A composition for preventing or improving graying of hair, promoting hair growth, and / or preventing or improving hair loss, comprising double-stranded miRNA as an active ingredient

Abstract

The present invention relates to a composition for improving gray hair, promoting hair growth and / or preventing or improving hair loss, comprising a double-stranded miRNA as an active ingredient, more specifically, to a pharmaceutical or cosmetic composition for improving gray hair, promoting hair growth and / or preventing or improving hair loss, comprising a double-stranded miRNA miR-3139, miR-3189, miR-3199 or miR-8485, a double-stranded oligonucleotide structure comprising the same, or nanoparticles comprising the structure as an active ingredient. The composition according to the present invention can prevent gray hair and slow down the progression of gray hair by activating melanocytes and promoting melanin production, and can improve hair that has already progressed to gray hair to the hair state before gray hair. In addition to the activity of melanocytes, it can promote the proliferation of hair papilla cells and keratinocytes present in hair follicles, induce the development of the outer root sheath of hair and hair growth, and exert the effect of promoting hair growth and / or preventing hair loss.

Description

[Technical field]

[0001] The present invention relates to a composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss, which comprises a double-stranded miRNA as an active ingredient, and more specifically, to a pharmaceutical or cosmetic composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss, which comprises as an active ingredient the double-stranded miRNA miR-3139, miR-3189, miR-3199 or miR-8485, a double-stranded oligonucleotide structure containing the same, or nanoparticles containing the structure. [Background technology]

[0002] Hair greying in humans is a phenomenon of physiological aging, which is known to be caused by a decrease in melanin pigment due to the decline and depletion of melanocytes or melanocyte stem cells in hair follicles. Melanin pigment is an important factor that determines hair color. Melanin is synthesized and secreted from melanosomes present in melanocytes, and is transferred to nearby keratinocytes, fibroblasts, etc., and then moves along with hair growth to maintain hair color. Currently, simple dyeing procedures are used to solve hair greying, but dyeing is a temporary method and re-dyeing is necessary as gray hair grows, and the ingredients in hair dyes have various side effects such as irritating the scalp and hair follicles and causing allergies and dermatitis. Currently, research related to the regulation of melanin production is limited to the development of substances that suppress symptoms such as hyperpigmentation caused by excessive induction of melanin in the skin, which occurs due to various factors such as genetic factors, aging, hormones, growth factors, and ultraviolet rays, and that have a skin whitening effect, and the elucidation of their mechanism of action. Conversely, little progress has been made in research on the mechanism of action and substance development related to promoting melanin production to overcome hair graying or reduced melanin synthesis. In addition, melanogenesis is regulated by the interaction of various signals (SCF-KIT-RAS-ERK signaling pathway, MC1R-cAMP-PKA signaling pathway, Wnt-β-catenin signaling pathway), but due to such a complex mechanism of action, it is difficult to elucidate the mechanism of action and develop new substances to prevent or improve hair graying.

[0003] Recently, androgenetic alopecia (AGA), which was mainly seen in middle-aged men and considered a genetic disease of men, is now occurring universally not only in young men but also in women due to serious environmental pollution, stress, changes in dietary habits, and rapid population aging. This has led to increased interest in hair loss and rapid growth in the hair loss market. Hair loss is known to be induced by various factors, including genetic factors, male hormones, aging, and blood circulation disorders. The only currently approved treatments are finasteride, which suppresses the production of dihydrotestosterone (DHT), a male hormone (androgen), and minoxidil, which improves vasodilation and blood circulation. However, these drugs have temporary and limited efficacy depending on the administration method and dosage, and are accompanied by various side effects, so there is a need to develop a new concept substance that activates hair follicle cells and induces cell proliferation to promote hair growth without side effects.

[0004] The hair growth cycle is composed of three stages, the anagen stage where hair grows most actively, the catagen stage where hair growth stops and hair degeneration begins, and the telogen stage where the activity of the hair follicle stops. Hair loss refers to the natural loss of hair that has stopped growing due to the growth cycle, and it is known that hair loss is caused by the action of various factors. Drug development to alleviate hair loss symptoms has been carried out for a long time, but the current situation is that there are no drugs other than finasteride, an oral hair loss treatment, and minoxidil, a topical hair loss treatment. However, since they induce the alleviation of hair loss symptoms through a mechanism of inhibiting the production of male hormones, they have limited efficacy and side effects. Therefore, it is necessary to develop a substance with a new mechanism and strategy that shows efficacy without side effects. Promoting the activation and proliferation of hair follicle cells to quickly convert hair in the telogen phase to the anagen phase is one of the important strategies for developing a hair loss treatment. Therefore, there is a need to develop a substance with a new concept that induces the activation and proliferation of hair follicle cells to promote hair growth.

[0005] The technology of silencing gene expression is an important tool in the development of therapeutic drugs and target validation for disease treatment, and various developments are being made in order to overcome the limitations of existing traditional drug treatment methods. One of these is the use of interfering RNA (RNAi) (Iorns, E., Lord, CJ, Turner, N. & Ashworth, A., Nat Rev Drug Discov 6, 556-68. 2007.). RNAi is a method used to suppress gene expression, and since it has a remarkable gene suppression effect with simple and low cost, the application fields of the technology are diversifying. siRNA is a single-stranded RNA consisting of 16 to 27 nucleotides, and acts as a component of a ribonucleoprotein complex called RISC (RNA Induced Silencing Complex) in cells. RISC functions as an RNA enzyme scissors and cuts messenger RNA (mRNA) to inhibit the production of proteins from mRNA. The siRNA contained in RISC binds to mRNA with a sequence complementary to the siRNA sequence to form double-stranded RNA, and RISC acts as an RNA enzyme scissors to cut the target mRNA, preventing it from further functioning as a template for the repeated production of proteins.

[0006] Thus, RNAi-based therapeutics are considered to be more advanced than the single molecule therapeutics in that they block mRNA before the protein production stage and utilize RNA and the RISC system in cells, but there are side effects that cannot be solved even with siRNA-based technology, which is a phenomenon called the off-target effect. As mentioned above, the siRNA degrades mRNA that is complementary to the siRNA sequence, but it also binds to and induces degradation of mRNA that is only partially complementary to the siRNA sequence, rather than complementary to the entire sequence, and this is called the off-target effect because it induces degradation of non-target mRNA.

[0007] In order to overcome the technical difficulties of the above-mentioned RNAi-based therapeutic agents, active research is being conducted into the use of microRNA (hereinafter referred to as miRNA) as a therapeutic agent (Agostini, M. & Knight, RA, Oncotarget 5, 872-81, 2014; Dangwal, S. &Thum, T., Annu Rev PharmacolToxicol 54, 185-203, 2014.). miRNAs are RNAs consisting of 16 to 27 nucleotides, and are classified as protein non-coding RNAs, as opposed to messenger RNAs that are translated into proteins (Carthew, RW & Sontheimer, EJ, Cell 136, 642-55, 2009; MacFarlane, L.-A. & Murphy, PR, Current Genomics 11, 537-561, 2010; Bartel, DP, Cell 136, 215-33, 2009). miRNAs are recorded in the genomes of higher animal and plant cells, and are known to play a key role in regulating cellular metabolism and functions, including cell creation, growth, differentiation, and death. To date, more than 2,000 types of miRNAs have been identified in the human genome, and the functions of a significant number of these miRNAs remain unknown.

[0008] miRNAs are transcribed from the genome by an RNA polymerase called Pol II, but their initial length is so diverse that it is impossible to specify (Carthew, RW &Sontheimer, EJ, Cell 136, 642-55, 2009; Brodersen, P. &Voinnet, O., Nat Rev Mol Cell Biol 10, 141-148, 2009.). This is due to the diversity of positions in the genome where miRNAs are generated, such as being located in introns, which are parts of mRNA that are not involved in protein production, and being transcribed simultaneously with the production of mRNA, or being located in inter-genic regions on the genome and being transcribed independently (Malone, CD & Hannon, GJ, Cell 136, 656-68, 2009.). The parent of the miRNA generated in this early stage is called primary miR (primary microRNA), which is edited into precursor miRNA (pre-miR) by an RNA cleavage enzyme (RNase) called Drosha in the nucleus (Bartel, DP, Cell 136, 215-33, 2009.). Pre-miR forms an RNA hairpin structure and consists of approximately 70-80 nucleotides. Pre-miR in the cell nucleus is transported from the nucleus to the cytoplasm by exportin proteins and other proteins, where it is processed by another RNA cleavage enzyme called Dicer in the cytoplasm to generate double-stranded mature miRNA (mature microRNA) consisting of 16-27 nucleotides. A single strand of RNA from the double-stranded miR is selectively selected and becomes active by binding to the ribonucleoprotein complex RISC, and binds to the target mRNA using the miR sequence.

[0009] Generally, mRNA can be divided into three parts based on whether it is involved in protein synthesis: the coding region, which contains protein translation information, and the 5'-UTR (Un-Translated Region) and 3'-UTR, which are the 5' and 3' parts of the coding region, respectively, that do not contain protein translation information. siRNA, which uses a complementary sequence with mRNA to cause degradation of target mRNA, acts regardless of the 5'-, 3'-UTR, and coding parts of mRNA, while miR mainly binds to the 3'-UTR (Carthew, RW &Sontheimer, EJ, Cell 136, 642-55, 2009; Bartel, DP, Cell 136, 215-33, 2009.). In addition to the difference in the binding site with mRNA, a unique feature of siRNA and other miRNAs is that siRNA mainly binds to mRNAs that contain sequences complementary to the entire siRNA sequence, whereas miRNA mainly uses a limited size of seed region sequence located 2-8 nucleotides from the 5' end of miRNA for target mRNA recognition. Therefore, even if the entire miRNA sequence does not have a completely complementary sequence to the target gene and contains a certain non-complementary sequence, it does not affect miRNA activity (Bartel, DP, Cell 136, 215-33, 2009.). Since the sequence size of the seed region is 6-8 nucleotides, there are many types of mRNAs that have a complementary sequence to it in the 3' UTR, and for this reason, one miRNA can simultaneously control multiple types of mRNA. These properties of miRNAs allow miRNAs to function as efficient regulators involved in the control of many aspects of cell physiology, including cell division, growth, differentiation, and death. In addition, the function of miRNA as a regulatory factor has the advantage that it can be effectively applied to various diseases. In contrast to siRNA, which aims to suppress the expression of a single gene, miRNA can simultaneously inhibit the expression of multiple genes involved in various signaling pathways.Many mRNAs contain regions in their 3' UTR where one or more miRNAs can potentially bind, and according to a bioinformatics calculation, it is known that the protein production of approximately 30% of all mRNAs is regulated by miRNAs.

