Therapeutic targets for correction of human dystrophin gene by gene editing and methods of use

Abstract

To provide more precise and efficient gene editing tools for correcting or treating patients with mutations in the dystrophin gene.SOLUTION: Disclosed herein are therapeutic targets for the correction of the human dystrophin gene by gene editing, and methods of use.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 260,712, filed November 30, 2015, and U.S. Provisional Patent Application No. 62 / 330,336, filed May 2, 2016, the entire contents of which are incorporated herein by reference.

[0002] STATEMENT OF GOVERNMENT RIGHTS This invention was made with Government support under an award by the National Science Foundation Graduate Research Fellowship Program. The U.S. Government has certain rights in this invention.

[0003] Technical Field The present disclosure relates to the field of gene expression modification, genomic engineering and modification of genes using Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) / CRISPR-associated (Cas) 9-based systems and viral delivery systems. The present disclosure also relates to the field of genomic engineering and modification of genes in muscle (e.g., skeletal muscle and cardiac muscle). [Background technology]

[0004] Synthetic transcription factors have been engineered to control gene expression for many different medical and scientific applications in mammalian systems (e.g., stimulating tissue regeneration, drug screening, compensating for genetic defects, activating repressed tumor suppressors, controlling stem cell differentiation, performing genetic screens, and creating synthetic gene circuits). These transcription factors can target promoters or enhancers of endogenous genes or can be purposely designed to recognize sequences orthogonal to the mammalian genome for regulation of transgenes. The most common strategies for designing novel transcription factors that target user-defined sequences are based on the programmable DNA-binding domains of zinc finger proteins and transcription activator-like effectors (TALEs). Both of these approaches involve applying the principles of protein-DNA interactions of these domains to the design of novel proteins with unique DNA-binding specificities. Although these methods have been widely successful in many applications, the protein engineering required to engineer protein-DNA interactions can be laborious and requires expertise.

[0005] In addition, the novel protein is not always effective. The reason for this is not yet known, but may be related to the effect of epigenetic modifications and chromatin state on protein binding to genomic target sites. In addition, there are challenges in ensuring that the novel protein and other components are delivered to each cell. Existing methods for delivering the novel protein and its multiple components include delivery of separate plasmids and vectors to cells, which leads to highly variable expression levels in each cell due to differences in copy number. In addition, gene activation after gene transfer is transient due to dilution of plasmid DNA, and transient gene expression may not be sufficient to induce a therapeutic effect. Furthermore, this approach is not suitable for cell types that are not easily transfected with genes. Therefore, another limitation of the novel protein is the efficacy of transcriptional activation.

[0006] A gene editing system based on CRISPR / Cas9 can be used to introduce site-specific double-strand breaks at targeted genomic loci. This DNA cleavage stimulates natural DNA repair mechanisms, leading to one of two possible repair pathways. In the absence of a donor template, this break is repaired by non-homologous end joining (NHEJ), an error-prone repair pathway that results in small insertions or deletions of DNA. This method can be used to intentionally disrupt, delete, or modify the reading frame of the targeted gene sequence. However, if a donor template is provided with nucleases, the cellular machinery repairs this break by homologous recombination, which is enhanced by orders of magnitude in the presence of DNA breaks. This method can be used to introduce specific changes in DNA sequences at targeted sites. Engineered nucleases have been used for gene editing in various human stem cells and cell lines, as well as gene editing in mouse liver. However, a major obstacle in the implementation of these techniques is their delivery to specific tissues in vivo in a manner that is effective, efficient, and facilitates successful genome modification.

[0007] Inherited genetic diseases have a devastating impact on children in the United States. These diseases currently have no cure and can only be managed by attempting to alleviate symptoms. For decades, the field of gene therapy has promised a cure for this disease. However, technical obstacles to the safe and efficient delivery of therapeutic genes to cells and patients have limited this approach. Duchenne muscular dystrophy (DMD) is a fatal genetic disease clinically characterized by muscle wasting, loss of ambulation, and death typically in the third decade of life due to the loss of functional dystrophin. DMD is the result of inherited or spontaneous mutations in the dystrophin gene. Most mutations causing DMD are the result of exon deletions, pushing the translation reading frame out of frame. Summary of the Invention [Problem to be solved by the invention]

[0008] Dystrophin is a key component of a protein complex involved in regulating muscle cell integrity and function. DMD patients generally lose the ability to physically support themselves during childhood, become increasingly weak during their teenage years, and die during their twenties. Current experimental gene therapy strategies for DMD require repeated administration of transient gene delivery vehicles or rely on the permanent integration of foreign genetic material into genomic DNA. Both of these methods have serious safety concerns. In addition, these strategies are limited by their inability to deliver the large and complex dystrophin gene sequence. There is a need for more precise and efficient gene editing tools to correct or treat patients with mutations in the dystrophin gene. [Means for solving the problem]

[0009] The present invention is directed to guide RNAs (gRNAs) comprising a targeting domain comprising a nucleotide sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:41, SEQ ID NO:42, or a complement thereof.

[0010] The present invention also relates to a DNA targeting composition comprising a first gRNA and a second gRNA.The first gRNA molecule and the second gRNA molecule comprise a targeting domain comprising the nucleotide sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:41, SEQ ID NO:42 or its complement.The first gRNA molecule and the second gRNA molecule comprise different targeting domains.

[0011] The present invention is also directed to an isolated polynucleotide comprising the gRNA molecule described above or the DNA targeting composition described above.

[0012] The present invention is directed to a vector comprising the gRNA described above, the DNA targeting composition described above, or the isolated polynucleotide described above.

[0013] The present invention is also directed to a vector comprising the DNA targeting composition described above.

[0014] The present invention is also directed to a vector encoding (a) a first guide RNA (gRNA) molecule, (b) a second gRNA molecule, and (c) at least one Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO:24) or NNGRRV (SEQ ID NO:25). The first gRNA molecule and the second gRNA molecule comprise a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:41, SEQ ID NO:42, or a complement thereof. The first gRNA molecule and the second gRNA molecule comprise different targeting domains.

[0015] The present invention is also directed to a cell comprising the gRNA described above, the DNA targeting composition described above, the isolated polynucleotide described above, or the vector described above.

[0016] The present invention is also directed to a kit comprising a gRNA as described above, a DNA targeting system as described above, an isolated polynucleotide as described above, a vector as described above or a cell as described above, optionally with instructions for use.

[0017] The present invention also relates to a method for correcting mutant dystrophin gene in a cell, the method comprising administering to the cell the gRNA described above, the DNA targeting system described above, the isolated polynucleotide described above or the vector described above.

[0018] The present invention also relates to a method for genome editing a mutant dystrophin gene in a subject, the method comprising administering to the subject a genome editing composition comprising the gRNA described above, the DNA targeting system described above, the isolated polynucleotide described above, the vector described above, or the cell described above.

[0019] The present invention is also directed to a method for treating a subject having a mutant dystrophin gene in need thereof, comprising administering to the subject the gRNA described above, the DNA targeting system described above, the isolated polynucleotide described above, the vector described above, or the cell described above.

[0020] The present invention is also directed to a modified adeno-associated viral vector for genome editing of a mutant dystrophin gene in a subject, the modified adeno-associated viral vector comprising a first polynucleotide sequence encoding a gRNA as described above and a second polynucleotide sequence encoding a Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25).

[0021] The present invention is also directed to a composition for deleting a segment comprising exon 51 in the dystrophin gene, the composition comprising: (a) a first vector comprising a polynucleotide sequence encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25); and (b) a second vector comprising a polynucleotide sequence encoding a second gRNA molecule and a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). Each of the first and second gRNA molecules has a targeting domain 19-24 nucleotides in length, and the first and second vectors are configured to form first and second double-stranded breaks in first and second introns, respectively, adjacent to exon 51 of the human DMD gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0022] The present invention is also directed to a cell comprising the composition described above.

[0023] The present invention is also directed to a method of correcting a mutant dystrophin gene in a cell, comprising administering to the cell (a) a first vector comprising a polynucleotide sequence encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO:24) or NNGRRV (SEQ ID NO:25), and (b) a second vector comprising a polynucleotide sequence encoding a second gRNA molecule and a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO:24) or NNGRRV (SEQ ID NO:25). The first and second gRNA molecules each have a targeting domain 19-24 nucleotides in length, and the vector is configured to form first and second double-stranded breaks in first and second introns, respectively, adjacent to exon 51 of the human dystrophin gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0024] The present invention is also directed to a method of treating a subject in need thereof having a mutant dystrophin gene, comprising administering to the subject (a) a first vector comprising a polynucleotide sequence encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25), and (b) a second vector comprising a polynucleotide sequence encoding a second gRNA molecule and a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). The first and second gRNA molecules each have a targeting domain 19-24 nucleotides in length, and the vector is configured to form first and second double-stranded breaks in first and second introns, respectively, adjacent to exon 51 of the human dystrophin gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0025] The present invention is also directed to a method of generating a transgenic rodent embryo having a human dystrophin gene with a deletion of exon 52 (Δ52) (hDMD), the method comprising administering to a rodent embryo a gRNA as described above, a DNA targeting system as described above, an isolated polynucleotide as described above, a vector as described above, a modified adeno-associated viral vector as described above, or a composition as described above, thereby deleting exon 52 of the human dystrophin gene, and selecting a transgenic rodent embryo having a deletion of exon 52 of the human dystrophin gene, the rodent embryo comprising a normal human dystrophin gene.

[0026] The present invention is also directed to transgenic rodent embryos produced by the methods described above.

[0027] The present invention is also directed to transgenic rodents produced from the transgenic rodent embryos described above. [Brief description of the drawings]

[0028] [Figure 1] 1 shows the activity of individual gRNAs JCR89 and JCR91 targeting the human dystrophin gene (wild-type dystrophin gene) in HEK293T cells and DMD patient myoblast cell lines (DMD 8036 and DMD 6594, each of which harbors a mutant form of the dystrophin gene) as determined by Surveyor assay. [Figure 2A-2B] Deletion of exon 51 in genomic DNA of HEK293T cells and DMD myoblasts (DMD 8036 and DMD 6594) (Figure 2A) and in cDNA derived from DMD myoblasts (Figure 2B) due to simultaneous treatment with SaCas9 and gRNAs JCR89 and JCR91. [Diagram 3] 1 shows an AAV-based in vivo system for simultaneous delivery of SaCas9 and gRNAs JCR89 and JCR91 to muscle tissue by two viral vectors. [Figure 4] 1 shows detection of deletion of human exon 51 in transgenic mice carrying the human DMD gene (hDMD / mdx mice) following local AAV8 delivery of a viral vector carrying SaCas9 and gRNA to the tibialis anterior (TA) muscle. [Diagram 5] 1 shows detection of human exon 51 deletion in transgenic mice carrying the hDMD gene after systemic AAV8 delivery by tail vein injection. [Figure 6] The various gRNA targets that are conserved between the human and rhesus genomes are shown (see gRNA sequences in Table 2). The location of each gRNA is shown relative to exon 51 of the human dystrophin gene. [Figure 7] The activity of individual gRNAs following transfection of human HEK293T cells as determined by Surveyor assay is shown. [Figure 8] The specificity of candidate gRNAs predicted using the CasOFFinder program (Bae et al. (2014) Bioinformatics 30:1473-1475) is shown. [Figure 9] 1 shows the deletion of exon 51 by gRNAs JCR157 and JCR160 in HEK293T cells and in DMD 6594 cells as determined by PCR of genomic DNA. [Figure 10] Shown is the activity (as determined by Surveyor assay) of gRNA JCR157 at various target lengths: 19, 20, 21, 22 and 23 nucleotides. [Figure 11] Shown is the activity (determined by Surveyor assay) of gRNA JCR160 at various target lengths: 19, 20, 21, 22 and 23 nucleotides. [Figure 12] Deletions generated by combining JCR157 and JCR160 of various lengths (21, 22 or 23 nucleotides) as determined by PCR of genomic DNA are shown. [Figure 13] Shows in vitro on-target nuclease activity by Surveyor assay. [Figure 14] 1 shows an in vitro deletion of exon 51 in genomic DNA. [Figure 15] 1 shows in vitro deletion of exon 51 in cDNA in human DMD myoblasts differentiated for 7 days. [Figure 16] Shows in vitro splicing of exons 47-52 in cDNA from DMD patient myoblasts. [Figure 17] FIG. 1 shows the design of Δ52 / mdx mice starting from healthy hDMD / mdx mice. [Figure 18] Shown is in vitro guide validation: Individual (Surveyor assay). [Figure 19]Shown is in vitro guide validation: pair: gRNA pairs were used to generate a deletion of exon 51 in genomic DNA of HEK293T cells. [Figure 20] An outline of the DNA microinjection protocol is shown. [Figure 21] 1 shows an outline of mouse breeding. [Figure 22] The results of genotyping of founder mice are shown. [Figure 23] Part of the results of sequencing founder mice 7, 63 and 76 are shown. [Figure 24] Further mouse breeding outlines are provided. [Diagram 25] Genotyping of litter 5 (males only) from the founder male 76+mdx / mdx breeding result is shown. "63" is the founder male (but was not the parent in this case). "293" represents the HEK293T cell genomic DNA control. [Figure 26] Genotyping of litter 1 from breeding results of founder male 63+mdx / mdx is shown. [Figure 27] A portion of the 392 bp sequencing reads of pups 54497 and 54498 are shown. [Figure 28] Immunohistochemical staining of the heart and TA from pups 54497 and 54498 is shown. [Figure 29] 1 shows that Δ52 / mdx mice lack dystrophin protein. [Diagram 30] 4 shows a Western blot demonstrating that Δ52 / mdx mice lack dystrophin protein consistent with the DMD genotype, whereas healthy hDMD / mdx mice express dystrophin. [Diagram 31] FIG. 1 shows the overall activity of Δ52 / mdx mice compared to mdx and hDMD / mdx mice, as measured by locomotor activity and exploration. [Diagram 32]1 shows a correction strategy for Δ52 / mdx mice using SaCas9 and gRNA to skip exon 51 by targeting the gRNA upstream and downstream of exon 51 in the intronic region for removal. [Diagram 33] 1 shows in vitro restoration of dystrophin protein from an exon 51 deletion in DMD patient myoblasts (DMD 6594 cells) using SaCas9 and gRNAs JCR179 and JCR183. [Diagram 34] 1 shows the experimental design for treating Δ52 / mdx mice using gRNA and the SaCas9 system. [Diagram 35] Shows in vivo exon 51 deletion in the right TA muscle. [Diagram 36] Shows in vivo exon 51 deletion in the right TA muscle. [Figure 37] 1 shows restoration of dystrophin protein in treated TA muscles in vivo. [Figure 38] 1 shows restoration of dystrophin protein in treated TA muscles in vivo. [Figure 39] The average of all time points for the total distance traveled is shown. [Diagram 40] The average of all time points for total rearing posture is shown. [Diagram 41] Grip strength of untreated and treated mice at 16 weeks is shown. [Diagram 42] The results of cDNA PCR for cardiac tissue are shown. [Diagram 43] Sequencing of the amplified cDNA PCR bands in FIG. 42 is shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] As described herein, certain methods and engineered gRNAs have been found to be useful in CRISPR / CRISPR-associated (Cas) 9-based gene editing systems for altering expression, genome engineering, and correcting or reducing the effect of mutations in the dystrophin gene involved in genetic diseases (e.g., DMD). The gRNAs of the present disclosure were generated at target sites that are more suitable for clinical translation. For example, the gene encoding Streptococcus pyogenes (S. pyogenes) Cas9 (SpCas9) is too large to be delivered by adeno-associated virus (AAV), a vector used for systemic gene delivery to muscle, if all other necessary regulatory sequences are included. Instead, the gRNAs of the present disclosure were selected and screened for use with Staphylococcus aureus (S. aureus) Cas9 (SsCas9), which is about 1 kb smaller than SpCas9. Target selection was screened for targets that are compatible with SaCas9 on sequences conserved between the human genome and the rhesus monkey genome, which greatly limits the number of possible gene targets. This selection criteria was chosen to consider gRNA candidates that can be active in both humans and rhesus monkeys to facilitate preclinical testing in non-human primate models.The gRNAs of the present disclosure (targeting both human and rhesus monkey dystrophin gene sequences) can be used with a CRISPR / Cas9-based system to target the intronic region surrounding exon 51 of the human dystrophin gene, resulting in genomic deletion of this region to restore functional dystrophin expression in cells derived from DMD patients.

[0030] Also described herein are gene constructs, compositions and methods for delivering CRISPR / Cas9-based gene editing system and multiple gRNAs to target dystrophin gene.The subject matter of the present disclosure also provides a method for delivering gene constructs (e.g., vectors) or compositions comprising this gene construct to skeletal and cardiac muscles.The vector can be AAV (e.g., modified AAV vectors).The subject matter of the present disclosure describes a method for delivering the active form of this class of therapeutic agent to skeletal or cardiac muscles, which is effective, efficient and facilitates successful genome modification, and further provides a means to rewrite the human genome for therapeutic applications and a target model species for basic science applications.

[0031] The section headings used in this section and throughout the disclosure herein are for organizational purposes only and are not intended to be limiting.

[0032] 1.Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of conflict, the present document, including definitions, will control. Although preferred methods and materials are described below, similar or equivalent methods and materials to those described herein can be used in the practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods and examples disclosed herein are illustrative only and are not intended to be limiting.

[0033] The terms "comprise," "including," "having," "having," "can," "containing," and variations thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not exclude additional actions or structural possibilities. The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments that "comprise," "consist of," and "consist essentially of" the embodiments or elements provided herein, whether or not expressly described.

[0034] For the recitation of numerical ranges herein, each intervening number is specifically contemplated to the same degree of precision. For example, for the range 6 to 9, the numbers 7 and 8 are specifically contemplated in addition to 6 and 9, and for the range 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are specifically contemplated.

[0035] As used herein, the term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined (i.e., the limitations of the measurement system). For example, "about" can mean within 3 or more than 3 standard deviations, as is customary in the art. Alternatively, "about" can mean within a range of up to 20%, preferably within a range of up to 10%, more preferably within a range of up to 5%, and even more preferably within a range of up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold of a value.

[0036] "Adeno-associated virus" or "AAV", as used interchangeably herein, refers to a small virus belonging to the Dependovirus genus of the Parvoviridae family that infects humans and some other primate species. AAV is not currently known to cause disease, and therefore the virus induces a very mild immune response.

[0037] As used herein, "binding region" refers to the region within a nuclease target region that is recognized and bound by a nuclease.

