Immunogenic composition comprising an antigen and an adjuvant comprising an aluminum metal-organic framework (Al-MOF)

Abstract

The present invention relates to an immunogenic composition comprising at least one antigen and at least one adjuvant, wherein said adjuvant comprises at least one metal organic framework, i.e. MOF, which comprises an inorganic moiety based on aluminum and at least one organic moiety based on a multidentate ligand, wherein the multidentate ligand is selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, and wherein said antigen is immobilized at least within said metal organic framework.

Description

[Technical field]

[0001] The present disclosure relates to the field of immunogenic compositions, particularly vaccine adjuvants.

[0002] More specifically, the present invention relates to the use of certain aluminum metal-organic framework (Al-MOF) systems as antigen delivery vehicles and adjuvants to induce potent immune responses. [Background technology]

[0003] The vaccine field is distinguished from other branches of the pharmaceutical industry due to the specificity of the sector: indeed, in addition to efficacy requirements, there are much higher safety requirements for products administered to a healthy population or even to the entire population, which lead to a systematic verification of batches and their release, not by the manufacturers themselves, but by official testing laboratories.

[0004] Adjuvant formulations have been used for many years in vaccine compositions to enhance immune responses with the aim of conferring long-term protection against targeted pathogens. Adjuvants for vaccines are therefore often essential to trigger immune responses and obtain strong and long-lasting protective immunization. Adjuvants are also very useful to reduce the required amount of a given antigen while maintaining an efficient level of immune response to the vaccine. Finally, it is also known that some adjuvants are only favorable for certain antigens, whereas others have a broader spectrum of action and are effective against various types of diseases in combination with antigens of different chemical nature.

[0005] Among the adjuvants already available, aluminum salts are the reference adjuvants for non-live vaccines, despite the intensive search for alternatives, thanks to their excellent inflammatory / immunostimulant ratio and their unique ability to boost the immune response to a variety of antigens.

[0006] However, although their risk-to-benefit ratio is excellent, these adjuvants are not absorbable and therefore do not degrade in vivo, leaving behind permanent deposits, which is particularly unfortunate since aluminum salts are the best and almost only compromise of efficacy / minimal local reactions that can be used in humans.

[0007] Furthermore, with such adjuvants the antigen is adsorbed to the salt surface, which is not suitable for all antigens.

[0008] Other alternatives have already been developed (squalene, liposomes, etc.), but so far they have not been as satisfactory as aluminium adjuvants, and therefore for most inactivated vaccines there is no practical alternative to the use of aluminium adjuvants.

[0009] Another concern when formulating adjuvants intended for human or animal use is that the preparation process must be carried out using products of low toxicity that are generally recognized by Health Agencies, for example, toxic solvents such as DMF should be avoided and other solvents that are better tolerated from a pharmaceutical standpoint should be preferred.

[0010] Therefore, there remains a need for new vaccine adjuvants as alternatives to current aluminum adjuvants, in particular new aluminum-based materials that disappear slowly after processing and are therefore absorbable.

[0011] In other words, there is a need for an aluminium-based adjuvant that is capable of degrading itself after serving as an adjuvant and as a cargo for antigens.

[0012] There is also a continuing need for new formulations, e.g., adjuvant compositions, that are at least as effective as commercially available formulations in enhancing immune responses, and that may even be more effective and thus favor antigen presentation.

[0013] There is also a need for adjuvant formulations that allow easy immobilization for a broad range of antigens and also for combinations of antigens and immune orienters.

[0014] Furthermore, adjuvants to reduce the dose of immunogens can be advantageous when the immunogens are expensive or complicated to produce on a large scale. A better, more intense and especially a more sustained antibody response is always desirable for better protection and to limit the number of booster immunizations required.

[0015] There is also a need for adjuvant formulations that are easy to manufacture, especially on an industrial scale, including raw materials, manufacturing intermediates, and processes that are deemed safe by most Health Authorities. Summary of the Invention [Problem to be solved by the invention]

[0016] The present invention aims to meet all or part of these needs. [Means for solving the problem]

[0017] Accordingly, the present invention is directed to an immunogenic composition comprising at least one antigen and at least one adjuvant, wherein the adjuvant comprises at least one metal-organic framework, i.e. MOF (Metal-Organic Framework), which comprises an aluminum-based inorganic moiety and at least one multidentate-ligand-based organic moiety, and wherein the antigen is immobilized at least within the metal-organic framework.

[0018] Therefore, according to one of its aspects, the present invention is directed to an immunogenic composition comprising at least one antigen and at least one adjuvant, wherein the adjuvant comprises at least one metal-organic framework, i.e. MOF, which comprises an inorganic moiety based on aluminum and at least one organic moiety based on a multidentate ligand, the multidentate ligand being selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, and wherein the antigen is immobilized at least within the metal-organic framework.

[0019] Preferably, the present invention is directed to an immunogenic composition comprising at least one antigen and at least one adjuvant, wherein the adjuvant comprises at least one metal organic framework, i.e. MOF, which comprises an inorganic moiety based on aluminum and an organic moiety at least comprising a fumarate, and wherein the antigen is immobilized within at least the metal organic framework.

[0020] As used herein, the term "immobilized" is intended to mean that the antigen is bound to the metal-organic framework and is at least within the metal-organic framework, and that the antigen is no longer in the fluid phase. Immobilization can occur in various ways. Immobilization can be performed using a single-step process, meaning that MOF formation and immobilization occur simultaneously. The metal-organic framework can capture the antigen by surrounding or encapsulating it. In some other situations, the antigen can also be included in the pores of the metal-organic framework, or the antigen can be adsorbed on the outer surface of the metal-organic framework. The antigen can also be linked to the metal-organic framework, especially by a covalent bond. It is understood that antigen immobilization is not limited to these types of immobilization and can be performed in various ways in the same metal-organic framework.

[0021] The antigen may be immobilized within the MOF, meaning that the antigen is not necessarily located within the pores of the MOF, but is trapped between MOF particles forming an insoluble phase.

[0022] It is understood that all or a part of the antigens are immobilized in the metal-organic framework. Thus, according to one embodiment, all of the antigens are immobilized in the metal-organic framework. According to another embodiment, a part of the antigens are immobilized in the metal-organic framework, and other antigens can be immobilized by the metal-organic framework, for example, on the surface of the metal-organic framework. Effect of the Invention

[0023] Unexpectedly, the inventors have discovered that special coordination polymers, called metal-organic frameworks or MOFs, combined with aluminium, appear to be particularly efficient adjuvants, overcoming the shortcomings detailed herein above and thus making it possible to achieve a better and stronger immune response. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] Metal-organic frameworks (MOFs) are hybrid materials that have already shown great potential for drug vectorization and controlled release and can be degraded in vivo. In particular, several MOF-based materials have been used as matrices to entrap several antigens therein, but have never been used as the sole adjuvant for vaccine formulation. In fact, with regard to vaccine adjuvants, to the best of our knowledge, no antigen has ever been immobilized within an aluminum-based MOF to be used as the sole adjuvant molecule.

[0025] In particular, the invention is based on the conjugation of aluminum-based coordination polymers (metal-organic frameworks) (denoted Al-MOFs) with any antigen (denoted Ag), in particular a pro-antigen, i.e. a biological or chemical molecule capable of eliciting, directly or indirectly, a specific immune response in an organism against a prophylactic or therapeutic vaccine, herein called immunogen, which is immobilized in the Al-MOF network in a single-step process under physicochemical conditions selected to preserve the antigenic properties of or induced by said immunogen.

[0026] Unlike known aluminum adjuvants, the aluminum-based MOFs according to the invention are absorbent and allow the immobilization of any type of antigen. Moreover, the adjuvants according to the invention show a better immune response than known aluminum adjuvants.

[0027] In fact, as shown in the following examples, the aluminum-metal-organic framework-based adjuvants of the present invention degrade while performing their function, unlike the reference products. The aluminum multidentate MOFs retain the adjuvant characteristics of aluminum, but the material is degraded by its chemical composition, exogenous organic ligands, and soluble Al. 3+ It has the advantage that it slowly breaks down into ions, thus allowing the aluminium to dissolve and be temporarily present at the injection site.

[0028] In addition, MOFs as considered according to the present invention are matrices which, due to their very large presentation surface, make it possible to immobilize large amounts of antigens, thus reducing the amounts of immunogen and adjuvant required.

[0029] WO 2021 / 097194 describes, inter alia, therapeutic agents encapsulated in zinc-based metal-organic frameworks. Such document does not describe aluminum-metal-organic frameworks. Moreover, the inventors of the present application have shown that such MOFs are not suitable for the immobilization of all antigens.

[0030] According to another of its aspects, the present invention is directed to a metal-organic framework for use in immobilizing an antigen in an immunogenic composition, preferably in a vaccine adjuvant, comprising an inorganic moiety based on aluminum and at least one organic moiety based on a multidentate ligand, the multidentate ligand being selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, wherein the antigen is immobilized at least within the metal-organic framework.

[0031] According to another of its aspects, the present invention is directed to a method of using a metal organic framework for immobilizing an antigen in an immunogenic composition, preferably in a vaccine adjuvant, the metal organic framework comprising an inorganic moiety based on aluminum and an organic moiety based on a multidentate ligand, the multidentate ligand being selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, wherein the antigen is immobilized at least within the metal organic framework.

[0032] In some preferred embodiments, such immunogenic compositions may be used as vaccine compositions. Preferably, the immunogenic compositions, particularly vaccine compositions, are absorbable.

[0033] Furthermore, the present invention proposes a simple and biologically compatible method for the synthesis of MOFs by coordination reaction of aluminum compounds with multidentate ligands that are in contact with target antigens.

[0034] The invention therefore relates, according to another of its aspects, to a method for preparing an immunogenic composition as defined above, comprising mixing at least one aluminium compound with at least one polycarboxylic acid selected from fumaric acid, muconic acid, mesaconic acid, oxalic acid, oxaloacetic acid, succinic acid, malic acid, citric acid, aconitic acid, isophthalic acid, substituted isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid or pyromellitic acid, and / or with a fumarate, muconate, mesaconate, oxalic acid or with a carboxylic acid selected from the group consisting of oxalic acid, oxalic acid, oxalic acid, succinic acid, malic acid, citric acid, aconitic acid, isophthalic acid, substituted isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid or pyromellitic acid, and / or with a carboxylic acid selected from the group consisting of fumarate, muconate, mesaconate, oxalic acid ... The present invention is directed to the above method, comprising at least a step consisting of reacting at least one polycarboxylate selected from salate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate in the presence of at least one antigen to form at least one Al-polycarboxylate metal organic framework that immobilizes the antigen.

[0035] The synthesis advantageously occurs under mild and sustainable conditions, so scaling up the synthesis does not pose any particular difficulties. In addition, the production costs of MOFs remain advantageously low (low-cost synthetic precursors, process in water and at room temperature).

[0036] The inventors have therefore also developed a method for the preparation of said MOFs, based on multidentate ligands and aluminium, under physicochemical conditions, which in particular make it possible to immobilise biological entities without denaturing said entities.

[0037] Unexpectedly, the presentation surface of the antigen immobilized in the MOF structure obtained according to the invention is advantageously much larger than that of the currently used quasi-macroscopic precipitates of proteins and aluminum salts. Moreover, as shown in the following examples, the immobilization capacity of Al-MOF is 100% by weight, immobilizing all of the antigen added. This possibility allows the immobilization of large amounts of antigens due to the very large presentation surface.

[0038] As disclosed in the Examples below, the stepwise degradation of Al-MOFs under physiological conditions has also been demonstrated in vivo.

[0039] immunogenic composition The present disclosure relates to immunogenic compositions. In some preferred embodiments, such immunogenic compositions may be used as vaccine compositions.

[0040] As used herein, the term "vaccine" is intended to mean a direct or indirect immunogenic composition administered to a subject to induce an immune response with the intent of protecting or treating the subject against a disease caused by a pathogen agent.

[0041] A vaccine composition is thus a composition used to elicit a protective immune response against a given antigen. Vaccines are usually used as a prophylactic tool, but in certain cases may also be used as a therapeutic agent.

[0042] Vaccines can include preventive vaccines and therapeutic vaccines. A preventive vaccine is a vaccine administered to prevent infectious diseases and immunize subjects before exposure to the pathogens that cause these diseases. A therapeutic vaccine is a vaccine intended to stimulate the immune system, for example by inducing the immune system to reject cancer cells or reproduce a specific immune response. Unlike a preventive vaccine, which is preventative in nature, a therapeutic vaccine is primarily administered as a treatment for subjects who already suffer from a particular disease, such as cancer or AIDS.

[0043] The immunogenic or vaccine composition according to the present disclosure comprises an antigen to induce immunity and an aluminum-based metal-organic framework (MOF), which primarily functions as an adjuvant in the composition along with its role in immobilizing and retaining the antigen.

[0044] Adjuvants According to the present invention, the adjuvant is a vaccine adjuvant.

[0045] Within this disclosure, the term "adjuvant" or "adjuvant effect" is used to refer to a compound or composition that, when added to an immunogenic composition comprising an antigen or a vaccine composition comprising an antigen, effectively triggers or enhances the immune response to the antigen, for example, by enhancing antigen presentation to antigen-specific immune cells and / or by activating these cells with the purpose of conferring long-term protection against a targeted pathogen.

[0046] Preferably, adjuvants according to the invention are absorbable, meaning that the immunogen is susceptible to absorption and therefore disappears or is eliminated over time from the injection site.

[0047] In particular, less than 40% by weight, preferably less than 30% by weight, preferably less than 25% by weight of the injected aluminium remains at the injection site after one month.

[0048] More particularly, less than 30% by weight, preferably less than 25% by weight, preferably less than 10% by weight of the injected aluminium remains at the injection site after two months.

[0049] More particularly, less than 20% by weight, preferably less than 15% by weight, preferably less than 6% by weight of the injected aluminium remains at the injection site after 3 months.

[0050] The adjuvants according to the invention comprise at least one metal-organic framework comprising an inorganic moiety based on aluminum and an organic moiety based on a multidentate ligand.

[0051] According to certain embodiments, the immunogenic composition according to the invention may comprise an adjuvant other than an adjuvant comprising at least one metal-organic framework.

[0052] Metal organic framework (MOF) Metal-organic frameworks (MOFs), also called coordination polymers, are hybrid solids that contain inorganic units and organic ligands. MOFs typically form structures, preferably porous structures, by combining metals with multidentate ligands.

[0053] In accordance with the present invention, the MOF is configured to degrade in vivo.

[0054] Any type of MOF comprising an inorganic moiety based on aluminum and an organic moiety based on at least one of the aforementioned multidentate ligands can be used in the immunogenic composition.

[0055] By appropriately combining the type and coordination number of aluminum ions with the type and topology of multidentate ligands, MOFs with desired structures can be obtained.

[0056] The MOF can be crystalline or amorphous.

[0057] Preferably, the metal organic framework is crystallized.

[0058] Preferably, the metal-organic framework is porous.

[0059] The combination of the aluminum compound and the ligand that form the MOF can be appropriately determined depending on the expected function and the desired pore size.

[0060] Thus, the MOFs of the invention may contain pores, in particular micropores and / or mesopores. Micropores are defined as pores with a diameter of less than 2 nm, and mesopores are defined based on a diameter of 2 to 50 nm, in each case corresponding to the definitions given by IUPAC or in Pure Applied Chem. 57 (1985), pages 603-619.

[0061] The presence of micropores and / or mesopores can be confirmed by sorption measurements.

[0062] The MOFs can be present in powder form or as agglomerates.

[0063] According to a preferred embodiment, the MOF according to the invention is not implemented in a separate vehicle, preferably not in yeast.

[0064] Aluminum-based inorganic part The aluminum-based inorganic moiety is preferably an aluminum compound selected from aluminum salts, aluminum oxide, aluminum hydroxide, and aluminum alkoxides, or combinations thereof.

[0065] Preferably, the aluminum compound is selected from aluminum salts, aluminum oxide, and aluminum hydroxide, or a combination thereof.

[0066] Aluminum salts include inorganic aluminum salts and organic aluminum salts.

[0067] The inorganic aluminum salts may be selected from aluminum nitrate, aluminum sulfate, aluminum phosphate, aluminum carbonate, aluminum halides, and aluminum perchlorate.

[0068] The aluminum halide can be aluminum chloride, aluminum bromide, aluminum fluoride, or aluminum iodide.

[0069] The organoaluminum salts may be selected from aluminum oxalate, aluminum acetate, aluminum stearate, aluminum lactate, aluminum laurate, and aluminum citrate.

[0070] The aluminum acetate can be basic aluminum monoacetate, basic aluminum diacetate, or neutral aluminum triacetate.

[0071] Aluminum alkoxides include, among others, aluminum isopropoxide, aluminum ethoxide, and aluminum butoxide.

[0072] It is obviously possible to envisage using blends of the various aluminium compounds mentioned above.

[0073] Aluminum sulfate, either anhydrous or hydrated, especially in its octadecahydrate or tetratetrahydrate form, is particularly preferred.

[0074] As the at least one aluminum compound it is also possible to use an aluminate.

[0075] For example, the alkali metal aluminate may in particular be NaAlO2. Since NaAlO2 has basic properties, the presence of a base in the reaction may be omitted. However, it is also possible to use an additional base.

[0076] Preferably, the aluminium-based inorganic portion is formed from aluminium sulphate.

[0077] According to one embodiment, the antigen / aluminum mass ratio is 10 when the antigen is tetanus toxoid. -5 to 1, preferably 10 -2 From 10 -1 It fluctuates up to.

[0078] It will be appreciated that such antigen / aluminium ratios will depend on the antigen selected.

[0079] The MOF of the present invention contains at least aluminum ions as metal ions.

[0080] In one embodiment, the aluminum ions are the only metal ions in the MOF framework.

[0081] In another embodiment, multiple metal ions are present in the MOF.

[0082] These one or more metal ions other than aluminum can be located in the pores of the MOF or can participate in the formation of the lattice of the framework, in which case at least one polydentate organic compound will be bound to such metal ion as well.

[0083] When multiple metal ions are included in the MOF, the multiple metal ions can be present in stoichiometric or non-stoichiometric amounts.

[0084] Preferably, the MOF has only one metal ion, more preferably aluminium.

[0085] Organic moieties based on polydentate ligands As used herein, "multidentate ligand" means a ligand capable of forming two or more coordinate bonds and is understood as defined by IUPAC.

[0086] Examples of organic polydentate ligands include those listed in WO 2010 / 075610.

[0087] Preferably, the ligands used are non-toxic.

[0088] The polydentate ligands in the MOFs are typically organic ligands, examples of which include carboxylate anions and heterocyclic compounds. Examples of carboxylate anions include dicarboxylate anions and tricarboxylate anions.

[0089] These one or more additional at least multidentate organic compounds are derived, for example, from dicarboxylic acid, tricarboxylic acid, or tetracarboxylic acid. Other at least multidentate organic compounds can also participate in the formation of the framework. However, it is also possible that at least non-multidentate organic compounds are included in the framework. At least non-multidentate organic compounds can be derived, for example, from monocarboxylic acid.

[0090] For the purposes of the present invention, the term "derivatized" means that the di-, tri-, or tetracarboxylic acid can be present in the framework in a partially deprotonated or fully deprotonated form. Furthermore, the di-, tri-, or tetracarboxylic acid can contain a substituent or multiple independent substituents. Non-limiting examples of such substituents are -OH, -NH2, -OCH3, -CH3, -NH(CH3), -N(CH3)2, -CN, and halides. Furthermore, the term "derivatized" used for the purposes of the present invention means that the di-, tri-, or tetracarboxylic acid can also be present in the form of the corresponding sulfur analogue. The sulfur analogue is the functional group -C(=O)SH and its tautomers as well as C(=S)SH, which can be used in place of one or more carboxylic acid groups. Furthermore, the term "derivatized" used for the purposes of the present invention means that one or more carboxylic acid functions can be replaced by a sulfonic acid group (-SO3H). In addition, a sulfonic acid group can be present in addition to two, three, or four carboxylic acid functions as well. Furthermore, for purposes of the present invention, the term "derivatized" means that one or more carboxylic acid functional groups may be in the form of a salt, such as a sodium carboxylate salt or a potassium carboxylate salt.