[0010] Despite the excellent efficacy and diverse range of use of miRNA or siRNA, in order for miRNA / siRNA to be developed as a therapeutic drug, it is necessary to improve the stability of miRNA / siRNA in the body and improve the cell delivery efficiency so that miRNA / siRNA can be effectively delivered to target cells (FY Xie., Drug Discov. Today.2006 Jan; 11(1-2):67-73). In order to improve the stability in the body and solve the problem of non-specific innate immune stimulation of miRNA / siRNA, there are active studies on modifying some nucleotides or backbones of miRNA / siRNA to make them resistant to nucleases, or using carriers such as viral vectors, liposomes, or nanoparticles. Delivery systems using viral vectors such as adenovirus and retrovirus have high transfection efficacy but high immunogenicity and oncogenicity. On the other hand, non-viral delivery systems, including nanoparticles, have a lower cell delivery efficiency than viral delivery systems, but they have high in vivo stability, can deliver to targets specifically, and have the advantage of uptake and internalization of the encapsulated RNAi oligonucleotides into cells or tissues with almost no cytotoxicity or induction of natural immunity. Therefore, they are currently considered to be a more promising delivery method than viral delivery systems (Akhtar S, J Clin Invest.2007 December 3; 117(12):3623-3632).

[0011] Among the non-viral delivery systems, the method using nanocarriers is a method in which nanoparticles are formed using various polymers such as liposomes and cationic polymer complexes, and miRNA / siRNA is loaded onto these nanoparticles, i.e., nanocarriers, and delivered to cells. Among the methods using nanocarriers, the most commonly used methods include polymeric nanoparticles, polymer micelles, and lipoplexes, among which the method using lipoplexes is composed of cationic lipids, which interact with anionic lipids in the endosomes of cells to induce the destabilization effect of the endosomes and deliver the miRNA / siRNA into cells. It is also known that by linking a chemical to the end of the miRNA / siRNA sense (passenger) strand to enhance pharmacokinetic properties, high efficiency in vivo can be induced (J Soutschek, Nature 11; 432(7014):173-8, 2004). In this case, the stability of miRNA / siRNA changes depending on the nature of the chemical compound bound to the end of the miRNA / siRNA sense or antisense (guide) strand.

[0012] For example, siRNA conjugated with a polymer such as polyethylene glycol (PEG) interacts with the anionic phosphate group of miRNA / siRNA in the presence of cationic substances to form a complex, which results in a carrier with improved stability of miRNA / siRNA (SH Kim, J Control Release 129(2):107-16, 2008). In particular, micelles composed of polymer complexes have an extremely small size and very uniform distribution compared to other systems used as drug delivery carriers such as microspheres or nanoparticles, and are a structure that forms spontaneously, making it easy to ensure the quality control and reproducibility of the formulation. In order to improve the intracellular delivery efficiency of miRNA / siRNA, a technology for ensuring stability and efficient cell membrane permeability has been developed through miRNA / siRNA conjugates in which a biocompatible polymeric hydrophilic substance (e.g., polyethylene glycol) is conjugated to miRNA / siRNA by simple covalent bond or linker-mediated covalent bond (Korean Patent No. 883471).

[0013] However, chemical modification of miRNA / siRNA and conjugation with polyethylene glycol (PEGylation) alone has the drawback of low stability in the body and poor delivery to target organs. To overcome these drawbacks, double-stranded oligonucleotide structures have been developed in which hydrophilic and hydrophobic substances are bound to double-stranded oligonucleotides, particularly double-stranded oligoRNA such as miRNA / siRNA. These structures are capable of isolating the SAMiRNA through the hydrophobic interaction of the hydrophobic substance. TM This results in the formation of self-assembled nanoparticles named SAMiRNA (self-assembled micelle inhibitory RNA) (Korea Patent No. 1224828). TM The technique has the advantage over conventional delivery techniques that it is possible to obtain nanoparticles that are very small and homogenous in size.

[0014] SAMiRNA TM As a specific example of the technology, PEG or HEG (Hexaethylenglycol) is used as a hydrophilic substance. PEG is a synthetic polymer that is often used to increase the solubility and adjust the pharmacokinetics of pharmaceuticals, especially proteins. PEG is a polydisperse substance, and one batch of polymers is composed of a sum of different numbers of monomers, and the molecular weight shows a Gaussian curve shape, and the degree of homogeneity of the substance is expressed by the polydisperse value (Mw / Mn). In other words, when PEG has a low molecular weight (3-5kDa), it shows a polydispersity index of about 1.01, and when it has a high molecular weight (20kDa), it shows a high polydispersity index of about 1.2, and the higher the molecular weight, the lower the homogeneity of the substance. Therefore, when PEG is bound to a drug, the polydispersity characteristics of PEG are reflected in the conjugate, making it difficult to verify a single substance. There is a trend to produce substances with low polydispersity indexes through improvements in the synthesis and purification process of PEG, but there are problems due to the polydispersity characteristics of the substance, such as the inconvenience of not being able to easily confirm whether binding has been achieved, especially when PEG is bound to a substance with a low molecular weight (Francesco M. VDRUG DISCOVERY TODAY(2005) 10(21):1451-1458). Accordingly, the existing self-assembling nanoparticle, SAMiRNA, has recently been TM An improved form of the technique is SAMiRNA TM The hydrophilic substance of the double-stranded oligonucleotide structure constituting the present invention is blocked with a basic unit containing 1 to 15 uniform monomers having a certain molecular weight and a linker as necessary, and an appropriate number of these are used as necessary to form a conventional SAMiRNA. TM A new type of carrier technology has been developed that has a smaller size and significantly improved polydispersity compared to conventional carriers.

[0015] Therefore, the present inventors have endeavored to discover miRNAs that can improve graying of hair, and as a result, have confirmed that miR-3139, miR-3189, miR-3199, and miR-8485 can activate melanocytes and promote melanin production, thereby improving graying of hair. In addition to activating melanocytes, the present inventors have confirmed the promotion of proliferation of hair follicle dermal papilla cells, keratinocytes, etc., present in hair follicles, and have confirmed an increase in the outer root sheath (ORS) of hair follicles and hair length, thereby completing the present invention. [Prior art documents] [Patent documents]

[0016] [Patent Document 1] Korean Patent No. 883471 [Patent Document 2] Korean Patent No. 1224828 [Patent Document 3] Korean Patent No. 1862349 [Non-patent literature]

[0017] [Non-Patent Document 1] Iorns, E., Lord, CJ, Turner, N. & Ashworth, A., Nat Rev Drug Discov 6, 556-68. 2007 [Non-Patent Document 2] Agostini, M. & Knight, RA, Oncotarget 5, 872-81, 2014 [Non-Patent Document 3] Dangwal, S. &Thum, T., Annu Rev PharmacolToxicol 54, 185-203, 2014 [Non-Patent Document 4] Carthew, RW &Sontheimer, EJ, Cell 136, 642-55, 2009 [Non-Patent Document 5] MacFarlane, L.-A. & Murphy, PR, Current Genomics 11, 537-561, 2010 [Non-Patent Document 6] Bartel, DP, Cell 136, 215-33, 2009 [Non-Patent Document 7] Carthew, RW &Sontheimer, EJ, Cell 136, 642-55, 2009 [Non-Patent Document 8] Brodersen, P. &Voinnet, O., Nat Rev Mol Cell Biol 10, 141-148, 2009 [Non-Patent Document 9] Malone, CD & Hannon, GJ, Cell 136, 656-68, 2009 [Non-Patent Document 10] Akhtar S, J Clin Invest. 2007 December 3; 117(12):3623-3632, 2007 [Non-Patent Document 11] SH Kim, J Control Release 129(2):107-16, 2008 Summary of the Invention

[0018] The present invention provides a novel composition that can improve graying of hair by activating melanocytes in hair follicles and promoting melanin production, and can prevent or improve hair loss by inducing promotion of hair follicle cell proliferation, thereby promoting hair growth.

[0019] To achieve the above object, the present invention provides: (i) miR-3139, miR-3189, miR-3199 or miR-8485; (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. (iii) To provide a pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss, which comprises nanoparticles containing the double-stranded oligonucleotide structure as an active ingredient.

[0020] The present invention also provides a method for treating hair loss in a subject in need of improving gray hair, promoting hair growth, and / or preventing or improving hair loss. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. (iii) To provide a cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss, which comprises nanoparticles containing the double-stranded oligonucleotide structure as an active ingredient.

[0021] The present invention is directed to subjects who need to improve gray hair, promote hair growth, and / or prevent or improve hair loss. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. (iii) Provided is a method for improving hair whitening, promoting hair growth, and / or preventing or improving hair loss, which comprises the step of administering nanoparticles containing the double-stranded oligonucleotide structure.

[0022] The present invention relates to a method for improving gray hair, promoting hair growth, and / or preventing or improving hair loss. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. Or (iii) the use of a nanoparticle comprising the double-stranded oligonucleotide structure is provided.

[0023] The present invention relates to a method for producing a pharmaceutical or cosmetic for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss. (i) miR-3139, miR-3189, miR-3199, or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. Or (iii) the use of a nanoparticle comprising the double-stranded oligonucleotide structure is provided. [Brief description of the drawings]

[0024] Figure 1 shows the SAMiRNA TM The results of a primary screening using 1,728 types of human miRNAs included in the gene were shown below, with the aim of measuring melanin production in a human skin cancer cell line (M21).

[0025] Figure 2 shows the results of a secondary screening of 18 species with high melanin production selected through screening using two types of human skin cancer cell lines (M21 and SK-MEL28).

[0026] Figure 3 shows the reproducibility evaluation results of melanin production and color change efficacy in human skin cancer cell line (SK-MEL-28) for the nine miRNAs with the highest melanin production in the first and second screenings.

[0027] Figure 4 shows the results of RT-qPCR analysis of changes in melanogenesis signaling to analyze the mechanism of action of the nine miRs that produced the highest amounts of melanin in the SK-MEL-28 cell line: miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, and miR-933.

[0028] Figure 5 shows the results of RT-qPCR analysis of the changes in melanogenesis signaling of nine miRs selected from a human epidermal melanocyte cell line: miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, and miR-933.

[0029] Figure 6 shows the results of Western blot analysis of the changes in melanogenesis signaling to analyze the mechanism of action of nine types of miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, and miR-933 selected from the SK-MEL-28 cell line.

