Methods for identifying and determining the ratios of RNA species in polyvalent RNA compositions

Abstract

Aspects of the present disclosure relate to methods for analyzing compositions that include RNA species with unique nucleotide sequences for RNA discrimination and / or ratio determination. The present disclosure is based, in part, on methods of cleaving discriminating sequences from RNA in a composition and detecting the abundance of each discriminating sequence to quantify the abundance of the corresponding RNA species. Other aspects relate to methods for producing compositions that include more than two RNA species, such as multivalent RNA compositions. The present disclosure is based, in part, on methods of determining the appropriate amount of input DNA for an in vitro transcription (IVT) reaction that will result in transcription of RNA in a predetermined ratio. In some aspects, the present disclosure relates to pharmaceutical compositions that include the multivalent RNA compositions produced by the methods described in this disclosure.

Description

[Technical Field]

[0001] Related Applications This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 169,398, filed April 1, 2021, U.S. Provisional Application No. 63 / 228,957, filed August 3, 2021, U.S. Provisional Application No. 63 / 248,083, filed September 24, 2021, and U.S. Provisional Application No. 63 / 287,722, filed December 9, 2021, each of which is incorporated herein by reference in its entirety.

[0002] Reference to sequence listings submitted as text files via EFS-WEB This application contains a Sequence Listing that has been submitted in ASCII format via EFS-Web, which is incorporated herein by reference in its entirety. The ASCII file, created on March 29, 2022, is named M137870168WO00-SEQ-NTJ and is 7,917 bytes in size. [Background technology]

[0003] Multivalent mRNA constructs are typically produced by transcribing one mRNA product at a time, purifying each mRNA product, and then mixing the purified mRNA products together prior to formulation. This type of process requires significant time and financial investment, especially at a Good Manufacturing Practice (GMP) scale. Summary of the Invention

[0004] Aspects of the present disclosure relate to RNA compositions containing one or more different RNA species (e.g., RNAs encoding different proteins), each of which contains a unique nucleotide sequence that can be used to distinguish the RNA species, and methods for analyzing the same. The present disclosure is based, in part, on the incorporation of unique identifying and / or ratio determining (IDR) sequences into the different RNA species of an RNA composition at similar locations (e.g., within non-coding regions) on each RNA species. Without wishing to be bound by theory, it is believed that RNA can be digested to release RNA fragments containing IDR sequences, and analytical methods can be used to quantify the types and amounts of each IDR-containing RNA fragment, generating a profile of the types and / or amounts of each RNA species in the RNA composition. The use of IDR sequences for analysis allows for the characterization of multivalent RNA compositions containing several different RNA species, even if the multiple RNA species are difficult to distinguish by length or coding sequence. For example, a multivalent RNA composition containing eight RNA species each encoding different serotypes of the same protein may have similar lengths and coding sequences, but each RNA species may contain different IDR sequences in the non-coding regions. Because each IDR sequence unambiguously identifies a particular RNA species, the abundance of the IDR sequences can be measured to determine the abundance of RNA encoding each serotype. Furthermore, the coding sequences of one or more RNA species in a multivalent RNA composition can be modified independently of the IDR sequences (e.g., to alter the structure of the encoded therapeutic protein or antigen), such that the same analytical methods can be used to evaluate RNA compositions in which one or more RNA coding sequences have been modified.

[0005] Additional aspects of the present disclosure relate to methods for producing polyvalent RNA compositions. The present disclosure is based, in part, on methods for determining an appropriate amount of input DNA (e.g., plasmid DNA, chemically synthesized DNA, etc.) for an in vitro transcription (IVT) reaction that will result in transcription of RNA from the input DNA in a predetermined ratio. In some aspects, the present disclosure relates to pharmaceutical compositions comprising polyvalent RNA compositions produced by the methods described herein.

[0006] Accordingly, some embodiments of the present disclosure provide a method for analyzing a polyvalent RNA composition, comprising: (i) contacting a polyvalent RNA composition comprising a first RNA species and a second RNA species with two or more RNase H guide oligonucleotides; (ii) digesting the first RNA species and the second RNA species with an RNase H enzyme to release a plurality of first RNA fragments and a plurality of second RNA fragments; (iii) determining the presence and / or amount of the released first and second RNA fragments.