[0091] The di-, tri- or tetracarboxylic acids may, in addition to the abovementioned functional groups, have an organic framework or an organic compound to which these functional groups are attached, whereby the abovementioned functional groups can in principle be attached to any suitable organic compound, provided that it is ensured that the organic compound carrying these functional groups is suitable for forming coordinate bonds to give rise to the framework.

[0092] The organic compounds may be derived from saturated or unsaturated aliphatic or aromatic compounds, or compounds which are both aliphatic and aromatic.

[0093] The aliphatic compound or the aliphatic part of the aliphatic and aromatic compound can be linear and / or branched and / or cyclic, where multiple rings per compound are also possible. The aliphatic compound or the aliphatic part of the aliphatic and aromatic compound contains, for example, 1 to 18, more preferably 1 to 14, more preferably 1 to 13, more preferably 1 to 12, more preferably 1 to 11, particularly preferably 1 to 10, carbon atoms, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms. In particular, the aliphatic compound or the aliphatic part can be methane, adamantane, acetylene, ethylene, or butadiene.

[0094] The aromatic compound or aromatic part of the aromatic aliphatic compound can have one or more rings, for example 2, 3, 4 or 5 rings, where the rings can be present separately from each other and / or at least two rings can be present in condensed form. The aromatic compound or aromatic part of the aliphatic aromatic compound can have in particular 1, 2 or 3 rings, with 1 or 2 rings being particularly preferred. Each ring of the compound can independently contain at least one heteroatom, such as N, O, S, B, P, Si, for example, N, O, and / or S. The aromatic compound or aromatic part of the aromatic aliphatic compound can have 1 or 2 C6 rings, where the two rings can be present separately or in condensed form. As aromatic compounds, benzene, naphthalene, and / or biphenyl and / or bipyridyl and / or pyridyl can be mentioned in particular.

[0095] Polydentate organic compounds are, for example, aliphatic or aromatic, acyclic or cyclic, hydrocarbons having 1 to 18, preferably 1 to 10, in particular 6, carbon atoms and having only 2, 3 or 4 carboxyl groups as functional groups.

[0096] For example, the polydentate organic compound may be a dicarboxylic acid, such as fumaric acid, oxalic acid, succinic acid, malic acid, aspartic acid, glutamic acid, glutaric acid, tartaric acid, 1,4-butanedicarboxylic acid, 1,4-butenedicarboxylic acid, 4-oxopyran-2,6-dicarboxylic acid, 1,6-hexanedicarboxylic acid, decanedicarboxylic acid, 1,8-heptadecanedicarboxylic acid, 1,9-heptadecanedicarboxylic acid, heptadecanedicarboxylic acid, acetylenedicarboxylic acid, 1,2-benzenedicarboxylic acid, 1,3-benzenedicarboxylic acid, 2,3-pyridinedicarboxylic acid, pyridine-2,3-dicarboxylic acid, 1,3-butadiene-1,4-dicarboxylic acid, 1,4-benzenedicarboxylic acid, p-benzenedicarboxylic acid, imidazole-2,4-dicarboxylic acid, 2-methylquinoline-3,4-dicarboxylic acid, quinoline-2, 4-Dicarboxylic acid, quinoxaline-2,3-dicarboxylic acid, 6-chloroquinoxaline-2,3-dicarboxylic acid, 4,4'-diaminophenylmethane-3,3'-dicarboxylic acid, quinoline-3,4-dicarboxylic acid, 7-chloro-4-hydroxyquinoline-2,8-dicarboxylic acid, diimidedicarboxylic acid, pyridine-2,6-dicarboxylic acid, 2-methylimidazole-4,5-dicarboxylic acid, thiophene-3,4-dicarboxylic acid, 2-isopropylimidazole-4,5-dicarboxylic acid, tetrahydropyran-4,4-dicarboxylic acid, perylene-3,9-dicarboxylic acid, perylene dicarboxylic acid, 3,6-dioxaoctane dicarboxylic acid, 3,5-cyclohexadiene-1,2-dicarboxylic acid, octane dicarboxylic acid, pentane-3,3-carboxylic acid acid), 4,4'-diamino-1,1'-biphenyl-3,3'-dicarboxylic acid, 4,4'-diaminobiphenyl-3,3'-dicarboxylic acid, benzidine-3,3'-dicarboxylic acid, 1,4-bis(phenylamino)benzene-2,5-dicarboxylic acid, 1,1'-binaphthyl dicarboxylic acid, 7-chloro-8-methylquinoline-2,3-dicarboxylic acid, 1-anilinoanthraquinone-2,4'-dicarboxylic acid, polytetrahydrofuran 250-dicarboxylic acid, 1,4-bis(carboxymethyl)piperazine-2,3-dicarboxylic acid, 7-chloroquinoline-3,8-dicarboxylic acid, 1-(4-carboxy)phenyl-3-(4-chloro)phenylpyrazoline-4,5-dicarboxylic acid, 1,4,5,6,7,7-hexachloro-5-norbornene-2,3-dicarboxylic acid, phenylindanedicarboxylic acid, 1,3-dibenzyl-2-oxoimidazolidine-4,5-dicarboxylic acid, 1,4-cyclohexanedicarboxylic acid, naphthalene-1,8-dicarboxylic acid, 2-benzoylbenzene-1,3-dicarboxylic acid, 1,3-dibenzyl-2-oxoimidazolidine-4,5-cis-dicarboxylic acid, 2,2'-biquinoline-4,4'-dicarboxylic acid, pyridine-3,4-dicarboxylic acid, 3,6,9-trioxaundecanedicarboxylic acid, hydroxybenzophenonedicarboxylic acid, commercially available compounds (Pluriol E 200-dicarboxylic acid, Pluriol E 300-dicarboxylic acid, Pluriol E 400-dicarboxylic acid, and Pluriol E 600-dicarboxylic acid), pyrazole-3,4-dicarboxylic acid, 2,3-pyrazinedicarboxylic acid, 5,6-dimethyl-2,3-pyrazinedicarboxylic acid, bis(4-aminophenyl)etherdiimide-dicarboxylic acid, 4,4'-diaminodiphenylmethanediimide-dicarboxylic acid, bis(4-aminophenyl)sulfonediimide-dicarboxylic acid, 1,4-naphthalenedicarboxylic acid, 2,6-naphthalene-dicarboxylic acid, 1,3-adamantanedicarboxylic acid, 1,8-naphthalenedicarboxylic acid, 2,3-naphthalenedicarboxylic acid, 8-methoxy-2,3-naphthalenedicarboxylic acid, 8-nitro-2,3-naphthalenecarboxylic acid acid), 8-sulfo-2,3-naphthalenedicarboxylic acid, anthracene-2,3-dicarboxylic acid, 2',3'-diphenyl-p-terphenyl-4,4"-dicarboxylic acid, (diphenyl ether)-4,4'-dicarboxylic acid, imidazole-4,5-dicarboxylic acid, 4(1H)-oxothiochromene-2,8-dicarboxylic acid, 5-tert-butyl-1,3-benzenedicarboxylic acid, 7,8-quinolinedicarboxylic acid, 4,5-imidazoledicarboxylic acid, 4-cyclohexene-1,2-dicarboxylic acid, hexatriacontanedicarboxylic acid, tetradecanedicarboxylic acid, 1,7-heptanedicarboxylic acid, 5-hydroxy-1,3-Benzenedicarboxylic acid, 2,5-dihydroxy-1,4-benzenedicarboxylic acid, pyrazine-2,3-dicarboxylic acid, furan-2,5-dicarboxylic acid, 1-nonene-6,9-dicarboxylic acid, eicosene dicarboxylic acid, 4,4'-dihydroxy-diphenylmethane-3,3'-dicarboxylic acid, 1-amino-4-methyl-9,10-dioxo-9,10-dihydroanthracene-2,3-dicarboxylic acid, 2,5-pyridinedicarboxylic acid, cyclohexene-2,3-dicarboxylic acid, 2,9-dichlorofluorbin-4,11-dicarboxylic acid, 7-chloro-3-methylquinoline-6,8-dicarboxylic acid, 2,4-dichloro The carboxylic acid is derived from benzophenone-2',5'-dicarboxylic acid, 1,3-benzenedicarboxylic acid, 2,6-pyridinedicarboxylic acid, 1-methylpyrrole-3,4-dicarboxylic acid, 1-benzyl-1H-pyrrole-3,4-dicarboxylic acid, anthraquinone-1,5-dicarboxylic acid, 3,5-pyrazoledicarboxylic acid, 2-nitrobenzene-1,4-dicarboxylic acid, heptane-1,7-dicarboxylic acid, cyclobutane-1,1-dicarboxylic acid, 1,14-tetradecanedicarboxylic acid, 5,6-dehydronorbornane-2,3-dicarboxylic acid, 5-ethyl-2,3-pyridinedicarboxylic acid, or camphordicarboxylic acid.

[0097] The polydentate organic compound may be, for example, one of the dicarboxylic acids mentioned above as examples thereof.

[0098] For example, the polydentate organic compound can be derived from a tricarboxylic acid, such as 2-hydroxy-1,2,3-propanetricarboxylic acid, 7-chloro-2,3,8-quinolinetricarboxylic acid, 1,2,3-benzenetricarboxylic acid, 1,2,4-benzenetricarboxylic acid, 1,2,4-butanetricarboxylic acid, 2-phosphono-1,2,4-butanetricarboxylic acid, 1,3,5-benzenetricarboxylic acid, 1-hydroxy-1,2,3-propanetricarboxylic acid, 4,5-dihydroxy-4,5-dioxo-1H-pyrrolo[2,3-F]quinoline-2,7,9-tricarboxylic acid, 5-acetyl-3-amino-6-methylbenzene-1,2,4-tricarboxylic acid, 3-amino-5-benzoyl-6-methylbenzene-1,2,4-tricarboxylic acid, 1,2,3-propanetricarboxylic acid, or aurintricarboxylic acid.

[0099] The polydentate organic compound may be, for example, one of the tricarboxylic acids mentioned above as examples thereof.

[0100] Examples of polydentate organic compounds derived from tetracarboxylic acids are 1,1-dioxidoperillo[1,12-BCD]thiophene-3,4,9,10-tetracarboxylic acid, perylene tetracarboxylic acid (e.g., perylene-3,4,9,10-tetracarboxylic acid or (perylene-1,12-sulfone)-3,4,9,10-tetracarboxylic acid), butane tetracarboxylic acid (e.g., 1,2,3,4-butane tetracarboxylic acid or meso-1,2,3,4-butane tetracarboxylic acid), decane-2,4,6,8-tetracarboxylic acid, 1,4,7,10,13,16-hexaoxacycloocta ... decane-2,3,11,12-tetracarboxylic acid, 1,2,4,5-benzenetetracarboxylic acid, 1,2,11,12-dodecanetetracarboxylic acid, 1,2,5,6-hexanetetracarboxylic acid, 1,2,7,8-octanetetracarboxylic acid, 1,4,5,8-naphthalenetetracarboxylic acid, 1,2,9,10-decanetetracarboxylic acid, benzophenonetetracarboxylic acid, 3,3',4,4'-benzophenonetetracarboxylic acid, tetrahydrofurantetracarboxylic acid, or cyclopentanetetracarboxylic acid (e.g. cyclopentane-1,2,3,4-tetracarboxylic acid).

[0101] The polydentate organic compound may be, for example, one of the tetracarboxylic acids mentioned above as examples thereof.

[0102] The polydentate organic compound may be selected, for example, from aromatic dicarboxylic acids, aromatic tricarboxylic acids, or aromatic tetracarboxylic acids, optionally at least monosubstituted, having one, two, three, four, or more rings, where each of the rings may contain at least one heteroatom, in which case two or more rings may contain the same or different heteroatoms. The polydentate organic compound may be selected, for example, from monocyclic dicarboxylic acids, monocyclic tricarboxylic acids, monocyclic tetracarboxylic acids, bicyclic dicarboxylic acids, bicyclic tricarboxylic acids, bicyclic tetracarboxylic acids, tricyclic dicarboxylic acids, tricyclic tricarboxylic acids, tricyclic tetracarboxylic acids, tetracyclic dicarboxylic acids, tetracyclic tricarboxylic acids, and / or tetracyclic tetracarboxylic acids. Suitable heteroatoms are, for example, N, O, S, B, P, in particular N, S, and / or O. Suitable substituents here are, inter alia, -OH, nitro groups, amino groups, or alkyl or alkoxy groups.

[0103] Examples of polydentate organic compounds include acetylenedicarboxylic acid (ADC), camphordicarboxylic acid, fumaric acid, succinic acid, malic acid, aspartic acid, glutamic acid, glutaric acid, benzenedicarboxylic acid, naphthalenedicarboxylic acid, biphenyldicarboxylic acids (e.g., 4,4'-biphenyldicarboxylic acid (BPDC)), pyrazinedicarboxylic acids (e.g., 2,5-pyrazinedicarboxylic acid), bipyridinedicarboxylic acids (e.g., 2,2'-bipyridinedicarboxylic acid (e.g., 2,2'-bipyridine-5,5'-dicarboxylic acid)), benzenedicarboxylic acids (e.g., 2,2'-bipyridinedicarboxylic acid (e.g., 2,2'-bipyridine-5,5'-dicarboxylic acid)), and benzenedicarboxylic acids (e.g., 2,2'-bipyridinedicarboxylic acid (e.g., 2,2'-bipyridine-5,5'-dicarboxylic acid)). The benzenetricarboxylic acid may be selected from benzenetricarboxylic acid (e.g., 1,2,3-benzenetricarboxylic acid, 1,2,4-benzenetricarboxylic acid, or 1,3,5-benzenetricarboxylic acid (BTC)), benzenetetracarboxylic acid, adamantanetetracarboxylic acid (ATC), adamantane dibenzoate (ADB), benzenetribenzoate (BTB), methane tetrabenzoate (MTB), adamantane tetrabenzoate, or dihydroxyterephthalic acid (e.g., 2,5-dihydroxyterephthalic acid (DHBDC)).

[0104] The polydentate organic compound may be selected, for example, from phthalic acid, isophthalic acid, terephthalic acid, 2,6-naphthalenedicarboxylic acid, 1,4-naphthalenedicarboxylic acid, 1,5-naphthalenedicarboxylic acid, 1,2,3-benzenetricarboxylic acid, 1,2,4-benzenetricarboxylic acid, 1,3,5-benzenetricarboxylic acid, or 1,2,4,5-benzenetetracarboxylic acid.

[0105] Specific examples include anions of fumaric acid, citric acid, malic acid, terephthalic acid, isophthalic acid, succinic acid, aspartic acid, glutamic acid, glutaric acid, trimesic acid, and derivatives thereof. Examples of heterocyclic compounds include bipyridine, imidazole, adenine, and derivatives thereof. Alternatively, the ligand may be an amine compound, a sulfonate anion, or a phosphate anion.

[0106] Examples of polydentate ligands are 2,3-pyrazinedicarboxylic acid (pzdc); pyrazine; trimesic acid (BTC); terephthalic acid (BDC); 1,4-diazabicyclo[2,2,2]octane (dabco); imidazole; 1,3,5-benzenetricarboxylic acid; citric acid; malic acid; isophthalic acid; 2,5-dihydroxyterephthalic acid (HBDC); 4,4'-oxobisbenzoic acid (4,4'-oxobisbenzoic acid)(OBA);1,3,5-tri(4'-carboxy-4,4'-biphenyl)benzene (BTB);4,4'-4''-benzene-1,3,5-triyl-tri-biphenylcarboxylic acid (BBC);azelaic acid;zoledronic acid;o-bromoterephthalic acid (o-Br-BDC);2-aminoterephthalic acid (H2N-BDC);[C3H7O]2-BDC;[C5H 11O]2-BDC;[C2H4]-BDC;1,4-Naphthalenedicarboxylic acid (1,4-NDC);2,6-Naphthalenedicarboxylic acid (2,6-NDC);4,4'-Biphenyldicarboxylic acid (BPDC);Tetrahydropyrene-2,7-dicarboxylic acid (HPDC);Pyrenedicarboxylic acid (PDC);Terphenyldicarboxylic acid (TPDC);Formic acid;m-BDC;BzPDC;5,5'-(9,10-anthracenediyl)diisophosphate;1,1'-Binaphthyl-4,4'-dicarboxylic acid (BNDC);4,4'-Biphenyldicarboxylic acid (BPDC);Dibenzylphosphate (DBP);1,3,5,7-Adamantanetetracarboxylic acid (ATC);Acetonitrile These include the anions of ethylenedicarboxylic acid (ADC); adamantanetetrabenzoic acid (ATB); methanetetrabenzoic acid (MTB); oxalic acid; 1,4-diphenyldiacrylic acid (PDAC); 4,4'-stilbenedicarboxylic acid (SDBC); 1,3,5-tri(4'-carboxy-4,4'-biphenyl)benzene (BTB); 4,4',4''-[benzene-1,3,5-triyl-tris(ethyne-2,1-diyl)]tribenzoic acid (BTE); 1,2,4,5-tetrakis(4-carboxyphenyl)benzene (TCPB); 1,4-dicarboxybenzene-2,3-dithiolate (DCBDT); and caustic acid (3,4,5-trihydroxybenzoic acid).

[0107] For example, the polydentate organic compound can be derived from a dicarboxylic acid, such as fumaric acid, malic acid, aspartic acid, glutamic acid, or glutaric acid.

[0108] The MOF may further comprise at least one monodentate ligand.

[0109] According to the invention, the polydentate ligand is selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, or is derived from fumaric acid, muconic acid, mesaconic acid, oxalic acid, oxaloacetic acid, succinic acid, malic acid, citric acid, aconitic acid, isophthalic acid, substituted isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid, or pyromellitic acid.

[0110] In particular, the polydentate ligand is selected from fumarate, muconate, mesaconate, succinate, malate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, or is derived from fumaric acid, muconic acid, mesaconic acid, succinic acid, malic acid, isophthalic acid, substituted isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid, or pyromellitic acid.

[0111] More particularly, the polydentate ligand is selected from fumarate, muconate, isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, and trimesate, or is derived from fumaric acid, muconic acid, isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, or trimesic acid.

[0112] In particular, the polydentate ligand is selected from fumarate, muconate, 2,5-furandicarboxylate, trimesate, and pyromellitate, or is derived from fumaric acid, muconic acid, 2,5-furandicarboxylic acid, trimesic acid, or pyromellitic acid.

[0113] Preferably, the polydentate ligand is selected from fumarate, muconate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, and trimesate, or is derived from fumaric acid, muconic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, or trimesic acid.

[0114] Preferably, the polydentate ligand is selected from fumarate, muconate, trimesate, and pyromellitate, or is derived from fumaric acid, muconic acid, diacid, trimesic acid, or pyromellitic acid.

[0115] More preferably, the polydentate ligand is selected from fumarate, muconate, and trimesate, or is derived from fumaric acid, muconic acid, or trimesic acid.

[0116] More preferably, the ligand used is a fumarate or is derived from fumaric acid.

[0117] MOF structure Depending on the organic ligands and / or the synthesis conditions, different structures can be obtained and therefore a large number of Al-MOF structures have been reported. Some examples are given below.