[0030] FIG. 7 shows the results of observing the promotion of outer root sheath (ORS) and hair follicle cell proliferation in human gray hair for the four final selected miRs, miR-3139, miR-3189, miR-3199, and miR-8485.

[0031] Figure 8 shows the results of observing the efficacy (color change) of the four final selected types, miR-3139, miR-3189, miR-3199, and miR-8485, in human gray hair.

[0032] FIG. 9a shows the results of cell color change and melanin production analysis by SAMiRNA-miR-3199 treatment in the SK-MEL-28 cell line.

[0033] FIG. 9b shows the results of RT-qPCR confirmation of changes in melanogenesis signaling by treatment with SAMiRNA-miR-3199 in the SK-MEL-28 cell line.

[0034] FIG. 9c shows the results of immunoblot analysis of changes in melanogenesis signaling by treatment with SAMiRNA-miR-3199 in the SK-MEL-28 cell line.

[0035] FIG. 9d shows the effect of SAMiRNA-miR-3199 treatment on changes in melanogenesis signaling in SK-MEL-28 cell line, confirmed by immunocytochemistry analysis.

[0036] FIG. 10a shows the results of selecting GSK3β as a target gene of miR-3199.

[0037] FIG. 10b shows the results of RT-qPCR analysis confirming the ability of SAMiRNA-miR-3199 treatment to inhibit GSK3β in SK-MEL-28 cell line.

[0038] FIG. 10c shows the results of immunoblot analysis confirming the ability of SAMiRNA-miR-3199 treatment to inhibit GSK3β in the SK-MEL-28 cell line.

[0039] FIG. 10d shows the results of immunocytochemistry analysis confirming the GSK3β inhibitory ability of SAMiRNA-miR-3199 treatment in SK-MEL-28 cell line.

[0040] FIG. 10e shows the results of a luciferase reporter assay, confirming that miR-3199 acts by directly binding to GSK3β mRNA 3' UTR.

[0041] FIG. 11a shows the results of an analysis of changes in cell color and melanin production levels in human epidermal melanocytes following treatment with SAMiRNA-miR-3199.

[0042] FIG. 11b shows the results of RT-qPCR analysis confirming the change in melanogenesis signaling by SAMiRNA-miR-3199 treatment in human epidermal melanocytes.

[0043] FIG. 11c shows the results of immunoblot analysis confirming changes in melanin production signaling by SAMiRNA-miR-3199 treatment in human epidermal melanocytes.

[0044] Figure 12a shows the results of evaluating the cytotoxicity and innate immune toxicity of SAMiRNA-miR-3199 in human hair papilla cells, keratinocytes, and human melanocytes.

[0045] FIG. 12b shows the results of evaluating the cytotoxicity and innate immune toxicity of SAMiRNA-miR-3199 by checking whether or not there is an increase in inflammatory cytokines. BEST MODE FOR CARRYING OUT THEINVENTION

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein is one that is well known and commonly used in the art.

[0047] In the present invention, in response to the demand for preventing, preventing or improving graying and hair loss, a screening library for 1728 types of human miRNA was synthesized (Table 2), which was then treated with human skin cancer cell lines M21 and SK-MEL-28 cells, and melanin production measurements and changes in cell color were analyzed comprehensively to discover four effective miRNAs, including miR-3139, miR-3189, miR-3199 and miR-8485. It was also confirmed that the miRNAs can improve melanocyte activity, melanogenesis promotion and graying of hair, and the mechanism of action of melanogenesis promotion was elucidated, and it was confirmed that the melanogenesis of hair can be promoted without side effects through cytotoxicity and natural immune toxicity evaluation. In addition, it was confirmed that the proliferation of cells such as dermal papilla cells and keratinocytes present in the hair follicle is promoted along with melanocyte activity, resulting in the development of the outer root sheath and an increase in hair length.

[0048] Therefore, the present invention is, in one aspect, (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. (iii) A pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss, comprising nanoparticles containing the double-stranded oligonucleotide structure as an active ingredient.

[0049] From another viewpoint, the present invention provides: (i) miR-3139, miR-3189, miR-3199, or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. (iii) A cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss, comprising nanoparticles containing the double-stranded oligonucleotide structure as an active ingredient.

[0050] In the present invention, the composition is characterized by improving graying of hair, promoting hair growth, and / or preventing or improving hair loss by activating melanocytes and proliferation of hair follicle cells, but is not limited thereto.

[0051] In the present invention, the miR-3139 is characterized by containing the base sequence shown in SEQ ID NO: 9 and the base sequence shown in SEQ ID NO: 10, and is preferably a DNA / DNA, RNA / RNA, or DNA / RNA hybrid composed of the base sequence shown in SEQ ID NO: 9 and the base sequence shown in SEQ ID NO: 10. miR-3139 5'- CAGGCAUCUGUUGAGCUCCUAUU-3' (SEQ ID NO: 9) 5'- UAGGAGCUCAACAGAUGCCUGUU-3' (SEQ ID NO: 10)

[0052] In the present invention, the miR-3189 is characterized by containing the base sequence shown in SEQ ID NO: 5 and the base sequence shown in SEQ ID NO: 6, and is preferably a DNA / DNA, RNA / RNA, or DNA / RNA hybrid composed of the base sequence shown in SEQ ID NO: 5 and the base sequence shown in SEQ ID NO: 6. miR-3189 5'- UGCCCCAUCUGUGCCCUGGGUAGGA -3' (SEQ ID NO:5) 5'- CCCUUGGGUCUGAUGGGGUAG-3' (SEQ ID NO:6)

[0053] In the present invention, the miR-3199 is characterized by containing the base sequence shown in SEQ ID NO: 15 and the base sequence shown in SEQ ID NO: 16, and is preferably a DNA / DNA, RNA / RNA, or DNA / RNA hybrid composed of the base sequence shown in SEQ ID NO: 15 and the base sequence shown in SEQ ID NO: 16. miR-3199 5'- CUUUCUCCUAAGGCAGUCCCUUU-3' (SEQ ID NO: 15) 5'- AGGGACUGCCUUAGGAGAAAGUU-3' (SEQ ID NO: 16)

[0054] In the present invention, the miR-8485 is characterized by containing the base sequence shown in SEQ ID NO: 1 and the base sequence shown in SEQ ID NO: 2, and is preferably a DNA / DNA, RNA / RNA, or DNA / RNA hybrid composed of the base sequence shown in SEQ ID NO: 1 and the base sequence shown in SEQ ID NO: 2. miR-8485 5'- ACGUGUGUGUGUGUGUGUGUU-3' (SEQ ID NO: 1) 5'- CACACACACACACACACGUAU-3' (SEQ ID NO: 2)

[0055] We confirmed that miR-3189, miR-3199, and miR-8485 of the present invention increase the expression of microphthalmia-associated transcription factor (MITF), tyrosinase (TYR), tyrosinase-related protein 1 (TYRP1), and tyrosinase-related protein 2 (TYRP2), and that miR-3139 increases the expression of TYR and TYRP2.

[0056] The genes increased by the miRNA of the present invention are known to have the following functions.

[0057] As a transcription factor, MITF regulates the expression of the TYR, TYRP1 and TYRP2 genes, which are enzymes directly involved in melanin synthesis, and is known to be an important transcription factor for the development and differentiation of melanocytes (D'Mello, SA, Finlay, GJ, Baguley, BC & Askarian-Amiri, ME Signaling Pathways in Melanogenesis. Int J Mol Sci. 17 (2016); Kawakami A, Fisher DE. The master role of microphthalmia-associated transcription factor in melanocyte and melanoma biology. Lab Investig. (2017)).

[0058] TYR, TYRP1, and TYRP2 are mainly involved in converting tyrosine into melanin pigments, and TYR and TYRP2 in particular are known to be important enzymes that affect the quantity and quality of melanin (NIU, C., AISA, HA., 2017: Upregulation of melanogenesis and tyrosinase activity: potential agents for vitiligo. Molecules 22, E1303. (2017); D'Mello, SA, Finlay, GJ, Baguley, BC & Askarian-Amiri, ME Signaling Pathways in Melanogenesis.Int J Mol Sci. 17 (2016)).

[0059] As described in the Background Art above, the seed region corresponding to the second base to the eighth or ninth base of the miRNA active sequence is the main factor for activity, and when preparing a double-stranded oligonucleotide, it is also possible to prepare and use a long double-stranded oligonucleotide containing this seed region.

[0060] The miRNA may be double-stranded, or in another embodiment, may include a single molecule polynucleotide, such as, but not limited to, an antisense oligonucleotide or miRNA.

[0061] On the other hand, miR-3139, miR-3189, miR-3199, or miR-8485 can include a sequence in which one or more bases have been substituted, deleted, or inserted in the sense strand constituting it or the antisense strand complementary thereto.

[0062] The double-stranded oligonucleotide according to the present invention may include an overhang, which is a structure containing one or more unpaired nucleotides at the 3'-end of one or both strands. The sense strand or antisense strand is preferably characterized by being composed of 19 to 31 nucleotides, but is not limited thereto.

[0063] In the present invention, in the case of an oligoconjugate in which a hydrophilic substance and a hydrophobic substance are bound to the RNA or DNA oligonucleotide, the oligonucleotide can be efficiently delivered in vivo and its stability can be improved through the conjugate in which a hydrophilic substance and a hydrophobic substance are bound to both ends of the RNA or DNA oligonucleotide.

[0064] In addition, self-assembled nanoparticles are formed through the hydrophobic interactions of hydrophobic substances. Such nanoparticles not only have extremely high delivery efficiency and stability in the body, but also have the advantage of being very uniform in particle size due to improved structure and easy quality control (QC), making the manufacturing process for drugs simple.

[0065] In one embodiment, the hydrophilic substance is (P) n , (P m -J) n or (JP m ) n where P is a hydrophile monomer, n is 1 to 200, m is 1 to 15, and J is a linker connecting the m hydrophile monomers or the m hydrophile monomers and the oligonucleotide to each other.

[0066] In the present invention, the hydrophilic substance is characterized in that it has a molecular weight of 200 to 10,000.

[0067] In the present invention, the hydrophilic substance is any one selected from the group consisting of polyethylene glycol, polyvinylpyrrolidone, and polyoxazoline, but is not limited thereto.

[0068] In the present invention, the hydrophilic substance monomer (P) is characterized by having the structure of the following compound (1): [ka] In the compound (1), G is selected from the group consisting of CH2, O, S and NH.

