Synthetic Intermembrane Proteolytic Receptors for Custom Antigen-Induced Transcriptional Control

Abstract

The present disclosure generally relates to, among other things, a novel class of receptors engineered to regulate transcriptional regulation in a ligand-dependent manner. In particular, the novel receptors contain a heterologous stop transport sequence and a γ-secretase cleavable transmembrane domain. The present disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding same, host cells genetically modified with the nucleic acids, and methods for regulating the activity of cells and / or for treating various diseases, such as cancer.

Description

[Technical field]

[0001] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. OD025751 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 164,995, filed March 23, 2021, the disclosure of which is incorporated by reference in its entirety, including any drawings.

[0003] Incorporating sequence tables This application contains a Sequence Listing, which is incorporated herein by reference in its entirety. The attached Sequence Listing text file entitled "048536-696001WO_Sequence Listing_ST25.txt" was created on Mar. 18, 2022 and is 307 KB.

[0004] The present disclosure relates generally to novel synthetic cellular receptors that bind cell surface ligands and have selectable specificity and activity. The disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding same, host cells genetically engineered with the nucleic acids, and methods for modulating cellular activity and / or treating various diseases, such as cancer. [Background technology]

[0005] A key issue limiting the development of engineered cell therapy in humans is the ability to control therapeutic gene expression and engineered cell activity. For example, first generation chimeric antigen receptor T cells (CAR-T) are unable to regulate or stop CAR-T activity when needed, and other issues include off-target activity and off-tumor / on-target activity (i.e., CAR-T target antigens are also found on normal cells outside the tumor). One possible solution to these issues is to use synthetic receptors that can modify gene expression and / or cell behavior. Existing synthetic Notch (SynNotch) receptors can bind to user-defined cell surface-displayed ligands, which trigger proteolytic cleavage of the receptor and release transcriptional regulators that induce custom transcriptional programs in the cell. In addition, some existing SynNotch receptors do not require the Notch regulatory region (NRR), which is thought to be necessary for induced cleavage of the receptor.

[0006] The present disclosure provides, inter alia, novel chimeric polypeptides that comprise a novel class of synthetic receptors that do not require sequences derived from a Notch receptor. Summary of the Invention

[0007] This disclosure describes synthetic chimeric polypeptides (e.g., chimeric receptors) that do not require sequences from Notch receptors. In particular, systematic engineering efforts have demonstrated that it is possible to utilize (1) an ADAM protease-cleavable extracellular domain (e.g., a hinge domain from CD8), (2) a γ-secretase-cleavable transmembrane domain (TMD), and (3) a stop-transfer-sequence to rationally construct synthetic regulated intermembrane proteolytic receptors (SynRIPRs). As described in more detail below, these receptors can be used to target various therapeutically relevant cell types to disease sites and control the therapeutic activity of the cells in a controlled and localized manner. These receptors can be coupled to inducible transcriptional programs such that when cells sense a disease site, they locally produce therapeutic agents such as antibodies, cytokines, toxins, and adjuvants. Receptors are highly versatile and programmable platforms for cell engineering, and essentially the production of any genetically encodable therapeutic agent can be controlled by these receptors.

[0008] In some embodiments of the present disclosure, synthetic chimeric receptors are provided that exhibit a variety of signaling properties mediated by the inclusion of heterologous STS and TMD sequences. These receptors provide a variety of sensitivities, including receptors that are sensitive to the degree of T cell activation when expressed in activated T cells. Some embodiments, when expressed in T cells, exhibit higher ligand-induced signaling levels when T cells are activated compared to ligand-induced signaling levels when T cells are not activated.

[0009] In some embodiments, the present disclosure provides, inter alia, a novel class of chimeric receptors that contain a non-Notch transmembrane domain (TMD) that includes at least one γ-secretase site. It is believed that modulation of TMD cleavage can facilitate optimization and / or improvement of the activity of the chimeric receptors disclosed herein, and thus may be particularly useful in modulating cellular activity and / or treating disease. In some embodiments, the chimeric receptors of the present disclosure include non-Notch STS sequences that allow the chimeric receptors disclosed herein to have a wide range of desirable characteristics. For example, by modifying the STS as described herein and selecting different juxtamembrane domains, receptors can be produced that have different noise levels (i.e., basal levels of receptor activation in the absence of a selected target ligand), different signal levels (i.e., expression levels obtained in the presence of a selected target ligand), and different signal:noise ratios.

[0010] In one aspect, provided herein is a chimeric polypeptide comprising, from N-terminus to C-terminus: (a) an extracellular binding domain having binding affinity for a selected ligand; (b) a linking sequence; (c) a transmembrane domain (TMD), the TMD having at least about 80% sequence identity to a transmembrane domain of a type 1 transmembrane receptor, the TMD comprising one or more ligand-inducible proteolytic cleavage sites; and (d) an intracellular domain (ICD) comprising a transcription regulator, wherein binding of a selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcription regulator and the linking sequence; and wherein the chimeric polypeptide does not comprise a sequence from a Notch receptor.

[0011] Non-limiting exemplary embodiments of the chimeric polypeptides provided herein include one or more of the following features: in some embodiments, the chimeric polypeptide further comprises a stop transport sequence (STS) between the TMD and the ICD; in some embodiments, the TMD comprises a polypeptide sequence having at least 80% sequence identity to a transmembrane domain from a type 1 transmembrane receptor and comprises a γ-secretase cleavage site; in some embodiments, the TMD comprises a polypeptide sequence having at least 90% sequence identity to a transmembrane domain from a type 1 transmembrane receptor and comprises a γ-secretase cleavage site; in some embodiments, the TMD comprises a polypeptide sequence having at least 95% sequence identity to a transmembrane domain from a type 1 transmembrane receptor and comprises a γ-secretase cleavage site. In some embodiments, the type 1 transmembrane receptor is CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, IFNAR2, IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCN E3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM, and comprises a gamma-secretase cleavage site. In some embodiments, the type 1 transmembrane receptor is APP, CLSTN1, CLSTN2, EPCAM, KCNE3, NECTIN1, PCDHGC3, and PTPRF. In some embodiments, the chimeric polypeptide provided herein comprises a stop transport sequence (STS), and the STS is heterologous to the TMD.In some embodiments, the STS comprises a sequence having at least 70% sequence identity to an STS sequence from CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRP1B, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, PTPRF, or PTPRM. In some embodiments, the STS comprises a sequence having at least 70% sequence identity to an STS sequence from CSF1R, DAG1, AGER, NRG1, KCNE3, PTPRF, or PTPRM.

[0012] In some embodiments, the extracellular domain comprises an antigen binding portion capable of binding to a ligand on the surface of the cell. In some embodiments, the cell is a pathogenic cell. In some embodiments, the ligand comprises a protein or a carbohydrate. In some embodiments, the ligand comprises CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD150 (PDGFR5), CD160 (PDGFR6), CD170 (PDGFR7), CD180 (PDGFR8), CD190 (PDGFR9), CD200 (PDGFR10), CD2100 (PDGFR11), CD220 (PDGFR12), CD230 (PDGFR13), CD240 (PDGFR14), CD250 (PDGFR15), CD260 (PDGFR16), CD270 (PDGFR17), CD280 (PDGFR18), CD290 (PDGFR19), CD360 (PDGFR19), CD350 (PDGFR19), CD370 (PDGFR19), CD380 (PDGFR19), CD390 (PDGFR20), CD400 (PDGFR20), CD410 (PDGFR20), CD420 (PDGFR20), CD430 (PDGFR20), CD440 (PDG D152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, BCMA (CD269), ALPPL2, GFP, eGFP, and SIRPα.

[0013] In some embodiments, the ligand is CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80(B7.1), CD86(B7.2), CD94, CD95, CD134, CD140(PDGFR4), CD152, CD154, CD158, CD178, CD181(C XCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, and MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), and signal regulatory protein alpha (SIRPα).

[0014] In some embodiments, the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen. In some embodiments, the ligand is a tumor-associated antigen or a tumor-specific associated antigen. In some embodiments, the extracellular binding domain comprises a ligand-binding portion of a receptor. In some embodiments, the antigen-binding portion is an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab') 2 In some embodiments, the antigen-binding portion is selected from the group consisting of a fragment, a Fab fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv.

[0015] In some embodiments, the antigen binding portion is selected from the group consisting of CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, The tumor associated antigen is selected from the group consisting of FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl. In some embodiments, the tumor associated antigen is CD19, CEA, HER2, MUC1, CD20, BCMA, ALPPL2, or EGFR. In some embodiments, the tumor associated antigen is CD19.

[0016] In some embodiments, the ligand-inducible proteolytic cleavage site is a γ-secretase cleavage site. In some embodiments, the transcriptional regulator comprises a transcriptional activator or a transcriptional repressor. In some embodiments, the ICD comprises a nuclear localization sequence and a transcriptional regulator sequence selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the chimeric polypeptide of the present disclosure further comprises a signal sequence, a detectable label, a tumor-specific cleavage site, a disease-specific cleavage site, or a combination thereof.

[0017] In some embodiments, a chimeric polypeptide of the disclosure comprises an STS having an amino acid sequence having at least 80% sequence identity to SEQ ID NO:89, 92, 108, 115, 138, 146, or 156.

[0018] In some embodiments, the hinge domain can promote oligomerization of the chimeric polypeptide through intermolecular disulfide bonds. In some embodiments, the linking sequence comprises an amino acid sequence having at least 80% sequence identity to a hinge domain derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any of them. In some embodiments, the hinge domain is derived from a CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 157-161.

[0019] In some embodiments, the TMD comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-2, 6, 20, 43, 39, 54, and 64. In some embodiments, the TMD comprises an amino acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 1-2, 6, 20, 43, 39, 54, and 64. In some embodiments, the TMD comprises an amino acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 1-2, 6, 20, 43, 39, 54, and 64. In some embodiments, the TMD comprises an amino acid sequence substantially identical to any one of SEQ ID NOs: 1-2, 6, 20, 43, 39, 54, and 64.

[0020] In some embodiments, a chimeric polypeptide of the present disclosure comprises: (a) a linking sequence comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 157-161; (b) a TMD comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192; and (c) an STS comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NOs: 85-156 and 173.

[0021] In another aspect, provided herein is a nucleic acid comprising a nucleotide sequence encoding a chimeric polypeptide disclosed herein. In some embodiments, the nucleotide sequence is incorporated into an expression cassette or expression vector. In some embodiments, the expression vector is a viral vector. In some embodiments, the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector. In some embodiments, the viral vector is a lentiviral vector.

[0022] In another aspect, provided herein is a recombinant cell comprising (a) a chimeric polypeptide disclosed herein and / or (b) a recombinant nucleic acid disclosed herein. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, or another T cell. In some embodiments, the recombinant cell further comprises (a) a second chimeric polypeptide disclosed herein and / or (b) a second nucleic acid disclosed herein, wherein the first chimeric polypeptide and the second chimeric polypeptide do not have the same sequence and / or the first nucleic acid or the second nucleic acid do not have the same sequence. In some embodiments, the chimeric polypeptide regulates the expression and / or activity of the second chimeric polypeptide.

[0023] In some embodiments, the recombinant cell of the present disclosure further comprises an expression cassette encoding a protein of interest operably linked to a promoter, wherein expression of the protein is regulated by a transcription factor encoded by the chimeric receptor. In some embodiments, the protein of interest is heterologous to the cell. In some embodiments, the promoter is GAL4. In some embodiments, the protein of interest is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor, a de-differentiation factor, an immune cell receptor, or a reporter.

[0024] Further provided herein, in another aspect, is a cell culture comprising at least one recombinant cell disclosed herein and a culture medium.

[0025] In yet another aspect, provided herein is a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and one or more of the following: (a) a recombinant nucleic acid disclosed herein, or (b) a recombinant cell disclosed herein. In some embodiments, the disclosed pharmaceutical composition comprises a recombinant nucleic acid disclosed herein and a pharma- ceutically acceptable carrier. In some embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or lipid nanoparticle (LNP).

[0026] In another aspect, provided herein is a method for modulating an activity of a cell, comprising: (a) providing a recombinant cell of the present disclosure; and (b) contacting the recombinant cell with a selected ligand, wherein binding of the selected ligand to the extracellular binding domain induces cleavage of the ligand-inducible proteolytic cleavage site, releasing a transcription factor, and the released transcription factor modulates an activity of the recombinant cell. In some embodiments, the contacting is performed in vivo, ex vivo, or in vitro. In some embodiments, the activity of the cell is selected from the group consisting of expression of a selected gene of the cell, proliferation of the cell, apoptosis of the cell, non-apoptotic death of the cell, differentiation of the cell, dedifferentiation of the cell, migration of the cell, secretion of a molecule from the cell, cell adhesion of the cell, and cytolytic activity of the cell. In some embodiments, the released transcription factor modulates expression of a gene product of the cell. In some embodiments, the released transcription factor modulates expression of a heterologous gene product. In some embodiments, the gene product of the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a proliferation inducer, a receptor, an RNA-guided nuclease, a site-specific nuclease, a T cell receptor, a toxin, a toxin-derived protein, a transcription regulator, a transcription activator, a transcription repressor, a translation regulator, a translation activator, a translation repressor, an activating immune receptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T cell receptor, an immune activator, an immune inhibitor, and an inhibitory immune receptor. In some embodiments, the released transcription regulator regulates differentiation of the cell, and the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

[0027] Another aspect is a method for inhibiting the activity of a target cell in an individual, comprising administering to the individual an effective number of a recombinant cell of the present disclosure, wherein the recombinant cell inhibits the activity of the target cell in the individual. In some embodiments, the target cell is an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B-cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a liver cancer cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T-cell lymphoma cell, a renal cancer cell, a sarcoma cell, a gastric cancer cell, a carcinoma cell, a mesothelioma cell, or a sarcoma cell. In some embodiments, the target cell is a pathogenic cell.

[0028] In another aspect, provided herein is a method for treating a disease in an individual, comprising administering to the individual an effective number of a recombinant cell of the present disclosure, wherein the recombinant cell treats the disease in the individual. In some embodiments, the treatment method of the present disclosure further comprises administering a second therapy to the individual. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, or toxin therapy. In some embodiments, the first therapy and the second therapy are administered together in the same composition or in separate compositions. In some embodiments, the first therapy and the second therapy are administered simultaneously. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy and the second therapy are administered in alternation.

[0029] In another aspect, provided herein is a system for modulating a cellular activity, modulating a target cell activity, or treating a disease in an individual in need thereof, the system comprising one or more of a chimeric polypeptide of this disclosure, a polynucleotide of this disclosure, a recombinant cell of this disclosure, or a pharmaceutical composition of this disclosure.

[0030] In another aspect, provided herein is a method for making a recombinant cell of the disclosure, the method comprising: (a) providing a cell capable of protein expression; and (b) contacting the provided cell with a recombinant nucleic acid of the disclosure. In some embodiments, the cells are obtained by leukapheresis performed on a sample obtained from a human subject or patient, and the cells are contacted ex vivo. In some embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or lipid nanoparticle (LNP).

[0031] In another aspect, provided herein is the use of one or more of the chimeric polypeptides of the present disclosure, the polynucleotides of the present disclosure, the recombinant cells of the present disclosure, or the pharmaceutical compositions of the present disclosure for the treatment of a disease. In some embodiments, the disease is cancer.