[0118] In particular, Al-MOFs with dicarboxylic acid ligands may include Al-MOFs with fumarate ligands, Al-MOFs with muconate ligands, Al-MOFs with mesaconate ligands, Al-MOFs with oxalate ligands, Al-MOFs with oxaloacetate ligands, Al-MOFs with succinate ligands, Al-MOFs with malate ligands, Al-MOFs with isophthalate ligands (1,3-benzenedicarboxylate), Al-MOFs with substituted isophthalate ligands, Al-MOFs with 2,5-thiophenedicarboxylate ligands, and Al-MOFs with 2,5-furandicarboxylate ligands.

[0119] A typical example of a dicarboxylate Al-MOF structure is the isostructural (similar topology but with different organic ligands) series of MIL-53(Al) (MIL = "Materiaux Institut Lavoisier de Versailles"). The MIL-53(Al) structure is composed of one-dimensional (1D) AlO4(OH)2 chains of corner-sharing Al(III) octahedra linked to each other by linear dicarboxylates (fumarates, muconates, etc.). The ligands can also be substituted with functional groups resulting in MIL-53(Al) structures with reduced porosity due to the presence of pending functional groups in the MOF channels.

[0120] When the dicarboxylate is a fumarate ligand (derived from fumaric acid), the structure is Al-fumarate (or MIL-53(Al)-FA or Basolite A520), i.e., 5.7×6.0 Å 2 The microporous structure has one-dimensional (1D) channels with a free aperture of .

[0121] When the dicarboxylate is the muconate ligand (derived from muconic acid), the structure can be MIL-53(Al)-muc, a microporous structure with one-dimensional (1D) channels of 9.0 Å free aperture.

[0122] Another Al-MOF structure is obtained when isophthalate ligands (derived from isophthalic acid) (1,3-benzenedicarboxylate) are linked to helical chains of cis-shaped, corner-sharing AlO6 octahedra. For example, CAU-10-H (CAU=Christian-Albrechts-Universitat) has a length of 3.6 Å. 2 1 shows a three-dimensional (3D) microporous structure having square-shaped one-dimensional channels with free apertures.

[0123] Alternatively, the use of 2,5-thiophenedicarboxylate afforded the CAU-23 structure, which has consecutive trans- and cis-corner-sharing AlO6 polyhedra, resulting in square channel micropores with a free aperture of 7.6 Å.

[0124] A typical example of a MOF obtained with 2,5-furandicarboxylate ligands is MIL-160(Al). MIL-160(Al) results from the combination of chains of AlO4(OH)2 octahedra with 2,5-furandicarboxylate ligands. This results in a three-dimensional (3D) structure with square, sinusoidal one-dimensional (1D) channels with a diameter of about 5-6 Å.

[0125] Al-MOFs with tricarboxylic acid ligands may include Al-MOFs with trimesate ligands, Al-MOFs with trimellitate (1,2,4 benzenetricarboxylate) ligands, Al-MOFs with citrate ligands, and Al-MOFs with aconitate ligands.

[0126] Based on the same building blocks, i.e. aluminum and trimesate (1,3,5-benzenetricarboxylate), various three-dimensional (3D) frameworks can be obtained, such as MIL-96(Al), MIL-100(Al), and MIL-110(Al). MIL-96(Al) results from the assembly of aluminum trimers coordinated to trimesate ligands and connected to additional hexagonal 18-membered ring subunits built by chains of aluminum octahedra. The microporosity of MIL-96(Al) consists of three types of cavities: spherical cages with a cavity-free diameter of about 11 Å, long cavities with dimensions of 9.5×12.6×11.3 Å, and narrow cavities with dimensions of 3.6×4.5 Å. MIL-100(Al) results from the combination of trimesate ligands with Al(III) trimers, resulting in a mesopore structure with two cavities of different diameters (24 Å and 29 Å) accessible through micropore windows (5.2 Å and 8.8 Å). MIL-110(Al) has a three-dimensional framework with 16 Å wide hexagonal channels composed of eight aluminum octahedra linked via trimesate ligands to form a micropore structure.

[0127] Al-MOFs with tetracarboxylic acid ligands may include Al-MOFs with pyromellitate (1,2,4,5-benzenetetracarboxylate) ligands.

[0128] Various frameworks can be obtained, such as MIL-118(Al) or MIL-120(Al). MIL-118(Al) consists of an infinite chain of trans-bonded aluminum-centered octahedra linked to each other via pyromellitate ligands. Depending on the hydration / drying state, the framework can exhibit three different phases. MIL-120(Al) consists of an infinite chain of aluminum-centered octahedra linked to each other via pyromellitate ligands, resulting in a 5.4×4.7 Å 2 The formation of channels occurs.

[0129] Preferably, the polycarboxylate comprises a fumarate.

[0130] The MOF may contain more than one type of ligand.

[0131] Only one type of MOF may be used, or two or more types of MOF may be used in combination.

[0132] The MOFs can be surface modified with polymers or other modifiers.

[0133] The content of the MOF in the immunogenic composition is, for example, 90 to 99.9% by mass, preferably 95 to 99.8% by mass, and more preferably 99 to 99.6% by mass, which is understood to be the case in a solvent-free vaccine composition.

[0134] The content of the MOF in the immunogenic composition may depend inter alia on the nature of the antigen, especially its weight and / or its purity.

[0135] Therefore, according to another embodiment, the content of the MOF in the immunogenic composition may be, for example, 70 to 99.9% by mass, preferably 75 to 99.8% by mass, and more preferably 85 to 99.6% by mass.

[0136] According to another embodiment, the content of the MOF in the immunogenic composition may be, for example, 3 to 99.9% by mass, preferably 4 to 99.8% by mass, more preferably 5 to 99.6% by mass, for example when bacteria are implemented.

[0137] The immunogenic composition according to one embodiment of the present invention may further comprise one or more adjuvants or immune orienters other than the MOF.

[0138] The immunogenic composition may also include one or more immunostimulants, such as a TLR ligand, an RLR ligand, an NLR ligand, a cyclic dinucleotide, or a cytokine.

[0139] antigen The immunogenic composition according to the present invention comprises at least one antigen immobilized within said metal-organic framework.

[0140] According to some embodiments, the immunogenic composition according to the present invention may further comprise at least one antigen that is not immobilized within said metal-organic framework.

[0141] Suitable antigens that may be used in the immunogenic or vaccine composition are described below.

[0142] The term "antigen" includes any molecule, e.g., a peptide, protein, polysaccharide, or complex polysaccharide, that contains at least one epitope that elicits and / or is directed against an immune response. For example, an antigen is a molecule that elicits, optionally after processing, an immune response that is specific, e.g., to the antigen or to a cell expressing the antigen.

[0143] Indeed, according to the present invention, "antigen" means any compound capable of producing an antigen and / or capable of producing an antigen. In particular, the antigen may be chosen from proteins, polysaccharides and their lipid derivatives, such as polyosides, lipids, molecules obtained by polymerization of amino acids, nucleic acids (natural or modified) encoding antigens; replicating or non-replicating nucleic acids encoding or modifying the immune response to antigens, viruses, pseudoviruses, vaccines, plasmids, phages, etc.

[0144] According to the present disclosure, any suitable antigen that is a candidate for an immune response can be envisaged. The antigen may correspond to or be derived from a naturally occurring antigen. Such naturally occurring antigens may include or be derived from allergens, viruses, bacteria, fungi, parasites and other infectious agents and pathogens, or the antigen may also be a tumor antigen. The antigen may be a protein or peptide antigen, a polysaccharide antigen or a complex polysaccharide antigen.

[0145] In other words, the term "antigen" according to the present invention includes an antigen, a proantigen, an antigen-inducing molecule, or an association of several antigens, or a molecule capable of eliciting a given type of immune response. Thus, an antigen according to the present invention may act as any direct or indirect specific immune response inducer.

[0146] The antigen-containing composition of the present disclosure may have different valencies. Valency refers to the number of antigenic components in the composition. In some embodiments, the composition is monovalent. The composition may also be a composition that includes multiple valencies, such as a bivalent composition, a trivalent composition, or a multivalent composition.

[0147] Compositions comprising antigens of the present disclosure may be used as immunogenic compositions, particularly vaccine compositions, to prevent, treat, or cure infectious diseases resulting from contact with infectious agents, such as bacteria, viruses, fungi, protozoans, and parasites.

[0148] According to one embodiment, the antigen suitable herein may be selected in the group consisting of bacterial antigens, protozoan antigens, viral antigens, fungal antigens, parasitic antigens or tumor antigens.

[0149] In another embodiment, wild-type or recombinant antigens or fragments or subunits thereof may be used. The antigen may be a protein, peptide, polysaccharide, and / or a complex polysaccharide.

[0150] Preferably, the antigen is selected from proteins, poliosides, lipids, nucleic acids, viruses, bacteria, parasites, and combinations thereof, in particular selected from tetanus toxoid, proteins derived from the SARS-CoV-2 virus, inactivated Escherichia coli, inactivated poliomyelitis virus, and meningococcal polysaccharides, and combinations thereof.

[0151] bacterial antigen Bacterial antigens may be derived from Gram-positive or Gram-negative bacteria. Bacterial antigens include Acinetobacter baumannii, Bacillus anthracis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, and others. botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Coagulase Negative Staphylococcus, Corynebacterium diphtheria, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, enterotoxigenic Escherichia coli (ETEC), enteropathogenic E. coli, E. coli O157:H7, Enterobacter sp.), Francisella tularensis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Legionella pneumophila, Leptospira interrogans, Listeria monocytogenes, Moraxella catarralis, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma pneumoniae, Neisseria gonorrhoeae, gonorrhoeae, Neisseria meningitides, Proteus mirabilis, Proteus sps.), Pseudomonas aeruginosa, Rickettsia rickettsii, Salmonella typhi, Salmonella typhimurium, Serratia marcesens, Shigella flexneri, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae agalactiae, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Vibrio cholerae, or Yersinia pestis.

[0152] Viral antigens Viral antigens include adenovirus; herpes simplex type 1; herpes simplex type 2; encephalitis virus, papillomavirus, varicella zoster virus; Epstein-Barr virus; human cytomegalovirus (CMV); human herpes virus type 8; human papillomavirus; BK virus; JC virus; smallpox; polio virus; hepatitis B virus; human bocavirus; parvovirus B19; human astrovirus; Norwalk virus; coxsackievirus; hepatitis A virus; poliovirus; rhinovirus; severe acute respiratory syndrome virus; hepatitis C virus; yellow fever virus; dengue virus; West Nile virus; rubella virus; hepatitis E virus; human immunodeficiency virus (HIV); influenza virus, type A or B; Guanarito virus; Junin virus; Lassa virus; Machupo virus; Sabia virus; Crimean-Congo hemorrhagic fever virus; It may be derived from Ebola virus; Marburg virus; measles virus; mumps virus; parainfluenza virus; respiratory syncytial virus (RSV); human metapneumovirus; Hendra virus; Nipah virus; rabies virus; Hepatitis D; Rotavirus; Orbivirus; Coltivirus; Hantavirus, Middle East respiratory coronavirus; SARS-Cov-2 virus; Chikungunya virus; Zika virus; parainfluenza virus; human enterovirus; Hantavirus; Japanese encephalitis virus; vesicular exanthema virus; Eastern equine encephalitis; or Banna virus.

[0153] In certain embodiments, the antigen is derived from a strain of influenza virus A or influenza virus B, or a combination thereof. The strain of influenza A or influenza B may be associated with an avian, porcine, equine, canine, human, or non-human primate.

[0154] The nucleic acid may encode a hemagglutinin protein or a fragment thereof. The hemagglutinin protein may be H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H111, H12, H13, H14, H15, H16, H17, H18, or a fragment thereof. The hemagglutinin protein may or may not include a head domain (HA1). Alternatively, the hemagglutinin protein may or may not include a cytoplasmic domain.

[0155] In certain embodiments, the hemagglutinin protein is a truncated hemagglutinin protein. The truncated hemagglutinin protein may include a portion of the transmembrane domain.

[0156] In some embodiments, the virus may be selected from the group consisting of an H1N1 virus, an H3N2 virus, an H7N9 virus, an H5N1 virus, and an H10N8 virus, or a B strain virus.

[0157] In another embodiment, the antigen may be derived from CMV. In particular, the antigen may be a combination of the pentamer (gH / gL / pUL128 / pUL130 / pUL131) and gB.

[0158] In another embodiment, the antigen is derived from a coronavirus, such as SARS-Cov-1 virus, SARS-Cov-2 virus, or MERS-Cov virus.

[0159] In another embodiment, the antigen may be derived from RSV. The antigen may be PreF-ferritin. Suitable pre-fusion RSV F antigens may be as disclosed in WO 2014 / 160463 (A1) or WO 2019 / 195316 (A1).

[0160] fungal antigen Fungal antigens include those from the phylum Ascomycota (e.g., Fusarium oxysporum, Pneumocystis jiroviecii, Aspergillus spp., Coccidioides immitis / posadasii, Candida albicians), the phylum Basidiomycota (e.g., Filobasidia neoformans, Trichosporon), the phylum Microsporidia (e.g., Encephalitozoon cuniculi, Enterocytozoon bienui), the phylum Enterocytozoon spp., ... bieneusi), or from the subdivision Mucoromycotina (e.g., Mucor circinelloides, Rhizopus oryzae, Lichtheimia corymbifera).

[0161] protozoan antigen Protozoan antigens may be derived from Entamoeba histolytica, Giardia lambila, Trichomonas vaginalis, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Balantidium coli, Toxoplasma gondii, Plasmodium spp., or Babesia microti.

[0162] parasite antigen Parasitic antigens include Acanthamoeba, Anisakis, Ascaris lumbricoides, horse flies, Balantidium coli, bedbugs, tapeworms (Cestoda), chiggers, Cochliomyia hominivorax, Entamoeba histolytica, Fasciola hepatica, Giardia lamblia, hookworms, Leishmania, Linguatula serrata, liver fluke, Loa loa, Paragonimus, pinworms, and Plasmodium falciparum. The pathogenic fungus may be derived from the following organisms: Schistosoma, Strongyloides stercoralis, ticks, tapeworms, Toxoplasma gondii, Trypanosoma, whipworms, or Wuchereria bancrofti.

[0163] Tumor antigens In one embodiment, the antigen can be a tumor antigen, i.e., a constituent of cancer cells, e.g., a protein or peptide expressed in cancer cells. The term "tumor antigen" refers to a protein that is specifically expressed in a limited number of tissues and / or organs or at a specific developmental stage under normal conditions, and is expressed or abnormally expressed in one or more tumor or cancer tissues. Tumor antigens include, for example, differentiation antigens (e.g., cell type-specific differentiation antigens, i.e., proteins that are specifically expressed in a specific cell type at a specific differentiation stage under normal conditions) and germline-specific antigens. For example, tumor antigens are presented by cancer cells in which the tumor antigen (it) is expressed.

[0164] For example, tumor antigens include carcinoembryonic antigen, a1-fetoprotein, isoferritin, and fetal sulfoglycoprotein, cc2-H-iron protein, and gamma-fetoprotein.

[0165] Other examples of tumor antigens that may be useful in the present invention include p53, ART-4, BAGE, β-catenin / m, Bcr-abL CAMEL, CAP-1, CASP-8, CDC27 / m, CD 4 / m, CEA, surface proteins of the claudin family (e.g., CLAUDIN-6, CLAUDIN-18.2, and CLAUDIN-12), c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, Gapl OO, HAGE, HER-2 / neu, HPV-E7, HPV-E6, HAST-2, hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A (e.g., MAGE-A1, MAGE-A2, MAGE-A3, MAGE -A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, or MAGE-A12), MAGE-B, MAGE-C, MART-1 / Melan-A, MC1 R, myosin / m, MUC1, MUM-1, MUM-2, MUM-3, NA88-A, NF1, NY-ESO-1, NY-BR-1, pl 90 minor BCR-abL, Pml / RARa, PRAME, proteinase 3, PSA, PSM, RAGE, RUI or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1, SCP2, SCP3, SSX, SURVrVIN, TEL / AML1, TPI / m, TRP-1, TRP-2, TRP-2 / 1NT2, TPTE, and WT (e.g., WT-1).

[0166] Only one type of antigen may be used, or two or more types of antigens may be used in combination.

[0167] The content of the antigen in the vaccine composition is, for example, 0.1 to 10% by mass, preferably 0.2 to 5% by mass, and more preferably 0.4 to 1% by mass. Such a content is understood to be in the case of a vaccine composition that does not contain a solvent.

[0168] The content of the antigen in the vaccine composition may depend inter alia on the nature of the antigen, especially its weight and / or its purity.

[0169] In one embodiment, the immunogenic compositions disclosed herein are subunit immunogenic compositions, such as subunit vaccine compositions.

[0170] The immunogenic or vaccine compositions disclosed herein may be formulated into solid, semi-solid, or liquid formulations, such as tablets, capsules, powders, aerosols, needles, nanoneedles, suspensions, or emulsions. Typical routes of administration of such compositions include, but are not limited to, oral, topical, transdermal, inhalation, parenteral, sublingual, buccal, and intranasal. The term "parenteral" as used herein includes subcutaneous injection, intravenous, intramuscular, intradermal, and intrasternal injection or infusion techniques. In some embodiments, the vaccine compositions disclosed herein may be administered by transdermal, subcutaneous, intradermal, or intramuscular routes. The compositions of the present disclosure are formulated based on the mode of delivery, including, for example, compositions formulated for delivery by parenteral delivery (e.g., intramuscular, intradermal, or subcutaneous injection).

[0171] The immunogenic compositions disclosed herein can be administered via any suitable route, for example, mucosal administration (e.g., intranasal or sublingual), parenteral administration (e.g., intramuscular, subcutaneous, transdermal, or intradermal), or oral administration. As will be appreciated by those skilled in the art, the immunogenic compositions can be appropriately formulated to be compatible with the intended route of administration. In one embodiment, the immunogenic compositions disclosed herein can be formulated to be administered via an intramuscular, or intradermal, or subcutaneous route. In one embodiment, the immunogenic compositions can be formulated to be administered via an intramuscular route.

[0172] The compositions disclosed herein are formulated so as to allow the active ingredients contained therein to be bioavailable upon administration of the composition to a subject.

[0173] Actual methods for preparing such dosage forms will be known, or apparent, to those skilled in the art; see, e.g., Remington: The Science and Practice of Pharmacy, 20th Edition (Philadelphia College of Pharmacy and Science, 2000).

[0174] The immunogenic compositions disclosed herein may be formulated with any pharma- ceutically acceptable carrier. The compositions may include at least one inert diluent or carrier. One exemplary pharma- ceutically acceptable vehicle is physiological saline buffer. Other physiologically acceptable vehicles are known to those skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences (18th edition), ed. A. Gennaro, 1990, Mack Publishing Company, Easton, Pa. The immunogenic compositions described herein may optionally include pharma- ceutically acceptable auxiliary substances required to mimic physiological conditions (e.g., pH adjusting and buffering agents, osmolality adjusting agents, wetting agents, etc.), such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, human serum albumin, essential amino acids, non-essential amino acids, L-arginine hydrochloride, sucrose, D-trehalose dehydrate, sorbitol, tris(hydroxymethyl)aminomethane, and / or urea. In addition, the vaccine compositions may optionally include pharma- ceutically acceptable additives, including, for example, diluents, binders, stabilizers, and preservatives.

[0175] In one embodiment, the composition can be in the form of liquid, for example emulsion or suspension.The liquid can be for delivery by injection.The composition intended to be administered by injection can include at least one of the following: surfactant, preservative, wetting agent, dispersant, suspending agent, buffer, stabilizer, and isotonicity agent. The liquid compositions disclosed herein may include at least one of the following: a sterile diluent (e.g., water for injection, saline (e.g., physiological saline), Ringer's solution, isotonic sodium chloride), fixed oils (e.g., synthetic mono- or diglycerides which may serve as solvents or suspending media), polyethylene glycol, glycerin, propylene glycol, or other solvents; antibacterial agents (e.g., benzyl alcohol or methylparabens); antioxidants (e.g., ascorbic acid or sodium bisulfite); chelating agents (e.g., ethylenediaminetetraacetic acid); buffers (e.g., acetates, citrates, or phosphates), and agents for adjusting tonicity (e.g., sodium chloride or dextrose); and agents acting as cryoprotectants (e.g., sucrose or trehalose).