[0007] In some embodiments, the first RNA species comprises a first discrimination sequence and the second RNA species comprises a second discrimination sequence, wherein the first discrimination sequence and the second discrimination sequence are different.

[0008] In some embodiments, the first and second discrimination sequences each have a nucleotide length independently selected from 1 to 25 nucleotides.

[0009] In some embodiments, the first discriminating sequence is not a sequence variant of the second discriminating sequence.

[0010] In some embodiments, the first and second discrimination sequences have different nucleotide lengths.

[0011] In some embodiments, the first discriminating sequence has a first discriminating mass equal to the mass of RNA consisting of the first discriminating sequence, and the second discriminating sequence has a second discriminating mass equal to the mass of RNA consisting of the second discriminating sequence, and the first discriminating mass and the second discriminating mass are different.

[0012] In some embodiments, the first and second discrimination masses differ by 9 Da or more, 25 Da or more, 50 Da or more, 75 Da or more, or 100 Da or more.

[0013] In some embodiments, measuring comprises detecting the released first and second RNA fragments by LC-MS.

[0014] In some embodiments, measuring comprises detecting the released first and second RNA fragments by LC-UV.

[0015] In some embodiments, the method further comprises calculating the ratio of the amount of the first RNA fragment released to the amount of the second RNA fragment released.

[0016] In some embodiments, the first RNA species comprises a first 5' UTR and the second RNA species comprises a second 5' UTR, and each of the two or more RNase H guide oligonucleotides is capable of hybridizing to a nucleotide sequence in the first 5' UTR and the second 5' UTR.

[0017] In some embodiments, the method comprises cleaving a first 5' UTR to release a first RNA fragment; and cleaving a second 5' UTR to release a second RNA fragment; The first RNA fragment includes a first cap and the second RNA fragment includes a second cap.

[0018] In some embodiments, the first RNA fragment comprises a first discrimination sequence and the second RNA fragment comprises a second discrimination sequence.

[0019] In some embodiments, the method comprises cleaving a first 5' UTR to release a first RNA fragment; and cleaving a second 5' UTR to release a second RNA fragment; The first RNA fragment comprises a first recognition sequence and the second RNA fragment comprises a second recognition sequence.

[0020] In some embodiments, the method comprises: (i) cleaving a first 5'UTR at a position upstream from a first recognition sequence and a position downstream of the first recognition sequence to release a first RNA fragment, wherein the first RNA fragment comprises the first recognition sequence; (ii) cleaving the second 5'UTR at a position upstream from the second recognition sequence and at a position downstream of the second recognition sequence to release a second RNA fragment, wherein the second RNA fragment comprises the second recognition sequence.

[0021] In some embodiments, the first RNA species comprises a first 3'UTR and the second RNA species comprises a second 3'UTR, and each of the two or more RNase H guide oligonucleotides is capable of hybridizing to a nucleotide sequence of the first 3'UTR and the second 3'UTR.

[0022] In some embodiments, the method comprises cleaving a first 3' UTR to release a first RNA fragment; and cleaving a second 3' UTR to release a second RNA fragment; The first RNA fragment comprises a first poly(A) tail and the second RNA fragment comprises a second poly(A) tail.

[0023] In some embodiments, the first RNA fragment comprises a first discrimination sequence and the second RNA fragment comprises a second discrimination sequence.

[0024] In some embodiments, the method comprises cleaving a first 3' UTR to release a first RNA fragment; and cleaving a second 3' UTR to release a second RNA fragment; The first RNA fragment comprises a first recognition sequence and the second RNA fragment comprises a second recognition sequence.

[0025] In some embodiments, the method comprises: (i) cleaving the first 3'UTR at a position upstream from the first recognition sequence and a position downstream of the first recognition sequence to release the first RNA fragment, wherein the first RNA fragment comprises the first recognition sequence; (ii) cleaving the second 3'UTR at a position upstream from the second recognition sequence and at a position downstream of the second recognition sequence to release the second RNA fragment, wherein the second RNA fragment comprises the second recognition sequence.

