Mutant-based coronavirus vaccine

Abstract

The present disclosure provides coronavirus mRNA vaccines, including vaccines against one or more mutated strains of SARS-CoV-2, and methods of using the vaccines.

Description

[Technical field]

[0001] This application is a continuation of U.S. Provisional Patent Application No. 63 / 138,228, filed January 15, 2021, U.S. Provisional Patent Application No. 63 / 140,921, filed January 24, 2021, U.S. Provisional Patent Application No. 63 / 161,439, filed April 12, 2021, U.S. Provisional Patent Application No. 63 / 173,972, filed May 26, 2021, and U.S. Provisional Patent Application No. 63 / 193,558, filed July 2021. 16, U.S. Provisional Patent Application No. 63 / 222,930, filed September 8, 2021, U.S. Provisional Patent Application No. 63 / 241,944, filed November 29, 2021, U.S. Provisional Patent Application No. 63 / 283,795, filed November 30, 2021, and U.S. Provisional Patent Application No. 63 / 284,565, filed November 30, 2021, each of which is incorporated by reference in its entirety herein. [Background technology]

[0002] Human coronaviruses are highly contagious enveloped, positive-stranded RNA viruses in the Coronaviridae family. Two subfamilies of the Coronaviridae family are known to cause human disease. The most important are the β-coronaviruses (betacoronaviruses). Several previously known β-coronaviruses are common etiologies of mild to moderate upper respiratory tract infections. However, in recent years, there have been a series of more lethal coronavirus outbreaks, including SARS and MERS. The latest novel coronavirus was first identified in December 2019 in the city of Wuhan, China, and was associated with a high mortality rate. This recently identified coronavirus, termed severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) (originally called "2019 novel coronavirus" or "2019-nCoV"), has rapidly infected millions of people and caused a global pandemic. The pandemic disease caused by the SARS-CoV-2 virus has been named Coronavirus Disease 2019 (COVID-19) by the World Health Organization (WHO). The first genome sequence of a SARS-CoV-2 isolate (Wuhan-Hu-1; USA-WA1 / 2020 isolate) was released on January 10, 2020, by researchers at Virological, a UK-based discussion forum for the analysis and interpretation of viral molecular evolution and epidemiology, from the China CDC in Beijing. The sequence was then deposited in GenBank on January 12, 2020, with Genbank accession number MN908947.1. Numerous SARS-CoV-2 strain variants have since been identified, some of which are more infectious than SARS-CoV-2 isolates.

[0003] At the time of the global emergency use authorization of the licensed SARS-CoV-2 nucleic acid-based vaccines, there is still no strategy to combat recently discovered or upcoming emerging SARS-CoV-2 variants of concern (VOCs). The ongoing health challenges and mortality associated with coronavirus infections, particularly the SARS-CoV-2 pandemic, are a threatening concern internationally. The public health crisis caused by SARS-CoV-2 and its variants highlights the importance of rapidly developing effective and safe vaccine candidates against these viruses.

[0004] The emergence of SARS-CoV-2 variants with substitutions in the receptor-binding domain (RBD) and N-terminal domain (NTD) of the viral S protein has raised concerns among scientists and health authorities. Coronavirus entry into host cells is mediated by an interaction between the RBD of the viral S protein and the host angiotensin-converting enzyme 2 (ACE2). Vaccine development has focused on inducing antibody responses against this region of the SARS-CoV-2 S protein. Recently, a neutralizing "supersite" has also been identified in the NTD. A significant reduction in vaccine efficacy has been correlated with amino acid substitutions in the RBD (e.g., K417N, E484K, and N501Y) and NTD (e.g., L18F, D80A, D215G, and Δ242-244) of the S protein. Some of the recent circulating isolates containing these substitutions, from the UK (B.1.1.7, alpha), South Africa (B.1.351, beta), Brazil (P.1 lineage, gamma), New York (B.1.526, iota), and California (B.1.427 / B.1.429 or CAL.20C lineage, epsilon), have shown reduced neutralization from convalescent sera in pseudovirus neutralization (PsVN) assays and resistance to certain monoclonal antibodies. Notably, mutations in the NTD subdomain, especially the neutralization supersite, are most widespread in B.1.351 lineage viruses. See McCallum, M. et al. N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2. Cell, doi:10.1016 / j.cell.2021.03.028(2021). reported an evaluation of the neutralizing capacity of sera from phase 1 participants and non-human primates (NHPs) administered two doses of mRNA-1273 using two orthogonal vesicular stomatitis virus (VSV) and lentiviral PsVN assays expressing S variants of 20E(EU1), 20A.EU2, D614G-N439K, mink cluster 5, B.1.1.7, P.1, B.1.427 / B.1.429, B.1.1.7+E484K, and B.1.351. See Wu, K. et al. Serum Neutralizing Activity Elicited by mRNA-1273 Vaccine. N Engl J Med, doi:10.1056 / NEJMc2102179 (2021). Subsequent studies have demonstrated reduced neutralizing titers against the full B.1.351 variant following mRNA-1273 vaccination, but the levels remain significant and suggest a promising protective effect. Despite predictions of continued efficacy of mRNA-1273 against this variant of primary concern, the duration of vaccine-mediated protection remains unknown.

[0005] L18F, D80A, D215G, L242-244del, R246I, K417N, E484K, N501Y, D614G, A701V, A67V, Δ69-70, T95I, G142D / Δ143-1 45, Δ211 / L212I, ins214EPE, G339D, S371L, S373P, S375F, N440K, G446S, S477N, T478K, E484A, Q493K, G496S, Q49 There remains a need for the development and evaluation of additional COVID-19 vaccines against SARS-CoV-2 variants that encode the SARS-CoV-2 prefusion-stabilizing S protein incorporating key mutations present in variants such as 8R, Y505H, T547K, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F, and any combination thereof. Additional vaccines are needed to expand coverage to multiple circulating variants as well as the ancestral wild-type virus that still circulates worldwide. Summary of the Invention

[0006] The SARS-CoV-2 vaccine, mRNA-1273 (developed by Moderna Therapeutics), has been shown to induce high virus-neutralizing titers in human participants in phase 1 trials (Jackson et al., 2020; Anderson et al., 2020) and is highly effective in preventing symptomatic COVID-19 disease and severe disease (Baden et al., 2020). However, the recent emergence of SARS-CoV-2 variants in the UK (B.1.1.7 lineage; alpha variant) and South Africa (B.1.351 lineage, beta variant) has raised concerns due to increased infection rates and the potential to evade immunity induced by natural infection or vaccination (Volz et al., 2021; Tegally et al., 2020; Wibmer et al., 2021; Wang et al., 2021; Collier et al., 2021).

[0007] The SARS-CoV-2 B.1.1.7 variant (alpha variant), first detected in southern England in September 2020, has spread rapidly and is associated with increased transmission and higher viral loads (Rambaut et al., 2020). This variant has 17 mutations in the viral genome. Of these, eight mutations are in the spike (S) protein, including 69-70del, Y144del, N501Y, A570D, P681H, T716I, S982A, and D1118H. Two key features of this variant, the 69-70 deletion and the N501Y mutation in the S protein, have raised concerns among scientists and policymakers in the UK based on increased infection and potential increased mortality, leading to further shutdowns. The 69-70 deletion has been associated with reduced susceptibility to neutralization by SARS-CoV-2 human convalescent serum samples (Kemp et al., 2021). N501 is one of six key amino acids that interact with the ACE-2 receptor (Starr et al. 2020), and tyrosine substitution has been shown to increase binding affinity to the ACE-2 receptor (Chan et al., 2020).

[0008] The B.1.351 variant (beta variant) has emerged in South Africa over the past few months and, similar to the B.1.1.7 variant, has been reported to be associated with increased transmissibility and increased viral load after infection (Tegally et al., 2020). The mutations present in the S protein are more extensive than those of the B.1.1.7 variant, with changes L18F, D80A, D215G, L242-244del, R246I, K417N, E484K, N501Y, D614G, and A701V, with three of these mutations located in the RBD (K417N, E484K, N501Y). B.1.351 shares key mutations in the RBD with variants reported in Brazil (Tegally et al., 2020; Naveca et al., 2021). Because the RBD is the primary target for neutralizing antibodies, these mutations may affect the efficacy of monoclonal antibodies already approved and in development, as well as polyclonal antibodies induced by infection or vaccination, in neutralizing the virus (Greaney et al., 2021, Wibmer et al., 2021).

[0009] Recent data suggest that a key mutation present in the B.1.351 variant, E484K, may confer resistance to SARS-CoV-2 neutralizing antibodies and limit the therapeutic efficacy of monoclonal antibody therapy (Wang et al., 2021; Greaney et al., 2020; Weisblum et al., 2020; Liu et al., 2020; Wibmer et al., 2021). Furthermore, the E484K mutation was shown to reduce neutralization against a panel of convalescent sera (Weisblum et al., 2020; Liu et al., 2020; Wibmer et al., 2021). With regard to vaccination, it is clear that mRNA-1273 induces significantly higher neutralization titers against the USA-WA1 / 2020 isolate than convalescent sera (Jackson et al., 2020). A recent study using a recombinant VSV PsVN assay showed that sera from mRNA-1273 vaccinated participants had reduced neutralizing titers against the E484K or K417N / E484K / N50Y combinations (Wang et al., 2021), but sera from mRNA-1273 clinical trial participants have not been evaluated against the full constellation of S mutations found in the B.1.1.7 or B.1.351 variants.

[0010] Neutralization of sera from phase 1 clinical trial participants vaccinated with mRNA-1273 against recombinant VSV-based SARS-CoV-2 PsVN assays using S proteins from the USA-WA1 / 2020 isolate, the D614G variant, the B.1.1.7 and B.1.351 variants, and previously emerged variants (20E, 20A.EU2, D614G-N439K, and mink cluster 5 variants) was examined (data discussed in the Examples). The impact of both single mutations and combinations of mutations present in the RBD region of the S protein was evaluated. Additionally, orthogonal evaluations in VSV and pseudotyped lentivirus neutralization assays were performed on sera from NHPs administered the mRNA-1273 vaccine at two different dose levels, as this evaluation is a useful preclinical model of vaccine-induced immunogenicity and protection. Using both of these assays, confirmatory data on pseudovirus neutralization was obtained. Overall, this comprehensive pseudovirus neutralization analysis in humans and non-human primates administered mRNA-1273 provides important validation needed to elucidate how SARS-CoV-2 variants may impact vaccines.

[0011] The present invention relates, inter alia, to a vaccine comprising a nucleic acid encoding a SARS-CoV-2 antigen that differs by at least one amino acid mutation from a SARS-CoV-2 spike antigen having an amino acid sequence of SEQ ID NO: 36, where the mutation is an amino acid substitution, deletion, or insertion, and where the mutation is an insertion, it is not a 2P mutation or is in addition to a 2P mutation. Such a vaccine (optionally also referred to herein as a mutant vaccine) may be administered to a seropositive or seronegative subject. For example, the subject may be naive and not have antibodies reactive to SARS-CoV-2, or may have pre-existing antibodies to SARS-CoV-2 due to having previously been infected with SARS-CoV-2 or having previously received a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against SARS-CoV-2. The mutant vaccine may be the only vaccine comprising a nucleic acid encoding a SARS-CoV-2 antigen that the subject vaccinates. Alternatively, the mutant vaccines may be administered in combination with other vaccines containing nucleic acids encoding SARS-CoV-2 antigens, as prime and / or boost doses.

[0012] Thus, the disclosure provides, in some embodiments, methods comprising administering to a subject a vaccine, e.g., an effective dose thereof, comprising a SARS-CoV-2 spike antigen, optionally a 2P-stabilized spike antigen of a second pandemic SARS-CoV-2 virus, where the subject has previously received a first vaccine comprising a nucleic acid encoding a first SARS-CoV-2 2P-stabilized spike antigen of a first pandemic SARS-CoV-2 virus, and where each of the first and second 2P-stabilized spike antigens is administered in an amount effective to induce an immune response specific to the first and second antigens, where the second pandemic SARS-CoV-2 virus has a spike protein having an amino acid sequence with at least one amino acid mutation with respect to the amino acid sequence of the spike protein of the first pandemic SARS-CoV-2 virus, where the mutation is an amino acid substitution, deletion, or insertion.

[0013] In some aspects, the disclosure provides methods comprising administering to a subject a first vaccine, e.g., an effective amount thereof, comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen, and administering to a subject a second vaccine comprising a nucleic acid encoding a second SARS-CoV-2 2P spike antigen, optionally a 2P stabilized spike antigen, wherein each of the nucleic acids encoding the first and second stabilized spike antigens is administered in an amount effective to induce an immune response specific for the respective encoded antigen, wherein the second encoded SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation relative to the amino acid sequence of the first encoded spike protein, where the mutation is an amino acid substitution, deletion, or insertion.

[0014] In another aspect, the disclosure provides a method comprising administering to a subject a first vaccine, e.g., an effective amount thereof, comprising a nucleic acid encoding a first SARS-CoV-2 2P stabilized spike antigen, and administering to a subject a second vaccine comprising a nucleic acid encoding a second SARS-CoV-2 2P spike antigen, optionally a 2P stabilized spike antigen, wherein each of the nucleic acids encoding the first and second stabilized spike antigens is administered in an amount effective to induce an immune response specific for each encoded antigen, wherein the second encoded SARS-CoV-2 spike antigen has an amino acid sequence having at least one amino acid mutation relative to the amino acid sequence of the first encoded spike protein, the mutation being an amino acid substitution, deletion, or insertion, wherein the first encoded SARS-CoV-2 spike antigen is an antigen of a first circulating SARS-CoV-2 virus and the second encoded SARS-CoV-2 spike antigen is a spike antigen of a second circulating SARS-CoV-2 virus.

[0015] Provided herein, in some embodiments, are compositions (e.g., vaccines) that include one or more messenger ribonucleic acid (mRNA) molecules encoding highly immunogenic antigen(s) capable of eliciting a potent neutralizing antibody response against a coronavirus antigen, such as a SARS-CoV-2 mutant antigen.

[0016] The disclosure provides, in some embodiments, a nucleic acid (e.g., messenger ribonucleic acid (mRNA)) encoding a SARS-CoV-2 antigen of a second circulating SARS-CoV-2 viral strain, where the antigen has an amino acid sequence with at least one amino acid mutation relative to an antigen of a first circulating SARS-CoV-2 viral strain, where the mutation is an amino acid substitution, deletion, or insertion, where the antigen is not a full-length stabilized spike protein with a 2P mutation, and where the mRNA is in a lipid nanoparticle.

[0017] In some embodiments, the first and second virus strains are circulating for at least some portion of the year, hi some embodiments, the first and second virus strains are circulating during the same pandemic or epidemic season.

[0018] In some embodiments, the SARS-CoV-2 antigen has a second amino acid mutation, deletion, or both an amino acid mutation and deletion relative to an antigen of a first circulating SARS-CoV-2 virus strain, and the second mutation or deletion corresponds to a third circulating virus strain.

[0019] In some embodiments, the lipid nanoparticles comprise an ionizable amino lipid, a sterol, a neutral lipid, and a polyethylene glycol (PEG)-modified lipid. In some embodiments, the lipid nanoparticles comprise 40-55 mol% of an ionizable amino lipid, 30-45 mol% of a sterol, 5-15 mol% of a neutral lipid, and 1-5 mol% of a PEG-modified lipid.

[0020] In some embodiments, the SARS-CoV-2 antigen is the receptor binding domain (RBD) of the spike protein. In some embodiments, the SARS-CoV-2 antigen is the N-terminal domain (NTD). In some embodiments, the SARS-CoV-2 antigen is a combination of the RBD and NTD. In some embodiments, the SARS-CoV-2 antigen is a combination of the RBD and NTD and a transmembrane domain joined by a linker.

[0021] In some embodiments, the SARS-CoV-2 antigen is an NTD, RBD, and influenza hemagglutinin transmembrane (HATM) domain linked by a linker (NTD-RBD-HATM). In some embodiments, the SARS-CoV-2 antigen is an NTD-RBD fusion.

[0022] In some embodiments, the SARS-CoV-2 antigen is the S1 protein subunit. In some embodiments, the SARS-CoV-2 antigen is the S1 protein subunit.

[0023] In some embodiments, the amino acid mutation, deletion, or both amino acid mutation and deletion in the antigen is associated with a viral structure or function that differs in amount or type from the corresponding structure or function in the first virus.In some embodiments, the function is ACE2 receptor binding, viral spread, viral uptake, viral pathogenesis, altered furin cleavage, or viral replication.

[0024] In some embodiments, the mRNA encodes a protein having at least 95% sequence identity to any one of SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63. In some embodiments, the mRNA encodes a protein having at least 95% sequence identity to any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0025] In some aspects, the disclosure provides a composition comprising a first messenger ribonucleic acid (mRNA) encoding a first SARS-CoV-2 antigen of a first SARS-CoV-2 virus and a second mRNA encoding a second SARS-CoV-2 antigen of a second SARS-CoV-2 virus, where the second SARS-CoV-2 virus has an amino acid sequence having at least one amino acid mutation, deletion, or both an amino acid mutation and deletion relative to the amino acid sequence of the first SARS-CoV-2 virus, and where each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation.

[0026] In some embodiments, the composition further comprises a third messenger ribonucleic acid (mRNA) encoding a third SARS-CoV-2 antigen of a third SARS-CoV-2 virus, the third SARS-CoV-2 antigen having an amino acid sequence having at least one amino acid mutation, deletion, or both an amino acid mutation and deletion, relative to the amino acid sequences of the first and second SARS-CoV-2 antigens.

[0027] In some embodiments, the composition further comprises a fourth messenger ribonucleic acid (mRNA) encoding a fourth SARS-CoV-2 antigen of a fourth SARS-CoV-2 virus, where the fourth SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation, deletion, or both amino acid mutation and deletion relative to the amino acid sequences of the first, second, and third SARS-CoV-2 antigens.

[0028] In some embodiments, the composition further comprises a fifth messenger ribonucleic acid (mRNA) encoding a fifth SARS-CoV-2 antigen of a fifth SARS-CoV-2 virus, wherein the fifth SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation, deletion, or both amino acid mutation and deletion relative to the amino acid sequences of the first, second, third, and fourth SARS-CoV-2 antigens.

[0029] In some embodiments, the composition further comprises a sixth messenger ribonucleic acid (mRNA) encoding a sixth SARS-CoV-2 antigen of a sixth SARS-CoV-2 virus, wherein the sixth SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation, deletion, or both amino acid mutation and deletion relative to the amino acid sequences of the first, second, third, fourth, and fifth SARS-CoV-2 antigens.

[0030] In some embodiments, the first antigen and the second antigen, and optionally the third, fourth, fifth and sixth antigens, are each antigens of a spike protein. In some embodiments, the first antigen and the second antigen, and optionally the third, fourth, fifth and sixth antigens, are each antigens of a receptor binding domain of a spike protein.

[0031] In some embodiments, the first antigen and the second antigen, and optionally the third, fourth, fifth and sixth antigens, each share at least 98% amino acid sequence identity with each other.

[0032] In some embodiments, the first SARS-CoV-2 virus is a first pandemic SARS-CoV-2 virus strain and the second SARS-CoV-2 virus is a second pandemic SARS-CoV-2 virus strain, and the first and second SARS-CoV-2 virus strains are circulating in the population during at least some of the days of the year.

[0033] In some embodiments, the mRNAs are present in a ratio of about 1:1 to each other in the composition, hi other embodiments, the vaccines are separate vaccines that are not co-formulated.

[0034] In some embodiments, the mRNA is in a lipid nanoparticle, the lipid nanoparticle comprising an ionizable amino lipid, a sterol, a neutral lipid, and a polyethylene glycol (PEG)-modified lipid. In some embodiments, the lipid nanoparticle comprises 40-55 mol% of an ionizable amino lipid, 30-45 mol% of a sterol, 5-15 mol% of a neutral lipid, and 1-5 mol% of a PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises 40-50 mol% of an ionizable amino lipid, 35-45 mol% of a sterol, 10-15 mol% of a neutral lipid, and 2-4 mol% of a PEG-modified lipid. In some embodiments, the lipid nanoparticle comprises 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, or 50 mol% of an ionizable amino lipid.

[0035] In some embodiments, the ionizable amino lipid is Compound 1: [ka] It has the structure:

[0036] In some embodiments, the sterol is cholesterol. In some embodiments, the neutral lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG).

[0037] The present disclosure provides, in some embodiments, an mRNA encoding a protein having at least 90% or 95% sequence identity to any one of SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63.

[0038] In some aspects, the disclosure provides an mRNA having at least 90% or 95% sequence identity to any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0039] In another aspect, the disclosure provides an mRNA having at least 98% sequence identity to any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0040] In some aspects, the disclosure provides an mRNA comprising any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0041] In some aspects, the disclosure provides methods comprising administering to a subject a first effective amount of a first SARS-CoV-2 antigen of a first pandemic SARS-CoV-2 virus and administering to a subject a second effective amount of a nucleic acid encoding a second SARS-CoV-2 antigen of a second pandemic SARS-CoV-2 virus, wherein the first and second antigens are administered in amounts effective to induce an immune response specific to the first and second antigens, wherein the second SARS-CoV-2 virus has an amino acid sequence having at least one amino acid mutation, deletion, or both amino acid mutation and deletion relative to the amino acid sequence of the first SARS-CoV-2 virus, and wherein each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation.

[0042] In some embodiments, the second pandemic SARS-CoV-2 virus is an immunodominant emerging strain detected during the period in which the first pandemic SARS-CoV-2 virus was present in the subject population.

[0043] In some embodiments, the second pandemic SARS-CoV-2 virus and the first pandemic SARS-CoV-2 virus are detectable in a subject population within at least one year. In some embodiments, the second pandemic SARS-CoV-2 virus and the first pandemic SARS-CoV-2 virus are detectable in a subject population during the same season. In some embodiments, the second pandemic SARS-CoV-2 virus and the first pandemic SARS-CoV-2 virus are detectable in a subject population during the same pandemic or epidemic period.

[0044] In some embodiments, the first SARS-CoV-2 antigen is a first nucleic acid encoding the first SARS-CoV-2 antigen. In some embodiments, the first nucleic acid is DNA or messenger RNA (mRNA). In some embodiments, the second vaccine further comprises a first nucleic acid encoding the first SARS-CoV-2 antigen. In some embodiments, the first nucleic acid encoding the first SARS-CoV-2 antigen and the second nucleic acid encoding the second SARS-CoV-2 antigen are present in the second vaccine in a 1:1 ratio.

[0045] In some embodiments, the nucleic acid encoding the second SARS-CoV-2 antigen of the second pandemic SARS-CoV-2 virus is the second nucleic acid and is messenger RNA (mRNA).

[0046] In some embodiments, the first and / or second spike antigen is a monovalent antigen.

[0047] In some embodiments, the first and / or second spike antigen is a multivalent antigen.

[0048] In some embodiments, the first encoded antigen is administered to the subject as a first vaccine dose consisting of one or more prime or priming immunizations, and the second encoded antigen is administered to the subject as a boost. In some embodiments, the first and second encoded SARS-CoV-2 antigens are present in the boost dose in a 1:1 ratio.

[0049] In some embodiments, the second encoded antigen is administered to the subject as a first vaccine consisting of one or more prime or priming immunizations, and the first encoded antigen is administered to the subject as a boost.

[0050] In some embodiments, the first and second encoded antigens are administered to the subject together as a boost.

[0051] In some embodiments, the first encoded antigen is administered to the subject as a prime or priming immunization and as a boost to complete vaccination.

[0052] In some embodiments, a first coded antigen is administered to the subject as a prime or priming immunization and as a boost at the initial vaccination, and a second coded antigen is administered to the subject as a boost three or more months after the initial vaccination.

[0053] In some embodiments, the boost is a seasonal boost or a pandemic shift boost.

[0054] The disclosure provides, in some embodiments, a method comprising administering to a subject a second effective dose of a second vaccine comprising a second nucleic acid encoding a second SARS-CoV-2 antigen, where the subject has previously been administered a first effective dose of a first vaccine comprising a first nucleic acid encoding a first SARS-CoV-2 antigen, where the second vaccine is administered in an amount effective to induce an immune response specific for the second antigen, where the second SARS-CoV-2 antigen has an amino acid sequence having at least one mutation with respect to the corresponding amino acid sequence of the first SARS-CoV-2 antigen, where the mutation is an amino acid substitution, deletion, or insertion, and where each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation.

[0055] In some embodiments, the first encoded SARS-CoV-2 antigen is representative of a first pandemic SARS-CoV-2 virus and the second encoded SARS-CoV-2 antigen is an antigen of a second pandemic SARS-CoV-2 virus. In some embodiments, the first encoded SARS-CoV-2 antigen is of a first pandemic SARS-CoV-2 virus and the second encoded SARS-CoV-2 antigen is an antigen of a second pandemic SARS-CoV-2 virus.

[0056] In some embodiments, the first encoded SARS-CoV-2 antigen is an antigen representative of a first plurality of pandemic SARS-CoV-2 viruses, and / or the second encoded SARS-CoV-2 antigen is an antigen representative of a second plurality of pandemic SARS-CoV-2 viruses.

[0057] In some embodiments, the first encoded SARS-CoV-2 antigen is an antigen of a first pandemic SARS-CoV-2 virus and the second encoded SARS-CoV-2 antigen is an antigen of a second pandemic SARS-CoV-2 virus.

[0058] In some embodiments, the second epidemic SARS-CoV-2 virus is an immunodominant emerging strain or variant of concern detected during the time period in which the first epidemic SARS-CoV-2 virus is present in the subject population. In some embodiments, the second epidemic SARS-CoV-2 virus and the first epidemic SARS-CoV-2 virus are detectable in the subject population within at least one year. In some embodiments, the second epidemic SARS-CoV-2 virus and the first epidemic SARS-CoV-2 virus are detectable in the subject population during the same season. In some embodiments, the second epidemic SARS-CoV-2 virus and the first epidemic SARS-CoV-2 virus are detectable in the subject population during the same pandemic or epidemic period.

[0059] In some embodiments, the first nucleic acid encoding the first SARS-CoV-2 antigen is DNA or messenger RNA (mRNA). In some embodiments, the first nucleic acid encoding the first SARS-CoV-2 antigen is messenger RNA (mRNA). In some embodiments, the second nucleic acid encoding the second SARS-CoV-2 antigen is messenger RNA (mRNA). In some embodiments, the second vaccine further comprises a first nucleic acid encoding the first SARS-CoV-2 antigen. In some embodiments, the first nucleic acid encoding the first SARS-CoV-2 antigen and the second nucleic acid encoding the second SARS-CoV-2 antigen are present in the second vaccine in a 1:1 ratio.

[0060] In some embodiments, the first and / or second vaccine is a monovalent vaccine. In some embodiments, the first and / or second vaccine is a multivalent vaccine that includes multiple nucleic acids encoding antigens representative of multiple variants of concern.

[0061] In some embodiments, a first encoded SARS-CoV-2 antigen is administered to a subject as a first vaccine consisting of one or more prime or priming immunizations, and a second encoded SARS-CoV-2 antigen is administered to a subject as a boost in one or more administrations.

[0062] In some embodiments, the second encoded SARS-CoV-2 antigen is administered to the subject as a first vaccine dose consisting of one or more prime or priming immunizations, and the first encoded SARS-CoV-2 antigen is administered to the subject as one or more boosts.

[0063] In some embodiments, the first and second encoded SARS-CoV-2 antigens are administered to a subject together as a boost. In some embodiments, the first and second encoded SARS-CoV-2 antigens are present in a boost dose in a 1:1 ratio.

[0064] In some embodiments, a first encoded SARS-CoV-2 antigen is administered to a subject as a prime or priming immunization and as a boost to complete vaccination, and a second encoded SARS-CoV-2 antigen is administered to a subject as a booster regimen at least 3 months after completing the first vaccination.

[0065] In some embodiments, a first encoded SARS-CoV-2 antigen is administered to a subject as a prime or priming immunization and as a boost at the time of the initial vaccination, and a second encoded SARS-CoV-2 antigen is administered to a subject as a boost more than 6 months after the initial vaccination.

[0066] In some embodiments, the boost is a seasonal boost or a pandemic shift boost to provide protection against multiple variants of concern.

[0067] In some embodiments, the boost dose is 50 μg.

[0068] In some embodiments, the first and / or second effective dose is 20 μg to 50 μg. In some embodiments, the first and / or second effective dose is 20 μg. In some embodiments, the first and / or second effective dose is 25 μg. In some embodiments, the first and / or second effective dose is 30 μg. In some embodiments, the first and / or second effective dose is 40 μg. In some embodiments, the first and / or second effective dose is 50 μg.

[0069] In some embodiments, the first and / or second effective dose is 30 μg. In some embodiments, the first and / or second effective dose is 10 μg. In some embodiments, the first and / or second effective dose is 10 μg to 30 μg. In some embodiments, the first and / or second effective dose is 10 μg to 20 μg. In some embodiments, the first and / or second effective dose is at least 10 μg and less than 25 μg. In some embodiments, the first and / or second effective dose is 5 μg to 30 μg. In some embodiments, the first and / or second effective dose is at least 5 μg and less than 25 μg.

[0070] In some aspects, the disclosure provides methods that include administering to a subject a vaccine that includes a first nucleic acid encoding a SARS-CoV-2 antigen of a first SARS-CoV-2 virus, the first SARS-CoV-2 virus being an emerging variant of an earlier SARS-CoV-2 virus, the antigen having an amino acid sequence that has at least one amino acid mutation relative to a corresponding protein antigen of the earlier SARS-CoV-2 virus, the mutation being an amino acid substitution, deletion, or insertion, and the subject is seropositive for the SARS-CoV-2 antigen of the earlier SARS-CoV-2 virus.