[0038] "Cardiomyocyte" or "heart muscle", used interchangeably herein, refers to a type of involuntary striated muscle (myocardium) found in the wall and histological basis of the heart. Cardiac muscle is made up of cardiomyocytes or myocardiocytes. Cardiomyocytes exhibit striations similar to those on skeletal muscle cells, but unlike multinucleated skeletal muscle, contain only one unique nucleus. In certain embodiments, "myocardial condition" refers to a condition associated with the myocardium (e.g., cardiomyopathies, heart failure, arrhythmias, and inflammatory heart disease).

[0039] As used herein, "coding sequence" or "encoding nucleic acid" refers to a nucleic acid (RNA or DNA molecule) that comprises a nucleotide sequence that codes for a protein. The coding sequence may further comprise a start and stop signal operably linked to regulatory elements, including a promoter and a polyadenylation signal, capable of directing expression in cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may be codon-optimized.

[0040] As used herein, "complement" or "complementary" means that a nucleic acid can undergo Watson-Crick (e.g., AT / U and CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs of a nucleic acid molecule. "Complementarity" refers to the property shared between two nucleic acid sequences such that when aligned antiparallel to one another, the nucleotide bases at every position are complementary.

[0041] As used herein, "correcting", "genome editing" and "repairing" refer to changing a mutant gene that codes for a truncated protein or no protein at all to obtain full-length functional or partially full-length functional protein expression. Correcting or repairing a mutant gene can include replacing a region of the gene that has a mutation, or replacing the entire mutant gene with a copy of the gene that does not have the mutation using a repair mechanism such as homology-directed repair (HDR). Correcting or repairing a mutant gene can also include repairing a frameshift mutation that results in a premature stop codon, an ectopic splice acceptor site, or an ectopic splice donor site by creating a double-strand break in the gene and then repairing the gene using non-homologous end joining (NHEJ). NHEJ can add or delete at least one base pair during repair, which can restore the proper reading frame and remove the premature stop codon. Correcting or repairing a mutant gene can also include destroying the ectopic splice acceptor site or splice donor sequence. Correcting or repairing a mutated gene can also include deleting a non-essential gene segment by the simultaneous action of two nucleases on the same DNA strand to restore the proper reading frame by removing the DNA between two nuclease target sites, and repairing the DNA break by NHEJ.

[0042] "Donor DNA," "donor template," and "repair template," as used interchangeably herein, refer to a double-stranded DNA fragment or molecule that contains at least a portion of a gene of interest. The donor DNA can encode a fully functional protein or a partially functional protein.

[0043] "Duchenne muscular dystrophy" or "DMD", used interchangeably herein, refers to a recessive, lethal, X-linked disorder that results in muscle degeneration and ultimately death. DMD is a common, inherited, monogenic disease that affects 1 in 3500 males. DMD is the result of inherited or spontaneous mutations that result in nonsense or frameshift mutations in the dystrophin gene. The majority of dystrophin mutations that cause DMD are exon deletions that disrupt the reading frame in the dystrophin gene, causing premature translation termination. DMD patients typically lose the ability to support themselves during childhood, develop progressive muscle weakness during their teenage years, and die in their twenties.

[0044] "Dystrophin" as used herein refers to a rod-shaped cytoplasmic protein that is part of a protein complex that connects the cytoskeleton of muscle fibers to the surrounding extracellular matrix through the cell membrane. Dystrophin provides structural stability to the dystroglycan complex of the cell membrane, which is responsible for regulating muscle cell integrity and function. The dystrophin gene or "DMD gene", as used interchangeably herein, is 2.2 megabases at the locus Xp21. The primary transcript is approximately 2,400 kb, and the mature mRNA is approximately 14 kb. 79 exons code for a protein that is more than 3500 amino acids.

[0045] "Exon 51" as used herein refers to the 51st exon of the dystrophin gene. Exon 51 is frequently adjacent to frame-breaking deletions in DMD patients and has been targeted in clinical trials for oligonucleotide-based exon skipping. A clinical trial for the exon 51 skipping compound eteplirsen recently reported significant functional benefit over 48 weeks, with an average of 47% dystrophin-positive fibers compared to baseline. Mutations in exon 51 are ideally suited for permanent correction by NHEJ-based genome editing.

[0046] As used herein interchangeably, "frameshift" or "frameshift mutation" refers to a type of genetic mutation in which the addition or deletion of one or more nucleotides results in a shift in the reading frame of a codon in an mRNA. The shift in reading frame can result in a change in the amino acid sequence in protein translation, such as a missense mutation or a premature stop codon.

[0047] As used herein, "functional" and "fully functional" describe a protein that has biological activity. A "functional gene" refers to a gene that is transcribed into mRNA that is translated into a functional protein.

[0048] As used herein, a "fusion protein" refers to a chimeric protein created through the joining of two or more genes that originally encoded separate proteins. Translation of the fusion gene results in a single polypeptide possessing functional properties derived from each of the original proteins.

[0049] "Genetic construct" as used herein refers to a DNA or RNA molecule that comprises a nucleotide sequence that codes for a protein.The coding sequence comprises start and stop signals that are operably linked to regulatory elements, including promoters and polyadenylation signals, that can induce expression in the cells of the individual to which the nucleic acid molecule is administered.As used herein, the term "expressible form" refers to a genetic construct that contains the necessary regulatory elements that are operably linked to the coding sequence that codes for a protein, such that the coding sequence is expressed when present in the cells of an individual.

[0050] "Genetic disease" as used herein refers to a disease, especially a condition present from birth, caused in part or in whole, directly or indirectly, by one or more abnormalities in the genome. The abnormality may be a mutation, an insertion, or a deletion. The abnormality may affect the coding sequence of a gene or its regulatory sequence. The genetic disease may be, but is not limited to, DMD, Becker muscular dystrophy (BMD), hemophilia, cystic fibrosis, Huntington's chorea, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, inherited disorders of hepatic metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease.

[0051] " Homologous recombination repair " or " HDR " used interchangeably herein refers to the mechanism in cells to repair double-stranded DNA damage when homologous fragments of DNA are present in the nucleus, usually in the G2 and S phases of the cell cycle. HDR uses donor DNA template to guide repair, and can be used to create specific sequence changes to genomes, including targeted addition of whole genes. When donor template is provided with CRISPR / Cas9-based gene editing system, the cellular machinery will repair the break by homologous recombination, which is enhanced by several orders of magnitude in the presence of DNA break. In the absence of homologous DNA fragments, non-homologous end joining can occur instead.

[0052] "Genome editing" as used herein refers to changing genes. Genome editing can include correcting or repairing mutated genes. Genome editing can include knocking out genes, such as mutated or normal genes. Genome editing can be used to treat disease or enhance muscle repair by changing targeted genes.

[0053] "Identical" or "identity" as used herein in the context of two or more nucleic acid or polypeptide sequences means that the sequences have a certain percentage of residues that are identical over a particular region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences over a particular region, determining the number of positions where identical residues exist in both sequences to give the number of matched positions, dividing the number of matched positions by the total number of positions in the particular region, and multiplying the result by 100 to give the percentage of sequence identity. If the two sequences are of different lengths, or the alignment results in one or more sticky ends such that only a single sequence is included in a particular region of comparison, the residues of the single sequence are included in the denominator of the calculation, but not in the numerator. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

[0054] As used herein interchangeably, "mutated gene" or "mutated gene" refers to a gene that has undergone a detectable mutation. A mutant gene has undergone an alteration, such as loss, gain, or exchange of genetic material, that affects the normal transmission and expression of the gene. As used herein, a "disrupted gene" refers to a mutant gene that has a mutation that results in a premature stop codon. The disrupted gene product is truncated compared to the full-length, undisrupted gene product.

[0055] As used herein, the term "non-homologous end joining (NHEJ) pathway" refers to a pathway that repairs double-strand breaks in DNA by directly ligating the broken ends without the need for a homologous template. Template-independent religation of DNA ends by NHEJ is a stochastic, error-prone repair process that introduces random microinsertions and microdeletions (indels) at the DNA breakpoint. This method can be used to intentionally disrupt, delete, or change the reading frame of targeted gene sequences. NHEJ generally uses short homologous DNA sequences, called microhomologies, to guide repair. These microhomologies are often present in single-stranded overhangs at the ends of double-strand breaks. When the overhangs are perfectly matched, NHEJ usually repairs the break accurately, while imprecise repairs resulting in loss of nucleotides can also occur, which is much more common when the overhangs are mismatched.

[0056] As used herein, a "normal gene" refers to a gene that has not undergone alteration, such as the loss, gain, or exchange of genetic material. A normal gene undergoes normal gene transmission and gene expression.

[0057] As used herein, "nuclease-mediated NHEJ" refers to NHEJ that is initiated after a nuclease, such as a Cas9 molecule, breaks double-stranded DNA.

[0058] As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" refers to at least two nucleotides that are covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, nucleic acid also encompasses the complementary strand of the depicted single strand. Many variants of nucleic acid can be used for the same purpose as a given nucleic acid. Thus, nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, nucleic acid also encompasses probes that hybridize under stringent hybridization conditions.

[0059] Nucleic acids can be single-stranded or double-stranded, and can contain portions of both double-stranded and single-stranded sequences. Nucleic acids can be DNA, both genomic and cDNA, RNA, or hybrids, where the nucleic acids can contain combinations of deoxyribonucleotides and ribonucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods.

[0060] As used herein, "operably linked" means that the expression of a gene is under the control of a promoter that is spatially linked to the gene. The promoter can be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene can be approximately the same as the distance between the promoter and the gene that the promoter controls in the gene from which the promoter is derived. As is known in the art, variations in this distance can be accommodated without loss of promoter function.

[0061] As used herein, "partially functional" describes a protein that is encoded by a mutated gene and that has less biological activity than a functional protein, but more biological activity than a non-functional protein.

[0062] As used interchangeably herein, a "premature stop codon" or "out-of-frame stop codon" refers to a nonsense mutation in the sequence of DNA that results in a stop codon at a position not normally found in the wild-type gene. A premature stop codon can result in a truncated or shortened protein compared to the full-length form of the protein.

[0063] "Promoter" as used herein means a synthetic or naturally derived molecule capable of conferring, activating or promoting expression of a nucleic acid in a cell. A promoter can contain one or more specific transcriptional regulatory sequences to further promote expression and / or to alter the spatial expression and / or temporal expression of the same. A promoter can also contain distal enhancer or repressor elements, which can be located as far away as several thousand base pairs from the start site of transcription. Promoters can be obtained from sources including viruses, bacteria, fungi, plants, insects and animals. A promoter can constitutively or variably regulate the expression of genetic components with respect to the cell, tissue or organ in which expression occurs, or with respect to the developmental stage in which expression occurs, or in response to external stimuli such as physiological stress, toxins, metal ions or inducers. Representative examples of promoters include the bacteriophage T7 promoter, the bacteriophage T3 promoter, the SP6 promoter, the lac operator-promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the SV40 early promoter or the SV40 late promoter, the human U6 (hU6) promoter and the CMV IE promoter.

[0064] "Skeletal muscle" as used herein refers to a type of striated muscle that is under the control of the somatic nervous system and is attached to bones by bundles of collagen fibers known as tendons. Skeletal muscle is composed of individual components known as myocytes, or "muscle cells," sometimes colloquially called "muscle fibers." Muscle cells are formed from the fusion of developmental myoblasts (a type of embryonic precursor cell that gives rise to muscle cells) in a process known as myogenesis. These long, cylindrical, multinucleated cells are also called myofibers.

[0065] As used herein, "skeletal muscle condition" refers to conditions associated with skeletal muscle, such as muscular dystrophies, aging, muscle degeneration, wound healing, and muscle weakness or atrophy.

[0066] "Subject" and "patient", used interchangeably herein, refer to any vertebrate, including, but not limited to, mammals (e.g., cows, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, and mice, non-human primates (e.g., monkeys such as cynomolgus or rhesus monkeys, chimpanzees), and humans). In some embodiments, the subject can be human or non-human. The subject or patient may be undergoing other forms of therapy.

[0067] "Target gene" as used herein refers to any nucleotide sequence that encodes a known or putative gene product. The target gene can be a mutated gene involved in a genetic disease. In certain embodiments, the target gene is the human dystrophin gene. In certain embodiments, the target gene is a mutated human dystrophin gene.

[0068] "Target region," as used herein, refers to the region of a target gene that a CRISPR / Cas9-based gene editing system is designed to bind and cleave.

[0069] As used herein, "transgene" refers to a gene or genetic material that contains a gene sequence that is isolated from one organism and introduced into another organism. This non-native segment of DNA can retain the ability to produce RNA or protein in the transgenic organism, or it can change the normal function of the genetic code of the transgenic organism. The introduction of a transgene has the potential to change the phenotype of the organism.

[0070] "Variant," as used herein with respect to a nucleic acid, means (i) a portion or fragment of a reference nucleotide sequence; (ii) the complement of a reference nucleotide sequence, or a portion thereof; (iii) a nucleic acid that is substantially identical to a reference nucleic acid, or its complement; or (iv) a nucleic acid that hybridizes to a reference nucleic acid under stringent conditions, its complement, or a sequence substantially identical thereto.

[0071] A "variant" with respect to a peptide or polypeptide differs in amino acid sequence by insertion, deletion, or conservative substitution of amino acids, but retains at least one biological activity. A variant can also refer to a protein having an amino acid sequence that is substantially identical to a reference protein having an amino acid sequence that retains at least one biological activity. Conservative substitution of amino acids, i.e., replacing an amino acid with another amino acid of similar properties (e.g., hydrophilicity, degree, and distribution of charged regions), is recognized in the art as generally involving minor changes. These minor changes can be determined to some extent by considering the hydropathic index of an amino acid, as understood in the art. Kyte et al., J. Mol. Biol. 157:105-132 (1982). The hydropathic index of an amino acid is based on consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic index can be substituted and still retain protein function. In one embodiment, amino acids with hydropathic indices of ±2 are substituted. The hydrophilicity of an amino acid can also be used to identify substitutions that will result in a protein that retains biological function. Consideration of the hydrophilicity of an amino acid in the context of a peptide allows for the calculation of the maximum local average hydrophilicity of the peptide. Substitutions can be made with amino acids that have hydrophilicity values ​​within ±2 of each other. Both the hydrophobicity index and hydrophilicity value of an amino acid are influenced by the particular side chain of that amino acid. Consistent with this finding, it will be appreciated that amino acid substitutions that are compatible with biological function depend on the relative similarity of the amino acids, particularly the side chains of those amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

[0072] As used herein, a "vector" refers to a nucleic acid sequence that contains an origin of replication. The vector can be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector can be a DNA or RNA vector. The vector can be a self-replicating extrachromosomal vector, preferably a DNA plasmid. For example, the vector can encode a Cas9 protein and at least one gRNA molecule (e.g., a gRNA comprising a targeting domain of any one of SEQ ID NOs: 1-19, 41, 42, or a complement thereof). In some embodiments, the Cas9 protein can have the amino acid sequence of SEQ ID NO: 27, SEQ ID NO: 33, or SEQ ID NO: 45. In some embodiments, the Cas9 protein can be a Staphylococcus aureus (S. aureus) Cas9 (e.g., a SaCas9 having the amino acid sequence of SEQ ID NO: 33 or 45). In some embodiments, the Cas9 protein is encoded by a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:43, or SEQ ID NO:44.

[0073] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the same meaning as commonly understood by those skilled in the art. For example, all academic terms used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry, and hybridization described herein, and these techniques, are well known and commonly used in the art. The meaning and scope of terms should be clear; however, in case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Furthermore, unless otherwise required by context, singular terms shall include the plural, and plural terms shall include the singular.

[0074] 2. Gene construct for genome editing of the dystrophin gene The present invention is directed to a gene construct for genome editing, genome modification or genome expression modification of dystrophin gene (e.g., human dystrophin gene).The gene construct comprises at least one gRNA that targets both human and rhesus monkey dystrophin gene sequence (e.g., target compatible with SaCas9).The gRNA of the present disclosure can be included in a CRISPR / Cas9-based gene editing system (e.g., a system using SaCas9) to target the intronic region surrounding exon 51 of human dystrophin gene, causing genome deletion of this region and restoring the expression of functional dystrophin in cells derived from DMD patients.

[0075] A dystrophin gene Dystrophin is a rod-shaped cytoplasmic protein that is part of a protein complex that connects the muscle fiber cytoskeleton to the surrounding extracellular matrix through the cell membrane. Dystrophin provides structural stability to the dystroglycan complex in the cell membrane. The dystrophin gene is 2.2 vega bases at locus Xp21. The primary transcript measures approximately 2,400 kb, and the mature mRNA is approximately 14 kb. 79 exons code for a protein that is more than 3500 amino acids. Normal skeletal muscle tissue contains only small amounts of dystrophin, but the abnormal lack of expression of this dystrophin leads to the development of severe and incurable symptoms. Some mutations in the dystrophin gene result in the production of defective dystrophin and severe dystrophic phenotypes in affected patients. Some mutations in the dystrophin gene result in partially functional dystrophin protein and very mild dystrophic phenotypes in affected patients.

[0076] DMD is the result of inherited or spontaneous mutations that cause nonsense or frameshift mutations in the dystrophin gene. Naturally occurring mutations and their consequences are relatively well understood for DMD. It is known that in-frame deletions occurring in the exon 45-55 region (e.g., exon 51) contained in the rod domain can produce a highly functional dystrophin protein, with many carriers being asymptomatic or exhibiting mild symptoms. Furthermore, by targeting exons in this region of the dystrophin gene (e.g., targeting exon 51), more than 60% of patients could theoretically be treated. Efforts are being made to restore the disrupted dystrophin reading frame in DMD patients by skipping non-essential exons (e.g., skipping exon 51) during splicing of the mRNA to produce an internally deleted but functional dystrophin protein. Deletion of an internal dystrophin exon (e.g., deletion of exon 51) causes a relatively mild form of Becker muscular dystrophy (i.e., BMD) that maintains the proper reading frame. The Becker muscular dystrophy (or BMD) genotype is similar to DMD in that there is a deletion in the dystrophin gene. However, this deletion keeps the reading frame intact. Therefore, an internally truncated but partially functional dystrophin protein is produced. BMD has a wide range of phenotypes, but in many cases, the phenotype is much milder than DMD when the deletion is between exons 45-55 of dystrophin. Therefore, changing the DMD genotype to the BMD genotype is a common strategy to correct dystrophin. There are many strategies to correct dystrophin, and many of these rely on restoring the endogenous dystrophin reading frame. This shifts the disease genotype from DMD to Becker muscular dystrophy. Many BMD patients have intragenic deletions that maintain the translational reading frame, resulting in a shorter but largely functional dystrophin protein.