[0069] In the present invention, the linker (J) is PO3 - , SO3 and CO2.

[0070] In the present invention, the molecular weight of the hydrophobic substance is 250 to 1,000. The hydrophobic substance is selected from the group consisting of steroid derivatives, glyceride derivatives, glycerol ethers, polypropylene glycols, C 12 Or C 50 However, the lipid is characterized in that the lipid is selected from the group consisting of unsaturated or saturated hydrocarbons, diacylphosphatidylcholine, fatty acids, phospholipids, and lipopolyamines, but is not limited thereto.

[0071] In the present invention, the steroid derivative is characterized by being selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanyl formate and cholestanylamine, but is not limited thereto.

[0072] In the present invention, the glyceride derivative is characterized in that it is selected from mono-, di- and tri-glycerides, but is not limited thereto.

[0073] In the present invention, the covalent bonds represented by X and Y are characterized in that they are non-degradable bonds or degradable bonds, the non-degradable bonds are characterized in that they are amide bonds or phosphorylated bonds, and the degradable bonds are characterized in that they are disulfide bonds, acid-degradable bonds, ester bonds, anhydrite bonds, biodegradable bonds or enzyme-degradable bonds, but are not limited thereto.

[0074] When the hydrophilic substance is A, the double-stranded oligonucleotide structure according to the present invention may have a structure represented by the following structural formula (1'). [ka] In the structural formula (1'), A, B, X, and Y are defined as in the structural formula (1), S represents the sense strand of miRNA, and AS represents the antisense strand of miRNA.

[0075] In one embodiment, the double-stranded oligonucleotide structure comprising an miRNA according to the present invention is a double-stranded oligonucleotide structure comprising the structure of the following structural formula (2). AX-5' R 3' YB Structural formula (2) In the structural formula (2), A, B, X, Y and R are the same as defined in the structural formula 1.

[0076] More preferably, the double-stranded oligonucleotide structure has the structure of the following structural formula (2'): [ka]

[0077] In one embodiment, the hydrophilic substance may be a cationic or nonionic polymeric substance having a molecular weight of 200 to 10,000, and preferably a nonionic polymeric substance having a molecular weight of 1,000 to 2,000. In the case of the hydrophilic substance, the nonionic hydrophilic polymeric compound is, for example, any one selected from the group consisting of polyethylene glycol, polyvinylpyrrolidone, and polyoxazoline, but is not limited thereto.

[0078] In another embodiment, the hydrophilic material is (P m -J) n or (JP m ) n In the case where the double-stranded oligonucleotide structure according to the present invention is a structure represented by the following structural formula (3) or structural formula (4): (P m -J) n -XRYB structural formula (3) (JP m ) n -XRYB Structural formula (4) In the structural formula (3) and the structural formula (4), P is a hydrophilic substance monomer, n is 1 to 200, m is 1 to 15, J is a linker linking m hydrophilic substance monomers or m hydrophilic substance monomers and an oligonucleotide, X and Y are each independently a simple covalent bond or a covalent bond via a linker, and R is a specific miRNA of the present invention. More preferably, the double-stranded oligonucleotide structure containing a miRNA according to the present invention has a structure represented by the following structural formula (3'). [ka] In the structural formula (3'), P, B, J, m, n, X, and Y are defined as in the structural formula (3), S represents the sense strand of miRNA, and AS represents the antisense strand of miRNA.

[0079] More preferably, the double-stranded oligonucleotide structure comprising the miRNA according to the present invention has a structure represented by the following structural formula (4'). [ka] In the structural formula (4'), P, B, J, m, n, X, and Y are defined as in the structural formula (4), S represents the sense strand of miRNA, and AS represents the antisense strand of miRNA.

[0080] The hydrophilic substance monomer (P) in the structural formula (3) and the structural formula (4) may be any monomer of a nonionic hydrophilic polymer that satisfies the object of the present invention without any limitation. Preferably, a monomer selected from compounds (1) to (3) in Table 1 may be used, more preferably a monomer of compound (1). G in compound (1) may be preferably selected from CH2, O, S, and NH.

[0081] In particular, among hydrophilic monomers, the monomer represented by compound (1) has various functional groups that can be introduced thereinto, and has excellent biocompatibility, such as good affinity in the body and induction of a reduced immune response. It also has the advantage of being able to increase the in vivo stability of the oligonucleotides contained in the structures represented by structural formulas (3) and (4) and increase the delivery efficiency, making it highly suitable for producing the structures according to the present invention.

[0082] [Table 1]

[0083] The hydrophilic substance in structural formula (3) and structural formula (4) preferably has a total molecular weight within the range of 1,000 to 2,000. For example, when hexaethylene glycol according to compound (1) is used, that is, a substance in which G is O and m is 6 in structural formula (3) and structural formula (4), since the molecular weight of the hexaethylene glycol spacer is 344, the number of repetitions (n) is preferably 3 to 5. The present invention can be applied to the hydrophilic substance in structural formula (3) and structural formula (4) as needed. m -J) or (JPm ), i.e., the hydrophilic substance block, can be used in an appropriate number represented by n. The hydrophilic substance monomer P and linker J contained in each hydrophilic substance block may be independently the same or different between each hydrophilic substance block. That is, when three hydrophilic substance blocks are used (n=3), a hydrophilic substance monomer based on compound (1) may be used in the first block, a hydrophilic substance monomer based on compound (2) may be used in the second block, and a hydrophilic substance monomer based on compound (3) may be used in the third block, and different hydrophilic substance monomers selected from the hydrophilic substance monomers based on compounds (1) to (3) may be used in all hydrophilic substance blocks in the same way. Similarly, the linker mediating the binding of the hydrophilic substance monomers may be the same for all hydrophilic substance blocks, or a different linker may be used for each hydrophilic substance block. In addition, the number m of hydrophilic substance monomers may be the same or different between each hydrophilic substance block. That is, the first hydrophile block may have three hydrophile monomers linked together (m=3), the second hydrophile block may have five hydrophile monomers linked together (m=5), the third hydrophile block may have four hydrophile monomers linked together (m=4), etc., or the same number of hydrophile monomers may be used in all hydrophile blocks.

[0084] In the present invention, the linker (J) is a PO3 - Preferably, but not limited to, the linker is selected from the group consisting of SO3 and CO2. It is obvious to those skilled in the art that any linker can be used as long as it meets the purpose of the present invention depending on the monomer of the hydrophilic substance used.

[0085] All or a portion of the hydrophile monomers may be modified, if desired, to carry functional groups necessary for conjugation with other substances, such as target-specific ligands.

[0086] In some cases, one to three phosphate groups may be bound to the 5' end of the antisense strand of the double-stranded oligonucleotide structure containing the gene-specific miRNA.

[0087] For example, a double-stranded oligonucleotide structure containing miRNA has a structure represented by the following structural formula (3'') or structural formula (4''). [ka] The hydrophobic material (B) serves to form nanoparticles composed of the oligonucleotide structure according to formula (1) through hydrophobic interactions.

[0088] The hydrophobic substance preferably has a molecular weight of 250 to 1,000, and is preferably a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, C 12 Or C 50 Examples of hydrophobic substances that can be used include, but are not limited to, unsaturated or saturated hydrocarbons, diacylphosphatidylcholine, fatty acids, phospholipids, lipopolyamines, etc. It is obvious to a person skilled in the art to which the present invention pertains that any hydrophobic substance can be used as long as it meets the purpose of the present invention.

[0089] The steroid derivative may be selected from the group consisting of cholesterol, cholesterol, cholestanol, choline acid, cholesteryl formate, cholestanyl formate and cholesterylamine, and the glyceride derivative may be selected from mono-, di- and tri-glycerides, and the fatty acid of the glyceride may be selected from the group consisting of C 12 Or C 50 Preferred are unsaturated or saturated fatty acids of the formula:

[0090] Among the above hydrophobic substances, saturated or unsaturated hydrocarbons and cholesterol are particularly preferred since they have the advantage that they can be easily bound to the oligonucleotide structure of the present invention during synthesis.

[0091] The hydrophobic substance is bound to the distal end opposite to the hydrophilic substance, and may be bound to any position on the sense or antisense strand of the miRNA.

[0092] In the present invention, the hydrophilic substance, hydrophilic substance block, or hydrophobic substance is bonded to the oligonucleotide by a simple covalent bond or a covalent bond (X or Y) via a linker. The covalent bond may be either a non-degradable bond or a degradable bond. In this case, the non-degradable bond may be an amide bond or a phosphorylation bond, and the degradable bond may be, but is not limited to, a disulfide bond, an acid degradable bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme degradable bond.

[0093] The miRNA sequence that can be used as an active ingredient in the composition provided by the present invention for improving graying of hair, preventing or improving hair loss, promoting hair follicle cell proliferation, and / or promoting hair growth by promoting melanocyte activity and melanin production is a sequence derived from a human gene, but the origin of the miRNA is not limited to a human gene, and miRNA sequences derived from genes derived from other animals can also be used.

[0094] The miRNA can be used in the form of various miRNA derivatives (miRNA mimics) that produce biologically equivalent efficacy of the miRNA, and modified miRNAs containing the miRNA sequence containing the same seed portion can be used. In this case, the length of the miRNA sense and antisense sequences can be reduced, and a short derivative consisting of a length of 15 nucleotides can also be used.

[0095] The miRNA derivatives of the miRNA may partially contain a phosphorothioate structure in which the phosphate backbone structure of RNA is replaced with other elements such as sulfur, and may be used in a form in which DNA, peptide nucleic acids (PNA), and locked nucleic acid (LNA) molecules are substituted in whole or in part in place of RNA. Also, the 2' hydroxyl group of the RNA sugar may be substituted with various functional structures, including, but not limited to, methylation, methoxylation, and fluorination.

[0096] The miRNA is not limited to double-stranded RNA of mature miRNA and the miRNA derivative derived therefrom, but can be used in the form of a miRNA precursor, which can also have the above-mentioned RNA phosphate backbone structure, partial or complete replacement of the RNA nucleic acid with DNA, PNA, LNA, etc., and modification of the 2' hydroxyl group of the RNA sugar molecule.

[0097] The miRNA can be used in the form of a miRNA precursor or primary miRNA (pre-miRNA), which can be synthesized by chemical methods or delivered to cells in the form of a plasmid for expression.

[0098] In the present invention, the method of transferring miRNA to cells cultured in a culture dish may be a method using a mixture with cationic lipids, a method of transferring by electrical stimulation, or a method using a virus, but it is not limited to the above methods and those skilled in the art can easily apply and use various methods known in the art for transferring miRNA.