[0176] The pH of the immunogenic composition disclosed herein may be about 5.5 to about 8, for example about 6.5 to about 7.5, or about 7.4. A stable pH may be maintained by the use of a buffer. Usable buffers that may be present include Tris buffer, HEPES buffer, or histidine buffer. The immunogenic composition disclosed herein may generally include a buffer. The immunogenic composition may be isotonic with respect to a mammal, for example, a human. The immunogenic composition may also include one or several additional salts, for example NaCl.

[0177] Parenteral preparations can be enclosed in glass or plastic ampoules, disposable syringes or multiple dose vials, transdermal high pressure injectors, etc. Injectable compositions are, for example, sterile.

[0178] The compositions disclosed herein can be prepared by methods well known in the pharmaceutical art. For example, compositions intended to be administered by injection can be prepared by combining the compositions disclosed herein with sterile distilled water or other carriers to form a sterile solution or suspension. A surfactant can be added to facilitate the formation of a homogeneous solution or suspension.

[0179] The compositions disclosed herein are administered in a therapeutically effective amount, which will vary depending on a variety of factors, including the activity of the particular therapeutic agent used; the metabolic stability and length of action of the therapeutic agent; the age, weight, general health, sex, and diet of the patient; the mode and time of administration; rate of excretion; drug combination; the severity of the particular disorder or condition; and the subject receiving the therapy.

[0180] In one embodiment, the immunogenic compositions disclosed herein can be packaged and stored by any preservation process, for example in a dry form, such as a lyophilized composition, or as micropellets obtained via the prilling process described in WO 2009 / 109550.

[0181] The dry composition may include a stabilizing agent (eg, mannitol, sucrose, or dodecyl maltoside), as well as combinations thereof, such as lactose / sucrose mixtures, sucrose / mannitol mixtures, and the like.

[0182] Methods for preparing immunogenic compositions The method of preparing an immunogenic composition according to the present invention comprises at least a step consisting of reacting at least one aluminum compound with at least a polycarboxylic acid selected from fumaric acid, muconic acid, mesaconic acid, oxalic acid, oxaloacetic acid, succinic acid, malic acid, citric acid, aconitic acid, isophthalic acid, substituted isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid, or pyromellitic acid, and / or at least a polycarboxylate selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate in the presence of at least one antigen to form at least one Al-polycarboxylate metal-organic framework immobilizing the antigen.

[0183] Preferably, the aluminum compound is aluminum sulfate.

[0184] According to the invention, the aluminum compound can react with the at least polycarboxylic acid and / or with the at least polycarboxylate. The reaction can therefore be carried out with a separately deprotonated polycarboxylate or with an aluminum precursor. Such steps can therefore be carried out before or during the process according to the invention.

[0185] Preferably, the process according to the invention comprises at least a step consisting of reacting at least one aluminium compound with at least a polycarboxylic acid selected from fumaric acid, muconic acid, mesaconic acid, oxalic acid, oxaloacetic acid, succinic acid, malic acid, citric acid, aconitic acid, isophthalic acid, substituted isophthalic acids, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid or pyromellitic acid, preferably at least fumaric acid.

[0186] Preferably, the molar ratio of the aluminum compound used for the reaction to polycarboxylic acid and / or polycarboxylate is 0.001 to 2.5, preferably 0.1 to 1.5, preferably 0.1 to 1, preferably 0.4 to 0.8, more preferably 0.4 to 0.6.

[0187] A molar ratio of 0.5 is particularly preferred.

[0188] The reaction in the process of the present invention is carried out in the presence of an aqueous solvent (aqueous medium).

[0189] Here, when a mixture is used, the water content is preferably more than 50% by weight, more preferably more than 60% by weight, even more preferably more than 70% by weight, even more preferably more than 80% by weight, even more preferably more than 90% by weight, even more preferably more than 95% by weight, even more preferably more than 99% by weight. In particular, the aqueous solvent consists of water only.

[0190] Additionally or alternatively, a base can be used in the reaction.

[0191] The reaction is typically carried out in the presence of a base, in water as a solvent.

[0192] It is preferred to use an alkali metal hydroxide or a mixture of different alkali metal hydroxides as the base. Examples are, in particular, sodium hydroxide and potassium hydroxide. However, other inorganic hydroxides or carbonates, or organic bases, such as amines, are also conceivable. Sodium hydroxide is particularly preferred.

[0193] Preferably, the reaction is carried out in the presence of a base, preferably an alkali metal hydroxide or a mixture of different alkali metal hydroxides, more preferably sodium hydroxide.

[0194] In particular, the reaction is carried out under an absolute pressure of 1 to 2 bar, preferably the reaction is carried out under atmospheric pressure. However, pressures slightly above atmospheric pressure or below atmospheric pressure may occur due to the equipment. Therefore, for the purposes of the present invention, the term "atmospheric pressure" refers to the pressure range given by the actual general atmospheric pressure of 1013 mbar.

[0195] According to another embodiment, the reaction may be carried out at 2 bar.

[0196] The appropriate pressure will be selected by the skilled artisan depending on the antigen selected and, in any case, will preserve the integrity of the medium, and in particular the integrity of the antigen.

[0197] The reaction can be carried out at room temperature (20° C.). However, the reaction can be carried out at temperatures above room temperature.

[0198] Preferably, the reaction is carried out at a temperature of 4°C to 75°C, particularly 4°C to 70°C, for example 4°C to 65°C, particularly 10°C to 70°C, preferably 10°C to 45°C, more preferably 10°C to 40°C.

[0199] However, the method can be carried out at negative temperatures, provided that the vehicle composition avoids freezing.

[0200] Furthermore, it is advantageous that the reaction is carried out while mixing the reaction mixture. Therefore, the reaction can be carried out with stirring, which is also advantageous in case of scale-up. More effective mixing can be achieved by circulating the reaction mixture with a pump during the reaction. This allows for continuous operation of the process of the invention.

[0201] In order to achieve a high space-time yield, the reaction is carried out for 1 minute to 96 hours. The reaction is preferably carried out for 2 hours to 48 hours. The reaction is more preferably carried out for 5 hours to 24 hours. The reaction is more preferably carried out for 8 hours to 16 hours.

[0202] The molar ratio of the polycarboxylic acid and / or polycarboxylate used for the reaction to the base used is preferably 0.05 to 2, more preferably 0.1 to 1.5, and even more preferably 0.2 to 1, when a polycarboxylate is used.

[0203] Preferably, the process according to the invention further comprises a centrifugation step at the end of the reaction and then, optionally, a redispersion step.

[0204] The process according to the invention may also comprise at least one conventional washing step at the end of the reaction.

[0205] The present invention will be better understood by reference to the following examples and figures, which are provided for illustrative purposes only and should not be construed as limiting the invention in any manner. [Brief description of the drawings]

[0206] [Figure 1] Typical characterization techniques for Al-fumarate are shown; (a) PXRD, (b) FT-IR, and (c) TGA. [Diagram 2] Figure 2 shows the stability of Al-fumarate in HEPES buffer (20 mM, pH 7.4); (a) PXRD over 4 days, (b) Al3+ leaching over 2 months as quantified by ICP-OES, (c) fumaric acid leaching over 2 months as quantified by HPLC, and (d) weight percentage of Al-fumarate decomposition over 2 months based on HPLC data. [Diagram 3] PXRD diagrams of Al-fumarate biocomposites where biomolecules were added in the ligand / base solution, in the metal salt solution, or directly to the reaction mixture; (a) BSA, (b) laccase, and (c) Cyt c. [Figure 4]Using BSA and Cyt c as model biomolecules, we show (a) immobilization capacity and (b) protein leaching of Al-Fumarate adjuvant and Alhydrogel® adjuvant after 4 days of storage, quantified based on the amount of biomolecule found in the respective supernatants. [Diagram 5] Characterization of Tetanus Toxoid (TT) (Al-fumarate) vaccines (TT@Al-fumarate vaccines) at M0 (a, b) and M1 (c, d) concentrations: (a, c) PXRD, (b, d) FT-IR. [Figure 6] (a) TT immobilization efficiency of M0 and M1 formulations, quantified based on the amount of TT (not adsorbed TT) detected in the supernatant using the microBCA protein measurement assay; (b) percentage of TT leached from TT (with Al-fumarate) (TT@Al-fumarate) and TT (with Alhydrogel®) (TT@Alhydrogel®), quantified based on the amount of TT (not adsorbed TT) detected in the supernatant using the microBCA protein measurement assay, one week after manufacturing of the vaccine formulation. [Figure 7] Figure 1 shows Ig anti-TT and IgG anti-TT indices for two vaccine formulations, TT (with Al-fumarate) and TT (with Alhydrogel®), used at four different concentrations (C0-C3); (a) IgG anti-TT antibodies (Ab) and (b) full length Ig anti-TT Ab and IgG anti-TT Ab (anti-light chain Elisa). Elisa optical density (OD) is expressed as an index, i.e. the value obtained from immunized mice divided by the value observed in serum from non-immunized control naive mice. Mice were bled on day 30 (D30). [Figure 8] The evolution of the mean and individual mouse body weights over time is shown for all subgroups (S-TT (with Al-fumarate), M-TT (with Alhydrogel®), and TT) as well as the control group. [Figure 9]Figure 1 shows the IgG anti-TT response observed in 10 pairs of mice immunized with either TT (with Alhydrogel®) or TT (with Al-fumarate) on day 14 (D14) or day 32 (D32). The direct OD observed in the ELISA is shown. [Figure 10] Comparison of TT (with Al-fumarate) and TT (with Alhydrogel®) Ig responses using serial dilutions of 200-3200 of sera from days 7, 14, 32 and 60. a) Standard curve in international units, b) shows the dilution curves, c) and d) comparison of the curves obtained from sera from day 32 (D32) and day 60 (D60), respectively. [Figure 11] From left to right, IgG anti-TT responses at day 32 after immunization with 9-month-old TT (with Al-fumarate), early TT (with Al-fumarate) (same preparation, same immunization as used 9 months ago), and freshly prepared TT (with Al-fumarate) are shown. [Figure 12] (a) TT immobilization efficiency on Al-fumarate surface, quantified based on the amount of TT (not adsorbed TT) detected in the supernatant using the microBCA protein measurement assay; (b) percentage of TT leached from TT (Al-fumarate-loaded surface) and TT (Alhydrogel®-loaded) one week after preparation of the vaccine formulation, quantified based on the amount of TT (not adsorbed TT) detected in the supernatant using the microBCA protein measurement assay. [Figure 13] TT (Al-fumarate added) and TT (Al-fumarate added-surface) formulations in HO, zeta potential measurements for Al-fumarate, and zeta potential measurements for TT are shown. [Figure 14] From left to right, IgG anti-TT responses are shown 32 days after immunization with TT, TT (with Alhydrogel®), TT (with Al-fumarate) (TT@Alhydrogel®) (TT@Al-fumarate), or TT (with Al-fumarate-surface) (TT@Al-fumarate-Surf). [Figure 15] The amount of Al3+ present at the injection site (right paw) of mice 7-60 days after injection as quantified by ICP-OES, as well as the weight % of Al3+ present at the injection site as estimated from the ICP-OES data, are shown using the log x-axis. [Figure 16] The weight % Al3+ present at the injection site (right limb) of mice 7-60 days post-injection, as quantified and estimated from ICP-OES data, is shown using a linear x-axis. [Figure 17] The PXRD diagram of Fluorescent-TT (with Al-fumarate) is shown. [Figure 18] Figure 1 shows the % of initial fluorescence radiance at the injection site over time for mice injected with Fluorescent-TT and Fluorescent-TT (with Al-fumarate). Each point represents the average of three mice. [Figure 19] HES staining of tissues from organs of naive mice (top row) and mice injected with TT (with Al-fumarate) (bottom row) is shown. Scale bar represents 500 μm. [Figure 20] The PXRD diagram of the experimental value of TT (ZIF-8 added) and the PXRD diagram of the experimental value of ZIF-8 and the PXRD diagram of the calculated value are shown. [Figure 21] Ig anti-TT obtained one month after immunization in the cases of TT, TT (with Al-fumarate), and TT (with ZIF-8) is shown. [Figure 22] PXRD patterns of formaldehyde inactivated E. coli (with Al-fumarate) (formaldehyde inactivated E. coli@Al-fumarate), experimental value of Al-fumarate, and calculated value (obtained from CCDC, accession number: 1051975, database identifier: DOYBEA) are shown. [Figure 23] Shown are TEM images of stained inactivated E. coli (unfixed, upper image) and inactivated E. coli (with Al-fumarate) (lower image). [Figure 24] FIG. 1 shows STEM-EDX mapping of Al and O on formaldehyde inactivated E. coli (with Al-fumarate). [Diagram 25] Flow cytometry analysis of inactivated E. coli (unfixed, left), inactivated E. coli (with Al-fumarate) (center), and inactivated E. coli released from E. coli (with Al-fumarate) (right); top row: axial and side scatter obtained using a BD LSR Fortessa™ instrument, and bottom row: direct video imaging performed using a Thermo Fisher Attune™ Cytpix™ for SYTO9 fluorophores detecting bacteria and / or bacterial DNA gated based on scatter. [Figure 26] Ig anti-E. coli in mice immunized with inactivated E. coli @ Al-fumarate, inactivated E. coli, or inactivated E. coli @ Alhydrogel®. Ranked values ​​are shown in the same order from lowest to highest Ig response in each group of 5 mice. [Figure 27] The PXRD pattern of inactivated poliovirus (with Al-fumarate) (inactivated-poliovirus@Al-fumarate), the experimental PXRD pattern of Al-fumarate and the calculated value (obtained from CCDC, accession number: 1051975, database identifier: DOYBEA) are shown. [Figure 28] a) Amount of protein detected using the microBCA protein measurement assay in the supernatant of the IMOVAX POLIO solution, the control reaction of Al-fumarate and the supernatant of inactivated poliovirus (with Al-fumarate), b) Immobilization efficiency of inactivated poliovirus (with Al-fumarate) estimated from the amount found in the supernatant. [Figure 29]The PXRD pattern of the glycan (Al-fumarate added) and the calculated PXRD pattern (obtained from CCDC, accession number: 1051975, database identifier: DOYBEA) are shown. [Diagram 30] 13C NMR spectra of Al-fumarate and glycan (with Al-fumarate added). [Diagram 31] The PXRD patterns of CpG1018 (with Al-fumarate added), experimental value of Al-fumarate and calculated value (obtained from CCDC, accession number: 1051975, database identifier: DOYBEA) are shown. [Diagram 32] The PXRD patterns of CpG1018+TT (with Al-fumarate added), the experimental value of Al-fumarate, and the calculated value (obtained from CCDC, accession number: 1051975, database identifier: DOYBEA) are shown. [Diagram 33] PXRD pattern of BSA (with Al-muconate) and PXRD pattern of Al-muconate in Example 25 are shown. [Diagram 34] PXRD pattern of MIL-160 of Example 26. [Diagram 35] PXRD pattern of BSA (with added Al-trimesate) of Example 27 and PXRD pattern of Al-trimesate are shown. [Diagram 36] 3 shows the PXRD pattern of BSA (with Al-pyromellitate added) of Example 28.

[0207] Working Example

[0208] Materials and Methods All biomolecules and chemicals were purchased from commercial suppliers and used without further purification unless otherwise specified.

[0209] Tetanus toxoid protein 2.8 mg / mL, 1428 Lf / mL, 5712 UI / mL was purchased from Creative Biolabs.

[0210] Alhydrogel (登録商標) Adjuvant 2% was purchased from InvivoGen.

[0211] Bovine serum albumin, standard grade, Zeba™ spin desalting columns (7k MWCO, 2 mL) were purchased from Thermo Fisher Scientific.

[0212] Cytochrome C from horse heart (95% or more), laccase from Trametes versicolor (0.5U / mg or more), aluminum sulfate (USP test standard), fumaric acid (USP / NF standard), sodium hydroxide (Ph.Eur., BP, NF, E524, 98-100.5% standard), aluminum standard for ICP (995mg / L), QuantiPro™ Assay Kit, phosphate buffered saline tablets, HEPES buffer solution (1M in H2O), hydrochloric acid (1mol / L, Ph.Eur., UPS) Standards), nitric acid 70% (99.999% or higher), zinc standard substance for ICP (1000 mg / L), phosphorus standard substance for ICP (1000 mg / L), 37% formaldehyde, paraformaldehyde (95-100%), 2-methylimadazole (Ph.Sec.Std.), trimesic acid (95%), 2,5-furandicarboxylic acid, and 1,2,4,5-benzene-tetracarboxylic acid were purchased from Sigma-Aldrich.

[0213] Zinc acetate was obtained from Fluka.

[0214] Aluminum acetate (basic) 90% was obtained from Acros Organics.

[0215] Nitric acid 52.5%, AnalaR NORMAPUR (登録商標) Analytical reagents were purchased from VWR.

[0216] Sodium chloride, muconic acid were purchased from Alfa Aesar.

[0217] Hydrochloric acid 37% for analysis ISO was purchased from Carlo Erba.

[0218] Mouse anti-tetanus toxoid ELISA kit, full length Ig (IgG, IgA, IgM) mouse anti-E. coli ELISA kit (reference 500-100ECP) were purchased from Alpha Diagnostics International.

[0219] InVivoTag (登録商標) The 680XL protein labeling kit was purchased from Perkin Elmer.

[0220] IMOVAX (登録商標) was obtained from Sanofi Pasteur.

[0221] PNEUMOVAX (登録商標) The vaccine was obtained from MSD.

[0222] CpG 1018 was obtained from Proteogenix.

[0223] Mouse studies In all studies, mice were housed in standard disposable cages in ventilated racks under controlled temperature of 21 ± 3 °C, humidity of 30% to 70%, and a light cycle of 12 h light / 12 h dark. Filtered water and autoclaved standard laboratory chow for rodents were provided ad libitum. Prior to dosing, mice were anesthetized under volatile anesthesia (isoflurane and oxygen as carrier gas).

[0224] In all studies, the vaccine was kept at room temperature for a few minutes immediately prior to administration to the animals in order to avoid administering a cold solution.

[0225] Prior to injection, immediately prior to filling the syringe, each vaccine was carefully resuspended by vortexing (three times, approximately 5 seconds each) unless otherwise specified.

[0226] In all studies, injections were performed using a 26G disposable needle attached to a 50 μL Hamilton syringe.

[0227] In all studies, whole blood was sampled and used for serum preparation following standard protocols.

[0228] For intermediate sampling, whole blood was sampled by the retro-orbital sinus route using capillary tubes (not coated with anticoagulant).For terminal sampling, immediately prior to euthanasia, whole blood was sampled by intracardiac puncture under volatile anesthesia (isoflurane and oxygen as carrier gas).

[0229] device Powder X-ray diffractograms were measured on a Siemens D5000 diffractometer operating in Bragg-Brentano geometry [(θ-2θ) mode] by using CuKα radiation unless otherwise specified.

[0230] Inductively coupled plasma optical emission spectroscopy (ICP-OES) was performed using an Agilent 720 Series with axial viewing of the plasma. All samples were filtered before injection into the instrument unless otherwise specified.

[0231] Fourier transform infrared spectroscopy (FT-IR) was performed on a ThermoScientific Nicolet 6700 FT-IR.