[0032] In another aspect, provided herein is the use of one or more of the chimeric polypeptides of the present disclosure, the polynucleotides of the present disclosure, the recombinant cells of the present disclosure, or the pharmaceutical compositions of the present disclosure in the manufacture of a medicament for the treatment of a disease.

[0033] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the exemplary embodiments and features described herein, further aspects, embodiments, objects and features of the present disclosure will become more fully apparent from the drawings and detailed description, and from the claims. [Brief description of the drawings]

[0034] [Figure 1A]1 shows a schematic of the experimental design and testing of an exemplary non-Notch synthetic regulated intramembrane proteolytic receptor (SynRIPR or SNIPR) according to some non-limiting embodiments of the present disclosure. 2 shows a schematic of the modular assembly of an exemplary non-Notch SNIPR around a CLSTN2 core. [Figure 1B] Schematic diagram of experimental design and testing of exemplary non-Notch synthetic regulated intramembrane proteolytic receptors (SynRIPR or SNIPR) according to some non-limiting embodiments of the present disclosure. Schematic summary of the results of JMD-based SNIPR tuning experiments. In these experiments, the reference receptor was an optimized CD8α Notch receptor (HingeNotch) composed of a truncated CD8α extracellular domain (ECD), a transmembrane domain (TMD) of human Notch1, and a C-terminal juxtamembrane domain (JMD) from Notch1. T cells expressing this anti-CD19 HingeNotch were able to activate response elements in the presence of CD19+K562 sender cells. This activation was boosted when a co-expressed anti-ALPPL2 CAR was activated and provided a T cell activation stimulus. In each of these exemplary SynRIPRs, the extracellular binding domain comprises a single-chain antigen-binding fragment (scFv) with binding affinity for a selected ligand (in this example, the B lymphocyte antigen CD19). As shown in Figures 1B-1C, assembly of non-Notch SynRIPRs using the CLSTN2 TMD and CLSTN2 JMD results in an inactive receptor, but replacement of the CLSTN2 JMD with a more capable JMD, such as the JMD from KCNE3 or PTPRF, can restore receptor function. [Figure 1C]Schematic diagram of experimental design and testing of exemplary non-Notch synthetic regulated intramembrane proteolytic receptors (SynRIPR or SNIPR) according to some non-limiting embodiments of the present disclosure. Schematic summary of the results of JMD-based SNIPR tuning experiments. In these experiments, the reference receptor was an optimized CD8α Notch receptor (HingeNotch) composed of a truncated CD8α extracellular domain (ECD), a transmembrane domain (TMD) of human Notch1, and a C-terminal juxtamembrane domain (JMD) from Notch1. T cells expressing this anti-CD19 HingeNotch were able to activate response elements in the presence of CD19+K562 sender cells. This activation was boosted when a co-expressed anti-ALPPL2 CAR was activated and provided a T cell activation stimulus. In each of these exemplary SynRIPRs, the extracellular binding domain comprises a single-chain antigen-binding fragment (scFv) with binding affinity for a selected ligand (in this example, the B lymphocyte antigen CD19). As shown in Figures 1B-1C, assembly of non-Notch SynRIPRs using the CLSTN2 TMD and CLSTN2 JMD results in an inactive receptor, but replacement of the CLSTN2 JMD with a more capable JMD, such as the JMD from KCNE3 or PTPRF, can restore receptor function.

[0035] [Figure 2-1] The experimental design of screening for TMD and JMD / STS that can be placed in the chimeric polypeptides described herein and non-Notch SynRIPRs, including modular assemblies of SynRIPRs with tunable transcriptional output, is shown. In these experiments, Notch1 JMD(STS) was held constant for TMD selection, while Notch1 TMD was held constant for JMD(STS) selection. T cells expressing high-performance "SynRIPR→BFP expression" circuits were co-incubated with donor cells for 48 hours. BFP output was measured using flow cytometry. [Figure 2-2]The experimental design of screening for TMD and JMD / STS that can be placed in the chimeric polypeptides described herein and non-Notch SynRIPRs, including modular assemblies of SynRIPRs with tunable transcriptional output, is shown. In these experiments, Notch1 JMD(STS) was held constant for TMD selection, while Notch1 TMD was held constant for JMD(STS) selection. T cells expressing high-performance "SynRIPR→BFP expression" circuits were co-incubated with donor cells for 48 hours. BFP output was measured using flow cytometry. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0036] The present disclosure generally relates to novel chimeric polypeptides, including, inter alia, a novel class of synthetic receptors that do not require sequences from Notch receptors. In particular, as described in more detail below, systematic engineering efforts have demonstrated that it is possible to utilize (1) ADAM protease-cleavable extracellular domains (e.g., hinge domains from CD8), (2) γ-secretase-cleavable transmembrane domains (TMDs), and (3) stop-transfer-sequences to rationally construct synthetic regulated intermembrane proteolytic receptors (SynRIPRs). Thus, these receptors do not exist in nature. As described below, the chimeric polypeptides of the present disclosure can be synthetic polypeptides, or can be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional regulation.

[0037] As described in more detail below, these receptors can be used to target various therapeutically relevant cell types to disease sites and control the therapeutic activity of the cells in a controlled and localized manner. These receptors can be linked to inducible transcriptional programs to locally produce therapeutic agents such as antibodies, cytokines, toxins, and adjuvants when the cells sense the disease site. Receptors are highly versatile and programmable platforms for cell engineering, and essentially the production of any genetically encodable therapeutic agent can be controlled by these receptors. Thus, the SynRIPRs described herein can potentially be used in either cancer, autoimmunity, or cell therapy for regeneration of damaged tissue. In addition, these receptors are compact in size. Polynucleotides encoding chimeric receptors provided herein can be made smaller than existing SynNotch-encoding polynucleotides, which allows the use of vectors with more limited capacity but otherwise more desirable characteristics, or the inclusion of additional elements that would otherwise be excluded from the size constraints associated with the capacity of the vector. The experimental data described herein demonstrate that advanced engineering efforts have now enabled scientists to rationally design receptors that function like Notch receptors but that do not share sequences with the Notch protein.

[0038] In some embodiments, the present disclosure provides a novel class of chimeric receptors that contain a non-Notch transmembrane domain (TMD) that includes at least one gamma-secretase site. As described in more detail below, cleavage of the TMD is an essential step in the signal transduction mediated by these synthetic receptors. Without being bound to a particular theory, it is believed that modulation of TMD cleavage may facilitate optimization and / or improvement of the receptors disclosed herein, which may then be particularly useful in modulating cellular activities, such as activating or inhibiting selected biosynthetic pathways, and / or treating diseases. In some embodiments, the receptors disclosed herein bind to ligands presented on the target cell surface, thereby triggering proteolytic cleavage of the receptor and release of transcriptional regulators that regulate custom transcriptional programs in the cell.

[0039] In some embodiments, the chimeric receptors disclosed herein also contain non-Notch STS sequences that allow the novel synthetic chimeric receptors disclosed herein to have a wide range of desirable characteristics. For example, by modifying the STS and selecting different juxtamembrane domains, receptors can be produced that have different noise levels (i.e., baseline levels of receptor activation in the absence of a selected target ligand), different signal levels (i.e., expression levels obtained in the presence of a selected target ligand), and different signal:noise ratios.

[0040] To date, all functional SynNotch receptors have contained sequences derived from Notch family members. As described in more detail below, to demonstrate the versatility of the modular receptor assembly approach, experiments were designed to engineer ligand-activated receptors from the ground up based on receptor components completely lacking Notch sequences. Although all receptors were expressed at high levels, it was observed that the otherwise active alcadein-gamma (CSTLN2) TMD did not function with the cognate but inactive STS / JMD sequences. Surprisingly, it was observed that receptor signaling was restored by replacing the CSTLN2 JMD with the more active one from KCNE3 (RSRKVDKR, SEQ ID NO: 146) or PTPRF (KRKRTH, SEQ ID NO: 108), suggesting that the original CLSTN2 JMD is functionally limited. The experimental results described herein demonstrate the ability to construct new functional synthetic regulated intramembrane proteolytic receptors from a set of functional parts, thereby illustrating that the synthetic biology approach of receptor assembly can generate receptors that function like Notch receptors, but can be rationally customized in their activity.

[0041] The disclosure also provides compositions and methods useful for producing such receptors, nucleic acids encoding same, host cells genetically modified with the nucleic acids, and methods for modulating cellular activity and / or for the treatment of various diseases, such as cancer.

[0042] In the following detailed description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, like symbols generally identify like components unless the context dictates otherwise. The exemplary alternatives described in the detailed description, drawings, and claims are not meant to be limiting. Other alternatives may be used, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects generally described herein and illustrated in the figures can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are expressly contemplated and made part of this application.

[0043] definition The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all the alternatives of "A," "B," "A or B," and "A and B."

[0044] The terms "administration" and "administering", as used interchangeably herein, refer to the delivery of a composition or formulation by a route of administration, including, but not limited to, intravenous, intraarterial, intracerebral, intrathecal, intramuscular, intraperitoneal, subcutaneous, intramuscular, and combinations thereof. This term includes, but is not limited to, administration by a medical professional and self-administration.

[0045] The terms "host cell" and "recombinant cell" are used interchangeably herein. Such terms, as well as "cell," "cell culture," and "cell line," are understood to refer not only to the particular subject cell or cell line, but also to the progeny or potential progeny of such a cell or cell line, regardless of the number of transfers. It should be understood that not all progeny are precisely identical to the parent cell. This is because certain modifications may occur in successive generations, either due to mutation (e.g., intentional or unintentional mutation) or environmental influences, so that such progeny may not in fact be identical to the parent cell, but are still within the scope of the terms as used herein, so long as the progeny retain the same function as the original cell or cell line.

[0046] As used herein, the term "construct" is intended to mean any recombinant nucleic acid molecule, such as an expression cassette, a plasmid, a cosmid, a virus, an autonomously replicating polynucleotide molecule, a phage, or a linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide molecule from any source, capable of either genomic integration or autonomous replication, comprising a nucleic acid molecule to which one or more nucleic acid sequences are, e.g., operably linked, in a functionally operable manner.

[0047] The term "operably linked," as used herein, refers to a physical or functional linkage between two or more elements, e.g., polypeptide sequences or polynucleotide sequences, enabling them to function in their intended manner.

[0048] The term "heterologous" refers to nucleic acid sequences or amino acid sequences that are operably linked or otherwise joined to each other in a nucleic acid construct or chimeric polypeptide, but that are not operably linked or adjacent to each other in nature.

[0049] The term "percent identity" as used herein in the context of two or more nucleic acids or proteins refers to two or more sequences or subsequences that are the same or have a specified percentage of the same nucleotides or amino acids (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity over a specified region when compared and aligned for maximum correspondence over a comparison window or designated region) when measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters described below, or by manual alignment and visual inspection. See, for example, the NCBI website at ncbi.nlm.nih.gov / BLAST. This definition may also refer to or be applied to the complement of a test sequence. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions. Sequence identity can be calculated over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence. Sequence identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al, Nucleic Acids Res (1984) 12:387), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol (1990) 215:403). Sequence identity can be measured using sequence analysis software, such as the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), with its default parameters.

[0050] The term "recombinant" when used with respect to a cell, nucleic acid, protein, or vector indicates that the cell, nucleic acid, protein, or vector has been modified or produced by human intervention, e.g., modified by or is the result of a laboratory method. Thus, for example, recombinant cells, proteins, and nucleic acids include cells, proteins, and nucleic acids produced by laboratory methods. Recombinant proteins may contain amino acid residues not found in the native (non-recombinant or wild-type) form of the protein, or may contain modified, e.g., labeled, amino acid residues. The term recombinant may include any modification to a peptide, protein, or nucleic acid sequence. Such modifications may include the following: any chemical modification of a peptide, protein, or nucleic acid sequence, including one or more amino acids, deoxyribonucleotides, or ribonucleotides, the addition, deletion, and / or substitution of one or more amino acids in a peptide or protein, the creation of fusion proteins, including, for example, antibody fragments, and the addition, deletion, and / or substitution of one or more nucleic acids in a nucleic acid sequence. The term "recombinant" when used in reference to a cell is not intended to include naturally occurring cells, but rather encompasses cells that have been engineered / modified to contain or express a polypeptide or nucleic acid that is not present in the cell when not engineered / modified.

[0051] As used herein, unless otherwise specified, a "therapeutically effective amount" of a drug is an amount or number sufficient to provide a therapeutic benefit in the treatment or management of a health condition or disease, such as cancer, or to delay or minimize one or more symptoms associated with a condition or disease. A therapeutically effective amount or number of a therapeutic agent means an amount or number of a therapeutic agent, alone or in combination with other therapeutic agents, that provides a therapeutic benefit in the treatment or management of a condition or disease. The term "therapeutically effective amount" can include an amount that improves overall treatment, reduces or avoids the symptoms or causes of a condition or disease, or enhances the therapeutic effectiveness of another therapeutic agent. An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which may also be referred to as a "therapeutically effective amount." A "reduction" of a symptom means that the severity or frequency of the symptom is reduced, or that the symptom is eliminated. The precise amounts or numbers of therapeutic agents that comprise a "therapeutically effective amount" will depend on the purpose of the treatment and may be ascertained by one of ordinary skill in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (Vols. 1-3, 2010); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (2016); Pickar, Dosage Calculations (2012); and Remington: The Science and Practice of Pharmacy, 22 nd Edition, 2012, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0052] As used herein, a "subject" or "individual" includes animals, such as humans (e.g., human individuals) and non-human animals. In some embodiments, a "subject" or "individual" may be a patient under the care of a physician. Thus, an individual may be a human patient or individual who has, is at risk of, or is suspected of having a target disease (e.g., cancer) and / or one or more symptoms of the disease. A subject may also be an individual who has been diagnosed as being at risk for a target condition at or after diagnosis. The term "non-human animal" includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, and non-mammals, e.g., non-human primates, sheep, dogs, cows, chickens, amphibians, reptiles, and the like.

[0053] Where a range of values ​​is provided, it is understood that each intervening value between the upper and lower limits of that range, to the tenth of the unit of the lower limit, and any other stated or intervening value within that stated range, is encompassed within the disclosure unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0054] Certain ranges are presented herein with numerical values ​​preceded by the term "about". In this specification, the term "about" is used to provide literal support for the exact number it precedes, as well as a number that is close to or approximately the number it precedes. In determining whether a number is close to or approximately a specifically recited number, the close or approximate unrecited number may be a number that, in the context in which it is presented, provides a substantial equivalent to the specifically recited number. If the degree of approximation is not clear from the context, "about" means within plus or minus 10% of the provided value in all cases, including the provided value, or rounded to the nearest significant figure. In some embodiments, the term "about" refers to the specified value ±10%, ±5%, or ±1%.

[0055] It is understood that aspects and embodiments of the disclosure described herein include the aspects and embodiments "comprising," "consisting," and "consisting essentially of." As used herein, "comprising" is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional unrecited elements or method steps. As used herein, "consisting of" excludes any element, step, or ingredient not specified in the claimed composition or method. As used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term "comprising," particularly in the description of a component of a composition or in the description of a step of a method, is understood to encompass compositions and methods that consist essentially of and consist of the recited components or steps.