[0071] The disclosure also provides a method, comprising administering to a subject a vaccine comprising a first nucleic acid encoding a SARS-CoV-2 antigen of a first SARS-CoV-2 virus, the first SARS-CoV-2 virus being an emerging variant of an earlier SARS-CoV-2 virus, the antigen having an amino acid sequence with at least one amino acid mutation relative to a corresponding protein antigen of the earlier SARS-CoV-2 virus, the mutation being an amino acid substitution, deletion, or insertion, and the subject being seronegative for the SARS-CoV-2 antigen of the earlier SARS-CoV-2 virus.

[0072] In some embodiments, the subject is administered a second dose of the vaccine between 2 weeks and 1 year after the first dose of the vaccine is administered. In some embodiments, the subject is administered a second vaccine between 2 weeks and 1 year after the vaccine is administered, the second vaccine comprising a second nucleic acid encoding a corresponding protein antigen of the initial SARS-CoV-2 virus. In some embodiments, the second vaccine comprises a mixture of a first and a second nucleic acid, the first and second nucleic acids being present in the second vaccine in a 1:1 ratio.

[0073] In some aspects, the disclosure provides methods comprising administering to a subject a booster vaccine comprising a nucleic acid encoding a first SARS-CoV-2 antigen derived from a first SARS-CoV-2 virus, where the subject has previously received at least one prime dose of a first vaccine comprising a first nucleic acid encoding a SARS-CoV-2 antigen of the first SARS-CoV-2 virus, where the booster vaccine is administered in an amount effective to induce a neutralizing immune response against a second SARS-CoV-2 virus, where the second SARS-CoV-2 virus comprises a second SARS-CoV-2 antigen, where the second SARS-CoV-2 antigen has an amino acid sequence with at least one amino acid mutation relative to a corresponding protein antigen of the first SARS-CoV-2 virus, where the booster vaccine is administered at a dose of 25-100 μg at least 6 months after the initial administration of the first vaccine, and where each of the first and second antigens is not a full length stabilized spike protein having a 2P mutation.

[0074] In some embodiments, the booster vaccine is administered at a dose of 50 μg.

[0075] In some embodiments, the booster vaccine is administered at least about 6 months after the second dose of the first vaccine. In some embodiments, the booster vaccine is administered 6-12 months after the second dose of the first vaccine. In some embodiments, the booster vaccine is administered at least about 8 months after the second dose of the first vaccine.

[0076] In some embodiments, the boost dose is a seasonal boost or a pandemic shift boost to provide a neutralizing immune response against multiple variants of concern. [Brief description of the drawings]

[0077] [Figure 1] Neutralization titers of mouse serum samples are shown. Serum was from mice immunized with 1 μg NTD-RBD-HATM. Neutralized viruses contained either the D614G mutation or a mutation associated with the South African variant B.1.351. [Diagram 2] Neutralization titers of mouse serum samples are shown. Serum was from mice administered 1 μg NTD_ext-RBD_ext-TM. Neutralized viruses contained either the D614G mutation or a mutation associated with the South African variant B.1.351. [Diagram 3] Neutralization titers of mouse serum samples are shown. Serum was from mice administered 1 μg of RBD__WH2020_NatSP_317_516__TM. Neutralized viruses contained either the D614G mutation or a mutation associated with the South African variant B.1.351. [Figure 4A]Neutralizing titers of mouse serum samples are shown. Serum was from mice that received 1 μg NTD-RBD-HATM on days 1 and 22, and then received 1 μg NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 on day 213. Samples were taken on day 212 (before the third dose) and day 233 (after the third dose). Neutralizing antibody titers at each time point are shown. Viruses being neutralized contained either the D614G mutation or the mutation associated with South African variant B.1.351. [Figure 4B] Neutralization titers of mouse serum samples are shown. Serum was from mice administered 1 μg NTD-RBD-HATM on days 1 and 22, followed by 1 μg NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 on day 213. Samples were taken on day 212 (before the third dose) and day 233 (after the third dose). The relative titer change between the two time points is shown. [Figure 4C] Neutralization titers of mouse serum samples are shown. Serum was from mice administered 1 μg NTD-RBD-HATM on days 1 and 22, followed by 1 μg NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 on day 213. Samples were taken on day 212 (before the third dose) and day 233 (after the third dose). The relative titer change between the different variants at the two time points is shown. [Figure 5A] Neutralizing titers of mouse serum samples are shown. Serum was from mice that received 0.1 μg NTD-RBD-HATM on days 1 and 22, and then 0.1 μg NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 on day 213. Samples were taken on day 212 (before the third dose) and day 233 (after the third dose). Neutralizing antibody titers at each time point are shown. Viruses being neutralized contained either the D614G mutation or the mutation associated with South African variant B.1.351. [Figure 5B]Neutralization titers of mouse serum samples are shown. Serum was from mice administered 0.1 μg NTD-RBD-HATM on days 1 and 22, followed by 0.1 μg NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 on day 213. Samples were taken on day 212 (before the third dose) and day 233 (after the third dose). The relative titer change between the two time points is shown. [Figure 5C] Neutralization titers of mouse serum samples are shown. Serum was from mice administered 0.1 μg NTD-RBD-HATM on days 1 and 22, followed by 0.1 μg NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 on day 213. Samples were taken on day 212 (before the third dose) and day 233 (after the third dose). The relative titer change between the different variants at the two time points is shown. [Figure 6A] Neutralizing titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 1 μg of NTD-RBD-HATM containing a mutation associated with the South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). Neutralizing antibody titers at each time point are shown based on neutralization of a pseudovirus containing a SARS-CoV-2 spike protein with the D614G mutation (left bar) or a mutation associated with the South African B.1.351 variant. [Figure 6B]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). The kinetics of neutralization titers from day 212 to day 248 are shown for each spike protein tested in Figure 6A. [Figure 6C] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). At each time point, the relative change in neutralization titer against the B.1.351 spike protein compared to the spike protein containing only the D614G mutation is shown. [Figure 6D] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (before the third dose), 233 (before the fourth dose), and 248 (14 days after the fourth dose). Reference neutralization titers against the D614G spike protein are shown for serum on day 36, two weeks after the second dose. [Figure 7A]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (prior to the third dose of mRNA-1283.351), 233 (prior to the fourth dose of mRNA-1283.351), and 248 (14 days after the fourth dose of mRNA-1283.351). Neutralizing antibody titers at each time point are shown, based on neutralization of pseudoviruses containing the SARS-CoV-2 spike protein with the D614G mutation (left bar) or a mutation associated with the South African B.1.351 variant. [Figure 7B] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (before the third dose of mRNA-1283.351), 233 (before the fourth dose of mRNA-1283.351), and 248 (14 days after the fourth dose of mRNA-1283.351). The kinetics of neutralization titers from days 212 to 248 are shown for each spike protein tested in Figure 7A. [Figure 7C]Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (prior to the third dose of mRNA-1283.351), 233 (prior to the fourth dose of mRNA-1283.351), and 248 (14 days after the fourth dose of mRNA-1283.351). At each time point, the relative change in neutralization titer against the B.1.351 spike protein compared to the spike protein containing only the D614G mutation is shown. [Figure 7D] Neutralization titers of mouse serum samples are shown. Serum was obtained from mice administered 0.1 μg of NTD-RBD-HATM on day 1 (prime dose) and again on day 22 (booster dose). Mice were administered 0.1 μg of NTD-RBD-HATM containing the mutation associated with South African variant B.1.351 (mRNA-1283.351) on days 213 (third dose) and 234 (fourth dose). Samples were taken on days 212 (before the third dose of mRNA-1283.351), 233 (before the fourth dose of mRNA-1283.351), and 248 (14 days after the fourth dose of mRNA-1283.351). Reference neutralization titers against the D614G spike protein are shown for serum on day 36, two weeks after the second dose. [Figure 8A] Protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice that received 10, 1, or 0.1 μg NTD-ext-RBD-ext-HATM on day 1 (prime dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Total IgG specific for SARS-CoV-2 spike protein as measured by ELISA is shown. [Figure 8B]Protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice that received 10, 1, or 0.1 μg NTD-ext-RBD-ext-HATM on day 1 (prime dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Neutralization titers of serum samples against pseudoviruses containing one of a panel of spike proteins, including 1) spike protein with a D614G mutation, 2) spike protein with a mutation associated with the B.1.351 variant, 3) spike protein containing a mutation associated with the P.1 variant, and 4) spike protein containing a mutation associated with the B.1.1.7 variant and an E484K mutation are shown. [Figure 8C] Protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice that received 10, 1, or 0.1 μg NTD-ext-RBD-ext-HATM on day 1 (prime dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). The reduction in neutralization titers of serum against each virus tested in Figure 8B is shown compared to baseline neutralization titers against the D614G spike protein. [Figure 8D] Protein-specific IgG and neutralization titers of mouse serum samples are shown. Serum was collected from mice that received 10, 1, or 0.1 μg of NTD-ext-RBD-ext-HATM on day 1 (prime dose) and again on day 22 (second dose). Serum was collected on day 36 (14 days after the second dose). Reference neutralization titers from mice immunized with a pseudovirus containing a mutation associated with the B.1.1.7 variant but not the E484K mutation are shown for sera elicited by two doses (days 1 and 14) with control mRNA-1273 and 1 μg of mRNA encoding a 2P-stabilized SARS-CoV-2 spike protein for each pseudovirus and spike protein tested in Figures 8B-8C. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0078] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a newly emerged respiratory virus with high morbidity and mortality. SARS-CoV-2 has spread rapidly around the world compared to SARS-CoV, which emerged in 2002, and Middle East respiratory syndrome coronavirus (MERS-CoV), which emerged in 2012. As reported by the World Health Organization (WHO), as of March 2021, the current outbreak of COVID-19 has caused approximately more than 120 million confirmed cases and more than 2.65 million deaths worldwide. New cases of COVID-19 infection are growing and are still growing rapidly. Therefore, it is important to develop a variety of safe and effective vaccines and drugs to prevent and treat COVID-19 and reduce the severe impact of COVID-19 worldwide. Vaccines and drugs produced using various modalities, as well as vaccines with improved safety and efficacy, are essential. There remains a need to accelerate advanced design and development of vaccines and therapeutics against coronavirus disease, and specifically coronavirus 2019 (COVID-19).

[0079] On January 7, 2020, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was identified as the etiology of a novel pneumonia that occurred in Wuhan, Hubei Province, China in December 2019 (Lu H.et al.(2020)J Med Virol. Apr;92(4):401-402.). Shortly thereafter, the virus caused an outbreak in China and spread worldwide. Analysis of the genome structure of SARS-CoV-2 revealed that it belongs to the β-coronavirus (CoV) (Chan et al.2020 Emerg Microbes Infect.;9(1):221-236).

[0080] Since then, numerous SARS-CoV-2 variant strains have emerged and become predominant in certain initial geographic regions. However, some variants that spread rapidly in one geographic area may spread rapidly worldwide. These variants are known as variants of concern (VOCs). Since the fall of 2020, two major variants have been discovered, one in the UK (20B / 501Y.V1, VOC 202012 / 01, or B.1.1.7 lineage, or alpha variant) and the other in South Africa (20C / 501Y.V2 or B.1.351 lineage, or beta variant). The two variants emerged separately from each other but appear to have improved transmissibility compared to the USA-WA1 / 2020 isolate. Furthermore, there is concern that these variants, as well as other epidemic strains, and future variants, may mutate further to avoid neutralization by existing vaccines and therapeutics such as antibodies. Thus, SARS-CoV-2 mutated forms, and any other emerging mutant SARS-CoV-2 strains, are of international health concern.

[0081] The threat of emergence of mutant strains of the virus poses a major challenge for vaccine development. The compositions disclosed herein provide a significant advance in the fight against new virus strains that cause global health concerns. Disclosed herein are vaccines and vaccine protocols with broad virus neutralization capabilities that reduce the threat of infection from multiple strains of the virus by administering a single or multiple doses of the same or different combinations of antigens derived from different strains. For example, the vaccination strategies disclosed herein, in some embodiments, include a "primary series" vaccination followed by boost(s) of SARS-CoV-2 antigens. The primary series (also referred to herein as initial, original, or first vaccine, or vaccination) includes one or more administrations (e.g., two administrations) of a SARS-CoV-2 antigen derived from the first identified SARS-CoV-2 strain. The initial series of vaccines may be an mRNA vaccine encoding an antigen having a spike protein, such as an antigen having the amino acid sequence of SEQ ID NO: 36, or a domain or subunit thereof. A subsequent booster or series of booster vaccines is then administered, for example, either immediately after the original vaccine or at a much later point in the vaccination protocol (eg, after neutralizing antibody titers have declined or after approval of a new vaccine strain).

[0082] In embodiments disclosed herein, an emerging SARS-CoV-2 variant strain is used to design an mRNA "boost" as a supplement to a previously administered SARS-CoV-2 vaccine, including a traditional boost, a seasonal boost, and a pandemic-shifted boost. A boost, as used herein, refers to any subsequent dose. A traditional boost is a second dose of an antigen administered to a subject after a period of time, such as 21-28 days, or even 2 weeks to 6 months. A traditional boost involves administering the same antigen corresponding to the same virus strain to a subject to generate a strong immune response against that virus strain and, optionally, other variant strains.

[0083] During a pandemic or epidemic, emerging viral strains may arise that are not effectively neutralized by vaccines designed against the original viral strain. In particular, emerging viral strains of SARS-CoV-2 are thought to arise through radial evolution; i.e., there are a variety of different mutations as opposed to linear evolution, where mutations accumulate with each other as the virus evolves. In such cases, a pandemic shift boost may be used to provide immune protection against the emerging viral strain. A pandemic shift boost is a subsequent vaccine administered to a subject after a full course of a first vaccine. A full course of a first vaccine may include one or more administrations of the first vaccine. A pandemic shift boost is comprised of a vaccine that includes an antigen derived from a mutant viral strain that emerged during a pandemic or epidemic of viral infection. A pandemic shift boost may be administered at any time after administration of the first vaccine. The first vaccine may be a vaccine against the originally detected viral strain, a combination of the original strain of the virus and a mutant(s) of that virus, or a vaccine against a mutant strain of the virus, so long as the pandemic shift boost includes a vaccine against a different viral mutant strain than the first vaccine.

[0084] Additionally, mutant strains of SARS-CoV-2 may emerge outside of pandemic or epidemic periods. These strains may emerge, for example, seasonally. Such mutant strains may be used to design seasonal SARS-CoV2 vaccines that are delivered as a seasonal boost. A seasonal boost is a subsequent dose administered to a subject after a full course of the first vaccine, which occurs when mutant strains arise outside of pandemic or epidemic periods. Traditional vaccine design uses a virus surveillance approach. However, traditional vaccines have slow development times, so antigen design decisions are often made far in advance and do not match the virus strains circulating at the time the vaccine is administered. During the development period, the virus may mutate or other strains may become prevalent, resulting in reduced efficacy of traditional vaccines. Traditional vaccines cannot be adapted because they are already produced, and new vaccines require additional time to design and manufacture. In contrast, the mRNA vaccines described herein may overcome these challenges. They can be manufactured in a matter of weeks, allowing them to be designed against coronaviruses circulating close to the date of vaccination. For example, seasonal or annual coronavirus vaccination programs may be developed that rapidly develop coronavirus vaccines depending on the virus strains circulating at the time of vaccination. That is, predictions of viruses close to a coronavirus season or other outbreak are believed to be more accurate than predictions from months before the season or outbreak begins, and therefore the mRNA vaccines described herein may be more effective because they are designed to target circulating viruses close to the time of the coronavirus season or vaccination planned. Thus, in exemplary embodiments, the vaccines of the present disclosure may be designed to combat seasonal coronavirus strains and, as such, are vaccines for use in the upcoming northern or southern hemisphere season. The vaccines are designed to combat viruses predicted to be circulating or spreading in the upcoming virus season based on an understanding of the coronaviruses circulating at a particular time.mRNA vaccines can be designed in a matter of days – a recent applicant went from design to manufacturing in just over five weeks – allowing data to be collected and analysed on what types and how often of the virus are circulating much closer to the start of vaccination programmes such as seasonal vaccination.

[0085] An important protein on the surface of coronaviruses, including SARS-CoV-2 and mutant strains described herein, is the spike (S) protein, such as the spike protein having the amino acid sequence of SEQ ID NO: 36. It has been found that there are specific regions in the spike protein that are associated with the ability of the virus to infect cells in vivo. Thus, in some embodiments, the vaccines used herein are mRNAs that encode spike protein domains, such as the receptor binding domain (RBD), the N-terminal domain (NTD), or a combination of the RBD and NTD. Both the RBD and NTD have been found to be associated with the ability of the vaccine to neutralize the virus. In some embodiments, the domain antigen, such as the RBD, comprises a 2P-stabilizing mutation. The vaccination protocols described herein also include various doses and dosages of mRNAs encoding domains, subunits, and full-length proteins from the original SARS-CoV-2 strain and / or the emerging mutant SARS-CoV-2 strains. In some embodiments, the antigens disclosed herein do not comprise a 2P-stabilizing spike protein.

[0086] In some embodiments, the vaccine comprises a nucleic acid encoding a spike protein antigen having at least one RBD mutation compared to a USA-WA1 / 2020 isolate reference strain. In some embodiments, the vaccine comprises a nucleic acid encoding a spike protein antigen comprising at least one RBD mutation selected from the group consisting of K417N, E484K, and N50Y compared to a USA-WA1 / 2020 isolate reference strain. In some embodiments, the vaccine comprises a nucleic acid encoding a spike protein antigen comprising two or all three RBD mutations selected from the group consisting of K417N, E484K, and N50Y compared to a USA-WA1 / 2020 isolate reference strain.

[0087] Diverse mRNA constructs have been designed and are disclosed herein. When mRNA encoding spike antigens is formulated into an appropriate delivery vehicle, domains and / or subunits of newly emerging mutant strains can induce a strong immune response against SARS-CoV-2, thus generating an effective and potent mRNA vaccine / booster that provides the requisite diversity to eliminate the original virus and subsequent strains. Intramuscular administration of mRNA encoding various antigens in LNPs results in delivery of the mRNA to immune tissues and cells of the immune system, where it is rapidly translated into protein antigens. Other immune cells, such as B cells and T cells, can then recognize and mount an immune response against the encoded protein, ultimately generating a long-term protective response against coronavirus. The drawbacks of protein vaccine development due to poor immunogenicity, insufficient presentation to the immune system or misfolding of antigens are circumvented by the use of highly effective mRNA vaccines encoding spike proteins, subunits and their domains as disclosed herein.

[0088] Due to the ever-evolving nature of viruses, scientists are continually monitoring the viral sequences and strains circulating in humans. These various circulating strains can be used as boost or individual vaccines as disclosed herein, or to further design multivalent mRNA vaccines. Viral surveillance can be used to provide annual or seasonal (or other planned) information to select the exact viral strains to use as the basis for the mRNA vaccine. Once the circulating strains have been identified, a vaccine composition can be developed based on those strains to target the two or three (or more) most representative viral types in circulation. This process of adding antigens from new strains to the vaccine may be repeated annually or at other intervals as necessary to maintain viral immunity in the population. The mRNA vaccines described herein, in some embodiments, encode multiple antigens from multiple circulating strains in a single lipid nanoparticle (LNP). In some embodiments, the mRNA vaccines include a combination of at least two antigens, each from a unique strain of coronavirus.

[0089] Thus, the present disclosure provides compositions (e.g., mRNA vaccines) that induce potent neutralizing antibodies against coronavirus antigens in subjects. Such compositions, in some embodiments, may be administered to seropositive or seronegative subjects. Seronegative subjects may be naive and may not have antibodies reactive to SARS-CoV-2. Seropositive subjects may have had a previous SARS-CoV-2 infection or may have previously received a dose of a vaccine (e.g., an mRNA vaccine) that induces antibodies against SARS-CoV-2 and thus may have pre-existing antibodies against SARS-CoV-2. In some embodiments, the composition comprises an mRNA encoding at least one (e.g., one, two, or more) coronavirus antigens, such as SARS-CoV-2 antigens from different SARS-CoV-2 mutant strains (also referred to herein as variants). In some embodiments, the mRNA vaccine comprises multiple mRNAs encoding SARS-CoV-2 antigens from different variants in a single lipid nanoparticle. In some embodiments, the mRNA vaccine comprises an mRNA encoding a SARS-CoV-2 antigen that includes one or more mutations from at least two different SARS-CoV-2 variants (e.g., encoding a combination of mutations and / or deletions found in the B.1.1.7 and 5021.V2 variants). Table 2 below provides examples of spike protein mutations in SARS-CoV-2 variants. [Table 1]

[0090] At least four groups of SARS-CoV-2 variants are currently of concern due to reports of increased prevalence, higher hACE2 binding affinity, or escape from mAbs and convalescent sera. One exemplary epidemic strain of coronavirus (UK) is N501Y-UK, or B.1.1.7 (alpha variant), which has the following mutations: ΔH69-ΔV70-ΔY144-N501Y-A570D-P681H-T716I-S982A-D1118H. This strain has been observed to spread rapidly through an area. N501Y increases binding affinity to hACE2, making it more amenable to viral uptake. ΔH69-ΔV70 has been shown to have reduced susceptibility to convalescent sera, and P681H is located immediately adjacent to the furin cleavage site.

[0091] Another strain (South Africa), N501Y-SA (B.1.351) (beta variant), carrying the K417N-E484K-N501Y mutations, has also shown rapid community spread and increased viral load in patients. E484K has been shown to reduce susceptibility to convalescent sera. Both N501Y and E484K are located in the receptor binding domain (RBD), and these mutations increase the RBD binding affinity for hACE2.

[0092] An additional strain, P.1(B1.1.248;20I / 501Y.V1) (gamma variant), has emerged in Japan from four travelers from Brazil. This variant contains 12 mutations in the spike protein, including N501U and E484K. Further mutations may affect its ability to be recognized by antibodies, and it is believed to be more infectious than the wild-type virus (USA-WA1 / 2020 isolate).

[0093] The B.1.429 (also known as CAL.20C or 542R.V1) strain (epsilon variant) was discovered at Cedars-Sinai Medical Center in Los Angeles. This variant contains five mutations: I4205V (ORF1a), D1183Y (ORF1b), and S13I, W152C, and L452R (spike protein) (Zhang et al., medRxiv pre-peer-review manuscript, January 20, 2021). The L452R mutation is located within the RBD and has been shown to be resistant to certain monoclonal antibodies against the spike protein.

[0094] An additional subclade of B.1.1.248 has emerged in the Brazilian state of Amazonas, raising concerns about reinfection in previously infected people. The two subclades of B.1.1.28 are designated P.2 (alias for B.1.1.28.2) and P.1 (alias for B.1.1.28.1). For clarity, the variant of concern (VOC) is the subclade designated P.1 (alias B.1.1.28.1) that has caused notable reinfections in previously infected and previously recovered women. Reinfections may be the result of limited or transient immunity induced by the initial infection, or may reflect the superior ability of the new strain to evade previous immune responses. This new strain contains 12 spike protein mutations, including three in the RBD (K417T, E484K, N501Y) and one new N-glycosylation site at T20N. The S protein mutations include 12 mutations: L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, and V1176F (see Naveca et al., SARS-CoV-2 reinfection by the new Variant of Concern (VOC) P.1 in Amazonas, Brazil, 2021). Reinfection caused moderate symptoms similar to the initial infection, but higher viral loads were recorded in nasopharyngeal and pharyngeal samples. Reinfection may be the result of the E484K mutation in the spike protein and the ability of the spike protein to promote evasion of SARS-CoV-2 neutralizing antibodies.

[0095] In Germany, a new variant was detected in 35 of the 73 new cases in Garmisch-Partenkirchen, which is currently being sequenced and has at least one point mutation in the spike protein.

[0096] Two related variants, both belonging to the B.1.617.1 subclade, have emerged in India. The genome of one B.1.617.1 variant, called v1 or B.1.617.1 v1 (kappa variant), encodes a spike protein with eight substitutions: T95I, G142D, E154K, L452R, E484Q, D614G, P681R, and Q1071H. The genome of the other B.1.617.1 variant, called v2 or B.1.617.1 v2, encodes a spike protein with eight substitutions: G142D, E154K, L452R, E484Q, D614G, P681R, Q1071H, and H1101D.

[0097] Another variant belonging to the B.1.617.2 subclade has also emerged in India. The genome of the B.1.617.2 (delta) variant encodes a spike protein with two deletions: F157del and R158del, as well as 10 substitutions: T19R, G142D, E156G, F157, R158, L452R, T478K, D614G, P681R, and D950N.

[0098] In Angola, a new variant called A.VOI.V2 with multiple spike protein mutations was detected through genomic surveillance. The genome of the A.VOI.V2 variant encodes a spike protein with 15 mutations, including 10 substitutions and 5 amino acid deletions: D80Y, ΔY144, ΔI210, D215G, ΔR246, ΔS247, ΔY248, L249M, W258L, R346K, T478R, E484K, H655Y, P681H, and Q957H.

[0099] We investigated a variant of interest (VOI), lambda (C.37), which was first documented in Peru and is the most frequently found in South America. It has a relatively high risk score, mainly due to a high number of deletions in the N-terminal domain (NTD), and the RSYLTPGD246-253N mutation may increase its ability to evade neutralizing antibodies.

[0100] Another variant of interest (VOI), mu (B.1621), was reported and first documented in Colombia and contains an insertion in the spike protein, 146N, and several amino acid substitutions (Y144T, Y145S, R346K, E484K, N501Y, and P681H).

[0101] Two further related variants, B.1.243 and B.1.243.1, have been found primarily in North America (Arizona). The B.1.243.1 variant has an additional spike protein mutation (V213G) as well as the E484K mutation, which may make it more resistant to neutralizing antibodies.

[0102] A variant of concern, Omicron (B.1.1.529), with multiple spike protein mutations, was first detected in Botswana. Mutations observed in this variant include those seen in the delta variant that are thought to increase transmissibility and mutations, and those seen in the beta and delta variants that are thought to promote immune escape. In particular, the Omicron variant genome encodes a spike protein with the following mutations: A67V, Δ69-70, T95I, G142D / Δ143-145, Δ211 / L212I, ins214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493K, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, and L981F.

[0103] These exemplary strains and other emerging strains (e.g., additional variants of concern) are candidates for the methods and formulations disclosed herein. The mRNAs encoding antigens of these and other coronavirus strains are designed for mRNA vaccines. In some embodiments, these variants include at least one amino acid substitution in the S1 or S2 domain of the coronavirus strain compared to the parent strain. In some embodiments, these variants include one or more amino acid deletions in the S1 or S2 domain of the coronavirus strain compared to the parent strain. As used herein, the parent strain is the reference virus strain. A variant strain has at least one structural difference (at least one amino acid is substituted, deleted, modified, or added) and at least one functional difference (in terms of type of function, degree of function, or strength) compared to the parent strain. The terms parent and variant do not imply that either existed prior to the other, but serve as a reference to structure / function. Functionality can mean, for example, increased transmissibility, increased morbidity, increased mortality, increased risk of "long COVID" (e.g., sequelae after the acute phase of SARS-CoV-2 infection), ability to avoid detection by diagnostic tests, reduced susceptibility to antiviral drugs, reduced susceptibility to neutralizing antibodies, ability to evade natural immunity, ability to infect vaccinated individuals, increased risk of certain conditions (e.g., multisystem inflammatory syndrome), and increased affinity for certain demographics or clinical groups (e.g., children, immunocompromised patients, etc.) compared to the original strain of the virus or other variants.

[0104] In some embodiments, the mRNA vaccines described herein may be administered as a prime or priming immunization (e.g., the first administration of a coronavirus vaccine to a subject). In some embodiments, the mRNA vaccines described herein may be administered as a booster, i.e., a dose administered after a prime or priming immunization described herein. In some embodiments, the booster and prime or priming immunizations comprise the same mRNA or multiple mRNAs. In other embodiments, the booster and prime or priming immunizations comprise different mRNA or multiple mRNAs. In other embodiments, multiple mRNA vaccines encoding different antigens (each directed against one strain or multiple strains) may be administered together or in parallel to provide a broad neutralization platform against multiple coronavirus strains.

[0105] SARS-Cov-2 The present disclosure provides compositions (e.g., mRNA vaccines) and vaccination methods that induce potent neutralizing antibodies against coronavirus antigens. The genome of SARS-CoV-2 is a single-stranded positive-stranded RNA (+ssRNA) with a size of 29.8-30 kb that encodes approximately 9860 amino acids (Chan et al. 2000, supra; Kim et al. 2020 Cell, May 14; 181(4):914-921.e10.). SARS-CoV-2 is a polycistronic mRNA with a 5' cap and a 3'-polyA tail. The SARS-CoV-2 genome is organized into specific genes that encode structural and nonstructural proteins (Nsps). The order of structural proteins in the genome is 5'-replicase (open reading frame (ORF)1 / ab)-structural proteins [spike (S)-envelope (E)-membrane (M)-nucleocapsid (N)]-3'. The genome of coronaviruses includes a variable number of open reading frames that code for accessory, nonstructural, and structural proteins (Song et al. 2019 Viruses; 11(1): p. 59). Most antigenic peptides are located in the structural proteins (Cui et al. 2019 Nat. Rev. Microbiol.; 17(3): 181-192). The spike surface glycoprotein (S), small envelope protein (E), matrix protein (M), and nucleocapsid protein (N) are the four major structural proteins. The S protein can be considered as one of the most important targets in coronavirus vaccine development among all other structural proteins, since it contributes to cell tropism and virus entry and can induce neutralizing antibodies (NAb) and protective immunity. Furthermore, amino acid sequence analysis has shown that the S protein contains conserved regions among coronaviruses, which may be the basis for universal vaccine development.