[0232] Thermogravimetric analysis (TGA) was performed using a Mettler Toledo TGA / DSC 1, STAR (登録商標) The experiment was carried out under oxygen (O2) flow in the system.

[0233] The optical density of the ELISA kit was measured on a single microtiter plate in a dual wavelength Tecan Spark instrument.

[0234] Origin was used as the statistical software.

[0235] List of abbreviations PXRD: Powder X-ray diffraction FT-IR: Fourier-transform infrared spectroscopy TGA: Thermogravimetric analysis ICP-OES: Inductively coupled plasma optical emission spectroscopy BSA: Bovine serum albumin Cyt c: Cytochrome c (Cyt c) HEPES: 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid PBS: Phosphate buffered saline BCA: Bicinchoninic acid SEM: Scanning electron microscopy TEM: Transmission electron microscopy STEM-EDS: Scanning transmission electron microscopy coupled with energy dispersive X-ray spectroscopy HPLC: High-performance liquid chromatography RT: Room temperature PFA 4%: Paraformaldehyde 4% solution Ab: Antibodies Ig: Immunoglobulin IgG: Immunoglobulin G OD: Optical Density CCDC: The Cambridge Crystallographic Data Centre NIR: Near Infra-Red IQR: Interquartile range SD: Standard Deviation BKG: Background IU: International Units

[0236] Example 1 Synthesis of Al-fumarate MOF For the synthesis of Al-fumarate MOF, 700 mg of Al2(SO4)3·xH2O (x is approximately 18) was dissolved in 10 mL of milliQ H2O.

[0237] A separate solution containing 243 mg of fumaric acid and 256 mg of NaOH in 10 mL of milliQ H2O was prepared and added to the metal salt solution.

[0238] A white precipitate was observed immediately and the mixture was left stirring at room temperature under atmospheric pressure for 8 hours.

[0239] The product was collected by centrifugation (3 min, 24500 g), dried overnight at 100° C., and analyzed using typical characterization techniques (PXRD, FT-IR, TGA), as shown in FIG. 1. Al-fumarate (Basolite (登録商標) The calculated PXRD pattern of A520) was obtained from the Cambridge Crystallographic Data Centre (CCDC); accession number: 1051975, database identifier: DOYBEA.

[0240] These characterization results were consistent with the formation of Al-fumarate.

[0241] If necessary, a washing step with milliQ H2O or HEPES (20 mM, pH 7.4) can be performed.

[0242] Example 2 Stability of Al-fumarate in HEPES HEPES buffer at a concentration of 20 mM and pH 7.4 was selected as the injection medium for Al-fumarate adjuvant formulations. The stability of Al-fumarate in the buffer was studied over a period of 0 days to 2 months.

[0243] More precisely, suspensions with an Al-fumarate concentration of 8.5 mg / mL in HEPES buffer (20 mM, pH 7.4) were prepared and stored at 4°C until analysis. To simulate shipping conditions, the suspensions were shaken manually for different lengths of time. At the designated stability test time points, the Al-fumarate was recovered by centrifugation (20 min, 24500 g) and dried at 100°C for 3 h for analysis. The stability of the formulations was evaluated over 4 days using a typical characterization technique (PXRD) that allows identifying possible structural changes induced by the buffer. Furthermore, ICP-OES and HPLC analytical techniques were used to characterize the Al leached into the solution (supernatant). 3+and fumaric acid, respectively, for up to 2 months. Note that at each time point, separate samples were analyzed.

[0244] Al-fumarate was found to be stable in HEPES buffer (20 mM, pH 7.4) since no structural changes were observed over a period of 4 days. 3+ and fumaric acid were detected in the supernatant over a period of 2 months (Figure 2), confirming that Al-fumarate in HEPES buffer (20 mM, pH = 7.4) is stable for at least 2 months.

[0245] Example 3 Effect of biomolecules on the synthesis of Al-fumarate Biomolecule loading during Al-fumarate synthesis was performed using model biomolecules with different structural features, isoelectric points, and sizes, namely bovine serum albumin (BSA), laccase, and cytochrome c (Cyt c).

[0246] The mode of addition of the biomolecules in the Al-fumarate reaction was also investigated by adding each biomolecule either to the metal salt solution, the ligand / base solution, or to the reaction a few seconds after mixing all the reactants.

[0247] The results obtained showed that the biomolecules in the synthesis of Al-fumarate did not affect the PXRD patterns (Figure 3), independent of the mode of addition and the structural features of the respective biomolecules.

[0248] Example 4 Al-fumarate adjuvant and Alhydrogel (登録商標) Immobilization capacity of adjuvants Al-Fumarate and Alhydrogel (登録商標) The immobilization ability of was investigated using model biomolecules, namely bovine serum albumin (BSA) and cytochrome c (Cyt c).

[0249] Additionally, the stability of the biocomposites with both adjuvants was investigated for 4 days to measure the amount of biomolecules leached into solution.

[0250] In the case of Al-fumarate adjuvants, BSA or Cyt c was added to the reaction a few seconds after mixing the metal salt and ligand / base solutions.

[0251] Alhydrogel (登録商標) In the case of adjuvants, BSA or Cyt c was mixed with the adjuvant suspension for 5 minutes.

[0252] At the end of each step, the products were centrifuged (3 min, 10,500 g) and the supernatants were collected and the amount of biomolecules remaining in solution (not adsorbed by the adjuvant) was quantified by the microBCA protein measurement assay (Figure 4a).

[0253] Furthermore, to investigate the possible leaching of the biomolecules from the adjuvant, the products were mixed with Al-fumarate and Alhydrogel. (登録商標) were resuspended in HEPES (20 mM, pH 7.4) and PBS (10 mM, pH 7.4), respectively, and stored at 4°C. At various time periods (0-4 days), samples were centrifuged (3 min, 10500 g) and their supernatants were collected and any leached biomolecules were quantified (via microBCA). The samples were resuspended again in the respective buffers and stored at 4°C for up to 4 days until the next measurement. The cumulative amounts of BSA and Cyt c detected in the respective supernatants up to day 4 are shown in Figure 4b.

[0254] The Al-fumarate according to the invention showed excellent immobilization capacity for both biomolecules tested (98 wt % for BSA and 99 wt % for Cyt c), whereas Alhydrogel (登録商標)was much more efficient in immobilizing BSA (99 wt%) than in immobilizing Cyt c (49 wt%) (Figure 4a).

[0255] Furthermore, protein leaching studies showed that minimal biomolecular weights were desorbed from Al-fumarate (Fig. 4b).

[0256] This study highlights that Al-fumarate is suitable for immobilization of biomolecules with various characteristics and can be widely used in the production of various vaccines.

[0257] Example 5 Immobilization of tetanus toxoid in Al-fumarate. Two different concentrations of TT (added with Al-fumarate) vaccines (M0 and M1) were prepared, with the TT / Al concentration adjusted to match the model human tetanus vaccine. 3+ The ratio was kept constant at 0.08 IU / μg Al.

[0258] Tetanus toxoid was also administered at the same concentrations (S0 and S1) and ratios (0.08 IU / μg Al) in the commercial adjuvant Alhydrogel. (登録商標) The vaccines were then adsorbed onto the mice and both vaccine groups were used for in vivo studies.

[0259] FIG. 5 shows the PXRD and FT-IR data for the two TT (Al-fumarate added) vaccines compared to the data for the control reaction, in which Al-fumarate was formed in the absence of antigen using exactly the same reaction conditions as for M0 / M1.

[0260] As can be seen, TT did not affect the formation of MOFs, which was consistent with previous studies shown above in Example 3 using other biomolecules (BSA, laccase, and Cyt c).

[0261] Finally, tetanus toxoid was not detected in M0 and M1 supernatants using the microBCA protein measurement assay, confirming total immobilization of the antigen in the vaccine (Figure 6a).

[0262] Example 6 Al-Fumarate or Alhydrogel (登録商標) Preparation of tetanus toxoid (TT) antigen vaccine compositions using the same and adjustment of their dosages - Patents.com The various vaccine compositions and doses were based on the tetanus toxoid monovalent human vaccine and are shown in Table 1 below.

[0263] [Table 1]

[0264] Both adjuvant systems (Al-fumarate and Alhydrogel) (登録商標) ), C0 and C1 vaccines were prepared, and C1 was used as the stock for C2 and C3 diluted vaccines.

[0265] Immobilization of tetanus toxoid (TT) antigen in Al-fumarate. For Al-fumarate-adjuvanted vaccines, two TT (Al-fumarate-added) vaccines, M0 and M1, were prepared, and M1 was used as a stock for M2 and M3 diluted vaccines. All solutions used (reactants, buffers, and MilliQ solutions) were sterilized before use using syringe filters with 0.2 μm pore membranes.

[0266] The exact amounts used are shown in Table 2 below, which shows the experimental details for the preparation of the TT (Al-fumarate spiked) vaccine.

[0267] [Table 2]

[0268] For both vaccines, stock solutions consisting of Al2(SO4)3·xH2O (700 mg) in 10 mL milliQ H2O and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL milliQ H2O were used.

[0269] A 2.8 mg / mL tetanus toxoid solution purchased from Creative Biolabs was used directly in the preparation of the vaccine.

[0270] In particular, two separate solutions (109 μL and 136 μL M0 and M1) were prepared, containing either the metal salt or the ligand / base, respectively. A few seconds after mixing the two solutions, tetanus toxoid solution was added to the reaction (8.4 μL for M0 and 10.5 μL for M1). The final mixture was left stirring at room temperature for 8 hours.

[0271] The vaccines were then centrifuged at 10,500 g for 3 min, the supernatant removed and replaced with 300 μL (for M0) or 750 μL (for M1) of HEPES buffer (20 mM, pH 7.4).

[0272] The TT (Al-fumarate added) vaccine was stored at 4°C for approximately 2 days prior to in vivo studies.

[0273] The amount of immobilized TT in Al-fumarate was quantified based on the amount of TT found in M0 and M1 supernatants by microBCA protein measurement assay. The amount of TT in M0 and M1 supernatants was negligible, confirming the total immobilization of TT (Figure 6a). 3+ The content was also confirmed by ICP-OES. 3+ The content did not show any significant difference from the expected value. Table 3 shows the Al content of the TT (Al-fumarate-added) vaccine and their controls quantified by ICP-OES. 3+ The content is indicated.

[0274] Mineralization procedure for ICP-OES: All samples were heated at 100° C. for 16 h before processing. 1 mL of HCl (1 M) was added to all dried products, which were then heated at 80° C. for 16 h in a closed vessel.

[0275] After complete mineralization of the samples, the samples were diluted to 40 mL with milliQ H2O for ICP-OES analysis. A calibration curve of 1000-10,000 ppb Al was used for the analysis.

[0276] [Table 3]

[0277] Alhydrogel (登録商標) Immobilization of tetanus toxoid (TT) antigen in Alhydrogel (登録商標) Adjuvant vaccines: two types of TT (Alhydrogel (登録商標) Two vaccines, namely S0 and S1, were prepared, and S1 was used as a stock for the S2 and S3 dilutions. The buffer solutions used were sterilized before use using a syringe filter with a 0.2 μm pore size membrane.

[0278] The exact amount used was TT (Alhydrogel (登録商標) Experimental details for the preparation of the vaccine are detailed in Table 4 below.

[0279] [Table 4]

[0280] Tetanus toxoid solution at 2.8 mg / mL purchased from Creative Biolabs and adjuvant 2% purchased from InvivoGen were used directly in the preparation of the vaccine.

[0281] Specifically, 8.4 μL (for S0) or 10.5 μL (for S1) of tetanus toxoid solution was diluted with the respective aliquot of PBS buffer (10 mM, pH 7.4) followed by addition of the indicated amount of Alhydrogel. (登録商標) The suspension was added.

[0282] The mixture was pipetted up and down for 5 minutes to allow antigen adsorption, and finally the remaining volume of PBS buffer was added.

[0283] The TT (Alhydrogel (登録商標) The vaccine was stored at 4°C for approximately 2 days until in vivo studies.

[0284] Commercially available Alhydrogel (登録商標) Al 3+ The content was also investigated. Table 5 below shows the Alhydrogel content as determined by ICP-OES. (登録商標) Al 3+ The content is indicated.

[0285] [Table 5]

[0286] Example 7 From the viewpoint of antigen leaching, TT (Al-fumarate added) preparation and TT (Alhydrogel (登録商標) Additive) Stability of formulation The stability of the TT (with Al-fumarate) formulation in terms of antigen leaching was investigated by measuring the amount of TT leached into the solution (supernatant) after 1 week of storage at 4° C. No leaching of TT was observed, confirming the stability of the formulation (FIG. 6b).

[0287] TT (Alhydrogel (登録商標) The (additive) formulation showed approximately 8 wt. % TT leached into the solution (supernatant) after 1 week of storage at 4° C. (FIG. 6b).

[0288] Example 8 Example 6. In vivo evaluation of vaccine-induced immune responses Seven-week-old Balb / c female mice weighing approximately 18 g were placed in a 10-mL ... (登録商標) Each subject was immunized by intramuscular injection of 20 μL of either the immunized control or the immunized control (added with IgG) into the quadriceps of the hind leg.

[0289] Al-fumarate adjuvant and Alhydrogel (登録商標) In both adjuvants, TT / Al 3+ Four concentrations were tested at a constant ratio of 0.08 IU / μg Al.

[0290] For each concentration, two mice were used per adjuvant group, and two additional mice that did not receive any vaccine injections (naive mice) were included in the study as a control group.

[0291] No local reactions were observed at the injection site. All mice gained weight within one month after immunization.

[0292] The immunized mice and the two control mice (naive mice) were sacrificed and bled at one month.

[0293] Sera were analyzed for full length antibody (Ab) responses using an anti-mouse light chain Elisa and for IgG Ab responses using an anti-mouse IgG specific Elisa. Elisa was performed according to the manufacturer's instructions.

[0294] Readings were recorded at two wavelengths, 450 nm and 630 nm, to correct for plaque background differences. Sera were tested at 1:10 and 1:100 dilutions for Ig detection, and at 1:100 and 1:1000 dilutions for IgG detection. At the highest antigen (Ag) concentration, a 1:2500 dilution was also tested for IgG. Protein and detergent concentrations were standardized for all serum dilutions used.

[0295] Each kit contained a reference curve of calibrated samples that allowed results to be expressed in kU / mL of Ab.

[0296] The index of antibody (Ab) responses was calculated by dividing the values ​​observed from the immunized mice by those from the naive mice after subtracting the kit diluent background from both values ​​(Figure 7). Full length Ig and IgG Ab responses were significantly higher in the immunized mice with Al-fumarate adjuvant and Alhydrogel. (登録商標) The responses were evaluated using both TT and adjuvant. These responses were proportional to the TT concentration and adjuvant concentration used. At all concentrations tested, Al-fumarate was more potent than Alhydrogel. (登録商標) induced a statistically significantly stronger Ab response than

[0297] Example 9 Kinetic study of immune responses triggered by two adjuvanted vaccines and free antigens in Example 6 Seven-week-old Balb / c female mice weighing approximately 18 g were treated with TT (with Al-fumarate), TT (with Alhydrogel (登録商標) The mice were immunized by intramuscular injection of 20 μL of either 100 μL of 10 ...

[0298] Al-fumarate adjuvant and Alhydrogel (登録商標) For both adjuvants, the C1 concentration (1.6 IU TT / 20 μg Al 3+ ) was used, and mice without the adjuvanted formulation were injected with 1.6 IU.

[0299] Each formulation (TT (Al-fumarate added), TT (Alhydrogel) (登録商標) For VACCINE IMMUNE (addition) and TT (TT), 24 mice were used per group, and two additional mice that did not receive any vaccine injection (naive mice) were included in the study as a control group.

[0300] No local reactions were observed at the injection site. All mice gained weight during the first month after immunization (Figure 8).

[0301] Six mice from each group were sacrificed on days 7, 14, 32, and 60 after injection, and serum was collected for ELISA analysis.

[0302] Two naive mice were sacrificed on days 14 and 60.

[0303] Data from 5 pairs of mice on day 14 and 5 pairs of mice on day 32 are shown in FIG. 9, which shows that the TT (Alhydrogel)-injected mice (登録商標) The mice showed better Ab responses than the mice injected with IgG.

[0304] The Ab content in 200-3200 serial dilutions of serum from days 7, 14, 32, and 60 was analyzed (Figure 10). At an OD of 0.6 (50 U), TT (Al-fumarate) Ig or TT (Alhydrogel) Ig were detected. (登録商標) TT (Al-fumarate) vs TT (Alhydrogel) at 3 (20kU / 60kU) on day 32 (D32) and 2.5 (40kU / 100kU) on day 60 (D60), respectively. (登録商標) The dilution ratio of 1:1 was calculated using the formula:

[0305] Example 10 Long-term stability of TT (with Al-fumarate) in terms of immunogenic efficacy To demonstrate the long-term stability of the TT (Al-fumarate-added) vaccine from the viewpoint of immunogenicity, a vaccine was prepared at a concentration of M1 (1.6 IU TT / 20 μg Al 3+ ) TT (with Al-fumarate) formulations were prepared simultaneously with the formulations used in Example 9, stored at 4° C., and tested after 9 months. No stabilizer / preservative additives were added to the formulations.

[0306] Seven-week-old Balb / cByJ female mice weighing approximately 19 g were immunized by intramuscular injection into the right hind leg with 20 μL of either freshly prepared TT (with Al-fumarate) or 9-month-old TT (with Al-fumarate) (preparation of the solutions is described in Example 6).

[0307] All vaccines contained 1.6 IU TT / 20 μL Al injected. The difference in Al content between samples was examined by ICP-OES and found to be less than 8%.

[0308] For each formulation (freshly prepared TT (with Al-fumarate) or 9-month-old TT (with Al-fumarate)), six mice were used per group.

[0309] The study lasted for 32 days, and serum was collected for all mice on day 32 post-injection (D32).

[0310] No local reactions were observed at the injection site. All mice gained weight during the first month after immunization, which was consistent with previous studies in Examples 8 and 9.

[0311] Sera from this study and sera obtained 9 months earlier using the same pre-aged immunogen preparation (Example 9) were analyzed for full-length antibody (Ab) responses using an Ig anti-mouse ELISA kit. The ELISA was performed according to the manufacturer's instructions.

[0312] Readings were recorded at two wavelengths, 450 nm and 630 nm, to correct for plaque background differences. Sera were tested at a 1:1000 dilution for IgG detection. Protein and detergent concentrations were standardized for all serum dilutions used.

[0313] Each kit contained a reference curve of calibrated samples that allowed results to be expressed in kU / mL of Ab.

[0314] Ab responses were expressed directly as OD. All samples were tested on triplicate plates, with the same reference curve used on each plate to allow for correction of OD values, although the raw reference curve data were nearly identical (1% and 5% difference, respectively).

[0315] As shown in Figure 11, TT (with Al-fumarate) after 9 months did not show any decrease in its immunogenic properties. IgG levels were similar between aged samples, freshly prepared, and those obtained from serum taken 9 months earlier with the same aged immunogen preparation.

[0316] A similar experiment was performed with a TT (with Al-fumarate) preparation stored without additives for 15 months at 4° C. The immunogenic properties of the 15-month old preparation remained in the range of 95% or greater efficacy than freshly prepared TT (with Al-fumarate).

[0317] This study highlights the suitability of Al-fumarate for the design of stable vaccine formulations.

[0318] Example 11 Preparation of tetanus toxoid (TT) antigen vaccine with TT surface immobilized on Al-fumarate (TT (Al-fumarate-added-surface)) Al-fumarate was tested for surface adsorption of TT using the M1 concentration for the formulation. All solutions used (reactants, buffers, and MilliQ solutions) were sterilized before use using a syringe filter with a 0.2 μm pore membrane.