[0077] In certain embodiments, modification of exon 51 (e.g., deletion or elimination of exon 51, e.g., by NHEJ) to restore reading frame improves phenotype DMD subjects, such as DMD subjects with deletion mutations. In certain embodiments, exon 51 of the dystrophin gene refers to the 51st exon of the dystrophin gene. Exon 51 is frequently adjacent to frame-breaking deletions in DMD patients and has been targeted in clinical trials of oligonucleotide-based exon skipping. Clinical trials of the exon 51 skipping compound eteplirsen reported significant functional benefits over 48 weeks with an average of 47% dystrophin-positive fibers compared to baseline. Mutations at exon 51 are ideally suited for permanent correction by NHEJ-based genome editing.

[0078] The vector of the present disclosure can create a deletion in a dystrophin gene (e.g., human dystrophin gene). In certain embodiments, the vector is configured to create two double-strand breaks (first double-strand break and second double-strand break) in two introns (first intron and second intron) adjacent to the target position of the dystrophin gene, thereby deleting the segment containing the dystrophin target position in the dystrophin gene. The "dystrophin target position" can be a dystrophin exon target position or a dystrophin intraexon target position as described herein. Deletion of the dystrophin exon target position can optimize the dystrophin sequence of a patient suffering from Duchenne muscular dystrophy, for example, increasing the function or activity of the encoded dystrophin protein, or improving the disease condition of the subject. In certain embodiments, the elimination of the dystrophin exon target position restores the reading frame. The dystrophin exon target position can include one or more exons of the dystrophin gene. In certain embodiments, the dystrophin target locus comprises exon 51 of the dystrophin gene (eg, the human dystrophin gene).

[0079] The genetic constructs (e.g., vectors) of the present disclosure can mediate highly efficient gene editing at exon 51 of the dystrophin gene (e.g., the human dystrophin gene). The genetic constructs (e.g., vectors) of the present disclosure restore expression of dystrophin protein in cells derived from DMD patients.

[0080] Exon 51 is frequently adjacent to frame-breaking deletions in DMD. Removal of exon 51 from dystrophin transcripts by exon skipping can be used to treat approximately 15% of all DMD patients. This class of dystrophin mutations is ideally suited for permanent correction by NHEJ-based genome editing and HDR. The genetic constructs (e.g., vectors) described herein have been developed for targeted modification of exon 51 in the human dystrophin gene. The genetic constructs (e.g., vectors) of the present disclosure are transfected into human DMD cells and mediate efficient genetic modification and gene conversion to correct the reading frame. Protein recovery is simultaneous with frame recovery and is detected in the majority of cells treated with CRISPR / Cas9-based gene editing systems.

[0081] b.CRISPR system The genetic construct (e.g., vector) of the present disclosure encodes a CRISPR / Cas9-based gene editing system specific for the dystrophin gene (e.g., human dystrophin gene). "Clustered regularly interspaced short palindromic repeats" and "CRISPR", as used interchangeably herein, refer to a locus that contains multiple short direct repeats found in approximately 40% of sequenced bacterial and 90% of sequenced archaeal genomes. The CRISPR system is a microbial nuclease system involved in defense against invading phages and plasmids, providing a form of adaptive immunity. CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes and non-coding RNA elements that can program the specificity of CRISPR-mediated nucleic acid cleavage. Short segments of foreign DNA, called spacers, are integrated between the CRISPR repeats in the genome and act as "memory" of past exposure. Cas9 forms a complex with the 3' end of the sgRNA (also interchangeably referred to herein as "gRNA"), and this protein-RNA pair recognizes its genomic target by complementary base pairing between the 5' end of the sgRNA sequence and a predefined 20 bp DNA sequence known as the protospacer. This complex is guided to the homologous locus of pathogen DNA, i.e., the protospacer and protospacer-adjacent motif (PAM) in the pathogen genome, via a coded region in the crRNA. The non-coding CRISPR array is transcribed and cleaved within the direct repeats to a short crRNA containing individual spacer sequences, which guides the Cas nuclease to the target site (protospacer). By simply exchanging the 20 bp recognition sequence of the expressed sgRNA, the Cas9 nuclease can be directed to a new target in the genome. CRISPR spacers are used to recognize and silence foreign genetic elements in a manner similar to RNAi in eukaryotes.

[0082] Three classes of CRISPR systems are known: type I, type II, and type III effector systems. Type II effector systems use a single effector enzyme, Cas9, to perform targeted DNA double-strand breaks in four sequential steps to cleave dsDNA. Compared to type I and type III effector systems, which require multiple different effectors acting as a complex, type II effector systems can function in alternative contexts, such as eukaryotic cells. Type II effector systems consist of a long precursor-crRNA, which is transcribed from a spacer-containing CRISPR locus, Cas9 protein, and tracrRNA, which is involved in precursor-crRNA processing. The tracrRNA hybridizes to the repeat region that separates the spacer of the precursor-crRNA, thus initiating dsRNA cleavage by endogenous RNase III. This cleavage is followed by a second cleavage event within each spacer by Cas9, producing the tracrRNA and mature crRNA that remains associated with Cas9, forming the Cas9:crRNA-tracrRNA complex.

[0083] The Cas9:crRNA-tracrRNA complex unwinds the DNA duplex and searches for a sequence match with the crRNA to cleave it. Target recognition occurs upon detection of complementarity between the "protospacer" sequence in the target DNA and the remaining spacer sequence in the crRNA. Cas9 mediates cleavage of the target DNA if the correct protospacer adjacent motif (PAM) is also present at the 3' end of the protospacer. For protospacer targeting, the sequence must immediately follow the protospacer adjacent motif (PAM), a short sequence recognized by the Cas9 nuclease required for DNA cleavage. Another type II system has a different PAM requirement. The S. pyogenes CRISPR system can have a PAM sequence for this Cas9 (SpCas9) as 5'-NRG-3' (where R is either A or G) and characterizes the specificity of this system in human cells. The unique capability of CRISPR / Cas9-based gene editing systems is the straightforward ability to simultaneously target multiple different genomic loci by co-expressing a single Cas9 protein with two or more sgRNAs. For example, in genetically modified systems, the Streptococcus pyogenes type II system naturally prefers to use the "NGG" sequence (where "N" can be any nucleotide), but also accepts other PAM sequences such as "NAG" (Hsu et al., Nature Biotechnology (2013) doi:10.1038 / nbt.2647). Similarly, Cas9 from Neisseria meningitidis (NmCas9) usually has a natural PAM of NNNNGATT, but is active across a range of PAMs, including the highly degenerate NNNNGNNN PAM (Esvelt et al. Nature Methods (2013) doi:10.1038 / nmeth.2681).

[0084] S. aureus Cas9 molecules recognize the sequence motif NNGRR (R=A or G) (SEQ ID NO: 22) and direct cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In certain embodiments, S. aureus Cas9 molecules recognize the sequence motif NNGRRN (R=A or G) (SEQ ID NO: 23) and direct cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In certain embodiments, S. aureus Cas9 molecules recognize the sequence motif NNGRRT (R=A or G) (SEQ ID NO: 24) and direct cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In certain embodiments, the S. aureus Cas9 molecule recognizes the sequence motif NNGRRV (R=A or G) (SEQ ID NO: 25) and directs cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In the above embodiment, N can be any nucleotide residue, e.g., A, G, C, or T. The Cas9 molecule can be engineered to alter its PAM specificity.

[0085] (1) CRISPR / Cas9-based gene editing system A genetically engineered form of the Type II effector system of Streptococcus pyogenes has been shown to function in human cells for genome engineering. In this system, Cas9 protein was guided to a target site in the genome by a synthetically reconstituted "guide RNA" ("gRNA", also used interchangeably herein with chimeric single-stranded guide RNA ("sgRNA"), which is generally a crRNA-tracrRNA fusion that obviates the need for RNase III and crRNA processing). Provided herein is a CRISPR / Cas9-based editing system for use in genome editing and treating genetic diseases. The CRISPR / Cas9-based editing system can be designed to target any gene, including genes involved in genetic diseases, aging, tissue regeneration, or wound healing. The CRISPR / Cas9-based gene editing system can include a Cas9 protein or a Cas9 fusion protein and at least one gRNA. In certain embodiments, the system includes two gRNA molecules. A Cas9 fusion protein can include a domain that has an activity different from that endogenous to Cas9, such as, for example, a transactivation domain.

[0086] The target gene (e.g., dystrophin gene, e.g., human dystrophin gene) may be involved in cell differentiation or any other process where gene activation may be desired, or may have a mutation (e.g., frameshift mutation or nonsense mutation). If the target gene has a mutation that creates a premature stop codon, an ectopic splice acceptor site, or an ectopic splice donor site, the CRISPR / Cas9-based gene editing system can be designed to recognize and bind to the nucleotide sequence upstream or downstream of the premature stop codon, the ectopic splice acceptor site, or the ectopic splice donor site. The CRISPR-Cas9-based system can also be used to disrupt normal gene splicing by targeting splice acceptor or splice donor to induce skipping of premature stop codon or restore the disrupted reading frame. The CRISPR-Cas9-based gene editing system may or may not mediate off-target changes to the protein-coding region of the genome.

[0087] (a) Cas9 molecule and Cas9 fusion protein The CRISPR / Cas9-based gene editing system can include a Cas9 protein or a Cas9 fusion protein, which is a nucleic acid cleaving endonuclease encoded by the CRISPR locus and involved in the type II CRISPR system. The Cas9 protein may be derived from any bacterial or archaeal species, including, but not limited to, Streptococcus pyogenes, Staphylococcus aureus (S. aureus), Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, and the like. cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopyrellula marina, Bradyrhizobium sp., Brevibacillus laterosporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lari, Candidatus Puniceispirillum, Clostridium cellulolyticum, Clostridium perfringensperfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter shibae, Eubacterium dolichum, Gamma proteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus sputorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens flavescens, Neisseria lactamica, Neisseria spp.sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lavamentivorans, Pasteurella multocida, Phascolarctobacterium succinatutens, Ralstonia syzygii, Rhodopseudomonas palustris, Rhodovulum sp., Simonsiella muelleri, Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tistrella mobilis, Treponema sp., or Verminephrobacter eiseniae. In certain embodiments, the Cas9 molecule is a Streptococcus pyogenes Cas9 molecule (also referred to herein as "SpCas9"). In certain embodiments, the Cas9 molecule is a Staphylococcus aureus Cas9 molecule (also referred to herein as "SaCas9").

[0088] The Cas9 molecule or Cas9 fusion protein can interact with one or more gRNA molecules and in combination with the gRNA molecule localize to a site that contains the target domain, and in certain embodiments, to the PAM sequence. The ability of the Cas9 molecule or Cas9 fusion protein to recognize the PAM sequence can be determined, for example, using a transformation assay previously described (Jinek 2012).

[0089] In certain embodiments, the ability of a Cas9 molecule or Cas9 fusion protein to interact with and cleave a target nucleic acid is PAM sequence dependent. The PAM sequence is a sequence in the target nucleic acid. In certain embodiments, cleavage of the target nucleic acid occurs upstream of the PAM sequence. Cas9 molecules from different bacterial species can recognize different sequence motifs (e.g., PAM sequences). In certain embodiments, the Cas9 molecule of S. pyogenes recognizes the sequence motif NGG and directs cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence (see, e.g., Mali 2013). In certain embodiments, the Cas9 molecule of S. thermophilus recognizes the sequence motifs NGGNG (SEQ ID NO: 36) and / or NNAGAAW (W=A or T) (SEQ ID NO: 20) and directs cleavage of target nucleic acid sequences 1-10 (e.g., 3-5) bp upstream of these sequences (see, e.g., Horvath 2010; Deveau 2008). In certain embodiments, the Cas9 molecule of S. mutans recognizes the sequence motifs NGG and / or NAAR (R=A or G) (SEQ ID NO: 21) and directs cleavage of target nucleic acid sequences 1-10 (e.g., 3-5) bp upstream of these sequences (see, e.g., Deveau 2008). In certain embodiments, S. aureus Cas9 molecules recognize the sequence motif NNGRR (R=A or G) (SEQ ID NO: 22) and direct cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In certain embodiments, S. aureus Cas9 molecules recognize the sequence motif NNGRRN (R=A or G) (SEQ ID NO: 23) and direct cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In certain embodiments, S. aureus Cas9 molecules recognize the sequence motif NNGRRT (R=A or G) (SEQ ID NO: 24) and direct cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence.In certain embodiments, the S. aureus Cas9 molecule recognizes the sequence motif NNGRRV (R=A or G; V=A or C or G) (SEQ ID NO: 25) and directs cleavage of a target nucleic acid sequence 1-10 (e.g., 3-5) bp upstream of this sequence. In the above embodiment, N can be any nucleotide residue, e.g., A, G, C, or T. The Cas9 molecule can be engineered to alter its PAM specificity.

[0090] In certain embodiments, the vector encodes at least one Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). In certain embodiments, the at least one Cas9 molecule is a S. aureus Cas9 molecule. In certain embodiments, the at least one Cas9 molecule is a mutant S. aureus Cas9 molecule.

[0091] Cas proteins can be mutated to inactivate nuclease activity. Inactivated Cas9 proteins without endonuclease activity (also called "iCas9" or "dCas9") have recently been targeted to genes in bacteria, yeast and human cells by gRNA to suppress gene expression through steric hindrance. Exemplary mutations associated with S. pyogenes Cas9 sequences include D10A, E762A, H840A, N854A, N863A and / or D986A. Exemplary mutations associated with S. aureus Cas9 sequences include D10A and N580A. In certain embodiments, the Cas9 molecule is a mutant S. aureus Cas9 molecule. In certain embodiments, the mutant S. aureus Cas9 molecule comprises a D10A mutation. The nucleotide sequence encoding this mutant S. aureus Cas9 is shown in SEQ ID NO:34 and is described below: [ka] [ka]

[0092] In a particular embodiment, the mutant S. aureus Cas9 molecule comprises an N580A mutation. The nucleotide sequence encoding this mutant S. aureus Cas9 molecule is shown in SEQ ID NO: 35 and described below: [ka] [ka] [ka]

[0093] The nucleic acid encoding the Cas9 molecule can be a synthetic nucleic acid sequence. For example, the synthetic nucleic acid molecule can be chemically modified. The synthetic nucleic acid sequence can be codon-optimized, for example, at least one non-common or less-common codon is replaced with a common codon. For example, the synthetic nucleic acid can direct the synthesis of an optimized messenger mRNA (e.g., optimized for expression in a mammalian expression system, for example, as described herein).

[0094] Additionally, or alternatively, a nucleic acid encoding a Cas9 molecule or a Cas9 polypeptide can contain a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art.

[0095] An exemplary codon-optimized nucleic acid sequence encoding a Cas9 molecule of S. pyogenes is shown in SEQ ID NO:26 and is described below. [ka] [ka] [ka]

[0096] The corresponding amino acid sequence of the S. pyogenes Cas9 molecule is shown in SEQ ID NO:27 and is provided below. [ka]

[0097] Exemplary codon-optimized nucleic acid sequences encoding a S. aureus Cas9 molecule and optionally including a nuclear localization sequence (NLS) are shown in SEQ ID NOs:28-32, 43, and 44, and are described below. Another exemplary codon-optimized nucleic acid sequence encoding a S. aureus Cas9 molecule includes nucleotides 1293-4451 of SEQ ID NO:83.

[0098] SEQ ID NO:28 is set forth below. [ka] [ka] [ka]

[0099] SEQ ID NO:29 is set forth below. [ka] [ka]

[0100] SEQ ID NO:30 is set forth below. [ka] [ka] [ka]

[0101] SEQ ID NO:31 is set forth below. [ka] [ka]

[0102] SEQ ID NO:32 is set forth below. [ka] [ka] [ka]

[0103] SEQ ID NO:43 is set forth below. [ka] [ka]

[0104] In some embodiments, the nucleotide sequence encoding the S. aureus Cas9 molecule comprises the nucleotide sequence of SEQ ID NO:44, which is set forth below. [ka] [ka]

[0105] The amino acid sequence of the S. aureus Cas9 molecule is shown in SEQ ID NO:33 and is provided below. [ka]

[0106] The amino acid sequence of the S. aureus Cas9 molecule is shown in SEQ ID NO:45 and is provided below. [ka]

[0107] Alternatively or additionally, the CRISPR / Cas9-based gene editing system can include a fusion protein. The fusion protein can include two heterologous polypeptide domains, where a first polypeptide domain includes a Cas protein, and a second polypeptide domain has an activity (e.g., transcription activation activity, transcription repression activity, transcription terminator activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, or demethylase activity). The fusion protein can include a Cas9 protein or a mutant Cas9 protein fused to another polypeptide domain having an activity (e.g., transcription activation activity, transcription repression activity, transcription terminator activity, histone modification activity, nuclease activity, nucleic acid association activity, methylase activity, or demethylase activity).

[0108] (a) Transcription activation activity The second polypeptide domain can have transcription activation activity (i.e., transactivation domain). For example, the fusion protein of iCas9 and transactivation domain can be targeted to a mammalian promoter via gRNA combination to activate gene expression of endogenous mammalian genes (e.g., human genes). The transactivation domain can include one VP16 protein, multiple VP16 proteins (e.g., VP48 domain or VP64 domain), or the p65 domain of NFkappaB transcription activator activity. For example, the fusion protein can be iCas9-VP64.

[0109] (b) Transcriptional repression activity The second polypeptide domain can have transcription repression activity. The second polypeptide domain can have Kruppel-associated box activity (e.g., KRAB domain), ERF repressor domain activity, Mxil repressor domain activity, SID4X repressor domain activity, Mad-SID repressor domain activity, or TATA box binding protein activity. For example, the fusion protein can be dCas9-KRAB.

[0110] (c) Transcription termination factor activity The second polypeptide domain can have transcription termination factor activity. The second polypeptide can have eukaryotic termination factor 1 (ERF1) activity or eukaryotic termination factor 3 (EFR3) activity.

[0111] (d) Histone-modifying activity The second polypeptide domain can have histone modifying activity. The second polypeptide domain can have histone deacetylase activity, histone acetyltransferase activity, histone demethylase activity or histone methyltransferase activity. The histone acetyltransferase can be p300 or CREB binding protein (CBP) protein or a fragment thereof. For example, the fusion protein can be dCas9-p300.

[0112] (e) Nuclease activity This second polypeptide domain can have a nuclease activity different from that of the Cas9 protein. Nucleases, or proteins with nuclease activity, are enzymes capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases are usually further classified as endonucleases and exonucleases, although some enzymes can belong to both categories. The well-known nucleases are deoxyribonucleases and ribonucleases.

