about two weeks. (Item 256) 256. The method of claim 255, wherein the non-pathogenic Staphylococcus epidermidis bacteria increases after about two weeks or is identified as increasing after about two weeks. (Item 257) 257. The method of any one of paragraphs 212 to 256, wherein potentially pathogenic or disease-associated Propionibacteria are reduced after about two weeks or are identified as being reduced after about two weeks. (Item 258) 258. The method of any one of paragraphs 212 to 257, wherein potentially pathogenic or disease-associated Stenotrophomonas is reduced after about two weeks or is identified as being reduced after about two weeks. (Item 259) 259. The method of any one of items 212 to 258, wherein said surface of the skin comprises a wound. (Item 260) 259. A method for treating acne, such as acne vulgaris, by the method according to any one of items 212 to 259. (Item 261) A method for treating eczema by the method according to any one of items 212 to 259. (Item 262) A method for treating psoriasis by the method according to any one of items 212 to 259. (Item 263) A method for treating urticaria by the method according to any one of items 212 to 259. (Item 264) 259. A method for treating rosacea by the method according to any one of items 212 to 259. (Item 265) A method for treating a skin infection by the method according to any one of Items 212 to 259. (Item 266) A method for reducing the amount of undesirable bacteria on the surface of an object by the method according to any one of items 212 to 258. (Item 267) A nucleic acid comprising a sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66 or its reverse complement, with the proviso that the nucleic acid has a non-naturally occurring sequence, or another modification, e.g., a label, or both. (Item 268) 268. The nucleic acid according to Item 267, wherein the sequence of 15 to 100 contiguous nucleotides is a sequence not found in N. eutropha strain C91. (Item 269) 269. The nucleic acid of item 267 or 268, further comprising a heterologous sequence 5' to said sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66. (Item 270) 269. The nucleic acid of item 267 or 268, further comprising a heterologous sequence 3' to said sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66. (Item 271) 269. The nucleic acid of item 267 or 268, further comprising a first heterologous sequence 5' to said sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66 and a second heterologous sequence 3' to said sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66. (Item 272) 272. The nucleic acid according to any of items 267 to 271, having a length of 15 to 20, 20 to 25, 25 to 30, 30 to 24, or 25 to 40 nucleotides. (Item 273) 273. The nucleic acid according to any of items 267 to 272, which is linked, e.g. covalently linked, to a detectable label, e.g. a fluorescent label. (Item 274) a first nucleic acid comprising 15 to 100 consecutive nucleotides from SEQ ID NO: 66; a second nucleic acid comprising 15 to 100 contiguous nucleotides from the reverse complement of SEQ ID NO: 66; and with the proviso that the first nucleic acid or the second nucleic acid, or both, have a non-naturally occurring sequence or a modification, such as a label, or both. (Item 275) 275. The composition of claim 274, wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and the second nucleic acid does not contain a sequence found in N. eutropha strain C91. (Item 276) 276. The composition of item 274 or 275, wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and the second nucleic acid further comprises a heterologous sequence 5' to the sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66. (Item 277) 277. The composition according to any of Items 274 to 276, wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and the second nucleic acid further comprises a heterologous sequence 3' to the sequence of 15 to 100 contiguous nucleotides from SEQ ID NO: 66. (Item 278) 278. The composition according to any of Items 274 to 277, wherein each of the first nucleic acid, the second nucleic acid, or the first nucleic acid and the second nucleic acid has a length of 15 to 20, 20 to 25, 25 to 30, 30 to 24, or 25 to 40 nucleotides. (Item 279) 279. The composition according to any of items 274 to 278, wherein the first nucleic acid, the second nucleic acid, or each of the first nucleic acid and the second nucleic acid is linked, e.g., covalently linked, to a detectable label, e.g., a fluorescent label. (Item 280) A nucleic acid consisting of the sequence AATCTGTCTCCACAGGC (SEQ ID NO: 64). (Item 281) A nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). (Item 282) 282. A molecule comprising a nucleic acid according to item 280 or 281 and a detectable label, for example a fluorescent label. (Item 283) 1. A composition comprising a first nucleic acid consisting of the sequence AATCTGTCTCCACAGGC (SEQ ID NO: 64) and a second nucleic acid consisting of the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65). (Item 284) (i) a first molecule comprising a first nucleic acid consisting of the sequence AATCTGTCTCCACAGGC (SEQ ID NO: 64); and (ii) optionally comprising a detectable label, e.g., a fluorescent label; A composition comprising: (i) a second nucleic acid comprising the sequence TATACCCACCACCCACGCTA (SEQ ID NO: 65); and (ii) a second molecule, optionally comprising a detectable label, e.g., a fluorescent label. (Item 285) D23 A method for detecting the presence of N. eutropha nucleic acid in a sample, comprising: performing a polymerase chain reaction (PCR) on the sample using primers specific for N. eutropha D23; and determining whether a PCR product is produced, wherein the presence of a PCR product indicates that the D23 N. eutropha nucleic acid was present in the sample.

[0173] The present disclosure contemplates all combinations of any one or more of the foregoing aspects and / or embodiments, as well as combinations with any one or more of the embodiments set forth in the detailed description and examples. [Brief explanation of the drawings]

[0174] [Figure 1]Growth of a bacterial mixed culture containing N. eutropha strain D23 is shown. Optical density at a wavelength of 600 nm is plotted against time. [Figure 2-1] Figure 2A: Nitrite production in a bacterial mixed culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Rate of nitrite production by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Rate of nitrite production by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Stability of N. eutropha D23 upon storage at 4°C. Nitrite concentration is plotted against time. [Figure 2-2] Figure 2A: Nitrite production in a bacterial mixed culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Rate of nitrite production by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Rate of nitrite production by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Stability of N. eutropha D23 upon storage at 4°C. Nitrite concentration is plotted against time. [Figure 2-3] Figure 2A: Nitrite production in a bacterial mixed culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Rate of nitrite production by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Rate of nitrite production by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Stability of N. eutropha D23 upon storage at 4°C. Nitrite concentration is plotted against time. [Figure 2-4]Figure 2A: Nitrite production in a bacterial mixed culture containing N. eutropha strain D23. Nitrite concentration is plotted against time. Figure 2B-I: Rate of nitrite production by N. eutropha D23 in batch culture. Nitrite concentration is plotted against time. Figure 2B-II: Rate of nitrite production by N. eutropha D23 in vitro. Nitrite concentration is plotted against time. Figure 2C: Stability of N. eutropha D23 upon storage at 4°C. Nitrite concentration is plotted against time. [Figure 3-1] Figure 3A: Shows the ability of N. eutropha D23 to inhibit the growth of P. aeruginosa (left panel) and S. aureus (right panel) in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3B: Shows the ability of N. eutropha D23 to inhibit the growth of Streptococcus pyogenes (left panel) and Acinetobacter baumannii (right panel) in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3C: Shows the ability of N. eutropha D23 to inhibit the growth of Propionibacterium acnes in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. [Figure 3-2]Figure 3A: Shows the ability of N. eutropha D23 to inhibit the growth of P. aeruginosa (left panel) and S. aureus (right panel) in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3B: Shows the ability of N. eutropha D23 to inhibit the growth of Streptococcus pyogenes (left panel) and Acinetobacter baumannii (right panel) in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3C: Shows the ability of N. eutropha D23 to inhibit the growth of Propionibacterium acnes in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. [Figure 3-3] Figure 3A: Shows the ability of N. eutropha D23 to inhibit the growth of P. aeruginosa (left panel) and S. aureus (right panel) in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3B: Shows the ability of N. eutropha D23 to inhibit the growth of Streptococcus pyogenes (left panel) and Acinetobacter baumannii (right panel) in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. Figure 3C: Shows the ability of N. eutropha D23 to inhibit the growth of Propionibacterium acnes in a co-culture experiment. The amount of each type of undesirable bacteria (in CFU / ml) is plotted against time. In this figure, "AOB" refers to strain D23. [Figure 4-1]Figure 4A: (Top panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4B: (Top panel) Plot of CFU / ml of the indicated bacteria over time in the co-culture experiment. (Middle panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4C: Plot of bactericidal activity of D23 against skin pathogens. Figure 4D: Plot of bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-2] Figure 4A: (Top panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4B: (Top panel) Plot of CFU / ml of the indicated bacteria over time in the co-culture experiment. (Middle panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4C: Plot of bactericidal activity of D23 against skin pathogens. Figure 4D: Plot of bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-3] Figure 4A: (Top panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4B: (Top panel) Plot of CFU / ml of the indicated bacteria over time in the co-culture experiment. (Middle panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4C: Plot of bactericidal activity of D23 against skin pathogens. Figure 4D: Plot of bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-4]Figure 4A: (Top panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4B: (Top panel) Plot of CFU / ml of the indicated bacteria over time in the co-culture experiment. (Middle panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4C: Plot of bactericidal activity of D23 against skin pathogens. Figure 4D: Plot of bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 4-5] Figure 4A: (Top panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4B: (Top panel) Plot of CFU / ml of the indicated bacteria over time in the co-culture experiment. (Middle panel) Plot of NO2 -concentration over time in the co-culture experiment. (Bottom panel) Plot of pH over time in the co-culture experiment. Figure 4C: Plot of bactericidal activity of D23 against skin pathogens. Figure 4D: Plot of bactericidal activity of D23 against skin pathogens. Figure 4E: Shows an alternative plot of the bactericidal activity of D23 against skin pathogens. [Figure 5-1]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-2]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-3]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-4]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-5]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-6]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-7]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-8]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-9]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-10]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-11]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-12]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-13]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 5-14]Figure 5A: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5B: Plots the CT50 for treatment with various D23s. Figure 5C: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5D: Plots the percent wound closure over time in an experiment testing the ability of D23 to improve wound healing. Figure 5E: Plots the CT50 for treatment with various D23s. Figure 5F: Shows images of D23-enhanced wound healing in diabetic mice on days 1, 11, and 15. Figure 5G: Shows blood glucose measurements for various concentrations of D23. Figure 5H: Shows the weight of the subject during the study. Figure 5I: Shows the weight of the subject during the study. Figure 5J: Shows the PCR scores of the subject's scalp test. In this figure, AOB refers to D23. Figure 5K: Schematic diagram of the human volunteer study evaluating Nitrosomonas-containing topical suspension (AOB-001). Figure 5L: (Left panel) PCR analysis of scalp swabs collected during the study. Percentage of samples positive for the AOB-specific three-gene signature (amoA, amoB, amoC). (Right panel) PCR analysis of scalp swabs collected during the study. Composite PCR scores for a total of six samples collected from each of the 23 volunteers. The scoring scheme used for positive samples collected at each of the six sampling points is shown. Figure 5M: Genus-level bacterial diversity determined by 16S rDNA sequencing in skin swab samples collected before and after topical application of AOB-001. The percentage of total sequence reads representing each of the 12 bacterial genera in samples collected at baseline, before application (day 0), immediately after 1 week of application (day 8), or 1 week after topical application was discontinued (day 14) is shown. The percentages of Acinetobacter, Burkholderia, Enterobacter, Escherichia, Shigella, Klebsiella, Nitrosomonas, Pantoea, Propionibacterium, Pseudomonas, Serratia, Staphylococcus, and Stenotrophomonas are shown.Figure 5N-A shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. The percentage of total 16S rDNA sequence reads representing Nitrosomonas is shown before application (day 0), immediately after one week of application (day 8), or one week after application was discontinued (day 14). Figure 5N-B shows the change in abundance of Nitrosomonas and other species in skin samples collected before and after AOB-001 application. Altered species abundance patterns were detected by 16S rDNA sequencing in samples collected from AOB users on day 0 versus day 8. Figure 5O shows user ratings of AOB-001. Assessments of AOB-001's hair and facial beauty benefits were provided by 23 volunteers after one week of scalp and facial application. Subjects are plotted in order of increasing composite PCT score. (2 = strongly agree, 0 = no change, -2 = strongly disagree). [Figure 6-1] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-2]1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-3] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-4] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-5]1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-6] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-7] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-8]1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-9] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-10] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-11]1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-12] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-13] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-14]1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-15] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 6-16] 1 is a table showing unique D23 genes with either the number and function of assigned open reading frames (ORFs) based on sequence analysis, or hypothetical genes over 200 base pairs in length. Column headings mean the following: Feature ID = unique identifier of the gene, Type = type of gene (where CDS indicates protein-coding DNA sequence), Start = start position of the gene in the genomic sequence of SEQ ID NO: 1, Stop = stop position of the gene in the genomic sequence of SEQ ID NO: 1, Frame = reading frame, Length = length of the gene (number of base pairs), Function = function of the gene or protein based on sequence analysis, Subsystem = category of gene function, D23GbkId = identifier of the gene. [Figure 7-1]6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-2] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-3] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-4] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-5] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-6] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-7] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-8] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-9] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-10] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-11] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-12]6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 7-13] 6 is a table showing unique D23 genes under 200 base pairs with the number of ORFs assigned. Column headings are as described in FIG. [Figure 8-1] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-2] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-3] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-4] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-5] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-6] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-7] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-8] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-9] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-10] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-11]6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-12] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-13] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-14] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-15] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 8-16] 6 is a table showing unique D23 genes without assigned ORF numbers. Column headings are as described in FIG. 6. [Figure 9] Unique C91 genes that have no homologues in D23 are listed. [Figure 10] 1 is a sequence alignment between the AmoA1 and AmoA2 proteins of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. FIG. 10 discloses SEQ ID NOs: 6, 12, 36, and 42, respectively, in order of appearance. [Figure 11] 11 is a sequence alignment between the AmoB1 and AmoB2 proteins of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. FIG. 11 discloses SEQ ID NOs: 8, 14, 38, and 44, respectively, in order of appearance. [Figure 12] 12 is a sequence alignment between the AmoC1 and AmoC2 proteins of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. FIG. 12 discloses SEQ ID NOs: 34, 40, 10, and 4, respectively, in order of appearance. [Figure 13]13 is a sequence alignment between the AmoC3 proteins of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. FIG. 13 discloses SEQ ID NOs: 46 and 16, respectively, in order of appearance. [Figure 14-1] Figures 14A and 14B show sequence alignments between the Hao1, Hao2, and Hao3 proteins of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. Figure 14 discloses SEQ ID NOs: 20, 22, 18, 50, 52, and 48, respectively, in order of appearance. [Figure 14-2] Figures 14A and 14B show sequence alignments between the Hao1, Hao2, and Hao3 proteins of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. Figure 14 discloses SEQ ID NOs: 20, 22, 18, 50, 52, and 48, respectively, in order of appearance. [Figure 15] Sequence alignment between the cycA1, cycA2, and cycA3 genes of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. Figure 15 discloses SEQ ID NOs: 26, 28, 24, 58, 56, and 54, respectively, in order of appearance. [Figure 16] 16 is a sequence alignment between the cycB1 and cycB2 genes of N. eutropha strains D23 and C91. The SEQ ID NOs for each protein are listed in Table 1. Figure 16 discloses SEQ ID NOs: 30, 32, 60, and 62, respectively, in order of appearance. [Figure 17] A bar graph of the percentage of bacteria by genus versus days is shown. [Figure 18] Bar graphs of the percentage of bacteria per genus for bacterial genera on days 0, 1, 8, 14, and 16 are shown. DETAILED DESCRIPTION OF THE INVENTION