[0056] Headings, e.g., (a), (b), (i), etc., are provided solely to facilitate reading of the specification and claims. The use of headings in this specification or claims does not require that the steps or elements be performed in alphabetical or numerical order or in the order in which they are presented.

[0057] All ranges disclosed herein also encompass any and all possible subranges and combinations of those subranges. Any recited range may be recognized as fully descriptive and allowing for the same range to be divided into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be easily divided into a lower third, middle third, upper third, etc. Also, as will be understood by those of skill in the art, all language such as "up to," "at least," "greater than," "less than," etc., includes the recited numbers and refers to a range that can be subsequently divided into subranges as described above. Finally, as will be understood by those of skill in the art, a range includes each individual member. Thus, for example, a group having 1-3 items refers to a group having 1, 2, or 3 items. Similarly, a group having 1-5 items refers to a group having 1, 2, 3, 4, or 5 items, and so forth.

[0058] It is understood that certain features of the present disclosure that are described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, various features of the present disclosure that are described in the context of a single embodiment for brevity may also be provided separately or in any suitable subcombination. All combinations of the embodiments related to the present disclosure are specifically embraced by the present disclosure and are disclosed herein as if each and every combination were individually and expressly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein as if each and every such subcombination were individually and expressly disclosed herein.

[0059] Compositions of the Disclosure As described in more detail below, the present disclosure provides a new class of chimeric polypeptide receptors engineered to regulate transcriptional regulation in a ligand-dependent manner that has multiple advantages over existing synthetic receptors. In particular, some embodiments of the present disclosure provide synthetic receptors that do not require sequences from a Notch receptor. In some embodiments, the inclusion of heterologous TMDs provides novel synthetic receptors with a variety of improved expression characteristics, thus expanding the range of available receptors available to cell engineers. In some embodiments, the synthetic receptors disclosed herein also include non-Notch STS sequences, allowing the novel synthetic receptors to have a wide range of desired characteristics. In addition, as described above, these novel synthetic receptors are compact in size, such that polynucleotides encoding these synthetic receptors can be made smaller than existing SynNotch-encoding polynucleotides, which allows the use of vectors that are more limited in volume but have otherwise more desirable characteristics, or the inclusion of additional elements that would otherwise be excluded from the size constraints associated with vector volume.

[0060] As shown below, the ability to construct de novo functional synthetic controlled intramembrane proteolytic receptors from a set of functional moieties indicates that synthetic biology approaches to receptor assembly are capable of generating receptors that function like naturally occurring receptors, such as the Notch receptor, but can be rationally customized in their activity.

[0061] Those skilled in the art will understand that the chimeric polypeptide receptors disclosed herein promote amplified activation under certain cellular and environmental circumstances. This type of feedback on receptor activity is a novel feature that can be exploited to enhance and regulate the expression of therapeutic payloads by engineered cells. As described in the Examples herein, the chimeric polypeptide receptors have been tested and validated in primary human T cells. Without being bound to a particular theory, it is believed that these novel receptors will show similar performance in other mammalian cells. In addition, those skilled in the art will understand upon reviewing this disclosure that the synthetic receptors disclosed herein can be engineered into various immune cell types for enhanced tumor recognition and elimination, or into engineered cells for tunable control of autoimmunity and tissue regeneration. Thus, engineered cells, such as immune cells engineered to express one or more of the chimeric receptors disclosed herein, are also within the scope of this disclosure.

[0062] Chimeric Polypeptides In one aspect, various novel non-naturally occurring chimeric polypeptides are provided herein that are engineered to regulate transcriptional regulation in a ligand-dependent manner. These novel receptors generally comprise (1) a γ-secretase cleavable transmembrane domain (TMD), and (2) a stop transfer sequence. The inclusion of heterologous STS and TMD sequences facilitates the optimization and / or improvement of the novel chimeric receptors disclosed herein, which are then useful in regulating cellular activity and / or treating disease. In some embodiments, the receptors provided herein bind to ligands presented on the target cell surface, triggering proteolytic cleavage of the receptor and releasing transcriptional regulators that regulate custom transcriptional programs in the cell.

[0063] In some embodiments, provided herein is a chimeric polypeptide comprising, from N-terminus to C-terminus, (a) an extracellular binding domain having binding affinity for a selected ligand; (b) a linking sequence; (c) a TMD having at least about 80% sequence identity to a transmembrane domain of a type 1 transmembrane receptor and comprising one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD comprising a transcription regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcription regulator and the linking sequence; and wherein the chimeric polypeptide does not comprise a sequence from a Notch receptor.

[0064] Extracellular domain (ECD) In some embodiments, the ECD of the chimeric polypeptides and chimeric receptors (e.g., SynRIPR) disclosed herein has binding affinity for one or more target ligands. In principle, there are no particular limitations regarding suitable ligands that can be targeted by the chimeric polypeptides provided herein. In some embodiments, the target ligand is a cell surface ligand. Non-limiting examples of suitable cell surface ligands include cell surface receptors, adhesion proteins, surface-bound carbohydrates, lipids, glycolipids, lipoproteins and lipopolysaccharides, integrins, mucins, and lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligand is a carbohydrate.

[0065] In some embodiments, the extracellular domain comprises a ligand-binding portion of a receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds one or more target antigens. In some embodiments, the ECD comprises an antigen-binding portion capable of binding one or more antigens on the surface of a cell (e.g., cell surface antigens). In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or functional antigen-binding fragment thereof. One of skill in the art, having read this disclosure, will readily appreciate that the terms "functional fragment thereof" or "functional variant thereof" refer to a molecule that has a common biological activity with the wild-type molecule from which the fragment or variant is derived. For example, a functional fragment or functional variant of an antibody is one that essentially retains the same ability to bind to the same epitope as the antibody from which the functional fragment or variant is derived. For example, an antibody capable of binding to an epitope of a cell surface receptor may be truncated at the N-terminus and / or C-terminus, and retention of its epitope-binding activity may be assessed using assays known to those of skill in the art. In some embodiments, the antigen-binding portion is an antibody, nanobody, diabody, triabody, or minibody, F(ab') 2 In some embodiments, the antigen-binding portion is selected from the group consisting of a fragment, a Fab fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv.

[0066] An antigen-binding portion may comprise a naturally occurring amino acid sequence or may be engineered, designed, or modified to provide desired and / or improved properties, such as binding affinity. In general, the binding affinity of an antigen-binding portion, such as an antibody, to a target antigen (e.g., CD19 antigen) can be calculated by the Scatchard method described by Frankel et al., Mol Immunol (1979) 16:101-06. In some embodiments, the binding affinity is measured by antigen / antibody dissociation rate. In some embodiments, the binding affinity is measured by competitive radioimmunoassay. In some embodiments, the binding affinity is measured by ELISA. In some embodiments, the antibody affinity is measured by flow cytometry. An antibody that "selectively binds" to an antigen (e.g., CD19) is an antigen-binding portion that binds to the antigen with high affinity and does not bind significantly to other unrelated antigens.

[0067] One skilled in the art can select an extracellular domain based on the desired localization or function of cells genetically engineered to express the chimeric polypeptide or SynRIPR of the present disclosure. For example, an extracellular domain can be selected to target receptor-expressing cells to estrogen-dependent breast cancer cells. In some embodiments, the extracellular domain of the disclosed chimeric polypeptide receptor (e.g., SynRIPR) can bind to a tumor-associated antigen (TAA) or tumor-specific antigen (TSA). TAA includes molecules, such as proteins, that are present on tumor cells and on a subpopulation of normal cells, or on many normal cells, but at much lower concentrations than on tumor cells. Examples include, but are not limited to, CEA, AFP, HER2, CTAG1B, and MAGEA1. In contrast, TSA includes molecules, such as proteins, that are generally present on tumor cells but not expressed on normal cells. Examples include, but are not limited to, oncogenic viral antigens and mutant proteins (also known as neo-antigens).

[0068] In some cases, the antigen-binding portion is specific for an epitope present in an antigen expressed by a tumor cell, i.e., a tumor-associated or tumor-specific antigen. The tumor-associated or tumor-specific antigen may be, for example, an antigen associated with breast cancer cells, B-cell lymphoma, pancreatic cancer, Hodgkin's lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma, lung cancer cells, non-Hodgkin's lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, melanoma cells, chronic lymphocytic leukemia cells, acute lymphocytic leukemia cells, neuroblastoma cells, gliomas, glioblastomas, colorectal cancer cells, etc. It will also be understood that tumor-associated antigens may also be expressed by non-cancerous cells. In some embodiments, the antigen-binding domain is specific for an epitope present in a tissue-specific antigen. In some embodiments, the antigen-binding domain is specific for an epitope present in a disease-associated antigen.

[0069] Generally, there are no particular limitations regarding suitable surface antigens that can be targeted by the chimeric polypeptide receptors disclosed herein. Non-limiting examples of suitable target antigens include CD19, B7H3 (CD276), BCMA (CD269), alkaline phosphatase, placenta-like 2 (ALPPL2), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), signal regulatory protein alpha (SIRPα), CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1 , CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

[0070] In some embodiments, the target antigen is CD19, B7H3 (CD276), BCMA (CD269), CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, ephrinB2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB 2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, Axl, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7-H3), IL-13Rα1, IL-13Rα2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), and cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, upper membrane protein (EMA), epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), macroscopic cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, melan-A (melanoma antigen recognized by T lymphocytes) protein , MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (IL-2 receptor chain), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgEFc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, scleroscin, SOST, TGFβ1, TNF-α, VEGF-A, pyruvate kinase isoenzyme M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, CD38, Selected from CD123, CD93, CD34, CD1a, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, kappa light chain, lambda light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its isovariants, TEM-8, sperm protein 17 (Sp17), and mesothelin.

[0071] Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternative reading frame protein), Trp-p8, STEAP1 (six transmembrane epithelial antigen of prostate 1), aberrant ras protein, aberrant p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), Ral-B, GPC2, CD276 (B7-H3), or IL-13Rα. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen binding portion of the ECD is specific for a reporter protein such as GFP and eGFP. Non-limiting examples of such antigen binding portions include the LaG17 anti-GFP nanobody. In some embodiments, the antigen binding portion of the ECD comprises an anti-BCMA fully humanized VH domain (FHVH). In some embodiments, the antigen is signal regulatory protein alpha (SIRPα).

[0072] Additional antigens that may be suitable for the chimeric polypeptide receptors disclosed herein include, but are not limited to, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7-H3), IL-13Rα1, IL-13Rα2, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes, MART-1), myo-D1, muscle specific actin (MSA), neurofilament, neuron specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1.

[0073] Additional suitable antigens include AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (one subunit of the heterodimeric IL-2 receptor), CD3, CD4, CD5, IFNα, IFNγ, IgE, IgE These include, but are not limited to, those associated with inflammatory diseases such as the Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, scleroscin, SOST, TGFβ1, TNFα, and VEGF-A.

[0074] Additional antigens suitable for the chimeric polypeptides and SynRIPR disclosed herein include, but are not limited to, pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1a, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, kappa light chain, lambda light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its isovariants, TEM-8, sperm protein 17 (Sp17), and mesothelin. Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternative reading frame protein), Trp-p8, STEAP1 (six transmembrane epithelial antigen of prostate-1), aberrant ras protein, aberrant p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen binding portion of the ECD is specific for a reporter protein such as GFP and eGFP. Non-limiting examples of such antigen binding portions include the LaG17 anti-GFP nanobody. In some embodiments, the antigen binding portion of the ECD comprises an anti-BCMA fully humanized VH domain (FHVH). In some embodiments, the antigen is signal regulatory protein alpha (SIRPα).

[0075] In some embodiments, antigens suitable for targeting by the chimeric polypeptides and chimeric receptors disclosed herein include ligands derived from pathogens. For example, the antigen can be HER2, which is produced by HER2-positive breast cancer cells. In some embodiments, the antigen can be CD19, which is expressed in B-cell leukemia. In some embodiments, the antigen can be EGFR, which is expressed in glioblastoma multiforme (GBM), but is much less expressed in healthy CNS tissues. In some embodiments, the antigen can be CEA, which is associated with cancer in adults, such as colon cancer.

[0076] In some embodiments, the antigen binding portion of the extracellular domain is specific for a cell surface target, non-limiting examples of which include CD19, CD30, Her2, CD22, ENPP3, EGFR, CD20, CD52, CD11α, and α integrin. In some embodiments, the chimeric polypeptides and SynRIPR disclosed herein comprise an extracellular domain having an antigen binding portion that binds to CD19, CEA, HER2, MUC1, CD20, or EGFR. In some embodiments, the chimeric polypeptides and SynRIPR disclosed herein comprise an extracellular domain that comprises an antigen binding portion that binds to CD19.

[0077] Concatenated Arrays As described above, the chimeric polypeptides and receptors of the present disclosure comprise a linking sequence disposed between the extracellular ligand binding domain (ECD) and the TMD.

[0078] In some embodiments, the linking sequence of the chimeric receptor has at least about 80% amino acid sequence identity to the polypeptide hinge domain. Without being bound to a particular theory, the hinge domain of the chimeric polypeptides and SynRIPRs disclosed herein can serve several functions, including controlling the flexibility and rigidity of the chimeric polypeptides and SynRIPRs, which can affect antigen binding and signal transduction. The length of the hinge domain can be adjusted to enhance the ability of SynRIPR to reach antigens in the space between SynRIPR and the target cell. The hinge domain can also be adjusted to mediate dimerization. Care should be taken in selecting an appropriate hinge domain. For example, a shorter hinge domain may be more rigid and more effective in signaling when bound to a target antigen, but may not reach a more membrane-proximal or otherwise particularly constrained target. In some embodiments, the hinge domain can promote oligomerization of the chimeric polypeptides through intermolecular disulfide bonds. In these examples, within the chimeric polypeptides and SynRIPRs disclosed herein, the hinge domain generally comprises a flexible oligo- or polypeptide connector region located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD, and also provides a site for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain comprises a motif that promotes dimerization of the chimeric polypeptides disclosed herein. In some embodiments, the hinge domain comprises a motif that promotes trimerization of the chimeric polypeptides disclosed herein (e.g., a hinge domain derived from OX40).

[0079] A hinge polypeptide sequence suitable for the compositions and methods of the present disclosure may be a naturally occurring hinge polypeptide sequence (e.g., from a naturally occurring immunoglobulin). Alternatively, the hinge polypeptide sequence may be a synthetic sequence corresponding to a naturally occurring hinge polypeptide sequence, or may be a completely synthetic hinge sequence, or may be engineered, designed, or modified to provide desired and / or improved properties, such as transcriptional regulation properties. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses (such as IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain), or functional variants thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs. Additional information in this regard can be found, for example, in a recent review by Vidarsson G. et al., Frontiers Immunol. October 20, 2014, which is incorporated herein by reference in its entirety.

[0080] Thus, in some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgG1 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgG2 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgG3 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgA hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgD hinge domain or a functional variant thereof.

[0081] Additional hinge polypeptide sequences suitable for the compositions and methods disclosed herein include, but are not limited to, hinge polypeptide sequences derived from CD8α hinge domain, CD28 hinge domain, CD152 hinge domain, PD-1 hinge domain, CTLA4 hinge domain, OX40 hinge domain, FcγRIIIα hinge domain, and functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from IgG4 hinge domain or a functional variant thereof.

