Materials and methods for the treatment of lysosomal acid lipase deficiency (LAL-D)

Abstract

The present disclosure provides gene therapy vectors, such as adeno-associated viruses (AAVs), designed for the treatment of lysosomal acid lipase deficiency (LAL-D) disorders, such as Wolman disease and cholesterol ester storage disease (CESD). The disclosed rAAVs provide wild-type lipase A (LIPA) cDNA to a subject in need, which results in expression of the wild-type protein.

Description

[Technical field]

[0001] This application contains a sequence listing in computer readable form, which is incorporated by reference in its entirety as a separate part of this disclosure and is identified as follows: 54743_Seqlisting.txt, Size: 14,266 bytes, Creation date: January 21, 2022.

[0002] The present disclosure provides gene therapy vectors, such as adeno-associated viruses (AAVs), designed for the treatment of lysosomal acid lipase deficiency (LAL-D) disorders, such as Wolman disease and cholesterol ester storage disease (CESD). The disclosed rAAVs provide wild-type human lipase A (LIPA) cDNA to a subject in need, which results in expression of wild-type human LAL protein. [Background technology]

[0003] Lysosomal acid lipase deficiency (LAL-D) is a lysosomal storage disorder caused by recessive mutations in the lipase A (LIPA) gene that result in the failure of the lysosomal acid lipase (LAL) protein to adequately hydrolyze cholesterol esters to free cholesterol and triglycerides to free fatty acids in the lysosomes. LAL plays an important and essential role in controlling plasma lipoprotein levels and in preventing cellular lipid overload, especially in the liver and spleen (Li et al., Arterioscler Thromb Vasc Biol 39:850-856, 2019; Aguisanda et al. Curr Chem Genom Transl Med 11:1-18, 2017). The LIPA gene is the only gene with this lysosomal function in the human genome. LAL-D is a rare genetic disease with a prevalence ranging from 1 in 40,000 to 1 in 300,000, although disease incidence may be underestimated in some cases through failure to diagnose (Pastores et al., Lysosomal Acid Lipase Deficiency: Therapeutic Options. Drug Des Devel Ther 14:591-601, 2020).

[0004] Null LIPA gene mutations cause Wolman disease (WD), a fatal disease of infants named after Moshe Wolman, who reported one of the first cases (Abromov et al., AMA J Dis Child 91:282-286, 1956). WD is characterized by hepatomegaly with liver dysfunction, dyslipidemia (elevated serum triglycerides and LDL-cholesterol with reduced HDL-cholesterol), hepatosplenomegaly, pulmonary fibrosis, and adrenal calcification and dysfunction. Infants develop disease in the first month of life and are stunted, likely due to a combination of liver disease and an inability to absorb nutrients through the intestinal lining. The median life span of untreated WD infants is 3.7 months. LIPA mutations with partial loss of function, usually 1-12% of normal activity, cause a later-onset, less severe form of the disease, cholesterol-ester storage disease (CESD). CESD does not result in early death, but is associated with significant morbidity, including liver fibrosis and cirrhosis (and also liver failure). Chronic dyslipidemia in LAL-D may also lead to advanced atherosclerosis, cardiac disease, including myocardial infarction, and high risk of cerebrovascular complications, including stroke. Liver biopsies in LAL-D patients typically demonstrate microvascular and macrovascular fatty degeneration involving Kupffer cells and hepatocytes, with fibrosis and cirrhosis as the disease progresses. Unlike other lysosomal storage disorders, such as Gaucher disease and Niemann-Pick disease, there does not appear to be primary CNS involvement (although histological studies are lacking). Although LAL-D is a rare genetic disorder, the pathological findings in LAL-D refer to important health problems that are greater and much more common than those seen in the general population. For example, reduced LAL-D activity is a biomarker for nonalcoholic fatty liver disease, a disease that affects millions of U.S. adults and children. Such reductions in LAL activity are progressive with increasing severity of liver disease, and LIPA enzyme activity decreases from simple steatosis to nonalcoholic steatohepatitis to cryptogenic cirrhosis. In addition, there are LIPA haplotypes that are strongly associated with coronary artery disease [10, 11]. The accumulation of fatty acids in LAL-D mimics human conditions such as morbid obesity and obesity associated with type II diabetes. Given how easily AAV transduces the liver and how important it is for the liver to control lipoprotein-based metabolism, it is conceivable that LIPA gene therapy could be applied to these other genetic and even non-genetic human diseases associated with obesity, based on the relationship of LAL-D to fat absorption in these other disorders. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Li et al.,Arterioscler Thromb Vasc Biol 39:850-856,2019 [Non-Patent Document 2] Aguisanda et al.Curr Chem Genom Transl Med 11:1-18,2017 [Non-Patent Document 3] Pastores et al.,Lysosomal Acid Lipase Deficiency:Therapeutic Options.Drug Des Devel Ther 14:591-601,2020 [Non-Patent Document 4] Abromov et al., AMA J Dis Child 91:282-286,1956 Summary of the Invention [Means for solving the problem]

[0006] The present disclosure provides clinical AAV vectors for use in gene replacement therapy for LAL-D, including disorders caused by mutations in the LIPA gene and non-genetic disorders associated with lipid accumulation and storage.

[0007] In one aspect, described herein is a polynucleotide comprising (a) one or more regulatory control elements and (b) a LIPA cDNA sequence. In some embodiments, the regulatory control element is a miniCMV promoter comprising the nucleotide sequence set forth in SEQ ID NO:3, or a fragment thereof that retains regulatory control or promoter activity. In some embodiments, the vector comprises a late SV40 polyadenylation sequence having the nucleotide sequence of SEQ ID NO:5. In some embodiments, the LIPA cDNA is a LIPA variant 1 cDNA, and the LIPA cDNA comprises the polynucleotide sequence set forth in SEQ ID NO:1.

[0008] In one embodiment, the disclosure provides an rAAV comprising a nucleotide sequence encoding a functional lysosomal acid lipase (LAL) protein, the nucleotide having, for example, at least 65%, at least 70%, at least 75%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more typically at least 90%, 91%, 92%, 93%, or 94%, and even more typically at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1, and the protein retains LAL activity, such as hydrolyzing cholesterol esters to free cholesterol and triglycerides to free acids in the lysosome. For example, the nucleotide sequence encoding a functional LAL protein may include one or more base pair substitutions, deletions, or insertions that affect the function of the LIPA protein. Furthermore, the nucleotide sequence encoding a functional LIPA protein may contain one or more base pair substitutions, deletions, or insertions that may increase or decrease expression of the LAL protein, and this change in expression pattern may be desirable for the treatment of LAL-D or disorders associated with lipid storage and accumulation.

[0009] In another embodiment, the disclosure provides an rAAV comprising a nucleotide sequence encoding a functional LAL protein, the protein comprising an amino acid sequence having, for example, at least 65%, at least 70%, at least 75%, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more typically at least 90%, 91%, 92%, 93%, or 94%, and even more typically at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2, and the protein retains LAL activity, such as hydrolysis of cholesterol esters to free cholesterol and triglycerides to free acids in lysosomes. For example, the nucleotide sequence encoding a functional LAL protein can include one or more amino acid substitutions, deletions, or insertions that affect the function of the LAL protein.

[0010] The terms "sequence identity," "percent sequence identity," or "percent identical" in the context of nucleic acid or amino acid sequences refer to residues in two sequences that are the same when aligned for maximum correspondence. The length of sequence identity comparison can be the full length of a genome, the full length of a gene coding sequence, or a fragment of at least about 500-5000 nucleotides is desirable. However, identity between smaller fragments, such as at least about 9 nucleotides, usually at least about 20-24 nucleotides, at least about 28-32 nucleotides, at least about 36 nucleotides or more, may also be desirable. Percent sequence identity can be determined by techniques known in the art. For example, homology can be determined by directly comparing the sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs such as ALIGN, ClustalW2, and BLAST. In one embodiment, when BLAST is used as the alignment tool, the following default parameters are used: genetic code=standard; filter=none; strand=both; cutoff=60; prediction=10; matrix=BLOSUM62; explanation=50 sequences; sort=high score; database=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translation+Swiss Protein+Spupdate+PIR.

[0011] In another aspect, the disclosure provides a rAAV construct contained in a plasmid comprising the nucleotide sequence of SEQ ID NO:4. For example, the rscrAAVrh74.miniCMV.LIPA vector comprises a nucleotide sequence within and including the ITR of SEQ ID NO:4. The rAAV vector comprises a 5'ITR, a miniCMV promoter, a coding sequence for the human LIPA gene, an SV40 late polyA, and a 3'ITR. In this embodiment, the 3'ITR contains a deletion of a terminal resolution site (dTR) that inhibits Rep protein nicking of the single-stranded viral genome. The presence of dTR in the 3'ITR increases the self-complementary binding of the viral genome to itself, which may be due to its small (2.2 kB) size that allows the double-stranded viral genome to be packaged within the viral capsid. The self-complementary nature of rscAAVrh74.mCMV.LIPA promotes both the rate and extent of gene expression compared to constructs that remain as single-stranded viral genomes. In one embodiment, the vector comprises nucleotides 1853-3906 of SEQ ID NO:4. The nucleotides in the ITRs can be in forward or reverse orientation. For example, the miniCMV promoter sequence, the human LIPA gene sequence, and the SV40 late polyA sequence can be in forward or reverse orientation. In another embodiment, the vector comprises a nucleotide sequence having about at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to nucleotides 1-4397 of SEQ ID NO:4. The plasmid set forth in SEQ ID NO:4 further comprises kanamycin resistance and an origin of replication.

[0012] In another aspect, the present specification describes a recombinant adeno-associated virus (rAAV) having a genome comprising the polynucleotide sequence described herein.In some embodiments, the rAAV is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVrh74, AAVrh, AAV11, AAV12, AAV13, or Anc80, AAV7m8, or derivatives thereof.

[0013] In some embodiments, the genome of the rAAV comprises a miniCMV promoter and a LIPA cDNA. An exemplary genome comprises a miniCMV promoter and a LIPA cDNA, e.g., rscrAAVrh74.miniCMV.LIPA, a rAAV shown as nucleotides 1853-3906 of SEQ ID NO: 4. The compact CMV promoter allows AAV packaging of the self-complementary double-stranded viral genome, which is not possible with promoters having larger sizes.

[0014] In another aspect, described herein are rAAV particles that comprise a rAAV described herein.

[0015] The composition comprises any of the rAAVs described herein or any of the viral particles described herein. The disclosed compositions can be formulated for any means of delivery, such as direct injection into the cerebrospinal fluid, intraventricular delivery, intrathecal delivery, intraperitoneal delivery, intraarterial delivery, or intravenous delivery.

[0016] In addition, the disclosed compositions can be formulated for intravenous or intraperitoneal delivery and can be administered at a concentration of about 1e13vg / kg to about 2e14vg / kg, e.g., 8×10 13 The doses include those of rAAV or rAAV particles in vg / kg.

[0017] Specifically contemplated is a method of treating LAL-D or a disorder associated with lipid storage or accumulation in a subject in need thereof, comprising administering a polynucleotide, rAAV, or rAAV particle as described herein. In some embodiments, the method further comprises administering an immunosuppressant before, after, or simultaneously with the polynucleotide, rAAV, or rAAV particle. LAL-D includes disorders or diseases caused by mutations in the LIPA gene, such as Wolman's disease or cholesterol ester storage disease. Disorders associated with lipid storage or accumulation include coronary artery disease, atherosclerosis, type II diabetes, obesity, or non-alcoholic fatty liver disease.

[0018] The disclosure also provides methods of treating dyslipidemia or hypercholesterolemia in a subject in need thereof comprising administering a polynucleotide, rAAV, or rAAV particle described herein, in some embodiments, the method further comprises administering an immunosuppressant before, after, or simultaneously with the polynucleotide, rAAV, or rAAV particle.

[0019] The disclosure also provides methods of reducing triglycerides, cholesterol, and / or fatty acids in a subject in need thereof comprising administering a polynucleotide, rAAV, or rAAV particle described herein, in some embodiments, the method further comprises administering an immunosuppressant before, after, or simultaneously with the polynucleotide, rAAV, or rAAV particle.

[0020] In any of the disclosed methods, the polynucleotide, rAAV, rAAV particles, or composition is delivered intravenously to the subject. In some embodiments, the method further comprises administering an immunosuppressant. For example, the polynucleotide, rAAV, rAAV particles, or composition is administered simultaneously with, prior to, or after administration of an immunosuppressant, such as prednisone, prednisolone, rapamycin, methotrexate, myophenolate mofetil, tacrolimus, mycophenolate, or rituximab. In any of the methods, the subject has a mutation in the LIPA gene. These mutations include those currently known, such as those shown in Table 1 herein, or future identified mutations in the LIPA gene associated with LAL-D.

[0021] As used herein, a "subject" may be any animal, and may be referred to as a patient. Preferably, the subject is a vertebrate, and more preferably, the subject is a mammal, such as a farm animal (e.g., cow, horse, pig) or a pet (e.g., dog, cat). In some embodiments, the subject is a human. In some embodiments, the subject is a pediatric subject. In some embodiments, the subject is a pediatric subject, e.g., a subject in the age range of 1-10 years, and the subject is an infant in the age range of 1 month to 12 months. In some embodiments, the subject is 4-15 years old. The subject, in one embodiment, is an adolescent subject, e.g., a subject in the age range of 10-19 years old. In other embodiments, the subject is an adult (18 years or older).