[0026] In some embodiments, the method comprises contacting a polyvalent RNA composition with first and second RNase H guide oligonucleotides; a first RNase H guide oligonucleotide capable of hybridizing to a sequence upstream from the identifier sequence; A second RNase H guide oligonucleotide is allowed to hybridize to a sequence downstream from the identifier sequence.

[0027] In some embodiments, the nucleotide sequence of the released first RNA fragment and the nucleotide sequence of the released second RNA fragment are identical except for the first discrimination sequence in the first RNA fragment and the second discrimination sequence in the second RNA fragment.

[0028] In some embodiments, each of the two or more RNase H guide oligonucleotides comprises a nucleotide sequence represented by the following formula: [R] p D1D2D3D4[R] q wherein each R is an RNA nucleotide, each D is a DNA nucleotide, and p and q are each independently an integer from 1 to 50.

[0029] In some embodiments, one or more RNA nucleotides of two or more RNase H guide oligonucleotides are modified RNA nucleotides.

[0030] In some embodiments, each RNA nucleotide of the two or more RNase H guide oligonucleotides is a modified RNA nucleotide.

[0031] In some embodiments, one or more modified RNA nucleotides of two or more RNase H guide oligonucleotides are 2'-O-methyl RNA nucleotides.

[0032] In some embodiments, each RNA nucleotide of the two or more RNase H guide oligonucleotides is a 2'-O-methyl RNA nucleotide.

[0033] In some embodiments, one or more modified RNA nucleotides of two or more RNase H guide oligonucleotides are (a) Xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6- Dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxy Oxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine , 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-Propargylaminocytosine, cyanine 3-6-Propargylaminouracil, cyanine 3-Aminoallylcytosine, cyanine 3-Aminoallyluracil, cyanine 5-6-Propargylaminocytosine, cyanine 5-6-Propargylaminouracil, cyanine 5-Aminoallylcytosine, cyanine 5-Aminoallyluracil, cyanine7-aminoallyluracil, dabsyl-5-3-aminoallyluracil, desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBE A-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isocytosine, ... isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonyl a modified nucleobase selected from the group consisting of carbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A); (b) 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'-deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3'-dideoxyribose, 3'-deoxyribose , a modified sugar selected from the group consisting of 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose, and / or (c) modified phosphates selected from the group consisting of phosphorothioates (PS), thiophosphates, 5'-O-methylphosphonates, 3'-O-methylphosphonates, 5'-hydroxyphosphonates, hydroxyphosphates, phosphoroselenoates, selenophosphates, phosphoramidates, carbophosphonates, methylphosphonates, phenylphosphonates, ethylphosphonates, H-phosphonates, guanidinium rings, triazole rings, boranophosphates (BPs), methylphosphonates, and guanidinopropylphosphoramidates.

[0034] In some embodiments, one or more DNA nucleotides of two or more RNase H guide oligonucleotides are modified DNA nucleotides.

[0035] In some embodiments, each DNA nucleotide of the two or more RNase H guide oligonucleotides is a modified DNA nucleotide.

[0036] In some embodiments, one or more modified DNA nucleotides of two or more RNase H guide oligonucleotides is a 5-nitroindole, inosine, 4-nitroindole, 6-nitroindole, 3-nitropyrrole, 2-6-diaminopurine, 2-amino-adenine, or 2-thio-thiamine DNA nucleotide.

[0037] In some embodiments, each of the two or more RNase H guide oligonucleotides does not contain a nucleotide sequence comprising six or more, five or more, or four or more consecutive DNA nucleotides having the same nucleobase.

[0038] In some embodiments, one or more of the RNAs is mRNA.

[0039] In some embodiments, each of the RNAs is an mRNA.

[0040] In some embodiments, one or more of the RNAs is in vitro transcribed (IVT) mRNA.

[0041] In some embodiments, each of the RNAs is an IVT mRNA.