[0319] The exact amounts used are shown in Table 6 below, which shows the experimental details for the preparation of the TT (Al-fumarate-loaded-surface) vaccine.

[0320] [Table 6]

[0321] For the synthesis of Al-fumarate, stock solutions consisting of Al2(SO4)3·xH2O (700 mg) in 10 mL of milliQ H2O and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL of milliQ H2O were used. In detail, 136 μL of two separate solutions, containing either metal salts or ligands / bases, were mixed together. A few seconds after mixing the two solutions, 10.5 μL of H2O was added to the reaction, which corresponds to the volume of TT solution that would normally be added when preparing the TT (Al-fumarate-added) formulation. The final mixture was left stirring at room temperature for 8 h.

[0322] The product was then centrifuged at 10,500 g for 3 min and the supernatant was removed. Al-fumarate was redispersed in 272 μL of milliQ H2O and 10.5 μL of TT solution (2.8 mg / mL, purchased from Creative Biolabs) was added for the immobilization procedure.

[0323] At the end of the immobilization process (16 h), the TT(Al-fumarate-loaded-surface) vaccine was centrifuged at 10500 g for 3 min, the supernatant was removed and replaced with 750 μL of HEPES buffer (20 mM, pH 7.4).

[0324] The TT (Al-fumarate-loaded-surface) vaccine was stored at 4° C. for further studies.

[0325] The amount of TT immobilized on the surface of Al-fumarate was quantified based on the amount of TT found in the supernatant by microBCA protein measurement assay. As shown in Figure 12a, all of the TT was immobilized on the surface of the MOF.

[0326] To investigate any change in the surface charge of Al-fumarate after TT immobilization, zeta potential measurements were performed for TT(Al-fumarate added), TT(Al-fumarate added-surface), Al-fumarate, and TT in HO. As shown in FIG. 13, both formulations and the MOFs have positive zeta potentials, but TT has a zeta potential of about -8 mV. However, TT(Al-fumarate added) and Al-fumarate show similar zeta potential values ​​(about 9 mV and 10 mV, respectively), while TT(Al-fumarate added-surface) has a lower zeta potential of about 6 mV. This difference indicates that in the case of the TT(Al-fumarate added) formulation, the antigen is trapped between the MOF particles, whereas in the case of the TT(Al-fumarate added-surface) formulation, the antigen is immobilized on the external surface of the MOFs, lowering its zeta potential value due to the negative charge of TT.

[0327] The stability of the TT(Al-fumarate-surface) formulation in terms of antigen leaching was investigated by measuring the amount of TT leached into the solution (supernatant) after 1 week of storage at 4° C. No TT leaching was observed from TT(Al-fumarate-surface), confirming the stability of the formulation, whereas about 8 wt % TT was leached from the surface of the Alhydrogel adjuvant ( FIG. 12 b).

[0328] Example 12 Evaluation of the vaccine of Example 7 (TT (Al-fumarate added-surface)) Seven-week-old Balb / cByJ female mice weighing approximately 19 g were treated with TT, TT(Alhydrogel (登録商標) Mice were immunized by intramuscular injection of 20 μL of either TT (Al-fumarate added), TT (Al-fumarate added), or TT (Al-fumarate added-surface) into the right hind leg.

[0329] All vaccines contained 1.6 IU TT / 20 μL injected (see Examples 6 and 11).

[0330] The three aluminum adjuvants 3+The content was confirmed by ICP-OES. Mineralization procedure for ICP-OES: 200 μL of TT (Alhydrogel (登録商標) The TT (Al-fumarate-added) vaccine suspension, TT (Al-fumarate-added) vaccine suspension, or TT (Al-fumarate-added-surface) vaccine suspension were heated at 100°C overnight before processing. 1 mL of HCl (37%) was added to all dried products, which were then heated at 80°C for 16 h in a closed container. After complete mineralization of the samples, they were diluted to 5 mL with milliQ H2O for ICP-OES analysis. Samples were not filtered before injection into the instrument.

[0331] As shown in Table 7 below, the three vaccines had similar aluminum content.

[0332] [Table 7]

[0333] Each formulation (TT, TT(Alhydrogel (登録商標) Six mice were used per group for either TT (Al-fumarate added), TT (Al-fumarate added), or TT (Al-fumarate added-surface)), and two additional mice not receiving any vaccine injections (naive mice) were included in the study as a control group.

[0334] The study lasted for 32 days, and serum was collected for all animals on day 32 post-injection (D32).

[0335] No local reactions were observed at the injection site. All mice gained weight during the first month after immunization, which was consistent with previous studies in Examples 8, 9, and 10.

[0336] Sera were analyzed for full length antibody (Ab) responses using an anti-mouse light chain Elisa and for IgG Ab responses using an anti-mouse IgG specific Elisa. Elisa was performed according to the manufacturer's instructions (Alpha Diagnostics International).

[0337] Readings were recorded at two wavelengths, 450 nm and 630 nm, to correct for plaque background differences. Sera were tested at 1:1000 for Ig and IgG detection.

[0338] Each kit contained a reference curve of calibrated samples that allowed results to be expressed in kU / mL of Ab.

[0339] IgG Ab response was observed in TT, TT(Alhydrogel (登録商標) The IgG levels obtained using TT (Al-fumarate added), TT (Al-fumarate added), or TT (Al-fumarate added-surface) were evaluated ( FIG. 14 ). Consistent with the studies in Examples 8 and 9, IgG levels obtained using TT (Al-fumarate added) were significantly higher than those obtained using TT (Alhydrogel (登録商標) The IgG levels obtained with TT (Al-fumarate-added-surface) were significantly higher than those obtained with TT (Al-fumarate-added) and with TT without adjuvant. The IgG levels obtained with TT (Al-fumarate-added-surface) were lower than those obtained with TT (Al-fumarate-added) and were significantly higher than those obtained with the reference adjuvant TT (Alhydrogel (登録商標) The levels were similar to those obtained using 100% ethanol (additional).

[0340] Example 13 In vitro absorption characteristics of Al-fumarate: Studies in serum and plasma This study was carried out by investigating the dissolution of MOFs in serum and plasma.

[0341] More precisely, 8.76 mg of Al-fumarate was dispersed in 1.7 mL of either serum or plasma and incubated at 37° C. with two-dimensional continuous stirring (60×60 rpm) for one month. At the end of one month, Al-fumarate was collected by centrifugation (12000 g, 20 min) and the supernatant (serum or plasma) was analyzed for Al by ICP-OES. 3+ It was taken for content measurement.

[0342] Al of the supernatant 3+ -ICP-OES analysis showed that 25.1 wt% and 24.0 wt% of the loaded Al-fumarate was degraded in serum and plasma, respectively, after one month, as detailed in Table 8 below.

[0343] [Table 8]

[0344] Example 14 Assessment of the absorption characteristics of Al-fumarate in vivo The absorption characteristics of the TT (Al-fumarate-added) formulation show that Al remains at the injection site (right limb) and in the blood circulation of mice. 3+ The amount of non-absorbable TT (Alhydrogel) was evaluated by quantifying the amount of (登録商標) The absorption characteristics of the 10-mg / kg 2-sodium phosphate buffer solution were compared with those of the 10-

[0345] Al (from the two adjuvants) at the injection site (right leg) and in the blood circulation of mice 3+ The presence of .ALPHA. was investigated by ICP-OES. The left limbs for all samples, as well as both limbs of all mice injected with TT alone and both limbs of naive mice, were also analyzed by ICP-OES as negative controls.

[0346] Digestion procedure for limb samples: All limb samples were removed from their storage media (PFA 4% in HEPES buffer (20 mM pH 7.4) or absolute ethanol (EtOH abs.) or HEPES buffer (20 mM pH 7.4)) and dehydrated at 100°C for 5 h before processing. After dehydration, the limbs were predigested with 2.5 mL HNO3 (70%, analytical grade) for 3 days at room temperature (RT), followed by exhaustive digestion at 50°C for 3 h. For ICP analysis, all digested samples were diluted with milliQ H2O to a final volume of 20 mL. A calibration curve of Al from 50 to 5,000 ppb was used for the analysis.

[0347] Blood sample digestion procedure: All blood samples were dehydrated at 100°C for 5 h before processing. After dehydration, the blood samples were predigested with 300 μL HNO3 (70%, analytical grade) at room temperature (RT) for 3 days, followed by exhaustive digestion at 50°C for 3 h. For ICP-OES analysis, all digested samples were diluted to a final volume of 5 mL with milliQ H2O. A calibration curve of Al from 50 to 5,000 ppb was used for the analysis.

[0348] 15 and 16 show the results of the TT (Al-fumarate added) group and the TT (Alhydrogel (登録商標) Al quantified by ICP-OES from digested right limbs of mice in the (added) group. 3+ amount of Al remaining at the injection site 3+ The percentages shown are by weight. For both adjuvants, the percentage of injected Al at day 7 was 3+ Only less than half of the amount (approximately 9 μg) remained at the injection site. However, from day 14 onwards, a gradual decomposition of aluminium from TT(Al-fumarate added) could be observed, whereas TT(Alhydrogel (登録商標) The aluminum from the added aluminum is detected as Al 3+ At day 60, TT (Alhydrogel) was administered to 100 subjects, as indicated by the unchanged amount of (登録商標)Mice injected with TT (added with Al-fumarate) received 3.6 times more Al than mice injected with TT (added with Al-fumarate). 3+ The half-life of aluminum from TT(with Al-fumarate) was in the range of 25 days, while aluminum from TT(with Alhydrogel) was fairly constant, showing an apparent half-life of over 220 days. This study supports the absorption characteristics of the TT(with Al-fumarate) formulation.

[0349] TT (Al-fumarate added) and TT (Alhydrogel (登録商標) In the left limb of mice injected with Al (addition), 3+ was not detected.

[0350] Al was observed in both the right and left limbs of TT-injected mice and in both the right and left limbs of naive mice. 3+ was not detected.

[0351] In either mouse group (TT (Al-fumarate added) or TT (Alhydrogel (登録商標) Al was also detected in the blood circulation of mice injected with TT or naïve mice. 3+ was not detected.

[0352] A similar study was performed using a larger injection dose (50 μg aluminum per hind paw). Al at the injection site at 90 days as detected by ICP-OES. 3+ The amount of Al injected into the mice was 100% at day 90. ... 3+ Only 5% of the TT (Alhydrogel) remained at the injection site. (登録商標) Mice injected with 10 times more Al 3 showed.

[0353] [Table 9]

[0354] Example 15 In vivo dynamics of fluorescently labeled TT (with Al-fumarate) To assess the local biodistribution of TT from TT (with Al-fumarate) and its persistence at the injection site, investigations were performed by time-dependent in vivo NIR imaging using TT labeled with a fluorescent probe, i.e., InVivo Tag 680 NHS fluorescent dye (PerkinElmer).

[0355] Preparation of Fluorescent-TT (Al-fumarate added) Fluorescent-TT was prepared by conjugating InVivo Tag 680 XL NHS fluorophore to TT according to the manufacturer's instructions. The absence of free residual dye after Zeba column purification was checked before fluorescent-TT inclusion.

[0356] Desalting and fluorescent dye binding: TT was desalted to NaCl 9:1000 using a 2 mL Zeba Spin column (7k MWCO). The column was washed twice with 1 mL NaCl 9:1000 by centrifugation at 1000g for 3 min. 500 μL TT (2.8 mg / mL) was added in a volume of 170 μL, then 130 μL, and finally loaded with 40 μL NaCl 9:1000, then centrifuged at 1000g for 3 min. NHS fluorescent dye was dissolved in 10 μL DMSO. 4 μL was added to the desalted TT buffered with 50 μL bicarbonate solution from the labeling kit. After 75 min with stirring every 5 min, fluorescent dye-bound TT (fluorescent-TT) was recovered using centrifugation at 1000 g for 3 min after column removal of free fluorescent dye using the kit's purification column previously equilibrated with NaCl 9:1000.

[0357] Protein concentration and fluorescence ratio were determined using absorbance measurements at wavelengths of 280 nm and 668 nm, utilizing the molar extinction coefficient and formula provided by the kit manufacturer. The resulting fluorescent-TT solution was 1 mg / mL (510 Lf / mL, 2040 UI / mL).

[0358] For the preparation of Fluoro-TT (Al-fumarate added), 81.4 μL of a stock solution of Al2(SO4)3·xH2O (700 mg in 10 mL milliQ H2O) was mixed with 81.4 μL of a stock solution of fumaric acid and NaOH (243 mg and 256 mg, respectively, in 10 mL milliQ H2O). A few seconds after mixing the two solutions, 17.64 μL of Fluoro-TT solution (1 mg / mL) was added to the reaction. The final mixture was left under stirring at room temperature for 8 h. The suspension was centrifuged at 10 000 g for 3 min.

[0359] For in vivo studies, the supernatant was then removed and replaced with 450 μL of HEPES buffer (20 mM, pH 7.4).

[0360] For characterization, after centrifugation the resulting powder was dried at 100° C. overnight and the supernatant was collected and analyzed by microBCA assay.

[0361] The formation of Al-fumarate in the presence of fluoro-TT was confirmed by PXRD (Figure 17). The amount of remaining fluoro-TT in the supernatant, quantified using the microBCA protein measurement assay, was found to be negligible, confirming the almost total immobilization of fluoro-TT in Al-fumarate.

[0362] This indicates that Al-fumarate is suitable for immobilization of InVivo Tag 680-labeled TT.

[0363] Fluorescent-TT vaccine was also prepared by adding 432 μL of HEPES buffer (20 mM, pH 7.4) to 17.64 μL of fluorescent-TT solution.

[0364] Both formulations were stored at 4 °C in the dark for approximately 6 days until in vivo studies.

[0365] In vivo assessment of the presence of fluorescent-TT (Al-fumarate added) at the injection site Seven-week-old Balb / cByJ female mice weighing approximately 19 g were immunized by intramuscular injection into the right hind leg with 50 μL of either Fluor-TT or Fluor-TT (with Al-fumarate).

[0366] The formulation was prepared such that all mice were injected with 4 IU (1.96 μg) of fluorescein-TT.

[0367] For both Fluorescent-TT and Fluorescent-TT (with Al-fumarate) formulations, three mice were used per group, and naive mice were also included in the study for background evaluation.

[0368] Fluorescence acquisition was performed with a Perkin Elmer optical imaging system IVIS Spectrum. Two-dimensional (2D) fluorescence imaging was performed by sensitive detection of light emitted by a fluorescent dye (VivoTag680 dye in this study). In vivo fluorescence acquisition was performed on mice anesthetized with a mixture of isoflurane and oxygen as carrier gas. During in vivo acquisition, the animals were placed on their left side (to acquire the fluorescent signal emanating from the injection site).

[0369] The parameters for in vivo fluorescence imaging are described below: Field of View (FOV): 14 x 14 cm (FOV C) Fluorescent labeling: InVivo Tag 680XL Excitation wavelength: 640nm Emission wavelength: 720nm Exposure Time: Automatic Min Count: 6000 Binning: 16 to 4 (automatically adjusted according to the intensity of the fluorescent signal) F / STOP:2 Subject height: 1.5cm

[0370] Fluorescence signals were assessed at various time points after injection, as indicated on the horizontal axis of FIG.

[0371] Quantification: To calculate the fluorescence signal, a region of interest (ROI) was placed on the right hind paw of the mouse. The total radiance efficiency (unit: p / s / (μW / cm2)) corresponding to the fluorescence signal was calculated. 2 )) were obtained for each ROI at each time point.

[0372] If a second fluorescence acquisition was performed, the total radiance efficiency was calculated on the second image.

[0373] The obtained total radiance efficiency signal was compared to the average background reference signal including its standard deviation (BKG+3SD). This reference signal (background radiance efficiency level, i.e. BKG radiance efficiency) corresponds to the autofluorescence of the mice and the noise emitted by the camera of the optical imaging system. The reference signal was calculated in BKG mice (group C) according to the following formula: BKG レベル =Average BKG シグナル(全取得) +3*BKG 標準偏差(全取得)

[0374] Any fluorescent signal higher than the BKG radiance efficiency was considered to be emitted by the injected formulation.

[0375] The fluorescence signal (total radiance efficiency) of each mouse was calculated. A reference autofluorescence signal was measured in a shaved area of ​​the thigh of a control mouse.

[0376] Strong quenching of the fluorescent signal within the MOF was observed, with the fluorescent-TT (with Al-fumarate) signal being half that of free fluorescent-TT, consistent with complete entrapment of fluorescent-TT within Al-fumarate.

[0377] The radiance signal was normalized to 100% based on the value measured at t = 0. Multiple Log10 in the radiance signal from Fluor-TT (Al-fumarate added) and control background allowed for long-term studies up to 4 weeks.

[0378] As shown in FIG. 18, a slower decay in fluorescence radiance at the injection site was observed in mice injected with Fluorescent-TT (with Al-fumarate) than with Fluorescent-TT alone.

[0379] The 50% fluorescence level was observed after approximately 60 hours for fluor-TT alone and almost three times longer for fluor-TT (with Al-fumarate), ie, after approximately 168 hours.

[0380] Immobilization of antigens with Al-MOF, especially TT on Al-fumarate, results in a slower release of the antigen at the injection site than without the MOF.

[0381] Example 16 Evaluation of in vivo toxicity of TT (with Al-fumarate) As shown in the previous examples (Example 8, Example 9, Example 10, and Example 12), when mice were injected with 20 μL of TT (with Al-fumarate) at a concentration of C1, i.e., 1.6 IU of TT and 20 μg of Al, 3+ When injected with , all mice gained weight over the course of the study (Figure 8), indicating the absence of acute toxicity.

[0382] To further evaluate the in vivo toxicity of the TT (Al-fumarate) formulation, a higher dose (100-fold higher) was injected per mouse and toxicity was assessed through the evolution of mouse body weight, aluminum content in potential storage organs measured by ICP-OES, and histological analysis of these organs.

[0383] Seven-week-old Balb / cByJ female mice weighing approximately 21 g were immunized with 50 μL of TT (with Al-fumarate) (see Example 6) at concentration M1 by intramuscular injection into both hind legs and 100 μL by subcutaneous (SC) injection into the right flank. Thus, the mice were injected with a total of 200 μg of Al and 16 IU of TT.

[0384] Euthanasia was performed on day 7 (1 mouse), as well as days 32 (2 mice), 60 (2 mice), and 90 (2 mice) after injection.

[0385] All mice gained weight for several months after immunization, confirming the absence of acute toxicity.

[0386] Uninjected naive mice were used for ICP background check and normal histological appearance of tissues, and euthanasia was performed on days 7, 60, and 90.

[0387] Organs of interest (spleen, liver) were removed and fixed in PFA 4% in HEPES buffer (20 mM pH 7.4) for ICP analysis or in fixative AFA (alcohol formalin acetic acid) for histological evaluation.

[0388] Al at 60 and 90 days after injection into the spleen and liver 3+ The amount of was analyzed by ICP-OES.

[0389] Organ digestion procedure: All organs were removed from their storage medium (PFA 4% in HEPES buffer (20 mM pH 7.4)) and dehydrated at 100°C for 5 h before processing. After dehydration, the organs were predigested with 2.5 mL HNO3 (70%, analytical grade) for 3 days at room temperature (RT), followed by exhaustive digestion at 50°C for 3 h. For ICP analysis, all digested samples were diluted with milliQ H2O to a final volume of 20 mL.

[0390] The histological appearance of tissues 7 days after injection into the spleen and liver were examined. The kidneys of mice injected with 50 μL of AI and naive mice were also examined 35 days after injection.

[0391] For histological analysis, tissues were fixed in AFA for at least overnight and up to 4 days. Fixed organs were then embedded in paraffin after dehydration in successive baths of ethanol, acetone, and xylene. Each organ was cut into 5 μM sections, made every 100 μm, using a microtome and glued onto untreated delipidated slides using albuminized glycerin. After paraffin removal, the sections were routinely stained with HES stain (hematoxylin, eosin G, and safranin). The sections were imaged using a light microscope (Leica DM2000) connected to a digital camera (Leica DF420C) driven by image acquisition software (LAS V4.2).