[0106] antigen The compositions, e.g., vaccine compositions, of the invention feature nucleic acids, in particular mRNAs, designed to code for an antigen of interest, e.g., an antigen derived from a betacoronavirus structural protein, in particular an antigen derived from the SARS-CoV-2 spike protein. The compositions, e.g., vaccine compositions, of the invention do not contain an antigen per se, but rather a nucleic acid, in particular an mRNA(s), that codes for an antigen or antigen sequence once delivered to a cell, tissue, or subject. Delivery of a nucleic acid, in particular an mRNA(s), is achieved by formulating said nucleic acid in a suitable carrier or delivery vehicle (e.g., lipid nanoparticles) such that upon administration to a cell, tissue, or subject, the nucleic acid is taken up by the cell, which then expresses the protein(s) encoded by the nucleic acid, e.g., the mRNA.

[0107] An antigen is a protein capable of inducing an immune response (e.g., causing the immune system to produce antibodies against the antigen). The vaccines of the present disclosure offer unique advantages over conventional protein-based vaccination approaches, e.g., recombinant protein production techniques, in which protein antigens are purified or produced in vitro. The vaccines of the present disclosure feature mRNA encoding a desired antigen, which when introduced into the body, i.e., administered in vivo to a mammalian subject (e.g., human), causes the body's cells to express the desired antigen. To facilitate delivery of the mRNA of the present disclosure to body cells, the mRNA is encapsulated in lipid nanoparticles (LNPs). Once delivered and taken up by the body's cells, the mRNA is translated in the cytosol and the protein antigen is produced by the host cell machinery. The protein antigen is presented, eliciting adaptive humoral and cellular immune responses. Because neutralizing antibodies are directed against the expressed protein antigen, protein antigens are considered target antigens relevant for vaccine development. As used herein, the term "antigen" encompasses immunogenic proteins and immunogenic fragments (immunogenic fragments that induce (or are capable of inducing) an immune response against (at least one) SARS-CoV-2 variant), unless otherwise specified. It is understood that the term "protein" encompasses peptides, and the term "antigen" encompasses antigenic fragments. While other molecules may be antigenic, such as bacterial polysaccharides or combinations of proteins and polysaccharide structures, for the viral vaccines included herein, viral proteins, fragments of viral proteins, and engineered and / or mutated proteins derived from SARS-CoV-2 are antigens provided herein.

[0108] Many proteins have a quaternary or three-dimensional structure consisting of multiple polypeptides or several polypeptide chains that associate into an oligomeric molecule. As used herein, the term "subunit" refers to a single protein molecule, e.g., a polypeptide or polypeptide chain resulting from processing of a nascent protein molecule, which assembles (or "coassembles") with other protein molecules (e.g., subunits or chains) to form a protein complex. A protein may have a relatively small number of subunits and thus be described as an "oligomer," or it may consist of many subunits and thus be described as a "multimer." The subunits of an oligomeric or multimeric protein may be identical, homologous, or completely different and dedicated to different tasks.

[0109] A protein or protein subunit may further comprise a domain. As used herein, the term "domain" refers to a distinct functional and / or structural unit within a protein. Typically, a "domain" is involved in a specific function or interaction and contributes to the overall role of the protein. Domains may exist in a variety of biological contexts. Similar domains (i.e., domains that share structural, functional and / or sequence homology) may exist within a single protein or may exist in separate proteins with similar or different functions. Protein domains are often conserved parts of a given protein's tertiary structure or sequence and may function and exist independently of the rest of the protein or its subunits.

[0110] In structural and molecular biology, identical, homologous, or similar subunits or domains can help classify newly identified or novel proteins, as was done shortly after the publication of the SARS-CoV-2 viral genome sequence.

[0111] As used herein, the term antigen is distinct from the term "epitope," which is a substructure of an antigen, e.g., a polypeptide or carbohydrate structure, such as 7-10 amino acids, that can be recognized by an antigen binding site but is insufficient to induce an immune response. Although the art describes protein antigens, e.g., isolated protein, polypeptide or peptide antigens, that are delivered to a subject or immune cells in isolated form, designing, testing, validating, and producing protein antigens can be costly and time-consuming, especially when producing proteins on a large scale. In contrast, mRNA technology is amenable to rapid design and testing of mRNA constructs encoding various antigens. Furthermore, rapid production of mRNA combined with formulation in an appropriate delivery vehicle (e.g., lipid nanoparticles) can proceed quickly and produce mRNA vaccines on a large scale quickly. Potential benefits also arise from the fact that the antigens encoded by the mRNA of the present invention are expressed by cells of the subject, e.g., expressed by the human body, and thus the subject, e.g., the human body, acts as a "factory" to produce the antigens that, in turn, induce the desired immune response.

[0112] The compositions provided herein may include one RNA or multiple RNAs encoding two or more antigens of the same or different viral strains. Also provided herein are combination vaccines that include RNAs encoding one or more coronavirus antigens and one or more antigen(s) of different organisms. Thus, the vaccines of the present disclosure may be combination vaccines that target one or more antigens of the same strain / species, or one or more antigens of different strains / species, such as organisms found in the same geographic area with high risk of coronavirus infection, or that induce immunity against organisms to which an individual is likely to be exposed when exposed to a coronavirus (e.g., COVID-19).

[0113] Encoded coronavirus spike (S) protein antigen The envelope spike (S) proteins of known betacoronaviruses determine the host tropism and entry of the virus into the host cell. Coronavirus spike (S) proteins are the antigens of choice for vaccine design because they can induce neutralizing antibodies and protective immunity. The S protein is important for SARS-CoV-2 infection. The composition of the S protein is similar among betacoronaviruses such as SARS-CoV-2, SARS-CoV, MERS-CoV, HKU1-CoV, MHV-CoV, and NL63-CoV.

[0114] As used herein, the term "spike protein" refers to a glycoprotein that forms a homotrimer that protrudes from the envelope (viral surface) of viruses, including betacoronaviruses. The trimerized spike protein promotes the entry of the virion into the host cell by binding to a receptor on the surface of the host cell and subsequently fusing the viral membrane with the host cell membrane. The S protein is a large, highly glycosylated type I transmembrane fusion protein composed of 1,160-1,400 amino acids depending on the virus type. The spike protein of betacoronaviruses contains approximately 1100-1500 amino acids.

[0115] The SARS-CoV-2 spike (S) protein is an antigen of choice for vaccine design because it can induce neutralizing antibodies and protective immunity. The mRNA of the present invention is designed to produce the SARS-CoV-2 spike protein (i.e., encode the spike protein such that the spike protein is expressed when the mRNA is delivered to a cell or tissue, e.g., a cell or tissue of a subject), as well as to produce antigenic variants thereof. Those skilled in the art will appreciate that while essentially full-length or complete spike protein may be necessary for a virus, e.g., a betacoronavirus, to perform its intended function of facilitating viral entry into host cells, a certain amount of variation in the structure and / or sequence of the spike protein may be tolerated when attempting to elicit an immune response primarily against the spike protein. For example, a slight truncation, e.g., of one to a few, perhaps up to 5 or up to 10 amino acids, from the N-terminus or C-terminus of the encoded spike protein, e.g., the encoded spike protein antigen, may be tolerated without altering the antigenic properties of the protein. Similarly, one to several, perhaps up to 5 or up to 10 amino acid (or more) variations (e.g., conservative substitutions) in the encoded spike protein, e.g., the encoded spike protein antigen, can be tolerated without altering the antigenic properties of the protein. In some embodiments, the spike protein is not a stabilized spike protein, e.g., the spike protein is stabilized by two proline substitutions (2P mutations).

[0116] In some embodiments, the spike protein is derived from different virus strains. A strain is a genetic variant of a microorganism (e.g., a virus). New virus strains can be created when two or more viruses infect the same cell in nature due to mutation or exchange of genetic components, such as antigenic drift or antigenic shift.

[0117] Antigenic drift is a type of genetic variation in viruses that occurs through the accumulation of mutations in the viral genes that code for the viral surface proteins that are recognized by host antibodies. This results in new strains of virus particles that are not effectively inhibited by the antibodies that prevented infection with previous strains. This makes it easier for the altered virus to spread throughout partially immune populations.

[0118] Antigenic shift is the process by which two or more different virus strains, or two or more different strains of a virus, combine to form a new subtype that has a mixture of surface antigens of two or more original strains. The term is often applied specifically to influenza, since influenza is the best-known example, but the process is known to occur with other viruses. Antigenic shift is a special case of reassortment or viral shift that results in a change in phenotype. Antigenic shift is contrasted with antigenic drift, which is the natural mutation over time of a known virus strain that can lead to loss of immunity or vaccine incompatibility. Antigenic shift is often associated with a major rearrangement of viral surface antigens, resulting in a significant reassortment and change in the phenotype of the virus.

[0119] A viral strain, as used herein, is a strain of a virus characterized by genetic variants of the virus or different isoforms of one or more surface proteins of the virus. For example, in the case of SARS-CoV-2, the different amino acid sequence of the SARS-CoV-2 spike protein makes an individual's immune response to the new strain less effective than the immune response to the strain used to immunize or initially infect the individual. New viral strains can arise from natural mutations resulting from an ongoing immune response in immunized or previously infected individuals, or a combination of natural mutations and immune selection. New viral strains may differ by one, two, three or more amino acid mutations in regions of the spike protein responsible for viral functions such as receptor binding or viral fusion with target cells. Spike proteins from new strains typically have greater than 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.3%, 99.5%, or 99.8% sequence identity at the amino acid level with the parent strain. The spike protein from the new strain may differ from the parent strain by as much as 80%, 85%, 90%, 95%, 98% or 99% identity at the amino acid level.

[0120] A natural virus strain is a variant of a particular virus that is recognizable because it has a "unique phenotypic characteristic" (such as a stable heritable biological, serological, and / or molecular characteristic) that is stable under natural conditions. Such a "unique phenotypic characteristic" can be a biological characteristic that is different from the reference virus to which it is compared, such as a unique antigenic characteristic, a host range (e.g., infects a different type of host), symptoms of disease caused by the strain, a different type of disease caused by this strain (e.g., transmitted by a different means), etc. A "unique phenotypic characteristic" can be detected clinically (e.g., clinical symptoms detected in a host infected with the strain) or can be detected within a comparative animal experiment where a skilled virologist can distinguish between animals infected with a reference control virus and animals infected with a novel strain, without knowing which animals were infected with which virus and without having information about the differences between the two viruses. Importantly, a virus variant is not a distinct strain when there is a simple difference in the genome sequence, but no distinct viral phenotype that can be recognized. The degree of variation in the genomic sequence is irrelevant to the classification of the variant as a strain, since small numbers of mutations can result in different phenotypes.

[0121] As an example, in some embodiments, the mRNA encodes an antigen from at least one virus strain variant or includes a mutation from at least one virus strain that is not wild-type SARS-CoV-2. In some embodiments, the vaccine includes an mRNA encoding a spike protein associated with the B.1.1.7 lineage (UK) variant (20B / 501Y.V1 VOC 202012 / 01). The B.1.1.7 lineage variant has a mutation at position 501 in the receptor binding domain (RBD) of the spike protein, where the amino acid asparagine (N) is replaced by tyrosine (Y); the N501Y mutation. Additionally, this variant has a 69 / 70 deletion, which occurs spontaneously multiple times and causes a conformational change in the spike protein, a P681H mutation near the S1 / S2 furin cleavage site, and an ORF8 stop codon (Q27 stop) caused by a mutation in ORF8. The 501.V2 (South Africa, SA) variant contains multiple mutations in the spike protein, including N501Y and E484K, but no deletions in 69 / 70. The E484K mutation is believed to be an "escape" mutation relative to at least one form of monoclonal antibody against SARS-CoV-2, so that it may alter the antigenicity of the virus. Other mutations discovered include the D614G mutation, which is believed to increase the infectivity of the virus, and the N543Y mutation (emerged from mink farms in the Netherlands and Denmark). In some embodiments, the spike protein contains mutations from more than one variant (e.g., a combination of mutations found in the B.1.1.7 and 502Y.V2 variants).

[0122] In exemplary embodiments, the spike protein, e.g., the encoded spike protein antigen, has an amino acid sequence set forth in any one of SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63. In other embodiments, the spike protein, e.g., the encoded spike protein antigen, has no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, or no more than 5 amino acid substitutions and / or deletions when compared to (aligned with) a spike protein having an amino acid sequence set forth in any one of SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63. Where minor changes are made in the encoded spike protein sequence, the variant preferably has the same activity and / or the same immunospecificity as the reference spike protein sequence, for example as determined by an immunoassay (e.g., an enzyme-linked immunosorbent assay (ELISA assay)).

[0123] The coronavirus S protein can be divided into two important functional subunits, the N-terminal S1 subunit that forms the globular head of the S protein, and the C-terminal S2 region that forms the protein stalk and is directly embedded in the viral envelope. Upon interaction with a potential host cell, the S1 subunit recognizes and binds to receptors on the host cell, particularly the angiotensin-converting enzyme 2 (ACE2) receptor, whereas the S2 subunit, the most conserved component of the S protein, is responsible for fusing the viral envelope with the host cell membrane. (See, for example, Shang et al., PLoS Pathog. 2020 Mar;16(3):e1008392.) Each monomer of the trimeric S protein trimer contains two subunits, S1 and S2, that mediate attachment and membrane fusion, respectively. As part of the in vivo infection process, the two subunits are separated from each other by an enzymatic cleavage process. The S protein is first cleaved in vivo by furin-mediated cleavage at the S1 / S2 site in infected cells, with a subsequent serine protease-mediated cleavage event occurring at the S2' site within S1. In SARS-CoV2, the S1 / S2 cleavage site is at amino acids 676-TQTNSPRRAR / SVA-688 (see SEQ ID NO: 35). The S2' cleavage site is at amino acids 811-KPSKR / SFI-818 (SEQ ID NO: 66).

[0124] As used herein, for example, in the context of designing a SARS-CoV-2 S protein antigen encoded by a nucleic acid, e.g., an mRNA, of the invention, the term "S1 subunit" (e.g., an S1 subunit antigen) refers to the N-terminal subunit of the spike protein beginning at the N-terminus of the S protein and ending at the S1 / S2 cleavage site, while the term "S2 subunit" (e.g., an S2 subunit antigen) refers to the C-terminal subunit of the spike protein beginning at the S1 / S2 cleavage site and ending at the C-terminus of the spike protein. As noted above, one of skill in the art will appreciate that while essentially full-length or complete spike protein S1 or S2 subunits are required for receptor binding or membrane fusion, respectively, a certain amount of variation in the structure and / or sequence of S1 or S2 is tolerated when one seeks to primarily elicit an immune response against the spike protein subunit. For example, minor truncations, e.g., one to a few, perhaps up to 4, 5, 6, 7, 8, 9 or 10 amino acids, from the N-terminus or C-terminus of an encoded subunit, e.g., the encoded S1 or S2 protein antigen, can be tolerated without altering the antigenic properties of the protein. Similarly, variations (e.g., conservative substitutions) of one to a few, perhaps up to 4, 5, 6, 7, 8, 9 or 10 amino acids (or more) of an encoded spike protein subunit, e.g., the encoded S1 or S2 protein antigen, can be tolerated without altering the antigenic properties of the protein(s). In exemplary embodiments, the spike protein, e.g., the encoded spike protein antigen, has an amino acid sequence set forth in any one of SEQ ID NOs: 20, 23, 26, 29 or 32.

[0125] The S1 and S2 subunits of the SARS-CoV-2 spike protein further comprise domains that are easily distinguishable by structure and function, which can then be characterized when designing antigens encoded by nucleic acid vaccines, particularly mRNA vaccines of the present invention. The domains in the S1 subunit include the N-terminal domain (NTD) and the receptor binding domain (RBD), which further comprises the receptor binding motif (RBM) in the S2 subunit, and the domains include the fusion peptide (FP), heptad repeat 1 (HR1), heptad repeat 2 (HR2), the transmembrane domain (TM), and the cytoplasmic domain, also known as the cytoplasmic tail (CT) (Lu R. et al., supra; Wan et al., J. Virol. Mar 2020,94(7)e00127-20). The HR1 and HR2 domains are sometimes referred to as the "fusion core region" of SARS-CoV-2 (Xia et al., 2020 Cell Mol Immunol. Jan;17(1):1-12.). The S1 subunit includes the N-terminal domain (NTD), the linker region, the receptor binding domain (RBD), the first subdomain (SD1), and the second subdomain (SD2). The S2 subunit includes, among others, the first heptad repeat (HR1), the second heptad repeat (HR2), the transmembrane domain (TM), and the cytoplasmic tail. The NTD and RBD of S1 are excellent antigens for the vaccine design approach of the present invention, as these domains have been shown to be targets of neutralizing antibodies in betacoronavirus-infected individuals. As used herein, for example, in the context of antigen design (such as the antigen encoded by the mRNA of the invention and expressed from an mRNA vaccine of the invention), the term "N-terminal domain" or "NTD" refers to a domain within the SARS-CoV-2 S1 subunit comprising approximately 290 amino acids in length that has identity to amino acids 1-290 of the S1 subunit of the spike protein having the amino acid sequence set forth as SEQ ID NO:36.As used herein, for example, in the context of antigen design (such as the antigens encoded by the mRNA of the invention and expressed from the mRNA vaccines of the invention), the term "receptor binding domain" or "RBD" refers to a domain within the S1 subunit of SARS-CoV-2 that comprises approximately 175-225 amino acids in length that has identity to amino acids 316-517 of the S1 subunit of the spike protein having the amino acid sequence shown as SEQ ID NO: 36. As used herein, the term "receptor binding motif" refers to the portion of the RBD that directly contacts the ACE2 receptor. The expressed RBD is predicted to specifically bind to angiotensin-converting enzyme 2 (ACE2) as its receptor and / or specifically react with RBD-binding and / or neutralizing antibodies, e.g., CR3022. In some embodiments, these antigens comprise stabilizing 2P mutations.

[0126] Compositions provided herein include mRNAs that can encode any one or more full-length or partial (sequence truncations or other deletions) S protein subunits (e.g., S1 or S2 subunits), one or more domains or combinations of domains of the S protein subunits (e.g., NTD, RBD, or NTD-RBD fusions, with or without SD1 and / or SD2), or chimeras of full-length or partial and S2 protein subunits. Other S protein subunits and / or domain configurations are contemplated herein.

[0127] In some embodiments, the mRNA vaccine encodes an antigen having at least one of the following mutations compared to the wild-type SARS-CoV-2 S protein (SEQ ID NO: 36): E484K, D614G, K417N, N501Y, L18F, D80A, D215G, R246I, A701V, A570D, P861H, T716I, S982A, D1118H. In some embodiments, the mRNA encodes an antigen having 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all 14 of the listed mutations. In some embodiments, the mRNA encodes an antigen having one or more deletions relative to the wild-type SARS-CoV-2 S protein sequence (SEQ ID NO: 36). Examples of deletions include, but are not limited to, positions 69, 70, 144, and 242-244. In some embodiments, the mRNA encodes an antigen having 1, 2, 3, 4, 5, or 6 deletions. In some embodiments, the mRNA encoding the antigen has 1, 2, 3, 4, 5, or 6 deletions and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 mutations, or any combination thereof.

[0128] In some embodiments, the mRNA vaccine comprises 1, 2, 3, 4, 5, or 6 mRNAs encoding different antigens, each antigen comprising at least one mutation and / or at least one deletion. In some embodiments, the mRNA vaccine further comprises an mRNA encoding a wild-type SARS-CoV-2 S protein antigen or an antigenic fragment thereof. In some embodiments, the mRNA vaccine is in a lipid nanoparticle (i.e., the lipid nanoparticle comprises 1, 2, 3, 4, 5, or 6 mRNAs encoding different antigens).

[0129] In some aspects, the compositions of the present disclosure include at least: a first mRNA encoding a first SARS-CoV-2 antigen of a first SARS-CoV-2 virus, and a second mRNA encoding a second SARS-CoV-2 antigen of a second SARS-CoV-2 virus. In some embodiments, the second SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation, deletion, or both an amino acid mutation and deletion relative to the amino acid sequence of the first SARS-CoV-2 antigen, wherein each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation. In some embodiments, the first SARS-CoV-2 virus is a first pandemic SARS-CoV-2 virus. In some embodiments, the second SARS-CoV-2 virus is a second pandemic SARS-CoV-2 virus. As used herein, "endemic virus" refers to a virus that is in circulation within a population for, for example, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, part of a year, a year, a year and a half, two years, three years or more. As used herein, "population" refers to a group of subjects. In some embodiments, a population is a global population. In some embodiments, a population is geographically limited (e.g., African population, European population) or regionally limited (e.g., Southern Hemisphere population).

[0130] In some embodiments, the composition further comprises a third mRNA encoding a third SARS-CoV-2 antigen of a third SARS-CoV-2 virus, where the third SARS-CoV-2 antigen has an amino acid sequence that has at least one amino acid mutation relative to the amino acid sequence of the first and / or second SARS-CoV-2 antigen.

[0131] In some embodiments, the composition further comprises a fourth mRNA encoding a fourth SARS-CoV-2 antigen of a fourth SARS-CoV-2 virus, where the fourth SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation relative to the amino acid sequence of the first, second and / or third SARS-CoV-2 antigen.

[0132] In some embodiments, the composition further comprises a fifth mRNA encoding a fifth SARS-CoV-2 antigen of a fifth SARS-CoV-2 virus, where the fifth SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation relative to the amino acid sequence of the first, second, third and / or fourth SARS-CoV-2 antigen.

[0133] In some embodiments, the composition further comprises a sixth mRNA encoding a sixth SARS-CoV-2 antigen of a sixth SARS-CoV-2 virus, where the sixth SARS-CoV-2 antigen has an amino acid sequence having at least one amino acid mutation relative to the amino acid sequence of the first, second, third, fourth and / or fifth SARS-CoV-2 antigen.

[0134] In some embodiments, the first and second antigens, and optionally the third, fourth, fifth and sixth antigens, are antigens that share at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with each other, respectively.

[0135] In some embodiments, the first antigen and the second antigen are antigens of a spike protein, hi some embodiments, the third, fourth, fifth, and / or sixth antigen are antigens of a spike protein.

[0136] In some embodiments, the mRNAs are present in equal amounts in the composition (e.g., 1:1 weight / weight ratio or 1:1 molar ratio), e.g., a ratio of mRNAs encoding different coronavirus antigens of 1:1 (:1:1:1:1). As used herein, "weight / weight ratio" or weight / weight ratio or weight:weight ratio refers to the ratio between the weights (masses) of the different components. "Molar ratio" refers to the ratio between the different components (e.g., the number of mRNAs encoding each antigen). In some embodiments, the ratio is 1:1, 1:2, 1:3, 1:4, 2:1, 3:1, or 4:1 (first mRNA:second mRNA). In each embodiment or aspect of the invention, it is understood that the featured vaccine includes an mRNA encapsulated within the LNP. While it is possible to encapsulate each unique mRNA into its own LNP, mRNA vaccine technology enjoys a significant technical advantage of being able to encapsulate multiple mRNAs in a single LNP product. In other embodiments, the vaccines are separate vaccines that are not co-formulated, but may be mixed separately prior to administration or may simply be administered separately.

[0137] The mutated SARS-CoV-2 antigens encoded by the second mRNA (and / or the third, fourth, fifth, or sixth mRNA) are, in some embodiments, associated with a viral function that differs in amount or type from the corresponding function in the first virus. Exemplary functions include, but are not limited to, ACE2 receptor binding, viral transmissibility, viral uptake, viral pathogenesis, altered furin cleavage, or viral replication. These functions are related to viral pathogenicity.

[0138] Exemplary sequences for coronavirus antigens and RNA encoding coronavirus antigens (e.g., SARS-CoV-2 mutant antigens) of the compositions of the disclosure are shown in Table 1. In some embodiments, the mRNA vaccine comprises a sequence having at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 18, 21, 24, 27, 30, 55, 58, 61, and 64. In some embodiments, the mRNA vaccine encodes a polypeptide that is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to a sequence selected from SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63.

[0139] In some embodiments, the second or subsequent SARS-CoV-2 virus is an immunodominant antigen derived from an emerging strain. The immunodominant antigen of the emerging strain is evaluated with respect to the strain from which the antigen is derived, compared to a different strain of the virus, such as the original strain or other variants. The immunodominant antigen of the emerging strain induces a stronger immune response against the emerging strain than against another strain.

[0140] In some embodiments, the second or subsequent epidemic SARS-CoV-2 virus is an immunodominant antigen derived from a variant of concern (VOC). The immunodominant antigen of the VOC is evaluated with respect to the strain from which the antigen is derived, as compared to a different strain of the virus, such as the original strain or other variants. In some embodiments, the VOC may exhibit, for example, increased transmissibility, increased morbidity, increased mortality, increased risk of "long COVID" (e.g., sequelae after the acute phase of SARS-CoV-2 infection), ability to avoid detection by diagnostic tests, reduced susceptibility to antiviral drugs, reduced susceptibility to neutralizing antibodies, ability to evade natural immunity, ability to infect vaccinated individuals, increased risk of certain conditions (e.g., multisystem inflammatory syndrome), and increased affinity for certain demographics or clinical groups (e.g., children, immunocompromised patients, etc.) as compared to the original strain of the virus or other variants.

[0141] nucleic acid The compositions of the present disclosure include (at least one) messenger RNA (mRNA) having an open reading frame (ORF) encoding a coronavirus antigen. In some embodiments, the mRNA further comprises a 5' UTR, a 3' UTR, a poly(A) tail, and / or a 5' cap analog.

[0142] It is also understood that the coronavirus vaccines of the present disclosure may include any 5' untranslated region (UTR) and / or any 3' UTR. Exemplary UTR sequences include SEQ ID NOs: 2, 4, 33, and 34; however, other UTR sequences may be used or substituted for any of the UTR sequences described herein. In some embodiments, the 5' UTR of the present disclosure comprises a sequence selected from SEQ ID NO: 33 (GGGAAAUA AGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC) and SEQ ID NO: 2 (GGGAAAUAAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC). In some embodiments, a 3'UTR of the disclosure comprises a sequence selected from SEQ ID NO: 34 (UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUU CUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC) and SEQ ID NO: 4 (UGAUAA UAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC). UTRs may also be omitted from the RNA polynucleotides provided herein.

[0143] Nucleic acids include polymers of nucleotides (nucleotide monomers). Nucleic acids are therefore also called polynucleotides. Nucleic acids may be or include, for example, deoxyribonucleic acids (DNA), ribonucleic acids (RNA), threose nucleic acids (TNA), glycol nucleic acids (GNA), peptide nucleic acids (PNA), locked nucleic acids (LNA, including, for example, LNA with a β-D-ribo configuration, α-LNA (a diastereomer of LNA) with an α-L-ribo configuration, 2′-amino-LNA with a 2′-amino functionalization, and 2′-amino-α-LNA with a 2′-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA), and / or chimeras and / or combinations thereof.

[0144] "Messenger RNA" (mRNA) is any RNA that encodes (at least one) protein (natural, non-natural, or modified polymer of amino acids) and can be translated in vitro, in vivo, in situ, or ex vivo to produce the encoded protein. Except as otherwise noted, the nucleic acid sequences set forth in this application may recite a "T" in a representative DNA sequence, but one of skill in the art will understand that when the sequence corresponds to an mRNA, the "T" is replaced with a "U". Thus, any DNA disclosed herein and identified by a particular sequence identification number also discloses the corresponding mRNA sequence complementary to that DNA, where each "T" in the DNA sequence is replaced with a "U". An open reading frame (ORF) is a continuous stretch of DNA or RNA that begins with a start codon (e.g., methionine (ATG or AUG)) and ends with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG, or UGA). ORFs typically encode proteins. The sequences disclosed herein may further include additional elements (e.g., 5' and 3' UTRs), although it will be understood that these elements, unlike ORFs, need not necessarily be present in the RNA polynucleotides of the present disclosure.

[0145] Mutant type (mutant strain) In some embodiments, the compositions of the present disclosure include RNA encoding a SARS-CoV-2 antigenic variant. An antigenic variant or other polypeptide variant refers to a molecule that differs in amino acid sequence from a wild-type, native, or reference sequence. An antigenic / polypeptide variant may have substitutions, deletions, and / or insertions at specific positions within the amino acid sequence compared to the native or reference sequence. Examples of SARS-CoV-2 antigenic variants are shown in Table 1. Typically, a variant has at least 50% identity to the wild-type, native, or reference sequence. In some embodiments, a variant shares at least 80% or at least 90% identity with the wild-type, native, or reference sequence.

[0146] A variant antigen / polypeptide encoded by a nucleic acid of the present disclosure may include amino acid changes that confer any of a number of desirable properties, for example, properties that enhance its immunogenicity, enhance its expression, and / or improve its stability or PK / PD properties in a subject. A variant antigen / polypeptide may be generated using conventional mutagenesis techniques and assayed accordingly to determine whether it has the desired properties. Assays for determining expression levels and immunogenicity are well known in the art, and examples of such assays are described in the Examples section. Similarly, the PK / PD properties of protein variants may be measured using art-recognized techniques (e.g., by assessing the expression of the antigen over time in a vaccinated subject and / or by confirming the durability of the induced immune response). The stability of the protein(s) encoded by the variant nucleic acid may be measured by analyzing the thermal stability or stability upon urea denaturation, or may be measured using in silico predictions. Methods for such experiments and in silico evaluations are known in the art.