[0082] In principle, there is no particular limit to the length and / or amino acid composition of the hinge domain, other than that it confers flexibility and the capacity for oligomerization. However, one of skill in the art will readily appreciate that the length and amino acid composition of the hinge polypeptide sequence can be optimized to alter the orientation and / or proximity of the ECD and TMD relative to each other, and of the chimeric polypeptide monomers relative to each other, to achieve a desired activity of the chimeric polypeptides of the present disclosure. In some embodiments, any single-chain peptide comprising about 1-100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as the hinge domain. In some embodiments, the hinge domain comprises about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, or about 30 to 90 amino acid residues. In some embodiments, the hinge domain comprises about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, or about 50 to 70 amino acid residues. In some embodiments, the hinge domain comprises about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the hinge domain comprises about 1-10, about 5-15, about 10-20, or about 15-25 amino acid residues.

[0083] In some embodiments, the linking sequence comprises an amino acid sequence having at least 80% sequence identity to a hinge domain derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any of them.

[0084] In some embodiments, the hinge domain is derived from the CD8α hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 157-161.

[0085] In some embodiments, the linking sequence comprises or consists of an amino acid sequence having at least about 80% sequence identity to the sequence set forth in SEQ ID NOs: 157-161 of the sequence listing, for example, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or about 99% sequence identity. In some embodiments, the linking sequence comprises or consists of an amino acid sequence having at least about 80% sequence identity to the sequence set forth in SEQ ID NOs: 157-161. In some embodiments, the linking sequence comprises or consists of an amino acid sequence having at least about 90% sequence identity to the sequence set forth in SEQ ID NOs: 157-161. In some embodiments, the linking sequence comprises or consists of an amino acid sequence having at least about 95% sequence identity to the sequence set forth in SEQ ID NOs: 157-161. In some embodiments, the linking sequence comprises or consists of an amino acid sequence having about 100% sequence identity to the sequence set forth in SEQ ID NOs: 157-161. In some embodiments, the linking sequence comprises or consists of an amino acid sequence selected from the group consisting of SEQ ID NOs: 157-161, wherein 1, 2, 3, 4, or 5 amino acid residues in any one of SEQ ID NOs: 157-161 are replaced by a different amino acid residue.

[0086] In some embodiments, one or more domains of the ROBO (Roundabout) cell surface receptor are incorporated into the linking sequence of the chimeric receptor of the present disclosure. The ROBO receptor releases a nuclear transcription factor domain following ligand-induced cleavage of the extracellular portion of the receptor by ADAM10 MMP and γ-secretase. However, ROBO does not contain a LIN / Notch domain, EGF-like repeats, or HD domain. Furthermore, the primary ligand of ROBO is a soluble protein (SLIT). Mammals have four ROBO receptors. ROBO1-3 have five immunoglobulin-like (Ig) domains, three fibronectin (Fn) repeats, and a transmembrane domain linked to an intracellular domain. ROBO4 has only two Ig domains and two Fn domains. Additional information in this regard can be found, for example, in H. Blockus et al., Development (2016) 143:3037-44, incorporated herein by reference.

[0087] In some embodiments, the linking sequence of the chimeric receptor disclosed herein comprises at least one fibronectin (Fn) repeat derived from a ROBO receptor. The linking sequence of the disclosed chimeric receptor can contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the linking sequence of the chimeric receptor comprises about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. In some embodiments, the linking sequence of the chimeric receptor has at least about 80% amino acid sequence identity to a ROBO1 JMD that comprises at least one fibronectin repeat.

[0088] In some embodiments, the linking sequence of the chimeric receptor has a polypeptide sequence about 4 to about 40 amino acid residues in length (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues). In some embodiments, the length and amino acid composition of the linking sequence can be optimized to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the present disclosure. In some embodiments, the linking sequence of the chimeric receptor has a polypeptide sequence about 4 to about 40, about 5 to about 30, about 10 to about 20, about 10 to about 30, about 10 to about 40, about 5 to about 20, about 5 to about 40, or about 20 to about 40 amino acid residues in length.

[0089] Transmembrane domain (TMD) As described above, the chimeric receptors of the present disclosure comprise a transmembrane domain having at least about 80% sequence identity to the TMD of a type 1 transmembrane receptor and containing one or more ligand-inducible proteolytic cleavage sites.

[0090] Examples of proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloproteinase cleavage sites of matrix metalloproteinases (MMPs) selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinases A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). For example, the cleavage sequence of MMP-9 is Pro-XX-Hy (X represents any residue: Hy, hydrophobic residues such as Leu, Ile, Val, Phe, Trp, Tyr, Val, Met, and Pro) (SEQ ID NO: 165), such as Pro-XX-Hy-(Ser / Thr) (SEQ ID NO: 166), such as Pro-Leu / Gln-Gly-Met-Thr-Ser (SEQ ID NO: 167) or Pro-Leu / Gln-Gly-Met-Thr (SEQ ID NO: 168). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, such as a urokinase plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences for uPA and tPA include sequences comprising Val-Gly-Arg (SEQ ID NO: 169). Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 170), where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 171), where the cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro-Arg (SEQ ID NO: 172).Additional suitable linkers that contain a protease cleavage site include those that bind to the following proteases: preScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9, thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L, cathepsin D, matrix metalloproteinase 1 (MMP-1), matrix metalloproteinase 2 (MMP-2), matrix metalloproteinase 3 (MMP-3), matrix metalloproteinase 4 (MMP-4), matrix metalloproteinase 5 (MMP-5), matrix metalloproteinase 6 (MMP-6), matrix metalloproteinase 7 (MMP-7), matrix metalloproteinase 8 (MMP-8), matrix metalloproteinase 9 (MMP-9), matrix metalloproteinase 10 (MMP-8), matrix metalloproteinase 11 (MMP-8), matrix metalloproteinase 12 (MMP-8), matrix metalloproteinase 13 (MMP-8), matrix metalloproteinase 14 (MMP-8), matrix metalloproteinase 15 (MMP-8), matrix metalloproteinase 16 (MMP-8), matrix metalloproteinase 17 (MMP-8), matrix metalloproteinase 18 (MMP-8), matrix metalloproteinase 19 ...2 (MMP-8), matrix metalloproteinase 13 (MMP-8), matrix metalloproteinase 14 ( Examples of sequences cleavable by plasminogen activator 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrix metalloproteinase (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases that are not native to the host in which the receptor is expressed (e.g., TEV) can be used as an additional control mechanism, reducing activation of the SynRIPR of the present disclosure until a protease is expressed or otherwise provided. Additionally, the protease can be tumor-associated or disease-associated (expressed to a significantly higher extent than normal tissue) and can function as an independent control mechanism. For example, some matrix metalloproteases are highly expressed in certain cancer types.

[0091] Generally, a suitable TMD for the chimeric receptors disclosed herein can be any transmembrane domain of a type 1 transmembrane receptor that contains at least one γ-secretase cleavage site. A detailed description of the structure and function of the γ-secretase complex and its substrate proteins, including amyloid precursor protein (APP), can be found, for example, in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs from type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, where the TMD contains at least one γ-secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of a chimeric polypeptide or SynRIPR of the disclosure is a TMD derived from the TMDs of APP, CLSTN1, CLSTN2, EPCAM, KCNE3, NECTIN1, PCDHGC3, and PTPRF. In some embodiments, the TMD of a chimeric polypeptide or SynRIPR of the disclosure is a TMD derived from the TMDs of members of the calsyntenin family, such as alcadein alpha and alcadein gamma.

[0092] Thus, in some embodiments, the transmembrane domain comprises an amino acid sequence that exhibits at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to a polypeptide sequence having at least about 70% sequence identity to a transmembrane domain from a type 1 transmembrane receptor that comprises a gamma-secretase cleavage site. In some embodiments, the transmembrane domain comprises an amino acid sequence that exhibits at least 70% sequence identity to a transmembrane domain from a type 1 transmembrane receptor that comprises a gamma-secretase cleavage site. In some embodiments, the transmembrane domain comprises an amino acid sequence that exhibits at least about 80% sequence identity to a transmembrane domain from a type 1 transmembrane receptor that comprises a gamma-secretase cleavage site. In some embodiments, the transmembrane domain comprises an amino acid sequence that exhibits at least about 90% sequence identity to a transmembrane domain from a type 1 transmembrane receptor that comprises a gamma-secretase cleavage site. In some embodiments, the transmembrane domain comprises an amino acid sequence that exhibits at least about 95% sequence identity to a transmembrane domain from a type 1 transmembrane receptor that contains a gamma-secretase cleavage site. In some embodiments, the type 1 transmembrane receptor is selected from the group consisting of CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, IFNAR2, IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KC NE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM.In some embodiments, the TMD comprises an amino acid sequence that exhibits at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192 in the sequence listing. In some embodiments, the transmembrane domain comprises an amino acid sequence that has at least 90% sequence identity to SEQ ID NOs: 1-84, 178, 182-185, and 190-192. In some embodiments, the transmembrane domain comprises an amino acid sequence that has at least 95% sequence identity to SEQ ID NOs: 1-88. In some embodiments, the transmembrane domain comprises an amino acid sequence that has about 100% sequence identity to SEQ ID NOs: 1-84, 178, 182-185, and 190-192. In some embodiments, the transmembrane domain comprises the amino acid sequence of SEQ ID NOs: 1-84, 178, 182-185 and 190-192, in which 1, 2, 3, 4 or 5 amino acid residues in the amino acid sequence are replaced with different amino acid residues.

[0093] In some embodiments, the amino acid substitutions in the TMD include one or more substitutions in the "GV" motif of the TMD. In some embodiments, at least one of such substitutions includes a substitution to alanine. For example, one, two, three, four, five or more amino acid residues of the sequence IATVVIIISVCMLVFVVAMGVY (SEQ ID NO:2) and any one of the sequences set forth in SEQ ID NOs:1, 6, 20, 43, 39, 54, and 64 may be replaced with a different amino acid. In some embodiments, the amino acid residues at positions 18 and / or 19 of the "GV" motif in SEQ ID NO:2 are replaced with a different amino acid residue. In some embodiments, the glycine residue at position 20 of SEQ ID NO:2 is replaced with a different amino acid residue. In some embodiments, the valine residue at position 21 of SEQ ID NO:2 is replaced with a different amino acid residue. In some embodiments, the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO:2 with a mutation (e.g., a G18A mutation) at a position corresponding to position 18 of SEQ ID NO:20. In some embodiments, the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO:2 with a mutation at a position corresponding to position 21 of SEQ ID NO:57 (eg, a V19A mutation).

[0094] Stop Transfer Sequence (STS) In some embodiments, the chimeric receptor of the present disclosure comprises a stop transport sequence (STS), which is essentially a highly charged domain located between the TMD and the ICD. Without being bound to a particular theory, such a highly charged domain located between the TMD and the ICD prevents the ICD from entering the membrane. In principle, there is no particular limit to the length and / or amino acid composition of the STS. In some embodiments, any single-chain peptide comprising about 1 to about 40 amino acid residues (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues) can be used as an STS. In some embodiments, the STS comprises about 1-15, about 5-20, about 8-25, about 10-30, about 12-35, about 14-40, about 5-40, about 10-35, about 15-30, about 20-25, about 20-40, about 10-30, about 4-20, or about 5-25 amino acid residues. In some embodiments, the STS comprises about 1-10, about 5-12, about 6-14, about 7-18, about 8-20, about 9-22, about 10-24, or about 11-26 amino acid residues. In some embodiments, the STS comprises about 4-10 residues, e.g., 4, 5, 6, 7, 8, 9, or 10 amino acid residues.

[0095] In some embodiments, the STS comprises a sequence having at least about 80% sequence identity to the STS domain of a type 1 receptor, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity to the STS domain of a type 1 receptor. In some embodiments, the STS comprises an amino acid sequence having at least 90% sequence identity to the STS domain of a type 1 receptor. In some embodiments, the STS comprises a sequence having at least 70% sequence identity, e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to an STS sequence from CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRP1B, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, PTPRF, or PTPRM. In some embodiments, the STS comprises a sequence having at least 70% sequence identity, e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to an STS sequence from CSF1R, DAG1, AGER, NRG1, KCNE3, PTPRF, or PTPRM. In some embodiments, the STS comprises a sequence that contains only Lys (K) or Arg (R) in the first four residues. In some embodiments, the STS comprises 1, 2, 3, 4, 5, or more basic residues. In some embodiments, the STS comprises 5, 4, 3, 2, 1, or 0 aromatic residues or residues with hydrophobic and / or large side chains.

[0096] In some embodiments, the STS comprises a sequence having at least 80% sequence identity, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to SEQ ID NOs: 85-156 and 173 of the Sequence Listing. In some embodiments, the STS comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, the STS comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, the STS comprises an amino acid sequence having at least 100% sequence identity to SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, an STS comprises an amino acid sequence having at least 90% or at least 95% sequence identity to SEQ ID NO: 146. In some embodiments, an STS comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 108. In some embodiments, an STS comprises the amino acid sequence of any one of SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156, wherein 1, 2, 3, 4, or 5 amino acid residues in the amino acid sequence are replaced by a different amino acid residue.

[0097] Intracellular domain (ICD) The chimeric receptor of the present disclosure further comprises an intracellular domain (ICD) that comprises a transcription regulator. A transcription regulator is a biochemical element that acts to activate or repress transcription of a promoter-driven DNA sequence. Transcription regulators suitable for the compositions and methods of the present disclosure may be naturally occurring transcription regulators or may be engineered, designed, or modified to provide desired and / or improved properties, such as regulation of transcription. In some embodiments, the transcription regulator directly controls the expression of one or more genes involved in cell differentiation. In some embodiments, the transcription regulator indirectly regulates the expression of one or more genes involved in cell differentiation by regulating the expression of a second transcription factor, thereby regulating the expression of one or more genes involved in cell differentiation. It will be understood by those skilled in the art that the transcription regulator may be a transcription activator or a transcription repressor. In some embodiments, the transcription regulator is a transcription repressor. In some embodiments, the transcription regulator is a transcription activator. In some embodiments, the transcription regulator may further comprise a nuclear localization signal. In some embodiments, the transcription factor is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcription factor is Gal4-VP64.

[0098] Additional Domains In some embodiments, the extracellular domain located at the N-terminus of the TMD can further comprise an additional domain, e.g., a membrane localization signal such as a CD8α signal, a detectable marker such as a myc tag or a his tag. In some embodiments, the chimeric receptor further comprises one or more additional proteolytic cleavage sites. In some embodiments, the chimeric receptor does not comprise an additional proteolytic cleavage site. In some embodiments, the chimeric receptor further comprises one or more glycosylation sites. In some embodiments, the chimeric receptor does not comprise a glycosylation site. In some embodiments, the chimeric receptor does not comprise a hinge domain to promote oligomerization of the chimeric polypeptide via intermolecular disulfide bonds.

[0099] In some embodiments, the chimeric receptor further comprises elements of the highly conserved ROBO cell surface receptor. In some embodiments, the disclosed chimeric receptor comprises, from N-terminus to C-terminus, (a) an extracellular ligand binding domain having binding affinity for a selected ligand, (b) a ROBO domain comprising fibronectin repeats, (c) a TMD comprising one or more ligand-inducible proteolytic cleavage sites, and (d) an ICD comprising a transcription regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage sites in the TMD, and the chimeric polypeptide does not comprise sequences from a Notch receptor.