[0022] In another aspect, described herein is the use of a polynucleotide, rAAV, or rAAV particle described herein in the preparation of a medicament for the treatment of LAL-D or a disorder associated with lipid storage or accumulation. In some embodiments, the LAL-D is Wolman's disease or cholesterol ester storage disease. In additional embodiments, the disorder associated with lipid storage or accumulation is coronary artery disease, atherosclerosis, type II diabetes, obesity, or non-alcoholic fatty liver disease.

[0023] Additionally, described herein is the use of a polynucleotide, rAAV, or rAAV particle described herein in the preparation of a medicament for treating dyslipidemia or hypercholesterolemia in a subject in need thereof.

[0024] The present disclosure also provides for the use of a polynucleotide, rAAV, or rAAV particle described herein in the preparation of a medicament for reducing triglycerides, cholesterol, and / or fatty acids in a subject in need thereof.

[0025] For example, any of the disclosed pharmaceutical agents are formulated for intravenous or intraperitoneal delivery. In some embodiments, the pharmaceutical agent is administered simultaneously with, prior to, or following administration of an immunosuppressant, such as prednisone, prednisolone, rapamycin, methotrexate, myophenolate mofetil, tacrolimus, mycophenolate, or rituximab.

[0026] In another aspect, described herein is a composition comprising a polynucleotide, rAAV, rAAV particle, or composition described herein for the treatment of LAL-D or a disorder associated with lipid storage or accumulation. In some embodiments, the LAL-D is Wolman's disease or cholesterol ester storage disease. In additional embodiments, the disorder associated with lipid storage or accumulation is coronary artery disease, atherosclerosis, type II diabetes, obesity, or non-alcoholic fatty liver disease.

[0027] Additionally, described herein are compositions comprising a polynucleotide, rAAV, rAAV particle, or composition described herein for treating dyslipidemia or hypercholesterolemia in a subject in need thereof.

[0028] In a further aspect, described herein are compositions comprising a polynucleotide, an rAAV, an rAAV particle, or a composition described herein for reducing triglycerides, cholesterol, and / or fatty acids in a subject in need thereof.

[0029] For example, any of the disclosed compositions are formulated for intravenous or intraperitoneal delivery. In some embodiments, the composition is administered simultaneously with, prior to, or after administration of an immunosuppressant. In another embodiment, the composition further comprises an immunosuppressant. Exemplary immunosuppressants include prednisone, prednisolone, rapamycin, methotrexate, myophenolate mofetil, tacrolimus, mycophenolate, or rituximab. [Brief description of the drawings]

[0030] [Figure 1] A schematic diagram of rscrAAVrh74.miniCMV.LIPA is provided. [Diagram 2] 14 demonstrates serum measures of liver enzymes in 4-month-old treated and untreated Lipa− / − mice. Alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity in serum from wild-type (WT), mock-treated Lipa− / −, and rAAVrh74.mCVM.LIPA-treated Lipa− / − mice (treated with 8×1013 vg / kg AAV IV on postnatal day 1 and analyzed at 4 mo). Error bars are SEM for n=6 (WT), 7 (Lipa− / −), or 8 (Lipa− / − treated) mice / grp with approximately equal representation of males and females. ***p<0.001, ****p<0.0001. [Diagram 3] Demonstration of serum LDL-cholesterol levels at 4 months of age. LDL-cholesterol levels in serum from wild type (WT), mock-treated Lipa- / -, and rAAVrh74.mCVM.LIPA-treated Lipa- / - mice (treated with 8x1013vg / kg AAV IV on postnatal day 1 and analyzed at 4mo). Error bars are SEM for n=6 (WT), 7 (Lipa- / -), or 8 (Lipa- / - treated) mice / grp. **p<0.01, ***p<0.001 [Figure 4-1]Comparison of body and organ weights in treated and untreated Lipa− / − mice compared to wild type is provided. (A) Total body weight, (B) liver weight, (C) spleen weight, (D) intestine weight, (E) heart weight, (F) kidney weight, (G) brain weight, and (H) muscle weight were compared. Treated Lipa− / − mice were given an IV dose of 8×1013 vg / kg rscAAVrh74.mCVM.LIPA on postnatal day 1 (P1) and analyzed at 6 months of age. Errors are SEM for n=4-5 / grp. *p<0.05, **p<0.01, ***p<0.001. Note that Lipa− / − mice gain weight, but this pales in comparison to the dramatic increase in organ weight of certain organs (liver and spleen). There is mild weight gain in other organs (kidneys and heart) but no or reduced weight gain in others (e.g. muscle, intestine, likely due to nutritional deficiencies due to fat deposition). [Figure 4-2] Comparison of body and organ weights in treated and untreated Lipa− / − mice compared to wild type is provided. (A) Total body weight, (B) liver weight, (C) spleen weight, (D) intestine weight, (E) heart weight, (F) kidney weight, (G) brain weight, and (H) muscle weight were compared. Treated Lipa− / − mice were given an IV dose of 8×1013 vg / kg rscAAVrh74.mCVM.LIPA on postnatal day 1 (P1) and analyzed at 6 months of age. Errors are SEM for n=4-5 / grp. *p<0.05, **p<0.01, ***p<0.001. Note that Lipa− / − mice gain weight, but this pales in comparison to the dramatic increase in organ weight of certain organs (liver and spleen). There is mild weight gain in other organs (kidneys and heart) but no or reduced weight gain in others (e.g. muscle, intestine, likely due to nutritional deficiencies due to fat deposition). [Figure 4-3]Comparison of body and organ weights in treated and untreated Lipa− / − mice compared to wild type is provided. (A) Total body weight, (B) liver weight, (C) spleen weight, (D) intestine weight, (E) heart weight, (F) kidney weight, (G) brain weight, and (H) muscle weight were compared. Treated Lipa− / − mice were given an IV dose of 8×1013 vg / kg rscAAVrh74.mCVM.LIPA on postnatal day 1 (P1) and analyzed at 6 months of age. Errors are SEM for n=4-5 / grp. *p<0.05, **p<0.01, ***p<0.001. Note that Lipa− / − mice gain weight, but this pales in comparison to the dramatic increase in organ weight of certain organs (liver and spleen). There is mild weight gain in other organs (kidneys and heart) but no or reduced weight gain in others (e.g. muscle, intestine, likely due to nutritional deficiencies due to fat deposition). [Figure 4-4] Comparison of body and organ weights in treated and untreated Lipa− / − mice compared to wild type is provided. (A) Total body weight, (B) liver weight, (C) spleen weight, (D) intestine weight, (E) heart weight, (F) kidney weight, (G) brain weight, and (H) muscle weight were compared. Treated Lipa− / − mice were given an IV dose of 8×1013 vg / kg rscAAVrh74.mCVM.LIPA on postnatal day 1 (P1) and analyzed at 6 months of age. Errors are SEM for n=4-5 / grp. *p<0.05, **p<0.01, ***p<0.001. Note that Lipa− / − mice gain weight, but this pales in comparison to the dramatic increase in organ weight of certain organs (liver and spleen). There is mild weight gain in other organs (kidneys and heart) but no or reduced weight gain in others (e.g. muscle, intestine, likely due to nutritional deficiencies due to fat deposition). [Diagram 5]Representative Oil Red / hematoxylin staining of organs from mock-treated and AAV-treated Lipa- / - mice and wild-type controls are provided. Lipa- / - treated mice received 8x1013vg / kg rscAAVrh74.mCVM.LIPA gene therapy IV on postnatal day 1, and at 6 months of age, tissues were stained with Oil Red O to identify disease-derived lipid overload. In all cases, Oil Red O staining was greatly reduced by treatment, but not absent. Bars are 200 μm. [Figure 6] Cellular triglyceride levels in liver and spleen following AAV treatment of Lipa− / − mice. (A) Liver and (B) spleen from 6-month-old wild-type (WT), Lipa− / −, and Lipa− / − treated mice (treated IV with 8×1013 vg / kg rscAAVrh74.mCVM.LIPA on postnatal day 1). Error bars are SEM, n=4-5 / grp. *p<0.05, **p<0.001, ***p<0.001, ****p<0.0001 [Figure 7] Provides AAV vector genome biodistribution per nucleus. Injection of Lipa- / - mice (LIPA KO) at 2 months resulted in increased transduction of liver, lymph nodes, spleen, and intestine compared to injection at P1 when assayed at 4 months of age. Error is SD for n=3 / group. Vg was measured per ug of genomic DNA and then converted to vg / nucleus (or per cell). [Figure 8] 13 demonstrates LIPA gene expression induced by rscAAVrh74.mCMV.LIPA. Injection of Lipa- / - mice (LIPA KO) at 2 months resulted in increased gene expression in liver, lymph nodes, spleen, and intestine compared to injection at P1 when assayed at 4 months of age. Error bars are SD for n=3 / group. Gene expression in treated LIPA KO mice is compared to normal gene expression in wild type mouse tissues. [Figure 9]13 provides images of whole liver in 4-month-old mice. Untreated, LIPA KO mice showed high fat content and increased size compared to wild type (FVBn). Treatment with P1 resulted in reduced size, but some fat content remained, and treatment with 2mo eliminated all fat content. [Figure 10] 1 shows liver cholesterol and triglyceride content after rscAAVrh74.mCMV.LIPA treatment in 4mo LIPA KO mice compared to wild type (FVBn). Error bars are SD. [Figure 11] Organ weights are provided 4 months after treatment with rscAAVrh74.mCMV.LIPA gene therapy. Error bars are SD for n=2-5 / grp. [Figure 12] Serum LIPA enzyme activity levels after rscAAVrh74.mCMV.LIPA gene therapy treatment at 4 months are shown. Error bars are SD. [Figure 13] 13 provides hepatic LIPA enzyme activity following treatment with rscAAVrh74.mCMV.LIPA at 4 months of age. Error bars are SD. [Figure 14-1] Data are provided demonstrating that rscAAVrh74.miniCMV.LIPA treatment reverses hepatosplenomegaly and elevated serum liver enzymes in Lipa− / − mice. (A) Schematic of treatment regimen for Lipa− / − mice. (B) Gross pathology of liver and spleen from wild-type, untreated Lipa− / −, and treated Lipa− / − mice. Scale bar=1 cm. (C-F) Relative weights of liver, spleen, intestine, and mesenteric lymph nodes. (G-H) Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. Schematic created with BioRender.com. ITR=inverted terminal repeat, pA=SV40 polyA, dTIR=mutated ITR. [Figure 14-2]Data are provided demonstrating that rscAAVrh74.miniCMV.LIPA treatment reverses hepatosplenomegaly and elevated serum liver enzymes in Lipa− / − mice. (A) Schematic of treatment regimen for Lipa− / − mice. (B) Gross pathology of liver and spleen from wild-type, untreated Lipa− / −, and treated Lipa− / − mice. Scale bar=1 cm. (C-F) Relative weights of liver, spleen, intestine, and mesenteric lymph nodes. (G-H) Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. Schematic created with BioRender.com. ITR=inverted terminal repeat, pA=SV40 polyA, dTIR=mutated ITR. [Figure 14-3] Data are provided demonstrating that rscAAVrh74.miniCMV.LIPA treatment reverses hepatosplenomegaly and elevated serum liver enzymes in Lipa− / − mice. (A) Schematic of treatment regimen for Lipa− / − mice. (B) Gross pathology of liver and spleen from wild-type, untreated Lipa− / −, and treated Lipa− / − mice. Scale bar=1 cm. (C-F) Relative weights of liver, spleen, intestine, and mesenteric lymph nodes. (G-H) Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. Schematic created with BioRender.com. ITR=inverted terminal repeat, pA=SV40 polyA, dTIR=mutated ITR. [Figure 14-4]Data are provided demonstrating that rscAAVrh74.miniCMV.LIPA treatment reverses hepatosplenomegaly and elevated serum liver enzymes in Lipa− / − mice. (A) Schematic of treatment regimen for Lipa− / − mice. (B) Gross pathology of liver and spleen from wild-type, untreated Lipa− / −, and treated Lipa− / − mice. Scale bar=1 cm. (C-F) Relative weights of liver, spleen, intestine, and mesenteric lymph nodes. (G-H) Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. Schematic created with BioRender.com. ITR=inverted terminal repeat, pA=SV40 polyA, dTIR=mutated ITR. [Figure 15] 13 provides Kaplan-Meier survival curves for untreated Lipa− / − versus Lipa− / − treated with P2. Gene therapy treatment extends lifespan beyond a median survival of 224 days. [Figure 16-1] We demonstrate that muscle atrophy may contribute to gait differences in Lipa- / - mice. (A) Mouse body weight at 2, 4, and 6 months. (B-C) Relative weights of gastrocnemius and quadriceps at 6 months. (D-H) Open field analysis at 6 months. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 16-2] We demonstrate that muscle atrophy may contribute to gait differences in Lipa- / - mice. (A) Mouse body weight at 2, 4, and 6 months. (B-C) Relative weights of gastrocnemius and quadriceps at 6 months. (D-H) Open field analysis at 6 months. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 16-3]We demonstrate that muscle atrophy may contribute to gait differences in Lipa- / - mice. (A) Mouse body weight at 2, 4, and 6 months. (B-C) Relative weights of gastrocnemius and quadriceps at 6 months. (D-H) Open field analysis at 6 months. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 16-4] We demonstrate that muscle atrophy may contribute to gait differences in Lipa- / - mice. (A) Mouse body weight at 2, 4, and 6 months. (B-C) Relative weights of gastrocnemius and quadriceps at 6 months. (D-H) Open field analysis at 6 months. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 17-1] We demonstrate that LIPA expression following rscAAVrh74.miniCMV.LIPA treatment results in increased lysosomal acid lipase enzyme activity. (A) Biodistribution of AAV in various organs and tissues. Quantitative real-time PCR was used to quantitate vector genomes (vg) per nucleus. (B) Relative expression of AAV-transduced human LIPA compared to endogenous mouse Lipa, normalized to 18S mRNA. (C-E) Lysosomal acid lipase enzyme activity in liver, spleen, and serum. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 17-2]We demonstrate that LIPA expression following rscAAVrh74.miniCMV.LIPA treatment results in increased lysosomal acid lipase enzyme activity. (A) Biodistribution of AAV in various organs and tissues. Quantitative real-time PCR was used to quantitate vector genomes (vg) per nucleus. (B) Relative expression of AAV-transduced human LIPA compared to endogenous mouse Lipa, normalized to 18S mRNA. (C-E) Lysosomal acid lipase enzyme activity in liver, spleen, and serum. All data are expressed as mean ± SD (n=5-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 18-1] Demonstrating that cholesterol and triglyceride content is reduced with treatment. (A-B) Cholesterol content in (A) liver and (B) spleen. (C-D) Triglyceride control in (C) liver and (D) spleen. (E-I) Serum lipid panel. (J) Oil Red O (ORO) staining of liver, spleen, and intestine tissue sections. Neutral lipids are stained red with ORO. Tissue sections were counterstained with hematoxylin (purple). Scale bar = 25 μm. All data are presented as mean ± SD (n = 5-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 18-2] Demonstrating that cholesterol and triglyceride content is reduced with treatment. (A-B) Cholesterol content in (A) liver and (B) spleen. (C-D) Triglyceride control in (C) liver and (D) spleen. (E-I) Serum lipid panel. (J) Oil Red O (ORO) staining of liver, spleen, and intestine tissue sections. Neutral lipids are stained red with ORO. Tissue sections were counterstained with hematoxylin (purple). Scale bar = 25 μm. All data are presented as mean ± SD (n = 5-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 18-3]Demonstrating that cholesterol and triglyceride content is reduced with treatment. (A-B) Cholesterol content in (A) liver and (B) spleen. (C-D) Triglyceride control in (C) liver and (D) spleen. (E-I) Serum lipid panel. (J) Oil Red O (ORO) staining of liver, spleen, and intestine tissue sections. Neutral lipids are stained red with ORO. Tissue sections were counterstained with hematoxylin (purple). Scale bar = 25 μm. All data are presented as mean ± SD (n = 5-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 18-4] Demonstrating that cholesterol and triglyceride content is reduced with treatment. (A-B) Cholesterol content in (A) liver and (B) spleen. (C-D) Triglyceride control in (C) liver and (D) spleen. (E-I) Serum lipid panel. (J) Oil Red O (ORO) staining of liver, spleen, and intestine tissue sections. Neutral lipids are stained red with ORO. Tissue sections were counterstained with hematoxylin (purple). Scale bar = 25 μm. All data are presented as mean ± SD (n = 5-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 18-5] Demonstrating that cholesterol and triglyceride content is reduced with treatment. (A-B) Cholesterol content in (A) liver and (B) spleen. (C-D) Triglyceride control in (C) liver and (D) spleen. (E-I) Serum lipid panel. (J) Oil Red O (ORO) staining of liver, spleen, and intestine tissue sections. Neutral lipids are stained red with ORO. Tissue sections were counterstained with hematoxylin (purple). Scale bar = 25 μm. All data are presented as mean ± SD (n = 5-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 19]14 provides immunohistochemical staining of LIPA and CD68 in liver sections. LIPA immunostaining in treated liver (brown). Macrophages are stained with anti-CD68 (brown). Tissue sections were counterstained with hematoxylin (purple). Scale bar = 100 μm. [Figure 20-1] We demonstrate that lower doses of rscAAVrh74.miniCMV.LIPA still exhibit therapeutic benefit. (A) Gross pathology of liver and spleen in untreated WT and Lipa- / - and treated Lipa- / - at different doses with rscAAVrh74.miniCMV.LIPA. Scale bar = 1 cm. (B-E) Relative weights of liver (B), spleen (C), intestine (D), and lymph node (E) after treatment at different doses. (F-G) Serum ALT and AST levels at different doses. All data are expressed as mean ± SD (n = 3-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 20-2] We demonstrate that lower doses of rscAAVrh74.miniCMV.LIPA still exhibit therapeutic benefit. (A) Gross pathology of liver and spleen in untreated WT and Lipa- / - and treated Lipa- / - at different doses with rscAAVrh74.miniCMV.LIPA. Scale bar = 1 cm. (B-E) Relative weights of liver (B), spleen (C), intestine (D), and lymph node (E) after treatment at different doses. (F-G) Serum ALT and AST levels at different doses. All data are expressed as mean ± SD (n = 3-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 20-3]We demonstrate that lower doses of rscAAVrh74.miniCMV.LIPA still exhibit therapeutic benefit. (A) Gross pathology of liver and spleen in untreated WT and Lipa- / - and treated Lipa- / - at different doses with rscAAVrh74.miniCMV.LIPA. Scale bar = 1 cm. (B-E) Relative weights of liver (B), spleen (C), intestine (D), and lymph node (E) after treatment at different doses. (F-G) Serum ALT and AST levels at different doses. All data are expressed as mean ± SD (n = 3-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 20-4] We demonstrate that lower doses of rscAAVrh74.miniCMV.LIPA still exhibit therapeutic benefit. (A) Gross pathology of liver and spleen in untreated WT and Lipa- / - and treated Lipa- / - at different doses with rscAAVrh74.miniCMV.LIPA. Scale bar = 1 cm. (B-E) Relative weights of liver (B), spleen (C), intestine (D), and lymph node (E) after treatment at different doses. (F-G) Serum ALT and AST levels at different doses. All data are expressed as mean ± SD (n = 3-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 21-1] We demonstrate that all doses of rscAAVrh74.miniCMV.LIPA treatment results in restored LIPA expression and lysosomal acid lipase enzymatic activity. (A) AAV biodistribution decreases with decreasing dose in liver, spleen, intestine, lymph nodes, heart, and lungs. (B) LIPA expression also decreases with dose in liver, spleen, intestine, lymph nodes, heart, and lungs. (C-E) Lysosomal acid lipase activity in liver, spleen, and serum. All data are expressed as mean ± SD (n=3-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 21-2]We demonstrate that all doses of rscAAVrh74.miniCMV.LIPA treatment results in restored LIPA expression and lysosomal acid lipase enzymatic activity. (A) AAV biodistribution decreases with decreasing dose in liver, spleen, intestine, lymph nodes, heart, and lungs. (B) LIPA expression also decreases with dose in liver, spleen, intestine, lymph nodes, heart, and lungs. (C-E) Lysosomal acid lipase activity in liver, spleen, and serum. All data are expressed as mean ± SD (n=3-8). Statistical significance between groups is indicated by different letters, P<0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 22-1] Figure 1 demonstrates that lipid content is reduced with treatment at all doses. (A) Cholesterol levels in liver. (B) Cholesterol content in spleen. (C) Triglyceride content in liver. (D) Triglyceride content in spleen. All data are expressed as mean ± SD (n = 3-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 22-2] Figure 1 demonstrates that lipid content is reduced with treatment at all doses. (A) Cholesterol levels in liver. (B) Cholesterol content in spleen. (C) Triglyceride content in liver. (D) Triglyceride content in spleen. All data are expressed as mean ± SD (n = 3-8). Statistical significance between groups is indicated by different letters, P < 0.05 using one-way ANOVA with Tukey's post-hoc test. [Figure 23-1] We provide the annotated sequence of ptrs-miniCMV.LIPA.KanR (5626 bp). [Figure 23-2] We provide the annotated sequence of ptrs-miniCMV.LIPA.KanR (5626 bp). [Figure 23-3] We provide the annotated sequence of ptrs-miniCMV.LIPA.KanR (5626 bp). [Figure 23-4]We provide the annotated sequence of ptrs-miniCMV.LIPA.KanR (5626 bp). [Figure 23-5] We provide the annotated sequence of ptrs-miniCMV.LIPA.KanR (5626 bp). [Figure 23-6] We provide the annotated sequence of ptrs-miniCMV.LIPA.KanR (5626 bp). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Enzyme replacement protein therapy has shown clinical efficacy in WD and CESD patients and has been approved by the FDA, but such treatment requires protein infusion every 2 weeks and results in only partial clinical correction (Burton et al. N Engl J Med 373:1010-1020, 2015). In a phase 3 enzyme replacement clinical trial of sebelipase alfa (also called Kanuma), for example, serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), total bilirubin, and low-density lipoprotein (LDL)-cholesterol elevations were reduced, on average, by only 50%, with at best a 32% overall reduction in liver fat content and a 6.8% reduction in spleen volume (Burton et al. supra). As demonstrated herein, AAV delivery of the LIPA gene can have a much greater impact on these indices in the LAL-D mouse model.