[0147] In some embodiments, the composition comprises an RNA or RNA ORF comprising the nucleotide sequence of any one of the sequences provided herein, or a nucleotide sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence of any one of the sequences provided herein.

[0148] The term "identity" refers to a relationship between two or more polypeptide (e.g., antigen) or polynucleotide (nucleic acid) sequences, as determined by comparing the sequences. Identity also refers to the degree of sequence relatedness between sequences or between sequences, as determined by the number of matches between two or more strings of amino acid or nucleic acid residues. Identity measures the percentage of perfect matches between the smaller of two or more sequences with gap alignment (if any) as addressed by a particular mathematical model or computer program (e.g., "algorithm"). The identity of related antigens or nucleic acids can be easily calculated by known methods. "Percent identity (%)" as applied to a polypeptide or polynucleotide sequence is defined as the percentage of residues (amino acid or nucleic acid residues) in a candidate amino acid or nucleic acid sequence that are identical to the residues in the amino acid or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for such alignments are well known in the art. It is understood that identity depends on the calculation of percent identity, but the value may vary depending on the gaps and penalties introduced in the calculation. In general, variants of a particular polynucleotide or polypeptide (e.g., antigen) have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to a particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art. Tools for such alignment include those in the BLAST suite (Stephen F. Altschul, et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402).Another well-known local alignment technique is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) "Identification of common molecular subsequences." J. Mol. Biol. 147:195-197). A general global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J. Mol. Biol. 48:443-453). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed, which purposefully generates global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm.

[0149] Thus, polynucleotides encoding peptides or polypeptides that contain substitutions, insertions, and / or additions, deletions, and covalent modifications with respect to a reference sequence, particularly a polypeptide (e.g., antigen) sequence disclosed herein, are included within the scope of this disclosure. For example, sequence tags or amino acids (e.g., one or more lysines) may be added to the peptide sequence (e.g., at its N-terminus or C-terminus). Sequence tags may be used for detection, purification, or localization of the peptide. Lysines may be used to increase the solubility of the peptide or to allow biotinylation. Alternatively, amino acid residues located at the carboxy- and amino-terminal regions of the amino acid sequence of a peptide or protein may be optionally deleted to result in a truncated sequence. Certain amino acids (e.g., C-terminal or N-terminal residues) may alternatively be deleted depending on the use of the sequence (e.g., expression of the sequence as part of a larger sequence that is soluble or bound to a solid support). In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., fold-on regions), and the like may be replaced with alternative sequences that achieve the same or similar functions. In some embodiments, cavities in the protein core may be filled, for example by introducing larger amino acids, to improve stability. In other embodiments, buried hydrogen bond networks may be replaced with hydrophobic residues to improve stability. In yet other embodiments, glycosylation sites may be removed and replaced with appropriate residues. Such sequences are readily identifiable to those skilled in the art. It is also understood that some of the sequences provided herein include sequence tags or terminal peptide sequences (e.g., at the N- or C-terminus) that may be deleted, for example, prior to use in the preparation of an mRNA vaccine.

[0150] As will be appreciated by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered within the scope of coronavirus antigens of interest. For example, provided herein is any protein fragment (meaning a polypeptide sequence that is at least one amino acid residue shorter than the reference antigen sequence but otherwise identical) of a reference protein, provided that the fragment is immunogenic and confers a protective immune response against coronavirus. In addition to identical but truncated variants of the reference protein, in some embodiments, the antigen contains 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations as shown in any sequence provided or referenced herein. The length of the antigen / antigen polypeptide can range from about 4, 6, or 8 amino acids to the full-length protein.

[0151] Stabilizing Element Natural eukaryotic mRNA molecules may contain stabilizing elements, including, but not limited to, untranslated regions (UTRs) at their 5'-end (5'UTR) and / or 3'-end (3'UTR), in addition to other structural features, such as a 5'-cap structure or a 3'-poly(A) tail. Both 5'UTRs and 3'UTRs are typically transcribed from genomic DNA and are elements of the premature mRNA. Structural features characteristic of mature mRNAs, such as the 5'-cap and 3'-poly(A) tail, are usually added to the transcribed (premature) mRNA during mRNA processing.

[0152] In some embodiments, the composition comprises an RNA polynucleotide having an open reading frame encoding at least one antigenic polypeptide with at least one modification, at least one 5'-end cap, and formulated in a lipid nanoparticle. The 5'-cap of the polynucleotide may be completed simultaneously during an in vitro transcription reaction using the following chemical RNA cap analogs: 3'-O-Me-m7G(5')ppp(5')G [ARCA cap]; G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G to generate a 5'-guanosine cap structure according to the manufacturer's protocol (New England BioLabs, Ipswich, MA). The 5'-capping of the modified RNA may be completed post-transcriptionally using vaccinia virus capping enzyme to generate the "cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). The cap 1 structure may be generated using both vaccinia virus capping enzyme and a 2'-O methyltransferase to generate m7G(5')ppp(5')G-2'-O-methyl. The cap 2 structure may be generated from the cap 1 structure by 2'-O-methylating the third-to-last 5'-nucleotide with a 2'-O methyltransferase. The cap 3 structure may be generated from the cap 2 structure by 2'-O-methylating the fourth-to-last 5'-nucleotide with a 2'-O methyltransferase. The enzymes may be from recombinant sources.

[0153] A 3'-poly(A) tail is typically a stretch of adenine nucleotides added to the 3' end of a transcribed mRNA. In some cases, it may contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3'-poly(A) tail may be an essential element for the stability of an individual mRNA.

[0154] In some embodiments, the composition comprises a stabilizing element. The stabilizing element may comprise, for example, a histone stem loop. A 32 kDa protein, stem loop binding protein (SLBP), has been identified. It associates with histone stem loops at the 3' end of histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle, peaking during S phase, when histone mRNA levels also increase. This protein has been shown to be essential for efficient 3' end processing of histone pre-mRNAs by U7 snRNP. SLBP continues to associate with stem loops after processing, and then promotes translation of mature histone mRNAs into histone proteins in the cytoplasm. The RNA binding domain of SLBP is conserved throughout metazoans and protozoans, and binding to histone stem loops depends on the structure of the loop. The minimal binding site comprises at least three nucleotides 5' and two nucleotides 3' to the stem loop.

[0155] In some embodiments, the mRNA comprises a coding region, at least one histone stem loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal should generally enhance the expression level of the encoded protein. The encoded protein, in some embodiments, is not a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), or a marker or selection protein (e.g., alpha-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0156] In some embodiments, the mRNA comprises a combination of a poly(A) sequence or a polyadenylation signal and at least one histone stem loop, which in themselves represent alternative mechanisms, but which also act synergistically to increase protein expression above the levels observed with either of the individual elements. The synergistic effect of the combination of poly(A) and at least one histone stem loop is independent of the order of the elements, nor of the length of the poly(A) sequence.

[0157] In some embodiments, the mRNA does not contain a histone downstream element (HDE). A "histone downstream element (HDE)" comprises a purine-rich polynucleotide stretch of about 15-20 nucleotides 3' of a naturally occurring stem-loop, which corresponds to a binding site for U7 snRNA, which is involved in processing histone pre-mRNA to mature histone mRNA. In some embodiments, the nucleic acid does not contain an intron.

[0158] The mRNA may or may not contain enhancer and / or promoter sequences, which may be modified or unmodified, and may or may not be activated. In some embodiments, the histone stem loop generally originates from a histone gene and comprises two adjacent partially or fully reverse complementary sequences separated by a spacer of short sequences, which form the loop of the structure. The unpaired loop region typically cannot base pair with any of the stem loop elements. It is often present in RNA, as it is an important component of many RNA secondary structures, but may also be present in single-stranded DNA. The stability of the stem loop structure generally depends on the length, the number of mismatches or bulges, and the base composition of the paired region. In some embodiments, wobble base pairs (non-Watson-Crick base pairs) may occur. In some embodiments, at least one histone stem loop sequence comprises a length of 15-45 nucleotides.

[0159] In some embodiments, the mRNA has one or more AU-rich sequences removed. These sequences (sometimes referred to as AURES) are destabilizing sequences found in the 3'UTR. AURES may be removed from the RNA vaccine. Alternatively, AURES may remain in the RNA vaccine.

[0160] Signal peptide In some embodiments, the composition comprises an mRNA having an ORF encoding a signal peptide fused to a coronavirus antigen. Signal peptides, which typically comprise the N-terminal 15-60 amino acids of a protein, are required for translocation across membranes along the secretory pathway and thus universally control entry of most proteins into the secretory pathway in both eukaryotes and prokaryotes. In eukaryotes, the signal peptide of a nascent precursor protein (preprotein) directs ribosomes to the rough endoplasmic reticulum (ER) membrane to initiate transmembrane transport of the growing peptide chain for processing. ER processing produces a mature protein, and the signal peptide is typically cleaved from the precursor protein by ER-resident signal peptidases of the host cell or is retained uncleaved to function as a membrane anchor. Signal peptides can also facilitate targeting of proteins to the cell membrane.

[0161] The length of the signal peptide can be 15 to 60 amino acids. For example, the length of the signal peptide can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids. In some embodiments, the length of the signal peptide is 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50 , 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15-20 amino acids in length.

[0162] Signal peptides from heterologous genes (which in effect regulate the expression of genes other than coronavirus antigens) are known in the art and may be tested for desired properties and then incorporated into the nucleic acids of the present disclosure.

[0163] Fusion proteins In some embodiments, the compositions of the present disclosure include an mRNA encoding an antigenic fusion protein. Thus, the encoded antigen(s) may include two or more proteins (e.g., proteins and / or protein fragments) linked together with or without a linker. Alternatively, the protein to which the protein antigen is fused promotes a strong immune response against the coronavirus antigen, rather than promoting a strong immune response against itself. The antigen fusion protein, in some embodiments, retains functional properties from each of the original proteins.

[0164] In some embodiments, the fusion protein comprises a receptor binding domain (RBD) from the SARS-CoV-2 spike protein.

[0165] In some embodiments, the fusion protein comprises the N-terminal domain (NTD) from the SARS-CoV-2 spike protein.

[0166] In some embodiments, the fusion protein comprises a transmembrane domain. The transmembrane domain may, in some embodiments, be derived from a virus that is not SARS-CoV-2. For example, the transmembrane domain may be derived from the influenza hemagglutinin transmembrane domain, which has been demonstrated to effectively anchor proteins to the cell surface.

[0167] Scaffolding The mRNA vaccines provided herein, in some embodiments, encode fusion proteins that include coronavirus antigens linked to each other or to a scaffold domain. In some embodiments, such scaffold moieties confer desired properties to the antigens encoded by the nucleic acids of the present disclosure. For example, scaffold proteins can improve the immunogenicity of an antigen, for example, by altering the structure of the antigen, altering the uptake and processing of the antigen, and / or binding the antigen to a binding partner.

[0168] In some embodiments, the scaffold moiety is a protein that can self-assemble into highly symmetric, stable, structurally organized protein nanoparticles with diameters between 10 and 150 nm, a size range highly suitable for optimal interaction with various cells of the immune system. In some embodiments, viral proteins or virus-like particles can be used to form stable nanoparticle structures. Examples of such viral proteins are known in the art. For example, in some embodiments, the scaffold moiety is Hepatitis B surface antigen (HBsAg). HBsAg forms spherical particles with an average diameter of about 22 nm, which are non-infectious because they do not contain nucleic acid (Lopez-Sagaseta, J. et al. Computational and Structural Biotechnology Journal 14 (2016) 58-68). In some embodiments, the scaffold moiety is Hepatitis B core antigen (HBcAg), which self-assembles into particles with diameters between 24 and 31 nm, resembling viral cores obtained from HBV-infected human livers. The generated HBcAg self-assembles into nanoparticles of two different sizes, 300 Å and 360 Å in diameter, corresponding to 180 or 240 protomers. In some embodiments, coronavirus antigens are fused to HBsAG or HBcAG to promote self-assembly of nanoparticles displaying coronavirus antigens.

[0169] In some embodiments, bacterial protein platforms may be used. Non-limiting examples of these self-assembling proteins include ferritin, lumazine, and encapsulin.

[0170] Ferritin is a protein whose main function is the storage of iron in cells. It is composed of twenty-four (24) subunits, each of which consists of four alpha-helical bundles that self-assemble into a quaternary structure with octahedral symmetry (Cho KJ et al. J Mol Biol. 2009; 390: 83-98). Several high-resolution structures of ferritin have been determined, confirming that Helicobacter pylori ferritin is composed of 24 identical protomers, whereas in animals, ferritin light and heavy chains exist that can assemble alone or combine in different ratios to form particles of 24 subunits (Granier T. et al. J Biol Inorg Chem. 2003; 8: 105-111; Lawson DM et al. Nature. 1991; 349: 541-544). Ferritin self-assembles into nanoparticles with robust thermal and chemical stability, and therefore, ferritin nanoparticles are well suited for carrying and exposing antigens.

[0171] Lumazine synthase (LS) is also well suited as a nanoparticle platform for antigen display. LS is an enzyme present in a wide variety of organisms, including archaea, bacteria, fungi, plants, and eubacteria, responsible for the penultimate catalytic step in the biosynthesis of riboflavin (Weber SE Flavins and Flavoproteins. Methods and Protocols, Series: Methods in Molecular Biology. 2014). LS monomers are 150 amino acids long and consist of a beta sheet of adjacent tandem alpha helices. A large number of different quaternary structures have been reported for LS, showing its morphological diversity (from homopentamers to symmetric assemblies of 12 pentamers forming a capsid with a diameter of 150 Å). Even LS cages of more than 100 subunits have been described (Zhang X. et al. J Mol Biol. 2006; 362: 753-770).

[0172] Encapsulin, a novel protein cage nanoparticle isolated from the thermophilic bacterium Thermotoga maritima, can also be used as a platform for presenting antigens on the surface of self-assembled nanoparticles. Encapsulin is assembled from 60 copies of identical 31 kDa monomers with a thin icosahedral T=1 symmetric cage structure (with inner and outer diameters of 20 nm and 24 nm, respectively) (Sutter M.et al.Nat Struct Mol Biol.2008,15:939-947). The exact function of encapsulin in T. maritima is not yet clearly understood, but its crystal structure was recently solved and its function was hypothesized as an intracellular compartment that encapsulates proteins such as DyP (dye-decolorizing peroxidase) and Flp (ferritin-like protein), which are involved in oxidative stress response (Rahmanpour R.et al.FEBS J.2013;280:2097-2104).

[0173] In some embodiments, the RNA of the present disclosure encodes a coronavirus antigen fused to a foldon domain. The foldon domain may be obtained, for example, from bacteriophage T4 fibritin (see, for example, Tao Y, et al. Structure. 1997 Jun 15; 5(6): 789-98).

[0174] Linkers and cleavable peptides In some embodiments, the mRNA of the present disclosure encodes two or more polypeptides, referred to herein as a fusion protein. In some embodiments, the mRNA further encodes a linker located between at least one or each domain of the fusion protein. The linker may be, for example, a cleavable linker or a protease-sensitive linker. In some embodiments, the linker is selected from the group consisting of F2A linker, P2A linker, T2A linker, E2A linker, and combinations thereof. This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see, for example, Kim, JH et al. (2011) PLoS ONE 6:e18556). In some embodiments, the linker is an F2A linker. In some embodiments, the linker is a GGGS linker (SEQ ID NO: 67). In some embodiments, the fusion protein comprises three domains with an intervening linker, and has the structure domain-linker-domain-linker-domain.

[0175] Any cleavable linker known in the art may be used in the context of the present disclosure. Examples of such linkers include F2A linker, T2A linker, P2A linker, E2A linker (see, for example, WO2017127750). Those skilled in the art will understand that other art-recognized linkers may be suitable for use in the constructs of the present disclosure (e.g., encoded by the nucleic acids of the present disclosure). Those skilled in the art will also understand that other polycistronic constructs (mRNAs that separately encode multiple antigens / polypeptides within the same molecule) may be suitable for use as provided herein.

[0176] Array Optimization In some embodiments, the ORFs encoding the antigens of the present disclosure are codon-optimized. Methods of codon optimization are known in the art. For example, any one or more ORFs of the sequences provided herein may be codon-optimized. In some embodiments, codon optimization may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structure; minimize tandem repeat codons or runs of bases that may impair gene organization or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post-translational modification sites (e.g., glycosylation sites) in the encoded protein; add, remove, or shuffle protein domains; insert or delete restriction enzyme recognition sites; modify ribosome binding sites and mRNA degradation sites; adjust translation rate to allow various domains of a protein to fold properly; or reduce or remove problematic secondary structures in a polynucleotide. Codon optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA), and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using an optimization algorithm.

[0177] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity to a native or wild-type sequence ORF (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity to a naturally occurring or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity to a native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity to a native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity to a native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen).

[0178] In some embodiments, the codon-optimized sequence shares 65%-85% (e.g., about 67%-85% or about 67%-80%) sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen). In some embodiments, the codon-optimized sequence shares 65%-75% or about 80% sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a coronavirus antigen).

[0179] In some embodiments, the codon-optimized sequence encodes an antigen that is the same as or more immunogenic than a coronavirus antigen encoded by a non-codon-optimized sequence (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% or more).

[0180] The modified mRNA, when transfected into a mammalian host cell, has a stability of 12 to 18 hours, or more than 18 hours, for example, 24, 36, 48, 60, 72 hours, or more than 72 hours, and is capable of being expressed by the mammalian host cell.

[0181] In some embodiments, a codon-optimized RNA may be an RNA with an enhanced level of G / C. The G / C content of a nucleic acid molecule (e.g., an mRNA) may affect the stability of the RNA. An RNA with an increased amount of guanine (G) and / or cytosine (C) residues may be more functionally stable than an RNA with a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition comprising an mRNA stabilized by sequence modification in the translation region. Due to the degeneracy of the genetic code, this modification is made by replacing existing codons with codons that further increase the stability of the RNA without changing the resulting amino acid. This approach is limited to the coding region of the RNA.

[0182] Unmodified nucleotides In some embodiments, the mRNA is not chemically modified and comprises standard ribonucleotides consisting of adenosine, guanosine, cytosine, and uridine. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues, e.g., residues present in transcribed RNA (e.g., A, G, C, or U). In some embodiments, the nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides, e.g., deoxyribonucleosides present in DNA (e.g., dA, dG, dC, or dT).

[0183] chemical modification The compositions of the present disclosure, in some embodiments, include RNA having an open reading frame encoding a coronavirus antigen, the nucleic acid comprising nucleotides and / or nucleosides that may be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides may be naturally occurring modified nucleotides and nucleosides or non-naturally occurring nucleotides and nucleosides. Such modifications may include art-recognized modifications at the sugar, backbone, or nucleobase moieties of the nucleotides and / or nucleosides.

[0184] In some embodiments, the naturally occurring modified nucleotides or nucleotides of the present disclosure are those that are generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.

[0185] In some embodiments, the non-natural modified nucleotides or nucleosides of the present disclosure are those that are generally known or recognized in the art. Non-limiting examples of such non-natural modified nucleotides and nucleosides can be found, inter alia, in published U.S. patent applications PCT / US2012 / 058519, PCT / US2013 / 075177, PCT / US2014 / 058897, PCT / US2014 / 058891, PCT / US2014 / 070413, PCT / US2015 / 36773, PCT / US2015 / 36759, PCT / US2015 / 36771, or PCT / IB2017 / 051367, all of which are incorporated herein by reference.

[0186] Thus, the nucleic acids of the present disclosure (e.g., DNA nucleic acids and RNA nucleic acids, e.g., mRNA nucleic acids) can include standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

[0187] Nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids such as mRNA nucleic acids) in some embodiments comprise a variety (two or more) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid comprises one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0188] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into a cell or organism exhibit reduced degradation in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0189] In some embodiments, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into a cell or organism may be less immunogenic (e.g., elicit a reduced natural response) in the cell or organism, respectively, compared to unmodified nucleic acids comprising standard nucleotides and nucleosides.

[0190] In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) contain non-naturally occurring modified nucleotides that are introduced during or after the synthesis of the nucleic acid to achieve a desired function or property. Modifications can be in the internucleotide bond, the purine or pyrimidine base, or the sugar. Modifications can be introduced by chemical synthesis or can be introduced at the end of the chain or anywhere in the chain using a polymerase enzyme. Any region of the nucleic acid can be chemically modified.

[0191] The present disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids such as mRNA nucleic acids). A "nucleoside" refers to a compound that includes a sugar molecule (e.g., pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized in any useful manner, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. A nucleic acid can include a region or regions of linked nucleosides. Such regions can have a variety of backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acid would include a region of nucleotides.

[0192] Base pairing of modified nucleotides encompasses not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides containing non-standard or modified bases and / or modified nucleotides, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between a non-standard base and a standard base, or between two complementary non-standard base structures, such as in the case of nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker can be incorporated into the polynucleotides of the present disclosure.

[0193] In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) include 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in a nucleic acid (e.g., an RNA nucleic acid such as an mRNA nucleic acid) include 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, a polyribonucleotide includes a combination of at least two (e.g., two, three, four, or more) of any of the foregoing modified nucleobases (including but not limited to chemical modifications).

[0194] In some embodiments, an mRNA of the disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0195] In some embodiments, an mRNA of the disclosure comprises 1-methylpseudouridine (m1ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0196] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions in the nucleic acid.

[0197] In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all of the uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all of the cytidine positions of the nucleic acid.

[0198] In some embodiments, an mRNA of the disclosure includes a uridine at one or more or all uridine positions of the nucleic acid.

[0199] In some embodiments, the mRNA is uniformly modified for a particular modification (e.g., completely modified, modified throughout the entire sequence). For example, the nucleic acid can be uniformly modified with 1-methyl-pseudouridine, i.e., all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, the nucleic acid can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue such as those described above.

[0200] The nucleic acids of the present disclosure may be partially or completely modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified within the nucleic acid of the present disclosure, or within a given sequence region thereof (e.g., within an mRNA, including or excluding a poly(A) tail). In some embodiments, all nucleotides X in the nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, where X may be any one of the nucleotides A, G, U, C, or any one of the following combinations: A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0201] Nucleic acids may contain from about 1% to about 100% modified nucleotides (either with respect to overall nucleotide content or with respect to one or more types of nucleotides (i.e., one or more of A, G, U, or C)), or any range of percentages (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-9 ...5%, 10%-20%, 10%-20%, 10%-20%, 10%-20%, 10%-20%, 10%-20%, 10%-20%, 10%-20%, 10 % to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentages are dependent upon the presence of unmodified A, G, U, or C.

[0202] The mRNA can contain as little as 1% to as much as 100% modified nucleotides, or any range of percentages (e.g., at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acid can contain modified pyrimidines such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in the nucleic acid are modified uracils (e.g., 5-substituted uracils). Replaced. Modified uracils may be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a nucleic acid are replaced with modified cytosines (e.g., 5-substituted cytosines). Modified cytosines may be replaced with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0203] Untranslated Regions (UTRs) The mRNA of the present disclosure may include one or more regions or portions that act or function as untranslated regions. If the mRNA is designed to encode at least one antigen of interest, the nucleic acid may include one or more of these untranslated regions (UTRs). The wild-type untranslated region of a nucleic acid is transcribed but not translated. In an mRNA, the 5'UTR begins at the transcription start point and continues to the start codon but does not include the start codon. On the other hand, the 3'UTR begins immediately after the stop codon and continues to the transcription termination signal. There is a growing body of evidence about the regulatory role that UTRs play in the stability and translation of nucleic acid molecules. The regulatory function of UTRs can be incorporated into the polynucleotides of the present disclosure, especially to increase the stability of the molecule. Specific functions may also be incorporated to ensure the control of the downregulation of the transcript in case the transcript is misdirected to an undesired organ site. A variety of 5'UTR and 3'UTR sequences are known and available in the art.

[0204] 5'UTR is the region of an mRNA immediately upstream (5') from the start codon (the first codon of an mRNA transcript that is translated by ribosomes). 5'UTRs do not code for proteins (they are non-coding). Natural 5'UTRs have a function that plays a role in translation initiation. They bear a signature such as the Kozak sequence, which is generally known to be involved in the process by which the ribosome initiates the translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG (SEQ ID NO:37), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another "G". 5'UTRs are also known to form secondary structures involved in the binding of elongation factors.

[0205] In some embodiments of the present disclosure, the 5'UTR is a heterologous UTR, i.e., a UTR found in nature associated with a different ORF. In another embodiment, the 5'UTR is a synthetic UTR, i.e., does not exist in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties (e.g., increase gene expression) and completely synthetic UTRs. Exemplary 5'UTRs include a-globin or b-globin from Xenopus or human (U.S. Pat. Nos. 8,278,063 and 9,012,219), human cytochrome b-245 a polypeptide, and hydroxysteroid (17b) dehydrogenase, and tobacco etch virus (U.S. Pat. Nos. 8,278,063 and 9,012,219). The CMV immediate early 1 (IE1) gene (US Patent No. 20140206753, WO2013 / 185069), sequence GGGAUCCUACC (SEQ ID NO: 38) (WO2014144196) may also be used. In another embodiment, the 5'UTR of the TOP gene is a 5'UTR of the TOP gene lacking a 5'TOP motif (oligopyrimidine tract) (e.g., WO / 2015101414, WO / 2015101415, WO / 2015 / 062738, WO2015024667, WO2015024667; a 5'UTR element from the ribosomal protein large 32 (L32) gene (WO / 2015101414, WO2015024667, WO2015024667). 5'UTR elements derived from the 5'UTR of the hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4) (WO2015024667), or the 5'UTR element derived from the 5'UTR of ATP5A1 (WO2015024667) may be used. In some embodiments, an internal ribosome entry site (IRES) is used in place of the 5'UTR.

[0206] In some embodiments, the 5'UTR of the disclosure comprises a sequence selected from SEQ ID NO:2 and SEQ ID NO:33.

[0207] The 3'UTR is the region of an mRNA immediately downstream (3') of the stop codon (the codon of the mRNA transcript that signals the end of translation). The 3'UTR does not code for a protein (it is non-coding). Native or wild-type 3'UTRs are known to have stretches of adenosines and uridines embedded in them. These AU-rich signatures are particularly prevalent in genes with high turnover. Based on sequence characteristics and functional properties, AU-rich elements (AREs) can be divided into three classes (Chen et al, 1995), where class I AREs contain several dispersed copies of the AUUUA motif within the U-rich region. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules that contain this type of ARE include GM-CSF and TNF-a. Class III AREs are less well defined. These U-rich regions do not contain AUUUA motifs. c-Jun and Myogenin are two well-studied examples of this class. Most proteins that bind to AREs are known to destabilize messengers, but members of the ELAV family, particularly HuR, have been demonstrated to increase mRNA stability. HuR binds to all three classes of AREs. Incorporation of a HuR-specific binding site into the 3'UTR of a nucleic acid molecule results in HuR binding, which stabilizes the message in vivo.

[0208] The introduction, removal, or modification of 3'UTR AU-rich elements (AREs) may be used to modulate the stability of the nucleic acids (e.g., RNA) of the present disclosure. When engineering a particular nucleic acid, one or more copies of AREs may be introduced to reduce the stability of the nucleic acid of the present disclosure, thereby suppressing translation and reducing the production of the resulting protein. Similarly, AREs may be identified and removed or mutated to increase stability in cells, increasing the translation and production of the resulting protein. Transfection experiments may be performed in relevant cell lines using the nucleic acids of the present disclosure, and protein production may be assayed at various times after transfection. For example, cells may be transfected with various ARE engineered molecules and transfected with the relevant protein using an ELISA kit, and the proteins produced may be assayed 6 hours, 12 hours, 24 hours, 48 ​​hours, and 7 days after transfection.

[0209] One of skill in the art will appreciate that heterologous or synthetic 5'UTRs may be used with any desired 3'UTR sequence. For example, a heterologous 5'UTR may be used with a synthetic 3'UTR and a heterologous 3"UTR.

[0210] Non-UTR sequences may also be used as regions or subregions within a nucleic acid. For example, introns or portions of intron sequences may be incorporated into the nucleic acids of the present disclosure. Incorporation of intron sequences can increase protein production and expression levels of the nucleic acid.

[0211] A combination of features may be included in the flanking regions, among other features. For example, an ORF may be flanked by a 5'UTR that may include a strong Kozak translation initiation signal and / or a 3'UTR that may include an oligo(dT) sequence for templated addition of a polyA tail. The 5'UTR may include a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes (e.g., the 5'UTRs described in U.S. Patent Application Publication No. 20100293625 and PCT / US2014 / 069155, which are incorporated by reference in their entireties).

[0212] It is understood that any UTR from any gene may be incorporated into the region of the nucleic acid. Additionally, multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs that are not mutants of the wild-type region. The UTRs or portions thereof may be placed in the same orientation as the transcript from which they are selected, or may be altered in orientation or position. Thus, the 5' and / or 3' UTRs may be inverted, shortened, extended, or combined with one or more other 5' or 3' UTRs. As used herein, the term "altered" with respect to a UTR sequence means that this UTR has been altered in some way relative to a reference sequence. For example, the 3' or 5' UTR may be altered relative to the wild-type or native UTR by a change in orientation or position as taught above, or by the inclusion of additional nucleotides, deletion of nucleotides, exchange or transposition of nucleotides. Any of these alterations that produce an "altered" UTR (either 3' or 5') include mutant UTRs.