[0113] (f) Nucleic acid association activity The second polypeptide domain may have nucleic acid-associating activity or nucleic acid-binding protein-DNA binding domain (DBD) is an independently folded protein domain that contains at least one motif that recognizes double-stranded or single-stranded DNA. The DBD may recognize a specific DNA sequence (recognition sequence) or may have a general affinity for DNA. The nucleic acid-associating region is selected from the group consisting of: helix-turn-helix region, leucine zipper region, winged helix region, winged helix-turn-helix region, helix-loop-helix region, immunoglobulin fold, B3 domain, zinc finger, HMG-box, Wor3 domain, TAL effector DNA binding domain.

[0114] (g) Methylase activity The second polypeptide domain can have a methylase activity, which is involved in the transfer of a methyl group to DNA, RNA, a protein, a small molecule, cytosine, or adenine. The second polypeptide domain can include a DNA methyltransferase.

[0115] (h) Demethylase activity The second polypeptide domain can have demethylase activity. The second polypeptide domain can include an enzyme that removes methyl (CH3-) groups from nucleic acids, proteins (especially histones) and other molecules. Alternatively, the second polypeptide can convert methyl groups to hydroxymethylcytosine in a mechanism for demethylating DNA. The second polypeptide can catalyze this reaction. For example, the second polypeptide that catalyzes this reaction can be Tet1.

[0116] (b) gRNA targeting the dystrophin gene The CRISPR / Cas9-based gene editing system includes at least one gRNA molecule (e.g., two gRNA molecules). The gRNA targets the CRISPR / Cas9-based gene editing system. The gRNA is a fusion of two non-coding RNAs: crRNA and tracrRNA. The sgRNA can target any desired DNA sequence by replacing the sequence encoding the 20 bp protospacer, which confers targeting specificity by complementary base pairing with the DNA target. The gRNA mimics the naturally occurring crRNA:tracrRNA duplex involved in the type II effector system. This duplex (which may include, for example, a 42 nucleotide crRNA and a 75 nucleotide tracrRNA) acts as a guide for Cas9 to cleave the target nucleic acid. "Target region," "target sequence," or "protospacer," as used interchangeably herein, refer to the region of a target gene (e.g., the dystrophin gene) that is targeted by the CRISPR / Cas9-based gene editing system. A CRISPR / Cas9-based gene editing system may include at least one gRNA, which targets different DNA sequences. The target DNA sequences may overlap. The target sequence or protospacer is followed by a PAM sequence at the 3' end of the protospacer. Different type II systems require different PAMs. For example, the Streptococcus pyogenes type II system uses a "NGG" sequence, where "N" can be any nucleotide. In some embodiments, the PAM sequence may be "NGG" and "N" can be any nucleotide. In some embodiments, the PAM sequence may be NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25).

[0117] The number of gRNA molecules encoded by a genetic construct (e.g., an AAV vector) of the present disclosure can be at least 1 gRNA, at least 2 different gRNAs, at least 3 different gRNAs, at least 4 different gRNAs, at least 5 different gRNAs, at least 6 different gRNAs, at least 7 different gRNAs, at least 8 different gRNAs, at least 9 different gRNAs, at least 10 different gRNAs, at least 11 different gRNAs, at least 12 different gRNAs, at least 13 different gRNAs, at least 14 different gRNAs, at least 15 different gRNAs, at least 16 different gRNAs, at least 17 different gRNAs, at least 18 different gRNAs, at least 18 different gRNAs, at least 20 different gRNAs, at least 25 different gRNAs, at least 30 different gRNAs, at least 35 different gRNAs, at least 40 different gRNAs, at least 45 different gRNAs, or at least 50 different gRNAs.The number of gRNAs encoded by the vector of the present disclosure may be at least 1 gRNA to at least 50 different gRNAs, at least 1 gRNA to at least 45 different gRNAs, at least 1 gRNA to at least 40 different gRNAs, at least 1 gRNA to at least 35 different gRNAs, at least 1 gRNA to at least 30 different gRNAs, at least 1 gRNA to at least 25 different gRNAs, at least 1 gRNA to at least 20 different gRNAs, at least 1 gRNA to at least 16 different gRNAs, at least 1 gRNA to at least 12 different gRNAs, at least 1 gRNA to at least 8 different gRNAs, at least 1 gRNA to at least 4 different gRNAs, at least 4 gRNA to at least 50 different gRNAs, at least 4 different gRNA to at least 45 different gRNAs, at least 4 different gRNA to at least 40 different gRNAs, at least 4 different gRNA to at least 35 different gRNAs, at least The number of different gRNAs can be from 4 different gRNAs to at least 30 different gRNAs, from 4 different gRNAs to at least 25 different gRNAs, from 4 different gRNAs to at least 20 different gRNAs, from 4 different gRNAs to at least 16 different gRNAs, from 4 different gRNAs to at least 12 different gRNAs, from 4 different gRNAs to at least 8 different gRNAs, from 8 different gRNAs to at least 50 different gRNAs, from 8 different gRNAs to at least 45 different gRNAs, from 8 different gRNAs to at least 40 different gRNAs, from 8 different gRNAs to at least 35 different gRNAs, from 8 different gRNAs to at least 30 different gRNAs, from 8 different gRNAs to at least 25 different gRNAs, from 8 different gRNAs to at least 20 different gRNAs, from 8 different gRNAs to at least 16 different gRNAs, or from 8 different gRNAs to at least 12 different gRNAs.In certain embodiments, the genetic construct (e.g., AAV vector) encodes one gRNA molecule (i.e., the first gRNA molecule) and optionally a Cas9 molecule. In certain embodiments, the first genetic construct (e.g., the first AAV vector) encodes one gRNA molecule (i.e., the first gRNA molecule) and optionally a Cas9 molecule, and the second genetic construct (e.g., the second AAV vector) encodes one gRNA molecule (i.e., the second gRNA molecule) and optionally a Cas9 molecule.

[0118] The gRNA molecule comprises a targeting domain, which is a complementary polynucleotide sequence of a target DNA sequence followed by a PAM sequence. The gRNA can comprise a "G" at the 5' end of the targeting domain or complementary polynucleotide sequence. The targeting domain of the gRNA molecule can comprise a complementary polynucleotide sequence of at least 10 base pairs, at least 11 base pairs, at least 12 base pairs, at least 13 base pairs, at least 14 base pairs, at least 15 base pairs, at least 16 base pairs, at least 17 base pairs, at least 18 base pairs, at least 19 base pairs, at least 20 base pairs, at least 21 base pairs, at least 22 base pairs, at least 23 base pairs, at least 24 base pairs, at least 25 base pairs, at least 30 base pairs, or at least 35 base pairs of the target DNA sequence followed by a PAM sequence. In certain embodiments, the targeting domain of the gRNA molecule has a length of 19-25 nucleotides. In certain embodiments, the targeting domain of the gRNA molecule is 20 nucleotides in length. In certain embodiments, the targeting domain of the gRNA molecule is 21 nucleotides in length. In certain embodiments, the targeting domain of the gRNA molecule is 22 nucleotides in length. In certain embodiments, the targeting domain of the gRNA molecule is 23 nucleotides in length.

[0119] The gRNA can target a region of the dystrophin gene (DMD). In certain embodiments, the gRNA can target at least one of an exon, an intron, a promoter region, an enhancer region, or a transcribed region of the dystrophin gene. In certain embodiments, the gRNA molecule targets intron 50 of the human dystrophin gene. In certain embodiments, the gRNA molecule targets intron 51 of the human dystrophin gene. In certain embodiments, the gRNA molecule targets exon 51 of the human dystrophin gene. The gRNA can include a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or a complement thereof.

[0120] Single or multiple gRNAs can be designed to restore dystrophin reading frame by targeting mutation hotspot at exon 51, or by introducing small insertions and deletions within exons, or by excluding exon 51. After treatment with the vector of the present disclosure, dystrophin expression can be restored in muscle cells of Duchenne patients in vitro. Human dystrophin was detected in vivo after transplantation of genetically corrected patient cells into immunodeficient mice. Significantly, the unique multiple gene editing capability of CRISPR / Cas9-based gene editing system allows efficient generation of large deletions in this mutation hotspot region, which can correct up to 62% of patient mutations by universal or patient-specific gene editing approach. In some embodiments, candidate gRNAs are evaluated and selected based on off-target activity, on-target activity measured by surveyor, and distance from exons.

[0121] 3. DNA targeting compositions The present invention also covers a DNA targeting composition comprising such a gene construct. The DNA targeting composition comprises at least one gRNA molecule (e.g., two gRNA molecules) that targets a dystrophin gene (e.g., human dystrophin gene) as described above. The at least one gRNA molecule can bind to and recognize a target region. The target region can be selected immediately upstream of a possible out-of-frame stop codon, so that an insertion or deletion during the repair process restores the dystrophin reading frame by frame conversion. The target region can also be a splice acceptor or splice donor site, so that an insertion or deletion during the repair process disrupts splicing by disrupting the splice site and excluding the exon, and restores the dystrophin reading frame. The target region can also be an ectopic stop codon, so that an insertion or deletion during the repair process restores the dystrophin reading frame by removing or destroying this stop codon.

[0122] In certain embodiments, the DNA targeting composition of the present disclosure comprises a first gRNA and a second gRNA, wherein the first gRNA molecule and the second gRNA molecule comprise a targeting domain comprising a nucleotide sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or a complement thereof. In certain embodiments, the first gRNA molecule and the second gRNA molecule comprise different targeting domains. In certain embodiments, the first gRNA molecule is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, or SEQ ID NO:15, and the second gRNA molecule is SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or SEQ ID NO:19. In certain embodiments, the first gRNA molecule is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15, and the second gRNA molecule is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19.

[0123] In certain embodiments, the first gRNA molecule and the second gRNA molecule are selected from the group consisting of: (i) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4. (vi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (x) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15;(xi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; and (xii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 42. In some embodiments, the DNA targeting composition comprises the nucleotide sequence set forth in SEQ ID NO: 37 and / or the nucleotide sequence set forth in SEQ ID NO: 38.

[0124] In certain embodiments, the DNA targeting composition can further comprise at least one Cas9 molecule or Cas9 fusion protein that recognizes either the NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25) PAM. In some embodiments, the DNA targeting composition comprises the nucleotide sequence set forth in SEQ ID NO: 83 or SEQ ID NO: 84. In certain embodiments, the vector is configured to create a first and a second double-stranded break in the first and second introns, respectively, adjacent to exon 51 of the human dystrophin gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0125] The deletion efficiency of the vector of the present disclosure can be related to the deletion size (i.e., the size of the segment deleted by this vector).In certain embodiments, the length or size of the specific deletion is determined by the distance between the PAM sequences in the targeted gene (e.g., the dystrophin gene).In certain embodiments, the specific deletion of a segment of the dystrophin gene (defined in terms of the length of this segment and the sequence that this segment contains (e.g., exon 51)) is the result of making a cut adjacent to a specific PAM sequence in the target gene (e.g., the dystrophin gene).

[0126] In a specific embodiment, the deletion size is about 50 to about 2,000 base pairs (bp), for example, about 50 to about 1999 bp, about 50 to about 1900 bp, about 50 to about 1800 bp, about 50 to about 1700 bp, about 50 to about 1650 bp, about 50 to about 1600 bp, about 50 to about 1500 bp, about 50 to about 1400 bp, about 50 to about 1300 bp, about 50 to about 1200 bp, about 50 to about 1150 bp, about 50 to about 1100 bp, about 50 to about 1000 bp, about 50 to about 900 bp, about 50 to about 850 bp, about 50 to about 800 bp, about 50 to about 75 ...900 bp, about 50 to about 1000 bp, about 50 to about 1100 bp, about 50 to about 1200 bp, about 50 to about 1300 bp, about 50 to about 1400 bp, about 50 to about 1500 bp, about 50 to about 1600 bp, about 50 to about 1700 bp, about 50 to about 1800 bp, about 50 to about 1900 bp, about 50 to about 1999 bp, about 50 to about 1900 bp, about Approx. 700bp, Approx. 50~Approx. 600bp, Approx. 50~Approx. 500bp, Approx. 50~Approx. 400bp, Approx. 50~Approx. 350bp, Approx. About 1900bp, about 100 to about 1800bp, about 100 to about 1700bp, about 100 to about 1650bp, about 100 to about 1600bp, about 100 to about 1500bp, about 100 to about 1400bp, about 100 to about 1300bp, about 100 to about 1200bp, about 100 to about 1150bp, about 100 to about 1100bp, about 100 to about 1000bp, about 100 to about 900bp, about 100 to about 850bp, about 100 to about 800bp, about 100 to about 750bp, about 100 to about 700bp, about 100 to about 600bp, about 100 to about 1000bp, about 100 to about 400bp, about 100 to about 350bp, about 100 to about 300bp, about 100 to about 250bp, about 100 to about 200bp, about 100 to about 150bp, about 200 to about 1999bp, about 200 to about 1900bp, about 200 to about 1800bp, about 200 to about 1700bp, about 200 to about 1650bp, about 200 to about 1600bp, about 200 to about 1500bp, about 200 to about 1400bp, about 200 to about 1300bp, about 200 to about 1200bp, about 200 to about 1150bp, about 200 to about 1100bp, about 200 to about 1000bp, about 200 to about 900bp, about 200 to about 850 bp, about 200 to about 800bp, about 200 to about 750bp, about 200 to about 700bp, about 200 to about 600bp, about 200 to about 2000bp, about 200 to about 400bp, about 200 to about 350bp, about 200 to about 300bp, about 200 to about 250bp, about 300 to about 1999bp,about 300 to about 1900 bp, about 300 to about 1800 bp, about 300 to about 1700 bp, about 300 to about 1650 bp, about 300 to about 1600 bp, about 300 to about 1500 bp, about 300 to about 1400 bp, about 300 to about 1300 bp, about 300 to about 1200 bp, about 300 to about 1150 bp, about 300 to about 1100 bp, about 300 to about 1000 bp, about 300 to about 900 bp, about 300 to about 850 bp, about 300 to about 800 bp, about 300 to about 750 bp, about 300 to about 700 bp, about 300 to about 600 bp, about 300 to about 3000 bp, about 300 to about 400 bp, or about 300 to about 350 bp. In certain embodiments, the deletion size can be about 118 base pairs, about 233 base pairs, about 326 base pairs, about 766 base pairs, about 805 base pairs, or about 1611 base pairs.

[0127] 4. Compositions for Gene Editing in Muscle The present invention is directed to a genetic construct (e.g., vector) or composition thereof for genome editing of a target gene in a subject's skeletal muscle or cardiac muscle. The composition comprises a modified AAV vector and a nucleotide sequence encoding a CRISPR / Cas9-based gene editing system (e.g., gRNA molecule and Cas9 molecule). The composition delivers an active CRISPR / Cas9-based gene editing system to skeletal muscle or cardiac muscle. The genetic construct (e.g., vector) of the present disclosure can be used in correcting or reducing the effect of a mutation in the dystrophin gene involved in genetic disease and / or other skeletal or cardiac muscle conditions (e.g., DMD). The composition can further comprise donor DNA or a transgene. The composition can be used in genome editing, genome manipulation, and correcting or reducing the effect of a mutation in a gene involved in genetic disease and / or other skeletal or cardiac muscle conditions.

[0128] A. CRISPR / Cas9-based gene editing system for targeting dystrophin Disclosed herein is a CRISPR / Cas9-based gene editing system specific for the dystrophin gene. The CRISPR / Cas9-based gene editing system can include Cas9 and at least one gRNA for targeting the dystrophin gene. The CRISPR / Cas9-based gene editing system can bind to and recognize the target region. The target region can be selected immediately upstream of a possible out-of-frame stop codon, so that the insertion or deletion during the repair process restores the dystrophin reading frame by frame conversion. The target region can also be a splice acceptor or splice donor site, so that the insertion or deletion during the repair process disrupts splicing and restores the dystrophin reading frame by disrupting the splice site and excluding the exon. The target region can also be an ectopic stop codon, so that the insertion or deletion during the repair process restores the dystrophin reading frame by removing or destroying this stop codon.

[0129] The gRNA can target a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-19, 41, 42, or a complement thereof. For example, the CRISPR / Cas9-based gene editing system of the present disclosure was engineered to mediate more efficient gene editing at exon 51 of the dystrophin gene. The CRISPR / Cas9-based gene editing system restored dystrophin protein expression in cells from DMD patients. In some embodiments, the DNA targeting composition comprises a nucleotide sequence set forth in SEQ ID NO: 37, a nucleotide sequence set forth in SEQ ID NO: 38, a nucleotide sequence set forth in SEQ ID NO: 83, and / or a nucleotide sequence set forth in SEQ ID NO: 84. For example, the DNA targeting composition comprises a nucleotide sequence set forth in SEQ ID NO: 37, a nucleotide sequence set forth in SEQ ID NO: 38, and a nucleotide sequence set forth in SEQ ID NO: 83, or the DNA targeting composition comprises a nucleotide sequence set forth in SEQ ID NO: 37, a nucleotide sequence set forth in SEQ ID NO: 38, and a nucleotide sequence set forth in SEQ ID NO: 84.

[0130] B. Adeno-associated virus vector The composition can also include a viral delivery system. In a particular embodiment, the vector is an adeno-associated virus (AAV) vector. The AAV vector is a small virus belonging to the genus Dependovirus of the family Parvoviridae that infects humans and some other primate species. The AAV vector can be used to deliver CRISPR / Cas9-based gene editing systems using various construct structures. For example, the AAV vector can deliver Cas9 and gRNA expression cassettes on separate vectors or on the same vector. Alternatively, when using small Cas9 proteins from species such as Staphylococcus aureus or Neisseria meningitidis, both Cas9 and up to two gRNA expression cassettes can be combined in a single AAV vector within the packaging limit of 4.7 kb.

[0131] In certain embodiments, the AAV vector is a modified AAV vector. The modified AAV vector can have enhanced tissue tropism of cardiac muscle and skeletal muscle. The modified AAV vector can allow the delivery and expression of CRISPR / Cas9-based gene editing system in mammalian cells. For example, the modified AAV vector can be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646). The modified AAV vector can deliver nuclease to skeletal muscle and cardiac muscle in vivo. The modified AAV vector can be based on one or more of several capsid types (e.g., AAV1, AAV2, AAV5, AAV6, AAV8 and AAV9). The modified AAV vector can be based on AAV2 pseudotypes with alternative muscle-tropic AAV capsids, such as AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5 and AAV / SASTG vectors that efficiently transduce skeletal or cardiac muscles by systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12:139-151). The modified AAV vector can be AAV2i8G9 (Shen et al. J. Biol. Chem. (2013) 288:28814-28823). In some embodiments, the composition comprises a nucleotide sequence set forth in SEQ ID NO:39 and / or a nucleotide sequence set forth in SEQ ID NO:40. In some embodiments, the composition comprises a first vector comprising a nucleotide sequence set forth in SEQ ID NO:39 and a second vector comprising a nucleotide sequence set forth in SEQ ID NO:40.