[0032] The present disclosure provides a recombinant (r) self-complementary (sc) AAV vector, rscAAVrh74.mCMV.LIPA, for use in treating WD and CESD patients. Originally isolated from the spleen of a rhesus macaque, the rhesus 74 (rh74) serotype of AAV has been shown to deliver high intravenous doses (2×10 14vg / kg). rAAVrh74 is similar to rAAV8, rAAV9, and rAAVrh.10 in that it exhibits a high propensity to enter tissues after intravenous (IV) delivery to the blood, allowing for whole-body, multi-organ perfusion of engineered gene therapies using a single-dose scheme (Zygmunt et al., Mol Ther Methods Clin Dev 15:305-319, 2019). This administration could theoretically be sustained for the life of the animal, at least in postmitotic cells (Chicoine et al., Mol Ther 22:713-724, 2014; Martin et al., Am J Physiol Cell Physiol 296:C476-488, 2009). AAV is unique in its safety profile and, as the viral genome, once transduced into its carrier cells, remains stably expressed as episomal DNA and only rarely integrates into the host genome (Grieger et al., Adv Biochem Eng Biotechnol 99:119-145, 2005; Xiao et al. J Virol 72:2224-2232, 1998). As with nearly all AAV serotypes, the liver and spleen are the most highly perfused organs when rAAVrh74 is delivered intravenously (Bish et al., Hum Gene Ther 19:1359-1368, 2008). The liver and spleen typically receive logarithmically higher numbers of AAV DNA vector genomes (vg) than other organs when administered to adult animals, and this is true in multiple mammalian species, including rodents, including humans, rhesus monkeys, dogs, and mice (Cunningham et al. Methods Mol Biol 1937:213-219., 2019, Palaschak et al., Methods Mol Biol 1950:333-360, 2019). Such characteristics make AAV an ideal gene delivery method for the treatment of genetic disorders such as LAL-D, where the liver and spleen are the most affected organs (Aguisanda et al., supra; Burton et al., supra).

[0033] The disclosed AAV vectors are optimized for therapeutic utility in LAL-D. Self-complementary (sc) technology allows for binding of the single-stranded viral DNA genome to itself, thereby priming second-strand DNA synthesis. This self-complementary element speeds up and enhances gene expression compared to constructs lacking the self-complementary element. The use of self-complementary technology is important for effective treatment of LAL-D, as children with complete deficiency become severely ill within one or two weeks of birth. Thus, the use of single-stranded rAAV vectors, which would take 3-4 weeks for maximal onset of gene expression, would not be ideal for preventing disease with such early and severe onset. Since only about 2.2 kB of DNA could be packaged into the self-complementary AAV vector, a little less than half (4.7 kB) of what can normally be packaged into a single-stranded vector, a miniaturized cytomegalovirus (mCMV) promoter was used to allow all of the necessary DNA elements to be included along with the full-length human LIPA transgene. This miniaturized mCMV promoter has been used by Fu and McCarty to drive scAAV vectors to treat other lysosomal storage disorders such as mucopolysaccharidoses, and the mCMV promoter shows the ability to drive gene expression across a broad spectrum of cells and tissues II (Fu et al., Mol Ther Methods Clin Dev 10:327-340, 2008). The size limitations of the self-complementary form of AAV, combined with the size of the LIPA gene itself, make it impossible to use the full-length form of the CMV promoter to generate a self-complementary AAV form containing the LIPA gene. AAV yields are reduced 19-fold when the full-length CMV promoter is used, likely due to reduced genome packaging into viral capsids due to the increased size of the AAV genome. Packaging yields from standard small-scale AAV preparations averaged 1.15 ± 0.15 × 10 when miniCMV is used. 13 vg, and an average of 6.0 ± 1.1 × 10 when the full-length CMV promoter was used. 11vg only (n=2 / group). Thus, miniCMV is a key design element of this AAV vector.

[0034] LIPA mutations The LIPA gene is located on human chromosome 10q23.2-23.3 and consists of 10 exons spread over approximately 38 kb. LIPA has three transcript variants: variant 2 (NM_000235) lacks an internal segment in the 5'UTR compared to variant 1 (NM_001127605). The two variants encode the same protein isoform with a size of 399 amino acids (AA), which has been experimentally verified by cDNA cloning (Baratta et al., World J Gastroenterol 25:4172-4180). The annotated variant 3 (NM_001288979) lacks two consecutive exons in the 5' region, which results in translation initiation at a downstream AUG, presumably resulting in a shorter protein isoform consisting of 283 AA. (Li and Zhang, Arterioscler Thromb Vasc Biol. 39(5):850-856, 2019).