[0213] In some embodiments, double, triple or quadruple UTRs, such as 5'UTR or 3'UTR, can be used.As used herein, a "double" UTR is one in which two copies of the same UTR are encoded consecutively or substantially consecutively.For example, double beta globin 3'UTR can be used as described in US Patent Publication No. 20100129877, the entire contents of which are incorporated herein by reference.

[0214] It is also within the scope of the present disclosure to have patterned UTRs.As used herein, "patterned UTRs" are UTRs that reflect a repeating or alternating pattern, such as ABABAB, AABBABBAABB, or ABCABCABC, or variations thereof that are repeated 1, 2, or more than 3 times.In these patterns, each letter A, B, or C represents a UTR that is different at the nucleotide level.

[0215] In some embodiments, the flanking region is selected from a family of transcripts whose proteins share a common function, structure, feature, or characteristic. For example, a polypeptide of interest may belong to a family of proteins expressed in a particular cell, tissue, or at a certain time during development. UTRs from any of these genes may be exchanged with any other UTRs from the same or different protein families to create new nucleic acids. As used herein, "family of proteins" is used in the broadest sense to refer to a group of two or more polypeptides of interest that share at least one function, structure, feature, localization, origin, or expression pattern.

[0216] The untranslated region may also include a translational enhancer element (TEE), including, by way of non-limiting example, a TEE described in U.S. Patent Application Publication No. 20090226470, which is incorporated by reference in its entirety, and TEEs known in the art.

[0217] Non-coding sequences Aspects of the present disclosure relate to multivalent RNA compositions comprising mRNAs, e.g., 2-15 mRNA polynucleotides each comprising a distinct open reading frame (ORF) encoding a coronavirus antigen polypeptide, where each mRNA polynucleotide comprises one or more non-coding sequences in a untranslated region (UTR) having a unique identifier sequence (non-coding sequence). In some embodiments, the non-coding sequence is a unique non-coding sequence. In some embodiments, each mRNA in a multivalent vaccine composition comprises its own unique non-coding sequence. As used herein, "non-coding sequence" refers to a sequence of a biomolecule (e.g., a nucleic acid, a protein, etc.) that functions to identify another biomolecule when that other biomolecule is combined with that sequence. Typically, a non-coding sequence is a heterologous sequence that is incorporated within or added to the sequence of a target biomolecule and utilized as a reference to identify a target molecule of interest. In some embodiments, a non-coding sequence is a sequence of a nucleic acid (e.g., a heterologous nucleic acid or a synthetic nucleic acid) that is incorporated within or added to the target nucleic acid and utilized as a reference to identify the target nucleic acid. In some embodiments, the non-coding sequence is a sequence of formula (N)n. In some embodiments, n is an integer ranging from 5 to 20, 5 to 10, 10 to 20, 7 to 20, or 7 to 30. In some embodiments, n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more. In some embodiments, each N is a nucleotide independently selected from A, G, T, U, and C or analogs thereof. Thus, some embodiments include (i) a nucleic acid (e.g., an mRNA) having a target sequence of interest (e.g., a coding sequence (e.g., encoding an antigenic protein or polypeptide)); and (ii) a unique non-coding sequence.

[0218] In some embodiments, one or more in vitro transcribed mRNAs comprise one or more non-coding sequences in an untranslated region (UTR), such as the 5'UTR or 3'UTR. Inclusion of a non-coding sequence in a UTR of an mRNA prevents the non-coding sequence from being translated into a peptide. In some embodiments, the non-coding sequence is located in the 3'UTR of the mRNA. In some embodiments, the non-coding sequence is located upstream of the polyA tail of the mRNA. In some embodiments, the non-coding sequence is located downstream (e.g., after) the polyA tail of the mRNA. In some embodiments, the non-coding sequence is located between the last codon of the ORF of the mRNA and the first "A" of the polyA tail of the mRNA. In some embodiments, the polynucleotide non-coding sequence located in the UTR comprises 1-10 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides).

[0219] In some embodiments, the UTR comprising the polynucleotide non-coding sequence further comprises one or more (e.g., 1, 2, 3, or more) RNAse cleavage sites, such as RNase H cleavage sites. In some embodiments, each different RNA of the multivalent RNA composition comprises a different (e.g., unique) non-coding sequence. In some embodiments, the RNA of the multivalent RNA composition is detected and / or purified according to the polynucleotide non-coding sequence of the RNA. In some embodiments, the mRNA non-coding sequence is used to identify the presence of the mRNA or to determine the relative ratio of different mRNAs in a sample (e.g., a reaction product or a pharmaceutical product). In some embodiments, the mRNA non-coding sequence is detected using one or more of deep sequencing, PCR, and Sanger sequencing. Examples of non-coding sequences include: AACUGAU;AAACAUCG;ATGCCUAA;AGUGGUCA;ACCACUGU;ACAUUGGC;CAGAUCUG;CAUCAAGU;CGCUGAUC;ACAAGCUA;CUGUAGCC;AGUACAAG;AACAACCA;AACCGAGA;AACGCUUA;AAGACGGA;AAGGUACA;ACACAGAA;ACAGCAGA;ACCUCCAA;ACGCUCGA;ACGUAUCA;ACUAUGCA;AGAGUCAA;AGAUCGCA;AGCAGGAA;AGUCACUA;AUCCUGUA;AUUGAGGA;CAACCACA;GACUAGUA;CAAUGGAA;CACUUCGA;CAGCGUUA;CAUACCAA;CCAGUUCA;CCGAAGUA;ACAGUG;CGAUGU;UUAGGC;AUCACG; and UGACCA.

[0220] In some embodiments, the polyvalent RNA composition comprises: (a) combining in a single reaction vessel a first linearized DNA molecule encoding a first mRNA polynucleotide, a second linearized DNA molecule encoding a second mRNA polynucleotide, and optionally a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth linearized DNA molecule encoding a third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth mRNA polynucleotide, wherein the first DNA molecule, the second DNA molecule, and the third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule are obtained from different sources; (b) simultaneously in vitro transcribing the linearized first DNA molecule, the linearized second DNA molecule, and any linearized third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecule to obtain a polyvalent RNA composition. The different sources may be bacterial cell cultures that cannot be co-cultured. In some embodiments, the amounts of the first, second, and third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth DNA molecules present in the reaction mixture before the start of IVT are normalized.

[0221] In vitro transcription of RNA The cDNA encoding the polynucleotide described herein can be transcribed using an in vitro transcription (IVT) system. In vitro transcription of RNA is known in the art and described in International Publication No. WO / 2014 / 152027, which is incorporated herein by reference in its entirety. In some embodiments, the RNA of the present disclosure is prepared according to any one or more of the methods described in WO2018 / 053209 and WO 2019 / 036682, each of which is incorporated herein by reference.

[0222] In some embodiments, the RNA transcripts are generated using an unamplified linearized DNA template in an in vitro transcription reaction to generate the RNA transcripts. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide (such as, but not limited to, coronavirus mRNA). In some embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells, are transfected with a plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, which is then isolated and purified. In some embodiments, the DNA template comprises an RNA polymerase promoter, e.g., a T7 promoter, located 5' to a gene of interest and operably linked to the gene of interest.

[0223] In some embodiments, the in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, encodes a 3' UTR and a poly A tail. The particular nucleic acid sequence composition and length of the in vitro transcription template depends on the mRNA encoded by the template.

[0224] "5' untranslated region" UTR refers to the region of an mRNA immediately upstream (i.e., 5') from the start codon (i.e., the first codon of the mRNA transcript that is translated by the ribosome) that does not code for a polypeptide. If an RNA transcript is being produced, the 5' UTR may contain a promoter sequence. Such promoter sequences are known in the art. It is understood that no such promoter sequences are present in the vaccines of the present disclosure.

[0225] "3' untranslated region" (UTR) refers to the region of an mRNA immediately downstream (i.e., 3') from a stop codon (i.e., a codon in the mRNA transcript that signals the end of translation) that does not code for a polypeptide.

[0226] An open reading frame is a contiguous stretch of DNA that begins with a start codon (eg, methionine (ATG)) and ends with a stop codon (eg, TAA, TAG, or TGA) and encodes a polypeptide.

[0227] A "poly(A) tail" is a region of an mRNA downstream, e.g., immediately downstream (i.e., 3'), of a 3'UTR that contains multiple consecutive adenosine monophosphates. A poly(A) tail can contain 10-300 adenosine monophosphates. For example, a poly(A) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50-250 adenosine monophosphates. In relevant biological environments (e.g., within a cell, in vivo), the poly(A) tail functions to protect the mRNA from enzymatic degradation (e.g., in the cytoplasm) and to assist in transcription termination, and / or transport of the mRNA from the nucleus and translation.

[0228] In some embodiments, the nucleic acid comprises 200 to 3,000 nucleotides. For example, the nucleic acid may comprise 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.

[0229] In vitro transcription systems typically include a transcription buffer, nucleotide triphosphates (NTPs), an RNAse inhibitor, and a polymerase.

[0230] NTPs may be produced in-house, selected from a commercial supplier, or synthesized as described herein. NTPs may be selected from those described herein, including, but not limited to, natural and unnatural (modified) NTPs.

[0231] Numerous RNA polymerases or variants may be used in the methods of the present disclosure. The polymerase may be selected from, but is not limited to, phage RNA polymerases, such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or mutant polymerases, such as polymerases that can incorporate modified nucleic acids and / or modified nucleotides, including but not limited to chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase.

[0232] In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises a 5' end cap, e.g., 7mG(5')ppp(5')NlmpNp.

[0233] chemical synthesis Solid-phase chemical synthesis. The nucleic acids of the present disclosure may be produced in whole or in part using solid-phase technology. Solid-phase chemical synthesis of nucleic acids is an automated method in which molecules are immobilized on a solid support and synthesized stepwise in a reaction solution. Solid-phase synthesis is useful for site-specific introduction of chemical modifications into nucleic acid sequences.

[0234] Solution Phase Chemical Synthesis. Synthesis of the nucleic acids of the present disclosure by sequential addition of monomer building blocks can be carried out in solution phase.

[0235] Combination of synthetic methods. Each of the synthetic methods discussed above has its own advantages and limitations. Attempts have been made to combine these methods to overcome the limitations. Such combinations of methods are within the scope of this disclosure. The combination of solid-phase or liquid-phase chemical synthesis and enzymatic ligation provides an efficient method to produce long-chain nucleic acids that cannot be obtained by chemical synthesis alone.

[0236] Ligation of nucleic acid regions or subregions Ligase-mediated assembly of nucleic acids may also be used. DNA or RNA ligases promote intermolecular ligation of the 5' and 3' ends of polynucleotide chains through the formation of phosphodiester bonds. Nucleic acids such as chimeric polynucleotides and / or circular nucleic acids may be prepared by ligation of one or more regions or subregions. DNA fragments may be joined by ligase-catalyzed reactions to generate recombinant DNAs with different functions. Two oligodeoxynucleotides, one containing a 5' phosphoryl group and the other containing a free 3' hydroxyl group, serve as substrates for DNA ligase.

[0237] purification Purification of nucleic acids as described herein may include, but is not limited to, nucleic acid cleanup, quality assurance and quality control. Cleanup may be performed by methods known in the art, such as, but not limited to, AGENCORT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNA™ Oligo-T Capture Probes (EXIQON® Inc, Vedbaek, Denmark), or HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified" when used in reference to nucleic acids, such as "purified nucleic acid", refers to something that has been separated from at least one contaminant. A "contaminant" is any substance that renders something unsuitable, impure, or adulterated from another. Thus, purified nucleic acids (e.g., DNA and RNA) are present in a form or setting that is different from that in which it is found in nature or that is present prior to being subjected to a processing or purification method.

[0238] Quality assurance and / or quality control checks can be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0239] In some embodiments, the nucleic acid may be sequenced by methods including, but not limited to, reverse transcriptase PCR.

[0240] Quantification In some embodiments, the nucleic acids of the present disclosure may be quantified in exosomes or derived from one or more bodily fluids, including peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, sputum fluid, amniotic fluid, earwax, breast milk, bronchoalveolar lavage fluid, semen, prostatic fluid, Cowper's or pre-ejaculatory fluid, sweat, feces, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyle, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretions, stool, pancreatic juice, sinus lavage, bronchopulmonary aspirate, blastodermal cavity fluid, and umbilical cord blood. Alternatively, the exosomes may be obtained from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.

[0241] The assay can be performed using construct-specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or a combination thereof, while exosomes can be isolated using immunohistochemistry such as enzyme-linked immunosorbent (ELISA). Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunosorbent capture, affinity purification, microfluidic separation, or a combination thereof.

[0242] These methods allow researchers to monitor residual or delivered levels of nucleic acid in real time, as the nucleic acids of the present disclosure, in some embodiments, differ from endogenous forms by structural or chemical modifications.

[0243] In some embodiments, nucleic acids may be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is the NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acids may be analyzed to determine whether the nucleic acids are of the appropriate size and to confirm that no degradation of the nucleic acid has occurred. Nucleic acid degradation may be confirmed by methods such as, but not limited to, agarose gel electrophoresis, HPLC-based purification methods, including, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0244] Lipid Nanoparticles (LNPs) In some embodiments, the mRNA of the present disclosure is formulated in lipid nanoparticles (LNPs). It should be understood that "lipid nanoparticles" as used herein refers to a single LNP or a population of LNPs. Lipid nanoparticles typically include ionizable amino (cationic) lipids, non-cationic lipids, sterols, and PEG lipid components along with a nucleic acid cargo of interest. Lipid nanoparticles of the present disclosure can be formulated using components, compositions, and methods generally known in the art (e.g., PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US2016 / 01428). 0; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 52117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575 and PCT / US2016 / 069491 (all of which are incorporated by reference in their entireties).

[0245] The vaccines of the present disclosure are typically formulated in lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0246] In some embodiments, the lipid nanoparticles comprise 20-60 mol% of ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20-55 mol% of ionizable cationic lipids. For example, the lipid nanoparticles may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% of ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% of ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, or 60 mol% ionizable amino lipids.

[0247] In some embodiments, the lipid nanoparticles contain 5-25 mol% non-cationic lipid. For example, the lipid nanoparticles may contain 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipid. In some embodiments, the lipid nanoparticles contain 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipid.

[0248] In some embodiments, the lipid nanoparticles contain 25-55 mol% sterol. For example, the lipid nanoparticles may contain 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticles contain 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.

[0249] In some embodiments, the lipid nanoparticles contain 0.5-15 mol% of PEG-modified lipid. For example, the lipid nanoparticles contain 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticles contain 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% of PEG-modified lipid.

[0250] In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable amino lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and about 0.5-15 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 40-50 mol% ionizable amino lipid, 5-15 mol% neutral lipid, 20-40 mol% cholesterol, and about 0.5-3 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 45-50 mol% ionizable amino lipid, 9-13% neutral lipid, 35-45 mol% cholesterol, and about 2-3 mol% PEG-modified lipid. In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% neutral lipid, 68.5 mol% cholesterol, and about 2.5 mol% PEG-modified lipid.

[0251] In some embodiments, the ionizable amino lipids of the present disclosure are compounds of formula (I): [ka] or a salt or isomer thereof, wherein: R1 is C 5-30 Alkyl, C 5-20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n C.H.Q.R. -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH2), nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N( R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -O(CH2) n -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; R8 is C 3-6 selected from the group consisting of carbocycle and heterocycle; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycle and heterocycle; Each R is C 1-3 Alkyl, C 2-3independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently C 3-6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0252] In some embodiments, a subset of compounds of formula (I) includes compounds in which R4 is -(CH2) n Q, -(CH2) n If it is CHQR, -CHQR, or -CQ(R), then (i) when n is 1, 2, 3, 4, or 5, Q is not -N(R), or (ii) when n is 1 or 2, Q is not a 5-, 6-, or 7-membered heterocycloalkyl.

[0253] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) nCHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is selected from the group consisting of C 3-6 Carbocyclic ring, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, - -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and one or more heteroatoms selected from N, O, and S, and oxo (=O), OH, amino, monoalkylamino or dialkylamino, and C 1-3 5-14 membered heterocycloalkyl substituted with one or more substituents selected from alkyl, each n being independently selected from 1, 2, 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R6 is C 1~3 Alkyl, C 2~3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; R8 is C 3-6 selected from the group consisting of carbocycle and heterocycle; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycle and heterocycle; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 2-12 alkenyl; Each Y is independently C 3-6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0254] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is C 3-6 Carbocyclic ring, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n (i) R4 is selected from -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2; and each n is independently selected from 1, 2, 3, 4, and 5; and Q is a 5-14 membered heterocycle; (i) R4 is -(CH2) n Q and n is 1 or 2, or (ii) R4 is -(CH2) n When R is -CHQR, n is 1; or (iii) when R is -CHQR and -CQ(R), Q is a 5-14 membered heteroaryl or an 8-14 membered heterocyclic alkyl; Each R5, C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1~3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 alkenyl, and H; R8 is C 3~6 selected from the group consisting of carbocycle and heterocycle; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3~6 selected from the group consisting of carbocycle and heterocycle; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1~12 Alkyl and C 2-12 alkenyl; Each Y is independently 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0255] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1~14 Alkyl, C 2~14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is C 3~6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is selected from the group consisting of C 3~6 Carbocyclic ring, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N(R )S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, --O(CH2) n wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independently C 1-3 Alkyl, C 2-3alkenyl, and H; Each R6 is C 1~3 Alkyl, C 2~3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1~3 Alkyl, C 2~3 alkenyl, and H; R8 is C 3~6 selected from the group consisting of carbocycle and heterocycle; R9 is H, CN, NO2, C 1~6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2~6 Alkenyl, C 3~6 selected from the group consisting of carbocycle and heterocycle; Each R is C 1~3 Alkyl, C 2~3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1~18 Alkyl, C 2~18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3~14 Alkyl and C 3~14 alkenyl; Each R* is C 1~12 Alkyl and C 2~12 alkenyl; Each Y is independently 3~6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0256] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5~30 Alkyl, C 5~20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are H, C 2~14 Alkyl, C 2~14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is -N(R)2 and n is selected from 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 alkenyl, and H; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 1-12 alkenyl; Each Y is independently C 3-6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0257] In some embodiments, another subset of compounds of formula (I) includes R1 is C 5-30 Alkyl, C 5-20 alkenyl, -R*YR", -YR", and -R"M'R'; R2 and R3 are C 1-14 Alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3 together with the atom to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R)2, where Q is -N(R)2 and n is selected from 1, 2, 3, 4, and 5; Each R5, C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R6 is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C2-3 alkenyl, and H; Each R is C 1-3 Alkyl, C 2-3 independently selected from the group consisting of alkenyl, and H; Each R' is C 1-18 Alkyl, C 2-18 independently selected from the group consisting of alkenyl, -R*YR″, -YR″, and H; Each R” is C 3-14 Alkyl and C 3-14 alkenyl; Each R* is C 1-12 Alkyl and C 1-12 alkenyl; Each Y is independently C 3-6 It is a carbocyclic ring; each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0258] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IA): [ka] or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M'; R is an unsubstituted C 1-3 Alkyl, or -(CH2) nQ, where Q is OH, -NHC(S)N(R), -NHC(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)R, -NHC(=NR)N(R), -NHC(=CHR)N(R), -OC(O)N(R), -N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; and each R and R is independently selected from H, C 1-14 Alkyl and C 2-14 alkenyl.

[0259] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (II): [ka] or a salt or isomer thereof, wherein I is selected from 1, 2, 3, 4, and 5; M is a bond or M'; R is an unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where n is 2, 3, or 4, and Q is selected from the group consisting of OH, -NHC(S)N(R), -NHC(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)R, -NHC(=NR)N(R), -NHC(=CHR)N(R), -OC(O)N(R), M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; R2 and R3 are independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0260] In some embodiments, subsets of compounds of formula (I) include those of formula (IIa), (IIb), (IIc), or (IIe): [ka] or a salt or isomer thereof, wherein R4 is as described herein.

[0261] In some embodiments, a subset of compounds of formula (I) includes compounds of formula (IId): [ka] or a salt or isomer thereof, wherein n is 2, 3, or 4; m, R', R", and R2-R6 are as described herein. For example, each of R2 and R3 can be independently selected from C 5-14 Alkyl and C 5-14 alkenyl.

[0262] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0263] In some embodiments, the ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0264] In some embodiments, the non-cationic lipids of the present disclosure are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DO ... 1-Oleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.

[0265] In some embodiments, the PEG-modified lipids of the present disclosure include PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. In some embodiments, the PEG-modified lipid is DMG-PEG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0266] In some embodiments, sterols of the present disclosure include cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and mixtures thereof.

[0267] In some embodiments, the LNPs of the present disclosure comprise an ionizable amino lipid of Compound 1, where the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG (e.g., PEG2000-DMG).

[0268] In some embodiments, the lipid nanoparticles comprise 45-55 mole percent (mol%) of an ionizable amino lipid (e.g., Compound 1). For example, the lipid nanoparticles may comprise 45-47, 45-48, 45-49, 45-50, 45-52, 46-48, 46-49, 46-50, 46-52, 46-55, 47-48, 47-49, 47-50, 47-52, 47-55, 48-50, 48-52, 48-55, 49-50, 49-52, 49-55, or 50-55 mol% of an ionizable amino lipid (e.g., Compound 1). For example, the lipid nanoparticles may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% of an ionizable amino lipid.

[0269] In some embodiments, the lipid nanoparticles contain 5-15 mol% of a non-cationic (neutral) lipid (e.g., DSPC). For example, the lipid nanoparticles may contain 5-6, 5-7, 5-8, 5-9, 5-10, 5-11, 5-12, 5-13, 5-14, 5-15, 6-7, 6-8, 6-9, 6-10, 6-11, 6-12, 6-13, 6-14, 6-15, 7-8, 7-9, 7-10, 7-11, 7-12, 7-13, 7-14, 7-15, 8-9, 8-10, 8-11, 8-12, 8-13 , 8-14, 8-15, 9-10, 9-11, 9-12, 9-13, 9-14, 9-15, 10-11, 10-12, 10-13, 10-14, 10-15, 11-12, 11-13, 11-14, 11-15, 12-13, 12-14, 13-14, 13-15, or 14-15 mol% of a non-cationic (neutral) lipid (e.g., DSPC). For example, the lipid nanoparticles may contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% of DSPC.

[0270] In some embodiments, the lipid nanoparticles comprise 35-40 mol% sterol (e.g., cholesterol). For example, the lipid nanoparticles may comprise 35-36, 35-37, 35-38, 35-39, 35-40, 36-37, 36-38, 36-39, 36-40, 37-38, 37-39, 37-40, 38-39, 38-40, or 39-40 mol% cholesterol. For example, the lipid nanoparticles may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.

[0271] In some embodiments, the lipid nanoparticles contain 1-3 mol% DMG-PEG. For example, the lipid nanoparticles may contain 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 mol% DMG-PEG. For example, the lipid nanoparticles may contain 1, 1.5, 2, 2.5, or 3 mol% DMG-PEG.

[0272] In some embodiments, the lipid nanoparticles comprise 50 mol% ionizable amino lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG. In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% PEG2000-DMG.

[0273] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 2:1 to about 30:1.

[0274] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 6:1.

[0275] In some embodiments, the LNPs of the disclosure comprise an N:P ratio of about 3:1.

[0276] In some embodiments, the LNPs of the present disclosure comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 10:1 to about 100:1.

[0277] In some embodiments, the LNPs of the present disclosure comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 20:1.

[0278] In some embodiments, the LNPs of the present disclosure comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 10:1.

[0279] In some embodiments, the average diameter of the LNPs of the disclosure is about 50 nm to about 150 nm.

[0280] In some embodiments, the average diameter of the LNPs of the disclosure is about 70 nm to about 120 nm.

[0281] Multivalent vaccines The compositions provided herein may include an RNA or multiple RNAs encoding two or more antigens of the same or different species. In some embodiments, the compositions include an RNA or multiple RNAs encoding two or more coronavirus antigens. In some embodiments, the RNA may encode 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more coronavirus antigens.

[0282] In some embodiments, two or more different mRNAs encoding antigens may be formulated in the same lipid nanoparticle. In other embodiments, two or more different RNAs encoding antigens may be formulated in separate lipid nanoparticles (each RNA is formulated in a single lipid nanoparticle). The lipid nanoparticles may then be combined and administered as a single vaccine composition (e.g., a vaccine composition comprising multiple RNAs encoding multiple antigens) or may be administered separately. In some embodiments, when a composition comprises two different RNAs encoding antigens, the ratio of the RNAs encoding the antigens is 1:1, 1:2, 1:4, 4:1, or 2:1.

[0283] First or 1st vaccine In some embodiments, the first or primary vaccine is an mRNA vaccine encoding an antigen derived from a first pandemic strain of the SARS-CoV-2 virus. For example, the first or primary vaccine can be an mRNA encoding a spike antigen having the amino acid sequence of SEQ ID NO: 36, a domain or subunit thereof. In other embodiments, the first vaccine can be any vaccine format that includes a corresponding antigen derived from a second or subsequent pandemic strain of the SARS-CoV-2 virus. As a non-limiting example, the first vaccine composition can be a recombinant vaccine. As used herein, "recombinant vaccine" refers to a vaccine made by genetic engineering, a process and method of manipulating the genetic material of an organism. In most cases, a recombinant vaccine contains one or more nucleic acids encoding a protein antigen that has been produced in a heterologous expression system (e.g., bacteria or yeast) and purified or purified from a large amount of a pathogenic organism. After administration, the vaccinated person produces antibodies against the one or more protein antigens, thereby protecting the person from the disease. In some embodiments, the recombinant vaccine is a vectored vaccine. Viral vectored vaccines contain polynucleotide sequences of non-viral origin (i.e., polynucleotides heterologous to the virus) that code for peptides, polypeptides, or proteins that can elicit an immune response in a host that comes into contact with the vector. Expression of the polynucleotide triggers the generation of a neutralizing antibody response and / or a cell-mediated response, such as a cytotoxic T cell response. Examples of viral vectored vaccines include, but are not limited to, vaccines developed by Oxford / AstraZeneca (COVID-19 Vaccine AstraZeneca), CanSino Biological Inc. / Beijing Institute of Biotechnology, Gamaleya Research Institute, Zydus Cadila, Pasteur / Themis / University of Pittsburgh Center for Vaccine Research, University of Hong Kong, and Altimmune (NasoVAX).In some embodiments, the recombinant vaccine is a nucleic acid-based (e.g., DNA, mRNA) coronavirus vaccine. Examples of DNA vaccines include vaccines developed by Inovio Pharmaceuticals (INO-4800), Genexine Consortium (GX-19), OncoSec and the Cancer Institute (CORVax12 and TAVO™), Karolinska Institutet / Cobra Biologics, Osaka University / Anges / Takara Bio, and Takis / Applied DNA Sciences / Evvivax. Exemplary mRNA vaccines include those being developed by BioNTech / Pfizer, Imperial College London, Curevac, and Walvax Biotech / People's Liberation Army (PLA) Academy of Military Sciences.

[0284] Pharmaceutical preparations Provided herein are compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for the prevention and / or treatment of coronaviruses, e.g., in humans and other mammals. The compositions provided herein can be used as therapeutic or prophylactic agents. They can be used in medicines to prevent and / or treat coronavirus infections.

[0285] In some embodiments, a SARS-CoV-2 vaccine comprising RNA as described herein may be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide (antigen).

[0286] An "effective amount" of a composition (e.g., comprising RNA) is based, at least in part, on the target tissue, the target cell type, the means of administration, the physical characteristics of the RNA (e.g., length, nucleotide composition, and / or degree of modified nucleosides), the other components of the vaccine, and other determinants, such as the age, weight, height, sex, and general health of the subject. Typically, an effective amount of a composition provides an induced or boosted immune response as a function of antigen production in the cells of the subject. In some embodiments, an effective amount of a composition comprising an RNA polynucleotide having at least one chemical modification is more efficient than a composition comprising a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (percentage of cells transfected with the RNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleic acid degradation (e.g., as indicated by an increased duration of protein translation from a modified polynucleotide), or a change in the antigen-specific immune response of the host cell.

[0287] The term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier that makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic use. A "pharmaceutical acceptable carrier" is one that does not cause undesirable physiological effects after or upon administration to a subject. A carrier in a pharmaceutical composition must also be "acceptable" in the sense of being compatible with the active ingredient and capable of stabilizing it. One or more solubilizing agents may be utilized as pharmaceutical carriers for delivery of the active agent. Examples of pharmaceutical acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a composition that can be used as a dosage form. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical carriers and diluents, as well as pharmaceutical necessities for their use, are described in Remington's Pharmaceutical Sciences.

[0288] In some embodiments, compositions (including polynucleotides and their encoded polypeptides) according to the present disclosure may be used for the treatment or prevention of coronavirus infection. A composition may be administered prophylactically as part of an active immunization scheme or therapeutically to healthy individuals or early in infection during the incubation period or during active infection after symptom onset. In some embodiments, the amount of RNA provided to a cell, tissue, or subject may be an amount effective for immunoprophylaxis.