[0099] From another aspect, the present invention relates to a double-stranded oligonucleotide structure and nanoparticles containing the miRNA of miR-3139, miR-3189, miR-3199, or miR-8485.

[0100] As described above, the double-stranded oligonucleotide structure containing the miRNA is amphiphilic, containing both hydrophobic and hydrophilic substances, and the hydrophilic portion faces outward due to its affinity with water molecules present in the body through interactions such as hydrogen bonds, while the hydrophobic portion faces inward through hydrophobic interactions between them, forming a thermodynamically stable nanoparticle. In other words, the hydrophobic substance is located at the center of the nanoparticle, and the hydrophilic substance is located on the outer side of the double-stranded oligonucleotide containing the miRNA, forming a nanoparticle that protects the miRNA sequence.

[0101] The nanoparticles according to the present invention may be formed only with double-stranded oligonucleotide structures having the same sequence, or may be composed of double-stranded oligonucleotide structures having different sequences, and may contain double-stranded oligonucleotide structures containing different melanogenesis-promoting and hair follicle cell proliferation-promoting gene target miRNAs. For example, the nanoparticles may be formed by mixing a double-stranded oligonucleotide structure containing miR-3139 and a double-stranded oligonucleotide structure containing miR-8485.

[0102] In addition, the composition according to the present invention may further contain a double-stranded oligonucleotide containing an miRNA other than the double-stranded oligonucleotide structure containing the miRNA that promotes melanogenesis and hair follicle cell proliferation through melanocyte activity, or a double-stranded oligonucleotide structure containing the same.

[0103] In the present invention, the double-stranded oligonucleotide structure containing the miRNA (SAMiRNA TM The melanocyte activation and melanin production promoting effects of the nanoparticles, and the resulting gray-whitening improvement effects, were confirmed. In addition to the activation of melanocytes, the proliferation promoting effects of dermal papilla cells and keratinocytes in hair follicles were also confirmed.

[0104] Therefore, the present invention can utilize the composition for pharmaceutical applications and as a cosmetic, and the pharmaceutical composition is characterized in that it is used in a dosage form selected from the following dosage forms: ointment, paste, gel, jelly, serum, aerosol spray, non-aerosol spray, foam, cream, lotion, solution, or suspension, but is not limited thereto.

[0105] When the composition is used as a cosmetic, it is characterized in that it is used in a formulation selected from the following formulations: hair tonic, hair conditioner, hair essence, hair lotion, hair nutrition lotion, hair shampoo, hair rinse, hair treatment, hair cream, hair nutrition cream, hair moisture cream, hair massage cream, hair wax, hair aerosol, hair pack, hair nutrition pack, hair soap, hair cleansing foam, hair oil, hair dryer, hair preservative, hair dye, hair waving agent, hair bleach, hair gel, hair glaze, hair dressing agent, hair lacquer, hair moisturizer, hair mousse, and hair spray, but is not limited thereto.

[0106] The composition of the present invention may be prepared by further comprising one or more pharma- ceutically acceptable carriers in addition to the active ingredient. The pharma-ceutically acceptable carrier must be compatible with the active ingredient of the present invention, and may be a mixture of physiological saline, sterile water, Ringer's solution, buffered physiological saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or one or more of these components. If necessary, other conventional additives such as antioxidants, buffers, bacteriostatic agents, etc. may be added. In addition, the composition may be formulated as an injectable dosage form such as an aqueous solution, suspension, or emulsion by additionally adding a diluent, dispersant, surfactant, binder, or lubricant. In particular, it is preferable to provide the composition in a lyophilized form. For the preparation of the lyophilized dosage form, a method commonly known in the art to which the present invention belongs may be used, and a stabilizer for lyophilization may be added. Furthermore, suitable formulations can be prepared according to each disease or ingredient by utilizing a suitable method in the art or a method disclosed in Remington's Pharmaceutical Sciences (Mack Publishing Company, Easton PA).

[0107] The content and administration method of the active ingredient contained in the composition of the present invention can be determined by a person skilled in the art based on the number and degree of functional decline of melanocytes in a normal individual, and the severity of the symptoms and site of graying. Also, it can be formulated in various forms such as an acid, tablet, injection, ointment, functional cosmetic, etc., and can be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.

[0108] When the double-stranded oligonucleotide structure containing the miRNA according to the present invention, or a composition or nanoparticle containing the same is used for the manufacture of a functional cosmetic or topical skin preparation, the formulation of the functional cosmetic or topical skin preparation is characterized in that it is selected from the group consisting of cream, lotion, gel, water-soluble liquid, and essence, but is not limited thereto.

[0109] From another perspective, the present invention is directed to a subject in need of improving gray hair, promoting hair growth, and / or preventing or improving hair loss. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. (iii) A method for improving hair whitening, promoting hair growth, and / or preventing or improving hair loss, comprising the step of administering nanoparticles containing the double-stranded oligonucleotide structure.

[0110] From another perspective, the present invention provides a method for improving gray hair, promoting hair growth, and / or preventing or improving hair loss. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. Or (iii) the use of a nanoparticle comprising the double-stranded oligonucleotide structure is provided.

[0111] From another perspective, the present invention relates to a composition for producing a pharmaceutical or cosmetic for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss, comprising (i) miR-3139, miR-3189, miR-3199, or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance, B is a hydrophobic substance, X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485. Or (iii) the use of a nanoparticle comprising the double-stranded oligonucleotide structure is provided. EXAMPLES

[0112] The present invention will be described in more detail below with reference to examples. It will be obvious to those skilled in the art that these examples are merely for the purpose of illustrating the present invention and are not to be construed as limiting the scope of the present invention thereto.

[0113] Example 1: Screening for melanogenesis-promoting miRNAs 1-1: Candidate group of human miRNAs that promote melanogenesis The miRNA database miRBase (www.mirbase.org) provides 21 versions of human miRNA sequences, and 1,728 miRNAs are synthesized as double-stranded oligonucleotide structures (SAMiRNAs) based on the stem-loop structure. TM ) (Table 2). All synthesized miRNA strands were identified and confirmed to have the intended sequence using a MALDI-TOF mass spectrometer. Screening was performed using 1728 miRNAs in human skin cancer cell lines to find the miRNA with the highest melanin production. The sequences of the 1728 human miRNA sense strands used in the present invention are publicly known in miRbase (http: / / www.mirbase.org), and when the seed region is present in only one strand, a complementary sequence was synthesized to deliver it to the cell in the form of a double strand.

[0114] For example, miRNA of miR-3139 was produced as follows. SEQ ID NO: 9: 5'- CAGGCAUCUGUUGAGCUCCUAUU -3' SEQ ID NO:10: 5'- UAGGAGCUCAACAGAUGCCUGUU-3'

[0115] In addition, when the seed sequence was present in both strands, each strand was synthesized as a sense and an antisense strand. For example, miRNA of miR-3189 was produced as follows. SEQ ID NO: 5: 5'- UGCCCCAUCUGUGCCCUGGGUAGGA -3' (sense) SEQ ID NO:6: 5'- CCCUUGGGUCUGAUGGGGUAG-3' (antisense)

[0116] [Table 2] TIFF2024508742000010.tif252128TIFF2024508742000011.tif252128TIFF2024508742000012.tif252128TIFF2024508742000013.t if252128TIFF2024508742000014.tif252128TIFF2024508742000015.tif252128TIFF2024508742000016.tif252128TIFF2024508742 000017.tif252128TIFF2024508742000018.tif252128TIFF2024508742000019.tif252128TIFF2024508742000020.tif252128TIFF20 24508742000021.tif252128TIFF2024508742000022.tif252128TIFF2024508742000023.tif252128TIFF2024508742000024.tif61128

[0117] 1-2: Cell culture and miRNA transfection To discover miRNAs that effectively increase melanin production, we used human melanoma M21 (Korean cell line bank, KR), a human-derived skin cancer cell line. The M21 cell line was cultured at 37°C / 5% CO2 in DMEM medium (Hyclone, US) containing 10% Fetal Bovine Serum (FBS, Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US). M21 cells were cultured at 4 × 10 4 The cells were dispensed at 100 x 100 cells / well, and the next day, miRNA was transfected at 40 nM using Lipofectamine RNAiMAX (Invitrogen, US) according to the manufacturer's protocol.

[0118] 1-3: Primary screening of 1728 miRNAs by measuring melanin production and reproducibility evaluation M21 cells were transfected three times with 1728 miRNAs according to the method of Example 1-2. After 72 hours of culture, all cells were collected and reacted with 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol, and the absorbance was measured at a wavelength of 405 mm to compare the color change and melanin production. After 72 hours of culture, all cells were collected and reacted with 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol, and the absorbance was measured at a wavelength of 405 mm to analyze the melanin production. For reproducibility evaluation, the top 9 miRNAs were treated with the method of Example 1-2 in M21 cell line. After 72 hours of culture, all cells were collected and reacted with 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol, and the absorbance was measured at a wavelength of 405 mm to analyze the melanin production.

[0119] As a result, nine miRNAs were selected that showed melanin production of 13.0μg / ml or more (1.88 times more than the negative control group) in the M21 cell line treated with a total of 1728 types, and similar melanin production to the positive control group IBMX (Sigma, US) / CuSO4 (Sigma, US) treatment group (Figure 1). In a repeat experiment for reproducibility evaluation, the top nine selected miRNAs were confirmed to cause higher color change and melanin production in the M21 cell line compared to the negative control group (Figure 2, Table 3).

[0120] [Table 3]

[0121] Example 2: Screening of the final sequence through replication evaluation of the nine selected miRNAs and analysis of the melanin production mechanism 2-1: Cell culture and miRNA transfection To evaluate the top nine melanin producers, we used the human skin cancer cell line SK-MEL-28 (Korean cell line bank, KR). The SK-MEL-28 cell line was cultured at 37°C / 5% CO2 in MEM medium (Hyclone, US) containing 10% FBS (Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US). SK-MEL-28 cells were cultured at 4 × 10 4 The cells were dispensed at 100 x 100 cells / well, and the next day, miRNA was transfected at 40 nM using Lipofectamine RNAiMAX (Invitrogen, US) according to the manufacturer's protocol.

[0122] 2-2: Reproducibility evaluation of the top 9 miRNAs through melanin production analysis To evaluate the reproducibility of the top 9 selected miRNAs, the color change and melanin production were measured for SK-MEL-28 cells. SK-MEL-28 cells were transfected with miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, or miR-933 three times each in the manner described in Example 2-1. After 72 hours of culture, all cells were collected and observed for color change. To measure the amount of melanin production, the cells were reacted with 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol, and the absorbance was measured at a wavelength of 405 mm to analyze the amount of melanin production.