[0035] There are at least 59 known mutations in the LIPA gene. Examples of these mutations are provided in Table 1 below. [Table 1]

[0036] AAV gene therapy The present disclosure provides gene therapy vectors, such as rAAV vectors expressing LIPA cDNA, and methods for treating lysosomal acid lipase deficiency (LAL-D), including Wolman disease and cholesterol ester storage disease. The disclosed gene therapy vectors are useful for treating disorders associated with lipid storage and accumulation, such as coronary artery disease, such as atherosclerosis, type II diabetes, obesity, and non-alcoholic fatty liver disease. In addition, the disclosed gene therapy vectors are useful for reducing triglycerides, cholesterol, and / or fatty acids in subjects in need of such reduction, and for treating dyslipidemia or hypercholesterolemia in subjects in need of such treatment.

[0037] As used herein, the term "AAV" is a common abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells where certain functions are provided by a co-infecting helper virus. Currently, there are at least 13 serotypes of AAV that have been characterized. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, (New York). However, it is well known that the various serotypes are very closely related, both structurally and functionally, even at the genetic level, so it is fully expected that these same principles will be applicable to additional AAV serotypes. (See, e.g., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R. Puttson, ed., and Rose, Comprehensive Virology 3:1-61 (1974).) For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes, and they all have three related capsid proteins, such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis, which reveals extensive cross-hybridization between serotypes along the length of the genome, and the presence of similar self-annealing segments at the ends that correspond to the "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control.

[0038] As used herein, "AAV vector" refers to one or more polynucleotides of interest (or transgenes) that are flanked by AAV terminal repeats (ITRs) that can be replicated and packaged into infectious viral particles when present in a host cell transfected with a vector that encodes and expresses the rep and cap gene products.

[0039] "AAV virion" or "AAV virus particle" or "AAV vector particle" refers to a viral particle consisting of at least one AAV capsid protein and a polynucleotide AAV vector enclosed in the capsid. When the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene delivered to a mammalian cell), it is typically referred to as an "AAV vector particle" or simply an "AAV vector". Thus, since such a vector is contained within the AAV vector particle, the production of the AAV vector particle necessarily includes the production of the AAV vector.

[0040] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long, including inverted terminal repeats (ITRs). Exemplary ITR sequences can be 130 base pairs long, or 141 base pairs long, such as the ITR sequences shown in SEQ ID NOs: 6 and 7. Nucleotide sequence SEQ ID NO: 6 is an exemplary 5'ITR, and the nucleotide sequence of SEQ ID NO: 7 is an exemplary 3'ITR that contains a deletion of a terminal resolution site (referred to as "dTR"). The deletion of the terminal resolution site inhibits Rep protein nicking of the single-stranded viral genome. The presence of dTR in the 3'ITR increases the self-complementary binding of the viral genome to itself, which may be due to its small (2.2 kB) size, which allows the double-stranded viral genome to be packaged within the viral capsid.

[0041] There are several serotypes of AAV. The nucleotide sequence of the genome of AAV serotypes is known. For example, the nucleotide sequence of the genome of AAV serotype 2 (AAV2) is presented in Srivastava et al., J Virol, 45:555-564 (1983), which is amended by Ruffing et al., J Gen Virol, 75:3385-3392 (1994). As other examples, the complete genome of AAV-1 is presented in GenBank Accession No. NC_002077, the complete genome of AAV-3 is presented in GenBank Accession No. NC_1829, the complete genome of AAV-4 is presented in GenBank Accession No. NC_001829, the AAV-5 genome is presented in GenBank Accession No. AF085716, the complete genome of AAV-6 is presented in GenBank Accession No. NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are presented in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Pat. Nos. 7,282,199 and 7,790,449 regarding AAV-8), and the AAV-9 genome is described in Gao et al. al., J. Virol., 78:6381-6388 (2004), the AAV-10 genome is presented in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is presented in Virology, 330(2):375-383 (2004). The cloning of the AAVrh.74 serotype is described in Rodino-Klapac., et al. Journal of translational medicine 5, 45 (2007). Cis acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the ITRs. Three AAV promoters (named p5, p19, and p40 after their relative map positions) drive expression of two AAV internal open reading frames encoding the rep and cap genes.Two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (e.g., at nucleotides 2107 and 2227 in AAV2), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that are ultimately involved in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes three capsid proteins (VP1, VP2, and VP3). Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0042] AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is non-cytotoxic, and natural infection of humans and other animals is silent and asymptomatic. Furthermore, AAV infects many mammalian cells, offering the possibility of targeting many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifetime of those cells as transcriptionally active nuclear episomes (extrachromosomal elements). The AAV proviral genome is infectious as cloned DNA in a plasmid making the construction of recombinant genomes feasible. Furthermore, because signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced with foreign DNA, such as a gene cassette containing a promoter, DNA of interest, and a polyadenylation signal. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It easily survives the conditions used to inactivate adenovirus (56°C to 65°C for several hours), making cryopreservation of AAV less important. AAV can also be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0043] Several studies have demonstrated long-term (>1.5 years) recombinant AAV-mediated protein expression in muscle. See Clark et al., Hum Gene Ther, 8:659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA, 93:14082-14087 (1996); and Xiao et al., J Virol, 70:8098-8108 (1996). See also Chao et al., Mol Ther, 2:619-623 (2000); and Chao et al., Mol Ther, 4:217-222 (2001). Furthermore, because muscle is highly vascularized, recombinant AAV transduction has resulted in the appearance of the transgene product in the systemic circulation following intramuscular injection, as described by Herzog et al., Proc Natl Acad Sci USA, 94:5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA, 94:13921-13926 (1997). Lewis et al., J Virol, 76:8769-8775 (2002) also demonstrated that skeletal muscle fibers possess the necessary cellular factors for correct antibody glycosylation, folding, and secretion, indicating that muscle is capable of stable expression of secreted protein therapeutics.

[0044] The recombinant AAV genome of the present disclosure comprises the nucleic acid molecule of the present disclosure and one or more AAV ITRs flanking the nucleic acid molecule. The AAV DNA in the rAAV genome can be derived from any AAV serotype capable of deriving a recombinant virus, including, but not limited to, AAV serotypes (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVRH74, AAV11, AAV12, AAV13, or Anc80, AAV7m8, and derivatives thereof). The generation of pseudotyped rAAV is disclosed, for example, in WO01 / 83692. Other types of rAAV variants are also contemplated, such as rAAVs with capsid mutations. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). As described in the Background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0045] The provided recombinant AAV (i.e., infectious, encapsidated rAAV particles) comprises a rAAV genome. The term "rAAV genome" refers to a polynucleotide sequence derived from a modified native AAV genome. In some embodiments, the rAAV genome has been modified to remove the native cap and rep genes. In some embodiments, the rAAV genome comprises endogenous 5' and 3' inverted terminal repeats (ITRs). In some embodiments, the rAAV genome comprises ITRs from an AAV serotype different from the AAV serotype from which the AAV genome was derived. In some embodiments, the rAAV genome comprises a transgene of interest flanked at the 5' and 3' ends by inverted terminal repeats (ITRs). In some embodiments, the rAAV genome comprises a "gene cassette." In exemplary embodiments, the genomes of both rAAVs lack AAV rep and cap DNA, i.e., there is no AAV rep or cap DNA between the ITRs of the genome.

[0046] The rAAV genome provided herein, in some embodiments, comprises one or more AAV ITRs flanking the transgene polynucleotide sequence. The transgene polynucleotide sequence is operably linked to transcriptional control elements (including but not limited to promoters, enhancers, and / or polyadenylation signal sequences) that are functional in the target cell forming a gene cassette. An example of a promoter is the miniCMV promoter having the nucleotide sequence of SEQ ID NO: 3. Additional promoters include chicken beta actin promoter (CBA), P546 promoter, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as but not limited to actin promoter, myosin promoter, elongation factor-1a promoter, hemoglobin promoter, and creatine kinase promoter.

[0047] Additionally, provided herein are miniCMV promoter sequences and promoter sequences that are at least: 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of the miniCMV (SEQ ID NO: 3) sequence that exhibits transcription-promoting activity.

[0048] Other examples of transcriptional control elements are tissue-specific control elements, such as promoters that allow expression specifically in neurons or specifically in astrocytes. Examples include the neuron-specific enolase and glial fibrillary acidic protein promoters. Inducible promoters are also contemplated. Non-limiting examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline-regulated promoters. The gene cassette may also include an intron sequence that facilitates the processing of the transgene RNA transcript when expressed in mammalian cells. One example of such an intron is the SV40 intron.

[0049] The rAAV genomes provided herein comprise a polynucleotide that encodes the LIPA protein (SEQ ID NO:1). In some embodiments, the rAAV genomes provided herein comprise a polynucleotide that encodes a polypeptide comprising an amino acid sequence that is at least: 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence encoded by the LIPA cDNA (SEQ ID NO:1).

[0050] The rAAV genome provided herein comprises nucleotides 1853-3906 of SEQ ID NO: 4. In some embodiments, the rAAV genome provided herein comprises a polynucleotide that is at least: 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to nucleotides 1853-3906 of SEQ ID NO: 4.

[0051] The rAAV genomes provided herein, in some embodiments, comprise a polynucleotide sequence that encodes an LAL protein and hybridizes under stringent conditions to the polynucleotide sequence set forth in SEQ ID NO:1, or its complement.

[0052] The DNA plasmid of the present disclosure comprises the rAAV genome of the present disclosure. The DNA plasmid is transferred to a cell that is permissive for infection with an AAV helper virus (e.g., adenovirus, E1 deleted adenovirus, or herpesvirus) for assembly of the rAAV genome into an infectious viral particle. Techniques for generating rAAV particles that provide the packaged AAV genome, rep and cap genes, and helper virus functions to a cell are standard in the art. Production of rAAV requires that the following components are present in a single cell (referred to herein as a packaging cell): the rAAV genome, AAV rep and cap genes separated from (i.e., not present in) the rAAV genome, and helper virus functions. The AAV rep and cap genes may be derived from any AAV serotype from which a recombinant virus may be derived, or may be derived from an AAV serotype different from the rAAV genome ITRs, for example, including, but not limited to, AAV serotypes AAV-9, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAVrh.74, AAV-8, AAV-10, AAV-11, AAV-12, and AAV-13. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692, which is incorporated herein by reference in its entirety.

[0053] The method for generating packaging cells is to create a cell line that stably expresses all the components required for the production of AAV particles. For example, a plasmid (or multiple plasmids) containing a rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selection marker (e.g., a neomycin resistance gene) is integrated into the genome of the cell. The AAV genome has been introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), addition of a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus, such as adenovirus. The advantage of this method is that the cells are selectable and are suitable for large-scale production of rAAV. Another example of a suitable method uses adenovirus or baculovirus rather than plasmids to introduce the rAAV genome and / or the rep and cap genes into the packaging cells.

[0054] The general principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches are described in: Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., Mol. Cell. Biol., 7:349 (1988). Samulski et al., J. Virol., 63: 3822-3828 (1989), U.S. Pat. No. 5,173,414, WO95 / 13365, and corresponding U.S. Pat. No. 5,658.776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. Vaccine 13: 1244-1250 (1995), Paul et al. Human Gene Therapy 4:609-615 (1993), Clark et al. Gene Therapy 3:1124-1132 (1996), U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The foregoing documents are incorporated herein by reference in their entireties, with particular emphasis on the sections of the documents relating to rAAV production.

[0055] Thus, the present disclosure provides packaging cells that produce infectious rAAV. In one embodiment, the packaging cells can be stably transformed cancer cells, such as HeLa cells, 293 cells, and PerC.6 cells (synonymous 293 cells). In another embodiment, the packaging cells are cells that are not transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblast cells), WI-38 cells (human fetal fibroblast cells), Vero cells (monkey kidney cells), and FRhL-2 cells (fetal rhesus lung cells).

[0056] rAAV can be purified by standard methods in the art (e.g., by column chromatography or cesium chloride gradients, etc.) Methods for purifying rAAV vectors from helper viruses are known in the art and are disclosed, for example, in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002), U.S. Patent No. 6,566,118, and WO 98 / 09657.

[0057] The compositions provided herein comprise rAAV and a pharma- ceutically acceptable excipient. Acceptable excipients are non-toxic to recipients, preferably inert at the dosages and concentrations used, and include, but are not limited to, buffers such as phosphate [e.g., phosphate-buffered saline (PBS)], citric acid, or other organic acids, antioxidants such as ascorbic acid, proteins such as low molecular weight polypeptides, serum albumin, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparaginine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and / or non-ionic surfactants such as Tween®, copolymers such as poloxamer 188, Pluronic® (e.g., Pluronic F68), or polyethylene glycol (PEG).

[0058] The dosage of rAAV administered in the methods of the present disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the duration of treatment, the therapeutic goal, the individual, and the cell type being targeted, and can be determined by standard methods in the art. Dosages may be expressed in units of viral genomes (vg). Dosages contemplated herein are approximately 1×10 7 , 1×10 8 , 1×10 9 , 5×10 9 , 6×10 9 , 7×10 9 , 8×10 9 , 9×10 9 , 1×10 10 , 2×10 10 , 3×10 10 , 4×10 10 , 5×10 10 , 1×10 11 , about 1×10 12 , about 1×10 13 , about 1.1×10 13 , about 1.2×10 13 , about 1.3×10 13, about 1.5×10 13 , about 2×10 13 , about 2.5×10 13 , about 3×10 13 , about 3.5×10 13 , about 4×10 13 , about 4.5×10 13 , about 5×10 13 , about 6×10 13 , about 7×10 13 , about 8×10 13 , about 9×10 13 , about 1×10 14 , about 2×10 14 , about 3×10 14 , about 4×10 14 , about 5×10 14 , about 1×10 15 ~Approx. 1×10 16 , or more, of the entire viral genome.