[0289] The composition may be administered with other prophylactic or therapeutic compounds. As a non-limiting example, the prophylactic or therapeutic compound may be an adjuvant or a booster. As used herein, the term "booster" when referring to a prophylactic composition such as a vaccine, refers to an additional administration of a prophylactic (vaccine) composition. A booster (or booster vaccine) may be administered after an earlier administration of the prophylactic composition. The time between the first administration of the prophylactic composition and the booster can be, but is not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or more. In some embodiments, the administration period between the first administration of the prophylactic composition and the booster is at least 6 months. In exemplary embodiments, the administration period between the first administration of the prophylactic composition and the booster may be, but is not limited to, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or 6 months. As described herein, the booster may include the same or a different mRNA compared to the initial administration of the prophylactic composition. In some embodiments, the booster may include a combination of the same mRNA from the initial administration of the prophylactic composition and at least one different mRNA. In some embodiments, the ratio of the mRNA from the early administration of the prophylactic composition to at least one different mRNA is 1:1, 1:2, 1:4, 4:1, or 2:1. In one embodiment, the ratio is 1:1. In some embodiments, the booster is monovalent (e.g., the mRNA encodes a single antigen). In some embodiments, the booster is multivalent (e.g., the mRNA encodes multiple antigens).

[0290] In some embodiments, the booster dose is between 5 μg and 30 μg, between 5 μg and 25 μg, between 5 μg and 20 μg, between 5 μg and 15 μg, between 5 μg and 10 μg, between 10 μg and 30 μg, between 10 μg and 25 μg, between 10 μg and 20 μg, between 10 μg and 15 μg, between 15 μg and 30 μg, between 15 μg and 25 μg, between 15 μg and 20 μg, between 20 μg and 30 μg, between 25 μg and 300 μg. In some embodiments, the booster dose is between 10 μg and 60 μg, between 10 μg and 55 μg, between 10 μg and 50 μg, between 10 μg and 45 μg, between 10 μg and 40 μg, between 10 μg and 35 μg, between 10 μg and 30 μg, between 10 μg and 25 μg, between 10 μg and 20 μg, between 15 μg and 60 μg, between 15 μg and 55 μg, between 15 μg and 50 μg, 15μg~45μg, 15μg~40μg, 15μg~35μg, 15μg~30μg, 15μg~25μg, 15μg~20μg, 20μg~60μg, 2 0μg~55μg, 20μg~50μg, 20μg~45μg, 20μg~40μg, 20μg~35μg, 20μg~30μg, 20μg~25μg, 25 μg~60μg, 25μg~55μg, 25μg~50μg, 25μg~45μg, 25μg~40μg, 25μg~35μg, 25μg~30μg, 30μg g~60μg, 30μg~55μg, 30μg~50μg, 30μg~45μg, 30μg~40μg, 30μg~35μg, 35μg~60μg, 35μg ~55μg, 35μg-50μg, 35μg-45μg, 35μg-40μg, 40μg-60μg, 40μg-55μg, 40μg-50μg, 40μg-45μg, 45μg-60μg, 45μg-55μg, 45μg-50μg, 50μg-60μg, 50μg-55μg, or 55μg-60μg. In some embodiments, the booster dose is at least 10μg and less than 25μg of the composition. In some embodiments, the booster dose is at least 5μg and less than 25μg of the composition.For example, the booster dose is 5 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg. In some embodiments, the booster dose is 50 μg.

[0291] In some embodiments, the compositions may be administered intramuscularly, intranasally, or intradermally, similar to the administration of inactivated vaccines known in the art.

[0292] The composition can be used in various settings depending on the prevalence of infection or the degree or level of unmet medical need. As a non-limiting example, the RNA vaccine can be used to treat and / or prevent various infectious diseases. RNA vaccines have superior properties in that they produce much larger antibody titers, better neutralizing immunity, produce a more durable immune response, and / or produce a faster response than commercially available vaccines.

[0293] Provided herein are pharmaceutical compositions comprising RNA and / or complexes, optionally in combination with one or more pharma- ceutically acceptable excipients.

[0294] The RNA may be formulated or administered alone or in combination with one or more other components, for example, an immunizing composition may include other components, including, but not limited to, an adjuvant.

[0295] In some embodiments, the immunizing composition does not include an adjuvant (is adjuvant-free).

[0296] The RNA may be formulated or administered in combination with one or more pharma- ceutically acceptable excipients. In some embodiments, the vaccine composition comprises at least one additional active agent, such as a therapeutic active agent, a prophylactic active agent, or a combination of both. The vaccine composition may be sterile, pyrogen-free, or both sterile and pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents, e.g., vaccine compositions, may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005, which is incorporated herein by reference in its entirety.

[0297] In some embodiments, the immunizing composition is administered to a human, human patient, or subject. For purposes of this disclosure, the term "active ingredient" generally refers to an RNA vaccine or a polynucleotide contained therein, such as an RNA polynucleotide (e.g., an mRNA polynucleotide) that encodes an antigen.

[0298] Formulations of the vaccine compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such methods of preparation include the step of bringing into association the active ingredient (e.g., mRNA polynucleotide) with an excipient and / or one or more accessory ingredients, and then dividing, shaping, and / or packaging the product into the desired single or multi-dose units as necessary and / or desired.

[0299] The relative amounts of active ingredient, pharma- ceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route of administration of the composition. By way of example, a composition may contain 0.1%-100%, e.g., 0.5-50%, 1-30%, 5-80%, at least 80% (w / w) active ingredient.

[0300] In some embodiments, the RNA is formulated with one or more excipients to (1) increase stability, (2) increase cell transfection, (3) allow sustained or delayed release (e.g., from a depot), (4) alter biodistribution (e.g., target to specific tissues or cell types), (5) increase translation of the encoded protein in vivo, and / or (6) alter the release profile of the encoded protein (antigen) in vivo. In addition to conventional excipients such as any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersing or suspending aids, surfactants, isotonicity agents, thickening or emulsifying agents, preservatives, excipients include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with RNA (e.g., for implantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

[0301] Dosage / Administration Provided herein are immunizing compositions (e.g., RNA vaccines), methods, kits, and reagents for the prevention and / or treatment of coronavirus infection in humans and other mammals. The immunizing compositions can be used as therapeutic or prophylactic agents. In some embodiments, the immunizing compositions are used to provide prophylactic protection from coronavirus infection. In some embodiments, the immunizing compositions are used to treat coronavirus infection. In some embodiments, the immunizing compositions are used to prime immune effector cells, for example, to activate peripheral blood mononuclear cells (PBMCs) ex vivo, which are then infused (reinfused) into a subject.

[0302] The subject may be any mammal, including non-human primates and human subjects. Typically, the subject is a human subject.

[0303] In some embodiments, the immunizing composition (e.g., an RNA vaccine) is administered to a subject (e.g., a mammalian subject, such as a human subject) in an amount effective to induce an antigen-specific immune response. RNA encoding a coronavirus spike protein antigen is expressed and translated in vivo to produce the antigen, which then stimulates an immune response in the subject.

[0304] Prophylactic protection from coronaviruses can be achieved following administration of the immunizing composition (e.g., RNA vaccine) of the present disclosure. The immunizing composition may be administered once, twice, three times, four times, or more, although a single dose of the vaccine may be sufficient (optionally followed by a single booster). Although not desirable, it is also possible to administer an immunizing composition to an infected individual to achieve a therapeutic response. Dosing may need to be adjusted accordingly.

[0305] A method of inducing an immune response in a subject against a coronavirus antigen (or multiple antigens) is provided in an aspect of the disclosure. In some embodiments, the method comprises administering to a subject an immunization composition comprising an mRNA having an open reading frame encoding a coronavirus antigen, thereby inducing an immune response specific to the coronavirus antigen in the subject, such that after vaccination, anti-antigen antibody titers in the subject are increased compared to anti-antigen antibody titers in subjects vaccinated with a prophylactically effective dose of a conventional vaccine against that antigen. An "anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

[0306] A prophylactically effective dose is a dose effective to prevent viral infection at a clinically acceptable level. In some embodiments, an effective dose is a dose listed on the vaccine package insert. As used herein, a conventional vaccine refers to a vaccine other than the mRNA vaccine of the present disclosure. For example, a conventional vaccine includes, but is not limited to, a live microbial vaccine, an inactivated microbial vaccine, a subunit vaccine, a protein antigen vaccine, a DNA vaccine, a virus-like particle (VLP) vaccine, and the like. In an exemplary embodiment, a conventional vaccine is a vaccine that has achieved regulatory approval and / or been registered by a national drug regulatory agency (e.g., the Food and Drug Administration (FDA) or the European Medicines Agency (EMA) in the United States).

[0307] In some embodiments, the anti-antigen antibody titer in the subject is increased by 1 log to 10 logs after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against coronavirus or an unvaccinated subject. In some embodiments, the anti-antigen antibody titer in the subject is increased by 1 log, 2 log, 3 log, 4 log, 5 log, or 10 log after vaccination compared to the anti-antigen antibody titer in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against coronavirus or an unvaccinated subject.

[0308] Another aspect of the present disclosure provides a method for inducing an immune response against coronavirus in a subject, comprising administering to the subject a composition comprising an mRNA comprising an open reading frame encoding a coronavirus antigen, thereby inducing a coronavirus-specific immune response in the subject, the immune response in the subject being equivalent to the immune response in a subject vaccinated with a conventional vaccine against coronavirus at a dosage level of 2-100 times that of the composition.

[0309] In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 2x the dosage level of the composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 3x the dosage level of the composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 4x, 5x, 10x, 50x, or 100x the dosage level of the composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 10x to 1000x the dosage level of the composition of the present disclosure. In some embodiments, the immune response in the subject is equivalent to the immune response in a subject vaccinated with a conventional vaccine at 100x to 1000x the dosage level of the composition of the present disclosure.

[0310] In other embodiments, the immune response is assessed by determining the [protein] antibody titer in the subject. In other embodiments, the ability of serum or antibodies from an immunized subject to neutralize viral uptake or reduce coronavirus transformation of human B lymphocytes is tested. In other embodiments, the ability to promote a robust T cell response(s) is measured using art-recognized techniques.

[0311] Another aspect of the disclosure provides a method of eliciting an immune response in a subject against coronavirus by administering to the subject a composition comprising an mRNA having an open reading frame encoding a coronavirus antigen to induce an immune response in the subject specific to the coronavirus antigen, wherein the immune response in the subject is induced 2 days to 10 weeks earlier than an immune response induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against coronavirus. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine at a dosage level 2-fold to 100-fold higher than the composition of the disclosure.

[0312] In some embodiments, an immune response in a subject is induced 2 days, 3 days, 1 week, 2 weeks, 3 weeks, 5 weeks, or 10 weeks earlier than the immune response induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0313] Also provided herein is a method of eliciting an immune response in a subject against a coronavirus by administering to the subject an mRNA having an open reading frame encoding a first antigen, wherein the RNA does not include a stabilizing element and an adjuvant is not co-formulated or co-administered with the vaccine.

[0314] The composition may be administered by any route that results in a therapeutically effective outcome. Such routes include, but are not limited to, intradermal, intramuscular, intranasal, and / or subcutaneous administration. The present disclosure provides a method that includes administering an RNA vaccine to a subject in need thereof. The exact amount required will vary from subject to subject depending on the subject's race, age, and general condition, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The RNA is typically formulated in unit dosage form for ease of administration and uniformity of dosage. However, it will be understood that the total daily usage of the RNA may be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level, prophylactically effective dose level, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific compound used; the specific composition used; the age, weight, general health, sex, and diet of the patient; the time of administration, route of administration, and excretion rate of the specific compound used; the duration of treatment; drugs used in combination or simultaneously with the specific compound used; and similar factors well known in the medical arts.

[0315] As provided herein, an effective amount (e.g., an effective dose) of RNA may be administered, for example, as low as 20 μg as a single dose or two 10 μg doses (e.g., a first effective vaccine dose and a second effective vaccine dose). In some embodiments, the first effective vaccine dose and the second effective vaccine dose are the same amount. In some embodiments, the first effective vaccine dose and the second effective vaccine dose are different amounts. In some embodiments, the effective amount is a total dose of 5 μg to 30 μg, 5 μg to 25 μg, 5 μg to 20 μg, 5 μg to 15 μg, 5 μg to 10 μg, 10 μg to 30 μg, 10 μg to 25 μg, 10 μg to 20 μg, 10 μg to 15 μg, 15 μg to 30 μg, 15 μg to 25 μg, 15 μg to 20 μg, 20 μg to 30 μg, 25 μg to 30 μg, or 25 μg to 300 μg. In some embodiments, the effective dose is 10 μg to 60 μg, 10 μg to 55 μg, 10 μg to 50 μg, 10 μg to 45 μg, 10 μg to 40 μg, 10 μg to 35 μg, 10 μg to 30 μg, 10 μg to 25 μg, 10 μg to 20 μg, 15 μg to 60 μg, 15 μg to 55 μg, 15 μg to 5 ...60 μg, 15 μg to 55 μg, 15 μg to 50 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 55 μg, 15 μg to 50 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 55 μg, 15 μg to 50 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg, 15 μg to 60 μg μg~45μg, 15μg~40μg, 15μg~35μg, 15μg~30μg, 15μg~25μg, 15μg~20μg, 20μg~60μg, 20μg g~55μg, 20μg~50μg, 20μg~45μg, 20μg~40μg, 20μg~35μg, 20μg~30μg, 20μg~25μg, 25μg~ 60μg, 25μg~55μg, 25μg~50μg, 25μg~45μg, 25μg~40μg, 25μg~35μg, 25μg~30μg, 30μg~6 0μg, 30μg~55μg, 30μg~50μg, 30μg~45μg, 30μg~40μg, 30μg~35μg, 35μg~60μg, 35μg~55μ In some embodiments, the effective dose (e.g., effective amount) is at least 10 μg and less than 25 μg of the composition.In some embodiments, the effective dose (e.g., effective amount) is at least 5 μg of the composition and less than 25 μg. For example, the effective amount may be 5 μg, 10 μg, 15 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, 200 μg, 250 μg, or 300 μg total dose. In some embodiments, the effective amount (e.g., effective dose) is 10 μg total dose. In some embodiments, the effective amount is a 20 μg total dose (e.g., two 10 μg doses). In some embodiments, the effective amount is a 25 μg total dose. In some embodiments, the effective amount is a 30 μg total dose. In some embodiments, the effective amount is a 50 μg total dose. In some embodiments, the effective amount is a 60 μg total dose (e.g., two 30 μg doses). In some embodiments, the effective amount is a 75 μg total dose. In some embodiments, the effective amount is a 100 μg total dose. In some embodiments, the effective amount is a 150 μg total dose. In some embodiments, the effective amount is a 200 μg total dose. In some embodiments, the effective amount is a 250 μg total dose. In some embodiments, the effective amount is a 300 μg total dose. In some embodiments, the composition comprises two or more mRNA polynucleotides, and the effective amount is a 20 μg total dose (e.g., 10 μg of a first mRNA and 10 μg of a second mRNA). In some embodiments, the composition comprises two or more mRNA polynucleotides and the effective amount is a total dose of 50 μg (e.g., 25 μg of the first mRNA and 25 μg of the second mRNA). In some embodiments, the composition comprises two or more mRNA polynucleotides and the effective amount is a total dose of 100 μg (e.g., 50 μg of the first mRNA and 50 μg of the second mRNA).

[0316] The RNAs described herein can be formulated in dosage forms described herein, e.g., intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous) dosage forms.

[0317] Vaccine Efficacy Some aspects of the present disclosure provide formulations of compositions (e.g., RNA vaccines) in which the RNA is formulated in an amount effective to generate an antigen-specific immune response in a subject (e.g., production of antibodies specific to a coronavirus antigen). An "effective amount" is a dose of RNA effective to generate an antigen-specific immune response. Also provided herein are methods of inducing an antigen-specific immune response in a subject. As used herein, an immune response to a vaccine or LNP of the present disclosure is the development in a subject of a humoral and / or cellular immune response to the coronavirus protein(s) present in the vaccine. For purposes of this disclosure, a "humoral" immune response refers to an immune response mediated by antibody molecules (including, for example, secretory (IgA) or IgG molecules), while a "cellular" immune response refers to an immune response mediated by T lymphocytes (e.g., CD4+ helper and / or CD8+ T cells (e.g., CTLs) and / or other white blood cells). One important aspect of cellular immunity involves antigen-specific responses by cytolytic T cells (CTLs). CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the cell surface. CTLs help induce and promote the destruction of intracellular microbes or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves antigen-specific responses by helper T cells. Helper T cells act to stimulate the function and help focus the activity of nonspecific effector cells against cells that present peptide antigens on their surface in conjunction with MHC molecules. The cellular immune response also results in the production of cytokines, chemokines, and other such molecules produced by activated T cells and / or other leukocytes, including those derived from CD4+ and CD8+ T cells.

[0318] In some embodiments, the antigen-specific immune response is characterized by measuring the anti-coronavirus antigen antibody titer produced in a subject administered the composition provided herein.Antibody titer is a measurement of the amount of antibodies in a subject, for example, antibodies specific to a particular antigen or epitope of an antigen.Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result.Enzyme-linked immunosorbent assay (ELISA), for example, is a common assay for quantifying antibody titer.

[0319] A variety of serological tests may be used to measure antibodies against an encoded antigen of interest, e.g., the SAR-CoV-2 virus or SAR-CoV-2 viral antigen, e.g., the SAR-CoV-2 spike or S protein (of its domains). These tests include hemagglutination inhibition tests, complement fixation tests, fluorescent antibody tests, enzyme-linked immunosorbent assays (ELISAs), and plaque reduction neutralization tests (PRNTs). Each of these tests measures a different antibody activity. In an exemplary embodiment, a plaque reduction neutralization test, or PRNT (e.g., PRNT50 or PRNT90), is used as a serological correlate of protection. PRNTs measure the biological parameter of in vitro virus neutralization, are the most serologically virus-specific tests for a particular class of viruses, and correlate well with serum levels of protection from viral infection. The basic design of a PRNT allows for virus-antibody interactions to be performed in test tubes or microtiter plates, which then plate the mixture onto virus-susceptible cells, preferably cells of mammalian origin, to measure the effect of the antibodies on viral infectivity. The cells are covered with a semi-solid medium that limits the spread of progeny viruses. Each virus that initiates a productive infection produces a localized area of ​​infection (plaques) that can be detected in a variety of ways. The plaques are counted and compared back to the starting concentration of the virus to determine the percent reduction in total viral infectivity. In PRNT, the serum sample to be tested is typically serially diluted before mixing with a standardized amount of virus. Because the concentration of virus is kept constant, when added to susceptible cells and overlaid with semi-solid medium, individual plaques can be identified and counted. In this way, a PRNT endpoint titer can be calculated for each serum sample at any selected percent reduction in viral activity.

[0320] In functional assays aimed at assessing vaccine immunogenicity, serum sample dilution series for antibody titration should ideally start below the "seroprotection" threshold titer. For SARS-CoV-2 neutralizing antibodies, the "seroprotection" threshold titer remains unknown. However, a seropositivity threshold of 1:10 can be considered as the seroprotection threshold in certain embodiments.

[0321] In some embodiments, a neutralizing immune response is one that produces levels of antibodies that meet or exceed the seroprotection threshold.

[0322] PRNT endpoint titers are expressed as the reciprocal of the last serum dilution that shows the desired percentage reduction in plaque counts. PRNT titers can be calculated based on a 50% or greater reduction in plaque counts (PRNT50). PRNT50 titers are preferred over titers that use a higher cutoff (e.g., PRNT90) for vaccine sera, as they provide more accurate results from the linear portion of the titration curve.

[0323] There are several ways to calculate PRNT titers. The simplest and most widely used method to calculate titers is to count plaques and report the titer as the reciprocal of the last serum dilution showing a >50% reduction in input plaque numbers based on a back titration of the input plaques. More accurate results may be calculated using curve fitting methods from several serum dilutions. There are a variety of computer analysis programs available for this (e.g., SPSS or GraphPad Prism).

[0324] In some embodiments, antibody titers are used to assess whether a subject has contracted an infectious disease or to determine whether immunization is required. In some embodiments, antibody titers are used to quantify the strength of an autoimmune response, to determine whether a booster immunization is required, to determine whether a previous vaccine was effective, and to confirm recent or past infection. According to the present disclosure, antibody titers may be used to quantify the strength of an immune response induced in a subject by a composition (e.g., an RNA vaccine).

[0325] In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 1 log over the control. For example, the anti-coronavirus antigen antibody titer produced in the subject can be increased by at least 1.5, at least 2, at least 2.5, or at least 3 logs over the control. In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by 1, 1.5, 2, 2.5, or 3 logs over the control. In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by 1 to 3 logs over the control. For example, the anti-coronavirus antigen antibody titer produced in the subject can be increased by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 3 logs over the control.

[0326] In some embodiments, the anti-coronavirus antigen-antibody titer produced in the subject is increased at least 2-fold over the control. For example, the anti-coronavirus antigen-antibody titer produced in the subject can be increased at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold over the control. In some embodiments, the anti-coronavirus antigen-antibody titer produced in the subject is increased 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold over the control. In some embodiments, the anti-coronavirus antigen-antibody titer produced in the subject is increased 2-10-fold over the control. For example, the anti-coronavirus antigen antibody titer produced in the subject may be increased by 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 times more than the control.

[0327] In some embodiments, the antigen-specific immune response is measured as the ratio of the geometric mean titers (GMT) of serum neutralizing antibody titers to coronavirus (referred to as the geometric mean ratio (GMR)). The geometric mean titer (GMT) is the average antibody titer in a group of subjects, calculated by multiplying all the values ​​together and taking the nth root of that number, where n is the number of subjects with available data.

[0328] In some embodiments, the control is the anti-coronavirus antigen antibody titer produced in a subject not administered the composition (e.g., an RNA vaccine). In some embodiments, the control is the anti-coronavirus antigen antibody titer produced in a subject administered a recombinant or purified protein vaccine. Recombinant protein vaccines typically contain protein antigens produced in heterologous expression systems (e.g., bacteria or yeast) or purified from large amounts of pathogenic organisms.

[0329] In some embodiments, the ability of a composition (e.g., an RNA vaccine) to be effective is measured in a mouse model. For example, a composition may be administered to a mouse model, and the mouse model may be evaluated for induction of neutralizing antibody titers. Viral challenge studies may also be used to evaluate the efficacy of a vaccine of the present disclosure. For example, a composition may be administered to a mouse model, the mouse model may be challenged with a virus, and the mouse model may be evaluated for survival and / or immune response (e.g., neutralizing antibody response, T cell response (e.g., cytokine response)).

[0330] In some embodiments, the effective amount of the composition (e.g., RNA vaccine) is a reduced dose compared to the standard of care dose of the recombinant protein vaccine. As used herein, "standard of care" refers to medical or psychological treatment guidelines, which may be general or specific. "Standard of care" refers to appropriate treatment based on scientific evidence and collaboration between medical professionals involved in the treatment of a given condition. It is the diagnostic and treatment process that a physician / clinician should follow for a certain type of patient, disease, and clinical situation. As used herein, "standard of care dose" refers to a dose of recombinant or purified protein vaccine, or live attenuated or inactivated vaccine, or VLP vaccine that a physician / clinician or other medical professional administers to a subject to treat or prevent coronavirus infection or a related condition while following the standard of care guidelines for treating or preventing coronavirus infection or a related condition.

[0331] In some embodiments, the anti-coronavirus antigen antibody titers produced in a subject administered an effective amount of the composition are comparable to the anti-coronavirus antigen antibody titers produced in a control subject administered a standard therapeutic dose of a recombinant or purified protein vaccine, or a live-attenuated or inactivated vaccine, or a VLP vaccine.

[0332] Vaccine efficacy can be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). For example, vaccine efficacy can be measured in a double-blind randomized controlled clinical trial. Vaccine efficacy can be expressed as the proportional reduction in disease incidence (AR) between the incidence in the non-vaccinated test cohort (ARU) and the incidence in the vaccinated test cohort (ARV), and can be calculated from the relative risk (RR) of disease in the vaccinated group using the following formula: Efficacy = (ARU-ARV) / ARU x 100; and Efficacy = (1-RR) x 100.

[0333] Similarly, vaccine efficacy can be assessed using standard analyses (see, for example, Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). Vaccine efficacy is an assessment of how a vaccine (which may already be known to have high vaccine efficacy) reduces disease in a population. This measure can assess the net balance of benefits and adverse effects of a vaccination program, beyond the vaccine itself, under natural field conditions rather than controlled clinical trials. Vaccine efficacy is proportional to the effect (potency) of the vaccine, but is also affected by how well target groups in the population are immunized, and by factors unrelated to the vaccine that affect "real-world" outcomes (e.g., hospitalizations, outpatient visits, or costs). For example, retrospective case-control analyses may be used to compare vaccination rates in a set of infected cases and appropriate controls. Vaccine efficacy can be expressed as a difference in proportions by use of the odds ratio (OR) of developing an infection despite vaccination. Efficacy = (1-OR) x 100

[0334] In some embodiments, the efficacy of the composition (e.g., an RNA vaccine) is at least 60% relative to unvaccinated control subjects. For example, the efficacy of the composition can be at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 95%, at least 98%, or 100% relative to unvaccinated control subjects.

[0335] Bactericidal immunity. Bactericidal immunity refers to an inherent immune state that prevents effective pathogen infection in a host. In some embodiments, an effective amount of the composition of the present disclosure is sufficient to cause sterilizing immunity in a subject for at least one year. For example, an effective amount of the composition of the present disclosure is sufficient to cause sterilizing immunity in a subject for at least two years, at least three years, at least four years, or at least five years. In some embodiments, an effective amount of the composition of the present disclosure is sufficient to cause sterilizing immunity in a subject at a dose at least 5 times lower than a control. For example, an effective amount may be sufficient to cause sterilizing immunity in a subject at a dose at least 10 times, 15 times, or 20 times lower than a control.

[0336] Detectable Antigen. In some embodiments, an effective amount of a composition of the present disclosure is sufficient to produce a detectable level of a coronavirus antigen as measured in the serum of a subject 1 to 72 hours after administration.

[0337] Titer. Antibody titer is a measure of the amount of antibodies in a subject, e.g., antibodies specific to a particular antigen (e.g., anti-coronavirus antigen). Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for quantifying antibody titer.

[0338] A neutralizing immune response is an immune response that is a neutralizing antibody response and / or an effective neutralizing T cell response. In some embodiments, a neutralizing antibody response produces antibodies at levels that meet or exceed the seroprotection threshold.

[0339] An effective T cell response is one that produces a baseline level of virus-activated or virus-specific T cells, including CD8+ and CD4+ T helper type 1 cells. Typically, CD8+ cytotoxic T lymphocytes eliminate intracellular viral compartments, while CD4+ T cells perform various functions in the body, such as helping B cells and other T cells, promoting memory generation, and indirect or direct cytotoxic activity. In some embodiments, effective T cells include a high percentage of CD8+ T cells and / or CD4+ T cells compared to baseline levels (in naive subjects). In some embodiments, these T cells are differentiated toward an early differentiation memory phenotype with co-expression of CD27 and CD28.

[0340] In some embodiments, an effective amount of a composition of the present disclosure is sufficient to produce a neutralizing antibody titer of 1,000 to 10,000 produced by neutralizing antibodies to a coronavirus antigen when measured in the serum of a subject 1 to 72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 1,000 to 5,000 produced by neutralizing antibodies to a coronavirus antigen when measured in the serum of a subject 1 to 72 hours after administration. In some embodiments, an effective amount is sufficient to produce a neutralizing antibody titer of 5,000 to 10,000 produced by neutralizing antibodies to a coronavirus antigen when measured in the serum of a subject 1 to 72 hours after administration.

[0341] In some embodiments, the neutralizing antibody titer is at least 100 NT 50 For example, the neutralizing antibody titer is at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NT. 50 In some embodiments, the neutralizing antibody titer may be at least 10,000 NT. 50 It is.

[0342] In some embodiments, the neutralizing antibody titer is at least 100 neutralizing units per milliliter (NU / mL). For example, the neutralizing antibody titer can be at least 200, 300, 400, 500, 600, 700, 800, 900, or 1000 NU / mL. In some embodiments, the neutralizing antibody titer is at least 10,000 NU / mL.

[0343] In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 1 log over the control. For example, the anti-coronavirus antigen antibody titer produced in the subject can be increased by at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 logs over the control.

[0344] In some embodiments, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 2-fold over the control. For example, the anti-coronavirus antigen antibody titer produced in the subject is increased by at least 3, 4, 5, 6, 7, 8, 9, or 10-fold over the control.

[0345] In some embodiments, the geometric mean, which is the n-th root of the product of n numbers, is commonly used to describe proportional growth. In some embodiments, the geometric mean is used to characterize the antibody titers produced in a subject.

[0346] A control can be, for example, an unvaccinated subject, or a subject administered a live attenuated virus vaccine, an inactivated virus vaccine, or a protein subunit vaccine.

[0347] Further embodiments 1. A nucleic acid encoding a SARS-CoV-2 antigen of a second circulating SARS-CoV-2 virus strain, wherein said antigen has an amino acid sequence with at least one amino acid mutation relative to an antigen of a first circulating SARS-CoV-2 virus strain, said mutation being an amino acid substitution, deletion or insertion, said antigen is not a full length stabilized spike protein with a 2P mutation, and said nucleic acid is within a lipid nanoparticle.

[0348] 2. The nucleic acid of paragraph 1, wherein the first and second virus strains are circulating for at least part of the year.

[0349] 3. The nucleic acid of paragraph 1, wherein the first and second virus strains are circulating during the same pandemic or epidemic period.