[0175] Supplementary Table 1 shows the genomic annotation of the 2,777 genes identified in strain D23 using sequence analysis. Column headings are as described in Figure 6. "C91 alias" refers to the homolog in strain C91. Supplementary Table 1 is attached at the end of the detailed description and examples.

[0176] Supplementary Table 2 shows the sequences of selected protein genes identified in strain D23 and is attached at the end of the detailed description and examples.

[0177] Ammonia-oxidizing bacteria (AOB) of the genus Nitrosomonas are Gram-negative, obligately autotrophic bacteria with the unique ability to generate nitrite and nitric oxide from ammonia alone as an energy source. They are widespread in both soil and aquatic environments and are essential components of environmental nitrification processes. Due to the role of nitrite and nitric oxide on human skin as key components of several physiological functions, such as vasodilation, skin inflammation, and wound healing, these bacteria may have beneficial properties for both healthy and immunopathological skin conditions. These bacteria may be safe for human use because they are slow-growing, unable to grow on organic carbon sources, may be sensitive to soaps and antibiotics, and are not associated with any disease or infection in animals or humans.

[0178] 1.Definition Ammonia-oxidizing bacteria refers to bacteria that can oxidize ammonia or ammonium to nitrite at a rate, e.g., a substantial rate, e.g., a predetermined rate, e.g., at least the rate shown in any one of Figures 2A, 2B, 2C, 4A, 4B, or 5, or at least 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% of that rate. In some embodiments, this substantial rate is at least 50, 75, 125, or 150 micromoles NO2. - / min, e.g., about 100-150, 75-175, 75-125, 100-125, 125-150, or 125-175 micromoles / min, e.g., about 125 micromoles NO2 - / min. + ) (e.g., about 200 mM) of nitrite (NO - ) to Nitrosomonas eutropha (Nitrosomonas eutropha). Examples of ammonia-oxidizing bacteria include N. eutropha strains D23 and C91, as well as other bacteria of the genera Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosocystis, Nitrosolobus, and Nitrosovibrio. The D23 Nitrosomonas eutropha strain is designated AOB D23-100 and refers to the strain deposited with the American Tissue Culture Collection (ATCC) on April 8, 2014, with accession number PTA-121157. The D23 Nitrosomonas eutropha with accession number PTA-121157 has a genome sequence set forth in SEQ ID NO: 1 herein. The nucleic acid sequence(s), e.g., genome sequence, of accession number PTA-121157 are incorporated herein by reference in their entirety.

[0179] As used herein, the term optimized Nitrosomonas eutropha (N. eutropha) refers to optimized growth rate, optimized NH4 + Oxidation rate, or NH4 + In one embodiment, this refers to N. eutropha with optimized tolerance to at least one nucleotide, such as ammonia monooxygenase, hydroxylamine oxidoreductase, cytochrome c554, and cytochrome c MThe N. eutropha gene differs from naturally occurring N. eutropha by only nucleotides in the gene selected from 552. This difference may arise, for example, by selection of naturally occurring mutations in N. eutropha, induced mutations, or directed genetic manipulation. In one embodiment, it differs from naturally occurring N. eutropha in that it has a set of alleles that do not occur together in nature. These differences may provide one or more of the following: treatment or prevention of skin disorders, treatment or prevention of diseases or conditions associated with low nitrite levels, treatment or prevention of body odor, treatment to provide nitric oxide to a subject, and treatment to inhibit microbial growth.

[0180] As used herein, "pure" refers to a composition that contains a certain organism but is substantially free of other organisms. For example, a pure culture of ammonia-oxidizing bacteria is a culture that is substantially free of organisms other than ammonia-oxidizing bacteria. For example, a pure culture of N. eutropha is a culture that is substantially free of organisms other than N. eutropha. In some embodiments, "substantially free" means that other organisms are not detectable by methods used to detect them (e.g., plating cultures and examining colony morphology, or PCR of conserved genes such as 16S RNA). A pure composition may contain non-living elements, such as nutrients or excipients. Any embodiment, preparation, composition, or formulation of ammonia-oxidizing bacteria discussed herein may optionally comprise, consist essentially of, or consist of pure ammonia-oxidizing bacteria.

[0181] Throughout this disclosure, a formulation may refer to a composition or a preparation.

[0182] As used herein, an "autotrophic organism," e.g., an autotrophic bacterium, is any organism that can feed itself by using inorganic materials as a source of nutrients and photosynthesis or chemosynthesis as an energy source. Autotrophic bacteria can synthesize organic compounds from carbon dioxide and ATP from other sources, such as the oxidation of ammonia to nitrite, the oxidation of hydrogen sulfide, and Fe. 2+ Fe 3+ The autotrophic bacteria of the present disclosure are unable to cause infection.

[0183] As used herein, "co-administered" means that two (or more) different therapeutic agents are delivered to a subject while the subject is afflicted with a disorder, e.g., the two or more therapeutic agents are delivered after the subject has been diagnosed with the disorder but before the disorder has been cured or eliminated. In some embodiments, the delivery of one therapeutic agent occurs consecutively with the start of the other therapeutic agent, such that they overlap. This may also be referred to herein as "co-delivery," "concurrent delivery," or "parallel delivery." In other embodiments, the delivery of one therapeutic agent ends before the delivery of the other therapeutic agent begins. This may also be referred to herein as "sequential delivery" or "sequential delivery." In either case, the therapeutic agents are more effective because they are co-administered. For example, the second therapeutic agent is more effective; e.g., an equivalent effect is seen with the second therapeutic agent, but to a lesser extent, or the second therapeutic agent alleviates symptoms to a greater extent than would be seen if the second therapeutic agent were administered in the absence of the first therapeutic agent, or a similar condition is seen with the first therapeutic agent. In some embodiments, delivery is such that the reduction in symptoms or other parameters associated with the disorder exceeds the reduction or decrease that would be observed when one therapeutic agent is delivered in the absence of the other. The effects of these two therapeutic agents may be partially additive, fully additive, or greater than additive (i.e., synergistic). The delivery may be such that the effect of the first therapeutic agent delivered is still detectable when the second therapeutic agent is delivered.

[0184] Complete N. europaea medium refers to the N. europaea growth medium described by Ensign et al., "In vitro activation of ammonia monooxygenase from Nitrosomonas europaea by copper." J. Bacteriol. 1993 Apr;175(7):1971-80.