[0123] As a result, the groups treated with miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, or miR-933 showed a significant color change and increased melanin production compared to the negative control group.Compared to the positive control group, which was treated with a melanin inducer, a significantly greater color change and increased melanin production was confirmed (Figure 3).

[0124] 2-3: RT-qPCR analysis to analyze the mechanism of melanin production promotion in SK-MEL-28 cells To analyze the mechanism of action of the top 9 selected miRNAs in promoting melanogenesis, RT-qPCR analysis was performed to analyze the genes of MITF, TYR, TYRP1, and TYRP2, which are important factors in the melanogenesis process. SK-MEL-28 cells were cultured in 12-well plates (Falcon, US) at 4 × 10 4After dispensing at 1000 cells / well, the cells were cultured at 37°C / 5% CO2. The next day, miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, or miR-933 were transfected into SK-MEL-28 cells three times each using the method of Example 2-1. After 96 hours of culture, total RNA was extracted from the cell lysate using a Universal RNA extraction kit (Bioneer, KR), and the RNA was used as a template in AccuPower GreenStar TM The mRNA expression levels of the above genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR using RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. The Ct values ​​of the two genes derived after qPCR array were used for relative quantitative analysis using the 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8] to calculate the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group. The primer sequences for each gene are as follows (Table 4).

[0125] [Table 4]

[0126] As a result, we confirmed that gene expression of TYR, TYRP1, and TYRP2, which are enzymes directly involved in melanin synthesis in melanocytes, was increased by nine miRNAs (Figure 4). In the case of the transcription factor MITF, we confirmed that it was only slightly increased or no change was observed, which is interpreted as a result of the existence of a mechanism by which MITF is regulated not only by gene expression but also by protein stability and activity.

[0127] 2-4: RT-qPCR analysis to analyze the mechanism of melanogenesis promotion in human melanocytes We analyzed the gene expression of MITF, TYR, TYRP1, and TYRP2 by nine miRNAs using human epidermal melanocytes obtained from normal human skin tissue. Human epidermal melanocytes (Invitrogen, US) cells were cultured at 1 × 10 5 After dispensing at 1000 cells / well, the cells were cultured in mammalian cell culture / primary cell culture (Gibco, US) containing human melanocyte growth supplement-2 (Gibco, US) at 37°C / 5% CO2. The next day, the cells were treated with 9 types of miR-8485, miR-7978, miR-6074, miR-3132, miR-4644, miR-3139, miR-3189, miR-3199, or miR-933 at 5μM each. After 96 hours of culture, total RNA was extracted from the cell lysate using a Universal RNA extraction kit (Bioneer, KR), and this RNA was used as a template in AccuPower GreenStar TM The mRNA expression levels of the genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR using RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol.

[0128] As a result, in human normal melanocytes, unlike the results for melanoma cells M21, we confirmed that miR-8485, miR-7978, miR-3139, miR-3189, miR-3199, and miR-933 increased MITF gene expression by about 1.2 to 1.7 times compared to the negative control group. In addition, in the case of TYR, we confirmed that the expression was increased by about 1.2 to 3.1 times by nine miRNAs. In the case of TYRP1 and TYRP2, differences in expression patterns were observed according to the nine miRNA sequences, and it was confirmed that TYRP1 and TYRP2 all showed a tendency to increase in the cases of miR-8485, miR-7978, miR-3189, miR-3199, and miR-933, while only TYRP2 was increased in the case of miR-6074, miR-3139, and miR-4644 (Figure 5).

[0129] 2-5: Western blot analysis to analyze the mechanism of melanin production promotion Western blot analysis was performed to analyze the expression of MITF and TYR proteins, which are important factors in the melanogenesis process. SK-MEL-28 cells were cultured in a 6-well plate (Falcon, US) at 1 × 10 5 After dispensing at 1000x1000 cells / well, the cells were cultured at 37°C / 5% CO2. The next day, SK-MEL-28 cells were transfected with miR-3139, miR-3189, miR-3199, or miR-8485, respectively, using the method of Example 2-1. After 96 hours of culture, analysis was performed according to the Western blot protocol. MITF (Santa Cruz Biotechnology Inc., US) and Tyrosinase (Santa Cruz Biotechnology Inc., US) were used as primary antibodies, and HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US) were used as secondary antibodies.

[0130] As a result, it was confirmed that MITF and TYR proteins were increased by the nine miRNAs, similar to the RT-qPCR results (Figure 6). By taking into consideration the cell color change, melanin synthesis amount, and key gene and protein expression results in the melanin production process by treatment with the top nine selected miRNAs, four miRNAs were finally selected: miR-3139, miR-3189, miR-3199, and miR-8485, which showed the highest melanin synthesis amount and clear gene and protein expression of MITF, TYR, and TYRP1 / 2 (Table 5).

[0131] [Table 5]

[0132] Example 3: Evaluation of the efficacy of the four selected miRNAs on human hair The four selected miRNAs were used to evaluate the efficacy of human gray hair. On the day of the experiment, the hair was collected by plucking the very tip of the gray hair and cutting about 1-2 cm from the hair root. Then, the hair was cultured in 200 μL of DMEM / F12 medium (Gibco, US) containing 10% FBS (Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US) in a 24-well plate (Falcon, US). The four miRNAs were treated at a concentration of 5 μM at two-day intervals for about 35 days, and the proliferation of gray hair root cells and the change in hair color and properties were observed.

[0133] As a result, while there were no significant changes during the treatment period in the negative control group, in the groups treated with miR-3139, miR-3189, miR-3199 or miR-8485, the outer root sheath area of ​​the hair follicle expanded over time, and increased proliferation or migration of hair follicle cells and keratinocytes was observed, as well as an increase in the length of the hair follicle (Figure 7). In addition, it was confirmed that overall graying, including the hair shaft, was improved (Figure 8).

[0134] Example 4: Evaluation of the melanin production promoting effect of SAMiRNA-miR-3199 in SK-MEL-28 cells 4-1: Cell culture and treatment with SAMiRNA-miR-3199 To evaluate the efficacy of SAMiRNA-miR-3199 in promoting melanogenesis, we used the human skin cancer cell line SK-MEL-28 (Korean cell line bank, KR). The SK-MEL-28 cell line was cultured at 37°C / 5% CO2 in MEM medium (Hyclone, US) containing 10% FBS (Hyclone, US) and 1% Penicillin-Streptomycin (Hyclone, US). SK-MEL-28 cells were plated in a 12-well plate (Falcon, US) at 4 × 10 4 The cells were dispensed at 1000 cells / well, and the next day, treatment was carried out at a concentration of 5 μM.

[0135] 4-2: Analysis of melanin production by SAMiRNA-miR-3199 treatment SK-MEL-28 cells were treated with SAMiRNA-miR-3199 as described in Example 4-1. After 72 hours of culture, all cells were collected and observed for color changes. To measure the amount of melanin produced, the cells were reacted with 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol, and the absorbance was measured at a wavelength of 405 mm to analyze the amount of melanin produced.

[0136] As a result, when treated with SAMiRNA-miR-3199, a significant change in color and an increase in the amount of melanin were observed compared to the negative control group (Figure 9a).

[0137] 4-3: Expression analysis of melanin production-related genes by SAMiRNA-miR-3199 treatment RT-qPCR analysis was performed to analyze the melanin production-related genes MITF, TYR, TYRP1, and TYRP2 by SAMiRNA-miR-3199 treatment. SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 as described in Example 4-1. After 96 hours of culture, total RNA was extracted from the cell lysate using a Universal RNA extraction kit (Bioneer, KR), and this RNA was used as a template in AccuPower GreenStarTM The mRNA expression levels of the above genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR using RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. The Ct values ​​of the two genes derived after qPCR array were used to calculate the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group by relative quantitative analysis using the 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8].

[0138] As a result, we confirmed that treatment with SAMiRNA-miR-3199 significantly increased MITF, a key transcription factor in melanin synthesis, and greatly increased gene expression of TYR, TYRP1, and TYRP2, key enzymes in melanin synthesis (Figure 9b).

[0139] 4-4: Analysis of melanin production-related protein expression by SAMiRNA-miR-3199 treatment Immunoblot analysis was performed to analyze the expression of MITF and TYR proteins, which are key factors in the melanogenesis process. SK-MEL-28 cells were cultured in a 6-well plate (Falcon, US) at 1 × 10 5After dispensing at 1000 cells / well, the cells were cultured at 37°C / 5% CO2. The next day, SK-MEL-28 cells were treated with 5μM SAMiRNA-miR-3199. After 96 hours of culture, analysis was performed according to the immunoblot protocol. The primary antibodies used were MITF (Santa Cruz Biotechnology Inc., US), Tyrosinase (Santa Cruz Biotechnology Inc., US), and α-Tubulin (Cell Signaling Technology, US), and the secondary antibodies used were HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US).

[0140] As a result, similar to the results of gene expression analysis by RT-qPCR, it was confirmed that treatment with SAMiRNA-miR-3199 significantly increased MITF and TYR proteins (FIG. 9c).

[0141] 4-5: Analysis of intracellular expression of melanogenesis-related proteins by SAMiRNA-miR-3199 treatment Immunocytochemistry was performed to analyze the intracellular expression patterns of MITF and TYR proteins, which are key factors in melanin production. Before cell dispensing, a cover glass was placed in a 12-well plate (Falcon, US), coated with Poly-L-lysine for 1 hour, and then SK-MEL-28 cells were cultured at 2 × 10 4The cells were dispensed at 100x100x100 cells / well and cultured at 37°C / 5% CO2. The next day, SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 as described in Example 4-1. After 96 hours of culture, the cells were reacted with 0.1% Triton-X100 solution for 10 minutes for cell permeability, and then blocked with a solution containing 1% BSA for 1 hour. MITF (abcam, UK) and Tyrosinase (Santa Cruz Biotechnology Inc., US) were used as primary antibodies, and HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US) were used as secondary antibodies. Images were analyzed using a spinning disk confocal (Dragonfly high-speed confocal image platform, Andor) for fluorescence analysis of stained cells.

[0142] As a result, we confirmed that treatment with SAMiRNA-miR-3199 significantly increased the expression of the transcription factor MITF in the nucleus, and significantly increased the expression of the melanin synthesis enzyme TYR in the cytoplasm where melanin bodies are located (Figure 9d).