[0100] In some embodiments, the chimeric receptor further comprises an extracellular oligomerization domain (e.g., a hinge domain) to promote oligomerization, e.g., dimerization, trimerization, or higher order multimers, of the chimeric receptor. In some embodiments, the disclosed chimeric receptor comprises, from N-terminus to C-terminus, (a) an extracellular ligand binding domain having binding affinity for a selected ligand, (b) a hinge domain, (c) a TMD comprising one or more ligand-inducible proteolytic cleavage sites, and (d) an ICD comprising a transcription regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage sites in the TMD, and the chimeric polypeptide does not comprise sequences from a Notch receptor.

[0101] In some embodiments, the hinge domain comprises a polypeptide motif capable of promoting oligomerization of the chimeric polypeptide through intermolecular disulfide bonds. In some embodiments, the chimeric receptors disclosed herein comprise, from N-terminus to C-terminus, (a) an extracellular ligand binding domain having binding affinity for a selected ligand, (b) a hinge domain capable of promoting oligomerization of the chimeric polypeptide through intermolecular disulfide bonds, (c) a TMD comprising one or more ligand-inducible proteolytic cleavage sites, and (d) an ICD comprising a transcription regulator, wherein binding of a selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage sites in the TMD, and the chimeric polypeptide does not comprise a sequence derived from a Notch receptor.

[0102] A chimeric receptor of the present disclosure can be a chimeric polypeptide of any length, including a chimeric polypeptide having a length of about 100 amino acids (aa) to about 1000 aa, for example, about 100 aa to about 200 aa, about 150 aa to about 250 aa, about 200 aa to about 300 aa, about 250 aa to about 350 aa, about 300 aa to about 400 aa, about 350 aa to about 450 aa, or about 400 aa to about 500 aa. In some embodiments, the disclosed chimeric polypeptides are generally about 400aa to about 450aa, about 450aa to about 500aa, about 500aa to about 550aa, about 550aa to about 600aa, about 600aa to about 650aa, about 650aa to about 700aa, about 700aa to about 750aa, about 750aa to about 800aa, about 800aa to about 850aa, about 850aa to about 900aa, about 900aa to about 950aa, or about 950aa to about 1000aa in length. In some cases, the disclosed chimeric polypeptides have a length of about 300aa to about 400aa. In some cases, the disclosed chimeric polypeptides have a length of 300aa to about 350aa. In some cases, the chimeric polypeptides of the present disclosure have a length of 300 aa to 325 aa. In some cases, the chimeric polypeptides of the present disclosure have a length of 350 aa to 400 aa. In some cases, the chimeric polypeptides of the present disclosure have a length of 750 aa to 850 aa.

[0103] In some embodiments, a chimeric receptor of the present disclosure comprises (a) an extracellular ligand-binding domain, (b) a linking sequence comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 157-161, and (c) a linking sequence comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192. 89, 92, 108, 115, 138, 146, and 156; and (e) an ICD comprising a transcription regulator. In some embodiments, a chimeric receptor of the present disclosure comprises: (a) a linking sequence comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 157-161; (b) a TMD comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192; and (c) an STS comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, a chimeric receptor of the present disclosure comprises: (a) a linking sequence comprising an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOs: 157-161; (b) a transmembrane domain comprising an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192; and (c) an STS comprising an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156.

[0104] In some embodiments, the chimeric polypeptides of the present disclosure comprise an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein, e.g., those listed in Table 1. Thus, in some embodiments, the chimeric polypeptides of the present disclosure comprise an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248 in the Sequence Listing. In some embodiments, the chimeric polypeptides of the present disclosure comprise an amino acid sequence having at least about 90% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248. In some embodiments, the chimeric polypeptides of the present disclosure comprise an amino acid sequence having at least about 95% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248. In some embodiments, a chimeric polypeptide of the present disclosure comprises an amino acid sequence having at least about 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248. In some embodiments, a chimeric polypeptide of the present disclosure comprises an amino acid sequence having at least about 100% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 197-248, wherein 1, 2, 3, 4, or 5 amino acid residues in the amino acid sequence are replaced with a different amino acid residue.

[0105] nucleic acid molecule In one aspect, some embodiments of the present disclosure relate to expression vectors comprising nucleic acid molecules comprising nucleotide sequences encoding the chimeric polypeptides and Notch receptors of the present disclosure, including expression cassettes, and these nucleic acid molecules operably linked to heterologous nucleic acid sequences, such as, for example, control sequences that direct the in vivo expression of the receptor in a host cell.

[0106] The nucleic acid molecules of the present disclosure may be of any length, including nucleic acid molecules that are generally about 5 Kb to about 50 Kb, e.g., about 5 Kb to about 40 Kb, about 5 Kb to about 30 Kb, about 5 Kb to about 20 Kb, or about 10 Kb to about 50 Kb, e.g., about 15 Kb to 30 Kb, about 20 Kb to about 50 Kb, about 20 Kb to about 40 Kb, about 5 Kb to about 25 Kb, or about 30 Kb to about 50 Kb.

[0107] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a chimeric receptor comprising, from N-terminus to C-terminus, (a) an extracellular ligand binding domain having binding affinity for a selected ligand; (b) a linking sequence having (i) at least about 80% sequence identity to a polypeptide hinge domain or (ii) at least about 80% sequence identity to a ROBO1 JMD comprising at least one fibronectin (Fn) repeat; (c) a TMD having at least about 80% sequence identity to a transmembrane domain of a type 1 transmembrane receptor comprising one or more ligand-inducible proteolytic cleavage sites; and (d) an ICD comprising a transcription regulator, wherein binding of the selected ligand to the extracellular binding domain induces cleavage at the ligand-inducible proteolytic cleavage site between the transcription regulator and the linking sequence; and the chimeric polypeptide does not comprise a sequence derived from a Notch receptor.

[0108] In some embodiments, the nucleotide sequence is incorporated into an expression cassette or expression vector. An expression cassette will generally be understood to include a construct of genetic material containing a coding sequence and sufficient control information to direct proper transcription and / or translation of the coding sequence in recipient cells in vivo and / or ex vivo. Generally, the expression cassette can be inserted into a vector for targeting to a desired host cell or tissue and / or into an individual. Thus, in some embodiments, an expression cassette of the present disclosure includes a nucleotide sequence encoding a chimeric polypeptide operably linked to expression control elements (elements) sufficient to induce expression of the cassette in vivo. In some embodiments, the expression control elements include any or a combination of promoters and / or enhancers, and optionally other nucleic acid sequences that can affect transcription and / or translation of the coding sequence.

[0109] In some embodiments, the nucleotide sequence is incorporated into an expression vector. The term "vector" generally refers to a recombinant polynucleotide construct designed for transfer between host cells, and will be understood by those skilled in the art to be used for transformation purposes, such as the introduction of heterologous DNA into a host cell. Thus, in some embodiments, a vector can be a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to effect replication of the inserted segment. In some embodiments, an expression vector can be an integrating vector.

[0110] In some embodiments, the expression vector may be a viral vector. As will be understood by those skilled in the art, the term "viral vector" is used broadly to refer to either a nucleic acid molecule (e.g., a transfer plasmid) that contains a viral-derived nucleic acid element that generally facilitates the transfer or integration of a nucleic acid molecule into the genome of a cell, or a viral particle that mediates nucleic acid transfer. A viral particle generally contains various viral components and may also contain host cell components in addition to the nucleic acid. The term viral vector can refer to either a virus or viral particle that can transfer a nucleic acid into a cell, or the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from a virus. The term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof that are primarily derived from a retrovirus. The term "lentiviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof, including the LTRs that are primarily derived from a lentivirus. In some embodiments, a nucleic acid molecule encoding a chimeric receptor of the present disclosure can be incorporated into one or more lentiviral vector constructs. In some embodiments, nucleic acid molecules encoding a chimeric receptor of the present disclosure can be incorporated into a single lentiviral vector construct, hi some embodiments, nucleic acid molecules encoding a chimeric receptor of the present disclosure can be incorporated into two, three, four, five, or more lentiviral vector constructs.

[0111] In some embodiments, the recombinant nucleic acid encodes a polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein. In some embodiments, the nucleic acid molecule encodes a chimeric polypeptide comprising: (a) a linking sequence comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 157-161; (b) a transmembrane domain comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192; and (c) an STS comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, the nucleic acid molecule encodes a chimeric polypeptide comprising: (a) a linking sequence comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 157-161; (b) a transmembrane domain comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192; and (c) an STS comprising an amino acid sequence having at least about 90% sequence identity to any one of SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156. In some embodiments, the nucleic acid molecule encodes a chimeric polypeptide comprising: (a) a linking sequence comprising an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOs: 157-161; (b) a transmembrane domain comprising an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192; and (c) an STS comprising an amino acid sequence having at least about 95% sequence identity to any one of SEQ ID NOs: 89, 92, 108, 115, 138, 146, and 156.

[0112] The nucleic acid sequence encoding the chimeric receptor can be optimized for expression in a host cell of interest. For example, the GC content of the sequence can be adjusted to an average level for a given cell host, calculated by referring to known genes expressed in the host cell. Methods for codon optimization are known in the art. The codon usage in the coding sequence of the chimeric receptor disclosed herein can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons in the coding sequence are optimized for expression in a particular host cell.

[0113] Some embodiments disclosed herein relate to vectors or expression cassettes comprising recombinant nucleic acid molecules encoding the chimeric receptors disclosed herein. Expression cassettes generally contain coding sequences and sufficient control information to direct proper transcription and / or translation of the coding sequences in recipient cells in vivo and / or ex vivo. Expression cassettes can be inserted into vectors for targeting to desired host cells and / or into individuals. Expression cassettes can be inserted into plasmids, cosmids, viruses, autonomously replicating polynucleotide molecules, or bacteriophages as linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotides from any source capable of genome integration or autonomous replication, comprising one or more nucleic acid sequences linked in a functionally operable manner, i.e., operably linked nucleic acid molecules.

[0114] Also provided herein are vectors, plasmids, or viruses that contain one or more of the nucleic acid molecules encoding any of the chimeric receptors disclosed herein. The nucleic acid molecules can be contained within a vector that is capable of directing their expression, for example, in a cell transformed / transduced with the vector. Vectors suitable for use in eukaryotic and prokaryotic cells are known in the art and are commercially available or readily prepared by one of ordinary skill in the art. For example, Sambrook, J., & Russell, DW (2012) Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russell, DW (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as”Sambrook”);Ausubel, FM(1987).Current Protocols in Molecular Biology.New York,NY:Wiley(includes appendix up to 2014);Bollag,DMet al.(1996).Protein Methods.New York,NY:Wiley-Liss;Huang,L.et al.(2005).Nonviral Vectors for Gene Therapy.San Diego:Academic Press;Kaplitt,MGet al.(1995).Viral Vectors:Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: the Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998).See Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, KB, Ferre, F. & Gibbs, R. (1994). PCR: the Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, EA (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SLet al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including appendices through 2014); and Makrides, SC (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences BV, the disclosures of which are incorporated herein by reference.

[0115] DNA vectors can be introduced into eukaryotic cells by conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (2012, supra) and other standard molecular biology laboratory manuals, such as calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scrape loading, ballistic transduction, nucleoporation, hydrodynamic shock, and infection.

[0116] Viral vectors that can be used in the present disclosure include, for example, retroviral vectors, adenoviral vectors, and adeno-associated viral vectors, lentiviral vectors, herpes viruses, simian virus 40 (SV40), and bovine papilloma virus vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY). For example, the chimeric receptors disclosed herein can be produced in eukaryotic hosts such as mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, Va). When selecting an expression system, care must be taken to ensure that the components are compatible with each other. Such judgment is possible for those skilled in the art. Furthermore, if guidance is needed in selecting an expression system, those skilled in the art can consult P. Jones, "Vectors: Cloning Applications", John Wiley and Sons, New York, NY, 2009).

[0117] The provided nucleic acid molecules may contain naturally occurring sequences or sequences that differ from naturally occurring sequences but encode the same gene product due to the degeneracy of the genetic code. These nucleic acid molecules may be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, such as those produced by phosphoramidite-based synthesis), or combinations or modifications of nucleotides within these types of nucleic acids. In addition, the nucleic acid molecules may be double-stranded or single-stranded (e.g., including either the sense or antisense strand).

[0118] A nucleic acid molecule is not limited to a sequence that codes for a polypeptide (e.g., an antibody). It can also include some or all of the non-coding sequences located upstream or downstream of a coding sequence (e.g., a coding sequence for a chimeric receptor). Those skilled in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. For example, a nucleic acid molecule can be generated by treating genomic DNA with a restriction endonuclease or by polymerase chain reaction (PCR). If the nucleic acid molecule is a ribonucleic acid (RNA), a transcript can be produced, for example, by in vitro transcription.

[0119] Recombinant Cells and Cell Cultures The nucleic acids of the present disclosure can be introduced into a host cell, such as a human T lymphocyte, to produce a recombinant cell containing the nucleic acid molecule. Accordingly, some embodiments of the present disclosure relate to a method for making a recombinant cell, comprising: (a) providing a cell capable of protein expression; and (b) contacting the provided cell with any of the recombinant nucleic acids described herein.

[0120] Introduction of the nucleic acid molecules of the present disclosure into cells can be achieved by viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0121] Thus, in some embodiments, the nucleic acid molecule is delivered to the cell by a viral or non-viral delivery vehicle known in the art. For example, the nucleic acid molecule can be stably integrated into the host genome, or can be episomally replicated, or can exist in the recombinant host cell as a minicircle expression vector for stable or transient expression. Thus, in some embodiments disclosed herein, the nucleic acid molecule is maintained and replicated in the recombinant host cell as an episomal unit. In some embodiments, the nucleic acid molecule is stably integrated into the genome of the recombinant cell. Stable integration can be accomplished using classical random genome recombination techniques, or more precise genome editing techniques such as guide RNA-directed CRISPR / Cas9 genome editing, or DNA-guided endonuclease genome editing using NgAgo (Natronobacterium gregoryi Argonaute), or TALEN genome editing (transcription activator-like effector nuclease). In some embodiments, the nucleic acid molecule is present in the recombinant host cell as a minicircle expression vector for stable or transient expression.

[0122] The nucleic acid molecule can be encapsulated in a viral capsid or lipid nanoparticle. For example, the introduction of nucleic acid into cells can be achieved by viral transduction. In a non-limiting example, adeno-associated virus (AAV) is a non-enveloped virus that can be engineered to deliver nucleic acid to target cells via viral transduction. Several AAV serotypes have been described, and all known serotypes can infect cells of multiple diverse tissue types. AAV can transduce a wide range of species and tissues in vivo without exhibiting toxicity, and produces relatively mild innate and adaptive immune responses.

[0123] Lentiviral systems are also suitable for nucleic acid delivery and gene therapy by viral transduction. Lentiviral vectors offer several attractive properties as gene delivery vehicles, including: (i) sustained gene delivery through stable vector integration into the host genome; (ii) ability to infect both dividing and non-dividing cells; (iii) broad tissue tropism, including important gene and cell therapy target cell types; (iv) no expression of viral proteins after vector transduction; (v) ability to deliver complex genetic elements such as polycistronic or intron-containing sequences; (vi) potentially safer integration site profile; and (vii) relatively easy system for vector engineering and production.