[0350] 4. The nucleic acid of any one of paragraphs 1 to 3, wherein the SARS-CoV-2 antigen has a second amino acid mutation relative to an antigen of the first circulating SARS-CoV-2 virus strain, the mutation being an amino acid substitution, deletion, or insertion, and the second mutation corresponds to a third circulating virus strain.

[0351] 5. The nucleic acid of any one of paragraphs 1 to 4, wherein the lipid nanoparticles comprise an ionizable amino lipid, a sterol, a neutral lipid, and a polyethylene glycol (PEG)-modified lipid.

[0352] 6. The nucleic acid according to paragraph 5, wherein the lipid nanoparticles comprise 40-55 mol % of an ionizable amino lipid, 30-45 mol % of a sterol, 5-15 mol % of a neutral lipid, and 1-5 mol % of a PEG-modified lipid.

[0353] 7. The nucleic acid of any one of paragraphs 1 to 6, wherein the SARS-CoV-2 antigen is the receptor binding domain (RBD) of the spike protein.

[0354] 8. The nucleic acid of any one of paragraphs 1 to 6, wherein the SARS-CoV-2 antigen is the N-terminal domain (NTD).

[0355] 9. The nucleic acid of any one of paragraphs 1 to 6, wherein the SARS-CoV-2 antigen is a combination of the RBD and NTD.

[0356] 10. The nucleic acid of any one of paragraphs 1 to 6, wherein the SARS-CoV-2 antigen is the NTD, the RBD, and the transmembrane domain linked by a linker.

[0357] 11. The nucleic acid of paragraph 10, wherein the SARS-CoV-2 antigen is the NTD, RBD, and influenza hemagglutinin transmembrane (HATM) domain linked by a linker (NTD-RBD-HATM).

[0358] 12. The nucleic acid of any one of paragraphs 1 to 6, wherein the SARS-CoV-2 antigen is an NTD-RBD fusion.

[0359] 13. The nucleic acid of any one of paragraphs 1 to 6, wherein the SARS-CoV-2 antigen is an S1 protein subunit.

[0360] 14. The nucleic acid of any one of paragraphs 1 to 13, wherein the amino acid mutation in the antigen is associated with a viral structure or function that differs in amount or type from the corresponding structure or function in the first virus.

[0361] 15. The nucleic acid according to paragraph 14, wherein the function is ACE2 receptor binding, viral spread, viral uptake, viral pathogenesis, alteration of furin cleavage, or viral replication.

[0362] 16. The nucleic acid of any one of paragraphs 1 to 15, wherein the nucleic acid encodes a protein having at least 95% sequence identity to any one of SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63.

[0363] 17. The nucleic acid of any one of paragraphs 1 to 16, having at least 95% sequence identity to any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0364] 18. The nucleic acid according to any one of paragraphs 1 to 17, wherein the nucleic acid comprises messenger RNA (mRNA).

[0365] 19. Composition: A composition comprising a first messenger ribonucleic acid (mRNA) encoding a first SARS-CoV-2 antigen of a first SARS-CoV-2 virus and a second mRNA encoding a second SARS-CoV-2 antigen of a second SARS-CoV-2 virus, wherein the second SARS-CoV-2 virus has an amino acid sequence having at least one amino acid mutation relative to the amino acid sequence of the first SARS-CoV-2 virus, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation.

[0366] 20. The composition of paragraph 19, wherein the first SARS-CoV-2 virus is a first pandemic SARS-CoV-2 virus strain and the second SARS-CoV-2 virus is a second pandemic SARS-CoV-2 virus strain, and the first and second virus strains are circulating in a population for at least some period of a year.

[0367] 21. The composition of any one of paragraphs 19 to 20, wherein the mRNAs are present in the composition in a ratio of about 1:1 relative to each other's mRNAs.

[0368] 22. The composition of any one of claims 19 to 21, wherein the mRNA is in a lipid nanoparticle, and the lipid nanoparticle comprises an ionizable amino lipid, a sterol, a neutral lipid, and a polyethylene glycol (PEG)-modified lipid.

[0369] 23. The composition according to paragraph 22, wherein the lipid nanoparticles comprise 40-55 mol % of an ionizable amino lipid, 30-45 mol % of a sterol, 5-15 mol % of a neutral lipid, and 1-5 mol % of a PEG-modified lipid.

[0370] 24. The composition according to any one of paragraphs 22 to 23, wherein the lipid nanoparticles comprise 40 to 50 mol % of an ionizable amino lipid, 35 to 45 mol % of a sterol, 10 to 15 mol % of a neutral lipid, and 2 to 4 mol % of a PEG-modified lipid.

[0371] 25. The composition of any one of paragraphs 22 to 24, wherein the lipid nanoparticles comprise 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, or 50 mol% of ionizable amino lipids.

[0372] 26. The composition of any one of paragraphs 22 to 25, wherein the ionizable amino lipid has the structure of Compound 1: [ka]

[0373] 27. The composition according to any one of paragraphs 22 to 26, wherein the sterol is cholesterol or a variant thereof.

[0374] 28. The composition according to any one of paragraphs 22 to 27, wherein the neutral lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0375] 29. The composition according to any one of paragraphs 22 to 28, wherein the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG).

[0376] 30. An mRNA encoding a protein having at least 95% sequence identity to any one of SEQ ID NOs: 20, 23, 26, 29, 32, 57, 60, and 63.

[0377] 31. An mRNA having at least 95% sequence identity to any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0378] 32. An mRNA having at least 98% sequence identity to any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0379] 33. An mRNA comprising any one of SEQ ID NOs: 21, 24, 27, 30, 55, 58, 61, and 64.

[0380] 34. A method comprising administering to a subject a second effective dose of a second vaccine comprising a second nucleic acid encoding a second SARS-CoV-2 antigen, wherein the subject has previously been administered a first effective dose of a first vaccine comprising a first nucleic acid encoding a first SARS-CoV-2 antigen, wherein the second vaccine is administered in an amount effective to induce an immune response specific to the second antigen, wherein the second SARS-CoV-2 antigen has an amino acid sequence having at least one mutation relative to the corresponding amino acid sequence of the first SARS-CoV-2 antigen, wherein the mutation is an amino acid substitution, deletion, or insertion, and wherein each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation.

[0381] 35. The method of paragraph 34, wherein the first encoded SARS-CoV-2 antigen is an antigen of a first pandemic SARS-CoV-2 virus and the second encoded SARS-CoV-2 antigen is an antigen of a second pandemic SARS-CoV-2 virus.

[0382] 36. The method of paragraph 34, wherein the first encoded SARS-CoV-2 antigen is representative of a first pandemic SARS-CoV-2 virus and the second encoded SARS-CoV-2 antigen is representative of a second pandemic SARS-CoV-2 virus.

[0383] 37. The method of paragraph 34, wherein the first encoded SARS-CoV-2 antigen is representative of a first plurality of pandemic SARS-CoV-2 viruses and / or the second encoded SARS-CoV-2 antigen is representative of a second plurality of pandemic SARS-CoV-2 viruses.

[0384] 38. The method of paragraph 34, wherein the first encoded SARS-CoV-2 antigen is an antigen of a first pandemic SARS-CoV-2 virus and the second encoded SARS-CoV-2 antigen is an antigen of a second pandemic SARS-CoV-2 virus.

[0385] 39. The method of any one of paragraphs 35 to 38, wherein the second pandemic SARS-CoV-2 virus is an immunodominant emerging strain or a variant of concern detected during the period in which the first pandemic SARS-CoV-2 virus is present in the subject population.

[0386] 40. The method of any one of paragraphs 35 to 39, wherein the second pandemic SARS-CoV-2 virus and the first pandemic SARS-CoV-2 virus are detectable in a subject population within at least one year.

[0387] 41. The method of any one of paragraphs 35 to 39, wherein the second pandemic SARS-CoV-2 virus and the first pandemic SARS-CoV-2 virus are detectable in a subject population during the same season.

[0388] 42. The method of any one of paragraphs 35 to 39, wherein the second pandemic SARS-CoV-2 virus and the first pandemic SARS-CoV-2 virus are detectable in a subject population during the same pandemic or epidemic period.

[0389] 43. The method of any one of paragraphs 34 to 42, wherein the first nucleic acid encoding the first SARS-CoV-2 antigen is DNA or messenger RNA (mRNA).

[0390] 44. The method of any one of paragraphs 34 to 43, wherein the first nucleic acid encoding the first SARS-CoV-2 antigen is messenger RNA (mRNA).

[0391] 45. The method of any one of paragraphs 34 to 43, wherein the second nucleic acid encoding the second SARS-CoV-2 antigen is messenger RNA (mRNA).

[0392] 46. ​​The method of any one of paragraphs 34 to 45, wherein the second vaccine further comprises the first nucleic acid encoding a first SARS-CoV-2 antigen.

[0393] 47. The method of paragraph 46, wherein the first nucleic acid encoding a first SARS-CoV-2 antigen and the second nucleic acid encoding a second SARS-CoV-2 antigen are present in the second vaccine in a 1:1 ratio.

[0394] 48. The method of any one of paragraphs 34 to 45, wherein the first and / or second vaccine is a monovalent vaccine.

[0395] 49. The method of any one of paragraphs 34 to 47, wherein the first and / or second vaccine is a multivalent vaccine comprising multiple nucleic acids encoding antigens representative of multiple variants of concern.

[0396] 50. The method of any one of paragraphs 34 to 49, wherein the first encoded SARS-CoV-2 antigen is administered to the subject as a first vaccine consisting of one or more doses, and the second encoded SARS-CoV-2 antigen is administered to the subject as a boost in one or more doses.

[0397] 51. The method of any one of paragraphs 34 to 49, wherein the second encoded SARS-CoV-2 antigen is administered to the subject as a first vaccine consisting of one or more doses, and the first encoded SARS-CoV-2 antigen is administered to the subject as a boost in one or more doses.

[0398] 52. The method of any one of paragraphs 34 to 49, wherein the first and second encoded SARS-CoV-2 antigens are administered together to the subject as a boost dose, optionally wherein the first and second encoded SARS-CoV-2 antigens are present in the boost dose in a 1:1 ratio.

[0399] 53. The method of any one of clauses 34 to 49, wherein the first encoded SARS-CoV-2 antigen is administered to the subject as a prime and boost dose to complete vaccination, and the second encoded SARS-CoV-2 antigen is administered to the subject as a booster regimen at least 3 months after the first vaccination is completed.

[0400] 54. The method of any one of paragraphs 34 to 47, wherein a first encoded SARS-CoV-2 antigen is administered to the subject as a prime dose and a boost dose in an initial vaccination, and the second encoded SARS-CoV-2 antigen is administered to the subject as a boost dose at least 6 months after the initial vaccination.

[0401] 55. The method of any one of paragraphs 48 to 52, wherein the boost dose is a seasonal boost or a pandemic shift boost to provide protection against multiple variants of concern.

[0402] 56. The method of any one of paragraphs 50 to 55, wherein the boost dose is 50 μg.

[0403] 57. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is between 20 μg and 50 μg.

[0404] 58. The method of any one of paragraphs 34 to 57, wherein the first and / or second effective dose is 20 μg.

[0405] 59. The method of any one of paragraphs 34 to 57, wherein the first and / or second effective dose is 25 μg.

[0406] 60. The method of any one of paragraphs 34 to 57, wherein the first and / or second effective dose is 30 μg.

[0407] 61. The method of any one of paragraphs 34 to 57, wherein the first and / or second effective dose is 50 μg.

[0408] 62. The method of any one of paragraphs 34 to 57, wherein the first and / or second effective dose is 30 μg.

[0409] 63. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is 10 μg.

[0410] 64. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is between 10 μg and 30 μg.

[0411] 65. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is between 10 μg and 20 μg.

[0412] 66. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is at least 10 μg and at least 25 μg.

[0413] 67. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is between 5 μg and 30 μg.

[0414] 68. The method of any one of paragraphs 34 to 56, wherein the first and / or second effective dose is at least 5 μg and less than 25 μg.

[0415] 69. A method comprising administering to a subject a vaccine comprising a first nucleic acid encoding a SARS-CoV-2 antigen of a first SARS-CoV-2 virus, wherein the first SARS-CoV-2 virus is an emerging variant of an earlier SARS-CoV-2 virus, the antigen has an amino acid sequence with at least one amino acid mutation relative to a corresponding protein antigen of the earlier SARS-CoV-2 virus, wherein the mutation is an amino acid substitution, deletion, or insertion, and the subject is seropositive for the SARS-CoV-2 antigen of the earlier SARS-CoV-2 virus.

[0416] 70. A method comprising administering to a subject a vaccine comprising a first nucleic acid encoding a SARS-CoV-2 antigen of a first SARS-CoV-2 virus, wherein the first SARS-CoV-2 virus is an emerging variant of an earlier SARS-CoV-2 virus, the antigen has an amino acid sequence with at least one amino acid mutation relative to a corresponding protein antigen of the earlier SARS-CoV-2 virus, wherein the mutation is an amino acid substitution, deletion, or insertion, and the subject is seronegative for the SARS-CoV-2 antigen of the earlier SARS-CoV-2 virus.

[0417] 71. The method of paragraph 69 or 70, wherein the subject is administered a second dose of the vaccine between two weeks and one year after the first dose of the vaccine is administered.

[0418] 72. The method of paragraph 69 or 70, wherein the subject is administered a second vaccine between 2 weeks and 1 year after administration of the vaccine, the second vaccine comprising a second nucleic acid encoding the corresponding protein antigen of the initial SARS-CoV-2 virus.

[0419] 73. The method of paragraph 72, wherein the second vaccine comprises a mixture of the first and second nucleic acids, and the first and second nucleic acids are present in the second vaccine in a 1:1 ratio.

[0420] 74. A method comprising administering to a subject a booster vaccine comprising a nucleic acid encoding a first SARS-CoV-2 antigen derived from a first SARS-CoV-2 virus, wherein the subject has previously received at least one prime dose of a first vaccine comprising a first nucleic acid encoding the SARS-CoV-2 antigen of the first SARS-CoV-2 virus, wherein the booster vaccine is administered in an amount effective to induce a neutralizing immune response against a second SARS-CoV-2 virus, wherein the second SARS-CoV-2 virus comprises a second SARS-CoV-2 antigen, the second SARS-CoV-2 antigen having an amino acid sequence with at least one amino acid mutation relative to a corresponding protein antigen of the first SARS-CoV-2 virus, wherein the booster vaccine is administered at a dose of 25-100 μg at least 6 months after the initial administration of the first vaccine, and wherein each of the first and second antigens is not a full-length stabilized spike protein having a 2P mutation.

[0421] 75. The method of paragraph 74, wherein the booster vaccine is administered at a dose of 50 μg.

[0422] 76. The method of paragraph 74 or 75, wherein the booster vaccine is administered at least about 6 months after the second dose of the primary vaccine.

[0423] 77. The method of paragraph 74 or 75, wherein the booster vaccine is administered 6 to 12 months after the second dose of the primary vaccine.

[0424] 78. The method of paragraph 74 or 75, wherein the booster vaccine is administered at least about 8 months after the second dose of the primary vaccine.

[0425] 79. The method of any one of paragraphs 74 to 78, wherein the boost dose is a seasonal boost or a pandemic shift boost to provide a neutralizing immune response against multiple variants of concern.

[0426] 80. The nucleic acid of any one of paragraphs 1 to 18, the composition of any one of paragraphs 19 to 29, the mRNA of any one of paragraphs 30 to 33, or the method of any one of paragraphs 34 to 79, wherein at least one mRNA further comprises one or more non-coding sequences in the untranslated region (UTR), optionally a 5'UTR or a 3'UTR.

[0427] 81. The nucleic acid, composition, mRNA, or method of paragraph 80, wherein all of said mRNAs further comprise one or more non-coding sequences in the UTR, optionally in the 5'UTR or 3'UTR.

[0428] 82. The method or composition of paragraph 56, wherein the non-coding sequence is located in the 3'UTR of the mRNA, upstream of the polyA tail of the mRNA.

[0429] 83. The nucleic acid, composition, mRNA, or method of paragraph 81, wherein the non-coding sequence is located in the 3'UTR of the mRNA downstream of the polyA tail of the mRNA.

[0430] 84. The nucleic acid, composition, mRNA, or method of paragraph 81, wherein the non-coding sequence is located in the 3'UTR of the mRNA, between the last codon of the ORF of the mRNA and the first "A" of the poly-A tail of the mRNA.

[0431] 85. The nucleic acid, composition, mRNA, or method of paragraph 81, wherein the non-coding sequence comprises 1 to 10 nucleotides.

[0432] 86. The nucleic acid, composition, mRNA, or method of any one of paragraphs 80 to 85, wherein the non-coding sequence comprises one or more RNAse cleavage sites.

[0433] 87. The method or composition of paragraph 86, wherein the RNAse cleavage site comprises an RNase H cleavage site. EXAMPLES

[0434] Example 1. mRNA vaccine induces human neutralizing antibodies against the spike variant of the global SARS-CoV-2 variant The mRNA vaccine used in this study encodes a protein containing the coronavirus SARS-CoV-2 spike protein N-terminal domain (NTD), receptor binding domain (RBD), and influenza hemagglutinin transmembrane (HATM) domain joined by a linker (NTD-RBD-HATM).

[0435] Both the NTD and RBD of coronavirus S protein are known to be binding sites for antibodies that exhibit neutralizing virus activity. The RBD in the case of SARS-CoV-2 is the receptor binding site of the spike protein, which binds to angiotensin-converting enzyme 2 (ACE2) as a receptor to gain entry into cells. The amino (N)-terminal domain NTD, whose function is not fully understood, appears to play a role in binding carbohydrate moieties and facilitating the conformational change of the spike protein from pre-fusion to post-fusion conformation. See Zhou H, Chen Y, Zhang S, et al. Nat Commun. 2019;10(1):3068. Recently, a neutralizing "supersite" has also been identified in the NTD. See McCallum, M. et al. N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2. Cell, doi:10.1016 / j.cell.2021.03.028(2021).

[0436] In experiments using lipid nanoparticle (LNP) formulations, the formulations contain 0.5-15% PEG-modified lipid, 5-25% non-cationic lipid, 25-55% sterol, and 20-60% ionizable amino lipid. The PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG), the non-cationic lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol is cholesterol, and the ionizable amino lipid has the structure of, for example, Compound 1.

[0437] Neutralization research In this study, the neutralizing activity of sera from clinical trial participants immunized with a recombinant vesicular stomatitis virus (VSV)-based mRNA vaccine encoding a protein containing the N-terminal domain (NTD), receptor binding domain (RBD), and influenza hemagglutinin transmembrane (HATM) domain joined by a linker (NTD-RBD-HATM) against SARS-CoV-2 spike proteins from the USA-WA1 / 2020 isolate, the D614G variant, the B.1.1.7 and B.1.1.351 variants, and previously emerged variants (20E.EU1, 20A.EU2, D614G-N439K, and mink cluster 5 variants) in a pseudovirus neutralization (PsVN) assay is evaluated using the effects of both single mutations and combinations of mutations and deletions present in the receptor binding domain (RBD) region of the S protein. Orthogonal evaluation in VSV and pseudotyped lentivirus neutralization assays will also be performed on sera from non-human primates (NHPs) that received the mRNA vaccine at two different doses.

[0438] To evaluate the ability of the mRNA vaccine to elicit potent neutralizing antibodies against novel SARS-CoV-2 variants, non-human primates (NHPs) will be administered two 30 μg doses of the mRNA vaccine over a 3-4 week period and serum will be collected. Similarly, human participants will be administered two 100 μg doses of the mRNA vaccine in a prime-boost regimen and their serum will be collected. Collected serum will be analyzed for neutralizing properties. Neutralizing activity will be measured using SARS-CoV-2 full-length spike pseudotyped recombinant VSV-ΔG firefly luciferase virus and antibody levels will be measured in a pseudovirus neutralization assay against isotypic SARS-CoV-2_D614 containing the spike protein from the USA-WA1 / 2020 isolate (D614), the D614G version, or the spike protein from the 20A.EU1, 20A.EU2, and mink cluster 5 variants (Table 2).

[0439] NHPs will be vaccinated with 30 or 100 μg of mRNA vaccine and analyzed on days 1 and 29. Neutralizing antibody responses will be measured using both lentiviral and VSV-based PsVN assays. Pseudoviruses in both assays incorporate full-length Spike protein and confer isolated, partial, or complete mutation sets present in the USA-WA1 / 2020(D614), G614, B.1.1.7, and B.1.351 lineages.

[0440] Human sera collected as described above will be further analyzed for neutralization against B.1.1.7 and B.1.351.

[0441] method Animal studies. Rhesus macaques (NHPs) are immunized in a prime-boost schedule with 10 or 30 μg of mRNA encoding the spike protein with two proline substitutions ("mRNA vaccine"), and serum is collected 4 weeks (day 56) after the booster dose.

[0442] Human studies. Humans are immunized with 100 μg of mRNA encoding a protein containing the N-terminal domain (NTD), receptor binding domain (RBD), and influenza hemagglutinin transmembrane (HATM) domain linked by a linker (NTD-RBD-HATM) ("mRNA vaccine") in a prime-boost schedule, with serum collected one week after the boost (day 36).

[0443] Neutralization of lentivirus-based pseudoviruses. To generate SARS-CoV-2 pseudotyped lentiviruses, a codon-optimized CMV / R-SARS-CoV-2 S (USA-WA1 / 2020 isolate, GenBank: MN908947.3) plasmid is constructed and then modified by site-directed mutagenesis to contain the D614G mutation. Additional spike mutations are implemented in the D614G backbone (i.e., N501Y, E484K, N439K, and other combinations similar to those in the B.1.1.7 and B.1.351 variants; Table 3). Pseudoviruses are produced by co-transfecting HEK293T / 17 cells (ATCC CRL-11268) with plasmids encoding a luciferase reporter, lentiviral backbone, and the SARS-CoV-2 S gene as previously described (Wang et al. Evaluation of candidate vaccine approaches for MERS-CoV. Nat Commun 6, 7712). In addition, a human transmembrane protease serine 2 (TMPRSS2) plasmid is co-transfected to generate pseudoviruses (Bottcher, E. et al. Proteolytic activation of influenza viruses by serine proteases TMPRSS2 and HAT from human airway epithelium. J. Virol. 80, 9896-9898 (2006)). Neutralizing antibody responses in serum are assessed by pseudoneutralization assays as previously described (Jackson et al., 2020). Briefly, heat-inactivated serum is serially diluted in duplicate, mixed with pseudovirus, and incubated for approximately 45 min at 37°C with 5% CO2. 293T-hACE2.mF cells are cultured at 7.5 x 10 in DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. 4The serum is diluted to a concentration of 100 cells / mL and added to the serum-pseudovirus mixture. After 72 hours, the cells are lysed and the luciferase activity (in relative light units (RLU)) is measured. The neutralization percentage is normalized considering uninfected cells as 100% neutralization and cells infected only with pseudovirus as 0% neutralization. IC 50 Potencies are determined using a log (agonist) vs. normalized response (variable slope) nonlinear regression model in Prism v8 (GraphPad).

[0444] Neutralization of recombinant VSV-based pseudoviruses. Codon-optimized full-length spike proteins of the USA-WA1 / 2020 isolate (D614), D614G, or the designated spike mutants listed in Tables 2 and 3 are cloned into the pCAGGS vector. To generate SARS-CoV-2 full-length spike pseudotyped recombinant VSV-ΔG-firefly luciferase viruses, BHK-21 / WI-2 cells (Kerafast, EH1011) are transfected with spike expression plasmids and subsequently infected with VSVΔG-firefly luciferase as previously described (Whitt, 2010, Journal of Virological Methods 169, 365-374). For the neutralization assay, serially diluted serum samples are mixed with pseudoviruses and incubated at 37°C for 45 min. The virus and serum mixture is then used to infect A549-hACE2-TMPRSS2 cells for 18 h at 37°C, after which ONE-Glo reagent (Promega E6120) is added to measure the luciferase signal (relative light units; RLU). The percentage of neutralization is calculated based on the RLU of the virus-only control and subsequently analyzed using a four-parameter logistic curve (Prism 8).

[0445] Example 2. Immunization with two doses of mRNA encoding mutant spike protein to generate neutralizing antibodies against mutant spike protein A composition comprising mRNA encoding a mutant spike protein (NTD-RBD-HATM) formulated in LNP (as described in Example 1) is administered to a subject, such as a mouse, hamster, rhesus monkey, or human. After a period of time, such as 3 weeks, the subject is vaccinated with the same composition as a booster dose. The mutant spike proteins encoded by the mRNA are listed in Table 3. The spike protein-specific neutralization titers are quantified by a VSVΔG-based SARS-CoV-2 pseudovirus neutralization assay, in which a VSVΔG-based SARS-CoV-2 pseudovirus expresses the same mutant spike protein encoded by the mRNA in the composition.

[0446] After a period of time, such as 3 weeks after the booster dose, protection from infection is assessed by introducing SARS-CoV-2 expressing wild-type or mutant spike proteins into the subjects' nasal passages, and the subjects are then monitored over the course of a period of time, such as 2 weeks, to quantify the amount of SARS-CoV-2 RNA or protein present in the nasal passages during the monitoring period after viral challenge. [Table 2]

[0447] Example 3. Immunization with a prime dose of mRNA encoding wild-type spike protein and a booster dose of mRNA encoding mutant spike protein to generate neutralizing antibodies against mutant spike protein

[0448] A composition comprising mRNA encoding a spike protein antigen fusion (NTD-RBD-HATM) formulated in LNP (as described in Example 1) is administered to a subject, such as a mouse, hamster, rhesus monkey, or human. After a period of time, such as 3 weeks, the subject is vaccinated with a composition comprising mRNA encoding a mutant spike protein (NTD-RBD-HATM) formulated in LNP as a booster dose. The mutant spike proteins encoded by the mRNA are listed in Table 3. The spike protein-specific neutralization titer is quantified by a VSVΔG-based SARS-CoV-2 pseudovirus neutralization assay, in which the VSVΔG-based SARS-CoV-2 pseudovirus expresses the same mutant spike protein encoded by the mRNA in the composition used in the booster dose.

[0449] After a period of time, such as 3 weeks, following the booster dose, protection from infection is assessed by introducing SARS-CoV-2 expressing wild-type or mutant spike proteins into the subject's nasal passages, and the subject is then monitored for a period of time, such as 2 weeks, to quantify the amount of SARS-CoV-2 RNA or protein present in the nasal passages during the monitoring period following viral challenge.

[0450] Example 4. Immunization with a prime dose of mRNA encoding wild-type spike protein and booster doses of mRNA encoding mutant spike proteins to generate neutralizing antibodies against mutant spike proteins A composition comprising an mRNA encoding a spike protein antigen fusion (NTD-RBD-HATM) formulated in LNP (as described in Example 1) is administered to a subject, such as a mouse, hamster, rhesus monkey, or human. After a period of time, such as 3 weeks, the subject is vaccinated with a composition comprising multiple mRNAs, each encoding a different mutant spike protein antigen fusion (NTD-RBD-HATM) formulated in LNP, as a booster dose. The mutant spike protein antigen fusions encoded by the mRNAs are listed in Table 3. Spike protein specific titers are quantified by a VSVΔG-based SARS-CoV-2 pseudovirus neutralization assay, in which the VSVΔG-based SARS-CoV-2 pseudovirus expresses the wild-type sequence of the spike protein antigen fusion protein or the mutant spike protein antigen fusion encoded by the booster dose composition.

[0451] After a period of time, such as 3 weeks, following the booster dose, protection from infection is assessed by introducing SARS-CoV-2 expressing wild-type or mutant spike proteins into the subject's nasal passages, and the subject is then monitored for a period of time, such as 2 weeks, to quantify the amount of SARS-CoV-2 RNA or protein present in the nasal passages during the monitoring period following viral challenge.

[0452] Example 5. Immunization with two doses of multiple mRNAs encoding mutant spike proteins to generate neutralizing antibodies against mutant spike proteins

[0453] A composition comprising multiple mRNAs, each encoding a different mutant spike protein antigen fusion (NTD-RBD-HATM), formulated in LNP (as described in Example 1), is administered to a subject, such as a mouse, hamster, rhesus monkey, or human. The mutant spike protein antigen fusions encoded by the mRNAs are listed in Table 3. After a period of time, such as 3 weeks, the subject is vaccinated with the same composition as a first booster dose. Spike protein specific titers are quantified by a VSVΔG-based SARS-CoV-2 pseudovirus neutralization assay, in which the VSVΔG-based SARS-CoV-2 pseudovirus expresses the wild-type or mutant spike protein encoded by the composition.

[0454] After a period of time, such as 3 weeks, after the first booster dose, protection from infection is assessed by introducing SARS-CoV-2 expressing wild-type or mutant spike protein into the subject's nasal cavity. The subject is then monitored for a period of time, such as 2 weeks, to quantify the amount of SARS-CoV-2 RNA or protein present in the nasal cavity over the monitoring period after viral challenge. In certain populations, a third dose may be administered as another booster dose.

[0455] Example 6: Coronavirus Strain Challenge

[0456] The study is designed to test the efficacy of candidate coronavirus vaccines comprising mRNAs disclosed herein encoding a coronavirus antigen (e.g., spike (S) protein, the S1 subunit (S1) of the spike protein, or the S2 subunit (S2) of the spike protein, domains, etc.), e.g., SARS-CoV-2 antigens, against a lethal challenge with a coronavirus in hamsters, mice, and / or rabbits. Animals are challenged with a lethal dose (10xLD90; approximately 100 plaque forming units; PFU) of the coronavirus.