[0042] In some aspects, the present disclosure relates to RNA compositions comprising two or more RNA species, wherein a first RNA species comprises a first discriminating sequence and a second RNA species comprises a second discriminating sequence, wherein the first discriminating sequence and the second discriminating sequence are different.

[0043] In some embodiments, the first and second discrimination sequences each have a nucleotide length independently selected from 1 to 25 nucleotides.

[0044] In some embodiments, the first discriminating sequence is not a sequence variant of the second discriminating sequence.

[0045] In some embodiments, the first and second discrimination sequences have different nucleotide lengths.

[0046] In some embodiments, the first discriminating sequence has a first discriminating mass equal to the mass of RNA consisting of the first discriminating sequence, and the second discriminating sequence has a second discriminating mass equal to the mass of RNA consisting of the second discriminating sequence, and the first discriminating mass and the second discriminating mass are different.

[0047] In some embodiments, the first and second discrimination masses differ by 9 Da or more, 25 Da or more, 50 Da or more, 75 Da or more, or 100 Da or more.

[0048] In some embodiments, one or more of the RNAs is mRNA.

[0049] In some embodiments, each of the RNAs is an mRNA.

[0050] In some embodiments, one or more of the RNAs is in vitro transcribed (IVT) mRNA.

[0051] In some embodiments, each of the RNAs is an IVT mRNA.

[0052] In some embodiments, the RNA composition comprises 2, 3, 4, 5, 6, 7, 8, 9, or 10 RNA species.

[0053] In some embodiments, each RNA species comprises an open reading frame encoding a therapeutic peptide or protein.

[0054] In some embodiments, each RNA species comprises an open reading frame encoding an antigenic peptide or protein.

[0055] In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or up to 100% of the RNA in the RNA composition comprises a poly(A) tail.

[0056] In some embodiments, the amount of each RNA species in the RNA composition is 0.2-5x, 0.3-3x, or 0.5-2x, 0.75-1.4x, 0.8-1.25x, or 0.9-1.15x the amount of each other RNA species in the RNA composition.

[0057] In some embodiments, the present disclosure provides: (a) an RNA composition described herein; (b) one or more pharmaceutically acceptable excipients.

[0058] In some embodiments, the RNA of the RNA composition is packaged in a lipid-based particle.

[0059] In some embodiments, the lipid-based particle is a liposome or a lipid nanoparticle.

[0060] In some aspects, the present disclosure provides a method for generating a polyvalent RNA composition, comprising: (a) combining in a single reaction vessel a linearized first DNA molecule encoding a first RNA and a linearized second DNA molecule encoding a second RNA, wherein the first DNA molecule and the second DNA molecule are obtained from different sources; (b) simultaneously transcribing the linearized first DNA molecule and the linearized second DNA molecule in vitro to obtain a polyvalent RNA composition.

[0061] In some aspects, the present disclosure provides a method for generating a polyvalent RNA composition, comprising: (a) producing a first DNA molecule in a first bacterial cell culture; (b) producing a second DNA molecule in a second bacterial cell culture, wherein the first bacterial cell culture and the second bacterial cell culture are not co-cultured; (c) purifying and linearizing the first DNA molecule and the second DNA molecule; (d) combining the purified and linearized first DNA molecule and the purified and linearized second DNA molecule into a single IVT reaction mixture, and then (e) simultaneously transcribing the first DNA molecule and the second DNA molecule in vitro to obtain a polyvalent RNA composition.

[0062] In some aspects, the present disclosure provides a method for generating a polyvalent RNA composition, comprising: (a) simultaneously transcribing in vitro at least two DNA molecules in a reaction mixture, wherein the at least two DNA molecules are: (i) a first population of DNA molecules encoding a first RNA; (ii) a second population of DNA molecules encoding a second RNA that is different from the first RNA; transcribing, wherein the amounts of the first and second populations of DNA molecules present in the reaction mixture prior to the initiation of IVT are normalized; (b) obtaining a polyvalent RNA composition.