[0185] "Culturing" refers to the process of placing a quantity of desired bacteria under conditions that promote its growth, i.e., promote cell division. These conditions may involve a specified culture medium, a set temperature range, and / or an agitation rate. Bacteria may be cultured in liquid culture or on plates, e.g., agar plates.

[0186] As used herein, the term "isolated" refers to a material that has been removed from its original or natural environment (e.g., the natural environment in which it occurs in nature). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system by human intervention is isolated. Such a polynucleotide may be part of a vector, and / or such a polynucleotide or polypeptide may be part of a composition, and such a vector or composition may still be isolated because it is not part of the environment in which it is found in nature.

[0187] The terms "nucleic acid," "nucleic acid sequence," "nucleotide sequence," or "polynucleotide sequence," and "polynucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. The polynucleotide can be either single-stranded or double-stranded, and, if single-stranded, can be the coding strand or non-coding (antisense) strand. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. The nucleotide sequence can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. A nucleic acid can be a recombinant polynucleotide, or a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin, either not occurring in nature or connected to another polynucleotide in a non-natural configuration.

[0188] As used herein, the term "optimized growth rate" refers to one or more of a doubling time of less than about 4, 5, 6, 7, 8, 9, or 10 hours when cultured under batch conditions as described in Example 2 herein, a doubling time of less than about 16, 18, 20, 22, 24, or 26 hours when grown under chemostat conditions as described in Example 2 herein, or growth from an OD of about 0.15 to an OD of at least about 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 over about one or two days. In one embodiment, an optimized growth rate is one having a doubling time that is at least 10, 20, 30, 40, or 50% shorter than the doubling time of naturally occurring N. eutropha.

[0189] As used herein, "optimized NH4 + The "oxidation rate" is the rate at which NH3 or NH4 + NO2 - For example, this rate refers to a rate of at least about 50, 75, 125, or 150 micromoles / minute of conversion of NH4 + (e.g., about 200 mM) NO2 -In one embodiment, the optimized NH + The oxidation rate is NH3 or NH4 + However, NO2 is released at least 10, 20, 30, 40, or 50% more rapidly than the rate seen in naturally occurring N. eutropha. - is the speed converted into

[0190] The percent (%) amino acid sequence identity to an amino acid sequence herein (e.g., a protein expressed by N. eutropha D23) is defined as the percentage of amino acid residues in a candidate sequence that are identical to those in a reference sequence, which may be a naturally occurring N. eutropha sequence or an N. eutropha D23 sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, without considering any conservative substitutions as part of the sequence identity. Alignment for determining percent amino acid sequence identity can be achieved in a variety of ways within the means of those skilled in the art, for example, using publicly available computer software such as BLAST, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment across the entire length of the sequences being compared. For example, WU-BLAST-2 software can be used to determine amino acid sequence identity (Altschul et al., Methods in Enzymology 266, 460-480 (1996), http: / / blast.wustl / edu / blast / README.html). WU-BLAST-2 uses several search parameters, many of which are set to default values. These adjustable parameters are set with the following values: overlap span = 1, overlap fraction = 0.125, and global threshold (T) = I1. The HSP score (S) and HSP S2 parameters are dynamic values ​​established by the program itself depending on the composition of a particular sequence, although minimum values ​​can be adjusted as needed.

[0191] Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and / or chemical properties (e.g., replacing leucine with serine, i.e., conservative amino acid substitutions). Typical, but non-limiting, conservative substitutions include the substitution of aliphatic amino acids Ala, Val, Leu, and Ile for one another, the exchange of hydroxyl-containing residues Ser and Thr, the exchange of acidic residues Asp and Glu, the exchange of amide-containing residues Asn and Gln, the exchange of basic residues Lys and Arg, the exchange of aromatic residues Phe and Tyr, and the exchange of small amino acids Ala, Ser, Thr, Met, and Gly. Additional conservative substitutions include the substitution of one amino acid with another having a similar spatial or steric configuration, e.g., the exchange of Asn with Asp or Gln with Glu. Amino acid substitutions can also be the result of replacing one amino acid with another having different structural and / or chemical properties (i.e., non-conservative amino acid substitutions). Insertions or deletions can optionally range from 1 to 5 amino acids. Acceptable variations can be determined by systematically making amino acid insertions, deletions, or substitutions in the sequence and testing the resulting variants for activity in in vivo or in vitro assays, for example, for urea or ammonia metabolism.

[0192] Percent (%) sequence identity to a nucleic acid sequence herein (e.g., the N. eutropha D23 genome and portions thereof) is defined as the percentage of nucleotides in a candidate sequence that are identical to the nucleotides in a reference sequence, which may be a naturally occurring N. eutropha sequence or an N. eutropha D23 sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment to determine percent nucleotide sequence identity can be achieved in a variety of ways within the means of one of ordinary skill in the art, for example, using publicly available computer software such as BLAST. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment over the entire length of the sequences being compared.

[0193] The terms "polypeptide," "peptide," and "protein" (when single-chain) are used interchangeably herein to refer to a polymer of amino acids. The polymer may be linear or branched, may comprise modified amino acids, and may be interrupted by non-amino acids. These terms also encompass amino acid polymers that have been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component). The polypeptide may be isolated from natural sources, produced by recombinant techniques from eukaryotic or prokaryotic hosts, or may be the product of synthetic methods.

[0194] As used herein, "NH4 + "Optimized tolerance to" refers to an NH3 or NH4 concentration greater than 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mM. + In one embodiment, the ability of the strain to grow under conditions of NH4 + Optimal resistance to selected concentrations of NH3 or NH4 +"N. eutropha" refers to the ability to grow in the presence of at least 10, 20, 30, 40, or 50% more rapidly, or at least 10, 20, 30, 40, or 50% longer than is possible in naturally occurring N. eutropha.

[0195] As used herein with respect to comparisons between nucleic acid or protein sequences, "similar" means having homology. Similar genes or proteins can include, for example, substitutions (such as conservative or non-conservative substitutions), insertions (e.g., insertions of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30 amino acids, and for example, insertions of up to 2, 3, 4, 5, 10, 15, 20, 25, 30, or 50 amino acids, or any positive combination thereof, or insertions of the number of nucleotides required to encode said amino acids), or deletions (e.g., deletions of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30 amino acids, and for example, deletions of up to 2, 3, 4, 5, 10, 15, 20, 25, 30, or 50 amino acids, or any positive combination thereof, or deletions of the number of nucleotides required to encode said amino acids), or any combination thereof. Each substitution, insertion, and deletion can be located at the N-terminus, C-terminus, or central region of the protein or gene. In some embodiments, conservative substitutions are those that do not alter the charge and / or polarity and / or approximate size and / or geometry of the substituted position.

[0196] As used herein, "transgenic" means containing one or more exogenous DNA segments, the exogenous DNA being derived from another organism, e.g., another bacterium, bacteriophage, animal, or plant.

[0197] As used herein, treating a disease or condition refers to a decrease in the severity or frequency of at least one symptom of the disease or condition compared to a similar patient but not treated. Treatment can also refer to halting, slowing, or reversing the progression of the disease or condition compared to a similar patient but not treated. Treatment can include addressing the underlying cause of the disease and / or one or more symptoms.

[0198] As used herein, a therapeutically effective amount refers to a dose sufficient to prevent the progression of or cause regression of a disease or condition, or a dose capable of alleviating the symptoms of a disease or condition, or a dose capable of achieving a desired result. A therapeutically effective dose can be measured, for example, in terms of bacterial count or viable bacterial count (e.g., in CFU), bacterial mass (e.g., in milligrams, grams, or kilograms), or bacterial volume (e.g., mm 3 It can be measured as a unit of mass.

[0199] As used herein, the term "viability" refers to the ability of autotrophic bacteria, e.g., ammonia-oxidizing bacteria, to oxidize ammonia, ammonium, or urea to nitrite at a predetermined rate. In some embodiments, this rate is at least 50, 75, 125, or 150 micromoles NO2. - / min, e.g., about 100-150, 75-175, 75-125, 100-125, 125-150, or 125-175 micromoles / min, e.g., about 125 micromoles NO2 - / min. + ) (e.g., about 200 mM) of nitrite (NO - ) conversion.

[0200] The "growth medium" or "AOB medium" referred to herein comprises the components in Table 3 or Table 4 herein below.

[0201] In some embodiments, the optimal condition for the present disclosure is a growth state, e.g., a maximum growth state, characterized by a pH of at least about 7.6, ammonia, trace minerals, oxygen, and carbon dioxide. Another state may be characterized by a pH of about 7.4 or less and the absence of carbon dioxide. Under low carbon dioxide conditions, ammonia-oxidizing bacteria, e.g., Nitrosomonas, continue to oxidize ammonia to nitrite to generate ATP, but lack sufficient carbon dioxide, e.g., to fix and generate proteins, and instead generate polyphosphates, which are used as an energy storage medium. This may allow the ammonia-oxidizing bacteria to remain in a "storage state" for a period of time, e.g., a predetermined period of time, e.g., at least 1, 2, 3, 4, 5, 6, or 7 days, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, or 1, 2, 3, 4, or 5 years. In some embodiments, the ammonia-oxidizing bacteria may remain in a storage state for at least about 6 months to about 1 year.

[0202] As used herein, "growth conditions" refers to autotrophic bacteria, e.g., ammonia-oxidizing bacteria, in a condition or environment, e.g., a medium, e.g., a culture medium, e.g., a growth medium, that may have a pH of at least about 7.6. The level of at least one of ammonia, ammonium ion, and urea may be about 1 micromolar to 1000 millimolar. The level of trace substances is about 0.01 micromolar to 200 micromolar iron. The level of oxygen is about 5% to 100% oxygen saturation (e.g., of the medium). The level of carbon dioxide is about 20 ppm to 10% saturation (e.g., of the medium). In certain embodiments, the level of at least one of ammonia, ammonium ion, and urea may be about 10 micromolar to 100 millimolar. The level of trace substances is about 0.1 micromolar to 20 micromolar iron. The level of oxygen is about 5% to 100% oxygen saturation. Carbon dioxide levels are approximately 200 ppm to 5% saturation (e.g., of the medium).

[0203] As used herein, "polyphosphate-loaded conditions" refers to autotrophic bacteria, e.g., ammonia-oxidizing bacteria, in a condition or environment, e.g., a medium, e.g., a culture medium, e.g., a growth medium, that may have a pH of about 7.4 or less. The level of at least one of ammonia, ammonium ion, and urea is about 1 micromolar to 2000 millimolar. The level of trace substances is 0.01 micromolar to 200 micromolar iron. The level of oxygen is about 0% to 100% O2 saturation (e.g., of the medium). The level of carbon dioxide is less than 0 to 400 ppm, and the level of phosphate is greater than about 1 micromolar. In certain embodiments, the level of at least one of ammonia, ammonium ion, and urea is about 10 micromolar to 200 millimolar. The level of trace substances is 0.1 micromolar to 20 micromolar iron. The level of oxygen is about 5% to 100% O2 saturation. Carbon dioxide levels are below about 0-200 ppm and phosphate levels are above about 10 micromolar.