[0132] 5. Methods for gene editing in muscle The present disclosure is directed to a method of gene editing in skeletal muscle or cardiac muscle of a subject. The method includes administering the above-described composition for gene editing in skeletal muscle or cardiac muscle to the skeletal muscle or cardiac muscle of a subject. The genome editing can include correcting a mutant gene or inserting a transgene. Correcting a mutant gene can include deleting, re-editing or replacing the mutant gene. Correcting a mutant allergen can include nuclease-mediated NHEJ or HDR.

[0133] 6. Method for Treating a Subject by Correcting a Mutant Gene The subject matter of the present disclosure provides a method for correcting a mutant gene (e.g., a mutant dystrophin gene, e.g., a mutant human dystrophin gene) in a cell and treating a subject suffering from a genetic disease (e.g., DMD). The method can include administering to a cell or a subject a genetic construct (e.g., a vector) of the present disclosure or a composition comprising the genetic construct described above for gene editing in skeletal muscle or in cardiac muscle of a subject. The use of a genetic construct (e.g., a vector) of the present disclosure or a composition comprising the genetic construct for gene editing in skeletal muscle or cardiac muscle of a subject to deliver a CRISPR / Cas9-based gene editing system to skeletal muscle or cardiac muscle can restore the expression of a fully functional or partially functional protein together with a repair template or donor DNA (which can replace the entire gene or the region containing the mutation). The CRISPR / Cas9-based gene editing system can be used to introduce site-specific double-strand breaks at targeted genomic loci. Site-specific double-strand breaks occur when the CRISPR / Cas9-based gene editing system binds to the target DNA sequence, allowing it to cleave the target DNA. This DNA cleavage can stimulate natural DNA repair mechanisms, resulting in one of two possible repair pathways: the homology-directed repair (HDR) pathway or the non-homologous end joining (NHEJ) pathway.

[0134] The present disclosure is directed to gene editing by a CRISPR / Cas9-based gene editing system without a repair template, which can efficiently correct the reading frame and restore the expression of functional proteins involved in genetic diseases. The CRISPR / Cas9-based gene editing system of the present disclosure can include the use of homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ)-based correction methods, which allow efficient correction in growth-limited primary cell lines that may not be amenable to homology-directed or selection-based gene correction. This strategy integrates the rapid and robust assembly of an active CRISPR / Cas9-based gene editing system with an efficient gene editing method for treating genetic diseases caused by mutations in non-essential coding regions that generate frameshifts, premature stop codons, ectopic splice donor sites, or ectopic splice acceptor sites.

[0135] A nuclease-mediated nonhomologous end joining Restoration of protein expression from endogenous mutant gene can be by template-free NHEJ-mediated DNA repair. In contrast to the transient method of targeting target gene RNA, the correction of the target gene reading frame in genome by the transiently expressed CRISPR / Cas9-based gene editing system can result in the permanent restoration of target gene expression by each modified cell and all of its progeny. In certain embodiments, NHEJ is nuclease-mediated NHEJ, which in certain embodiments refers to the NHEJ initiated by Cas9 molecule to break double-stranded DNA. This method includes administering the gene construct (e.g., vector) of the present disclosure or a composition comprising this gene construct to skeletal muscle or cardiac muscle of a subject for gene editing in skeletal muscle or cardiac muscle.

[0136] Nuclease-mediated NHEJ gene correction corrects mutated target genes and can offer several potential advantages over HDR pathways. For example, NHEJ does not require a donor template, which can lead to non-specific insertion mutations. In contrast to HDR, NHEJ operates efficiently in all phases of the cell cycle, and can therefore be efficiently utilized in both cycling and post-mitotic cells (such as muscle fibers). This provides a robust and permanent gene repair alternative to oligonucleotide-based exon skipping or drug-imposed read-through of stop codons, and may theoretically require only one drug treatment. NHEJ-based gene correction using CRISPR / Cas9-based gene editing systems and other genetically engineered nucleases, including meganucleases and zinc finger nucleases, can be combined with other existing ex vivo and in vivo platforms for cell and gene-based therapy, in addition to the plasmid electroporation approach described herein. For example, delivery of CRISPR / Cas9-based gene editing systems by mRNA-based transfection or as purified cell-permeable proteins can enable a DNA-free genome editing approach that would avoid any possibility of insertional mutagenesis.

[0137] B homology-directed repair Restoring protein expression from endogenous mutated gene can include homologous recombination repair.The method as described above further includes administering a donor template to the cell.The donor template can include a nucleotide sequence encoding a fully functional or partially functional protein.For example, the donor template can include a miniaturized dystrophin construct (called "minidys"), a fully functional dystrophin construct for repairing mutated dystrophin gene, or a fragment of the dystrophin gene that results in the repair of mutated dystrophin gene after homologous recombination repair.

[0138] c. Methods for correcting mutant genes and treating subjects using CRISPR / Cas9 The present disclosure also covers genome editing using CRISPR / Cas9-based gene editing system to restore the expression of fully functional or partially functional proteins using repair template or donor DNA (which can replace the whole gene or the region containing the mutation). CRISPR / Cas9-based gene editing system can be used to introduce site-specific double-strand breaks at targeted genomic loci. Site-specific double-strand breaks are created when CRISPR / Cas9-based gene editing system uses gRNA to bind to target DNA sequence, thereby allowing target DNA to be cut. CRISPR / Cas9-based gene editing system has the advantage of genome editing advancement due to its fast successful and efficient gene modification. This DNA break can stimulate natural DNA repair mechanism and lead to one of two possible repair pathways: homology-directed repair (HDR) or non-homologous end joining (NHEJ) pathway. For example, a CRISPR / Cas9-based gene editing system directed to the dystrophin gene can include a gRNA having a nucleic acid sequence of any one of SEQ ID NOs: 1-19, 41, and 42, or a complement thereof.

[0139] The present disclosure is directed to genome editing using a repair template-free CRISPR / Cas9-based gene editing system that can efficiently correct reading frames and restore the expression of functional proteins involved in genetic diseases. The disclosed CRISPR / Cas9-based gene editing system and method can include using a homology-directed repair or nuclease-mediated non-homologous end joining (NHEJ)-based correction approach, which allows efficient correction in growth-limited primary cell lines where homology-directed or selection-based gene correction may not be applicable. This strategy integrates the rapid and robust assembly of an active CRISPR / Cas9-based gene editing system with an efficient gene editing method for the treatment of genetic diseases caused by mutations in non-essential coding regions that result in frameshifts, premature stop codons, ectopic splice donor sites, or ectopic splice acceptor sites.

[0140] The present disclosure provides a method for correcting mutant genes in cells and treating subjects suffering from genetic diseases such as DMD. The method can include administering a CRISPR / Cas9-based gene editing system, a polynucleotide or vector encoding the CRISPR / Cas9-based gene editing system, or a composition of the CRISPR / Cas9-based gene editing system to a cell or a subject as described above. The method can include administering a CRISPR / Cas9-based gene editing system, for example, administering a Cas9 protein or a Cas9 fusion protein containing a second domain having nuclease activity, a nucleotide sequence encoding the Cas9 protein or Cas9 fusion protein, and / or at least one gRNA, where the gRNAs target different DNA sequences. These target DNA sequences can be overlapping. The number of gRNAs administered to the cells can be at least one gRNA, at least two different gRNAs, at least three different gRNAs, at least four different gRNAs, at least five different gRNAs, at least six different gRNAs, at least seven different gRNAs, at least eight different gRNAs, at least nine different gRNAs, at least ten different gRNAs, at least fifteen different gRNAs, at least twenty different gRNAs, at least thirty different gRNAs, or at least fifty different gRNAs, as described above. The gRNAs can include at least one nucleic acid sequence of SEQ ID NOs: 1-19, 41, 42, or a complement thereof. The method can include homologous recombination repair or non-homologous end joining.

[0141] 7. Methods of Treating Disease The present disclosure is directed to a method of treating a subject in need thereof. The method comprises administering to a tissue of the subject a genetic construct (e.g., vector) of the present disclosure described above or a composition comprising the genetic construct. In certain embodiments, the method can comprise administering to a skeletal or cardiac muscle of the subject a genetic construct (e.g., vector) of the present disclosure described above or a composition comprising the genetic construct. In certain embodiments, the method can comprise administering to a vein of the subject a genetic construct (e.g., vector) of the present disclosure described above or a composition comprising the genetic construct. In certain embodiments, the subject suffers from a condition of the skeletal or cardiac muscle that causes degeneration or debilitation or a genetic disease. For example, the subject suffers from Duchenne muscular dystrophy described above.

[0142] A. Duchenne muscular dystrophy Using the above-described method, dystrophin gene can be corrected to restore the fully functional or partially functional protein expression of said mutant dystrophin gene.In some aspects and embodiments, the present disclosure provides a method for reducing the effect (e.g., clinical symptoms / indications) of DMD in a patient.In some aspects and embodiments, the present disclosure provides a method for treating DMD in a patient.In some aspects and embodiments, the present disclosure provides a method for preventing DMD in a patient.In some aspects and embodiments, the present disclosure provides a method for preventing further deterioration of DMD in a patient.

[0143] 8. How to Generate Transgenic Rodents Carrying Δ52hDMD The present disclosure is directed to a method of generating a transgenic rodent embryo having a human dystrophin gene with a deletion of exon 52. The method includes administering the gRNA to a rodent embryo, thereby deleting exon 52 of the human dystrophin gene, and selecting a transgenic rodent embryo with a deletion of exon 52 of the human dystrophin gene, the rodent embryo comprising a normal human dystrophin gene. In some embodiments, the rodent embryo is a mouse embryo. In some embodiments, the transgenic rodent embryo is heterozygous hDMD or heterozygous hDMD-Δ52. In some embodiments, a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 41 and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 42 are administered to the rodent embryo to delete exon 52 of the human dystrophin gene. In some embodiments, the method further comprises administering to the rodent embryo a Cas protein comprising the amino acid sequence set forth in SEQ ID NO: 27. The present disclosure is directed to a transgenic rodent embryo produced by this method. The present disclosure is also directed to a transgenic rodent produced from the transgenic rodent embryo.

[0144] 9. Constructs and Plasmids The composition described above can include a genetic construct encoding the CRISPR / Cas9-based gene editing system disclosed herein. The genetic construct (e.g., a plasmid) can include a nucleic acid encoding the CRISPR / Cas9-based gene editing system (e.g., at least one of a Cas9 protein and a Cas9 fusion protein and / or a gRNA). The composition described above can include a genetic construct encoding a modified AAV vector and a nucleic acid sequence encoding the CRISPR / Cas9-based gene editing system disclosed herein. The genetic construct (e.g., a plasmid) can include a nucleic acid encoding the CRISPR / Cas9-based gene editing system. The composition described above can include a genetic construct encoding a modified lentiviral vector disclosed herein.

[0145] The genetic construct (e.g., recombinant plasmid or recombinant viral particle) can comprise a nucleic acid encoding a Cas9 fusion protein and at least one gRNA. In some embodiments, the genetic construct can comprise a nucleic acid encoding a Cas9 fusion protein and at least two different gRNAs. In some embodiments, the genetic construct can comprise a nucleic acid encoding a Cas9 fusion protein and more than two different gRNAs. In some embodiments, the genetic construct can comprise a promoter operably linked to a nucleotide sequence encoding at least one gRNA molecule and / or a Cas9 molecule. In some embodiments, the promoter is operably linked to a nucleotide sequence encoding a first gRNA molecule, a second gRNA molecule and / or a Cas9 molecule. The genetic construct can be present in a cell as a functional extrachromosomal molecule. The genetic construct can be a linear minichromosome, such as a centromere, a telomere, or a plasmid or a cosmid.

[0146] Gene constructs can also be part of the genome of recombinant virus vectors, including recombinant lentiviruses, recombinant adenoviruses, and recombinant adenovirus-associated viruses. Gene constructs can be part of the genetic material in attenuated live microorganisms or recombinant microbial vectors that live in cells. Gene constructs can include regulatory elements for gene expression of the coding sequence of nucleic acid. Regulatory elements can be promoters, enhancers, start codons, stop codons, or polyadenylation signals.

[0147] In some embodiments, the genetic construct is a vector. The vector can be an adeno-associated virus (AAV) vector, which encodes at least one Cas9 molecule and at least one gRNA molecule, and the vector is capable of expressing at least one Cas9 molecule and at least one gRNA molecule in mammalian cells. The vector can be a plasmid. The vector can be used for in vivo gene therapy. The vector can be recombinant. The vector can include a heterologous nucleic acid encoding a fusion protein (e.g., a Cas9 fusion protein) or a CRISPR / Cas9-based gene editing system. The vector can be a plasmid. The vector can be useful for transfecting a cell with a nucleic acid encoding a Cas9 fusion protein or a CRISPR / Cas9-based gene editing system, and the transformed host cell is maintained in culture under conditions that allow expression of the Cas9 fusion protein or the CRISPR / Cas9-based gene editing system.

[0148] Coding sequences can be optimized for stability and high levels of expression. In some cases, codons are selected to reduce secondary RNA structure formation, such as those formed due to intramolecular binding.

[0149] The vector can include a heterologous nucleic acid encoding a CRISPR / Cas9-based gene editing system, and can further include a start codon that can be upstream of the CRISPR / Cas9-based gene editing system coding sequence, and a stop codon that can be downstream of the CRISPR / Cas9-based gene editing system coding sequence. The start and stop codons can be in frame with the CRISPR / Cas9-based gene editing system coding sequence. The vector can also include a promoter operably linked to the CRISPR / Cas9-based gene editing system coding sequence. The promoter operably linked to the CRISPR / Cas9-based gene editing system coding sequence can be a promoter from simian virus 40 (SV40), a mouse mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter, such as a bovine immunodeficiency virus (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CMV) promoter, such as a CMV immediate early promoter, an Epstein-Barr virus (EBV) promoter, a U6 promoter, such as a human U6 promoter, or a Rous sarcoma virus (RSV) promoter. The promoter can also be a promoter from a human gene, such as human ubiquitin C (hUbC), human actin, human myosin, human hemoglobin, human muscle creatine, or human metallothionein. The promoter can also be a tissue-specific promoter, such as a muscle- or skin-specific promoter, natural or synthetic. Examples of such promoters are described in US Patent Publication Nos. 20040175727 and 20040192593, the contents of which are incorporated herein in their entireties.Examples of muscle-specific promoters include the Spc5-12 promoter (described in U.S. Patent Publication No. 20040192593, which is incorporated by reference in its entirety; Hakim et al. Mol. Ther. Methods Clin. Dev. (2014) 1:14002; and Lai et al. Hum Mol Genet. (2014) 23(12):3189-3199), the MHCK7 promoter (described in Salva et al., Mol. Ther. (2007) 15:320-329), the CK8 promoter (described in Park et al. PLoS ONE (2015) 10(4):e0124914), and the CK8e promoter (described in Muir et al., Mol. Ther. Methods Clin. Dev. (2014) 1:14025). In some embodiments, expression of the gRNA and / or Cas9 protein is driven by tRNA.

[0150] Each of the polynucleotide sequences encoding gRNA molecules and / or Cas9 molecules can be operably linked to a promoter.The promoters operably linked to gRNA molecules and / or Cas9 molecules can be the same promoter.The promoters operably linked to gRNA molecules and / or Cas9 molecules can be different promoters.The promoters can be constitutive, inducible, repressible or regulatable promoters.

[0151] The vector can also include a polyadenylation signal that can be downstream of the CRISPR / Cas9-based gene editing system.The polyadenylation signal can be SV40 polyadenylation signal, LTR polyadenylation signal, bovine growth hormone (bGH) polyadenylation signal, human growth hormone (hGH) polyadenylation signal, or human β-globin polyadenylation signal.The SV40 polyadenylation signal can be the polyadenylation signal from pCEP4 vector (Invitrogen, San Diego, CA).

[0152] The vector can also include a CRISPR / Cas9-based gene editing system, i.e., an enhancer upstream of the Cas9 protein, or Cas9 fusion protein coding sequence, or sgRNA, or a CRISPR / Cas9-based gene editing system. The enhancer can be essential for DNA expression. The enhancer can be human actin, human myosin, human hemoglobin, human muscle creatine, or a viral enhancer, such as those derived from CMV, HA, RSV, or EBV. Polynucleotide function enhancers are described in U.S. Pat. No. 5,593,972, U.S. Pat. No. 5,962,428, and WO 94 / 016737, the contents of each of which are fully incorporated by reference. The vector can also include a mammalian origin of replication to maintain the vector extrachromosomally, and can produce multiple copies of the vector in cells. The vector can also include a regulatory sequence, and the regulatory sequence can be fully adapted for gene expression in the mammalian or human cell to which the vector is administered. Vectors may also include a reporter gene, such as green fluorescent protein ("GFP"), and / or a selectable marker, such as hygromycin ("Hygro").

[0153] The vector can be an expression vector or a system for producing the protein by conventional techniques and readily available starting materials (Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989), fully incorporated by reference). In some embodiments, the vector can include a nucleic acid sequence encoding a CRISPR / Cas9-based gene editing system, for example, a nucleic acid sequence encoding a Cas9 protein or a Cas9 fusion protein, and a nucleic acid sequence encoding at least one gRNA comprising at least one of the nucleic acid sequences of SEQ ID NOs: 1-19, 41, 42, or a complement thereof. In some embodiments, the Cas9 protein or Cas9 fusion protein is encoded by the nucleic acid sequence of any one of SEQ ID NO: 26. In some embodiments, the vector includes the nucleic acid sequence of SEQ ID NO: 39 or SEQ ID NO: 40.

[0154] 10. Pharmaceutical Compositions The subject of the present disclosure provides a composition comprising the genetic construct described above. The pharmaceutical composition of the present invention can be formulated according to the mode of administration used. When the pharmaceutical composition is an injectable pharmaceutical composition, the pharmaceutical composition is sterile, pyrogen-free and particulate-free. An isotonic formulation is preferably used. In general, additives for isotonicity can include sodium chloride, dextrose, mannitol, sorbitol and lactose. In some cases, an isotonic solution (e.g., phosphate buffered saline) is preferred. Stabilizers include gelatin and albumin. In some embodiments, a vasoconstrictor is added to the formulation.