[0059] Approximately 1×10 9 ~Approx. 1×10 10 , about 5×10 9 ~Approx. 5×10 10 , about 1×10 10 ~Approx. 1×10 11 , about 1×10 11 ~Approx. 1×10 15 vg, approx. 1×10 12 ~Approx. 1×10 15 vg, approx. 1×10 12 ~Approx. 1×10 14 vg, approx. 1×10 13 ~about 6×10 14 vg, approx. 1×10 13 ~Approx. 1×10 15 vg, and approximately 6 × 10 13 ~Approx. 1.0×10 14 vg doses are also contemplated. One dose exemplified herein is 1×10 administered via intravenous or intraperitoneal delivery. 13 vg.

[0060] Dosages may also be expressed in units of vg / kg. Doses contemplated herein are approximately 1×10 7 vg / kg, 1×10 8 vg / kg, 1×10 9vg / kg, 5×10 9 vg / kg, 6×10 9 vg / kg, 7×10 9 vg / kg, 8×10 9 vg / kg, 9×10 9 vg / kg, 1×10 10 vg / kg, 2×10 10 vg / kg 10 , 3×10 10 vg / kg, 4×10 10 vg / kg, 5×10 10 vg / kg, 1×10 11 vg / kg, about 1×10 12 vg / kg, about 1×10 13 vg / kg, about 1.1×10 13 vg / kg, about 1.2×10 13 vg / kg, about 1.3×10 13 vg / kg, about 1.5×10 13 vg / kg, about 2×0 13 vg / kg, about 2.5×10 13 vg / kg, about 3×10 13 vg / kg, about 3.5×10 13 vg / kg, about 4×10 13 vg / kg, about 4.5×10 13 vg / kg, about 5×10 13 vg / kg, about 6×10 13 vg / kg, about 7×10 13 , about 8×10 13 , about 9×10 13 , about 1×10 14 vg / kg, about 2×10 14 vg / kg, about 3×0 14 vg / kg, about 4×10 14 vg / kg, about 5×10 14 vg / kg, about 1×10 15 vg / kg ~ about 1×10 16 vg / kg is included.

[0061] about 1×10 9 vg / kg ~ about 1×10 10 vg / kg, about 5×10 9 vg / kg ~ about 5×10 10 vg / kg, about 1×10 10vg / kg ~ approx. 1×10 11 vg / kg, approximately 1×10 11 vg / kg ~ approx. 1×10 15 vg / kg, approximately 1×10 12 vg / kg ~ approx. 1×10 15 vg / kg, approximately 1×10 12 vg / kg ~ approx. 1×10 14 vg / kg, approximately 1×10 13 vg / kg ~ approx. 2×10 14 vg / kg, approximately 1×10 13 vg / kg ~ approx. 1×10 15 vg / kg, and approximately 6 × 10 13 vg / kg ~ approx. 1.0×10 14 Dosages of 1×10 vg / kg are also contemplated. One dose exemplified herein is 1×10 administered via intravenous or intraperitoneal delivery. 13 vg / g.

[0062] Methods of transducing target cells with rAAV in vivo or in vitro are contemplated by the present disclosure. In vivo methods include administering an effective dose or effective multiple doses of a composition comprising an rAAV of the present disclosure to an animal (including a human) in need thereof. If the dose is administered prior to the onset of a disorder / disease, the administration is prophylactic. If the dose is administered after the onset of a disorder / disease, the administration is therapeutic. In embodiments of the present disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, delays or prevents progression to the disorder / disease state, delays or prevents progression of the disorder / disease state, reduces the extent of the disease, results in remission (partial or complete) of the disease, and / or prolongs survival. Examples of LAL-D contemplated for prevention or treatment by the methods of the present disclosure are Wolman's disease and cholesterol ester storage disease, or disorders associated with lipid storage or accumulation, such as coronary artery disease, atherosclerosis, type II diabetes, obesity, non-alcoholic fatty liver disease, dyslipidemia, or hypercholesterolemia.

[0063] Combination therapy is also contemplated by the present disclosure. Combination as used herein includes both simultaneous and sequential therapy. Combination of the disclosed method with standard medical treatment, including combination with novel therapy, is specifically contemplated. In some embodiments, combination therapy includes administering an immunosuppressant in combination with the gene therapy disclosed herein.

[0064] Administration of an effective dose of the composition may be by routes standard in the art, including, but not limited to, intramuscular, parenteral, intravenous, intraarterial, intraperitoneal, oral, buccal, nasal, pulmonary, intracranial, intraosseous, intraocular, rectal, or vaginal. The route and serotype of administration of the AAV components of the rAAV of the present disclosure (specifically, the AAV ITRs and capsid proteins) can be selected and / or adapted by one of skill in the art taking into account the infection and / or disease state to be treated and the target cells / tissues expressing wild-type LAL protein.

[0065] The present disclosure provides for local and systemic administration of effective doses of the rAAV and compositions of the present disclosure. For example, systemic administration is administration into the circulatory system so that the entire body is affected. Systemic administration includes enteral administration, such as absorption through the digestive tract, and parenteral administration through injection, infusion, or implantation.

[0066] Transduction of cells with the rAAV of the present disclosure results in sustained expression of LAL protein. Thus, the present disclosure provides methods for administering / delivering rAAV expressing LAL protein to animals, preferably humans. These methods include transducing cells with one or more rAAV of the present disclosure.

[0067] The term "transduction" is used to refer to the administration / delivery of the coding region of the LIPA gene to recipient cells, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure, resulting in expression of LAL in recipient cells.

[0068] Immunosuppressants The immunosuppressant may be administered before or after the initiation of an immune response to the rAAV in the subject after administration of gene therapy. In addition, the immunosuppressant may be administered simultaneously with gene therapy or protein replacement therapy. The immune response in the subject includes an adverse immune response or inflammatory response following or caused by administration of the rAAV to the subject. The immune response may be the production of antibodies in the subject in response to the administered rAAV.

[0069] Exemplary immunosuppressants include glucocorticosteroids, Janus kinase inhibitors, calcineurin inhibitors, mTOR inhibitors, cytostatic agents such as purine analogs, methotrexate, and cyclophosphamide, inosine monophosphate dehydrogenase (IMDH) inhibitors, biologics such as monoclonal antibodies or fusion proteins and polypeptides, and dipeptide boronic acid molecules such as bortezomib.

[0070] The immunosuppressant may be an anti-inflammatory steroid, which is a steroid that reduces inflammation and suppresses or modulates the immune system of a subject. Exemplary anti-inflammatory steroids are glucocorticoids such as prednisolone, betamethasone, dexamethasone, methotrexate, hydrocortisone, methylprednisolone, deflazacort, budesonide, or prednisone.

[0071] Janus kinase inhibitors are inhibitors of the JAK / STAT signaling pathway by targeting one or more of the Janus kinase family of enzymes. Exemplary Janus kinase inhibitors include tofacitinib, baricitinib, upadacitinib, peficitinib, and oclacitinib.

[0072] Calcineurin inhibitors bind to cyclophilin and inhibit the activity of calcineurin. Exemplary calcineurin inhibitors include cyclosporine, tacrolimus, and picecrolimus.

[0073] mTOR inhibitors reduce or inhibit the serine / threonine-specific protein kinase mTOR. Exemplary mTOR inhibitors include rapamycin (also known as sirolimus), everolimus, and temsirolimus.

[0074] Immunosuppressants include immunosuppressant macrolides. The term "immunosuppressant macrolide" refers to a macrolide drug that suppresses or modulates the immune system of a subject. Macrolides are a class of drugs that contain a large macrocyclic lactone ring to which one or more deoxy sugars, such as cladinose or desoamine, are attached. The lactone ring is usually 14, 15, or 16 members. Macrolides belong to the polyketide class of drugs and can be natural products. Examples of immunosuppressant macrolides include tacrolimus, pimecrolimus, and rapamycin (also known as sirolimus).

[0075] Purine analogs block nucleotide synthesis and include IMDH inhibitors. Exemplary purine analogs include azathioprine, mycophenolates such as mycophenolate acid or mycophenolate mofetil, and lefunomide.

[0076] Exemplary immunosuppressant biologics include abatacept, adalimumab, anakinra, certolizumab, etanercept, golimumab, infliximab, ixekizumab, natalizumab, rituximab, secukinumab, tocilizumab, ustekinenumab, vedolizumab, basiliximab, belatacept, and daclizumab.

[0077] Specifically, the immunosuppressant is an anti-CD20 antibody. The term anti-CD20 specific antibody refers to an antibody that specifically binds to CD20 or inhibits or reduces the expression or activity of CD20. Exemplary anti-CD20 antibodies include rituximab, ocrelizumab, or ofatumumab.

[0078] Additional examples of immunosuppressive antibodies include anti-CD25 antibodies (or anti-IL2 or anti-TAC antibodies) such as basiliximab and daclizumab, as well as anti-CD3 antibodies such as muromonab-CD3, otelixizumab, teplizumab and vicilizumab, and anti-CD52 antibodies such as alemtuzumab.

[0079] The following examples are offered by way of illustration and not by way of limitation: Numerical ranges recited include each integer value within each range, including the integer minimum and maximum recited. EXAMPLES

[0080] Example 1 Constructs encoding gene therapy LIPA An AAV genomic construct encoding LIPA was generated as shown in FIG. 1, which shows the AAVrh74 vector design with a full-length transcript of the LIPA cDNA under the control of the miniCMV promoter (SEQ ID NO:3).

[0081] A human GFP cDNA clone was obtained from Origene, Rockville, MD. The LIPA cDNA alone was further subcloned into the self-complementary AAVrh74 genome under the control of the miniCMV promoter. The plasmid construct also contained an intron, such as the simian virus 40 (SV40) chimeric intron, and a polyadenylation signal (PolyA). The construct was packaged into either AAVrh74 genome.

[0082] The LIPA cDNA expression cassette had a kanamycin resistance gene and an optimized Kozak sequence that allowed for more robust transcription. rAAV vectors were produced by a modified cross-packaging approach that allowed the AAVrh 74 vector genome to be packaged into multiple AAV capsid serotypes [Rabinowitz et al., J Virol. 76(2):791-801 (2002)]. Production was achieved using a standard three-plasmid DNA / CaPO4 precipitation method using HEK293 cells. HEK293 cells were maintained in DMEM supplemented with 10% fetal bovine serum, and penicillin and streptomycin. The production plasmids were (i) plasmids encoding therapeutic proteins, (ii) a rep2-capX modified AAV helper plasmid encoding a cap serotype AAVrh74 isolate, and (iii) an adenovirus type 5 helper plasmid (pAdhelper) expressing the adenovirus E2A, E4 ORF6, and VA I / II RNA genes. A quantitative PCR-based titration method was used to determine encapsidated vector genome (vg) titers using a Prism 7500 Taqman detector system (PE Applied Biosystems). [Clark et al., Hum Gene Ther. 10(6):1031-1039 (1999)]. Final titers (vg ml-1) were determined by quantitative reverse transcriptase PCR using specific primers and probes using a Prism 7500 real-time detector system (PE Applied Biosystems, Grand Island, NY, USA). Aliquots of virus were kept at -80°C.

[0083] All plasmids used to generate packaged AAV genomes also contain a kanamycin resistance gene (KanR) outside the ITR sequences used to package the genome. This allows the DNA encoding the AAV genome to be transformed into bacteria to produce large amounts of DNA in the presence of kanamycin, which will kill all untransformed bacteria. KanR is not packaged into the AAV capsid in the AAV genomes used to treat patients, but its presence allows DNA production in bacteria.

[0084] A map of plasmid r(sc)AAVrh74.miniCMV.LIPA is shown in Figure 2 and the sequence of the entire plasmid is provided in SEQ ID NO: 4. The vector scAAVrh74.miniCMV.LIPA contains a nucleotide sequence within and including the ITRs of SEQ ID NO: 4. The rAAV vector contains the 5' AAV2 ITR, the miniCMV promoter, the coding sequence of the LIPA gene, the SV40 late polyA, and the 3' AAV2 ITR. The plasmid shown in SEQ ID NO: 4 further contains kanamycin resistance along with a pUC origin of replication.

[0085] Table 2 shows the molecular characteristics of the plasmid (SEQ ID NO: 4), where ranges refer to nucleotides in SEQ ID NO: 4.

number

[0086] Example 2 LIPA gene replacement in LIPA-deficient mice The following studies were performed in purebred Lipa deficiency (Lipa - / - ) tested AAV-based LIPA (human) gene replacement therapy in mice. - / -Mice, like WD and CESD patients, develop severe liver dysfunction and damage as a result of the large load of cholesterol esters and triglycerides on this organ (Du et al. Hum Mol Genet 7:1347-1354, 1998; Du et al. J Lipid Res 42:489-500, 2001). For example, mice develop hepatosplenomegaly, elevated serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), and elevated liver and spleen cholesterol and triglycerides. Disease is evident within 3 weeks of age and the Lipa - / - Mice have severe disease by 4 months of age, showing a 3- to 6-fold increase in liver and spleen size. Mice develop disease over the next several months, beginning at 6 months of age.

[0087] Mouse: lal - / - The mouse was first generated by Du et al. in 1998. Mouse models have been widely used to study the role of Lal in multiple organ systems. - / - The mice survive to adulthood and are fertile, but die at 7-8 months of age. - / - Mice show large accumulations of TG and CE in the liver, spleen, and small intestine, resembling hepatosplenomegaly, the major clinical symptom of WD and CESD in humans. - / - Mice provide a model to study human WD and CESD, but more importantly, serve as a powerful tool to investigate the systemic effects of lysosomal lipolysis on metabolic and immune homeostasis.