[0204] The polyphosphate loading state can be induced for a period of time, e.g., a predetermined period of time. The predetermined period of time can be a period that allows for sufficient polyphosphate accumulation in the ammonia-oxidizing bacteria. The predetermined period of time is a period suitable for providing sufficient polyphosphate loading to allow for long-term storage of the ammonia-oxidizing bacteria. The predetermined period of time can be based at least in part on a period of about 0.2-10 times, 0.3-5 times, 0.5-3 times, 0.5-1.5 times, or 0.5-1 times the doubling time of the ammonia-oxidizing bacteria. The predetermined period of time can be based at least in part on a period of about one doubling time of the ammonia-oxidizing bacteria. In some embodiments, the predetermined period of time is about 8 hours to 12 hours. In some embodiments, the predetermined period of time is about 10 hours. In some embodiments, the predetermined period of time is about 24 hours.

[0205] The purpose of polyphosphate-loading conditions may be to provide AOB with enough ammonia, ammonium ions, and / or urea, and O so that ATP can be produced, but to deprive them of CO and carbonate so that they cannot use the ATP to fix CO and instead use the ATP to generate polyphosphate that can be stored by the bacteria.

[0206] As used herein, the term "storage conditions" refers to a state or environment, e.g., an autotrophic bacterium, e.g., an ammonia-oxidizing bacterium, in a medium, e.g., a culture medium, e.g., a growth medium, having a pH of about 7.4 or less (in some embodiments, the pH may be 7.6 or less). The level of at least one of ammonia, ammonium ion, and urea is about 1 to 1000 micromolar. The level of trace substances is about 0.1 to 100 micromolar. The level of oxygen is about 0 to 100% saturation (e.g., of the medium). The level of carbon dioxide is about 0 to 800 ppm. In certain aspects, the level of at least one of ammonia, ammonium ion, and urea is about 10 to 100 micromolar. The level of trace substances is about 1 to 10 micromolar. The level of oxygen is about 0 to 100% saturation (e.g., of the medium). The level of carbon dioxide is about 0 to 400 ppm.

[0207] AOB are produced, according to some embodiments of the present disclosure, by generating AOB biomass during growth conditions, then exposing the AOB to polyphosphate loading conditions, and then removing the medium and resuspending the AOB in a buffer, e.g., a storage buffer (i.e., during storage conditions).

[0208] The ammonia-oxidizing bacteria may remain in a "storage state" for a period of time, e.g., a predetermined period of time, e.g., at least 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4 weeks, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, 1, 2, 3, 4, or 5 years. In some embodiments, the ammonia-oxidizing bacteria may remain in a storage state for at least about 6 months to about 1 year. Upon regeneration, the viability of the ammonia-oxidizing bacteria is at least about 50%, 60%, 70%, 80%, 90%, or 100% of the viability of the ammonia-oxidizing bacteria (e.g., in a growth state) prior to storage. In some embodiments, the ammonia-oxidizing bacteria preparation, upon storage under selected conditions, produces NH4 + The oxidizing agent may be formulated to lose no more than 10%, 20%, 30%, 40%, 50%, 60%, or 70% of its ability to oxidize.

[0209] The time required to regenerate the ammonia-oxidizing bacteria from a storage state (or polyphosphate-loaded state) can be a predetermined period of time. For example, the predetermined period of time can be less than about 75 hours, or less than about 72 hours. The predetermined period of time can be based at least in part on a period of about 0.2-10 times, 0.3-5 times, 0.5-3 times, 0.5-1.5 times, or 0.5-1 times the doubling time of the ammonia-oxidizing bacteria. The predetermined period of time can be based at least in part on a period of about one doubling time of the ammonia-oxidizing bacteria. The predetermined period of time can be about 8 hours to 12 hours. The predetermined period of time can be about 10 hours. The predetermined period of time can be less than about 75 hours, 72 hours, 70 hours, 68 hours, 65 hours, 60 hours, 55 hours, 50 hours, 45 hours, 40 hours, 35 hours, 30 hours, 25 hours, 20 hours, 15 hours, 10 hours, 5 hours, 4 hours, 3 hours, 2 hours, or 1 hour. The predetermined period of time can be about 5 minutes to 5 hours. The predetermined period of time can be about 5 to 10 minutes, 10 to 15 minutes, 15 to 20 minutes, 20 to 25 minutes, 25 to 30 minutes, 30 to 45 minutes, 45 to 60 minutes, 60 minutes to 1.5 hours, 1.5 hours to 2 hours, 2 hours to 2.5 hours, 2.5 hours to 3 hours, 3 hours to 3.5 hours, 3.5 hours to 4 hours, 4 hours to 4.5 hours, or 4.5 hours to 5 hours. In some embodiments, the predetermined period of time can be about 2 hours. This predetermined period of time can be, for example, the time it takes to achieve regeneration of the ammonia-oxidizing bacteria, e.g., the time it takes to achieve at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99%, or 100% viability of the ammonia-oxidizing bacteria compared to the viability of the bacteria (e.g., in a growth state) before storage.

[0210] 2. Ammonia-oxidizing bacteria (AOB), N. eutropha strain D23, and similar bacteria Autotrophic ammonia-oxidizing bacteria (herein referred to as AOBs or simply AOB) are obligate autotrophic bacteria described by Alan B. Hooper and A. Krummel et al. Alan B. Hooper, Biochemical Basis of Obligate Autotrophy in Nitrosomonas europaea, Journal of Bacteriology, February 1969, pp. 776-779. Antje Krummel et al., Effect of Organic Matter on Growth and Cell Yield of Ammonia-Oxidizing Bacteria, Arch Microbiol (1982) 133:50-54. These bacteria obtain all of their metabolic energy solely from the oxidation of ammonia to nitrite, with nitric oxide (NO) as an intermediate, in their respiratory chain, and obtain virtually all of their carbon by fixing carbon dioxide. They cannot utilize carbon sources other than a few simple molecules.

[0211] Ammonia-oxidizing bacteria (AOB) are widespread in the environment, and in the presence of ammonia, oxygen, and trace metals, they fix carbon dioxide and grow. AOB growth can be slow, and toxic levels of ammonia can kill fish and other organisms before the AOB can grow and reduce the ammonia to non-toxic levels. The slow growth of AOB can also delay the health benefits of NO and nitrites that AOB produce when applied to the skin.

[0212] It is desirable to replenish aquaria, skins, or processes with enough viable AOB to grow and store for that purpose. Because AOB do not form spores, dry storage with high viability is difficult; wet storage keeps them metabolically active.

[0213] For example, the decline in nitrification capacity of AOB during storage for wastewater treatment has been studied (Munz G, Lubello C, Oleszkiewicz JA. Modeling the decay of ammonium oxidizing bacteria. Water Res. 2011 Jan;45(2):557-64. Oi:10.1016 / j.watres.2010.09.022).

[0214] The growth, long-term storage, and restoration of activity of Nitrosomonas has been discussed by Cassidy et al. (U.S. Pat. No. 5,314,542), who disclose growing Nitrosomonas, removing toxic waste products, storing it in sterile water of appropriate salinity for periods up to one year, and then regenerating it by adding a buffer (CaCO3) and 200 ppm ammonium (this regeneration takes 72 hours).

[0215] As obligate autotrophs, AOB use this energy to fix CO2 and synthesize proteins by reducing the equivalent generated by the oxidation of ammonia to nitrite. Growth requires ammonia, oxygen, minerals, and carbon dioxide.

[0216] Nitrosomonas is called "Polyphosphate and Orthophosphate Content of Nitrosomonas europaea as a Function of Growth" (KRTerry and ABHooper,Journal of Bacteriology,July 1970, pp. 199-206, Vol. 103, No. 1), it can exist in several metabolic states.

[0217] In certain embodiments of the present disclosure, the ammonia-oxidizing bacteria can be pure. The ammonia-oxidizing bacteria preparation (formulation or composition) comprises, consists essentially of, or consists of pure ammonia-oxidizing bacteria. The ammonia-oxidizing bacteria can be from a genus selected from the group consisting of Nitrosomonas, Nitrosococcus, Nitrosospria, Nitrosocystis, Nitrosolobus, Nitrosovibrio, and combinations thereof.

[0218] The present disclosure provides, inter alia, a unique strain, e.g., an optimized strain, N. eutropha strain D23, of ammonia-oxidizing bacteria that can increase production of nitric oxide and nitric oxide precursors on the surface of a subject, e.g., a human subject. The present disclosure also provides methods of using the bacterium and articles comprising the bacterium.

[0219] In some embodiments, the N. eutropha does not occur in nature. For example, it may have accumulated desirable mutations during selection. In other embodiments, desirable mutations may be introduced by the experimenter. In some embodiments, the N. eutropha may be a purified preparation or may be optimized N. eutropha.

[0220] In a preferred embodiment, the N. eutropha strain is autotrophic and therefore unable to cause infection. The preferred strain utilizes urea as well as ammonia, eliminating the need for hydrolysis of urea in sweat before absorption and utilization by the bacteria. Also, in order to grow at low pH, the bacteria require NH4 + The selected strain must also be capable of living on the external skin of a subject, e.g., a human, and must be able to tolerate the conditions therein.

[0221] Although this disclosure specifically refers to N. eutropha strain D23, preparations, methods, compositions, therapeutics, wearable articles, and apparel having one or more other strains of N. eutropha, one or more other species of Nitrosomonas, and one or more other ammonia-oxidizing bacteria may be used. Autotrophic AOB are obligate autotrophic bacteria referred to by Alan B. Hooper and A. Krummel et al. Alan B. Hooper, Biochemical Basis of Obligate Autotrophy in Nitrosomonas europaea, Journal of of Bacteriology, February 1969, pp. 776-779. Antje Krummel et al., Effect of Organic Matter on Growth and Cell Yield of Ammonia-Oxidizing Bacteria, Arch Microbiol (1982) 133:50-54. These bacteria obtain all of their metabolic energy solely from the oxidation of ammonia to nitrite, with nitric oxide (NO) as an intermediate, in their respiratory chain, and obtain virtually all of their carbon by fixing carbon dioxide. They cannot utilize carbon sources other than a few simple molecules.

[0222] In certain embodiments, the N. eutropha is the strain with accession number PTA-121157, deposited with the American Tissue Culture Collection (ATCC) on April 8, 2014, and designated AOB D23-100 (25 vials).

[0223] In certain embodiments, the N. eutropha comprises a chromosome having a sequence at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to SEQ ID NO:1 (strain D23 complete genome sequence).