[0155] The composition can further comprise a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient can be a functional molecule as a vehicle, adjuvant, carrier, or diluent. The pharmaceutically acceptable excipient can be a gene transfer promoter (which can include surfactants), such as immune stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analogs (including monophosphoryl lipid A), muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known gene transfer promoters.

[0156] The gene transfer promoter is a polyanion, a polycation (including poly-L-glutamic acid (LGS)), or a lipid. The gene transfer promoter is poly-L-glutamic acid, and more preferably, poly-L-glutamic acid is present in a concentration of less than 6 mg / ml in the composition for genome editing in skeletal muscle or cardiac muscle. The gene transfer promoter can also include surfactants, such as immune stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analogs (including monophosphoryl lipid A), muramyl peptides, quinone analogs, and vesicles, such as squalene and squalene, and hyaluronic acid can also be used with the gene construct. In some embodiments, the DNA vector encoding the composition may also include a gene transfer facilitating agent, such as a lipid, a liposome (including lecithin liposomes or other liposomes known in the art), a DNA-liposome mixture (see, e.g., WO 09324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known gene transfer facilitating agents. Preferably, the gene transfer facilitating agent is a polyanion, polycation (including poly-L-glutamic acid (LGS)), or a lipid.

[0157] 11. Method of Service Provided herein is a method of delivering the disclosed genetic construct (e.g., vector) or composition thereof to a cell. The delivery of the composition can be transfection or electroporation of the composition as a nucleic acid molecule that is expressed in the cell and delivered to the surface of the cell. The nucleic acid molecule can be electroporated using a BioRad Gene Pulser Xcell device or an Amaxa Nucleofector IIb device. Several different buffers can be used, such as BioRad electroporation solution, Sigma phosphate buffered saline product number D8537 (PBS), Invitrogen OptiMEM I (OM) or Amaxa Nucleofector solution V (NV). Transfection can include transfection reagents such as Lipofectamine 2000.

[0158] When the genetic construct or composition of the present disclosure is delivered to tissue, and the vector is delivered into the cells of a mammal, the transgenic cells express gRNA and Cas9 molecules.The genetic construct or composition can be administered to a mammal to change gene expression, or re-edit or change genome.For example, the genetic construct or composition can be administered to a mammal to correct dystrophin gene in the mammal.The mammal can be human, non-human primate, cow, pig, sheep, goat, antelope, bison, buffalo, bovid, deer, hedgehog, elephant, llama, alpaca, mouse, rat or chicken, and preferably human, cow, pig or chicken.

[0159] The gene construct (e.g., vector) encoding gRNA molecule and Cas9 molecule can be delivered to mammals by DNA injection (also called DNA vaccination) with or without in vivo electroporation, liposome-mediated, nanoparticle-facilitated, and / or recombinant vector.The recombinant vector can be delivered by any virus type.The virus type can be recombinant lentivirus, recombinant adenovirus, and / or recombinant adeno-associated virus.

[0160] The genetic construct (e.g., vector) of the present disclosure or a composition comprising the genetic construct can be introduced into a cell to genetically correct the dystrophin gene (e.g., human dystrophin gene). In certain embodiments, the genetic construct (e.g., vector) of the present disclosure or a composition comprising the genetic construct is introduced into myoblasts derived from a DMD patient. In certain embodiments, the genetic construct (e.g., vector) or a composition comprising the genetic construct can be introduced into fibroblasts derived from a DMD patient, the genetically corrected fibroblasts can be treated with MyoD to induce differentiation into myoblasts, and the myoblasts can be transplanted into a subject (e.g., a damaged muscle of a subject) to verify that the corrected dystrophin protein is functional and / or to treat the subject. The modified cells can be stem cells (e.g., induced pluripotent stem cells), bone marrow-derived progenitor cells, skeletal muscle progenitor cells, human skeletal myoblasts from a DMD patient, CD133 + The cells can be mesoangioblasts, MyoD-transduced cells or Pax7-transduced cells, or other myogenic progenitor cells. For example, the CRISPR / Cas9-based gene editing system can induce neuronal or myogenic differentiation of induced pluripotent stem cells.

[0161] 12. Route of Administration The genetic construct (e.g., vector) of the present disclosure or a composition comprising the genetic construct can be administered to a subject by various routes (e.g., orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal administration, intrapleurally, intravenously, intraarterially, intraperitoneally, subcutaneously, intramuscularly, intranasally, intrathecally, and intraarticularly, or a combination thereof). In certain embodiments, the genetic construct (e.g., vector) or composition of the present disclosure is administered intramuscularly, intravenously, or a combination thereof to a subject (e.g., a subject suffering from DMD). For veterinary use, the genetic construct (e.g., vector) or composition of the present disclosure can be administered in an appropriately tolerated formulation according to standard veterinary practice. A veterinarian can readily determine the dosage regimen and route of administration that is most suitable for a particular animal. The composition can be administered by a conventional syringe, a needleless injection device, a "microprojectile bombardment gone gun," or other physical methods (e.g., electroporation ("EP"), "hydrodynamic methods," or ultrasound).

[0162] The genetic constructs (e.g., vectors) or compositions of the present disclosure can be delivered to mammals by several techniques (e.g., DNA injection with and without in vivo electroporation (also referred to as DNA vaccination), liposome-mediated, nanoparticle-facilitated, recombinant vectors (e.g., recombinant lentiviruses, recombinant adenoviruses, and recombinant adenovirus-associated viruses)). The compositions can be injected into skeletal or cardiac muscles. For example, the compositions can be injected into the tibialis anterior muscle or tail.

[0163] In some embodiments, a genetic construct (e.g., a vector) of the present disclosure or a composition comprising this genetic construct is administered: 1) by tail vein injection (systemic) into adult mice; 2) by intramuscular injection, e.g., by local injection into a muscle (e.g., the TA or gastrocnemius) in adult mice; 3) by intraperitoneal injection into P2 mice; or 4) by facial vein injection (systemic) into P2 mice.

[0164] 13.Cell type Any of these delivery methods and / or routes of delivery can be utilized with a myriad of cell types (e.g., cell types currently under investigation for cell-based therapies for DMD), including, but not limited to, immortalized myoblasts, such as wild type and DMD patient derived lines, e.g., Δ48-50 DMD, DMD6594(del48-50), DMD8036(del48-50), C25C14 and DMD-7796 cell lines, primary DMD skin fibroblasts, induced pluripotent stem cells, bone marrow derived progenitor cells, skeletal muscle progenitor cells, human skeletal myoblasts from DMD patients, CD133 + Cells, mesodermal hemangioblasts, cardiomyocytes, hepatocytes, chondrocytes, mesenchymal progenitor cells, hematopoietic stem cells, smooth muscle cells, and MyoD- or Pax7-transduced cells, or other myogenic progenitor cells. Immortalization of human myogenic cells can be used to derive clones of genetically corrected myogenic cells. Cells can be modified ex vivo to isolate and grow clonal populations of immortalized DMD myoblasts that contain genetically corrected dystrophin genes and no other nuclease-induced mutations in the protein-coding region of the genome. Alternatively, transient delivery of CRISPR / Cas9-based systems in vivo by non-viral or non-integrating viral transduction or by direct delivery of purified proteins and gRNAs containing cell-penetrating motifs can allow highly specific correction in situ with minimal or no risk of exogenous DNA integration.

[0165] 14. Kit Provided herein is a kit that can be used to correct mutant dystrophin gene.The kit includes at least gRNA for correcting mutant dystrophin gene and instructions for using CRISPR / Cas9-based gene editing system.Also provided herein is a kit that can be used for genome editing of dystrophin gene in skeletal muscle or cardiac muscle.The kit includes the gene construct (e.g., vector) for genome editing in skeletal muscle or cardiac muscle described above or a composition that includes this gene construct, and instructions for using the composition.

[0166] The instructions included in the kit can be affixed to the packaging material or can be included as a package insert. The instructions are typically, but not limited to, written or printed material. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term "instructions" can include an address of an internet site that provides the instructions.

[0167] The gene construct (for example, vector) for correcting mutant dystrophin in skeletal muscle or cardiac muscle or for genome editing of dystrophin gene or the composition comprising this gene construct can comprise the modified vector comprising the gRNA molecule and Cas9 molecule described above, which specifically binds to and cuts a certain region of dystrophin gene.The gene editing system based on CRISPR / Cas9 described above can be included in the kit to specifically bind to and target a specific region in mutant dystrophin gene.The kit can further comprise donor DNA, another gRNA or transgene described above. EXAMPLES

[0168] 15. Working Example It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the disclosed methods described herein are readily applicable and recognizable, and may be made using suitable equivalents without departing from the scope of the disclosure or the aspects and embodiments disclosed herein. Having thus described the present disclosure in detail, the disclosure will be more clearly understood by reference to the following examples. The examples are merely intended to illustrate some aspects and embodiments of the present disclosure, and should not be considered as limiting the scope of the disclosure. The disclosures of all journal references, U.S. patents and publications referred to herein are incorporated herein by reference in their entirety.

[0169] The present invention has multiple aspects and is illustrated by the following non-limiting examples.

[0170] Example 1 Targeting the human dystrophin gene A CRISPR / Cas9-based gene editing system was used to target and delete exon 51 of the human dystrophin gene. S. aureus Cas9 (SaCas9) (approximately 1 kb smaller than S. pyogenes Cas9) was used with adeno-associated virus (AAV) to deliver the CRISPR / Cas9-based gene editing system. The codon-optimized nucleic acid sequence encoding the S. aureus Cas9 molecule is set forth in SEQ ID NO: 43 or SEQ ID NO: 44. Figure 3 shows a schematic of AAV-based in vivo co-delivery of SaCas9 and two gRNAs into muscle tissue by two viral vectors. Each vector had a copy of SaCas9 and one gRNA driven by the CMV promoter and the hU6 promoter, respectively (PT366-179 (SEQ ID NO: 39) and PT366-183 (SEQ ID NO: 40)).

[0171] The activity of individual gRNAs targeting the human dystrophin gene, JCR89 (targeting exon 51 upstream) and JCR91 (targeting exon 51 downstream) (set against the human genome), was determined in Surveyor assays in HEK293T cells (with a normal version of the dystrophin gene) and myoblast cell lines from DMD patients (DMD8036 and DMD6594, each with a mutant version of the dystrophin gene) (see FIG. 1). The Surveyor assay detects mismatches in genomic DNA, which indicate insertions and deletions from the CRISPR / Cas9-based gene editing system. For JCR89, the parent band size was 555nt, and the primers used were: forward primer -aagttacttgtccaggcatga (SEQ ID NO: 91); and reverse primer -gaaaaacttctgccaacttttatca (SEQ ID NO: 92). The expected cleavage band sizes were 134nt and 421nt. For JCR91, the parent band size was 632 nt and the primers used were: forward primer-tgcaaataacaaaagtagccataca (SEQ ID NO: 93); and reverse primer-tctttagaaaggcttgaaagctg (SEQ ID NO: 94). The expected cleavage band sizes were 210 nt and 422 nt.

[0172] HEK293T cells and DMD myoblasts (DMD8036 and DMD6594) were co-treated with ScCas9 and gRNAs JCR89 and JCR91 (SEQ ID NO: 37 and SEQ ID NO: 38). Genomic DNA was amplified with forward primer -cttcactgctggccagttta (SEQ ID NO: 95) and reverse primer -tctttagaaaggcttgaaagctg (SEQ ID NO: 94). The expected parent band size was 1646nt, and the expected "complete" deletion band was 766nt (the actual deletion size between the gRNA cleavage sites was different from 766nt due to the occurrence of indels). Figure 2A shows the deletion of exon 51 in genomic DNA of HEK293T cells and DMD myoblasts. Figure 2B shows the deletion of exon 51 in cDNA from DMD myoblasts. "No RT" is a negative control where no reverse transcriptase was added.

[0173] A CRISPR / Cas9-based gene editing system was injected into transgenic mice carrying the human DMD gene (hDMD / mdx mice) to delete exon 51. Local AAV8 delivery of viral vectors carrying SaCas9 and gRNA was applied to the tibialis anterior (TA) muscle. See Table 1. Three mice were injected with AAV8 as follows: one mouse was injected with a high dose of AAV8 in both TAs ("HH"), one mouse was injected with a low dose of AAV8 in both TAs ("LL"), and one mouse was injected with a low dose in the left TA and a high dose in the right TA ("LH"). The doses are listed in the second column of Table 1. Mice were sacrificed after 8 weeks of treatment ("PT week") and tissues were removed for analysis. Nested PCR revealed deletion of exon 51 in both limbs of HH mice, the right TA of LL mice, and the right limb of LH mice.

[0174] [Table 1]

[0175] Genomic DNA taken from mouse TA muscle was amplified in a first PCR reaction using forward primer: cttcactgctggccagttta (SEQ ID NO: 95) and reverse primer: tctttagaaaggcttgaaagctg (SEQ ID NO: 94). 1-3 μL of this PCR product was used in a second PCR reaction (2× gDNA PCR) using forward primer -aagttacttgtccaggcatga (SEQ ID NO: 91); and reverse primer -ttgaacatggcattgcataaA (SEQ ID NO: 96). This second PCR had the expected parent band at 1089 nt and the expected deletion band at 323 nt (the actual deletion size between the gRNA cleavage sites was different from 323 nt due to the occurrence of an indel). Figure 4 shows the results of the second PCR. The "L" lane shows the results in the left TA muscle, which was used as a control and administered saline. The "R" lane shows the results in the right TA muscle, which was injected with equal amounts of the two premixed viral vectors. The CRISPR / Cas9-based gene editing system was also injected into the tail vein of hDMD / mdx mice by systemic AAV8 delivery (see Figure 5). Genomic DNA from mouse liver (Figure 5-left panel) and mouse heart (Figure 5-right panel) were also amplified using the same protocol as in Figure 4. The expected band of approximately 300 nucleotides showed the deletion of exon 51.

[0176] Additional gRNAs were generated and selected that target human and rhesus macaque dystrophin gene sequences or the human dystrophin gene sequence (see Figure 6 and Table 2). Table 2 lists the general target of the gRNA, the genomic strand recognized, the gRNA sequence, and the PAM sequence associated with this gRNA. The target genomic sequences of the gRNA (shown in genomic plus strand) are listed in Table 3. These gRNAs were tested in cultured human cells to discover optimal activity and gRNA combinations that produced deletions. The selected gRNAs were also prioritized based on expected specificity in the human genome (Figure 8) and screened for various optimal target sequence lengths from 19 to 23 nucleotides (Figures 10 and 11). Figure 6 shows the various gRNA targets listed in Table 2 that are conserved between the human and rhesus macaque genomes. The location of each gRNA is shown in relation to exon 51 of the human dystrophin gene.

[0177] [Table 2-1] [Table 2-2]

[0178] [Table 3]

[0179] Each candidate gRNA listed in Table 2 was transfected into human HEK293T cells. The activity of these candidate gRNAs was determined by Surveyor assay (see FIG. 7). For JCR160, the parent band size was 483nt and the primers used were: forward primer-cgggcttggacagaacttac (SEQ ID NO: 97); and reverse primer-ctgcgtagtgccaaaacaaa (SEQ ID NO: 98). The expected cleavage band sizes were 192nt and 291nt. For JCR157, the parent band size was 631nt and the primers used were: forward primer-gagatgtcttttgcagctttcc (SEQ ID NO: 99); and reverse primer-gggaccttggtaaagccaca (SEQ ID NO: 100). The expected cleavage band sizes were 147nt and 484nt.

[0180] The specificity of these candidate gRNAs was predicted using the CasOFFinder program (Bae et al. (2014) Bioinformatics 30:1473-1475; see FIG. 8). Candidate gRNAs were evaluated and selected based on off-target activity, on-target activity, and distance from exons measured by the Surveyor assay. gRNAs JCR157 and JCR160 had low predicted off-target activity and were used for further testing.

[0181] A modified pDO240 plasmid containing gRNA JCR157, a modified pDO240 plasmid containing gRNA JCR160, and a plasmid containing SaCas9 (pDO242; SEQ ID NO: 83) were transfected into HEK293T cells and electroporated into DMD6594 cells. The parent band is expected to be 2451 nt and the deletion band is expected to be approximately 840-850 nt. Figure 9 shows the deletion of exon 51 as determined by PCR of genomic DNA (approximately 850 nucleotides) using forward primer -tgcctttcaatcattgtttcg (SEQ ID NO: 101) and reverse primer -agaaggcaaattggcacaga (SEQ ID NO: 102). The deletion created between the gRNA cleavage sites was approximately 1611 nt.

[0182] Figure 10 shows the activity of gRNA JCR157 (19, 20, 21, 22 and 23 nucleotides) of various target lengths determined by Surveyor assay in HEK293T cells using the primers and PCR conditions used for JCR157 in Figure 7. Figure 11 shows the activity of gRNA JCR160 (19, 20, 21, 22 and 23 nucleotides) of various target lengths determined by Surveyor assay in HEK293T cells using forward primer -cgggcttggacagaacttac (SEQ ID NO: 97); and reverse primer -ctgcgtagtgccaaaacaaa (SEQ ID NO: 98). The parent band size was expected to be 483nt, and the expected cleavage band sizes were 209nt and 274nt.

[0183] Combinations of gRNAs JCR157 and JCR160 (21, 22 or 23 nucleotides) with various target lengths were used in HEK293T cells using the conditions used in Figure 9. Figure 12 shows PCR of genomic DNA. The combination of JCR157 and JCR160, each with a 23 nucleotide target, had nearly 50% deletion.

[0184] Using a target sequence of 23nt, each gRNA flanking exon 51 (upstream JCR179 and downstream JCR183) was individually performed with SaCas9 to demonstrate on-target nuclease activity in HEK293T cells ("293s") and in DMD6594 cells ("DMD6594s") (see Figure 13). For JCR179, the parent band size was 594nt, and the primers used were: forward primer -tgcctttcaatcattgtttcg (SEQ ID NO: 101); and reverse primer -aaggccccaaaatgtgaaat (SEQ ID NO: 103). The expected cleavage band sizes were 594nt and 130nt. For JCR183, the parent band size was 731 nt and the primers used were: forward primer-gagtttggctcaaattgttactctt (SEQ ID NO: 104); and reverse primer-ctgcgtagtgccaaaacaaa (SEQ ID NO: 98). The expected cleavage band sizes were 440 nt and 291 nt. Figure 13 shows the on-target nuclease activity in vitro by Surveyor assay.