[0088] 1 day old (P1) Lipa - / - Mice were administered a single injection of rscAAVrh74.mCMV.LIPA intravenously. 13 rscAAVrh74.mCMV.LIPA was administered intravenously via the retroorbital vein at 1000 mg / kg. - / - Mice were pure FvB / Breeding onto the NJ background, which resulted in nearly double the litter size compared to C57Bl / 6J-bred mice, did not significantly alter the disease phenotype. - / - The liver in the mice is severely enlarged and damaged.

[0089] 4-month-old mock-treated Lipa - / - In mice, alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were elevated 10-fold compared to wild-type mice, and these elevations were reduced by 90% by AAV treatment (Figure 2). For both AST and ALT indicators, this was a highly significant change (p<0.0001 for both comparisons). AST and ALT are markers of liver damage and are the main clinical biomarkers used to follow LAL-D disease in patients.

[0090] Treatment with rscAAVrh74.mCMV.LIPA also resulted in a complete normalization of serum LDL-cholesterol, which was attributed to increased export of elevated cholesterol from the liver by Lipa. - / - Other serum indices affected by the disease, such as reduced serum HDL-cholesterol (which mediates cholesterol influx into the liver) and reduced serum glucose (likely reflecting reduced nutrient uptake into the intestine), were both increased in mice treated with 4mo Lipid. - / - In mice, serum bilirubin levels were reduced by more than half and significantly increased toward baseline wild-type levels by AAV treatment (not shown). Other indicators of abnormal liver function, such as elevated serum total bilirubin and total protein, were also completely corrected by treatment with rscAAVrh74.mCMV.LIPA, although these changes were statistically significant only for total protein (e.g., total bilirubin: WT 0.38 ± 0.02 mg / dL, Lipa - / - 0.54±.013mg / dL, Lipa - / - Treated 0.31±0.04mg / dL, Total protein:WT 5.55±0.07g / dL, Lipa - / -6.82±0.10g / dL (p<0.00001 vs. WT), Lipa - / - Treated 5.78 ± 0.18 (p < 0.001 vs. untreated Lipa - / - ).

[0091] By 4 months of age, Lipa - / - The mice are easily recognized by visual inspection as they have enlarged and distended abdomens due to a dramatic increase in liver and spleen size, which is also a symptom of the human disease (Burton et al. J Pediatr Gastroenterol Nutr 61:619-625, 2015). By the 6-month endpoint, both the spleen and liver had increased in combined size by more than five-fold (Figure 4). This is primarily due to the significant loading of triglycerides into these organs, although other organs are also affected, e.g., the intestine, heart, and kidneys show increased size due to the fat loading (Figure 4). In contrast, brain size did not increase and muscle size decreased, likely due to impaired nutrient absorption (Figure 4). 8×10 13 Treatment with rscAAVrh74.mCVM.LIPA at a dose of 100 vg / kg reduced the increase in organ size at 6 months of age in all tested organs by at least 70%, with all such organs showing significant improvement toward their baseline wild-type indices (Figure 4).

[0092] These improvements in organ size were matched by a significant reduction in staining with Oil Red O (hematoxylin counterstain in blue, FIG. 5). Oil Red O staining was performed in 6-month-old sham-treated Lipid-treated mice to identify lipid burden in the intestine, spleen, liver, and kidney. - / - Compared with controls, AAV-treated Lipa - / - The study showed a highly significant reduction in staining in untreated mice. Such reduced staining strongly indicated reduced fat content. This was confirmed by biochemical indicators of triglyceride content in the liver and spleen. - / -The more than five-fold increase in triglyceride content in mice was significantly reduced by AAV treatment, approaching baseline wild-type levels in both cases (Figure 6). AAV treatment also resulted in an improvement in the overall activity level of the mice in the open field test, with the mice exhibiting locomotor activity equal to or greater than that of wild-type mice. For example, at 6 months, the mean total locomotor events per 5-minute interval was significantly greater in sham-treated Lipid-treated mice compared to wild-type FVB / NJ controls. - / - In mice, this index was reduced by 35% compared with AAV-treated Lipid - / - In mice, activity was increased 1.35-fold over wild-type activity (WT: 4477 ± 381 events / 5 min, Lipase - / - :2925±771 events / 5 min, Lipa - / - Treated: 6069 ± 72 events / 5 min, treated vs. untreated Lipa - / - p<0.05 for comparisons).

[0093] Surprisingly, Lipa - / - It was expected that the liver would be readily transduced with AAV in mice, but the liver was 13 At an IV dose of 1.5 vg / kg (n=4), transduction was only at 1.7 ± 0.4 vg / nucleus, a mere two-fold increase in transduction compared to skeletal muscle in the same mice (0.9 ± 0.1 vg / nucleus, n=4). This level of transduction indicates saturation of cells in the liver (>1 vg / nucleus), whereas it is not uncommon to generate 10–100 vg / nucleus with this dose of other AAV vectors

[22] . This lower level of transduction may be due to the fact that hepatocytes in the liver divide in the first month of life in mice as the liver grows, making it impossible to therapeutically transduce such cells at a time point prior to the generation of such hepatocytes, at postnatal day 2.

[0094] Example 3 Gene therapy in young adult mice Because hepatocytes divide in the liver as they grow until about 1 month of age, we investigated the treatment of young adult (2 month old) mice. - / -Mice were administered a single injection of rscAAVrh74.mCMV.LIPA intravenously via the retro-orbital vein with 8 × 10 13 vg / kg of rscAAVrh74.mCMV.LIPA. Adult Lipa - / - Treatment of mice with rscAAVrh74.mCMV.LIPA led to a logarithmic increase in transduction of the viral genome into the liver, increasing it from 2 to 50 vg / nucleus (Figure 7).

[0095] This transduction level resulted in increased human LIPA transgene expression above the normal mouse LIPA gene expression seen in wild-type tissues, as measured by qRT-PCR (Figure 8). - / - The overall appearance of the liver from mice was not different from wild type (FVBn) and showed no fat at all, whereas 4-month-old Lipa from mice treated with P1 - / - Mice were treated with untreated Lipase - / - Although not as much as in mice, they still contained some fat and were also greatly increased in size (Figure 9).

[0096] The visually observed reduced fat content was consistent with the treated Lipid in both the liver and spleen. - / - This was confirmed by the measured reduction in cholesterol and triglycerides in (LIPA KO) mice, which were not significantly different from wild type in the 2mo condition (Figure 10).

[0097] The weights of the liver, spleen, and intestine were all compared with those of untreated Lipomas. - / -At 2 months, the AAV expression was reduced to near normal levels, despite the fact that these organs had already doubled in size by this time point in mice due to fat loading (Figure 11). Thus, rscAAVrh74.mCMV.LIPA can prevent and reverse disease symptoms in the LAL-D model. Blood cells in lymph nodes showed greater prevention of fat loading with treatment at 2 mo compared to 2 days (Figure 11). Since mouse blood cells turn over over the course of several months, this indicates a trans effect of rscAAVrh74.mCMV.LIPA treatment in adult mice, as blood cells would have lost AAV expression due to turnover by 4 months of age. This finding indicates that LIPA enzyme activity was increased in the LiPA cells treated with rscAAVrh74.mCMV.LIPA as adults. - / - This correlated with the fact that it was indeed elevated in mouse serum (Figure 12), along with its elevation in liver tissue (Figure 13).

[0098] This data indicates that the LIPA enzyme is released from the liver and expressed systemically in the blood as a result of gene therapy treatment in adult animals, providing therapeutic protein in trans to tissues where cells are constantly turning over, such as blood. This allows rscAAVrh74.mCMV.LIPA gene therapy to provide enzyme replacement therapy not only to transduced cells and tissues when appropriate doses and timing of therapy are given, but also to cells not transduced by gene therapy. Such therapy would allow for uninterrupted prevention of disease throughout the body on an ongoing basis during the patient's lifetime.

[0099] Example 3 rscAAVrh74.miniCMV.LIPA treatment was - / - Can inhibit and reverse hepatosplenomegaly and elevated serum liver enzymes in mice As an extension of the experiments described in Example 2, rscAAVrh74.miniCMV.LIPA was administered at various ages. These experiments tested AAV doses that, when accounting for differences in titration methods, were equivalent to the highest doses currently used in gene therapy clinical trials (36, 37). A dose of 8.4 × 10 per kilogram of rscAAVrh74.miniCMV.LIPA AAV gene therapy was administered at 1.5 × 10 per kilogram. 13 The dose (vg / kg) of vector genome (vg) was calculated using the Lipid - / - Mice were injected intravenously via the facial vein for early (P2, postnatal day 2) or via the tail vein for intermediate (P60, postnatal day 60) or advanced (P120, postnatal day 120) disease stages. Mice were followed to endpoints of P60 (2 months of age), P120 (4 months of age), and P180 (6 months of age). (Figure 14A) At these time points, mice were necropsied and organs (liver, spleen, kidney, intestine, mesenteric lymph nodes, heart, lung, thymus, brain) and muscles (left and right gastrocnemius and quadriceps) were harvested for biodistribution and gene expression. Harvested non-muscle organs were weighed and then immersed in OCT before being frozen in isopentane cooled on dry ice. Muscles were weighed and then flash frozen in isopentane cooled with liquid nitrogen.

[0100] Hepatosplenomegaly, or enlargement of the liver and spleen, and yellowing of the organs due to increased fatty deposits, are both symptoms of Lipa - / - We have defined the characteristics of LAL-D and disease in mice. Both phenotypes are characterized by the - / - A 10-fold increase in liver weight was present in aged mice and progressed with age (Fig. 14B-D). Liver weight increased over time and comprised as much as 25% of total body weight by 6 months of age, in contrast to only 5% of body weight at all three ages in wild-type (WT) mice (Fig. 14C). Similarly, spleen weight was, on average, 0.3% in the Lipa mice compared to 0.3% in the WT. - / - In mice, the increase in lipid metabolism increased to 2% of total body weight at 6 months of age (Figure 14D). - / -Treatment of mice resulted in reduced liver weight and normalized liver color, although early treatment (P2) was much less effective than treatment with P60 or P120. P2 injection reduced liver size to wild-type levels at 2 and 4 months, indicating disease inhibition, but only partially reduced liver weight by approximately 50% at 6 months. In contrast, P60 and P120 injections were more effective, reducing liver weight to 8% and 10% of total body weight, respectively, at 6 months, indicating disease reversal, despite evidence of hepatosplenomegaly already present at these ages. P2 injection was more effective at reducing spleen size than liver at the 6-month endpoint (Figure 14D), and treatment at all three time points reduced spleen weight to near wild-type levels. Intestine and mesenteric lymph nodes also showed increased splenic mass in the 6-month endpoint compared with the 6-month endpoint (Figure 14C). - / - The AAV treatments showed increased weight in mice (Fig. 14E,F). Intestine weight increased to 4.5% of total body weight at 6 months of age compared to 3% in WT (Fig. 14E), while mesenteric lymph node weight increased to 0.6% of body weight compared to 0.1% in WT (Fig. 14F). Again, AAV treatment reduced intestinal and mesenteric lymph node weights in a manner similar to the response seen in the liver, with P2 injections showing improvement to near wild-type levels at 2 or 4 months that were lost by 6 months, while injections at P60 or P120 showed reduced weights at the 6-month endpoint. Unlike liver, spleen, and intestine, no data showed complete normalization of lymph node weights at any time point at any of the treatment times tested. Instead, at best, only a mean reduction of 50% of body weight was achieved by 6 months (Fig. 14F).

[0101] Serum ALT and AST activity were also measured, and when elevated, these enzymes indicate liver damage (Fig. 14G, H). Both serum ALT and AST levels were significantly increased in Lipid-treated mice compared to WT by 6 months. - / -In mice, serum ALT / AST levels were increased 20-fold in WT mice. Here, treatment at all time points resulted in decreased serum ALT / AST levels, with the effect of injection at P60 and P120 being more pronounced than at P2. Similar to liver weight, injection at P2 reduced serum ALT and AST levels to near wild-type levels at 2 and 4 months, but only showed a reduction of about 50% at 6 months. Injection of this dose of rscAAVrh74.miniCMV.LIPA in WT mice did not significantly increase serum transaminase levels at any of the time points tested. Despite increased body weight and serum liver enzyme levels at 6 months for P2 injection, several P2-treated Lipa mice survived beyond the 6-month endpoint. - / - Mice were treated with untreated Lipase - / - Compared to controls, there was a significant increase in overall life span (Figure 15). - / - Mice showed a median survival of 224 days, compared with P2-treated Lipase - / - Mice had a median survival of 506 days and were significantly longer than untreated Lipomas. - / - This was more than double the median mouse lifespan.

[0102] Lipa - / - The body weight of the mice did not differ from that of WT mice at any time point of the study (Figure 16A). - / - A significant reduction in muscle mass of about 25% was observed in mice (Fig. 15B, C). - / - Mice presented with a distended abdomen. Open field studies in which fine, ambulatory, central, peripheral, and rearing motor events were determined were performed as previously described (49) to determine whether mobility was affected (Figure 16D-H). Fine motor (such as sniffing and grooming) and peripheral motor (movement around the periphery of the open field area) were significantly increased in Lipid-treated mice compared to WT. - / - While rats were unaffected by the treatment, central cage-based ambulation and rearing were significantly reduced. All such measures were improved by treatment at all time points. Such muscle atrophy was also associated with the development of Lipid-induced hypertrophy in the rats. - / -In addition to abdominal distension in mice, which may contribute to the gait differences, these muscle weights increased back to WT levels upon P60 and P120 injections, but were only slightly increased for P2 (Supplementary Fig. 16B,C).