[0124] In some embodiments, host cells can be genetically engineered (e.g., transduced, transformed, or transfected) with, for example, either a vector containing a nucleic acid sequence encoding a chimeric receptor described herein, a viral-derived expression vector, or a vector for homologous recombination that further contains a nucleic acid sequence homologous to a portion of the genome of the host cell. Host cells can be either untransformed cells or cells that have already been transfected with one or more nucleic acid molecules.

[0125] In some embodiments, the recombinant cell is a prokaryotic or eukaryotic cell. In some embodiments, the cell is transformed in vivo. In some embodiments, the cell is transformed ex vivo. In some embodiments, the cell is transformed in vitro. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell. In some embodiments, the mammalian cell is an immune cell, a neuron, an epithelial cell, and an endothelial cell, or a stem cell. In some embodiments, the recombinant cell is an immune system cell, such as a lymphocyte (e.g., a T cell or an NK cell), or a dendritic cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell, a cytotoxic T cell, or other T cell. In some embodiments, the immune system cell is a T lymphocyte.

[0126] In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells. In some embodiments of the cells, the cells are lymphocytes. In some embodiments, the cells are precursor T cells or regulatory T (Treg) cells. In some embodiments, the cells are CD34+, CD8+, or CD4+ cells. In some embodiments, the cells are CD8+ T cytotoxic lymphocyte cells selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, and bulk CD8+ T cells. In some embodiments of the cells, the cells are CD4+ T helper lymphocyte cells selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, and bulk CD4+ T cells. In some embodiments, the cells may be obtained by leukapheresis performed on a sample obtained from a human subject.

[0127] In some embodiments, the recombinant cell further comprises a second nucleic acid molecule disclosed herein, wherein the first nucleic acid molecule and the second nucleic acid molecule do not have the same sequence. In some embodiments, the recombinant cell further comprises a second chimeric polypeptide disclosed herein, wherein the first chimeric polypeptide and the second chimeric polypeptide do not have the same sequence. In some embodiments, the first chimeric polypeptide regulates the expression and / or activity of the second chimeric polypeptide.

[0128] In some embodiments, the recombinant cell further comprises an expression cassette encoding a protein of interest operably linked to a promoter, and the expression of the protein of interest is regulated by the transcriptional regulator encoded by the chimeric receptor. In some embodiments, the protein of interest is heterologous to the recombinant cell. In principle, there is no particular restriction on the selection of a protein to target for regulation of expression by the transcriptional regulator encoded by the chimeric receptor. Non-limiting examples of proteins suitable for regulation by the compositions and methods disclosed herein include cytokines, cytotoxins, chemokines, immunomodulators, pro-apoptotic factors, anti-apoptotic factors, hormones, differentiation factors, de-differentiation factors, immune cell receptors, or reporter genes. In some embodiments, the immune cell receptor is a T cell receptor (TCR). A TCR generally comprises two polypeptides (e.g., polypeptide chains), such as a TCR α-chain, a TCR β-chain, a TCR γ-chain, a TCR δ-chain, or a combination thereof. Such TCR polypeptide chains are known in the art. In some embodiments, the immune cell receptor comprises a chimeric antigen receptor (CAR). Methods for CAR design, delivery and expression in T cells, and production of clinical grade CAR-T cell populations are known in the art. See, e.g., Lee et al., Clin Cancer Res (2012) 18(10):2780-90, incorporated herein by reference in its entirety. In some embodiments, an expression cassette encoding a protein of interest is incorporated into the same nucleic acid molecule encoding the chimeric receptor of the present disclosure. In some embodiments, an expression cassette encoding a protein of interest is incorporated into a second expression vector separate from the nucleic acid molecule encoding the chimeric receptor of the present disclosure.

[0129] In another aspect, various cell cultures are provided herein, comprising at least one recombinant cell disclosed herein and a culture medium. Generally, the culture medium can be any one of the culture media suitable for cell culture described herein. Techniques for transforming a wide variety of the above host cells and species are known in the art and described in the technical and scientific literature. Thus, cell cultures comprising at least one recombinant cell disclosed herein are also within the scope of this application. Suitable methods and systems for generating and maintaining cell cultures are known in the art.

[0130] Pharmaceutical Compositions In some embodiments, the nucleic acids and recombinant cells of the present disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions generally include the nucleic acid, and / or recombinant cells, and a pharma- ceutically acceptable excipient, e.g., a carrier.

[0131] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In all cases, the composition must be sterile and fluid to the extent that it can be administered by syringe. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants, for example, sodium dodecyl sulfate. The action of microorganisms can be prevented by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, generally, isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, and / or sodium chloride, are included in the composition. Prolonged absorption of the injectable composition can be achieved by including in the composition an agent that delays absorption, such as aluminum monostearate and gelatin.

[0132] Sterile injection solution can be prepared by incorporating the required amount of active compound into suitable solvent with one or combination of the above-listed components as required, followed by filtration sterilization.Generally, dispersion is prepared by incorporating active compound into sterile vehicle that contains basic dispersion medium and other components required from above-listed.For the preparation of sterile powder for sterile injection solution, the preferred preparation method is vacuum drying and freeze-drying, and the powder of active ingredient and any additional desired ingredients is obtained from its previously sterile filtered solution.

[0133] In some embodiments, the chimeric polypeptides and SynRIPR of the present disclosure may also be administered by transfection or infection using methods known in the art, including, but not limited to, those described in McCaffrey et al. (Nature (2002) 418:6893), Xia et al. (Nature Biotechnol (2002) 20:1006-10), or Putnam (Am J Health Syst Pharm (1996) 53:151-60, erratum at Am J Health Syst Pharm (1996) 53:325).

[0134] Methods of the Disclosure Administration of any one or more of the therapeutic compositions described herein, such as nucleic acids, recombinant cells, and pharmaceutical compositions, can be used to treat individuals with diseases such as cancer and chronic infections. In some embodiments, the nucleic acids, recombinant cells, and pharmaceutical compositions are incorporated into therapeutic compositions for use in methods of treating individuals who have, are suspected of having, or may be at high risk of developing one or more autoimmune disorders or diseases associated with checkpoint inhibition. Exemplary autoimmune disorders and diseases can include, but are not limited to, celiac disease, type 1 diabetes, Graves' disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, and systemic lupus erythematosus.

[0135] Thus, in one aspect, provided herein is a method for inhibiting the activity of a target cell in an individual, comprising administering to the individual a first therapy comprising one or more of the nucleic acids, recombinant cells, and pharmaceutical compositions provided herein, wherein the first therapy inhibits the activity of the target cell. For example, the activity of the target cell can be inhibited if its proliferation is reduced, if its pathological or pathogenic behavior is reduced, if it is destroyed or killed, etc. Inhibition includes a measured reduction of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. In some embodiments, the method comprises administering to the individual an effective number of recombinant cells disclosed herein, wherein the recombinant cells inhibit the target cell in the individual. Generally, the target cells of the disclosed methods can be any cell, such as, for example, acute myeloma leukemia cells, anaplastic lymphoma cells, astrocytoma cells, B-cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, liver cancer cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T-cell lymphoma cells, renal cancer cells, sarcoma cells, gastric cancer cells, carcinoma cells, mesothelioma cells, or sarcoma cells. In some embodiments, the target cells are pathogenic cells.

[0136] In another aspect, provided herein is a method of treating a disease in an individual in need thereof, comprising administering to the individual a first therapy comprising one or more of a chimeric polypeptide, SynRIPR, a nucleic acid, a recombinant cell, or a pharmaceutical composition provided herein, wherein the first therapy treats the disease in the individual. In some embodiments, the method comprises administering to the individual a first therapy comprising an effective number of recombinant cells provided herein, wherein the recombinant cells treat the disease.

[0137] In another aspect, provided herein is a method for aiding in the treatment of a disease in an individual in need thereof, comprising administering to the individual a first therapy comprising one or more recombinant nucleic acids, recombinant cells, or pharmaceutical compositions disclosed herein, and administering to the individual a second therapy, wherein the first and second therapies together treat the disease in the individual. In some embodiments, the method comprises administering to the individual a first therapy comprising an effective number of recombinant cells disclosed herein, wherein the recombinant cells treat the disease.

[0138] Administration of recombinant cells to an individual In some embodiments, the methods involve administering an effective amount or number of recombinant cells of the present disclosure to an individual in need of such methods. This administering step can be accomplished using any transfer method known in the art. For example, the recombinant cells of the present disclosure can be injected directly into the individual's bloodstream by intravenous infusion or can be otherwise administered to the individual.

[0139] The terms "administering," "introducing," and "implanting" are used interchangeably herein and refer to a method of delivering recombinant cells expressing a chimeric receptor provided herein to an individual. In some embodiments, the method comprises administering recombinant cells to an individual by a method or route of administration that results in at least partial localization of the introduced cells at a desired site such that a desired effect occurs. The recombinant cells or their differentiated progeny can be administered by any suitable route that delivers the cells or their differentiated progeny to a desired location in an individual where at least a portion of the administered cells or components of the cells remain viable. The survival period of the cells following administration to an individual can be as short as a few hours, e.g., 24 hours, to long-term engraftment over the life of the individual for several days, years, or even.

[0140] When provided prophylactically, in some embodiments, the recombinant cells described herein are administered to an individual prior to any symptoms of the disease or condition to be treated. Thus, in some embodiments, prophylactic administration of the recombinant stem cell population prevents the onset of symptoms of the disease or condition.

[0141] When provided therapeutically in some embodiments, the recombinant cells are provided at (or after) the onset of a symptom or sign of a disease or condition, e.g., at the onset of a disease or condition.

[0142] For use in the various embodiments described herein, an effective amount of the recombinant cells disclosed herein is at least 10 2 Cells, at least 5 x 10 2 Cells, at least 10 3 Cells, at least 5 x 10 3 Cells, at least 10 4 Cells, at least 5 x 10 4 Cells, at least 10 5 Cells, at least 2 x 10 5 Cells, at least 3 x 10 5 Cells, at least 4 x 10 5 Cells, at least 5 x 10 5 Cells, at least 6 x 10 5 Cells, at least 7 x 10 5 Cells, at least 8 x 10 5 Cells, at least 9 x 10 5 Cells, at least 1 x 10 6 Cells, at least 2 x 10 6 Cells, at least 3 x 10 6 Cells, at least 4 x 10 6 Cells, at least 5 x 10 6 Cells, at least 6 x 10 6 Cells, at least 7 x 10 6 Cells, at least 8 x 10 6 Cells, at least 9 x 10 6The recombinant cells may be derived from one or more donors, or may be obtained from an autologous source (i.e., the human subject being treated). In some embodiments, the recombinant cells are expanded in culture prior to administration to an individual in need thereof.

[0143] In some embodiments, delivery of a composition comprising recombinant cells (i.e., a composition comprising a plurality of recombinant cells expressing any of the chimeric receptors provided herein) to an individual by a method or route results in at least partial localization of the cell composition at a desired site. The cell composition can be administered by any suitable route that results in an effective treatment in the individual, e.g., administration includes administering at least a portion of the delivered composition, e.g., at least 1×10 4 The cells are delivered to the desired site for a period of time, resulting in delivery to the desired site in an individual. Modes of administration include injection, infusion, instillation, etc. "Injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, percutaneous intratracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. For delivery of cells, administration can be performed by injection or infusion.

[0144] In some embodiments, the recombinant cells are administered systemically, in other words, a population of recombinant cells is administered other than directly to a target site, tissue, or organ such that it instead enters the individual's circulatory system and is thus subject to metabolic and other similar processes.

[0145] The efficacy of treatment with the composition for the treatment of a disease or condition can be determined by a skilled clinician. However, one skilled in the art will understand that a treatment is considered to be an effective treatment if any one or all of the signs or symptoms or markers of the disease are improved or ameliorated. Efficacy can also be measured by an individual's inability to deteriorate (e.g., the progression of the disease is stopped or at least slowed) as assessed by the need for hospitalization or medical intervention. Methods for measuring these indications are known to those skilled in the art and / or described herein. Treatment includes any treatment of disease in an individual or animal (some non-limiting examples include humans or mammals) and includes (1) inhibiting disease progression, e.g., stopping or slowing the progression of symptoms; or (2) alleviating the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the onset of symptoms.

[0146] As discussed above, a therapeutically effective amount includes an amount of a therapeutic composition sufficient to promote a particular effect when administered to an individual, such as one having, suspected of having, or at risk for a disease. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the onset of a symptom of a disease, alter the course of a symptom of a disease (such as, but not limited to, slow the progression of a symptom of a disease), or reverse a symptom of a disease. It will be understood that for any given case, the appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.

[0147] The efficacy of treatment, including the disclosed therapeutic compositions for the treatment of disease, can be determined by a skilled clinician. However, a treatment is considered effective if at least any one or all of the signs or symptoms of the disease are improved or ameliorated. Efficacy can also be measured by an individual's inability to deteriorate (e.g., the progression of the disease is stopped or at least slowed) as assessed by the need for hospitalization or medical intervention. Methods for measuring these indications are known to those skilled in the art and / or described herein. Treatment includes any treatment of disease in an individual or animal (some non-limiting examples include humans or mammals) and includes (1) inhibiting the disease, e.g., stopping or slowing the progression of symptoms; (2) alleviating the disease, e.g., causing regression of symptoms; or (3) preventing or reducing the likelihood of the onset of symptoms.

[0148] In some embodiments, the individual is a mammal. In some embodiments, the mammal is a human. In some embodiments, the individual has or is suspected of having a disease associated with inhibition of cell signaling mediated by a cell surface ligand or antigen. Diseases suitable for treatment by the compositions and methods of the present disclosure include, but are not limited to, cancer, autoimmune diseases, inflammatory diseases, and infectious diseases. In some embodiments, the disease is cancer or a chronic infectious disease.

[0149] Methods for CAR design, delivery and expression in T cells, and production of clinical grade CAR-T cell populations are known in the art. See, for example, Lee et al., Clin Cancer Res (2012) 18(10):2780-90, which is incorporated herein by reference in its entirety. For example, engineered CARs can be introduced into cells, e.g., T cells, using retroviruses that efficiently and stably integrate nucleic acid sequences encoding chimeric antigen receptors into the target cell genome. Exemplary methods are described in Examples 4 and 7 below.

[0150] Other methods known in the art include, but are not limited to, lentiviral transduction, transposon-based systems, direct RNA transfection, and CRISPR / Cas systems (e.g., Type I, Type II, or Type III systems using appropriate Cas proteins).

[0151] In some embodiments, recombinant adeno-associated virus (AAV) vectors can be used for delivery. The technology for producing rAAV particles is standard in the art, in which a cell is provided with the polynucleotide to be delivered, the rep and cap genes, and the packaged AAV genome containing helper virus functions. The production of rAAV requires the following components to be present in a single cell (herein referred to as a packaging cell): the rAAV genome, and the AAV rep and cap genes that are separate from the helper virus functions (e.g., not within the rAAV genome). The AAV rep and cap genes can be from any AAV serotype from which a recombinant virus can be derived, and can be from an AAV serotype different from the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, and AAV rh.74. Production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692.