[0224] In certain embodiments, the bacteria having the sequence characteristics described above have (1) an optimized growth rate as measured by doubling time, (2) an optimized growth rate as measured by OD600, and (3) an optimized NH4 + Oxidation rate, (4) NH4 + and (4) optimized resistance to NO2 - Specific subcombinations of these properties are identified in the following paragraphs.

[0225] In some embodiments, the N. eutropha described herein has (1) an optimized growth rate as measured by doubling time, (2) an optimized growth rate as measured by OD600, and (3) an optimized NH4 + Oxidation rate, (4) NH4+ and (4) optimized resistance to NO2 - For example, the bacterium may have characteristics (1) and (2); (2) and (3); (3) and (4); or (4) and (5) from the first list of this paragraph. As another example, the bacterium may have characteristics (1), (2), and (3); (1), (2), and (4); (1), (2), and (5); (1), (3), and (4); (1), (3), and (5); (1), (4), and (5); (2), (3), and (4); (2), (3), and (5); or (3), (4), and (5). As a further example, the bacterium can have characteristics (1), (2), (3), and (4) from the first list of this paragraph; (1), (2), (3), and (5); (1), (2), (4), and (5); (1), (3), (4), and (5); or (2), (3), (4), and (5). In some embodiments, the bacterium has characteristics (1), (2), (3), (4), and (5) from the first list of this paragraph.

[0226] The present disclosure provides: (1) optimized growth rate as measured by doubling time; (2) optimized growth rate as measured by OD600; and (3) optimized NH4 + Oxidation rate, (4) NH4 + and (4) optimized resistance to NO2 -Also provided are pure compositions of N. eutropha having one or more of the optimized resistances to . For example, the pure N. eutropha compositions can have characteristics (1) and (2); (2) and (3); (3) and (4); or (4) and (5) from the first list of this paragraph. As another example, the pure N. eutropha compositions can have characteristics (1), (2), and (3); (1), (2), and (4); (1), (2), and (5); (1), (3), and (4); (1), (3), and (5); (1), (4), and (5); (2), (3), and (4); (2), (3), and (5); or (3), (4), and (5) from the first list of this paragraph. As a further example, the pure N. eutropha composition can have properties (1), (2), (3), and (4) from the first list of this paragraph; (1), (2), (3), and (5); (1), (2), (4), and (5); (1), (3), (4), and (5); or (2), (3), (4), and (5). In some embodiments, the pure N. eutropha composition from the first list of this paragraph has properties (1), (2), (3), (4), and (5).

[0227] N. eutropha strain D23, which was deposited in 25 vials with the ATCC Patent Depository under accession number PTA-121157 on April 8, 2014, designated AOB D23-100, comprises a circular genome having SEQ ID NO: 1, or its complement. Thus, in some embodiments, the N. eutropha strains described herein comprise a nucleic acid sequence, e.g., a genome, similar to SEQ ID NO: 1, or its complement.

[0228] For example, the N. eutropha can include a nucleic acid sequence having a 1,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 1,000 base pair portion of SEQ ID NO: 1 or its complement. The 1,000 base pair portion can span, for example, nucleotides (n x 1,000) + 1 to (n + 1) x 1,000, where n = 0, 1, 2, 3, ... 2538, e.g., nucleotides 1 to 1,000, 1,001 to 2,000, etc., to the end of SEQ ID NO: 1.

[0229] In embodiments, the N. eutropha comprises a nucleic acid sequence having a 2,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 2,000 base pair portion of SEQ ID NO: 1 or its complement, where the 2,000 base pair portion can span, for example, nucleotides (n x 2,000) + 1 to (n + 1) x 2,000, where n = 0, 1, 2, 3, ... 1269, e.g., nucleotides 1 to 2,000, 2,001 to 4,000, etc., to the end of SEQ ID NO: 1.

[0230] In embodiments, the N. eutropha comprises a nucleic acid sequence having a 5,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 5,000 base pair portion of SEQ ID NO: 1 or its complement, where the 5,000 base pair portion can span, for example, nucleotides (n x 5,000) + 1 to (n + 1) x 5,000, where n = 0, 1, 2, 3, ... 508, e.g., nucleotides 1 to 5,000, 5,001 to 10,000, etc., to the end of SEQ ID NO: 1.

[0231] In embodiments, the N. eutropha comprises a nucleic acid sequence having a 10,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 10,000 base pair portion of SEQ ID NO: 1 or its complement, where the 10,000 base pair portion can span, for example, nucleotides (n x 10,000) + 1 to (n + 1) x 10,000, where n = 0, 1, 2, 3, ... 254, e.g., nucleotides 1 to 10,000, 10,001 to 20,000, etc., to the end of SEQ ID NO: 1.

[0232] In embodiments, the N. eutropha comprises a nucleic acid sequence having a 20,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 20,000 base pair portion of SEQ ID NO: 1 or its complement, where the 20,000 base pair portion can span, for example, nucleotides (n x 20,000) + 1 to (n + 1) x 20,000, where n = 0, 1, 2, 3, ... 127, e.g., nucleotides 1 to 20,000, 20,001 to 40,000, etc., to the end of SEQ ID NO: 1.

[0233] In embodiments, the N. eutropha comprises a nucleic acid sequence having a 50,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 50,000 base pair portion of SEQ ID NO: 1 or its complement, where the 50,000 base pair portion can span, for example, nucleotides (n x 50,000) + 1 to (n + 1) x 50,000, where n = 0, 1, 2, 3, ... 51, e.g., nucleotides 1 to 50,000, 50,001 to 100,000, etc., to the end of SEQ ID NO: 1.

[0234] In embodiments, the N. eutropha comprises a nucleic acid sequence having a 100,000 base pair portion having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identity to a 100,000 base pair portion of SEQ ID NO: 1 or its complement, where the 100,000 base pair portion can range, for example, from nucleotide (n x 100,000) + 1 to (n + 1) x 100,000, where n = 0, 1, 2, 3, . . . 26, e.g., from nucleotides 1 to 100,000, 100,001 to 20,000, etc., to the end of SEQ ID NO: 1.

[0235] In some embodiments, the disclosure provides compositions of N. eutropha comprising a chromosome at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to SEQ ID NO: 1. In some embodiments, the disclosure provides pure compositions of N. eutropha comprising a chromosome at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to SEQ ID NO: 1.

[0236] In certain embodiments, the N. eutropha strain comprises a nucleic acid sequence, e.g., a genome, that hybridizes under low, moderate, high, or very stringent conditions, or other hybridization conditions described herein, to SEQ ID NO: 1, or to the genome of the D23 strain, designated AOB D23-100, deposited in 25 vials with the ATCC Patent Depository under accession number PTA-121157 on April 8, 2014, or to their complements. As used herein, the term "hybridizes under low, moderate, high, or very stringent conditions" describes hybridization and washing conditions. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, Inc., incorporated by reference. Sons, NY (1989), 6.3.1-6.3.6. Aqueous and non-aqueous hybridization methods are described in this reference, and either can be used. Specific hybridization conditions referred to herein are as follows: 1) low stringency hybridization conditions in 6x sodium chloride / sodium citrate (SSC) at about 45°C, followed by two washes in 0.2x SSC, 0.1% SDS at at least 50°C (for low stringency conditions, the temperature of these washes can be increased to 55°C); 2) moderate stringency hybridization conditions in 6x SSC at about 45°C. 3) high stringency hybridization conditions in 6x SSC at about 45°C, followed by one or more washes in 0.2x SSC, 0.1% SDS at 65°C; 4) very high stringency hybridization conditions in 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2x SSC, 1% SDS at 65°C. Very high stringency conditions (4) are the preferred conditions and should be used unless otherwise specified.

[0237] The genome of strain D23 (SEQ ID NO: 1) was compared to the genome of N. eutropha C91. Annotation of the D23 genome is provided in Supplementary Table 1, which lists the locations of the 2,777 genes in SEQ ID NO: 1 that were identified by sequence analysis. In certain embodiments, the N. eutropha described herein comprises one or more genes or proteins listed in Supplementary Table 1, or a gene or protein similar to one of said genes or proteins.

[0238] Thus, in some embodiments, the N. eutropha comprises a gene in Supplementary Table 1, or a protein encoded by said gene. In certain embodiments, the N. eutropha comprises a gene similar to (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical to) a gene in Supplementary Table 1, or a protein encoded by said gene. In embodiments, the N. eutropha comprises at least 2, 3, 4, 5, 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1000, 1500, 2000, 2500, or all of the genes in Supplementary Table 1, or genes or proteins identical or similar to the proteins encoded by said genes.

[0239] In some embodiments, the N. eutropha described herein (e.g., strain D23) contains one or more genes or proteins absent from strain C91, or a gene or protein similar to one of said genes or proteins. Examples of these genes are provided in Figures 6-8 and described in more detail in Example 4 herein.

[0240] Thus, with respect to Figure 6, in some embodiments, the N. eutropha includes genes identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the genes in Figure 6. In some embodiments, the N. eutropha comprises proteins identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the proteins encoded by the genes listed in Figure 6.

[0241] With respect to Figure 7, in some embodiments, the N. eutropha includes genes identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the genes in Figure 7. In some embodiments, the N. eutropha comprises proteins identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, or all of the proteins encoded by the genes listed in Figure 7.

[0242] With respect to Figure 8, in some embodiments, the N. eutropha includes genes identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, or all of the genes in Figure 8. In some embodiments, the N. eutropha comprises proteins identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, or all of the proteins encoded by the genes listed in Figure 8.

[0243] With reference collectively to Figures 6-8, in some embodiments, the present N. eutropha includes genes identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 20, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or all of the genes in Figures 6-8. In some embodiments, the N. eutropha comprises proteins identical or similar (e.g., at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% identical) to 1, 2, 3, 4, 5, 10, 20, 40, 60, 80, 100, 150, 200, 250, 300, 350, 400, 450, 500, or all of the proteins encoded by the genes listed in Figures 6-8.

[0244] In some embodiments, the N. eutropha described herein (e.g., strain D23) lacks one or more genes or proteins unique to strain C91, or a gene or protein similar to one of said genes or proteins. Examples of these genes are provided in FIG. 9 and described in more detail in Example 4 herein. Thus, in some embodiments, the N. eutropha described herein lacks at least 1, 2, 3, 4, 5, 10, 20, 50, 100, 150, 200, 250, or all of the genes in FIG. 9. In some embodiments, the N. eutropha described herein lacks up to 2, 3, 4, 5, 10, 20, 50, 100, 150, 200, 250, or all of the genes in FIG. 9. In embodiments, the N. eutropha described herein lacks about 1-5, 5-10, 10-20, 20-50, 50-100, 100-150, 150-200, 200-250, or 250 to all of the genes in Figure 9.