[0103] Example 4 AAV transduction in organs results in LIPA expression and restored lysosomal acid lipase enzyme activity Quantitative real-time PCR (Figure 17A) was used to assess AAVvg biodistribution in various organs and tissues from all injection time points, as described in (50). At the 6-month endpoint, there were differences in organ biodistribution between mice injected with P2 and those injected with P60 or P120, with injection with P2 showing greater AAV transduction in the heart and lungs (21.82 ± 8.41 vg / nucleus and 7.87 ± 1.16 vg / nucleus, respectively; Table 3), whereas injection with P60 or P120 showed greater transduction in the liver (406.13 ± 117.59 vg / nucleus and 90.69 ± 21.48 vg / nucleus, respectively), kidney, lung, spleen, and liver (Table 3). Injections at P2 showed higher levels (20-50 vg / nucleus) in the heart and thymus (Figure 17A, Table 4). Comparison of kidney and muscle from the left and right sides of the body plan showed equal AAV distribution. With injections at P2, there was a sharp decline in transduction from 4 to 6 months in the heart and liver, but transduction levels remained relatively stable over the course of the study in most organs (Tables 3 and 4 below). With injections at P60, transduction levels were also stable when measured at 2 and 4 months post-injection. [Table 3] [Table 4]

[0104] We then used quantitative reverse transcription (RT)-PCR to measure the mRNA levels of the human LIPA transgene in treated mice compared to the normal expression of the endogenous mouse Lipa gene in wild-type tissues. At the 6-month study endpoint, injection at P2 resulted in 3-fold and 15-fold increased LIPA expression in the lungs and heart, respectively (Figure 17B), consistent with the findings of 7 and 20 vg / nucleus of AAVvg in these organs at this time point. P2 injection achieved near-normal levels of gene expression in the liver, with human LIPA / mouse WT Lipa equal to 0.8. Interestingly, despite the fact that, on average, there was 90 or 400 vg / nucleus in the liver at this time point, respectively, there was only a 1.5-fold increase in liver with the same ratio for P60 or P120 injection at 6 months, indicating feedback inhibition on AAV-mediated LIPA transgene expression. Similarly, AAV transduction in kidney and lymph node did not result in increased expression LIPA / Lipa ratios, despite the presence of 5-30 vg / nucleus in those tissues at P60 and P120. Also of interest was the fact that skeletal muscles (gastrocnemius and quadriceps) injected with P2 showed a 20-fold higher LIPA / Lipa ratio at 6 months for P2, whereas muscles injected with P60 and P120 showed lower ratios, despite having higher AAVvg. rscAAVrh74.miniCMV.LIPA treatment at any time point did not alter endogenous murine Lipa expression (not shown), but did increase Lipa expression. - / - Tissues in mice showed some reduction in endogenous Lipa gene expression compared to wild type (not shown).

[0105] Lysosomal acid lipase (LAL) enzyme activity was also measured in liver, spleen, and serum from treated and control mice (Figure 17C-E). Overall LAL enzyme activity was significantly increased in the treated and control mice compared to the WT. - / - At the 6-month endpoint, liver enzyme activity was reduced by 90% compared with untreated Lipase at all examined time points. - / -The LAL activity in the spleen was not significantly different between mice treated with P60 and P120 (Figure 17C). However, when injected with P60 and P120, AAV treatment resulted in a significant increase in enzyme activity, 4-fold and 2.5-fold over WT activity, respectively. In the spleen, overall LAL activity was reduced by about 80% compared to WT at 6 months. Similar to the liver, P2-injected spleens showed no improvement in activity at 6 months. However, unlike the liver, the P60 treatment time point in the spleen also showed no improvement, while P120 showed an increase, but did not reach WT levels (Figure 17D).

[0106] Serum LAL enzyme activity was also assayed to determine whether exogenous LAL was being secreted from cells as a result of treatment in a manner that could be utilized in trans by other tissues. Frozen liver and spleen samples were homogenized in LAL tissue extraction buffer (0.1 M sodium phosphate pH 6.8, 1 mM EDTA, 0.02% sodium azide, 10 mM DTT, 0.5% NP-40). Protein concentration was determined by bicinchoninic acid assay (Pierce) using BSA as a standard. LAL activity was determined using 4-methylumbelliferyl palmitate (4-MUP, Gold Biotechnology) as a substrate as previously described (51, 52). Briefly, 1 μg of protein was added to 0.345 mM substrate solution (0.345 mM 4-MUP, 90.9 mM sodium acetate, pH 4.0, 1% (v / v) Triton X-100, and 0.0325% (w / v) cardiolipin) and the enzymatic reaction was performed in triplicate in the presence or absence of the LAL inhibitor Lalistat2 (Sigma Aldrich). The reaction was incubated at 37°C for 3 h in the dark. The reaction was stopped by adding 200 μl of 150 mM EDTA, pH 11.5). A standard curve of 4-methylumbelliferone (4-MU, Gold Biotechnology) ranging from 0 to 33.3 μM was prepared. Fluorescence was measured on a SpectraMax M2 plate reader (Molecular Devices) using a 355 nm excitation filter and a 460 nm emission filter. LAL activity (pmol / min / μμg) was calculated by subtracting the enzyme activity of the inhibited reaction from that of the uninhibited reaction.

[0107] Serum enzyme activity was only performed in mice treated with P60 and P120 because there was not enough serum remaining after blood chemistry analysis from P2-treated mice. - / - Overall LAL activity in mice was approximately one-third that of WT (11.80±2.89 vs. 29.43±2.91 pmol / min / μμl serum). Treatment with P60 and P120 restored serum LAL enzyme activity to WT levels (FIG. 17E).

[0108] Example 5 Lipa treated with rscAAVrh74.miniCMV.LIPA - / - Reduces triglyceride and cholesterol levels in mice Total lipids were extracted from flash frozen tissues using a lipid extraction kit (chloroform-free) (abcam) according to the manufacturer's protocol. Triglycerides were measured using Infinity triglyceride reagent (Thermo Fisher Scientific) and total cholesterol was measured using Infinity cholesterol reagent (Thermo Fisher Scientific). Lipid concentrations were determined against a standard curve of triglyceride or cholesterol standards (Pointe Scientific). Measurements were performed in triplicate and absorbance values ​​at 500 nm were measured on a Synergy 2 plate reader (BioTek Instruments).

[0109] Untreated Lipids, when assayed at 2, 4, and 6 months, - / - Total cholesterol in the liver of mice was constantly elevated, averaging 19.96±3.97 μg / mg liver, approximately 12-fold higher than in the WT (FIG. 18). Cholesterol content in the spleen increased more slowly, from 2.65±0.66 μg / mg at 2 months to 5.51±0.91 μg / mg at 6 months. Cholesterol content in the WT spleen also increased with age (from 1.44±0.70 μg / mg at 2 months to 2.23±0.36 μg / mg at 6 months). Treatment with P2 significantly reduced cholesterol levels in the liver and spleen at 2 and 4 months after injection. At 6 months, total cholesterol levels for P2 treatment were significantly higher than those of untreated Lipid in both liver and spleen. - / - Levels were restored to those of the WT for P60 and P120 injections (FIG. 18B), while cholesterol content remained reduced to near WT levels for P60 and P120 injections.

[0110] Untreated Lipa - / -Triglyceride levels in the liver of mice doubled from 2 to 4 months of age (14.04 ± 4.15 μg / mg to 29.32 ± 3.70 μg / mg) and then remained constant at 6 months (30.66 ± 10.45 μg / mg) (Figure 18C). Thus, at 6 months, these values ​​were, on average, elevated 6-fold compared to WT (average 4.70 ± 0.34 μg / mg). At all time points, treatment significantly reduced hepatic triglycerides, approaching or reaching WT levels (Figure 18C). In the spleen, Lipid - / - Triglyceride content in mice increased more gradually from 2 to 6 months of age (2.27±1.32μg / mg to 4.31±2.82μg / mg), with no significant difference in Lipid levels up to 6 months of age. - / - Spleen triglyceride content was not significantly higher than in WT. Unlike the liver, treatment with P2 and P60 did not significantly alter triglyceride content in the spleen at the 2-, 4-, or 6-month endpoints (FIG. 18D). Instead, only treatment with P120 showed a significant decrease.

[0111] Lipa - / - Serum changes in mice included elevated LDL cholesterol, along with reduced total cholesterol, triglycerides, HDL cholesterol, and free fatty acids (Figure 18E-I). As seen with lipid levels in liver and spleen, P2 treatment did not significantly improve any of these altered serum lipid levels at the 2, 4, or 6 month endpoints, although in many cases there was a trend toward improvement. In contrast, treatment with P60 and P120 did not significantly improve Lipid levels. - / - The treatment offset the reduction in total cholesterol, HDL cholesterol, and free fatty acids in mice, producing levels close to those seen in WT mice at the 6-month endpoint. Similarly, treatment partially corrected triglycerides and LDL cholesterol.

[0112] Oil Red O (ORO) staining of tissue sections was used to visualize neutral lipids in the liver, spleen, and intestine (Figure 18J). - / -There was a large accumulation of ORO-stained lipid in the liver, spleen, and intestine, with strong staining nearly ubiquitous in the liver. At all treatment time points, there was an overall decrease in ORO staining, which was most pronounced for treatment at P60 and P120. After treatment, ORO staining appeared primarily as lipid islands in tissues, whereas in untreated Lipid - / - The more diffuse staining seen in the mouse was absent in the remainder of the section.

[0113] Example 6 LIPA expression reduces macrophages in the liver To determine the degree of hepatocyte expression and the degree of macrophage occupancy in treated livers, LIPA and CD68 immunostaining were performed. 10 μm frozen tissue sections were prepared from liver samples. Slides were fixed in acetone for 10 min at -20°C, air-dried to evaporate excess acetone, and washed twice in PBS. Slides were incubated in BLOXALL endogenous blocking solution (Vector Laboratories) for 10 min, washed twice in PBS, and then blocked in 2.5% normal serum for 30 min. Slides were incubated overnight at 4°C with antibodies against LIPA (1:1000, HPA057052, Sigma Aldrich), or CD68 (1:500, MCA1957GA, Bio-Rad). After incubation, slides were washed twice in PBS and incubated with ImmPRESS HRP reagent (Vector Laboratories) for 30 min. Slides were then washed twice in PBS and stained with ImmPACT DAB staining solution (Vector Laboratories) for 5 min. They were then counterstained with hematoxylin QS (Vector Laboratories), dehydrated, differentiated, and mounted in Cytoseal XYL (Thermo Fisher Scientific) with glass coverslips.

[0114] As shown in Figure 19, at the 6-month endpoint, P2 treated Lipase - / -Mice injected at P60 and P120 showed only very diffuse and weak staining in liver cells, with little or no punctate staining that would be expected for lysosomal localization of the protein. In contrast, mice injected at P60 and P120 showed increased punctate immunostaining that was evident throughout the liver sections. Anti-CD68 staining, a marker used to detect macrophages and Kupffer cells, was significantly higher in untreated Lipid-injected mice than in untreated control mice. - / - LIPA and CD68 immunostaining showed highly elevated staining in mice with P60 and P120. At all treatment time points, there was a decrease in CD68-positive macrophages, but staining remained within lipid islands present in the liver. Thus, LIPA and CD68 immunostaining supported the notion that P60 and P120 treatment resulted in high levels of LIPA expression and decreased macrophage occupancy in the liver.

[0115] Example 7 Lower doses of rscAAVrh74.miniCMV.LIPA still show therapeutic benefit 8.4×10 13 A dose of 4.2 × 10 vg / kg was administered to ensure saturation to determine if gene therapy is viable for LAL-D. Given the encouraging data from this administration, experiments were designed to determine if lower doses of gene therapy vector would still prove efficacious. Injections at P60 (mid-stage) disease yielded the most positive results at the higher dose, so this injection protocol was repeated with 4.2 × 10 13 , 2.1×10 13 , and 1.05×10 13 vg / kg rscAAVrh74.miniCMV.LIPA, ultimately lowering the dose 8-fold compared to the starting dose. These mice were followed up until 6 months of age (4 months after injection).

[0116] The gross pathology of the liver and spleen was first examined. With decreasing dose, the liver appeared progressively larger and more yellowish, and showed increased fatty deposits (FIG. 20A). Nevertheless, treatment with all four doses did not significantly improve the pathology of untreated Lipomas. - / - showed a more normal liver appearance when compared to mice (Figure 20A), and at the two higher doses (8.4×1013 and 4.2 x 10 13 The first dose (vg / kg) had a slightly greater effect than the two lower doses. The spleens also appeared longer and thicker as the dose was reduced, but similarly remained much smaller and less enlarged than would occur without treatment (Figure 20A). Hepatosplenomegaly was reduced at all four doses, and the percentage of body weight for liver and spleen at all four doses was significantly greater than that of untreated Lipomegaly. - / - The IL-16 expression level was significantly reduced compared to that in mice (Figure 20B, C). However, the IL-16 expression level was significantly reduced at the two lowest doses used (1.05 × 10 13 vg / kg and 2.1 × 10 13 vg / kg), 4.2 × 10 13 vg / kg. Similarly, all four doses showed a reduction in intestinal weight (Fig. 20D), but only the two highest doses showed a reduction in mesenteric lymph node weight (Fig. 20E). Serum ALT and AST values ​​were significantly reduced at all four doses, with a slight trend toward higher levels at the lower doses as well (Fig. 20F and G).