[0392] As can be seen from Table 10 below, Al was detected in the spleen and liver at 60 and 90 days after injection. 3+ The amount of aluminium was negligible, less than 0.6% by weight of the injected dose, indicating that no accumulation of aluminium in possible storage organs had occurred.

[0393] [Table 10]

[0394] Images of HES stained sections from liver and spleen 7 days after injection (200 μg Al) and kidney 35 days after injection (50 μg Al) did not show any abnormal appearance on the tissue sections ( FIG. 19 ). In particular, neither cellular infiltrates nor abnormal cell morphology were observed. The histological appearance was sufficiently similar to naive healthy mouse tissue. Kidney tissue sections did not show any glomerular or tubular pathology.

[0395] The study highlights the lack of acute toxicity and the absence of aluminum storage in the organisms and preserved tissues.

[0396] Example 17 Evaluation of the role of aluminum in the immunogenicity of TT (with aluminum fumarate) To demonstrate the relevance of aluminum, Al-fumarate was compared with a zinc imidazolate MOF, ZIF-8 (ZIF = zeolitic imidazolate structure), to determine the in vivo tetanus toxoid immunogenicity potency. (efficiency) were compared from the standpoint of:

[0397] Preparation of TT (ZIF-8 added) TT was immobilized in ZIF-8. A stock solution of 3 mol / L 2-methylimidazole and 1 mol / L zinc acetate was prepared. 426.5 μL of 2-methylimidazole stock solution, 10.4 μL of milliQ H2O, and 23.1 μL of tetanus toxoid solution (TT, 2.8 mg / mL, 1428 Lf / mL, 5712 UI / mL) were mixed and vortexed for 10 seconds. Then, 40 μL of zinc acetate stock solution was added. The mixture was vortexed for 30 seconds and then left to stir at room temperature for 1 hour.

[0398] As a control experiment, 23.1 μL of milliQ H2O was added instead of the TT solution.

[0399] For in vivo studies, the supernatant was then removed and replaced with 1650 μL of HEPES buffer (20 mM, pH 7.4).

[0400] For characterization, after centrifugation, the resulting powder was dried at 100° C. overnight.

[0401] The calculated PXRD pattern of ZIF-8 was obtained from CCDC; accession number: 602542, database identifier: VELVOY.

[0402] The PXRD patterns (FIG. 20) confirmed the formation of ZIF-8 with and without TT.

[0403] In vivo evaluation of immune responses triggered by Al-based or Zn-based adjuvants Seven-week-old Balb / cByJ female mice weighing approximately 19 g were immunized by intramuscular injection into the right hind leg with 20 μL of either TT, TT (with Al-fumarate), or TT (with ZIF-8).

[0404] TT vaccine and TT (Al-fumarate added) vaccine were prepared at C1 concentration according to the same protocol as in Example 6.

[0405] All vaccines were prepared aiming to contain 1.6 IU TT / 20 μL injected. The metal content of TT (with Al-fumarate) and TT (with ZIF-8) was confirmed by ICP-OES. Mineralization procedure for ICP-OES: 200 μL of each vaccine was heated at 100° C. for 16 h before processing. 1 mL of HCl (1M) was added to all dried products, which were then heated at 80° C. for 16 h in a closed container. After complete mineralization of the samples, they were diluted to 5 mL with milliQ H2O for ICP-OES analysis. Samples were not filtered before injection.

[0406] As shown in Table 11 below, the two vaccines exhibited similar metal contents.

[0407] [Table 11]

[0408] For each formulation (TT, TT (with Al-fumarate), or TT (with ZIF-8)), six mice were used per group, and two additional mice that did not receive any vaccine injections (naive mice) were included in the study as a control group.

[0409] The study lasted for 30 days, and serum was collected from all animals 30 days (30D) after injection.

[0410] No local reactions were observed at the injection site. All mice gained weight within one month after immunization.

[0411] Sera were analyzed for full Ig antibody (Ab) responses using an anti-mouse light chain Elisa. The Elisa was performed according to the manufacturer's instructions (Alpha Diagnostics International). Readings were recorded at two wavelengths, 450 nm and 630 nm, to correct for plate background differences. Sera were tested at 1:1000 for Ig detection.

[0412] Each kit included a reference curve of calibrated samples that allowed for normalization of interplate differences or for results to be expressed in kU / mL of Ab.

[0413] Ig Ab responses were assessed using TT, TT (with Al-fumarate), or TT (with ZIF-8) (Figure 21). The difference in Ig levels between TT and TT (with Al-fumarate) is consistent with previous studies (Example 12), where much higher Ig levels were obtained using TT (with Al-fumarate). The Ig levels obtained using TT (with ZIF-8) were negligible, demonstrating the absence of immunization.

[0414] This study shows that ZIF-8 is not suitable for immobilization of all antigens, especially TT.

[0415] Example 18 Immobilization of formaldehyde-inactivated Escherichia coli in Al-fumarate Wild uropathogenic E. coli strains without antibiotic resistance were isolated from uropathogens on CPSO agar. Several E. coli colonies were picked and resuspended in PBS buffer (0.150 mM, 7.4) containing 1% aqueous solution of 37% formaldehyde, 1% BSA. The inactivated E. coli suspension was stored at approximately 4°C until use.

[0416] Prior to immobilization, the inactivated E. coli suspension was washed twice with NaCl 0.9% (2400 g, 5 min). The resulting suspension contained 9–10 × 10 6 The culture was adjusted to contain bacteria / μL (measured by cytometry, see below).

[0417] Stock solutions of Al2(SO4)3·xH2O (700 mg) in 10 mL of milliQ HO and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL of milliQ HO were prepared. 1360 μL of each of the two stock solutions (aluminum precursor and ligand / base) were mixed. A few seconds after mixing, inactivated bacterial suspension was added to the reaction (105 μL, 9.6 × 10 6 The final mixture was left under stirring at room temperature for 8 hours. The suspension was then centrifuged at 2000 g for 5 minutes and washed twice with NaCl 0.9% solution.

[0418] As a control experiment, the same procedure was carried out as well, but without the addition of bacteria.

[0419] The final products were dried at 100° C. overnight and analyzed using typical characterization techniques (PXRD, TEM) or stored as suspensions at 4° C. for flow cytometry analysis.

[0420] FIG. 22 shows the PXRD patterns of samples obtained with and without formaldehyde-inactivated E. coli, both of which are consistent with the formation of Al-fumarate MOFs.

[0421] Bacterial immobilization was confirmed by TEM images (Figure 23) and TEM-EDS mapping (Figure 24).

[0422] Imaging procedure: Before imaging, the sample was washed twice with H2O to remove NaCl and to avoid its recrystallization on the imaging grid. The sample was diluted to reduce the number of bacteria on the TEM grid. For preparation of the TEM grid, one drop of the sample was placed on a Cu mesh TEM grid (EMC) coated with carbon-Formar. Inactivated bacteria were stained with one drop of 0.1% phosphotungstic acid (EMC). After the grid was dried, the sample was examined using a transmission electron microscope (TEM, Hitachi HT-7700, Japan). Images were taken with a digital camera (Hamamatsu, Japan). STEM-EDS was performed on unstained samples in a Hitachi HT-7700 electron microscope equipped with a Bruker X-ray detector.

[0423] TEM images clearly show the presence of particles around the inactivated bacteria (Figure 23). Unstained STEM-EDS mapping confirmed the presence of Al element homogeneously distributed in the sample (Figure 24).

[0424] Formaldehyde-inactivated E. coli was measured using BD LSR Fortessa (商標) Equipment and Thermo Fisher Attune (商標) Cytpix (商標) True Count in the device (商標) Bacteria were counted using a Becton-Dickinson kit and then analyzed by flow cytometry. Axial and side scatter were analyzed on both instruments. Direct video imaging was performed using a Thermo Fisher Attune for SYTO 9 fluorophores to detect bacteria and / or bacterial DNA gated based on scatter. (商標) Cytpix (商標) This was carried out using

[0425] Bacteria were analyzed in three conditions: without MOF, encapsulated in MOF, and after dissolution of MOF after incubating 500 μL of the suspension in 2 mL of 100 mM EDTA, 10 mM PBS (pH 7.4) for 3 days.

[0426] As shown in FIG. 25, the encapsulated bacteria exhibited a different scattering profile than the non-encapsulated bacteria, suggesting that the MOF matrix coated the bacteria.

[0427] On the other hand, bacteria released from dissolved MOFs showed the same scattering profile as unencapsulated bacteria, indicating that the bacteria were released without morphological damage. (商標) Cytpix (商標) This was further supported by the similar image appearance of unencapsulated and released bacteria under direct imaging in a Thermo Fisher instrument.

[0428] This study highlights that Al-fumarate is suitable for immobilizing inactivated bacteria, especially inactivated E. coli, while preserving their morphological appearance.

[0429] Example 19 Al-Fumarate or Alhydrogel (登録商標) Preparation of a formaldehyde-inactivated Escherichia coli antigen vaccine composition comprising: Wild uropathogenic E. coli strains without antibiotic resistance were isolated from uropathogens on CPSO agar. One E. coli colony was plated on TSA agar. Bulk bacterial culture plates were harvested and resuspended by pouring over 1% aqueous solution of 37% formaldehyde, 1% BSA in PBS buffer (0.150 mM, 7.4). Inactivated E. coli suspensions were stored at approximately 4°C until use.

[0430] Prior to immobilization, the inactivated E. coli suspension was washed twice with NaCl 0.9% (2400 g, 5 min). The resulting suspension contained approximately 7–8 × 10 6 The plate was adjusted to contain bacteria / μL (measured by cytometry).

[0431] All solutions used (reactants, buffers, and MilliQ solutions) were sterilized before use using syringe filters with 0.2 μm pore size membranes, except for the bacterial suspensions, which were sterilized by formaldehyde fixation.

[0432] Immobilization of inactivated E. coli antigens in Al-fumarate (E. coli (Al-fumarate added)) To prepare the inactivated E. coli (with Al-fumarate) vaccine, 362 μL of each solution (metal salt and ligand / base) was mixed. A few seconds after mixing the two solutions, 28 μL of the inactivated E. coli suspension (approximately 7.5×10 6 bacteria / μL) was added to the reaction. The final mixture was left stirring at room temperature for 8 hours. The suspension was then centrifuged at 2400 g for 5 minutes, the supernatant was removed and replaced with 1000 μL of HEPES buffer (20 mM, pH 7.4).

[0433] The inactivated E. coli (Al-fumarate) vaccine was stored at 4°C for approximately 7 days prior to in vivo studies.

[0434] Immobilization of inactivated Escherichia coli antigens in alhydrogel. Alhydrogel (登録商標) For the adjuvanted vaccines, adjuvant 2% was purchased from InvivoGen and used directly in the preparation of the vaccine.

[0435] 28 μL of inactivated E. coli suspension (approximately 7.5 × 10 6 bacteria / μL) was diluted in 583 μL of PBS buffer (10 mM, pH 7.4) followed by 194 μL of Alhydrogel. (登録商標) The suspension was added.

[0436] The mixture was pipetted up and down for 5 minutes to allow antigen adsorption, and finally, 196 μL of PBS buffer was added.

[0437] Inactivated E. coli (Alhydrogel (登録商標) The vaccine was stored at 4°C for approximately 7 days until in vivo studies.

[0438] Aluminum content of E. coli vaccine Inactivated E. coli (Al-fumarate added) vaccine and inactivated E. coli (Alhydrogel (登録商標) Additive) Vaccine Al 3+ The content was investigated by ICP-OES.

[0439] Mineralization procedure for ICP-OES: 200 μL of inactivated E. coli (with Al-fumarate) vaccine and inactivated E. coli (with Alhydrogel) (登録商標) The vaccine (spiked) was heated at 100°C for 16 hours before processing. 1 mL of HCl (37%) was added to all dried products, which were then heated at 80°C for 16 hours in a closed container. After complete mineralization of the samples, they were diluted to 5 mL with milliQ H2O for ICP-OES analysis. The samples were not filtered before injection into the instrument and were run in duplicate.

[0440] Table 12 below shows the Al content of inactivated E. coli vaccines quantified by ICP-OES. 3+ The contents are shown in the table. As can be seen from the table, the inactivated E. coli (with Al-fumarate) vaccine and the inactivated E. coli (with Alhydrogel) vaccine (登録商標) Both vaccines had relatively similar aluminum contents.

[0441] [Table 12]

[0442] Inactivated E. coli antigen without adjuvant For the inactivated E. coli vaccine, 28 μL of inactivated E. coli suspension (approximately 7.5 × 106 The inactivated E. coli vaccine was stored at 4°C for approximately 7 days prior to in vivo studies.

[0443] Example 20 Example 19. Evaluation of in vivo immune responses to the vaccine Seven-week-old Balb / cByJ female mice weighing approximately 20 g were fed either inactivated E. coli, inactivated E. coli (with Al-fumarate), or inactivated E. coli (with Al-hydrogel). (登録商標) Each subject was immunized by intramuscular injection of 50 μL of either the immunized mouse or mouse strain into the right hind leg.

[0444] As described in Example 19, each vaccine was adjuvanted with Al-fumarate and Alhydrogel. (登録商標) Both adjuvants were formulated to contain similar amounts of bacteria at a constant Al ratio.

[0445] Each preparation (inactivated E. coli, inactivated E. coli (with Al-fumarate), or inactivated E. coli (with Alhydrogel) (登録商標) For the immunization group, 10 mice were used per group, and 3 additional mice that did not receive any vaccine injections (naive mice) were included in the study as a control group.

[0446] Euthanasia was performed on half of the mice (n=5) on day 21 post-injection (D21) and on the remaining mice (n=5) on day 42 post-injection (D42). One naive mouse was sacrificed on day 21 and two naive mice were sacrificed on day 42 post-injection.

[0447] On day 21 post-injection, the remaining mice in each group received an additional 50 μL intramuscular injection into the quadriceps muscle of the right hind leg.

[0448] For one animal per group, at the start of the study (day 0 (D0)), blood was sampled by retro-orbital sinus route using dry capillary tubes, allowed to clot, and then used for serum preparation. For all animals, whole blood was sampled by intracardiac puncture before euthanasia (day 21 (D21) or day 42 (D42)) and used for serum preparation.

[0449] All mice gained weight over a period of 21 or 42 days after immunization.

[0450] Full-length Ig (IgG IgA IgM) in serum was detected using a mouse anti-E. coli ELISA kit (reference 500-100 ECP) ​​from Alpha Diagnostic International. Plates were coated with purified lysates of E. coli strains TOP10, K12, DH5α, BL21, HB101. Sera were diluted 1:1000 and tested according to the manufacturer's instructions.

[0451] Among the sera on day 21 (D21) (Figure 26a), all five mice injected with inactivated E. coli (with Al-fumarate) showed strong Ig responses, whereas only 16 mice injected with inactivated E. coli (with Al-hydrogel) showed strong Ig responses. (登録商標) Ig levels in mice injected with E. coli (added with Al-fumarate) or inactivated E. coli without adjuvant remained low, with ratio indexes of 16.9 and 1.6 for inactivated E. coli (added with Al-fumarate), respectively. The smaller ratio was due to atypical mice in the no-adjuvant group, which showed a higher Ig response and 2.7-fold higher pre-immune levels than the other non-immunized mice, evidence of prior sensitization. Ig levels in the other no-adjuvant mice were higher than those of E. coli (added with Al-hydrogel). (登録商標) The levels remained very low in mice injected with 100 mg / kg / day (additional).

[0452] On day 42 (D42) (FIG. 26b), mice from the inactivated E. coli (with Al-fumarate) group had higher Ig levels than mice from the other groups, i.e., 3-fold higher than without adjuvant and the reference Alhydrogel. (登録商標) This was 1.63-fold higher than when adjuvant was used.

[0453] This study demonstrated that Al-fumarate is suitable for immobilizing inactivated bacteria while preserving their immunogenic potential, and acts as an adjuvant to enhance the immunogenicity of naked inactivated bacteria and even the reference Alhydrogel. (登録商標) It is emphasized that, compared to adjuvants, it results in an enhanced immune response.

[0454] Example 21 Fixation of inactivated poliovirus in Al-fumarate (Inactivated poliovirus (with Al-fumarate)) IMOVAX from Sanofi Pasteur (登録商標) POLIO vaccine was used as the source of inactivated poliomyelitis virus. One dose (0.5 mL) contains the following inactivated poliomyelitis viruses: type 1 (Mahoney strain produced in VERO cells) 40 D antigenic units (DU), type 2 (MEF-1 strain produced in VERO cells) 8 DU, type 3 (Saukett strain produced in VERO cells) 32 DU.

[0455] Stock solutions of Al2(SO4)3·xH2O (700 mg) in 10 mL of milliQ HO and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL of milliQ HO were prepared. 1554 μL of each of the two stock solutions (aluminum precursor and ligand / base) were mixed. After a few seconds of mixing, IMOVAX (登録商標) POLIO solution was added to the reaction (120 μL). The final mixture was left stirring at room temperature for 8 hours. The product (inactivated polyomyelite (Al-fumarate added)) was collected by centrifugation (10000 g, 3 min).

[0456] The same procedure is also used for IMOVAX (登録商標) A control experiment (Al-fumarate) was performed by adding 120 μL of H2O instead of the POLIO solution.

[0457] The final product was dried at 100° C. overnight and analyzed using PXRD characterization technique (FIG. 27).

[0458] The supernatant was collected and the amount of protein remaining in solution (not adsorbed) was quantified by the microBCA protein measurement assay (Figure 28). As a control for the microBCA protein measurement assay, 120 μL of IMOVAX (登録商標) POLIO solution was used.

[0459] The resulting PXRD pattern is consistent with the formation of Al-fumarate in the presence of inactivated poliovirus (Figure 27).

[0460] Al-fumarate according to the invention showed the capacity to immobilize more than 50% of the introduced inactivated poliovirus suspension based on the quantification of the remaining protein in the synthetic supernatant by the microBCA assay (FIG. 28).

[0461] This study demonstrated that Al-fumarate inhibits the activity of inactivated viruses, particularly IMOVAX. (登録商標) It is emphasized that the inactivated poliomyelitis virus derived from the POLIO vaccine is suitable for immobilizing

[0462] Example 22 Immobilization of glycans on Al-fumarate (Glycan (Al-fumarate added)) PNEUMOVAX from MSD (登録商標) The vaccine was used as a source of pneumococcal capsular polyosides. Each dose (0.5 mL) contained 25 μg of each of the 23 pneumococcal polysaccharide serotypes (1, 2, 3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19F, 19A, 20, 22F, 23F, and 33F).

[0463] Before use, the vaccine solution was lyophilized. Samples were immersed in liquid nitrogen for a few minutes and then lyophilized for 24 hours. The resulting powder was dissolved in 50 μL of MilliQ H2O.

[0464] Stock solutions of Al2(SO4)3·xH2O (700 mg) in 10 mL of milliQ H2O and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL of milliQ H2O were prepared. 653 μL of the two stock solutions (aluminum precursor and ligand / base) were mixed. A few seconds after mixing, 50 μL of glycan solution (25 μg / 50 μL each) was added to the reaction. The final mixture was left under stirring at room temperature for 8 h. The product (glycan (Al-fumarate added)) was collected by centrifugation (10000 g, 3 min).

[0465] The same procedure was also performed as a control experiment (Al-fumarate) by adding 50 μL of H2O instead of the glycan solution.