[0245] Sequencing of the D23 genome revealed that genes involved in ammonia metabolism (e.g., ammonia monooxygenase, hydroxylamine oxidoreductase, cytochrome c, and cytochrome c)M We uncovered several potentially interesting genes, including cycA (552). All of these genes are present in multiple copies, and in general, these copies are not identical to one another. One set of genes of interest is the ammonia monooxygenase synthesis operon amoCAB, which is present in two copies in addition to a third copy of amoC. These operons have homologs in C91, namely, Neut_2078 / 7 / 6 and Neut_2319 / 8 / 7. Another set of interesting genes is hydroxylamine oxidoreductase (hao), which is present in three copies. This hao homolog in C91 is designated Neut_1672, 1793, and 2335. A third set of interesting genes is the cytochrome c554 gene encoded by cycA, which is present in three copies. The corresponding C91 genes are designated Neut_1670, 1791, and 2333. The fourth set of interesting genes is the cytochrome c encoded by cycB, which is present in two copies. M 552 genes. These homologous C91 genes are designated Neut_1790 and 2332. Each gene group is summarized in Table 1 and discussed in more detail below. [Table 1]

[0246] In some embodiments, the N. eutropha described herein contain genes that are the same as or similar to the genes and proteins in Table 1.

[0247] More specifically, in certain embodiments, the disclosure provides compositions, e.g., purified N. eutropha preparations, of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to an ammonia monooxygenase sequence in Table 1. In certain embodiments, the disclosure provides compositions of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to a hydroxylamine oxidoreductase sequence in Table 1. In certain embodiments, the present disclosure provides compositions of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to a cytochrome c554 sequence in Table 1. In certain embodiments, the present disclosure provides compositions of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to a cytochrome c554 sequence in Table 1. M Compositions of N. eutropha are provided that contain nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the 552 sequence.

[0248] In certain embodiments, the disclosure provides compositions of N. eutropha comprising an amino acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to an ammonia monooxygenase sequence in Table 1. In certain embodiments, the disclosure provides compositions of N. eutropha comprising an amino acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to an hydroxylamine oxidoreductase sequence in Table 1. In certain embodiments, the present disclosure provides compositions of N. eutropha comprising an amino acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to a cytochrome c554 sequence in Table 1. ... MCompositions of N. eutropha are provided that contain an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.1%, 97.2%, 97.5%, 98%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, or 99.5% identical to the 552 sequence.

[0249] In some embodiments, the N. eutropha is present in a pure composition, for example, in the form of a purified, optimized N. eutropha preparation.

[0250] More specifically, in certain embodiments, the present disclosure provides pure compositions of N. eutropha comprising a nucleic acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 98.5%, 98.8%, 98.9%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to an ammonia monooxygenase sequence in Table 1. In certain embodiments, the present disclosure provides pure compositions of N. eutropha comprising a nucleic acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to a hydroxylamine oxidoreductase sequence in Table 1. In certain embodiments, the present disclosure provides pure compositions of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to a cytochrome c554 sequence in Table 1. In certain embodiments, the present disclosure provides pure compositions of N. eutropha comprising a nucleic acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to a cytochrome c554 sequence in Table 1. M Pure compositions of N. eutropha containing nucleic acid sequences that are at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the 552 sequence are provided.

[0251] In certain embodiments, the disclosure provides pure compositions of N. eutropha comprising an amino acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 98.5%, 98.8%, 98.9%, 99%, 99.2%, 99.3%, 99.4%, 99.5%, or 99.6% identical to an ammonia monooxygenase sequence in Table 1. In certain embodiments, the disclosure provides pure compositions of N. eutropha comprising an amino acid sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.4%, 99.5%, 99.6%, or 99.7% identical to an hydroxylamine oxidoreductase sequence in Table 1. In certain embodiments, the present disclosure provides pure compositions of N. eutropha comprising an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.5%, 99.6%, or 99.7% identical to a cytochrome c554 sequence in Table 1. ... M Pure compositions of N. eutropha are provided that contain an amino acid sequence that is at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 97.1%, 97.2%, 97.5%, 98%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, or 99.5% identical to the 552 sequence.

[0252] In some embodiments, the N. eutropha comprises a gene or protein comprising a sequence at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to any of the strain D23 sequences in Table 1, e.g., SEQ ID NOs: 4-33. Substitutions can be conservative or non-conservative, and insertions and deletions are also contemplated. In some embodiments, the N. eutropha comprises a gene or protein comprising a sequence in Table 1, e.g., any of SEQ ID NOs: 4-33. In some embodiments, the protein has an N-terminal and / or C-terminal extension or deletion of up to about 1, 2, 3, 4, 5, 6, 8, 10, 15, 20, 25, 50, or 100 amino acids.

[0253] The nucleic acid sequence alignment in Table 1 shows the percent identity between homologs of C91 and D23. The following paragraphs discuss this percent identity and describe various genes that share homology with the D23 gene in Table 1.

[0254] More specifically, these amoA1 genes are about 98.8% identical (i.e., at positions 821 / 831). Thus, in some embodiments, the N. eutropha described herein contain the D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain the D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 98.8%, 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoA1 gene.

[0255] These amoA2 genes are about 98.8% identical (i.e., at positions 821 / 831). Thus, in some embodiments, the N. eutropha described herein contain the D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain the D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 98.8%, 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoA2 gene.

[0256] These amoB1 genes are about 99.1% identical (i.e., at positions 1255 / 1266). Thus, in some embodiments, the N. eutropha described herein contain the D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where the gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain the D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where the gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 99.1%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoB1 gene.

[0257] These amoB2 genes are about 99.1% identical (i.e., at positions 1254 / 1266). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 99.1%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoB2 gene.

[0258] These amoC1 genes are about 99.8% identical (i.e., at positions 814 / 816). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at least one, two, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to one, two, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 99.8%, 99.9%, or 100% identical to the D23 amoC1 gene.

[0259] These amoC2 genes are about 99.8% identical (i.e., at positions 814 / 816). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at least one, two, or all of the positions where this gene differs between strain C91 and strain D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to one, two, or all of the positions where this gene differs between strain C91 and strain D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 99.8%, 99.9%, or 100% identical to the D23 amoC2 gene.

[0260] These amoC3 genes are about 98.9% identical (i.e., at positions 816 / 825). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 98.9%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 amoC3 gene.

[0261] These hao1 genes are about 99.0% identical (i.e., at positions 1696 / 1713). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprises a gene that is at least about 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao1 gene.

[0262] These hao2 genes are about 99.4% identical (i.e., at positions 1702 / 1713). Thus, in some embodiments, the N. eutropha described herein comprise a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprise a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprise a gene that is at least about 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao2 gene.

[0263] These hao3 genes are about 99.2% identical (i.e., at positions 1700 / 1713). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 hao3 gene.

[0264] These cycA1 genes are about 98.0% identical (i.e., at positions 694 / 708). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprises a gene that is at least about 98.0%, 98.2%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA1 gene.

[0265] These cycA2 genes are about 98.7% identical (i.e., at positions 699 / 708). Thus, in some embodiments, the N. eutropha described herein comprise a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where the gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprise a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all of the positions where the gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprise a gene that is at least about 98.7%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA2 gene.

[0266] These cycA3 genes are about 99.3% identical (i.e., at positions 703 / 708). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least one, two, three, four, five, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to one, two, three, four, five, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a gene that is at least about 99.3%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycA3 gene.

[0267] These cycB1 genes are about 96.7% identical (i.e., at positions 696 / 720). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or all of the positions where this gene differs between strain C91 and strain D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or all of the positions where this gene differs between strain C91 and strain D23. In embodiments, the N. eutropha described herein comprises a gene that is at least about 96.7%, 96.8%, 97.0%, 97.2%, 97.4%, 97.6%, 97.8%, 98.0%, 98.2%, 98.4%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycB1 gene.

[0268] These cycB2 genes are about 97.1% identical (i.e., at positions 702 / 723). Thus, in some embodiments, the N. eutropha described herein contain a D23 nucleotide at at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein contain a D23 nucleotide at up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or all of the positions where this gene differs between strains C91 and D23. In embodiments, the N. eutropha described herein comprises a gene that is at least about 97.1%, 97.2%, 97.4%, 97.6%, 97.8%, 98.0%, 98.2%, 98.4%, 98.4%, 98.6%, 98.8%, 99.0%, 99.2%, 99.4%, 99.6%, 99.8%, or 100% identical to the D23 cycB2 gene.

[0269] The following four paragraphs describe the genes and proteins in Table 1 in more detail.

[0270] Ammonia monooxygenase reacts [ka] amoA, amoB, and amoC are enzymes involved in ammonia oxidation that catalyze amoA (Ensign et al., 1993). In N. eutropha strain D23, the ammonia monooxygenase operon contains three genes designated amoA, amoB, and amoC. Strain D23 contains two copies of the entire operon and a third copy of amoC. These genes and corresponding proteins are listed in Table 1, above. In certain embodiments, the N. eutropha described herein contain one or two ammonia monooxygenase subunit A genes and / or proteins in Table 1 (e.g., the D23 sequence in Table 1), or genes and / or proteins similar thereto. In some embodiments, the N. eutropha described herein contain one or two ammonia monooxygenase subunit B genes and / or proteins in Table 1 (e.g., the D23 sequence in Table 1), or genes and / or proteins similar thereto. In certain embodiments, the N. eutropha described herein comprises one, two, or three ammonia monooxygenase subunit C genes and / or proteins of Table 1 (e.g., the D23 sequence of Table 1), or genes and / or proteins similar thereto. In some embodiments, the N. eutropha described herein comprises at least one or two of: (a) an ammonia monooxygenase subunit A gene and / or protein of Table 1 (e.g., the D23 sequence of Table 1), (b) an ammonia monooxygenase subunit B gene and / or protein of Table 1 (e.g., the D23 sequence of Table 1), and (c) an ammonia monooxygenase subunit C gene and / or protein of Table 1 (e.g., the D23 sequence of Table 1). For example, the N. eutropha can comprise all of these ammonia monooxygenase genes and / or proteins of Table 1 (e.g., the D23 sequence of Table 1), or genes and / or proteins similar thereto. Even more specifically, in some embodiments, the N. eutropha comprises all of the D23 ammonia monooxygenase genes of Table 1.In some embodiments, the N. eutropha comprises all of the D23 ammonia monooxygenase proteins in Table 1. Hydroxylamine oxidoreductase is a hydroxylamine oxidoreductase that reacts with the following general reaction: [ka] They typically use heme as a cofactor. N. eutropha strain D23 contains three hydroxylamine oxidoreductases designated hao1, hao2, and hao3. These genes and corresponding proteins are listed in Table 1, above. In some embodiments, the N. eutropha described herein contains one, two, or three hydroxylamine oxidoreductase genes and / or proteins in Table 1 (e.g., the D23 sequence in Table 1), or genes and / or proteins similar thereto. For example, the N. eutropha can contain all of the hydroxylamine oxidoreductase genes and / or proteins in Table 1 (e.g., the D23 sequence in Table 1), or genes and / or proteins similar thereto. Even more specifically, in some embodiments, the N. eutropha contains all of the D23 hydroxylamine oxidoreductase genes in Table 1. In some embodiments, the N. eutropha comprises all of the D23 hydroxylamine oxidoreductase proteins of Table 1.