[0143] Example 5: Target gene analysis and mechanism analysis of SAMiRNA-miR-3199 5-1: miR-3199 target gene analysis Using a miRNA target gene prediction program (TargetScan, http: / / www / targetscan.org / ), we selected the GSK3β gene, a core regulator of the main signal transduction system in the melanogenesis mechanism, from among the many genes predicted to be capable of binding to the seed sequence of miR-3199. Binding of miR-3199 to 4153-4159 of the 3'UTR of GSK3β was predicted (Figure 10a).

[0144] 5-2: Analysis of SAMiRNA-miR-3199's ability to inhibit target gene GSK3β mRNA RT-qPCR analysis was performed to analyze the inhibitory effect of SAMiRNA-miR-3199 on the target gene GSK3β mRNA. SK-MEL-28 cells were cultured in a 12-well plate (Falcon, US) at 4 × 10 4 After dispensing at 1000 cells / well, the cells were cultured at 37°C / 5% CO2. The next day, SK-MEL-28 cells were treated with SAMiRNA-miR-3199 as described in Example 4-1. After 24 hours of culture, total RNA was extracted from the cell lysate using a Universal RNA extraction kit (Bioneer, KR). This RNA was used as a template in AccuPower GreenStar TM The mRNA expression levels of GSK3β (Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR according to the manufacturer's protocol using RT-qPCR Master Mix (Bioneer, KR). The Ct values ​​of the two genes derived after qPCR array were used for relative quantitative analysis using the 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8] to calculate the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group. The primer sequences for GSK3β are as follows (Table 6).

[0145] [Table 6]

[0146] As a result, it was confirmed that SAMiRNA-miR-3199 treatment significantly reduced the target gene GSK3β (Figure 10b).

[0147] 5-3: Analysis of GSK3β protein expression by SAMiRNA-miR-3199 treatment Immunoblot analysis was performed to analyze the inhibitory effect of SAMiRNA-miR-3199 on GSK3β protein. SK-MEL-28 cells were cultured in a 6-well plate (Falcon, US) at 1 × 10 5 After dispensing at 1000x1000 cells / well, the cells were cultured at 37°C / 5% CO2. SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 as described in Example 4-1. After 96 hours of culture, analysis was performed according to the immunoblot protocol. Primary antibodies used were GSK3β (Cell Signaling Technology Inc., US), β-catenin (Becton, Dickinson and Company Inc, US), and α-Tubulin (Cell Signaling Technology, US), and secondary antibodies used were HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US).

[0148] As a result, we confirmed that GSK3β protein was reduced by SAMiRNA-miR-3199 treatment, similar to the results of GSK3β gene expression analysis by RT-qPCR. GSK3β phosphorylates β-catenin, promoting its degradation and reducing protein stability, and when GSK3β expression is inhibited, β-catenin protein stability increases and the protein increases. Therefore, we confirmed that β-catenin protein increases by SAMiRNA-miR-3199 treatment (Figure 10c).

[0149] 5-4: Analysis of intracellular GSK3β protein expression patterns following SAMiRNA-miR-3199 treatment Immunocytochemistry was performed to analyze the intracellular GSK3β protein expression pattern following SAMiRNA-miR-3199 treatment. Before cell dispensing, a cover glass was placed in a 12-well plate (Falcon, US), coated with Poly-L-lysine for 1 hour, and then SK-MEL-28 cells were added at 2 × 104 The cells were dispensed at 1000 x 1000 cells / well and cultured at 37°C / 5% CO2. The next day, SK-MEL-28 cell line was treated with SAMiRNA-miR-3199 as described in Example 4-1. After 48 hours of culture, the cells were reacted with 0.1% Triton-X100 solution for 10 minutes for cell permeability, and then blocked with a solution containing 1% BSA for 1 hour. GSK3β (Cell Signaling Technology Inc., US), β-catenin (Becton, Dickinson and Company Inc, US) were used as primary antibodies, and HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) and HRP-linked-anti-rabbit IgG (Cell Signaling Technology, US) were used as secondary antibodies. The stained cells were analyzed using a spinning disk confocal (Dragonfly high-speed confocal image platform, Andor) for fluorescence analysis.

[0150] As a result, we confirmed that SAMiRNA-miR-3199 treatment reduced the expression of the target gene, GSK3β, and significantly increased β-catenin protein in the nucleus and cytoplasm (Figure 10d).

[0151] 5-5: Analysis of direct binding of SAMiRNA-miR-3199 to the 3'UTR of GSK3β mRNA To analyze whether miR-3199 directly binds to the 3'UTR of GSK3β mRNA, a luciferase reporter assay was performed. SK-MEL-28 cells were cultured in a 12-well plate (Falcon, US) at 3 × 10 4After dispensing at 1000 cells / well, the cells were cultured at 37℃ / 5% CO2. The next day, SK-MEL-28 cells were transfected with vectors containing GSK3β-wild type (WT) with a normal GSK3β-binding site or GSK3β-mutant (MT) with a mutated GSK3β-binding site (unable to bind) using Lipofectamine RNAiMAX (Invitrogen, US). At the same time, 5μM SAMiRNA-miR-3199 was also added. After 96 hours of culture, the experiment was performed and analyzed using the Dual-Luciferase® Reporter Assay System (Promega™ Corporation, US) according to the manufacturer's protocol to measure luciferase activity.

[0152] As a result, when cells expressing GSK3β-WT, which has a normal binding site, were treated with SAMiRNA-miR-3199, luciferase activity was significantly reduced, whereas in cells expressing GSK3β-MT, which has a mutant binding site, luciferase activity did not change with SAMiRNA-miR-3199 treatment (Fig. 10e). This confirmed that miR-3199 inhibits GSK3β by directly binding to the 3' UTR (4153-4159) of GSK3β mRNA.

[0153] Example 6: Evaluation of the melanogenesis-promoting efficacy of SAMiRNA-miR-3199 in human melanocytes 6-1: Cell culture and treatment with SAMiRNA-miR-3199 To evaluate the melanin production promoting effect of SAMiRNA-miR-3199, human epidermal melanocytes (HEMs, Invitrogen, US) obtained from normal human skin tissue were used. HEMs were cultured in mammalian cell culture / primary cell culture medium (Gibco, US) containing melanocyte growth supplement-2 (Gibco, US) at 37°C / 5% CO2. HEMs were cultured at 1 × 10 5 The cells were dispensed at 100 x 100 cells / well, and the next day, treated with SAMiRNA-miR-3199 at a concentration of 5 μM.

[0154] 6-2: Analysis of melanin production by SAMiRNA-miR-3199 treatment To evaluate the efficacy of SAMiRNA-miR-3199, color change and melanin production were measured in HEMs. SAMiRNA-miR-3199 was treated at a concentration of 5 μM in HEMs as in Example 6-1. After 72 hours of culture, all cells were collected and observed for color change. To measure the amount of melanin production, the cells were reacted with 1M NaOH (Bioneer, KR) at 37°C for 2 hours according to the melanin extraction protocol, and the absorbance was measured at a wavelength of 405 mm to analyze the amount of melanin production.

[0155] As a result, when treated with SAMiRNA-miR-3199, a significant change in color and an increase in the amount of melanin were observed compared to the negative control group (Figure 11a).

[0156] 6-3: Analysis of melanin production-related gene expression by SAMiRNA-miR-3199 treatment After SAMiRNA-miR-3199 treatment, RT-qPCR analysis was performed to analyze genes such as MITF, TYR, TYRP1, TYRP2, and GSK3β. HEMs were treated with SAMiRNA-miR-3199 as described in Example 6-1. After 96 hours of culture, total RNA was extracted from the cell lysate using a Universal RNA extraction kit (Bioneer, KR), and this RNA was used as a template in AccuPower GreenStar TMThe mRNA expression levels of the above genes (Human qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR using RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. The Ct values ​​of the two genes derived after qPCR array were used for relative quantitative analysis using the 2(- Delta Delta C(T)) Method [Livak KJ, Schmittgen TD. 2001. Methods. Dec;25(4):4 02-8] to calculate the relative amount (fold change) of each gene mRNA in the experimental group compared to the control group.

[0157] As a result, we confirmed that the expression of the genes MITF, TYR, TYRP1, and TYRP2 was significantly increased by SAMiRNA-miR-3199 treatment (Fig. 11b). We also confirmed that the expression of GSK3β, a target gene of miR-3199, was significantly decreased (Fig. 11b).

[0158] 6-4: Analysis of melanin production core protein expression by SAMiRNA-miR-3199 treatment Immunoblot analysis was performed to analyze the changes in MITF and TYR protein expression following SAMiRNA-miR-3199 treatment. HEMs were placed in a 6-well plate (Falcon, US) at 2 × 10 5 After dispensing at 1000xylenol / well, the cells were cultured at 37°C / 5% CO2. HEMs were treated with SAMiRNA-miR-3199 as described in Example 6-1. After 96 hours of culture, analysis was performed according to the immunoblot protocol. MITF (Santa Cruz Biotechnology Inc., US), Tyrosinase (Santa Cruz Biotechnology Inc., US), and α-Tubulin (Cell Signaling Technology, US) were used as primary antibodies, and HRP-linked-anti-mouse IgG (Cell Signaling Technology, US) was used as secondary antibody.

[0159] As a result, similar to the results of gene expression analysis by RT-qPCR, it was confirmed that treatment with SAMiRNA-miR-3199 increased MITF and TYR proteins (FIG. 11c).

[0160] Example 7: Cytotoxicity and innate immune toxicity evaluation of SAMiRNA-miR-3199 7-1: Cytotoxicity evaluation of SAMiRNA-miR-3199 To evaluate the cytotoxicity of SAMiRNA-miR-3199, human follicle dermal papilla cells (HFDPC, Promocell, DE), keratinocytes (HaCaT, ATCC, US), and human melanocytes (Human Epidermal Melanocytes, Invitrogen, US) were used. 3 × 10 HFDPCs were cultured in a 96-well plate (Falcon, US). 3 cells / well, HaCaT 4×10 3 cells / well, HEMs 5×10 3 After dispensing at 100 cells / well, the cells were cultured at 37°C / 5% CO2. The next day, each cell was treated with SAMiRNA-miR-3199 at different concentrations (0, 1, 5, 10, 20 μM). After 72 hours of culture, the experiment was performed and analyzed using a WST assay kit (DOGEN, KR) according to the manufacturer's protocol to measure cytotoxicity.