[0152] CAR-T cells can be expanded ex vivo, for example in response to an autoimmune disease antigen, and then re-infused into the subject in therapeutically effective amounts.

[0153] The exact amount of CAR T cells to be administered can be determined by a physician, taking into account individual differences in the subject's age, weight, extent of disease, and condition.

[0154] Administration of T cell therapy may be defined by total cells per infusion or cells per kilogram of body weight, particularly for pediatric subjects (e.g., patients). Because T cells replicate and expand after transplantation, the administered cell dose may differ from the final steady-state cell count. In some embodiments, pharmaceutical compositions comprising the CAR T cells of the present disclosure are administered in doses of 10 4 ~10 10 In another embodiment, the pharmaceutical composition comprising the CAR T cells of the present disclosure may be administered in a dose of 10 3 ~10 8 The antibody may be administered at any dose of cells / kg body weight, including all integer values ​​within these ranges.

[0155] The compositions comprising the CAR T cells of the present disclosure may be administered multiple times at these dosages. The cells may be administered by using injection techniques known in the art (see, for example, Rosenberg et al., New Engl J Med, (1988) 319:1676). The optimal dosage and treatment regimen for a particular subject may be determined by one of skill in the art by monitoring the subject for symptoms of disease and adjusting the treatment accordingly.

[0156] Additional Therapy As mentioned above, the recombinant cells and pharmaceutical compositions described herein can be administered in combination with one or more additional therapeutic agents, such as, for example, chemotherapeutic agents or anti-cancer agents or anti-cancer therapies. Administration "in combination with" one or more additional therapeutic agents includes simultaneous (concurrent) administration and consecutive administration in any order. In some embodiments, the one or more additional therapeutic agents, chemotherapeutic agents, anti-cancer agents or anti-cancer therapies are selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, and surgery. "Chemotherapy" and "anti-cancer agents" are used interchangeably herein. Various classes of anti-cancer agents can be used. Non-limiting examples include alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxins, antibodies (e.g., monoclonal or polyclonal antibodies), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Glivec®)), hormone therapy, soluble receptors, and other antineoplastic agents.

[0157] Thus, in some embodiments, the method of the present disclosure comprises administering to the subject a composition disclosed herein separately as a single therapy (e.g., monotherapy). In some embodiments, the composition of the present disclosure is administered to the subject as a first therapy in combination with a second therapy. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, and surgery. In some embodiments, the first therapy and the second therapy are administered simultaneously. In some embodiments, the first therapy is administered simultaneously with the second therapy. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in alternation. In some embodiments, the first therapy and the second therapy are administered together in a single formulation.

[0158] Methods for modulating cellular activity In another aspect, various methods for modulating the activity of a cell are provided herein. The methods include (a) providing a recombinant cell of the present disclosure; and (b) contacting the recombinant cell with a selected ligand, where binding of the selected ligand to the extracellular binding domain induces cleavage of the ligand-inducible proteolytic cleavage site, releasing a transcription factor, and the released transcription factor modulates the activity of the recombinant cell. Those skilled in the art upon reading this disclosure will understand that the disclosed methods can be performed in vivo, ex vivo, or in vitro.

[0159] Cellular activities that may be modulated using the methods of the present disclosure include, but are not limited to, expression of a selected gene of a cell, proliferation of a cell, apoptosis of a cell, non-apoptotic death of a cell, differentiation of a cell, de-differentiation of a cell, migration of a cell, secretion of molecules from a cell, cell adhesion of a cell, and cytolytic activity of a cell.

[0160] In some embodiments, the released transcriptional regulator regulates the expression of a gene product in the cell. In some embodiments, the released transcriptional regulator regulates the expression of a heterologous gene product in the cell. A heterologous gene product is one that is not normally produced by the cell. For example, the cell can be genetically modified with a nucleic acid that includes a nucleotide sequence that encodes a heterologous gene product.

[0161] In some embodiments, the heterologous gene product is a secreted gene product. In some embodiments, the heterologous gene product is a cell surface gene product. In some cases, the heterologous gene product is a cytoplasmic gene product. In some embodiments, the released transcriptional regulator simultaneously regulates the expression of two or more heterologous gene products in a cell.

[0162] In some embodiments, the heterologous gene product of the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a proliferation inducer, a receptor, an RNA-guided nuclease, a site-specific nuclease, a T cell receptor (TCR), a chimeric antigen receptor (CAR), a toxin, a toxin-derived protein, a transcription regulator, a transcription activator, a transcription repressor, a translation regulator, a translation activator, a translation repressor, an activating immunoreceptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, an engineered T cell receptor, an immune activator, an immune inhibitor, and an inhibitory immunoreceptor.

[0163] In some embodiments, the released transcription factors regulate differentiation of a cell, and the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

[0164] The chimeric receptors of the present disclosure provide a higher degree of expression than standard SynNotch receptors when using the same binding domain and ICD. In some embodiments, depending on the ligand / binding domain pair and their affinity, the SynRIPRs of the present disclosure can provide about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% increased expression over the corresponding SynNotch receptor.

[0165] Additionally, the chimeric receptors of the present disclosure can provide transcriptional regulation that is responsive to the degree of T cell activation independent of ligand binding, allowing for additional flexibility when, for example, it is desirable to enhance or suppress T cell responses upon activation despite the absence of a chimeric receptor ligand.

[0166] Systems and Kits Also provided herein are systems and kits that include the chimeric polypeptides, SynRIPR, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions provided and described herein, as well as instructions for making and using them. For example, in some embodiments, systems and / or kits are provided herein that include one or more of the chimeric polypeptides described herein, SynRIPR, recombinant nucleic acids described herein, recombinant cells described herein, or pharmaceutical compositions described herein. In some embodiments, the systems and / or kits of the present disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) that are used to administer any one of the chimeric polypeptides, SynRIPR, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions provided to an individual. In some embodiments, the kits may have one or more additional therapeutic agents that can be administered simultaneously or sequentially with other kit components for a desired purpose, such as to regulate the activity of cells, inhibit target cancer cells, or treat a disease in an individual in need thereof.

[0167] Any of the above systems and kits may further comprise one or more additional reagents, which may be selected from a dilution buffer, a reconstitution solution, a wash buffer, a control reagent, a control expression vector, a negative control polypeptide, a positive control polypeptide, and reagents for in vitro production of the chimeric receptor polypeptide.

[0168] In some embodiments, the components of the system or kit can be packaged in separate containers. In some other embodiments, the components of the system or kit can be combined in a single container.

[0169] In some embodiments, the system or kit may further include instructions for using the components of the kit to carry out the method. The instructions for carrying out the method are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be present within the kit as a package insert, on a label on the container of the kit or its components (i.e., associated with the package or subpackage), etc. The instructions may be present as an electronic storage data file present on a suitable computer-readable storage medium, such as a CD-ROM, diskette, flash drive, etc. In some examples, the actual instructions are not present within the kit, but a means for obtaining the instructions from a remote source (e.g., via the Internet) may be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions may be recorded on a suitable substrate.

[0170] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0171] No admission is made that any reference cited herein constitutes prior art. The discussion of references states what their authors assert, and the inventors reserve the right to challenge the accuracy and pertinence of the cited documents. Although several sources of information, including scientific journal articles, patent documents, and textbooks, are mentioned herein, it will be clearly understood that this reference is not an admission that any of these documents form part of the common general knowledge in the art.

[0172] The discussion of general methods presented herein is intended for illustrative purposes only: other alternative methods and substitutions will be apparent to those of skill in the art upon review of this disclosure, and are intended to be within the spirit and scope of this application. EXAMPLES

[0173] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology that are well known to those of skill in the art and are fully described in the above-cited references.

[0174] Further embodiments are disclosed in further detail in the following examples, which are provided for illustrative purposes and are not intended to limit the scope of the disclosure or claims in any way.

[0175] Example 1. Design and Construction of Chimeric Receptor and Response Element Constructs This example describes the design and construction of a family of non-Notch-regulated intramembrane proteolytic receptors (SynRIPR) receptors. The receptors were constructed by fusing CD19 scFV (Porter et al., 2011) to an extracellular domain composed of a truncated CD8α (P01732) hinge region (Thr138-Cys164, SEQ ID NO: 158), a transmembrane domain (TMD) and an intracellular juxtamembrane domain (STS, as shown below), and a transcription factor. The transcription factor GAL4-VP64 used in these experiments contained a DNA domain from the yeast GAL4 transcription factor fused to the activation domain VP64, which consists of tetrameric repeats of the minimal activation domain (amino acids 437-447) of the herpes simplex protein VP16.

[0176] Detailed information about various exemplary receptors of the present disclosure can be found in Table 1 below. [Table 1-1] [Table 1-2] [Table 1-3]

[0177] All receptors contain an N-terminal CD8α signal peptide (MALPVTALLLPLALLLHAARP, SEQ ID NO: 162) for membrane targeting and a myc tag (EQKLISEEDL, SEQ ID NO: 163) for proper determination of surface expression by α-myc AF647 (Cell-Signaling No. 2233). For the construction of these receptors, DNA fragments encoding the amino acid sequences provided in the sequence listing were PCR amplified from synthesized gene fragments or plasmids containing the DNA sequences for the indicated proteins and assembled using standard cloning techniques (e.g., overhang PCR, fusion PCR, and in-fusion cloning) with flanking translation start and stop sequences into a modified pHR'SIN:CSW vector (KT Roybal et al., Cell (2016) 167(2):419-32) containing the 3-phosphoglycerate kinase (PGK) promoter for all primary T cell experiments described below.

[0178] The pHR'SIN:CSW vector was also modified to generate a response element plasmid. To this end, five copies of the target sequence for binding of the GAL4 DBD domain (GGAGCACTGTCCTCCGAACG, SEQ ID NO: 164) were cloned 5' to the minimal synthetic pybTATA promoter.

[0179] Also included in the response element plasmid is a PGK promoter that either constitutively drives expression of a fluorophore (mCitrine or mCherry) to properly identify transduced T cells or SynRIPR for single vector experiments. For all inducible chimeric antigen receptor (CAR) vectors, CAR was tagged with a Flag tag at the N-terminus and co-induced with GFP using a T2A element. All induced elements were cloned via a BamHI site in multiple cloning located 3' to the Gal4 response element. All constructs were cloned via In-Fusion® cloning (Takara #638951) according to the manufacturer's instructions.

[0180] Example 2 Isolation and culture of primary human T cells This example describes the isolation and culture of primary human T cells, which were then used in various cell transduction experiments described in Example 3 below.

[0181] In these experiments, primary CD4+ and CD8+ T cells were isolated from anonymous donor blood after apheresis and enriched by negative selection using human T cell isolation kits (human CD4+ or CD8+ enrichment cocktails, STEMCELL Technologies catalog numbers 15062 and 15063). Blood was collected from the Blood Centers of the Pacific (San Francisco, CA) as approved by the University Institutional Review Board. T cells were cryopreserved in growth medium (RPMI-1640, UCSF Cell Culture Core) containing 20% ​​human AB serum (Valley Biomedical Inc., number HP1022) and 10% DMSO. After thawing, T cells were cultured in human T cell medium containing X-VIVO™ 15 (Lonza #04-418Q), 5% human AB serum and 10 mM neutralized N-acetyl-L-cysteine ​​(Sigma-Aldrich #A9165) supplemented with 30 units / mL IL-2 (NCI BRB Preclinical Repository) for all experiments.

[0182] Example 3 Human T cells were stably transduced with lentiviral vectors This example describes the general protocol used for lentiviral transduction of human T cells.

[0183] Generally, lentiviral vectors pseudotyped with vesicular stomatitis virus envelope G protein (VSV-G) (pantropic vectors) were produced by transfecting Lenti-X™ 293T cells (Clontech #11131D) with pHR'SIN:CSW transgene expression vector and viral packaging plasmids pCMVdR8.91 and pMD2.G using Mirus TransIT®-Lenti (Mirus, #MIR 6606). Generally, primary T cells were thawed on the same day and after 24 hours of culture, stimulated with beads with anti-CD3 and anti-CD28 antibodies bound to their surface (Human T-Activator CD3 / CD28 Dynabeads®, Life Technologies #11131D) at a cell:bead ratio of 1:3. After 48 hours, viral supernatants were harvested and primary T cells were exposed to the virus for 24 hours. Five days after T cell stimulation, the beads were removed and T cells were expanded until day 14, at which point they could be rested and used for assays. T cells were sorted for assay on a Beckton Dickinson (BD Biosciences) FACSAria™ II flow cytometer. Sorted T cells were expanded until day 10 for in vivo assays and until day 14 for in vitro assays.

[0184] Example 4 In vitro SynRIPR activation assay For all in vitro SynRIPR activation assays, 1 x 10 5T cells or Jurkat T cells were co-cultured with target cells at a 1:1 ratio in 96-well round-bottom plates (VWR). To exogenously activate T cells, 100ng / mL PMA (Sigma #P1575) or MCAM BiTE was added to the co-culture. When activating the co-expressed ALPPL2 CAR, ALPPL2+K562 cells were added to the co-culture at a 1:1 ratio with T cells. Cultures were analyzed at the indicated time points for reporter activation using a BD FACSymphony Fortessa X-50. All flow cytometry analyses were performed with FlowJo software (BD).

[0185] Example 5 cancer cell lines This example describes the generation of myeloid leukemia "donor" cells that express CD19 at levels comparable to Daudi tumors.

[0186] The cancer cell lines used were K562 myeloid leukemia cells (ATCC number CCL-243) and Daudi B-cell lymphoblasts (ATCC number CCL-213). K562 cells were lentivirally transduced to stably express human CD19 at levels comparable to Daudi tumors. CD19 levels were determined by staining cells with α-CD19 APC (Biolegend® number 302212). All cell lines were screened for transgene expression.

[0187] Example 6 Generation of reporter Jurkat T cells for screening This example describes the generation of reporter Jurkat T cells that are subsequently used for screening of various synthetic receptors containing non-Notch transmembrane domains (TMDs) and / or stop transport sequences (STSs).

[0188] In these experiments, E6-1 Jurkat T cells (ATCC number TIB-152) were lentivirally transduced with a reporter plasmid carrying an inducible Gal4-driven BFP reporter gene and a constitutively expressed mCitrine reporter gene as previously described (KT Roybal et al., Cell, 164:1-10, 2016). Reporter-positive Jurkat cells were sorted and expanded for positive mCitrine expression using a Beckton Dickinson (BD Biosciences) FACSAria™ II flow cytometer.

[0189] Lentiviral particles were produced using receptor transgene expression vectors as previously described (L. Morsut et al., Cell (2016) 164:780-91). Individual cultures of reporter-positive Jurkat T cells were lentivirally transduced in 96-well plates with myc-tagged α-CD19 human SynNotch1 receptors with modified transmembrane domains (TMD) or juxtamembrane domains (STS). After viral transduction, receptor transduction efficiency of each Jurkat cell population was measured using a BD FACSymphony Fortessa X-50 after staining with anti-myc AF647 (Cell-Signaling #2233).

[0190] Example 7 Non-Notch synthesis-regulated intramembrane proteolytic receptor (SynRIPR) This example describes experiments that were performed to demonstrate the control of intramembrane proteolysis in vitro by the exemplary chimeric non-Notch polypeptides described herein.