[0457] Animals used are groups of approximately 10 animals approximately 6-8 weeks of age. Animals are vaccinated at weeks 0 and 3 via IM, ID or IV administration routes. Candidate vaccines may be chemically modified or unmodified. Animal sera are tested for microneutralization. Animals are then challenged at approximately weeks 6-8 with approximately 1 LD90 of coronavirus via IN, IM, ID or IV administration routes. Endpoints are approximately 13-15 days after infection, death, or euthanasia. Animals exhibiting severe symptoms as judged by more than 30% weight loss, extreme lethargy or paralysis are euthanized. Temperatures and weights are assessed and recorded daily.

[0458] Example 7 - In vivo expression of SARS-CoV-2 mRNA vaccine constructs 6-8 week old BALB / c mice are administered 2 μg or 10 μg of COVID-19 construct or Tris buffer (as a control) intramuscularly in each hind leg. Constructs contain any mRNA encoding an antigen disclosed herein in cationic lipid nanoparticles, 10.7 mM sodium acetate, 8.7% sucrose, 20 mM Tris (pH 7.5). One day later, spleens and lymph nodes are harvested and protein expression is detected using flow cytometry.

[0459] Example 8 - SARS-CoV-2 mRNA protects humanized mice against lethal challenge Humanized DPP4 288 / 330 + / + Mice are immunized with 0.01, 0.1, or 1 μg of SARS-CoV-2 mRNA-encoded antigen at weeks 0 and 3. Mock-immunized mice are immunized with PBS. Four weeks after the boost, mice are challenged with a lethal dose of mouse-adapted SARS-CoV. After challenge, mice are monitored for weight loss and signs of viral infection. On days 3 and 5 after challenge, lungs are harvested from five mice per group for analysis of viral titers and hemorrhage.

[0460] Example 9 - Immunogenicity of SARS-CoV-2 mRNA Encoding B.1.351 Spike Protein Antigen (1st and 2nd Booster Dose) BALB / c mice were immunized with 0.1 μg or 1 μg of mRNA encoding spike protein antigen fusion (NTD-RBD-HATM) on days 1 and 22 (n=8 / group). Mice were then administered the first booster dose (dose 3; 0.1 μg or 1 μg) on ​​day 213 and the second booster dose (dose 4; 0.1 μg or 1 μg) on ​​day 234. The first and second booster doses contained mRNA encoding spike protein antigen fusions with the following mutations relative to wild-type SARS-CoV-2 virus: L18F, ΔH69, ΔV70, D80A, ΔY144, D215G, L242, Δ244, R246I, K417N, E484K, and N501Y). For each vaccine, the mRNA was formulated in lipid nanoparticles (LNPs) containing 0.5-15% PEG-modified lipid, 5-25% non-cationic lipid, 25-55% sterol, and 20-60% ionizable amino lipid. The PEG-modified lipid was 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG), the non-cationic lipid was 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol was cholesterol, and the ionizable amino lipid had the structure, for example, Compound 1.

[0461] Blood was collected on days 36, 212, and 233 and analyzed by pseudovirus neutralization assays described herein. Briefly, pseudoviruses were constructed using the Wuhan-Hu-1 spike containing the mutation D614G (a comparator variant known as D614G) alone or in combination with additional mutations found in B.1.351 (L18F, D80A, D215G, Δ242-244, R246I, K417N, E484K, N501Y, A701V). Neutralization assays were performed using a validated lentivirus-based spike pseudotyped virus assay in 293T cells stably transduced to overexpress ACE24.

[0462] Figures 4A-4C show neutralizing antibody titers in mice on day 212 (before the third dose, 1 µg) and day 233 (after the third dose). As shown in Figure 4A, neutralizing antibody titers increased from day 212 to day 233 against the D614 mutant spike protein and more dramatically against the B.1.351 mutant spike protein. In both cases, the antibody titers on day 233 declined by approximately two-fold over the six-month period from day 36 to day 212. For example, neutralizing antibody titers against D614G (ID 50 ) was 29,242 on day 36 and 15,444 on day 212 (data not shown). As shown in Figure 4B, the neutralization titers on day 233 were 4.9-fold higher against the D614G mutant spike protein than on day 212, and 41-fold higher against the B.1.351 mutant spike protein. Figure 4C shows that the D614G mutant spike protein induced a neutralization titer 4.4-fold higher than that against the B.1.351 mutant spike protein. However, after the third dose (day 233), the neutralization titer induced against the D614G mutant spike protein was 0.5-fold higher than that induced by the B.1.351 mutant spike protein.

[0463] 5A-5C show the neutralizing antibody titers of mice on day 212 (before the third dose, 0.1 μg) and day 233 (after the third dose). As shown in FIG. 5A, the neutralizing antibody titers increased from day 212 to day 233 against the D614 mutant spike protein and against the B.1.351 mutant spike protein. In both cases, the antibody titers on day 233 were higher than those measured on day 36 (14 days after the second dose). As shown in FIG. 5B, the neutralizing titers on day 233 were 22-fold higher than on day 212 against the D614G mutant spike protein and 41-fold higher against the B.1.351 mutant spike protein. FIG. 5C shows that the D614G mutant spike protein induced a neutralizing titer 3.2-fold higher than that against the B.1.351 mutant spike protein. However, after the third dose (day 233), the neutralizing titer induced by the D614G mutant spike protein was 1.8-fold higher than that induced by the B.1.351 mutant spike protein.

[0464] Example 10. Immunization with two doses of multiple mRNAs encoding mutant spike proteins to generate neutralizing antibodies against mutant spike proteins BALB / c mice aged 6-8 weeks are administered 1 μg or 10 μg of mRNA encoding SARS-CoV-2 antigens or PBS (as a control) intramuscularly in one hind leg (formulated as a 50 μL dose) on days 1 and 22. For each vaccine, the mRNA is formulated in lipid nanoparticles (LNPs) containing 0.5-15% PEG-modified lipid, 5-25% non-cationic lipid, 25-55% sterol, and 20-60% ionizable amino lipid. The PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG), the non-cationic lipid is 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol is cholesterol, and the ionizable amino lipid has the structure of, for example, Compound 1. The groups tested are shown in Table 4. [Table 3]

[0465] Blood samples are taken from the mice on days 14, 21, and 36 and analyzed by ELISA and neutralization assays as described herein.

[0466] Example 11: In vitro neutralization screening Codon-optimized full-length spike protein of the D614G mutant or spike protein of the B.1.351 mutant were cloned into the pCAGGS vector. For neutralization assays, serially diluted serum samples were mixed with pseudovirus and incubated at 37°C for 45 min. Serum samples were from mice administered 1 μg of NTD-RBD-HATM, NTD_ext-RBD_ext-TM or RBD__WH2020_NatSP_317_516__TM(RBD-HATM). The virus-serum mixture was then used to infect A549-hACE2-TMPRSS2 cells for 18 h at 37°C, after which neutralizing antibody titers were measured. The results are shown in Figures 1 to 3 and demonstrate that NTD-RBD-HATM had a 3.3-fold reduction in neutralization titers against the B.1.351 variant compared to titers resulting from the D614G pseudovirus, NTD_ext-RBD_ext-TM had a 3.5-fold reduction in neutralization titers between the D614 and B.1.351 variants, and RBD__WH2020_NatSP_317_516_TM had no significant reduction in neutralization titers against the B.1.351 variant compared to titers resulting from the D614G pseudovirus.

[0467] Example 12. Immunization with four doses of mRNA encoding mutant spike protein to generate neutralizing antibodies against mutant spike protein BALB / c mice aged 6–8 weeks were administered 1 μg (Figures 6A–6D) or 0.1 μg (Figures 7A–7D) of mRNA encoding SARS-CoV-2 antigens, specifically NTD-RBD-HATM, or PBS (as a control) intramuscularly (formulated as a 50 μL dose) in one hind leg on days 1 (first dose, prime) and 22 (second dose, booster). Mice were administered either 1 μg (Figures 6A-6D) or 0.1 μg (Figures 7A-7D) of mRNA encoding the mutant SARS-CoV-2 antigen (mRNA-1283.351), NTD-RBD-HATM_L18F_D80A_D215G_L242_244del_R246I_K417N_E484K_N501Y (containing the mutations associated with the B.1.351 variant), on days 213 (third dose) and 234 (fourth dose). For each vaccine, the mRNA was formulated in lipid nanoparticles (LNPs) containing 0.5–15% PEG-modified lipid, 5–25% non-cationic lipid, 25–55% sterol, and 20–60% ionized amino lipid. The PEG-modified lipid was 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG), the non-cationic lipid was 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol was cholesterol, and the ionizable amino lipid had the structure, for example, of compound 1. Serum was collected from mice on days 212 (before the third dose), 233 (21 days after the third dose, before the fourth dose), and 248 (14 days after the fourth dose) and analyzed for neutralization titers against VSV-based pseudoviruses expressing SARS-CoV-2 spike proteins containing either 1) the D614G mutation relative to the sequence of the WH2020 full-length spike protein, or 2) a mutation associated with the B.1.351 variant.

[0468] The results of these neutralization assays for mice administered a 1 μg dose of mRNA in each vaccine are shown in Figures 6A-6D. Each of the third and fourth doses increased the mean neutralization titers of sera against D614G and B.1.351 spike proteins (Figure 6A). Neutralization titers against pseudoviruses carrying each spike protein increased over time, and this increase was more pronounced in neutralization titers against B.1.351 spike protein (Figure 6B). Before the third dose, sera were approximately 4.4 times more effective at neutralizing D614G spike protein than B.1.351 spike protein (Figure 6C). However, after each of the third and fourth doses, neutralization titers were roughly equivalent between both spike proteins, and sera neutralized D614G spike protein and B.1.351 spike protein by approximately 90% (Figure 6C). Furthermore, neutralizing titers against either spike protein after the fourth dose were >3-fold higher than the reference neutralizing titers against the D614G spike protein on day 36, 14 days after the second dose (Figures 6A, 6D). These results demonstrate that administration of mRNA encoding the mutant spike protein effectively elicits neutralizing antibodies against the mutant spike protein and boosts (boosts) the antibody response against the spike protein encoded by the previously administered initial mRNA.

[0469] The results of these neutralization assays are shown in Figures 7A-7D for mice administered a 0.1 μg dose of mRNA in each vaccine. The third and fourth doses each increased the mean neutralization titers of sera against the D614G and B.1.351 spike proteins (Figure 7A). Neutralization titers against each spike protein increased over time, and this increase was more pronounced in neutralization titers against pseudoviruses carrying the B.1.351 spike protein (Figure 7B). Before the third dose, sera were approximately 3.5-fold more effective at neutralizing the D614G spike protein than the B.1.351 spike protein (Figure 7C). However, after the third and fourth doses, respectively, neutralization titers were greater for pseudoviruses carrying the B.1.351 spike protein, with pseudoviruses carrying the B.1.351 spike protein neutralizing sera approximately 1.8-fold higher after the third dose and 2.5-fold higher after the fourth dose of the D614G spike protein (Figure 7C). Furthermore, neutralization titers against pseudoviruses carrying either spike protein after the fourth dose were more than 8-fold higher than the reference neutralization titers against the D614G spike protein at 14 days and 36 days after the second dose (Figures 7A, 7D). These results indicate that administration of mRNA encoding a mutant spike protein effectively elicits neutralizing antibodies against pseudoviruses carrying mutant spike proteins and boosts (boosts) antibody responses specific for the spike protein encoded by the previously administered mRNA.

[0470] Example 13: Immunization with two doses of mRNA encoding NTD-ext-RBD-ext-TM Six- to eight-week-old BALB / c mice were administered 0.1 μg, 1 μg, or 10 μg of mRNA encoding SARS-CoV-2 antigens, specifically NTD_ext-RBD_ext-TM (NTD-ext-RBD-ext-TM), or PBS (as a control) via intramuscular injection (formulated as a 50 μL volume) into one hind leg on days 1 (first dose, prime) and 22 (second dose, booster). Serum was collected from mice on days 21 (3 weeks after the first dose, prior to the second dose) and 36 (2 weeks after the second dose) and tested by ELISA to quantify total IgG specific for the parental SARS-CoV-2 spike protein with the WH2020 amino acid sequence. Each first dose of mRNA encoding the NTD-ext-RBD-ext-TM spike antigen elicited a robust SARS-CoV-2 spike protein-specific antibody response, and a second booster dose increased IgG titers 10- to 100-fold in each dose group (Figure 8A).

[0471] Sera obtained on day 36 from mice vaccinated twice with 1 μg doses of mRNA encoding NTD-ext-RBD-TM were also evaluated for neutralizing activity against a panel of VSV-based pseudoviruses each expressing a different SARS-CoV-2 spike protein. The panel of spike proteins tested is shown in Table 5. This included the D614G spike protein, the B.1.351 spike protein, the P.1 spike protein, the B.1.1.7 spike protein, and the B.1.1.7 spike protein (containing the E484K mutation). The results of these neutralization assays are shown in Figures 8B-8D. Two 1 μg doses of mRNA encoding NTD-ext-RBD-ext-TM elicited potent neutralizing antibody responses against pseudoviruses carrying each of the Spike proteins tested (Figure 8B). Neutralizing titers against each mutant spike protein carrying the E484K mutation, B.1.351, P.1, and B.1.1.7, were 2-3 times lower than those against the D614G reference spike protein (Figure 8C). However, compared with reference serum from mice administered two 1 μg doses of mRNA encoding the 2P-stabilized WH2020 full-length spike protein, serum from mice administered two 1 μg doses of mRNA encoding NTD-ext-RBD-ext-TM was 1.5-2 times more effective at neutralizing pseudoviruses carrying each spike protein tested (Figures 8B, 8D). These results indicate that mRNA encoding an NTD-RBD-TM fusion protein with an extended receptor-binding domain and transmembrane domain elicits potent neutralizing antibody responses against multiple SARS-CoV-2 mutant spike proteins. [Table 4]

[0472] Example 14 - Immunogenicity of the third dose of SARS-CoV-2 mRNA Six- to eight-week-old BALB / c mice were administered 1 µg of mRNA encoding SARS-CoV-2 antigens or PBS (as a control) intramuscularly in one hind leg (formulated as a 50 µL dose) on days 1 and 22. Mice were then administered a third dose containing mRNA encoding spike protein variants (mRNA-1283, mRNA-1283.351, mRNA-1283.617.2, mRNA-1283+mRNA-1283.351, mRNA-1283+mRNA-1283.617.2, or mRNA-1283+mRNA-1283.351+mRNA-1283.617.2) at week 8 (day 57). For each vaccine, the mRNA was formulated in lipid nanoparticles (LNPs) containing 0.5-15% PEG-modified lipid, 5-25% non-cationic lipid, 25-55% sterol, and 20-60% ionizable amino lipid. The PEG-modified lipid was 1,2 dimyristoyl-sn-glycerol, methoxypolyethylene glycol (PEG2000 DMG), the non-cationic lipid was 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol was cholesterol, and the ionizable amino lipid had the structure, for example, Compound 1.

[0473] Blood samples were taken on days 21, 36, and 78 and analyzed by ELISA and neutralization assays described herein. Neutralization titers are shown in Table 5. [Table 5]

[0474] As shown above, all third (booster) doses resulted in increased neutralizing antibody production above that observed on day 21 (just before administration of the second dose) and day 36 (2 weeks after administration of the second dose). In samples challenged with the S2P antigen (spike protein containing a double proline mutation), increased titer levels were seen in all groups after the third shot (booster). All titers were within 2-fold of the other formulations, indicating that the combination formulations perform comparably to the single (monovalent) formulations. Among the monovalent groups, the highest titers were achieved with mRNA-1283.617.2, while the mRNA-1283+1283.617.2 formulation achieved the highest titers. For the NTD and RBD antigens, the mRNA-1283 formulation produced the greatest antibody titers.

[0475] References 1 Zhou,P.et al.A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 579,270-273,doi:10.1038 / s41586-020-2012-7(2020). 2 Coronaviridae Study Group of the International Committee on Taxonomy of,V.The species Severe acute respiratory syndrome-related coronavirus:classifying 2019-nCoV and naming it SARS-CoV-2. Nat Microbiol 5,536-544,doi:10.1038 / s41564-020-0695-z(2020). 3 Wrapp, D. et al. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 367,1260-1263,doi:10.1126 / science.abb2507(2020). 4 Jackson,L.A.et al.An mRNA Vaccine against SARS-CoV-2 - Preliminary Report. N Engl J Med 383,1920-1931,doi:10.1056 / NEJMoa2022483(2020). 5 Baden,L.R.et al.Safety and immunogenicity of two heterologous HIV vaccine regimens in healthy,HIV-uninfected adults(TRAVERSE):a randomised,parallel-group,placebo-controlled,double-blind,phase 1 / 2a study. Lancet HIV 7,e688-e698,doi:10.1016 / S2352-3018(20)30229-0(2020). 6 FDA(2021) COVID-19 Vaccines.https: / / www.fda.gov / emergency-preparedness-and-response / coronavirus-disease-2019-covid-19 / covid-19-vaccines. 7 Korber,B.et al.Tracking Changes in SARS-CoV-2 Spike:Evidence that D614G Increases Infectivity of the COVID-19 Virus. Cell 182,812-827 e819,doi:10.1016 / j.cell.2020.06.043(2020). 8 Plante,J.A.et al.Spike mutation D614G alters SARS-CoV-2 fitness. Nature 592,116-121,doi:10.1038 / s41586-020-2895-3(2021). 9 Volz,E.et al.Evaluating the Effects of SARS-CoV-2 Spike Mutation D614G on Transmissibility and Pathogenicity. Cell 184,64-75 e11,doi:10.1016 / j.cell.2020.11.020(2021). 10 Yurkovetskiy,L.et al.Structural and Functional Analysis of the D614G SARS-CoV-2 Spike Protein Variant. Cell 183,739-751 e738,doi:10.1016 / j.cell.2020.09.032(2020). 11 Walls,A.C.et al.Structure,Function,and Antigenicity of the SARS-CoV-2 Spike Glycoprotein. Cell 181,281-292 e286,doi:10.1016 / j.cell.2020.02.058(2020). 12 Letko,M.,Marzi,A.& Munster,V.Functional assessment of cell entry and receptor usage for SARS-CoV-2 and other lineage B betacoronaviruses. Nat Microbiol 5,562-569,doi:10.1038 / s41564-020-0688-y(2020). 13 Wang,Q.et al.Structural and Functional Basis of SARS-CoV-2 Entry by Using Human ACE2. Cell 181,894-904 e899,doi:10.1016 / j.cell.2020.03.045(2020). 14 Shang,J.et al.Cell entry mechanisms of SARS-CoV-2. Proc Natl Acad Sci U S A 117,11727-11734,doi:10.1073 / pnas.2003138117(2020). 15 Keech,C.et al.Phase 1-2 Trial of a SARS-CoV-2 Recombinant Spike Protein Nanoparticle Vaccine. N Engl J Med 383,2320-2332,doi:10.1056 / NEJMoa2026920(2020). 16 Walsh,E.E.et al.Safety and Immunogenicity of Two RNA-Based Covid-19 Vaccine Candidates. N Engl J Med 383,2439-2450,doi:10.1056 / NEJMoa2027906(2020). 17 Anderson,E.J.et al.Safety and Immunogenicity of SARS-CoV-2 mRNA-1273 Vaccine in Older Adults. N Engl J Med 383,2427-2438,doi:10.1056 / NEJMoa2028436(2020). 18 McCallum,M.et al.N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2. Cell,doi:10.1016 / j.cell.2021.03.028(2021). 19 Li,Q.et al.The Impact of Mutations in SARS-CoV-2 Spike on Viral Infectivity and Antigenicity. Cell 182,1284-1294 e1289,doi:10.1016 / j.cell.2020.07.012(2020). 20 Tegally,H.et al.Detection of a SARS-CoV-2 variant of concern in South Africa. Nature,doi:10.1038 / s41586-021-03402-9(2021). 21 Shen,X.et al.SARS-CoV-2 variant B.1.1.7 is susceptible to neutralizing antibodies elicited by ancestral spike vaccines. Cell Host Microbe,doi:10.1016 / j.chom.2021.03.002(2021). 22 Wibmer,C.K.et al.SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma. Nat Med,doi:10.1038 / s41591-021-01285-x(2021). 23 Voysey,M.et al.Safety and efficacy of the ChAdOx1 nCoV-19 vaccine(AZD1222) against SARS-CoV-2:an interim analysis of four randomised controlled trials in Brazil,South Africa,and the UK. Lancet 397,99-111,doi:10.1016 / S0140-6736(20)32661-1(2021). 24 Voysey,M.et al.Single-dose administration and the influence of the timing of the booster dose on immunogenicity and efficacy of ChAdOx1 nCoV-19(AZD1222) vaccine:a pooled analysis of four randomised trials. Lancet 397,881-891,doi:10.1016 / S0140-6736(21)00432-3(2021). 25 Andreano,E.et al.SARS-CoV-2 escape in vitro from a highly neutralizing COVID-19 convalescent plasma.bioRxiv,doi:10.1101 / 2020.12.28.424451(2020). 26 Hoffmann,M.et al.SARS-CoV-2 variants B.1.351 and P.1 escape from neutralizing antibodies. Cell,doi:10.1016 / j.cell.2021.03.036(2021). 27 Garcia-Beltran,W.F.et al.Multiple SARS-CoV-2 variants escape neutralization by vaccine-induced humoral immunity. Cell,doi:10.1016 / j.cell.2021.03.013(2021). 28 Starr,T.N.et al.Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding. Cell 182,1295-1310 e1220,doi:10.1016 / j.cell.2020.08.012(2020). 29 Starr,T.N.et al.Deep mutational scanning of SARS-CoV-2 receptor binding domain reveals constraints on folding and ACE2 binding.bioRxiv,doi:10.1101 / 2020.06.17.157982(2020). 30 Tada,T.et al.Decreased neutralization of SARS-CoV-2 global variants by therapeutic anti-spike protein monoclonal antibodies.bioRxiv,doi:10.1101 / 2021.02.18.431897(2021). 31 Tada,T.et al.Neutralization of viruses with European,South African,and United States SARS-CoV-2 variant spike proteins by convalescent sera and BNT162b2 mRNA vaccine-elicited antibodies.bioRxiv,doi:10.1101 / 2021.02.05.430003(2021). 32 Deng,X.et al.Transmission,infectivity,and antibody neutralization of an emerging SARS-CoV-2 variant in California carrying a L452R spike protein mutation.medRxiv,doi:10.1101 / 2021.03.07.21252647(2021). 33 Greaney,A.J.et al.Comprehensive mapping of mutations in the SARS-CoV-2 receptor-binding domain that affect recognition by polyclonal human plasma antibodies. Cell Host Microbe 29,463-476 e466,doi:10.1016 / j.chom.2021.02.003(2021). 34 Wang,P.et al.Antibody resistance of SARS-CoV-2 variants B.1.351 and B.1.1.7.Nature,doi:10.1038 / s41586-021-03398-2(2021). 35 Zhou,H.et al.B.1.526 SARS-CoV-2 variants identified in New York City are neutralized by vaccine-elicited and therapeutic monoclonal antibodies.bioRxiv,doi:10.1101 / 2021.03.24.436620(2021). 36 Wu,K.et al.Serum Neutralizing Activity Elicited by mRNA-1273 Vaccine. N Engl J Med,doi:10.1056 / NEJMc2102179(2021). 37 Novavax(2021). Novavax COVID-19 Vaccine Demonstrates 89.3% Efficacy in UK Phase 3 Trial.Press Release January 28,2021:https: / / ir.novavax.com / node / 15506 / pdf 38 K,E.et al.Efficacy of ChAdOx1 nCoV-19(AZD1222) vaccineagainst SARS-CoV-2 variant of concern 202012 / 01(B.1.1.7):an exploratory analysis of a randomisedcontrolled trial.Lancet,doi:10.1016 / S0140-6736(21)00628-0(2021). 39 Pfizer(2021) Pfizer and BioNTech confirm high efficacy and no serious safety concerns through up to six months following second dose in updated topline analysis of landmark COVID-19 vaccine study. Press Release(プレスリリース) April 1,2021:https: / / www.pfizer.com / news / press-release / press-release-detail / pfizer-and-biontech-confirm-high-efficacy-and-no-serious. 40 Corbett,K.S.et al.SARS-CoV-2 mRNA vaccine design enabled by prototype pathogen preparedness. Nature 586,567-571,doi:10.1038 / s41586-020-2622-0(2020). 41 Ho,D.et al.Increased Resistance of SARS-CoV-2 Variants B.1.351 and B.1.1.7 to Antibody Neutralization. Res Sq,doi:10.21203 / rs.3.rs-155394 / v1(2021). 42 Wrobel,A.G.et al.SARS-CoV-2 and bat RaTG13 spike glycoprotein structures inform on virus evolution and furin-cleavage effects. Nat Struct Mol Biol 27,763-767,doi:10.1038 / s41594-020-0468-7(2020). 43 Lan,J.et al.Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature 581,215-220,doi:10.1038 / s41586-020-2180-5(2020). 44 Nelson,J.et al.Impact of mRNA chemistry and manufacturing process on innate immune activation. Sci Adv 6,eaaz6893,doi:10.1126 / sciadv.aaz6893(2020). 45 Hassett,K.J.et al.Optimization of Lipid Nanoparticles for Intramuscular Administration of mRNA Vaccines. Mol Ther Nucleic Acids 15,1-11,doi:10.1016 / j.omtn.2019.01.013(2019). 46 John,S.et al.Multi-antigenic human cytomegalovirus mRNA vaccines that elicit potent humoral and cell-mediated immunity. Vaccine 36,1689-1699,doi:10.1016 / j.vaccine.2018.01.029(2018). 47 Bahl, K. et al. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vac...

Claims

1. A vaccine comprising messenger ribonucleic acid (mRNA) formulated in lipid nanoparticles, said mRNA comprising an open reading frame encoding a fusion protein comprising an N-terminal domain (NTD) of SARS-CoV-2 spike (S) protein linked to a receptor binding motif (RBM) of said SARS-CoV-2 S protein by a first GS linker, said RBM being linked to a transmembrane domain (TD) by a second GS linker, said open reading frame comprising nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine, and said fusion protein having one or more of the following amino acid mutations relative to SEQ ID NO:36: G142D, ΔN211, L212I, S373P, S375F, N440K, Q498R, and Y505H.

2. A vaccine comprising messenger ribonucleic acid (mRNA) formulated in lipid nanoparticles, said mRNA comprising an open reading frame encoding a fusion protein comprising an N-terminal domain (NTD) of SARS-CoV-2 spike (S) protein linked to a receptor binding motif (RBM) of said SARS-CoV-2 S protein by a first GS linker, said RBM being linked to a transmembrane domain (TD) by a second GS linker, said open reading frame comprising nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine, and said fusion protein having one or more of the following amino acid mutations in the N-terminal domain relative to SEQ ID NO:36: G142D, ΔN211I, and L212I.

3. A vaccine comprising messenger ribonucleic acid (mRNA) formulated in lipid nanoparticles, said mRNA comprising an open reading frame encoding a fusion protein comprising an N-terminal domain (NTD) of SARS-CoV-2 spike (S) protein linked to a receptor binding motif (RBM) of said SARS-CoV-2 S protein by a first GS linker, said RBM being linked to a transmembrane domain (TD) by a second GS linker, said open reading frame comprising nucleosides consisting of N1-methyl-pseudouridine, adenosine, guanosine, and cytidine, said fusion protein having one or more of the following amino acid mutations in the receptor binding domain (RBD) relative to SEQ ID NO:36: S373P, S375F, N440K, Q498R, and Y505H.

4. A vaccine described in any one of claims 1 to 3, wherein the TD is an influenza hemagglutinin transmembrane domain.

5. The vaccine described in any one of claims 1 to 4, wherein the fusion protein is an NTD-RBM-TD fusion protein.

6. A vaccine described in any one of claims 1 to 5, wherein the RBM binds to the ACE2 receptor.

7. The vaccine of claim 1, wherein the lipid nanoparticles comprise a molar ratio of 40-55 mol% ionizable amino lipid, 5-15 mol% neutral lipid, 30-45 mol% sterol, and 1-5 mol% polyethylene glycol (PEG)-modified lipid.

8. The method of claim 1, wherein the ionizable amino lipid has the formula (I): 【Chemistry 1】 (In the formula, R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, and -R"M'R'; R 2 and R 3 are independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; R 4 is --(CH 2 ) n Q, where Q is --OR and n is selected from 1, 2, 3, 4, and 5; R 5 is H; R 6 is H; M and M' are independently selected from -C(O)O- and -OC(O)-; R 7 is H; R is H; R' is selected from the group consisting of C 1-18 alkyl and C 2-18 alkenyl; R″ is selected from the group consisting of C 3-14 alkyl and C 3-14 alkenyl; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13. The vaccine of claim 7 comprising a compound of formula:

9. The method of claim 1, wherein the ionizable amino lipid has the following structure: 【Chemistry 2】 9. The vaccine of claim 7 or 8, comprising a compound having the formula:

10. The vaccine of any one of claims 1 to 9, wherein the fusion protein comprises a receptor binding domain (RBD) that includes the RBM.

11. A vaccine as described in any one of claims 1 to 10 for use in a method for inducing an antigen-specific immune response in a subject, the method comprising administering the mRNA vaccine to the subject in an amount effective to result in the antigen-specific immune response.

12. A vaccine according to any one of claims 1 to 11 for use in the prevention of SARS-CoV-2 infection.

Images