[0117] The biodistribution of AAV was examined in all organs and tissues for the dosing experiment (Figure 21A, Table 5). 13 vg / kg vs. 4.2 × 10 13 vg / kg, and 2.1 × 10 13 vg / kg to 1.05 × 10 13 There was a two-fold decrease in AAV between the 10 and 20 vg / kg groups, with 4.2 × 10 13 vg / kg and 2.4 × 10 13 There was a more than two-fold sharp decrease in AAVvg / nucleus between doses of 1.05 × 10 13 At the lowest dose of 1000 vg / kg, the liver still had approximately 20 vg / nucleus and the spleen had 2 vg / nucleus. Interestingly, this translated into the less expected expression of human LIPA transcript (Figure 21B), which was significantly higher in the liver than in the spleen at the highest dose (8.4 x 10 13At the lowest dose (1.05 × 10 vg / kg), despite greater than 200 vg / nucleus, there was only a 2-fold increase in LIPA expression normalized to endogenous mouse wild-type Lipa expression. 13 Using 100 mg of AAV (vg / kg), LIPA transcript levels were still restored to WT levels (Figure 21B) and resulted in WT levels of enzyme activity in the liver (Figure 21C). Low expression of AAV and LIPA transcripts at all doses in the spleen was consistent with untreated Lipase - / - The LAL enzyme activity in serum was significantly increased in mice treated with 100 mg / kg of lipase compared to untreated mice (Figure 21D). - / - was elevated compared to (Figure 21E). [Table 5]

[0118] All four doses also demonstrated efficacy in untreated Lipid- - / - Compared to mice treated with 100 mg / kg / day DMSO, cholesterol (Figure 22A,B) and triglyceride (Figure 22C,D) contents in the liver were significantly reduced. Cholesterol and triglyceride contents in both liver and spleen were reduced to be equal or nearly equal to WT levels at all four doses used. Spleen triglyceride levels were reduced more than triglyceride levels in the liver, but all indices were significantly different. Thus, the reduction in lipid content in the liver and spleen was consistent with the Lipid - / - 1.05 × 10 in mice 13 This can be achieved with doses of rscAAVrh74.miniCMV.LIPA as low as vg / kg.

[0119] References 1. Pastores, GM, and Hughes, DA (2020). Lysosomal Acid Lipase Deficiency: Therapeutic Options. Drug Des Devel Ther 14:591-601. 2.Gomaraschi,M,Bonacina,F,and Norata,GD(2019).Lysosomal Acid Lipase:From Cellular Lipid Handler to Immunometabolic Target.Trends Pharmacol Sci 40:104-115. 3.Li,F,and Zhang,H(2019).Lysosomal Acid Lipase in Lipid Metabolism and Beyond.Arterioscler Thromb Vasc Biol 39:850-856. 4.Aguisanda,F,Thorne,N,and Zheng,W(2017).Targeting Wolman Disease and Cholesteryl Ester Storage Disease:Disease Pathogenesis and Therapeutic Development.Curr Chem Genom Transl Med 11:1-18. 5.Abramov,A,Schorr,S,and Wolman,M(1956).Generalized xanthomatosis with calcified adrenals.AMA J Dis Child 91:282-286. 6.Burton,BK,Deegan,PB,Enns,GM,Guardamagna,O,Horslen,S,Hovingh,GK,et al.(2015).Clinical Features of Lysosomal Acid Lipase Deficiency.J Pediatr Gastroenterol Nutr 61:619-625. 7.Pericleous,M,Kelly,C,Wang,T,Livingstone,C,and Ala,A(2017).Wolman’s disease and cholesteryl ester storage disorder:the phenotypic spectrum of lysosomal acid lipase deficiency.Lancet Gastroenterol Hepatol 2:670-679. 8.Shan,Z,and Ju,C(2020).Hepatic Macrophages in Liver Injury.Front Immunol 11:322. 9.Baratta,F,Pastori,D,Ferro,D,Carluccio,G,Tozzi,G,Angelico,F,et al(2019).Reduced lysosomal acid lipase activity:A new marker of liver disease severity across the clinical continuum of non-alcoholic fatty liver disease?World J Gastroenterol 25:4172-4180. 10.Du,H,and Grabowski,GA(2004).Lysosomal acid lipase and atherosclerosis.Curr Opin Lipidol 15:539-544. 11.Wild,PS,Zeller,T,Schillert,A,Szymczak,S,Sinning,CR,Deiseroth,A,et al.(2011).A genome-wide association study identifies LIPA as a susceptibility gene for coronary artery disease.Circ Cardiovasc Genet 4:403-412. 12.Burton,BK,Balwani,M,Feillet,F,Baric,I,Burrow,TA,Camarena Grande,C,et al.(2015).A Phase 3 Trial of Sebelipase Alfa in Lysosomal Acid Lipase Deficiency.N Engl J Med 373:1010-1020. 13.Spencer,HT,Riley,BE,and Doering,CB(2016).State of the art:gene therapy of haemophilia.Haemophilia 22 Suppl 5:66-71. 14.High,KA(2012).The gene therapy journey for hemophilia:are we there yet?Hematology Am Soc Hematol Educ Program 2012:375-381. 15.Rodino-Klapac,LR,Chicoine,LG,Kaspar,BK,and Mendell,JR(2007).Gene therapy for duchenne muscular dystrophy:expectations and challenges.Arch Neurol 64:1236-1241. 16.Mendell,JR,Al-Zaidy,S,Shell,R,Arnold,WD,Rodino-Klapac,LR,Prior,TW,et al.(2017).Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy.N Engl J Med 377:1713-1722. 17.Testa,F,Maguire,AM,Rossi,S,Pierce,EA,Melillo,P,Marshall,K,et al.(2013).Three-year follow-up after unilateral subretinal delivery of adeno-associated virus in patients with Leber congenital Amaurosis type 2.Ophthalmology 120:1283-1291. 18.Nagree,MS,Scalia,S,McKillop,WM,and Medin,JA(2019).An update on gene therapy for lysosomal storage disorders.Expert Opin Biol Ther 19:655-670. 19.Penati,R,Fumagalli,F,Calbi,V,Bernardo,ME,and Aiuti,A(2017).Gene therapy for lysosomal storage disorders:recent advances for metachromatic leukodystrophy and mucopolysaccaridosis I.J Inherit Metab Dis 40:543-554. 20.Biffi,A(2016).Gene therapy for lysosomal storage disorders:a good start.Hum Mol Genet 25:R65-75. 21.Rastall,DP,and Amalfitano,A(2015).Recent advances in gene therapy for lysosomal storage disorders.Appl Clin Genet 8:157-169. 22.Zygmunt,DA,Xu,R,Jia,Y,Ashbrook,A,Menke,C,Shao,G,et al.(2019).rAAVrh74.MCK.GALGT2 Demonstrates Safety and Widespread Muscle Glycosylation after Intravenous Delivery in C57BL / 6J Mice.Mol Ther Methods Clin Dev 15:305-319. 23.Chicoine,LG,Rodino-Klapac,LR,Shao,G,Xu,R,Bremer,WG,Camboni,M,et al.(2014).Vascular delivery of rAAVrh74.MCK.GALGT2 to the gastrocnemius muscle of the rhesus macaque stimulates the expression of dystrophin and laminin alpha2 surrogates.Mol Ther 22:713-724. 24.Martin,PT,Xu,R,Rodino-Klapac,LR,Oglesbay,E,Camboni,M,Montgomery,CL,et al.(2009).Overexpression of Galgt2 in skeletal muscle prevents injury resulting from eccentric contractions in both mdx and wild-type mice.Am J Physiol Cell Physiol 296:C476-488.25.Grieger,JC,and Samulski,RJ(2005).Adeno-associated virus as a gene therapy vector:vector development,production and clinical applications.Adv Biochem Eng Biotechnol 99:119-145. 26.Rosas,LE,Grieves,JL,Zaraspe,K,La Perle,KM,Fu,H,and McCarty,DM(2012).Patterns of scAAV vector insertion associated with oncogenic events in a mouse model for genotoxicity.Mol Ther 20:2098-2110. 27.Xiao,X,Li,J,and Samulski,RJ(1998).Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus.J Virol 72:2224-2232. 28.Bish,LT,Morine,K,Sleeper,MM,Sanmiguel,J,Wu,D,Gao,G,et al.(2008).Adeno-associated virus (AAV) serotype 9 provides global cardiac gene transfer superior to AAV1,AAV6,AAV7,and AAV8 in the mouse and rat.Hum Gene Ther 19:1359-1368. 29.Cunningham,SC,and Alexander,IE(2019).AAV-Mediated Gene Delivery to the Mouse Liver.Methods Mol Biol 1937:213-219. 30.Palaschak,B,Herzog,RW,and Markusic,DM(2019).AAV-Mediated Gene Delivery to the Liver:Overview of Current Technologies and Methods.Methods Mol Biol 1950:333-360. 31.McCarty,DM(2008).Self-complementary AAV vectors;advances and applications.Mol Ther 16:1648-1656. 32.Fu,H,Zaraspe,K,Murakami,N,Meadows,AS,Pineda,RJ,McCarty,DM,et al.(2018).Targeting Root Cause by Systemic scAAV9-hIDS Gene Delivery:Functional Correction and Reversal of Severe MPS II in Mice.Mol Ther Methods Clin Dev 10:327-340. 33.Du,H,Duanmu,M,Witte,D,and Grabowski,GA(1998).Targeted disruption of the mouse lysosomal acid lipase gene:long-term survival with massive cholesteryl ester and triglyceride storage.Hum Mol Genet 7:1347-1354. 34.Du,H,Heur,M,Duanmu,M,Grabowski,GA,Hui,DY,Witte,DP,et al.(2001).Lysosomal acid lipase-deficient mice:depletion of white and brown fat,severe hepatosplenomegaly,and shortened life span.J Lipid Res 42:489-500. 35. Sun, Y, Xu, YH, Du, H, Quinn, B, Liou, B, Stanton, L, et al. (2014). Reversal of advanced disease in lysosomal acid lipase deficient mice: a model for lysosomal acid lipase deficiency disease. Mol Genet Metab 112:229 - 241. 36. Mendell JR, Al-Zaidy S, Shell R, Arnold WD, Rodino-Klapac LR, Prior TW, et al. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. New England Journal of Medicine. 2017;377(18):1713 - 22. 37. Mendell JR, Sahenk Z, Lehman K, Nease C, Lowes LP, Miller NF, et al. Assessment of Systemic Delivery of rAAVrh74.MHCK7.micro-dystrophin in Children With Duchenne Muscular Dystrophy: A Nonrandomized Controlled Trial. JAMA Neurology.

[0120] SEQ ID NO: 1: LIPA gene variant 1 SEQ ID NO:3 TCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGGACTCACGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCG ptrs.miniCMV.LIPA AAV vector plasmid sequence (SEQ ID NO:4) CGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGAATTCGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC

Claims

1. (a) one or more regulatory control elements; (b) a lipase A (LIPA) cDNA sequence.

2. The polynucleotide of claim 1 , wherein the regulatory control element is a miniCMV promoter or a fragment thereof.

3. 3. The polynucleotide of claim 1 or 2, wherein the LIPA cDNA comprises: (a) a nucleotide sequence having at least 95% sequence identity to SEQ ID NO:1; or (b) the nucleotide sequence shown in SEQ ID NO:

1.

4. The polynucleotide according to any one of claims 1 to 3, further comprising the nucleotide sequence of SEQ ID NO:

3.

5. 4. The polynucleotide of claim 1, comprising nucleotides 1853 to 3906 of SEQ ID NO:

4.

6. 6. The polynucleotide of any one of claims 1 to 5, comprising: (a) a nucleotide sequence that is at least 95% identical to SEQ ID NO:4; or (b) the nucleotide sequence of SEQ ID NO:

4.

7. A recombinant adeno-associated virus (rAAV) having a genome comprising the polynucleotide sequence of any one of claims 1 to 5.

8. 8. The rAAV of claim 7, wherein the rAAV is of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVrh74, AAV11, AAV12, AAV13, or Anc80, AAV7m8, and derivatives thereof.

9. An rAAV particle comprising the rAAV of claim 7 or 8.

10. A composition comprising an rAAV according to claim 7 or 8, or a viral particle according to claim 9.

11. The composition of claim 10 , wherein the composition is formulated for intravenous delivery.

12. 12. A composition for treating lysosomal acid lipase deficiency (LAL-D) in a subject in need thereof, comprising a polynucleotide according to any one of claims 1 to 6, an rAAV according to claim 7 or 8, an rAAV particle according to claim 9, or a composition according to claim 10 or 11.

13. The composition of claim 12, wherein the LAL-D is Wolman's disease or cholesterol ester storage disease.

14. The composition of claim 12 or 13, wherein the subject has a mutation in the LAL-D gene.

15. 12. A composition for treating a disorder associated with lipid storage or accumulation in a subject in need thereof, comprising a polynucleotide according to any one of claims 1 to 6, an rAAV according to claim 7 or 8, an rAAV particle according to claim 9, or a composition according to claim 10 or 11.

16. 16. The composition of claim 15, wherein the disorder is coronary artery disease, atherosclerosis, type II diabetes, obesity, or non-alcoholic fatty liver disease.

17. 12. A composition for treating dyslipidemia or hypercholesterolemia in a subject in need thereof, comprising a polynucleotide according to any one of claims 1 to 6, an rAAV according to claim 7 or 8, an rAAV particle according to claim 9, or a composition according to claim 10 or 11.

18. 12. A composition for reducing triglycerides, cholesterol, and / or fatty acids in a subject in need thereof, comprising a polynucleotide according to any one of claims 1 to 6, an rAAV according to claim 7 or 8, an rAAV particle according to claim 9, or a composition according to claim 10 or 11.

19. The composition of any one of claims 15 to 18, wherein the composition is administered in combination with an immunosuppressant.

20. The composition of any one of claims 15 to 19, wherein the composition is formulated for intravenous delivery.

Images