[0191] In these experiments, the reference receptor was an optimized CD8α Notch receptor (HingeNotch) composed of a truncated CD8α extracellular domain (ECD), the transmembrane domain (TMD) of human Notch1, and the C-terminal juxtamembrane domain (JMD / STS) from Notch1. T cells expressing this anti-CD19 HingeNotch were able to activate response elements in the presence of CD19+K562 donor cells. This activation was boosted when a co-expressed anti-ALPPL2 CAR was activated and provided a T cell activation stimulus. The results of these experiments are shown diagrammatically in Figures 1A-1C.

[0192] All receptors were expressed at high levels, but the active alcadein-gamma (CSTLN2) TMD was observed to be non-functional with the cognate but inactive STS / JMD sequence. Notably, by replacing the Notch1 TMD and JMD / STS with the equivalent domains from CLSTN2, receptor activity was observed to be undetectable. Although the CLSTN2 TMD performed well in previous TMD screening experiments (data not shown), the CLSTN2 JMD / STS was confirmed to be non-functional. It was also observed that restoring the Notch1 JMD restored receptor activity with the CLSTN2 TMD.

[0193] Surprisingly, replacement of the CSTLN2 JMD / STS with the more active JMD / STS from KCNE3 (RSRKVDKR, SEQ ID NO: 146) or PTPRF (KRKRTH, SEQ ID NO: 108) was observed to restore receptor signaling, e.g., producing functional receptors when paired with the CLSTN2 TMD, indicating that the original CLSTN2 JMD was functionally limited.

[0194] In summary, the experimental results described herein demonstrate that assembly of non-Notch SynRIPRs using the CLSTN2 TMD and JMD results in an inactive receptor, but receptor function is restored when the CLSTN2 JMD is replaced with a more capable JMD.

[0195] As mentioned above, all existing functional SynNotch receptors contained sequences derived from Notch family members. To demonstrate the versatility of the modular receptor assembly approach, the experiments described in this example were designed to engineer ligand-activated receptors from the ground up, based on receptor components that completely lacked Notch sequences. The experimental results described herein demonstrate the ability to build new functional synthetic regulated intramembrane proteolytic receptors from a set of functional parts, thereby illustrating that the synthetic biology approach of receptor assembly can generate receptors that function like Notch receptors, but can be rationally customized in their activity.

[0196] Example 8 Modular assembly of SynRIPR This example describes experiments performed to demonstrate that synthetic receptors can be assembled in a modular manner by combining ligand binding domains, ECDs, TMDs, JMDs, and transcription factors.

[0197] In these experiments, the optimized CD8α hinge ECD was selected for further testing due to its robust expression and lack of ligand-independent signaling. In the following experiments, Notch1 JMD(STS) was kept constant for TMD selection, while Notch1 TMD was kept constant for JMD(STS) selection.

[0198] For TMD selection, we combined this CD8α hinge ECD with anti-CD19 scFv, various high-performing TMDs from previous screens, Notch1 JMD, and the transcription factor Gal4VP64. T cells expressing these receptors were co-incubated with CD19+ donor K562 cells for 48 hours and production of the BFP reporter was measured using flow cytometry. The Notch1 TMD and two TMD mutants were selected due to their low levels of ligand-independent signaling.

[0199] For the selection of JMDs, the optimized CD8α hinge ECD was paired with anti-CD19 scFv, Notch1 TMD, various JMDs, and the transcription factor Gal4VP64. T cells expressing these receptors were co-incubated with CD19+ donor K562 cells and the production of the BFP reporter was measured using flow cytometry. Notch1, NRG1, and Notch2 JMDs were selected due to their variable output production levels that allow for signal modulation.

[0200] In these experiments, T cells expressing the high-performance SynRIPR->BFP-expressing circuit were co-incubated with donor cells for 48 hours. BFP output was measured using flow cytometry. The results of these experiments are shown diagrammatically in Figure 2.

[0201] In summary, the experiments described herein demonstrate that by selecting the ECD, TMD, and JMD for further testing, a synthetic regulated intramembrane proteolytic receptor scaffold suitable for clinical translation can be designed and assembled. Exemplary design criteria included robust expression under both basal and activated T cell conditions, high ligand-dependent activation, and low ligand-independent activation. In one exemplary workflow, an optimized CD8α-hinge ECD was first selected for its robust expression and selective responsiveness to ligands, which could then be screened with a selection of high-performing TMDs and JMDs. As the assembly of SynRIPR suggests roughly additive effects of each component on total receptor function, the optimization search could be simplified by screening through TMDs and JMDs with constant Notch1 complementary components. It was decided to keep the TMD of Notch1 due to its robust activation and best-in-class levels of ligand-independent signaling from experiments, as well as the ready availability of mutants for tunability. We screened this ECD-TMD combination against a panel of JMDs and selected a set of SNIPRs (synthetic intramembrane proteolytic receptors) with varying activation levels. We observed that SynRIPR expression levels vary between TMDs and JMDs, but these differences do not fully correlate with receptor activation, which may indicate a more pleiotropic function of JMDs.

[0202] While certain alternatives of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims, and therefore there is no intention to be limited to the precise abstract and disclosure set forth herein. References David L.Porter,M.D.,Bruce L.Levine,Ph.D.,Michael Kalos,Ph.D.,Adam Bagg,M.D.,and Carl H.June,M.D.Chimeric Antigen Receptor-Modified T Cells in Chronic Lymphoid Leukemia.N.Engl J Med.(2011)Aug 25;365(8):725-33。 Gordon WR et al.,The molecular logic of Notch signaling-a structural and biochemical perspective.J.Cell Sci.(2008)121:3109-19。 Gordon WR et al.,Mechanical Allostery:Evidence for a Force Requirement in the Proteolytic Activation of Notch.Dev Cell(2015)33:729-36。 Haapasalo A1,Kovacs DM.The many substrates of presenilin / γ-secretase.J Alzheimers Dis.(2011);25(1):3-28。 Rosmalen M.,Krom M.,and Merkx M.Tuning the Flexibility of Glycine-Serine Linkers To Allow Rational.Biochemistry(2017)56:6565-6574。 Morsut L,Roybal KT,Xiong X,Gordley RM,Coyle SM,Thomson M,and Lim WA.Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors.Cell.(2016)February 11;164(4):780-91。 Naso MF,Tomkowicz B,Perry WL 3rd,Strohl WR.Adeno-Associated Virus(AAV)as a Vector for Gene Therapy.BioDrugs.(2017);31(4):317-34。 Nasri M,Karimi A,Allahbakhshian Farsani M.Production,purification and titration of a lentivirus-based vector for gene delivery purposes.Cytotechnology.(2014);66(6):1031-38。 Roybal KT,Jasper Z.Williams,Leonardo Morsut,Levi J.Rupp,Isabel Kolinko,Joseph H.Choe,Whitney J.Walker,Krista A.McNally,and Wendell A.Lim.Engineering T cells with Customized Therapeutic Response Programs Using Synthetic Notch Receptors.Cell.(2016)Oct 6;167(2):419-32。 Samulski and Muzyczka.AAV-Mediated Gene Therapy for Research and Therapeutic Purposes.Annu.Rev.Virol.(2014)1:427。 Sakuma,et al.(2012).Lentiviral vectors:basic to translational.Biochem.J.443:603。 Watson D.J.,Wolfe J.H.Viral vectors for gene therapy:methods and protocols.Totowa,NJ,USA:Humana Press;(2003).pp.383-404。 Vidarsson G.et al.,IgG subclasses and allotypes:from structure to effector functions.Frontiers Immunol.(2014)Oct 20;5:520。 Zhang et al.,The γ-secretase complex:from structure to function.Frontiers in Cellular Neuroscience.(2014)December 8:427。

Claims

1. From the N-terminus to the C-terminus, a) an extracellular binding domain (ECD) having binding affinity for a selected ligand; b) a linking sequence; and c) a transmembrane domain (TMD), the TMD having at least about 80% sequence identity to the transmembrane domain of a type 1 transmembrane receptor and containing one or more ligand-inducible proteolytic cleavage sites; d) an intracellular domain (ICD) comprising a transcription factor, wherein binding of the selected ligand to the ECD induces cleavage at the ligand-inducible proteolytic cleavage site between the transcription factor and the linking sequence; The chimeric polypeptide does not contain a sequence derived from a Notch receptor.

2. The chimeric polypeptide of claim 1, further comprising a stop transport sequence (STS) located between the TMD and the ICD, the STS being heterologous to the TMD.

3. The chimeric polypeptide of claim 1 or 2, wherein the TMD comprises a polypeptide sequence having at least 80% sequence identity to a transmembrane domain from a type 1 transmembrane receptor and comprises a gamma-secretase cleavage site.

4. The type 1 transmembrane receptor is CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, IFNAR2, IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL 4. The chimeric polypeptide of claim 3, wherein the chimeric polypeptide is selected from the group consisting of: 1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SORT1, SDC1, SDC2, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM, and comprises a γ-secretase cleavage site.

5. 5. The chimeric polypeptide of claim 2, wherein the STS comprises a sequence having at least 70% sequence identity to an STS sequence from CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRP1B, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, PTPRF, or PTPRM.

6. The chimeric polypeptide of any one of claims 1 to 5, wherein the ECD comprises an antigen-binding portion capable of binding to a ligand on the surface of a cell.

7. The chimeric polypeptide of claim 6 , wherein the cell is a pathogenic cell.

8. The chimeric polypeptide of any one of claims 1 to 7, wherein the ligand comprises a protein or a carbohydrate.

9. A chimeric polypeptide described in any one of claims 1 to 8, wherein the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen.

10. The ligand is CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD5 2, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD 95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), C 10. The chimeric polypeptide of any one of claims 1 to 9, wherein the chimeric polypeptide is selected from the group consisting of D183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, and MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), and signal regulatory protein alpha (SIRPα).

11. The chimeric polypeptide according to any one of claims 1 to 10, wherein the ligand is a tumor-associated antigen or a tumor-specific associated antigen.

12. The chimeric polypeptide of any one of claims 1 to 11, wherein the ECD comprises a ligand-binding portion of a receptor.

13. The antigen-binding moiety is an antibody, nanobody, diabody, triabody, or minibody, F(ab') ２ The chimeric polypeptide of any one of claims 6 to 12, which is selected from the group consisting of a fragment, a Fab fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), or a functional fragment thereof.

14. The antigen-binding portion is CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33. , CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, EphrinB2, FAP, FLT3, GD2, GD3, GM3 , GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

15. The chimeric polypeptide of any one of claims 1 to 14, wherein the ligand-inducible proteolytic cleavage site is a γ-secretase cleavage site.

16. The chimeric polypeptide of any one of claims 1 to 15, wherein the transcriptional control factor comprises a transcriptional activator or a transcriptional repressor.

17. 17. The chimeric polypeptide of any one of claims 1 to 16, wherein the ICD comprises a nuclear localization sequence and a transcription regulator sequence selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16.

18. The chimeric polypeptide of any one of claims 2 to 17, wherein the STS comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NOs: 85-156, and 173.

19. The chimeric polypeptide of any one of claims 1 to 18, wherein the hinge domain is capable of promoting oligomerization of the chimeric polypeptide via intermolecular disulfide bonds.

20. The chimeric polypeptide of any one of claims 1 to 19, wherein the linking sequence comprises an amino acid sequence having at least 80% sequence identity to a hinge domain derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any thereof.

21. The chimeric polypeptide of claim 20, wherein the hinge domain comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 157-161.

22. The chimeric polypeptide of any one of claims 1 to 21, wherein the TMD comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-84, 178, 182-185, and 190-192.

23. A recombinant nucleic acid comprising a nucleotide sequence encoding the chimeric polypeptide of any one of claims 1 to 22.

24. a) a chimeric polypeptide according to any one of claims 1 to 22, and / or b) A recombinant cell comprising the recombinant nucleic acid of claim 23.

25. 25. The recombinant cell of claim 24, wherein the cell is a mammalian cell.

26. 26. The recombinant cell of claim 25, wherein the mammalian cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell.

27. 27. The recombinant cell of claim 26, wherein the immune cell is a B cell, monocyte, natural killer cell, basophil, eosinophil, neutrophil, dendritic cell, macrophage, regulatory T cell, helper T cell, cytotoxic T cell, or other T cell.

28. a) a second chimeric polypeptide according to any one of claims 1 to 22, and / or b) a second nucleic acid according to claim 23, 28. The recombinant cell of any one of claims 24 to 27, wherein the first chimeric polypeptide and the second chimeric polypeptide do not have the same sequence and / or the first nucleic acid or the second nucleic acid do not have the same sequence.

29. The recombinant cell of claim 28 , wherein the chimeric polypeptide modulates the expression and / or activity of the second chimeric polypeptide.

30. 30. The recombinant cell of any one of claims 24 to 29, further comprising an expression cassette encoding a protein of interest operably linked to a promoter, wherein expression of the protein is regulated by the transcription factor encoded by the chimeric receptor.

31. 31. The recombinant cell of claim 30, wherein the protein of interest is heterologous to the cell.

32. 32. The recombinant cell of claim 30 or 31, wherein the promoter is GAL4.

33. 33. The recombinant cell of any one of claims 30 to 32, wherein the protein of interest is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor, a de-differentiation factor, an immune cell receptor, or a reporter.

34. A pharma- ceutically acceptable carrier and one of the following: a) a recombinant nucleic acid according to claim 23, or b) one or more of the recombinant cells according to any one of claims 24 to 33.

35. 1. A method for modulating a cellular activity, comprising: a) providing a recombinant cell according to any one of claims 24 to 33; b) contacting the recombinant cell with the selected ligand, wherein binding of the selected ligand to the ECD induces cleavage of a ligand-inducible proteolytic cleavage site, releasing the transcription factor, and the released transcription factor modulates an activity of the recombinant cell.

36. 34. Use of a composition comprising a recombinant cell in the manufacture of a medicament for inhibiting activity of a target cell in an individual, said composition being administered to said individual, said composition comprising a recombinant cell according to any one of claims 24 to 33, said recombinant cell inhibiting activity of said target cell in said individual.

37. A composition comprising a recombinant cell for use in a method for inhibiting the activity of a target cell in an individual, wherein the composition is administered to the individual, and the composition comprises a recombinant cell described in any one of claims 24 to 33.

38. 38. The use of claim 36 or the composition of claim 37, wherein the target cell is an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B cell carcinoma cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a liver cancer cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung carcinoma cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T cell lymphoma cell, a renal carcinoma cell, a sarcoma cell, a gastric cancer cell, a carcinoma cell, a mesothelioma cell, or a sarcoma cell.

39. 26. Use of a composition comprising a recombinant cell in the manufacture of a medicament for the treatment of a disease in an individual in need thereof, wherein said composition is administered to said individual and said recombinant cell comprises a chimeric polypeptide according to any one of claims 1 to 22 and / or a recombinant nucleic acid according to claim 23.

40. A composition comprising a recombinant cell for use in a method for treating a disease in an individual in need thereof, wherein the composition is administered to the individual, and the recombinant cell comprises a chimeric polypeptide described in any one of claims 1 to 22 and / or a recombinant nucleic acid described in claim 23.

41. A method for producing a recombinant cell according to any one of claims 24 to 33, comprising the steps of: a) providing a cell capable of protein expression; b) contacting said provided cell with the recombinant nucleic acid of claim 23.

Images