[0271] The ability of D23 to aerobically catabolize ammonia as a sole energy source and reductant is mediated by two specialized protein complexes, Amo and Hao, and cytochromes c554 and c6, which transfer electrons to the quinone pool. m552. During ammonia oxidation at low oxygen concentrations, the NO reductase activity of c554 is important. N. eutropha strain D23 contains three cytochrome c554 genes, designated cycA1, cycA2, and cycA3. These genes and corresponding proteins are listed in Table 1, above. In some embodiments, the N. eutropha described herein contains one, two, or three cytochrome c554 genes and / or proteins in Table 1 (e.g., the D23 sequence in Table 1), or genes and / or proteins similar thereto. For example, the N. eutropha can contain all of the cytochrome c554 genes and / or proteins in Table 1 (e.g., the D23 sequence in Table 1), or genes and / or proteins similar thereto. Even more specifically, in some embodiments, the N. eutropha contains all of the D23 cytochrome c554 genes in Table 1. In some embodiments, the N. eutropha comprises all of the D23 cytochrome c554 proteins in Table 1.

[0272] The ability of D23 to aerobically catabolize ammonia as a sole energy source and reductant is mediated by two specialized protein complexes, Amo and Hao, and cytochromes c554 and c6, which transfer electrons to the quinone pool. m Requires 552. Cytochrome c m N. eutropha strain D23 has two cytochrome c enzymes designated cycB1 and cycB2, which reduce quinones with electrons from Hao. M 552 genes. These genes and corresponding proteins are listed in Table 1 above. In some embodiments, the N. eutropha described herein encode one or two cytochrome c genes listed in Table 1. M 552 gene and / or protein (e.g., sequence D23 in Table 1), or a gene and / or protein similar thereto. For example, this N. eutropha contains cytochrome c in Table 1. M552 gene and / or protein (e.g., the D23 sequence of Table 1), or genes and / or proteins similar thereto. Even more specifically, in some embodiments, the N. eutropha may contain the D23 cytochrome c of Table 1. M In some embodiments, the N. eutropha contains both the D23 cytochrome c and D552 genes of Table 1. M 552 proteins.

[0273] In some embodiments, the N. eutropha described herein comprises a combination of genes and / or proteins selected from Table 1. The combination can include, for example, the genes and / or proteins listed in the previous four paragraphs. For example, the combination can include genes and / or proteins from two classes of Table 1. Thus, in some embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or described in the previous four paragraphs and one or more hydroxylamine oxidoreductase genes and / or proteins. In embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or described in the previous four paragraphs and one or more cytochrome c554 genes and / or proteins. In embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or described in the previous four paragraphs and one or more cytochrome c M In some embodiments, the N. eutropha comprises one or more hydroxylamine oxidoreductase genes and / or proteins listed in Table 1 or described in the previous four paragraphs and one or more cytochrome c 552 genes and / or proteins. In some embodiments, the N. eutropha comprises one or more hydroxylamine oxidoreductase genes and / or proteins listed in Table 1 or described in the previous four paragraphs and one or more cytochrome c 554 genes and / or proteins. In some embodiments, the N. eutropha comprises one or more hydroxylamine oxidoreductase genes and / or proteins listed in Table 1 or described in the previous four paragraphs and one or more cytochrome c M Contains 552 genes and / or proteins.

[0274] The combination may also include genes and / or proteins from the three classes of Table 1. Thus, in some embodiments, the N. eutropha includes one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or in the preceding four paragraphs, and one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c554 genes and / or proteins. In embodiments, the N. eutropha includes one or more ammonia monooxygenase genes and / or proteins listed in Table 1 or in the preceding four paragraphs, and one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c M In some embodiments, the N. eutropha comprises one or more ammonia monooxygenase genes and / or proteins, and one or more cytochrome c 554 genes and / or proteins, and / or one or more cytochrome c 552 genes and / or proteins, as described in Table 1 or in the preceding four paragraphs. M In some embodiments, the N. eutropha comprises one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c 554 genes and / or proteins, and / or one or more cytochrome c 552 genes and / or proteins, as described in Table 1 or in the preceding four paragraphs. M Contains 552 genes and / or proteins.

[0275] This combination can include genes and / or proteins from all four classes of Table 1. Thus, in some embodiments, the N. eutropha contains one or more ammonia monooxygenase genes and / or proteins, and one or more hydroxylamine oxidoreductase genes and / or proteins, and one or more cytochrome c554 genes and / or proteins, and / or one or more cytochrome c M It contains 552 genes.

[0276] Table 2 (below) lists the sequence differences between the D23 and C91 proteins of Table 1. For example, AmoA1 has an M at position 1 of C91 but a V at position 1 of D23; this difference is abbreviated as M1V in Table 2. As another example, D23 CycB1 has a DDD insertion between residues 194 and 195 of the C91 protein, resulting in residues 195, 196, and 197 in the D23 protein; this difference is abbreviated as 195insD, 196insD, and 197insD, respectively, in Table 2. The sequence alignments that form the basis of Table 2 are shown in Figures 10-16. [Table 2]

[0277] Thus, the N. eutropha described herein can comprise one or more of the sequence features listed in Table 2. For example, the N. eutropha can comprise at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the sequence features in Table 2. In some embodiments, the N. eutropha comprises no more than 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the sequence features in Table 2. In embodiments, the N. eutropha comprises 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of the sequence features in Table 2. The N. eutropha can also comprise fragments of the proteins.

[0278] For each category of gene or protein, in some embodiments, the N. eutropha comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the sequence characteristics of the first division of Table 2 (describing ammonia monooxygenases). In embodiments, the N. eutropha comprises 1-5, 3-7, 4-8, or 5-10 of the sequence characteristics of the first division of Table 2. For example, in some embodiments, the N. eutropha comprises at least one, two, or three sequences characteristic of the amoA genes or proteins listed in Table 2, and / or two or fewer of these sequences. The N. eutropha may also comprise sequences characteristic of at least one or two of the amoB genes or proteins listed in Table 2. Additionally, the N. eutropha may comprise sequences characteristic of at least one or two of the amoC3 genes listed in Table 2. The N. eutropha may also comprise fragments of the proteins.

[0279] With respect to the hao genes and proteins, the N. eutropha may comprise at least one, two, three, four, five, six, seven, eight, or all of the sequence characteristics of the second section of Table 2 (describing hydroxylamine oxidoreductases). In embodiments, the N. eutropha comprises 1-4, 2-5, 3-6, or 4-8 of the sequence characteristics of the second section of Table 2. The N. eutropha may also comprise at least one, two, or three of the sequence characteristics of Hao1 listed in Table 1, and / or two or fewer of these characteristics. The N. eutropha may also comprise at least one or two of the sequence characteristics of Hao2 or Hao3 listed in Table 2. The N. eutropha may also comprise fragments of the proteins.

[0280] Turning now to cytochrome c554, the present N. eutropha may include at least one, two, three, four, or all of the sequence characteristics of the third division (depicting cytochrome c554) of Table 2. In embodiments, the present N. eutropha includes up to two, three, four, or all of the sequence characteristics of the third division of Table 2. In embodiments, the present N. eutropha includes at least one or two sequences characteristic of cytochrome c554 CycA1 listed in Table 2. The present N. eutropha may also include at least one sequence characteristic of c554 CycA2 or c554 CycA3 listed in Table 2. The present N. eutropha may also include fragments of the above proteins.

[0281] c M Regarding the 552 genes and proteins, this N. eutropha has 552 genes and proteins (cytochrome c M 552) of the fourth division. In embodiments, the N. eutropha includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the sequence features of the fourth division of Table 2. For example, in embodiments, the N. eutropha includes 1-5, 2-7, 3-8, or 5-10 sequence features of the fourth division of Table 2. In embodiments, the N. eutropha includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or all of the sequence features of the fourth division of Table 2. M 552 CycB1 at least 1, 2, 3, 4, 5, 6, or 7 sequence characteristics of CycB1, and / or no more than 2, 3, 4, 5, 6, or 7 of these characteristics. M The N. eutropha may also comprise at least one, two, or three sequences characteristic of 552 CycB2, and / or two or fewer of these characteristics. The N. eutropha may also comprise fragments of said protein.

[0282] It is understood that the above paragraphs that refer to sequence characteristics of various N. eutropha proteins also describe the sequences of the nucleic acids that encode these proteins.

[0283] Sequencing analysis described herein revealed that strain D23 lacks a plasmid. Consequently, in some embodiments, the N. eutropha bacterium lacks a plasmid, i.e., all of its DNA is contained in the chromosome. In some embodiments, the N. eutropha bacterium lacks an endogenous plasmid but carries one or more transgenic plasmids.

[0284] The D23 strain is not believed to be a natural product, but rather has acquired certain mutations and characteristics during long-term cultivation and selection in the laboratory. For example, D23 exhibits a high NH4 content above about 200 mM or 250 mM. + The cells have the ability to grow for more than 24 hours under these conditions.

[0285] In some embodiments, the N. eutropha disclosed herein differs from naturally occurring bacteria in the presence of siderophores. For example, the present N. eutropha may have elevated or decreased levels of siderophores compared to N. eutropha C91. Generally, siderophores are secreted iron-chelating compounds that help bacteria remove iron from their environment. Some siderophores are peptides, while others are small organic molecules.

[0286] These AOB, e.g., N. eutropha contemplated in the present disclosure, can contain mutations relative to wild-type N. eutropha and / or the N. eutropha sequences disclosed herein. These mutations can, for example, arise spontaneously, be introduced by random mutagenesis, or be introduced by targeted mutagenesis. For example, the N. eutropha can lack one or more genes or regulatory DNA sequences typically contained in wild-type N. eutropha. The N. eutropha can also contain point mutations, substitutions, insertions, deletions, and / or rearrangements relative to a sequenced or wild-type strain. The N. eutropha can be a purified, optimized N. eutropha preparation.

[0287] In certain embodiments, the N. eutropha is transgenic. For example, it can contain one or more genes or regulatory DNA sequences that wild-type N. eutropha D23 lacks. More specifically, the N. eutropha can contain, for example, a reporter gene, a selectable marker, a gene encoding an enzyme, or a promoter (including an inducible or repressible promoter). In some embodiments, the additional gene or regulatory DNA sequence is integrated into the bacterial chromosome; in some embodiments, the gene or regulatory DNA sequence is on a plasmid, for example, a plasmid related to the plasmid found in N. eutropha N91.