[0185] A plasmid containing SaCas9 and gRNAs JCR179 and JCR183 (targeting 23 nt of JCR157 and JCR160; SEQ ID NO:37 and SEQ ID NO:38) was transfected into human HEK293T cells and electroporated into DMD myoblasts (DMD6594s). DMD6594 cells are immortalized DMD patient myoblasts that already lack exons 48-50. The parent band is expected to be 2451 nt and the deletion band is expected to be approximately 823 nt. Figure 14 shows the in vitro deletion of exon 51 in genomic DNA in human HEK293T cells (left panel) and DMD6594s cells (right panel) as determined by PCR of genomic DNA using forward primer -tgcctttcaatcattgtttcg (SEQ ID NO:101) and reverse primer -agaaggcaaattggcacaga (SEQ ID NO:102). The deletion created between the gRNA cleavage sites was approximately 1628 nt. The top panel shows a schematic of the target gene of the upstream and downstream gRNA in HEK293T and DMD6594 cells, with purple indicating normally processed exons and yellow indicating mutated exons. The middle panel shows the results of PCR across the genomic deletion region, with asterisks indicating deletions. The bottom panel shows droplet digital PCR of genomic DNA. In HEK293T cells, the gRNA and SaCas9 had a 16% deletion, while DMD6594 cells had approximately 10% editing.

[0186] To determine whether the changes in genomic DNA were transcribed into RNA, RNA was harvested from DMD myoblasts that were co-transfected with SaCas9 and both gRNAs and differentiated for 7 days (see FIG. 15). The RNA was reverse transcribed into cDNA and the cDNA was PCR amplified using standard methods known in the art. In FIG. 15, the bottom left panel shows PCR amplification of exon 44 to exon 52 using forward primer -tggcggcgttttcattat (SEQ ID NO: 105) and reverse primer -TTCGATCCGTAATGATTGTTCTAGCC (SEQ ID NO: 106). The parent band is expected to be 948 nt and the deletion band is expected to be approximately 715 nt. FIG. 15 shows the deletion band only in cells treated with SaCas9 and both gRNAs. The bottom right panel shows ddPCR revealing approximately 14% editing of the cDNA. The exon 47-52 junction was sequenced in vitro in the cDNA of DMD patient myoblasts (see FIG. 16). In FIG. 16, the sequence of the band from the untreated cells (control cells Δ48-50) showed that exons 47-51 were joined as expected, and the deleted band in the treated cells (Δ48-50+Δ51) showed the exon 47-52 junction. Therefore, there was a clear absence of exon 51 and the disclosed system for targeting genomic DNA levels was performed via transcription.

[0187] Example 2 Generation of Δ52 / mdx mice Figure 17 shows the design of the Δ52 / mdx mouse. hDMD / mdx mice were obtained from Leiden University and engineered to create a related model of DMD in which exon 52 has been removed, resulting in an out-of-frame shift and the DMD genotype. hDMD / mdx mice contain a full-length wild-type human dystrophin gene on chromosome 5 in an mdx background, resulting in the absence of mouse dystrophin expression.

[0188] To create a related model of DMD, the SpCas9 CRISPR / Cas9 editing system and gRNA were used to target and delete exon 52 of the human dystrophin gene. Various gRNAs targeting upstream and downstream of exon 52 were tested and validated using the Surveyor assay (see FIG. 18). For the upstream gRNA, forward primer-ctccggaatgtctccatttg (SEQ ID NO: 87) and reverse primer-TTGTGTGTCCCATGCTTGTT (SEQ ID NO: 107) were used, with a parental band size of 402nt. For JCR94 (AACAAATATCCCTTAGTATC (SEQ ID NO: 41)), the expected cleavage sizes were 243nt and 159nt. For the downstream gRNA, forward primer-CAACGCTGAAGAACCCTGAT (SEQ ID NO: 108) and reverse-atgagggagagactggcatc (SEQ ID NO: 88) were used, with a parental band size of 509nt. For JCR99 (AATGTATTTCTTCTATTCAA (SEQ ID NO: 42)), the expected cleavage size was 346nt and 163nt. A pair of gRNAs (e.g., JCR94 and JCR99) was tested and verified by detecting the deletion of exon 51 in the genomic DNA of HEK293T cells using forward primer-ctccggaatgtctccatttg (SEQ ID NO: 87) and reverse primer-atgagggagagactggcatc (SEQ ID NO: 88) (see FIG. 19). The parent band size was 718nt, the deletion band was 392nt, and the deletion between the gRNAs was 326nt. The pair of JCR94 and JCR99 was used in a genome editing system to generate Δ52 / mdx mice. Specifically, the mice were generated by injecting JCR94 gRNA, JCR99 gRNA, and SaCas9 into mouse embryos.

[0189] Figure 20 shows the DNA microinjection protocol including the BAC recombineering service. Day 1: Pregnant mares were treated intraperitoneally with serum gonadotropins to induce ovulation. Day 3: Pregnant mares were treated intraperitoneally with human chorionic gonadotropins. 471 embryos were produced in the first round, but only 5 plugs were visible. 150 fertilized embryos were used (14 females were superovulated). Pronuclear injections were performed with less than 50 ng of Cas9 and 20 ng of each guide. Figure 21 shows the mouse breeding protocol for producing transgenic mice.

[0190] The founder mice were genotyped using the following genotyping protocol. Genomic DNA (gDNA) was extracted from the tail snips of the mice using the DNEasy Blood and Tissue kit (Qiagen). To genotype each pup, gDNA was amplified using the AccuPrime HiFi Taq kit as follows: i. 100 ng gDNA; ii. 2.5 μL AccuPrime Buffer II; iii. 0.1 μL AccuPrime HiFi Taq; iv. 1 μL JRH261 (ctccggaatgtctccatttg (SEQ ID NO: 87)) (10 μM); v. 1 μL JRH264 (atgagggagagactggcatc (SEQ ID NO: 88)) (10 μM); and vi. water to a total volume of 25 μL. The reactions were run in a thermocycler as follows: i. 95 degrees for 4 minutes; ii. 95 degrees for 30 seconds; iii. 52 degrees for 30 seconds; iv. 68 degrees for 1:00 minutes; v. steps ii-iv repeated 35 times; and 4 degrees forever. The PCR reactions were separated on a gel (Figure 22). The expected band size was 718 nt if there was no deletion (i.e. exon 52 was still present) and approximately 392 nt if exon 52 was deleted. As shown in Figure 22, founder mice 7, 63 and 76 had exon 52 deleted.

[0191] The amplified band was sequenced using JRH264 primer (see FIG. 23) to sequence the recombined ends of the target region. FIG. 23 shows the sequenced region, with bold, underlined and normal letters indicating the native sequence, and italicized letters indicating insertions or deletions. In the expected sequence ("Delta52"), the bolded letters are linked to the underlined letters. In the founder mice, there were insertions (italicized letters) and deletions (hyphens) in this region.

[0192] Male founder mice were mated with mdx / mdx females to breed chimeras (Figure 24). Litters generated from founder male 76 or founder male 63 with mdx / mdx females were screened and genotyped for exon 52 deletion using the conditions used in Figure 22 (Figures 25 and 26, respectively). If exon 52 was deleted, the expected band size was approximately 392 nt. If exon 52 was present, the expected band size was approximately 718 nt. Pups 54497 and 54498 (from a breeding pair of founder male 63 + mdx / mdx females) had a deletion of exon 52 and were sequenced (Figure 27). Pups 54497 and 54498 had 92.86% identity to each other in a 392 bp sequencing read, and the indel was identical.

[0193] Dystrophin expression in healthy hDMD / mdx and Δ52 / mdx mice was compared using fluorescent immunohistochemistry. As shown in FIG. 28, Δ52 / mdx mouse pups 54497 and 54498 lacked dystrophin protein. For heart staining, laminin probe exposure was 100 ms and dystrophin exposure was 900 ms. For TA muscle samples, laminin and dystrophin probe exposure was 2.0 s. See also FIG. 29, which shows Δ52 / mdx mice lacking dystrophin protein. Dystrophin expression was lost in Δ52 / mdx mice in both heart and TA muscle. There were few spontaneous revertant fibers (random splice events or somatic mutations) in TA muscle, which was consistent with the mdx mouse model. Western blotting also showed that Δ52 / mdx mice lacked dystrophin protein consistent with the DMD genotype, while healthy hDMD / mdx mice express dystrophin. See Figure 30.

[0194] Δ52 / mdx mice showed similar levels of activity as mdx mice after the first 5 min of the open field test. In this open field test, mice were allowed to freely explore the open field arena (20×20×30 cm) for 30 min. Animal activity and location were automatically monitored using infrared diodes (x, y and z axes) interfaced to a computer running Fusion Activity software (version 5.3, Omnitech, Columbus, OH). Figure 31 shows the overall activity of Δ52 / mdx mice compared to mdx and hDMD / mdx mice, as indicated by locomotor activity and exploration. Distance traveled and upright vertical activity are shown in the left and right panels, respectively.

[0195] Example 3 Restoration of dystrophin by removal of exon 51 The removal of exon 51 can create a Becker muscular dystrophy (BMD)-like genotype in Δ52 / mdx mice, and theoretically restore dystrophin expression. The Δ52 / mdx mice are used to demonstrate the restoration of dystrophin expression by the removal of exon 51 using the CRISPR / Cas9-based gene editing system of the present disclosure. Figure 32 shows the correction strategy using SaCas9 and gRNA, in which gRNA targets exon 51 upstream and downstream in the intron region, thereby skipping exon 51.

[0196] Plasmids containing standard gRNA JCR179 (upstream) or JCR183 (downstream) (SEQ ID NO: 37 and SEQ ID NO: 38, respectively) and SaCas9 were electroporated into DMD patient myoblasts. Proteins were collected from differentiated cells and analyzed using Western blot with dystrophin antibody. Figure 33 shows that genomic DNA can be edited to restore dystrophin protein, because cells treated with all three components (i.e., both gRNAs and SaCas9) showed dystrophin expression.

[0197] This system was then tested in Δ52 / mdx mice. Figure 34 shows the experimental design for treating Δ52 / mdx mice using the gRNA and SaCas9 system, including a schematic of the two viral vectors used in this experimental design. AAV8 recombinant viral constructs were generated using vectors PT366-179 (SEQ ID NO: 39) and PT366-183 (SEQ ID NO: 40) and methods known in the art for producing viral particles. These viral vectors (AAV8) were co-delivered in vivo as two viral particles. Each viral particle contained SaCas9 and one of the gRNAs (see Figure 3). Δ52 / mdx mice were treated with AAV8 recombinant viral construct 5E11. The virus was injected intramuscularly into the right TA muscle, and the left TA muscle served as the contralateral control and was injected with PBS. After treatment, both the left and right TA muscles were removed and sections of each were taken for genomic DNA analysis. As shown in Figure 35, PCR was performed across the region of interest and a deletion band was observed in the treated right TA muscle on the gel on the left, indicating a level of genome editing. This deletion band was sequenced and the dominant product was the expected ligated 3 base pairs from the PAM of each gRNA. Figure 35 shows the in vivo exon 51 deletion in the right TA muscle.

[0198] Similarly, sections of treated right TA and control left TA muscles were analyzed to determine whether the edits were transmitted through RNA. PCR was performed across exons 50-53 in the cDNA. As shown in the gel on the right of Figure 36, in two of the treated samples, there is a loss of exons 51 and 52. The deletion bands were sequenced, and the dominant product was the concatenation of exons 50-53, as expected, given that the mice already lacked exon 52 and the CRISPR / Cas9-based gene editing system removed exon 51 (see sequence chromatogram on the bottom right). Figure 36 shows exon 51 deletion in vivo in the right TA muscle.

[0199] Figure 37 shows representative fluorescent immunohistochemical staining showing that dystrophin was almost absent in the control PBS-injected left TA muscle of Δ52 / mdx mice. Some dystrophin staining in green on the control left TA may be due to revertant fibers or dead cells that may also stain green. There is a clear increase in green dystrophin staining in the treated right TA muscle, as shown in the photograph on the right. Figure 37 shows dystrophin protein restoration in vivo in treated TA muscle.

[0200] Protein was extracted from the left and right TA muscles from three test mice, and Western blot analysis was performed. Figure 38 shows the recovery of dystrophin protein in treated TA muscles in vivo. No protein expression was observed in the control left TA muscle, and all three right TA muscles showed various levels of dystrophin protein expression. Mouse 1 had the strongest protein expression from the right TA, and mice 2 and 3 had a weak but present band. The CRISPR / Cas9-based gene editing system of the present disclosure worked in vivo to restore dystrophin protein expression to some extent in Δ52 / mdx mice.

[0201] Physiological testing of mice. Treated mice (all male hDMD-Δ52(het) / mdx(hemi) mice) were treated with AAV8 (n=10) or AAV9 (n=10) recombinant viral constructs containing SaCas9 and containing gRNA and compared to untreated mice (hDMD-Δ52 / mdx) (n=10). AAV recombinant viral constructs were generated using vectors PT366-179 (SEQ ID NO: 39) and PT366-183 (SEQ ID NO: 40) and methods known in the art. Treated mice had 200 μL of virus injected into the tail vein at 6-8 weeks of age. Mice were tested after 8 weeks.

[0202] Open field distance test. Mice were allowed to freely explore the open field arena for 30 min. Animal activity and location were automatically monitored with an infrared diode interfaced to a computer running Fusion Activity software. Data were collected continuously and divided into intervals of 5 min intervals. Figure 39 shows the average of all time points for total distance traveled in 16 week old mice treated at 8 weeks of age compared to untreated 16 week old mice. The average of all time points for total rearing postures after 16 weeks is shown in Figure 40. Statistics were one-way ANOVA, comparison of each column mean to untreated mean, and Dunnett post hoc (mean + / - SEM). AAV8- and AAV9-treated mice show a statistically significant increase in distance traveled compared to untreated age-matched mice (statistically significant). All treated mice show a statistically significant increase in the amount of rearing postures compared to untreated age-matched controls.

[0203] Grip strength. Grip strength was tested in untreated and treated mice at 16 weeks of age. Mice were tested for grip strength with 3-5 trials for the front and back paws, respectively. Trial averages are shown in Figure 41. Grip strength is reported as grams weight. As shown in Figure 41, AAV9-treated mice showed statistically significant increased grip strength in the front paws compared to untreated age-matched mice. Statistics were two-way ANOVA, Tukey's test post hoc.

[0204] cDNA PCR. Tissue from mouse heart was processed using RNEasy Plus Universal Mini Kit (Qiagen). The resulting RNA was reverse transcribed into cDNA using SuperScript VILO cDNA synthesis kit. 1 μL of cDNA was PCR amplified using AccuPrime DNA polymerase and a primer at exon 48 (forward primer: gtttccagagctttacctgagaa (SEQ ID NO: 89)) and at exon 54 (reverse primer: CTTTTATGAATGCTTCTCCAAG (SEQ ID NO: 90)). The expected band size was 997 nt when there was no deletion (i.e. exon 52 was still present) and approximately 764 nt when exon 52 was deleted. FIG. 42 shows P2 mice ("JA10 (P2 AAV9)") injected with AAV9 via the facial vein at 36-50 hours of age, and adult mice injected with 3.3-7.7E12 of AAV8 ("JA11 (TV AAV8)") or 4.3-7.5E12 of AAV9 ("JA12 (TV AAV9)") via the tail vein. As shown in FIG. 42, editing occurred to various degrees in P2 mice (48-54 hour old mice) AAV9-treated mice, as well as AAV8 adult-treated mice and AAV9 adult-treated mice, which was further confirmed by sequencing of the deletion band using primer tttctgtgattttcttttggattg (SEQ ID NO: 109) that binds to exon 53. FIG. 43 shows a representative chromatogram showing the deletion of exons 51 and 52 in the sequence of the deletion band from Ja10 mouse 1.

[0205] It is understood that the foregoing detailed description and the accompanying examples are merely illustrative and should not be taken as limitations on the scope of the invention, which is defined solely by the appended claims and equivalents thereof.

[0206] Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including but not limited to, with respect to the chemical structures, substituents, derivatives, intermediates, compounds, compositions, formulations, or methods of use of the invention, can be made without departing from the spirit and scope thereof.

[0207] For reasons of completeness, the various aspects of the invention are presented in the following numbered clauses: Section 1. A guide RNA (gRNA) comprising a targeting domain comprising a nucleotide sequence as set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:41, SEQ ID NO:42, or a complement thereof.

[0208] Section 2. A DNA targeting composition comprising a first gRNA and a second gRNA, wherein the first gRNA molecule and the second gRNA molecule comprise a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:41, SEQ ID NO:42, or a complement thereof, and wherein the first gRNA molecule and the second gRNA molecule comprise different targeting domains.

[0209] Clause 3. The DNA targeting composition of clause 2, wherein the first gRNA molecule is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:41, and the second gRNA molecule is SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19 or SEQ ID NO:42.

[0210] Clause 4. The DNA targeting composition of clause 2 or clause 3, wherein the first gRNA molecule is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15, and the second gRNA molecule is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19.

[0211] Clause 5. The first gRNA molecule and the second gRNA molecule are: (i) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4. (vi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (x) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15;The DNA targeting composition according to any one of claims 2 to 4, selected from the group consisting of: (xi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; and (xii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 42.

[0212] Item 6. The DNA targeting composition of any one of items 2 to 5, further comprising a Clustered Regularly Interspaced Short Palindromic Repeats-associated (Cas) protein.

[0213] Clause 7. The DNA targeting composition of clause 6, wherein the Cas protein comprises a Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 25) or NNGRRV (SEQ ID NO: 25).

[0214] Item 8. The DNA targeting composition of item 6 or 7, wherein the Cas protein comprises a Staphylococcus aureus Cas9 molecule having the amino acid sequence of SEQ ID NO:45.

[0215] Item 9. A DNA targeting composition described in any one of items 2 to 8, wherein the DNA targeting composition comprises the nucleotide sequence of SEQ ID NO: 83, the nucleotide sequence of SEQ ID NO: 84, the nucleotide sequence of SEQ ID NO: 37 and / or the nucleotide sequence of SEQ ID NO: 38.

[0216] Item 10. An isolated polynucleotide comprising a gRNA molecule described in item 1 or a DNA targeting composition described in any one of items 2 to 9.

[0217] Item 11. A vector comprising the gRNA described in item 1, the DNA targeting composition described in any one of items 2 to 9, or the isolated polynucleotide described in item 10.

[0218] Item 12. A vector comprising the DNA targeting composition described in any one of items 6 to 9.

[0219] Section 13. A vector encoding (a) a first guide RNA (gRNA) molecule, (b) a second gRNA molecule, and (c) at least one Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO:24) or NNGRRV (SEQ ID NO:25), wherein the first gRNA molecule and the second gRNA molecule comprise a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:41, SEQ ID NO:42, or a complement thereof, and wherein the first gRNA molecule and the second gRNA molecule comprise different targeting domains.