[0466] The final product was dried overnight at 100° C. and analyzed by PXRD (FIG. 29) and 13 The powder was analyzed using C NMR spectroscopy (Figure 30). PXRD was measured on a Bruker D8 Advance diffractometer with Debye-Scherrer geometry equipped with a Ge(111) monochromator selecting Cu Kα1 radiation (λ=1.540598 Å) and a LynxEye detector. The powder was packed into a glass capillary. 13 C NMR (RMN in French) spectrum, 13 The spectra were recorded on an Advance Bruker 500 MHz NMR spectrometer operating in a static magnetic field of 11.7 T, corresponding to a C Larmor frequency of 126 MHz. 13 C{1H}CPMAS spectra were acquired at 20 kHz with 5 × 0.5 millisecond (ms) contact times.

[0467] The PXRD pattern showed that Al-fumarate was formed in the presence of glycan (Figure 29).

[0468] 13 The C NMR spectrum (Figure 30) shows that the glycan (with Al-fumarate) sample contained the Csp 3 The results showed the presence of features (δ ∼ 71 ppm) that were not present in the Al-fumarate sample. These results confirm the presence of glycans in the MOF powder and indicate their immobilization.

[0469] This study demonstrated that Al-fumarate inhibits the activity of glycans, particularly PNEUMOVAX. (登録商標) It is emphasized that the glycans derived from the vaccine are suitable for immobilization.

[0470] Example 23 Immobilization of nucleic acid (CpG1018) in Al-fumarate (CpG1018 (Al-fumarate added)) CpG1018 (phosphorothioate oligonucleotide, 22 bases long, sequence: TGACTGTGAACGTTCGAGATGA (in powder form, used directly without further purification), modification: all bases) was obtained from Proteogenix.

[0471] 1051.83 μg of CpG1018 was dissolved in 35 μL of MilliQ H2O.

[0472] Stock solutions of Al2(SO4)3·xH2O (700 mg) in 10 mL of milliQ H2O and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL of milliQ H2O were prepared. 136 μL of the two stock solutions (aluminum precursor and ligand / base) were mixed. A few seconds after mixing, the CpG solution was added to the reaction (10 μL, 30 μg / μL). The final mixture was left stirring at room temperature for 8 h. The product was collected by centrifugation (10000 g, 5 min).

[0473] As a control experiment, the same procedure was also performed adding 10 μL of H2O instead of the CpG solution.

[0474] The final product was dried at 50° C. for 8 hours and analyzed using PXRD technique, and the supernatant was harvested to quantify the amount of CpG 1018 (not immobilized) remaining in solution.

[0475] Since CpG 1018 contains phosphorus (P) element, but Al-fumarate does not contain any P element, the immobilization of CpG was investigated by ICP-OES.

[0476] Mineralization procedure for ICP-OES: All samples were heated at 50° C. for 8 h before processing. 300 μL of HCl (37%) was added to all dried products, which were then heated at 80° C. for 16 h in a closed vessel. After complete mineralization of the samples, they were diluted to 5 mL with milliQ H2O for ICP-OES analysis. The samples were not filtered before injection.

[0477] As can be seen from FIG. 31, the PXRD pattern indicated that Al-fumarate was formed in the presence of CpG 1018.

[0478] Table 13 below shows the P content of the Al-fumarate and CpG1018 (Al-fumarate spiked) samples and their respective supernatants as detected by ICP-OES.

[0479] [Table 13]

[0480] Negligible amounts of P were detected in the Al-fumarate samples and their supernatants, confirming the absence of elemental P in Al-fumarate.

[0481] P element was found to be negligible in the supernatant of CpG1018 (with Al-fumarate), suggesting the absence of CpG 1018, whereas P element was detected in the CpG1018 (with Al-fumarate) sample, indicating the immobilization of CpG 1018 by Al-fumarate.

[0482] This study highlights that Al-fumarate is suitable for immobilizing nucleic acids, especially CpG 1018.

[0483] Example 24 Immobilization of both nucleic acid (CpG1018) and tetanus toxoid in Al-fumarate (CpG1018 (Al-fumarate added)) CpG1018 (phosphorothioate oligonucleotide, 22 bases long, sequence: TGACTGTGAACGTTCGAGATGA, modification: all bases) was obtained from Proteogenix in powder form and used directly without further purification.

[0484] 1051.83 μg of CpG 1018 was dissolved in 35 μL of MilliQ H2O.

[0485] Tetanus toxoid (TT) solution of 2.8 mg / mL purchased from Creative Biolabs was used directly.

[0486] Stock solutions of Al2(SO4)3·xH2O (700 mg) in 10 mL of milliQ H2O and fumaric acid (243 mg) / NaOH (256 mg) in 10 mL of milliQ H2O were prepared. 136 μL of the two stock solutions (aluminum precursor and ligand / base) were mixed. A few seconds after mixing, 10 μL of CpG 1018 solution (30 μg / μL) and 10 μL of TT solution (2.8 mg / mL) were added to the reaction. The final mixture was left stirring at room temperature for 8 hours. The product (CpG1018+TT (with Al-fumarate)) was collected by centrifugation (10000 g, 5 min).

[0487] As control experiments, the same procedure was also performed by adding 20 μL of H2O instead of the CpG solution and the TT solution (Al-fumarate), and by adding only 10 μL of TT solution (TT (Al-fumarate added)).

[0488] The final product was dried at 50°C for 8 hours, analysed using PXRD and the supernatant was harvested to quantify the amount of CpG 1018 and TT (not immobilised) remaining in solution.

[0489] The amount of immobilized TT was investigated by quantifying the amount of remaining TT (unadsorbed) in the supernatant by microBCA protein measurement assay.

[0490] Since CpG contains P element, the immobilization of CpG was investigated by ICP-OES.

[0491] Mineralization procedure for ICP-OES: All samples were heated at 50° C. for 8 h before processing. 300 μL of HCl (37%) was added to all dried products, which were then heated at 80° C. for 16 h in a closed vessel. After complete mineralization of the samples, they were diluted to 5 mL with milliQ H2O for ICP-OES analysis. The samples were not filtered before injection.

[0492] As can be seen from FIG. 32, the PXRD pattern showed that Al-fumarate was formed in the simultaneous presence of CpG 1018 and TT.

[0493] Quantification of the amount of remaining TT (unadsorbed) in the supernatant by microBCA protein measurement assay revealed that the amount of immobilized TT in CpG1018+TT (with Al-fumarate) was more than 78% of the introduced TT.

[0494] Table 14 below shows the P content of the Al-fumarate sample, the TT (Al-fumarate added) sample, and the CpG1018+TT (Al-fumarate added) sample and their respective supernatants.

[0495] P elements were only detected in the CpG1018+TT (Al-fumarate added) and TT (Al-fumarate added) samples. The amount of P elements detected in the TT (Al-fumarate added) sample was very small compared with the amount of P elements detected in the CpG1018+TT (Al-fumarate added) sample. This indicated that the P elements detected in the CpG1018+TT (Al-fumarate added) sample were mainly due to the presence of CpG1018.

[0496] These results indicate that CpG 1018 was immobilized by Al-fumarate in the presence of TT.

[0497] [Table 14]

[0498] This study highlights that Al-fumarate is suitable for jointly immobilizing nucleic acids and proteins, in particular CpG1018 and tetanus toxoid.

[0499] Example 25 Immobilization of biomolecules in Al-muconate For the synthesis of BSA (Al-muconate), 700 mg of Al2(SO4)3·xH2O (x is approximately 18) was dissolved in 10 mL of milliQ H2O. A separate solution containing 297 mg of muconic acid (trans,trans-1,3-butadiene-1,4-dicarboxylic acid) and 256 mg of NaOH in 10 mL of milliQ H2O was prepared and added to the metal salt solution. 200 μL of BSA (0.15 mg / μL) was immediately added to the mixture, and the mixture was left under stirring at room temperature under atmospheric pressure for 20 h.

[0500] A control experiment was performed by adding 200 μL of milliQ H2O instead of the BSA solution.

[0501] The product was collected by centrifugation (20 min, 21,200 g), washed three times with water, dried at 100° C. overnight, and analyzed using a typical characterization technique (PXRD), as shown in FIG. 33.

[0502] The supernatant was collected and used to quantify the amount of remaining biomolecules (not adsorbed by adjuvant) in solution by the microBCA protein measurement assay. The solution was filtered using a syringe filter with a 0.2 μm pore size PTFE membrane before analysis.

[0503] As shown in FIG. 33, the PXRD patterns indicated the formation of crystalline structures with and without BSA.

[0504] The amount of residual BSA detected in the supernatant was less than 45% of the BSA introduced, indicating an immobilization efficiency of more than 55%.

[0505] This study shows that Al-muconate is suitable for the immobilization of antigens, especially BSA.

[0506] Example 26 Synthesis of Al-furandicarboxylate MOF For the synthesis of Al-furandicarboxylate MOF, 2 mL of HO was added to 324 mg of Al(OH)(CHCOO) and 312 mg of 2,5-furandicarboxylic acid. The mixture was left under stirring at room temperature for 72 h.

[0507] The product was collected by centrifugation (20 min, 21,200 g), washed three times with water, dried at 100° C. overnight, and analyzed using a typical characterization technique (PXRD), as shown in FIG. 34.

[0508] The calculated PXRD pattern of MIL-160(Al)_H2O was obtained from CCDC; accession number: 1828694, database identifier: PIBZOS.

[0509] These characterization results were consistent with the formation of hydrated MIL-160.

[0510] Example 27 Immobilization of biomolecules within Al-trimesate MOF For the synthesis of BSA (Al-trimesate added), 700 mg of Al2(SO4)3·xH2O (x is approximately 18) was dissolved in 20 mL of H2O in a 30 mL vial. Then, 440 mg of trimesic acid (1,3,5-benzenetricarboxylic acid) and 256 mg of NaOH were added to the solution. After a few minutes, 200 μL of BSA (0.15 mg / μL) was added, and the mixture was left stirring at room temperature under atmospheric pressure for 24 h.

[0511] A control experiment was performed without the addition of BSA.

[0512] The product was collected by centrifugation (20 min, 21,200 g), washed three times with water, dried at 100° C. overnight, and analyzed using a typical characterization technique (PXRD), as shown in FIG. 35.

[0513] The supernatant was collected and used to quantify the amount of remaining biomolecules (not adsorbed by adjuvant) in solution by the microBCA protein measurement assay. The solution was filtered using a syringe filter with a 0.2 μm pore size PTFE membrane before analysis.

[0514] Calculated PXRD patterns of MIL-110 and MIL-96 were obtained from the CCDC; accession numbers: 1538658 and 1558833, database identifiers: GAWBUE and WEVYEE, respectively.

[0515] As shown in Figure 35, the PXRD patterns indicated the formation of the MIL-110 construct containing trace amounts of the MIL-96 construct. The constructs were obtained with and without BSA.

[0516] The amount of residual BSA detected in the supernatant was less than 5% of the BSA introduced, indicating an immobilization efficiency of more than 95%.

[0517] This study shows that Al-trimesate is suitable for the immobilization of antigens, especially BSA.

[0518] Example 28 Immobilization of biomolecules in Al-pyromellitate MOFs For the synthesis of BSA (Al-pyromellitate loading), 700 mg of Al2(SO4)3·xH2O (x is approximately 18) was dissolved in 10 mL of milliQ H2O. A separate solution containing 532 mg of pyromellitic acid (1,2,4,5-benzenetetracarboxylic acid) and 384 mg of NaOH in 10 mL of milliQ H2O was prepared and added to the metal salt solution. 200 μL of BSA (0.15 mg / μL) was immediately added to the mixture, and the mixture was left under stirring at room temperature under atmospheric pressure for 24 h.

[0519] The product was collected by centrifugation (20 min, 21200 g), washed three times with water, dried at 100° C. overnight, and analyzed using typical characterization techniques (PXRD, FT-IR, TGA), as shown in FIG. 36.

[0520] The supernatant was harvested and the amount of remaining biomolecules in solution (not adsorbed by adjuvant) was quantified by the microBCA protein measurement assay.

[0521] As shown in FIG. 36, the PXRD pattern indicated the formation of semi-crystalline structures containing BSA.

[0522] The amount of residual BSA detected in the supernatant was less than 10% of the BSA introduced, indicating an immobilization efficiency of more than 90%.

[0523] This study shows that Al-pyromellitate is suitable for the immobilization of antigens, especially BSA.

[0524] result Ig Ab responses and IgG Ab responses were significantly increased with Al-fumarate adjuvant and Alhydrogel. (登録商標) These responses were proportional to the TT and adjuvant concentrations used.

[0525] At all concentrations tested, Al-fumarate was (登録商標) induced a statistically significantly stronger Ab response than

[0526] In conclusion, it was shown that the antigen is completely immobilized in the Al-fumarate according to the invention.

[0527] Furthermore, the antigen does not affect the synthesis and structure of Al-fumarate.

[0528] Furthermore, the Al-fumarate according to the invention is (登録商標) The immobilization with Al-fumarate according to the present invention also showed superior immobilization ability to that of the comparative Alhydrogel. (登録商標) is more stable than the case

[0529] The Al-fumarate according to the invention is stable in the injection medium (HEPES, 20 mM pH 7.4) for at least 2 months.

[0530] The Al-fumarate according to the invention is partially degraded in vitro in serum / plasma under concentrated conditions.

[0531] The Al-fumarate according to the invention is resorbed from the injection site.

[0532] The Al-fumarate according to the invention is suitable for the design of a stable vaccine formulation, which retains its immunogenicity for at least 9 months.

[0533] Formulations containing TT (Al-fumarate-added-surface) have been shown to be stable.

[0534] Immobilization of antigens with Al-MOF, especially TT in Al-fumarate, results in a slower release of antigens at the injection site than without the MOF.

[0535] The absence of acute toxicity and of aluminium storage in the organisms and preserved tissues when TT (with Al-fumarate) was used was highlighted.

[0536] In contrast to the present invention, zinc-based MOFs are not suitable for the immobilization of all antigens.

[0537] The Al-fumarate according to the invention is suitable for immobilizing inactivated bacteria, in particular inactivated E. coli, while preserving their morphological appearance.

[0538] The Al-fumarate according to the invention is suitable for immobilizing inactivated bacteria while preserving their immunogenic potential and acts as an adjuvant, enhancing the immunogenicity of naked inactivated bacteria and also of the reference Alhydrogel. (登録商標) Compared to adjuvants, it results in an enhanced immune response.

[0539] The Al-fumarate according to the invention is capable of inactivating viruses, in particular IMOVAX. (登録商標) Inactivated poliomyelitis virus from POLIO vaccine; glycan, especially PNEUMOVAX (登録商標) It is suitable for immobilization of vaccine-derived glycans; of nucleic acids, in particular CpG1018; and of nucleic acids and proteins in combination, in particular CpG1018 and tetanus toxoid.

[0540] Al-muconate, Al-trimesate and Al-pyromellitate according to the invention are suitable for the immobilization of antigens, in particular BSA.

Claims

1. An immunogenic composition comprising at least one antigen and at least one adjuvant; wherein the adjuvant comprises at least one metal organic framework, i.e. MOF, comprising an inorganic moiety based on aluminum and at least one organic moiety based on a multidentate ligand, the multidentate ligand being selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate; and wherein the antigen is immobilized at least within the metal-organic framework. The immunogenic composition.

2. 2. The immunogenic composition of claim 1, wherein the at least one metal-organic framework is crystallized.

3. 3. The immunogenic composition of claim 1 or 2, wherein the at least one metal-organic framework is porous.

4. 3. The immunogenic composition of claim 1 or 2, wherein the organic moiety of the multidentate metal-organic framework comprises at least one fumarate.

5. The immunogenic composition of claim 1 or 2, wherein the immunogenic composition comprises at least one antigen selected from a protein, a polyoside, a lipid, a nucleic acid, a virus, a bacterium, a parasite, and combinations thereof.

6. The immunogenic composition described in claim 1 or 2, wherein the immunogenic composition comprises at least one antigen selected from tetanus toxoid, a protein derived from the SARS-CoV-2 virus, inactivated Escherichia coli, inactivated poliovirus, and meningococcal polysaccharides, and combinations thereof.

7. The immunogenic composition of claim 1 or 2, wherein the adjuvant is absorbable.

8. 3. The immunogenic composition of claim 1 or 2, further comprising at least one antigen that is not immobilized within the metal-organic framework.

9. The immunogenic composition of claim 1 or 2, administered by oral, topical, transdermal, inhalation, parenteral, sublingual, buccal and / or intranasal routes.

10. The immunogenic composition described in claim 1 or 2, which is administered by mucosal administration, parenteral administration or oral administration.

11. 1. A metal organic framework for use in immobilizing an antigen in a vaccine adjuvant, the metal organic framework comprising an inorganic moiety based on aluminum and an organic moiety based on a multidentate ligand, the multidentate ligand being selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, wherein the antigen is immobilized at least within the metal organic framework.

12. 12. The metal-organic framework of claim 11 , wherein said adjuvant is absorbent.

13. 13. The metal organic framework according to claim 11 or 12, wherein said organic moiety based on a multidentate ligand comprises at least one fumarate.

14. 1. A method of using a metal organic framework to immobilize an antigen in a vaccine adjuvant, the metal organic framework comprising an inorganic moiety based on aluminum and an organic moiety based on a multidentate ligand, the multidentate ligand being selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate, wherein the antigen is immobilized within at least the metal organic framework.

15. 15. The method of claim 14, wherein the adjuvant is absorbable.

16. 16. The method of claim 14 or 15, wherein the organic moiety based on a multidentate ligand comprises at least one fumarate.

17. A method for preparing the immunogenic composition of claim 1 or 2, comprising the steps of: reacting at least one aluminum compound with at least one polycarboxylic acid selected from fumaric acid, muconic acid, mesaconic acid, oxalic acid, oxaloacetic acid, succinic acid, malic acid, citric acid, aconitic acid, isophthalic acid, substituted isophthalic acid, 2,5-thiophenedicarboxylic acid, 2,5-furandicarboxylic acid, trimesic acid, trimellitic acid, or pyromellitic acid, and / or at least one polycarboxylate selected from fumarate, muconate, mesaconate, oxalate, oxaloacetate, succinate, malate, citrate, aconitate, isophthalate, substituted isophthalate, 2,5-thiophenedicarboxylate, 2,5-furandicarboxylate, trimesate, trimellitate, and pyromellitate in the presence of at least one antigen to form at least one Al-polycarboxylate metal-organic framework for immobilizing the antigen; The method comprises at least the steps of:

18. 18. The method of claim 17, wherein the aluminum compound is aluminum sulfate.

19. 18. The method of claim 17, wherein the polycarboxylic acid is at least fumaric acid.

20. The method of claim 17, wherein the reaction is carried out in an aqueous medium.

21. The method of claim 17, wherein the reaction is carried out in an aqueous medium consisting of only water.

22. The method of claim 17, wherein the reaction is carried out in the presence of a base.

23. The method of claim 22, wherein the reaction is carried out in the presence of one alkali metal hydroxide or a mixture of multiple different alkali metal hydroxides.

24. The method of claim 22, wherein the reaction is carried out in the presence of sodium hydroxide.

25. 18. The method of claim 17, wherein the reaction is carried out at a temperature between 4° C. and 75° C.

26. The method of claim 25, wherein the reaction is carried out at a temperature of from 10°C to 45°C.

27. 18. The process according to claim 17, wherein the molar ratio of aluminum compound used for the reaction to polycarboxylic acid and / or polycarboxylate is between 0.001 and 2.

5.

28. The method according to claim 27, wherein the molar ratio of the aluminum compound used for the reaction to the polycarboxylic acid and / or polycarboxylate is from 0.1 to 1.

29. 18. The method of claim 17, further comprising a centrifugation step at the end of the reaction.

30. The method of claim 17, further comprising a centrifugation step at the end of the reaction, and then a redispersion step.

Images