[0161] As a result, no cytotoxicity was observed in any of the cell lines, even at a high concentration of 20 μM SAMiRNA-miR-3199 (FIG. 12a).

[0162] 7-2: Evaluation of innate immune toxicity of SAMiRNA-miR-3199 To evaluate the natural immunotoxicity of SAMiRNA-miR-3199, human peripheral blood mononuclear cells (PBMC) (Cellular Technology Limited, US) were used. 5 × 105 cells / well were dispensed into a 12-well plate (Falcon, US) and cultured at 37℃ / 5% CO2. The next day, SAMiRNA-miR-3199 was treated at different concentrations (0, 5, 10, 20μM). After 6 hours of culture, total RNA was extracted from the cell lysate using a Universal RNA extraction kit (Bioneer, KR), and this RNA was used as a template in AccuPower GreenStar TM The mRNA expression levels of inflammatory cytokine genes (Human Immune qPCR panel kit, Bioneer, KR) and RPL13A (Human reference qPCR primer set, Bioneer, KR) were analyzed by qRT-PCR using RT-qPCR Master Mix (Bioneer, KR) according to the manufacturer's protocol. The primer sequences for each gene are as follows (Table 7).

[0163] [Table 7]

[0164] As a result, even at the high concentration of 20 μM SAMiRNA-miR-3199, no increase in inflammatory cytokines (IL-1β, IL-6, IL-12β, TNF-α, INF-γ, etc.) was observed, confirming that no natural immune toxicity was observed (Figure 12b).

[0165] Example 8: Double-stranded oligonucleotide construct (SAMiRNA) The double-stranded oligonucleotide structure produced in the present invention has a structure as shown in the following structural formula (5). C-SSC 186 - 5' S 3' -Polyethylene glycol 2000 structural formula (5) 3' AS 5' -PO4 In the structural formula (5), S is the sense strand of miRNA, AS is the antisense strand of miRNA, PO4 is a phosphate group, polyethylene glycol is a hydrophilic monomer, and polyethylene glycol 2000 is a linker of the phosphate group (PO3 - ) and C 24 is a hydrophobic substance containing a disulfide bond, and 5' and 3' indicate the terminal directions of the double-stranded oligo RNA.

[0166] The sense strand of the miRNA of structural formula (5) is prepared by synthesizing an oligo-RNA hydrophilic material structure including a sense strand having polyethylene glycol bound to the 3' end by using DMT-polyethylene glycol 2000-CPG as a support and linking phosphodiester bonds forming an RNA backbone structure using β-cyanoethyl phosphoamide, and then synthesizing the hydrophobic C 24 was bound to the 5' end to prepare the sense strand of the desired RNA polymer structure. In the case of the antisense strand that is annealed with the sense strand, an antisense strand with a sequence complementary to the sense strand was prepared using a method of connecting the phosphodiester bonds that make up the RNA backbone structure using β-cyanoethylphosphoamide, and then an antisense strand with a phosphate group bound to the 5' end was prepared. [Industrial Applicability]

[0167] The composition according to the present invention can activate melanocytes and promote melanin production to prevent hair from turning gray and slow down the progression of the graying, and can restore hair that has already turned gray to its pre-graying state, and can be usefully used as a pharmaceutical composition, cosmetic, or hair dye composition, since it has no side effects, which is different from simple dyes that have been used repeatedly to hide conventional graying of hair. In addition, the composition can be usefully used as a pharmaceutical composition and cosmetic composition, which can promote the activation of melanocytes and the proliferation of dermal papilla cells and keratinocytes present in hair follicles, thereby alleviating alopecia and promoting hair growth without side effects.

[0168] Although the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance selected from the group consisting of polyethylene glycol (PEG), polyvinylpyrrolidone, and polyoxazoline, or a hydrophilic substance having the following structural formula (5) or structural formula (6): (A' m -J) n Structural formula (5) (J-A' m ) n Construct (6) In the structural formula (5) and the structural formula (6), A' is a hydrophilic substance monomer, m is 1 to 15, n is 1 to 10, and J is a linker connecting m hydrophilic substance monomers or connecting m hydrophilic substance monomers and an oligonucleotide to each other; The hydrophilic substance monomer A' is any one selected from the following compounds (1) to (3), and PO 3 - , S.O. 3 and CO 2 The linker (J) is selected from the group consisting of: B is a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, C is １２ Or C ５０ is a hydrophobic substance selected from the group consisting of unsaturated or saturated hydrocarbons, diacylphosphatidylcholine, fatty acids, phospholipids, and lipopolyamines; the steroid derivative is selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanyl formate and cholesterylamine; The glyceride derivative is selected from mono-, di- and tri-glycerides; X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485; or (iii) a nanoparticle comprising the double-stranded oligonucleotide structure; A pharmaceutical composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss, comprising as an active ingredient.

2. The pharmaceutical composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss according to claim 1, characterized in that the miR-3139 comprises the base sequence shown in SEQ ID NO: 9 and the base sequence shown in SEQ ID NO:

10.

3. The pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 1, characterized in that the miR-3189 contains the base sequence shown in SEQ ID NO: 5 and the base sequence shown in SEQ ID NO:

6.

4. The pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 1, characterized in that the miR-3199 contains the base sequence shown in SEQ ID NO: 15 and the base sequence shown in SEQ ID NO:

16.

5. The pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 1, characterized in that the miR-8485 comprises the base sequence shown in SEQ ID NO: 1 and the base sequence shown in SEQ ID NO:

2.

6. The pharmaceutical composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss according to claim 1, wherein the hydrophilic substance has a molecular weight of 200 to 10,000.

7. The pharmaceutical composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss according to claim 1, wherein the molecular weight of the hydrophobic substance is 250 to 1,000.

8. The pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 1, characterized in that the covalent bonds represented by X and Y are non-degradable bonds or degradable bonds.

9. The pharmaceutical composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss according to claim 8, wherein the non-degradable bond is an amide bond or a phosphorylated bond.

10. The pharmaceutical composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 8, characterized in that the degradable bond is a disulfide bond, an acid-degradable bond, an ester bond, an anhydrite bond, a biodegradable bond, or an enzymatically degradable bond.

11. (ii) A double-stranded oligonucleotide structure comprising a structure represented by the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance which is polyethylene glycol (PEG); B is a hydrophobe which is C6-SS-C18; X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485; or (iii) a nanoparticle comprising the double-stranded oligonucleotide structure; A pharmaceutical composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss, comprising as an active ingredient.

12. (i) miR-3139, miR-3189, miR-3199 or miR-8485, (ii) a double-stranded oligonucleotide structure comprising the structure of the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance selected from the group consisting of polyethylene glycol (PEG), polyvinylpyrrolidone, and polyoxazoline, or a hydrophilic substance having the following structural formula (5) or structural formula (6): (A' m -J) n Structural formula (5) (J-A' m ) n Construct (6) In the structural formula (5) and the structural formula (6), A' is a hydrophilic substance monomer, m is 1 to 15, n is 1 to 10, and J is a linker connecting m hydrophilic substance monomers or connecting m hydrophilic substance monomers and an oligonucleotide to each other; The hydrophilic substance monomer A' is any one selected from the following compounds (1) to (3), and PO 3 - , S.O. 3 and CO 2 The linker (J) is selected from the group consisting of: B is a steroid derivative, a glyceride derivative, a glycerol ether, a polypropylene glycol, C is １２ Or C ５０ is a hydrophobic substance selected from the group consisting of unsaturated or saturated hydrocarbons, diacylphosphatidylcholine, fatty acids, phospholipids, and lipopolyamines; the steroid derivative is selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesteryl formate, cholestanyl formate and cholesterylamine; The glyceride derivative is selected from mono-, di- and tri-glycerides; X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485; or (iii) a nanoparticle comprising the double-stranded oligonucleotide structure; A cosmetic composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss, comprising the above-mentioned compound as an active ingredient.

13. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 12, characterized in that the miR-3139 contains the base sequence shown in SEQ ID NO: 9 and the base sequence shown in SEQ ID NO:

10.

14. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 12, characterized in that the miR-3189 contains the base sequence shown in SEQ ID NO: 5 and the base sequence shown in SEQ ID NO:

6.

15. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 12, characterized in that the miR-3199 contains the base sequence shown in SEQ ID NO: 15 and the base sequence shown in SEQ ID NO:

16.

16. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 12, characterized in that the miR-8485 includes the base sequence shown in SEQ ID NO: 1 and the base sequence shown in SEQ ID NO:

2.

17. The cosmetic composition for improving gray hair, promoting hair growth and / or preventing or improving hair loss according to claim 12, wherein the hydrophilic substance has a molecular weight of 200 to 10,000.

18. The cosmetic composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss according to claim 12, wherein the molecular weight of the hydrophobic substance is 250 to 1,000.

19. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 12, characterized in that the covalent bonds represented by X and Y are non-degradable bonds or degradable bonds.

20. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 19, characterized in that the non-degradable bond is an amide bond or a phosphorylated bond.

21. The cosmetic composition for improving graying of hair, promoting hair growth, and / or preventing or improving hair loss according to claim 19, characterized in that the degradable bond is a disulfide bond, an acid-degradable bond, an ester bond, an anhydrite bond, a biodegradable bond, or an enzymatically degradable bond.

22. (ii) A double-stranded oligonucleotide structure comprising a structure represented by the following structural formula (1): AXRYB structural formula (1) In the structural formula (1), A is a hydrophilic substance which is polyethylene glycol (PEG); B is a hydrophobe which is C6-SS-C18; X and Y each independently represent a simple covalent bond or a covalent bond via a linker, and R represents miR-3139, miR-3189, miR-3199, or miR-8485; or (iii) a nanoparticle comprising the double-stranded oligonucleotide structure; A cosmetic composition for improving graying of hair, promoting hair growth and / or preventing or improving hair loss, comprising the above-mentioned compound as an active ingredient.

23. The cosmetic composition according to claim 12, wherein the cosmetic composition is selected from the group consisting of hair tonic, hair conditioner, hair essence, hair lotion, hair nourishing lotion, hair shampoo, hair rinse, hair treatment, hair cream, hair nourishing cream, hair moisture cream, hair massage cream, hair wax, hair aerosol, hair pack, hair nourishing pack, hair soap, hair cleansing foam, hair oil, hair dryer, hair preservative, hair dye, hair waving agent, hair bleach, hair gel, hair glaze, hair dressing agent, hair lacquer, hair moisturizer, hair mousse, and hair spray.

Images