[0220] Item 14. The vector of item 13, wherein the vector is configured to form first and second double-stranded breaks in first and second introns flanking exon 51 of the human DMD gene.

[0221] Clause 15. The vector of clause 13 or clause 14, wherein the first gRNA molecule is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:41 and the second gRNA molecule is SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19 or SEQ ID NO:42.

[0222] Item 16. The vector according to any one of items 13 to 15, wherein the first gRNA molecule is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15, and the second gRNA molecule is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19.

[0223] Clause 17. The first gRNA molecule and the second gRNA molecule are: (i) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4. (vi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (x) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15;and (xi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18.

[0224] Item 18. The vector according to any one of items 11 to 17, wherein the vector is a viral vector.

[0225] Item 19. The vector of item 18, wherein the vector is an adeno-associated virus (AAV) vector.

[0226] Item 20. The vector described in item 19, wherein the AAV vector is an AAV8 vector or an AAV9 vector.

[0227] Clause 21. The vector of any one of clauses 11 to 20, wherein the vector comprises a tissue-specific promoter operably linked to a nucleotide sequence encoding the first gRNA molecule, the second gRNA molecule and / or the Cas9 molecule.

[0228] Clause 22. The vector of clause 21, wherein the tissue-specific promoter is a muscle-specific promoter.

[0229] Paragraph 23. A cell comprising the gRNA described in paragraph 1, the DNA targeting composition described in any one of paragraphs 2 to 9, the isolated polynucleotide described in paragraph 10, or the vector described in any one of paragraphs 11 to 22.

[0230] Clause 24. A kit comprising a gRNA described in clause 1, a DNA targeting system described in any one of clauses 2 to 9, an isolated polynucleotide described in clause 10, a vector described in any one of clauses 11 to 22 or a cell described in claim 23, and optionally instructions for use.

[0231] Clause 25. A method for correcting a mutant dystrophin gene in a cell, comprising administering to the cell a gRNA described in clause 1, a DNA targeting system described in any one of clauses 2 to 9, an isolated polynucleotide described in clause 10, or a vector described in any one of clauses 11 to 22.

[0232] Clause 26. A method for genome editing a mutant dystrophin gene in a subject, comprising administering to the subject a composition for genome editing comprising the gRNA described in clause 1, the DNA targeting system described in any one of clauses 2 to 9, the isolated polynucleotide described in clause 10, the vector described in any one of clauses 11 to 22, or the cell described in clause 23.

[0233] Item 27. The method of item 26, wherein the genome editing composition is administered to the subject intramuscularly, intravenously, or a combination thereof.

[0234] 28. The method of any one of claims 25 to 27, wherein correcting the mutant dystrophin gene comprises nuclease-mediated non-homologous end joining.

[0235] Clause 29. A method of treating a subject in need thereof having a mutated dystrophin gene, comprising administering to said subject a gRNA described in clause 1, a DNA targeting system described in any one of clauses 2-9, an isolated polynucleotide described in clause 10, a vector described in any one of clauses 11-22, or a cell described in clause 23.

[0236] Clause 30. A modified adeno-associated virus vector for genome editing of a mutant dystrophin gene in a subject, the modified adeno-associated virus vector comprising a first polynucleotide sequence encoding a gRNA described in clause 1, and a second polynucleotide sequence encoding a Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25).

[0237] Clause 31. The modified adeno-associated viral vector of clause 30, wherein the modified adeno-associated viral vector comprises a nucleotide sequence set forth in SEQ ID NO:39 or SEQ ID NO:40.

[0238] Section 32. A composition for deleting a segment containing exon 51 in the dystrophin gene, comprising: (a) a first vector comprising a polynucleotide sequence encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25); and (b) a polynucleotide sequence encoding a second gRNA molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). and a second vector comprising a polynucleotide sequence encoding a second Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of said first and second gRNA molecule, each of said first and second gRNA molecules having a targeting domain 19 to 24 nucleotides in length, and said first and second vectors being configured to form first and second double-stranded breaks in first and second introns, respectively, adjacent to exon 51 of the human DMD gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0239] Item 33. The composition described in item 32, wherein the segment has a length of about 50 base pairs to about 2,000 base pairs.

[0240] Clause 34. The composition of clause 33, wherein the segment has a length of about 118 base pairs, about 233 base pairs, about 326 base pairs, about 766 base pairs, about 805 base pairs, or about 1611 base pairs.

[0241] Clause 35. The composition of any one of clauses 32-34, wherein the first Cas9 molecule and the second Cas9 molecule are identical.

[0242] Item 36. The composition of item 35, wherein the first Cas9 molecule and the second Cas9 molecule are Staphylococcus aureus Cas9 molecules.

[0243] Item 37. The composition of item 36, wherein the first Cas9 molecule and the second Cas9 molecule are mutant Staphylococcus aureus Cas9 molecules.

[0244] Clause 38. The composition of any one of clauses 32-34, wherein the first Cas9 molecule and the second Cas9 molecule are different.

[0245] Item 39. The composition of item 38, wherein the first Cas9 molecule or the second Cas9 molecule is a Staphylococcus aureus Cas9 molecule.

[0246] Clause 40. The composition of any one of clauses 32 to 39, wherein the first Cas9 molecule and / or the second Cas9 molecule comprises a SaCas9 molecule having the amino acid sequence of SEQ ID NO: 45.

[0247] Item 41. The composition according to any one of items 32 to 40, wherein the first vector and / or the second vector is a viral vector.

[0248] Clause 42. The composition described in clause 41, wherein the first vector and / or the second vector is an adeno-associated virus (AAV) vector.

[0249] Item 43. The composition described in item 42, wherein the AAV vector is an AAV8 vector or an AAV9 vector.

[0250] Item 44. The composition according to any one of items 32 to 43, wherein the dystrophin gene is a human dystrophin gene.

[0251] Clause 45. The composition of any one of clauses 32 to 44, wherein the first gRNA molecule and the second gRNA molecule comprise a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or a complement thereof, and wherein the first gRNA molecule and the second gRNA molecule comprise different targeting domains.

[0252] Clause 46. The composition described in any one of clauses 32 to 45, wherein the first gRNA molecule is SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 or SEQ ID NO:15, and the second gRNA molecule is SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 or SEQ ID NO:19.

[0253] Clause 47. The composition described in any one of clauses 32 to 46, wherein the first gRNA molecule is selected from the group consisting of SEQ ID NO:1, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14 and SEQ ID NO:15, and the second gRNA molecule is selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:19.

[0254] Clause 48. The first gRNA molecule and the second gRNA molecule are: (i) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4. (vi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (x) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15;and (xi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18.

[0255] Item 49. The composition described in any one of items 32 to 48, wherein the first vector comprises the nucleotide sequence set forth in SEQ ID NO: 39 and the second vector comprises the nucleotide sequence set forth in SEQ ID NO: 40.

[0256] Item 50. A composition according to any one of items 32 to 49 for use in medicine.

[0257] Item 51. A composition described in any one of items 32 to 50 for use in treating Duchenne muscular dystrophy.

[0258] Item 52. A cell comprising the composition described in any one of items 32 to 51.

[0259] 53. A method for correcting a mutant dystrophin gene in a cell, comprising: transfecting the cell with (a) a first vector comprising a polynucleotide sequence encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO:24) or NNGRRV (SEQ ID NO:25); and (b) a polynucleotide sequence encoding a second gRNA molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO:24) or NNGRRV (SEQ ID NO:25). and a second vector comprising a polynucleotide sequence encoding a second Cas9 molecule that recognizes a cis-adjacent motif (PAM), wherein each of the first and second gRNA molecules has a targeting domain 19 to 24 nucleotides in length, and the vector is configured to form first and second double-stranded breaks in first and second introns, respectively, adjacent to exon 51 of the human dystrophin gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0260] Clause 54. The first gRNA molecule and the second gRNA molecule are: (i) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4. (vi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (x) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15;and (xi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO:18.

[0261] Clause 55. The method of clause 53 or clause 54, wherein the mutant dystrophin gene comprises a premature stop codon, a disrupted reading frame, an ectopic splice acceptor site, or an ectopic splice donor site.

[0262] Clause 56. The method of any one of clauses 53 to 55, wherein the mutant dystrophin gene contains a premature stop codon and a frameshift mutation resulting in a truncated gene product.

[0263] Clause 57. The method of any one of clauses 53 to 55, wherein the mutant dystrophin gene comprises a deletion of one or more exons that disrupts the reading frame.

[0264] Clause 58. The method of any one of clauses 53 to 57, wherein the correction of the mutant dystrophin gene comprises deleting a premature stop codon, correcting a disrupted reading frame, or altering splicing by disrupting a splice acceptor site or disrupting a splice donor sequence.

[0265] Item 59. The method of any one of items 53 to 58, wherein the correction of the mutant dystrophin gene comprises a deletion of exon 51.

[0266] Item 60. The method according to any one of items 53 to 59, wherein the correction of the mutant dystrophin gene comprises homologous recombination repair.

[0267] 61. The method of claim 60, further comprising administering to said cells donor DNA.

[0268] Clause 62. The method of any one of clauses 53 to 61, wherein the correction of the mutant dystrophin gene comprises nuclease-mediated non-homologous end joining.

[0269] Item 63. The method of any one of items 53 to 62, wherein the cells are myoblasts.

[0270] Clause 64. The method of any one of clauses 53 to 63, wherein the cells are derived from a subject suffering from Duchenne muscular dystrophy.

[0271] Clause 65. The method of any one of clauses 53 to 64, wherein the cells are myoblasts derived from a human subject suffering from Duchenne muscular dystrophy.

[0272] Clause 66. The method according to any one of clauses 53 to 65, wherein the first gRNA molecule and the second gRNA molecule are selected from the group consisting of: (i) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19.

[0273] Clause 67. A method of treating a subject in need thereof having a mutant dystrophin gene, comprising administering to the subject (a) a first vector comprising a polynucleotide sequence encoding a first guide RNA (gRNA) molecule and a polynucleotide sequence encoding a first Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25), and (b) a polynucleotide sequence encoding a second gRNA molecule and a polynucleotide sequence encoding a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). and a second vector comprising a polynucleotide sequence encoding a second Cas9 molecule that recognizes a spacer adjacent motif (PAM), wherein each of the first and second gRNA molecules has a targeting domain 19-24 nucleotides in length, and the vector is configured to form first and second double-stranded breaks in first and second introns, respectively, adjacent to exon 51 of the human dystrophin gene, thereby deleting a segment including exon 51 in the dystrophin gene.

[0274] Clause 68. The first gRNA molecule and the second gRNA molecule are: (i) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 1, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 2; (ii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4; (iii) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 15, and a targeting domain comprising a nucleotide sequence set forth in SEQ ID NO: 4. (vi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 19; (x) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 15;and (xi) a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 18.

[0275] Item 69. The method of item 68, wherein the subject is afflicted with Duchenne muscular dystrophy.

[0276] Item 70. The method of any one of items 67 to 69, wherein the first vector and the second vector are administered to a muscle of the subject.

[0277] Item 71. The method of item 70, wherein the muscle is a skeletal muscle or a cardiac muscle.

[0278] Item 72. The method of item 71, wherein the skeletal muscle is the tibialis anterior muscle.

[0279] Clause 73. The method of any one of clauses 67 to 72, wherein the first vector and the second vector are administered to the subject intramuscularly, intravenously, or a combination thereof.

[0280] Clause 74. A method of generating a transgenic rodent embryo having a human dystrophin gene with exon 52 deleted (Δ52) (hDMD), comprising administering to a rodent embryo the gRNA described in clause 1, the DNA targeting system described in any one of clauses 2-9, the isolated polynucleotide described in clause 10, the vector described in any one of clauses 11-22, the modified adeno-associated virus vector described in clause 30 or clause 31, or the composition described in any one of clauses 32-51, thereby deleting exon 52 of the human dystrophin gene, and selecting a transgenic rodent embryo in which exon 52 of the human dystrophin gene has been deleted, wherein the rodent embryo contains a normal human dystrophin gene.

[0281] Clause 75. The method of clause 74, wherein the rodent embryo is a mouse embryo.

[0282] Clause 76. The method of clause 74 or clause 75, wherein the rodent embryo is heterozygous hDMD or heterozygous hDMD-Δ52.

[0283] Clause 77. The method of any one of clauses 74 to 76, wherein the rodent embryo is administered a first gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain comprising the nucleotide sequence set forth in SEQ ID NO: 42 to delete exon 52 of the human dystrophin gene.

[0284] Clause 78. The method of any one of clauses 74-77, further comprising administering to said rodent embryo a Cas protein comprising an amino acid sequence set forth in SEQ ID NO:27.

[0285] Clause 79. A transgenic rodent embryo produced by the method of any one of clauses 74 to 78.

[0286] Clause 80. A transgenic rodent produced from the transgenic rodent embryo of clause 79.

[0287] Appendix pDO240 (SEQ ID NO: 37) harboring JCR179 (gRNA in bold) [ka] [ka]

[0288] pDO240 (SEQ ID NO: 38) with JCR183 (gRNA in bold) [ka] [ka]

[0289] PT366 with JCR179 PT366AAV 179 (SEQ ID NO: 39) - AAV plasmid used for in vivo work (gRNA in bold; SaCas9 in uppercase; NLS in lowercase, bold and underlined) [ka] [ka] [ka] [ka] [ka]

[0290] PT366 with JCR183 (SEQ ID NO: 40) - used for in vivo work (gRNA in bold; SaCas9 in uppercase; NLS in lowercase, bold and underlined) [ka] [ka] [ka] [ka] [ka]

[0291] pDO242 (SaCas used in all JCR89 / 91 and JCR157 / 160 projects for in vivo work; SaCas9 in uppercase) (SEQ ID NO: 83) [ka] [ka] [ka] [ka]

[0292] pJRH1 (SaCas9 used for all JCR179 / 183 projects, SaCas9 in uppercase; NLS in lowercase, bold and underlined) (SEQ ID NO:84) [ka] [ka] [ka] [ka] [ka]

[0293] NLS sequence in PT366 (SEQ ID NO:85) AAAAGGCCGGCGGCCACGAAAAAAGGCCGGCCAGGCAAAAAAGAAAAAG

[0294] pDO203 - General backbone for cloning gRNA into SpCas9; JCR94 and JCR99 were placed in bold to test in cells and then mRNA was made to generate hDMD-delta52 / mdx mice (SEQ ID NO: 86) [ka] [ka]

Claims

1. An isolated polynucleotide encoding a first gRNA molecule and a second gRNA molecule, the first gRNA molecule and the second gRNA molecule comprising: (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; and (xii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

42. An isolated polynucleotide selected from the group consisting of:

2. 2. The isolated polynucleotide of claim 1, further encoding a clustered regularly interspaced short palindromic repeats associated 9 (Cas9) molecule.

3. 3. The isolated polynucleotide of claim 2, wherein the Cas9 molecule recognizes either the protospacer adjacent motif (PAM) NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25).

4. 4. The isolated polynucleotide of claim 3, wherein the first gRNA molecule, the second gRNA molecule and the Cas9 molecule are configured to form first and second double-stranded breaks in first and second introns adjacent to exon 51 of the human DMD gene.

5. 3. The isolated polynucleotide of Claim 2, comprising a tissue-specific promoter operably linked to a nucleotide sequence encoding the first gRNA molecule, the second gRNA molecule, and / or the Cas9 molecule.

6. A cell comprising the isolated polynucleotide of claim 2.

7. A composition for deleting a segment including exon 51 in the dystrophin gene, comprising the isolated polynucleotide of claim 1.

8. A composition for deleting a segment containing exon 51 in a dystrophin gene, comprising: (a) a first isolated polynucleotide encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25); and (b) a second isolated polynucleotide encoding a second gRNA molecule and a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). Including, The first gRNA molecule, the second gRNA molecule, the first Cas9 molecule, and the second Cas9 molecule are configured to create a first double-stranded break in a first intron adjacent to exon 51 of the human DMD gene and a second double-stranded break in a second intron, thereby deleting a segment including exon 51 in the dystrophin gene; and The first gRNA molecule and the second gRNA molecule (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; and (xii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

42. A composition selected from the group consisting of:

9. The first gRNA molecule and the second gRNA molecule (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; and (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

18. The composition of claim 8 selected from the group consisting of:

10. A composition for correcting a mutant dystrophin gene in a cell, comprising the isolated polynucleotide of claim 1.

11. 1. A composition for correcting a mutant dystrophin gene in a cell, comprising: (a) a first isolated polynucleotide encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25); and (b) a second isolated polynucleotide encoding a second gRNA molecule and a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). Including, The first gRNA molecule, the second gRNA molecule, the first Cas9 molecule, and the second Cas9 molecule are configured to create a first double-stranded break in a first intron adjacent to exon 51 of the human DMD gene and a second double-stranded break in a second intron, thereby deleting a segment including exon 51 in the dystrophin gene; and The first gRNA molecule and the second gRNA molecule (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:18; and (xii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

42. A composition selected from the group consisting of:

12. The first gRNA molecule and the second gRNA molecule (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; and (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

18. The composition of claim 11 selected from the group consisting of:

13. 13. A composition for treating a subject in need thereof having a mutated dystrophin gene comprising the isolated polynucleotide of claim 1.

14. 1. A composition for treating a subject in need thereof having a mutated dystrophin gene, comprising: (a) a first isolated polynucleotide encoding a first guide RNA (gRNA) molecule and a first Cas9 molecule that recognizes a protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25); and (b) a second isolated polynucleotide encoding a second gRNA molecule and a second Cas9 molecule that recognizes the protospacer adjacent motif (PAM) of either NNGRRT (SEQ ID NO: 24) or NNGRRV (SEQ ID NO: 25). Including, The first gRNA molecule, the second gRNA molecule, the first Cas9 molecule, and the second Cas9 molecule are configured to create a first double-stranded break in a first intron adjacent to exon 51 of a human dystrophin gene and a second double-stranded break in a second intron, thereby deleting a segment including exon 51 in the dystrophin gene; and The first gRNA molecule and the second gRNA molecule (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:18; and (xii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 41, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

42. A composition selected from the group consisting of:

15. The first gRNA molecule and the second gRNA molecule (i) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:1, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:2; (ii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:4; (iii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (iv) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (v) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (vi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 19; (vii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 18; (viii) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 4; (ix) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:19; (x) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 14, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 15; and (xi) a first gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO: 11, and a second gRNA molecule comprising a targeting domain encoded by the nucleotide sequence of SEQ ID NO:

18. The composition of claim 14 selected from the group consisting of:

Images