[0288] In some preferred embodiments, the N. eutropha differs from naturally occurring bacteria by at least one nucleotide. For example, the N. eutropha differs from naturally occurring bacteria in a gene or protein that is part of a related pathway, such as ammonia metabolic pathway, urea metabolic pathway, or pathway that produces nitric oxide or nitric oxide precursors. More specifically, the N. eutropha can include a mutation that increases the activity of a pathway, for example, by increasing the level or activity of a component of the pathway.

[0289] The above-mentioned mutations can be introduced using any suitable technique. Numerous methods are known for introducing mutations at a given position. For example, site-directed mutagenesis, oligonucleotide-directed mutagenesis, or site-specific mutagenesis can be used. Non-limiting examples of specific mutagenesis protocols are described, for example, in Mutagenesis, pp. 13.1-13.105 (Sambrook and Russell, eds., Molecular Cloning A Laboratory Manual, Vol. 3, 3rd ed. 2001). Additionally, non-limiting examples of well-characterized mutagenesis protocols available from commercial sources include the Altered Sites® II in vitro mutagenesis system (Promega). Corp., Madison, Wis.), Erase-a-Base® system (Promega, Madison, Wis.), GeneTailor™ site-directed mutagenesis system (Invitrogen, Inc., Carlsbad, Calif.), QuikChange® II site-directed mutagenesis kit (Stratagene, La Jolla, Calif.), and Transformer™ site-directed mutagenesis kit (BD-Clontech, Mountain View, Calif.).

[0290] In some embodiments, the ammonia-oxidizing bacteria preparation may include a concentration or amount of ammonia-oxidizing bacteria to at least partially treat a condition or disease. The ammonia-oxidizing bacteria preparation may include a concentration or amount of ammonia-oxidizing bacteria to alter, e.g., decrease or increase, the amount, concentration, or proportion of bacteria or bacterial genera on a surface, e.g., a skin surface. The bacteria may be non-pathogenic or pathogenic, or may be potentially pathogenic.

[0291] In some embodiments, the ammonia oxidizing bacteria preparation comprises about 10 8 ~about 10 14 The preparation may contain at least 10 CFU / L. 8 , 10 9 , 10 10 , 10 11 , 2×10 11 , 5×10 11 , 10 12 , 2×10 12 , 5×10 12 , 10 13 , 2×10 13 , 5×10 13 , or 10 14 , or about 10 8 ~10 9 , 10 9 ~10 10 , 10 10 ~10 11 , 10 11 ~10 12, 10 12 ~10 13 , or 10 13 ~10 14 In certain embodiments, the preparation may contain about 1 x 10 CFU / L. 9 CFU / L ~ approx. 10 x 10 9 In certain embodiments, the preparation may contain about 1 x 10 CFU / L. 9 CFU ~ approx. 10 x 10 9 It may contain CFU.

[0292] In some embodiments, the ammonia-oxidizing bacteria preparation may contain between about 0.1 milligrams (mg) and about 1000 mg of ammonia-oxidizing bacteria. In certain aspects, the preparation may contain between about 50 mg and about 1000 mg of ammonia-oxidizing bacteria. The preparation may contain between about 0.1-0.5 mg, 0.2-0.7 mg, 0.5-1.0 mg, 0.5-2 mg, 0.5-5 mg, 2.5-5 mg, 2.5-7.0 mg, 5.0-10 mg, 7.5-15 mg, 10-15 mg, 15-20 mg, 15-25 mg, 20-30 mg, 25-50 mg, 25-75 mg, 50-75 mg, 50-100 mg, 75-100 mg , 100-200mg, 200-300mg, 300-400mg, 400-500mg, 500-600mg, 600-700mg, 700-800mg, 800-900mg, 900-1000mg, 100-250mg, 250-500mg, 100-500mg, 500-750mg, 750-1000mg, or 500-1000mg.

[0293] In some embodiments, the ammonia-oxidizing bacteria preparation may comprise a mass ratio of ammonia-oxidizing bacteria to excipient, e.g., a pharmaceutically acceptable excipient or a cosmetically acceptable excipient, ranging from about 0.1 grams / L to about 1 gram / L. The preparation may comprise a mass ratio of ammonia-oxidizing bacteria to excipient ranging from about 0.1-0.2, 0.2-0.3, 0.1-0.5, 0.2-0.7, 0.5-1.0, or 0.7-1.0 grams / L.

[0294] In some embodiments, the ammonia-oxidizing bacteria preparation can be in a growth state. The growth state can be provided by exposing the ammonia-oxidizing bacteria to an environment that can promote growth. The growth state can be, for example, by exposing the ammonia-oxidizing bacteria to an environment that can promote growth. + ) to nitrite (NO2 - The growth conditions can be conditions for the ammonia-oxidizing bacteria in an environment that allows for the immediate availability of ammonia-oxidizing bacteria to convert ammonia into ammonium nitrate (NH 3 ). The growth conditions can include providing the ammonia-oxidizing bacteria in an environment having a pH greater than about 7.6. The growth conditions can also include providing the ammonia-oxidizing bacteria in an environment having ammonia, ammonium salts, and / or urea, trace minerals, and sufficient oxygen an...

Claims

1. Compared to N. eutropha bacterial strain C91 cultivated under similar conditions, Optimized growth rate; Optimized NH ４ ＋ Acidification rate; N.H. ４ ＋ Optimized resistance to; and NO ２ － Optimized resistance to A purified preparation of optimized Nitrosomonas eutropha (N. eutropha) bacteria having at least two properties selected from: A purified preparation, wherein the optimized N. eutropha bacterium comprises a mutation in at least one of an ammonia monooxygenase gene, a hydroxylamine oxidoreductase gene, a cytochrome c554 gene, or a cytochrome cm552 gene.

2. 2. The purified preparation of claim 1, wherein the N. eutropha bacterium comprises a genome having a sequence at least 90% identical to SEQ ID NO:1 or its complement, and proteins or genes of SEQ ID NOs:4-33.

3. 3. The purified preparation of claim 1 or claim 2, wherein the N. eutropha bacterium comprises a protein that is mutant at at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, or all of the amino acid positions listed in Table 2 compared to N. eutropha strain C91.

4. 4. The purified preparation of any of claims 1 to 3, wherein the optimized growth rate is a rate that allows continuous cultivation of N. eutropha at an OD600 (optical density at 600 nm) of about 0.15 to 0.18 to reach an OD600 of about 0.5 to 0.6 in about 1 to 2 days.

5. 5. The purified preparation of any of claims 1 to 4, wherein the optimized growth rate is a doubling time of about 8 hours when cultured under batch culture conditions.

6. a) The optimized NH ４ ＋ The oxidation rate is NH ４ ＋ NO ２ － oxidized to at least about 1 at a rate of 25 micromoles / min; or b) The NH ４ ＋ Optimized resistance to approximately 200 mM NH ４ ＋ and the ability to grow for at least about 48 hours in a medium comprising A purified preparation according to any one of claims 1 to 5.

7. The N. eutropha bacteria have an optimized growth rate, an optimized NH ４ ＋ Oxidation rate and NH ４ ＋ 7. The purified preparation of claim 1, having at least two properties selected from: optimized resistance to

8. The N. eutropha bacteria have an optimized growth rate, an optimized NH ４ ＋ Oxidation rate and NH ４ ＋ A purified preparation according to any one of claims 1 to 7, having optimized resistance to

9. The N. eutropha bacterium is a) a chromosome that hybridizes to SEQ ID NO:1 under very high stringency; b) an AmoA protein having identity to SEQ ID NO: 6 or 12 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; an AmoB protein having identity to SEQ ID NO: 8 or 14 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; an amoC gene having identity to SEQ ID NO: 4, 10, or 16 selected from at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; a hydroxylamine oxidoreductase protein having identity to SEQ ID NO: 18, 20, or 22 selected from among at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; a cytochrome c554 protein having identity to SEQ ID NO: 24, 26, or 28 selected from among at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; or a cytochrome cM552 protein having identity to SEQ ID NO: 30 or 32 selected from among at least about 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, and 100% identical; or c) 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, or all of the sequence features in Table 2 9. The purified preparation of any one of claims 1 to 8, comprising:

10. 10. The purified preparation of any of claims 1 to 9, wherein the N. eutropha bacterium comprises at least one structural difference or at least one mutation relative to a wild-type bacterium of N. eutropha strain C91.

11. The N. eutropha bacterium is a) a nucleic acid that can be amplified using a primer pair comprising a primer comprising the sequence of SEQ ID NO: 64 and a primer comprising the sequence of SEQ ID NO: 65; or b) a nucleic acid or protein that is at least 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, or 100% identical to any of the sequences of SEQ ID NOs: 64-66 or to a protein encoded by any of the sequences of SEQ ID NOs: 64-66; 11. The purified preparation of any one of claims 1 to 10, comprising:

12. The N. eutropha bacterium may contain at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, A purified preparation according to any of claims 1 to 11, comprising a mutation at position 7, 28, 29, 30, 31, 32, 33, 34 or 35.

13. Optimized growth rate, optimized NH ４ ＋ Oxidation rate, NH ４ ＋ Optimized resistance to NO ２ － and optimized resistance to , wherein the optimized N. eutropha bacterium comprises a mutation in an ammonia monooxygenase gene, a hydroxylamine oxidoreductase gene, a cytochrome c554 gene, or a cytochrome cm552 gene, and the method comprises: (a) Optimized growth rate, optimized NH ４ ＋ Oxidation rate, or NH ４ ＋ culturing the bacterium under conditions that select for one or more of the optimized resistances to, thereby producing a culture; (b) Optimized growth rate, optimized NH ４ ＋ Oxidation rate, or NH ４ ＋ testing a sample from said culture for optimized resistance to (c) Optimized growth rate, optimized NH ４ ＋ Oxidation rate, or NH ４ ＋ repeating the culturing and testing steps until a bacterium having optimized resistance to is obtained; A method comprising:

14. 13. The purified preparation of any of claims 1-12 for use in a method for: (a) inhibiting microbial growth on the skin of a subject; (b) treating or preventing body odor associated with the skin of a subject; (c) delaying signs of aging of the skin of a subject; or (d) altering the composition of the skin microbiome of a subject.

15. 13. A purified preparation according to any of claims 1 to 12 for use in a method for treating a skin disease associated with low nitrite levels, wherein the skin disease is urticaria, impetigo, HIV dermatitis, infection in diabetic foot ulcers, atopic dermatitis, acne, acne vulgaris, eczema, contact dermatitis, allergic reactions, psoriasis, rosacea, skin infections, vascular diseases, vaginal yeast infections, sexually transmitted diseases, baldness, or leg ulcers secondary to diabetes or bed restraint.

16. 16. The purified preparation of claim 15, wherein the skin disease is acne, eczema, psoriasis or rosacea.

17. The purified preparation of any of claims 14 to 16, formulated as an aerosol or spray.

18. The purified preparation of any of claims 14 to 17, formulated for immediate or sustained release.

Images