[0063] In some aspects, the present disclosure provides a method for generating a polyvalent RNA composition, comprising: (a) simultaneously transcribing in vitro at least two DNA molecules in a reaction mixture, wherein the at least two DNA molecules are: (i) a first population of DNA molecules encoding a first RNA; (ii) a second population of DNA molecules encoding a second RNA that is different from the first RNA; (b) obtaining a multivalent RNA composition having a predetermined ratio of the first RNA to the second RNA produced by the IVT of step (a), wherein the multivalent RNA composition comprises more than 40% poly-A tailed RNA.

[0064] In some aspects, the present disclosure provides a method for generating a polyvalent RNA composition, comprising: (a) simultaneously transcribing in vitro at least two DNA molecules in a reaction mixture, wherein the at least two DNA molecules are: (i) a first population of DNA molecules encoding a first RNA; (ii) a second population of DNA molecules encoding a second RNA that differs in length from the first RNA by at least 100 nucleotides; (b) obtaining a polyvalent RNA composition having a predetermined ratio of the first RNA to the second RNA produced by the IVT of step (a).

[0065] In some embodiments, the first and / or second populations of DNA molecules comprise plasmid DNA (pDNA), chemically synthesized DNA, or complementary DNA (cDNA).

[0066] In some embodiments, the IVT comprises co-transcriptional capping.

[0067] In some embodiments, the first RNA and / or the second RNA comprises a 5' cap.

[0068] In some embodiments, at least 75% of the first RNAs each comprise a polyA tail.

[0069] In some embodiments, at least 75% of the second RNAs each comprise a polyA tail.

[0070] In some embodiments, the first RNA and / or the second RNA comprises messenger RNA (mRNA).

[0071] In some embodiments, the first RNA and / or the second RNA encodes a therapeutic peptide or protein.

[0072] In some embodiments, the first RNA and / or the second RNA encodes an antigenic peptide or protein.

[0073] In some embodiments, normalization is based on molar mass, degradation rate (e.g., of input DNA and / or output RNA), nucleotide content, purity, and / or poly-A tail efficiency.

[0074] In some embodiments, the molar amounts of the first and second populations of DNA molecules are normalized according to the higher poly-A tail efficiency between the first and second DNA populations.

[0075] In some embodiments, the reaction mixture further comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional populations of DNA.

[0076] In some embodiments, the polyvalent RNA composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional RNAs.

[0077] In some embodiments, each of the additional RNAs encodes a therapeutic peptide or protein.

[0078] In some embodiments, the method further comprises purifying the polyvalent RNA composition from the reaction mixture.

[0079] In some embodiments, the purifying comprises chromatography or gel electrophoresis.

[0080] In some embodiments, the purifying comprises column chromatography.

[0081] In some embodiments, the first RNA and / or the second RNA comprises a 5' untranslated region (5'UTR).

[0082] In some embodiments, the first RNA and / or the second RNA comprises a 3' untranslated region (3'UTR).

[0083] In some embodiments, the polyvalent RNA composition has a predetermined ratio of the first RNA to the second RNA.

[0084] In some aspects, the present disclosure relates to polyvalent RNA compositions produced by the methods described herein.

[0085] In some aspects, the present disclosure provides: (a) a polyvalent RNA composition described herein; (b) one or more pharmaceutically acceptable excipients.

[0086] In some embodiments, the RNA of the multivalent RNA composition is packaged in a lipid-based particle.

[0087] In some embodiments, the lipid-based particle is a liposome or a lipid nanoparticle. [Brief explanation of the drawings]

[0088] [Figure 1] 1 shows a schematic diagram illustrating the generation of a multivalent RNA composition. A shows a workflow in which each RNA of the multivalent RNA composition is transcribed separately, purified, mixed, and then formulated into a multivalent composition. B shows a workflow, according to some embodiments, in which more than two DNAs are in vitro transcribed (IVT) in a single reaction, and the resulting multivalent RNA composition is purified and formulated without further mixing of the RNAs. [Figure 2] Representative data comparing RNA produced by co-transcription and mixing are shown. The data show that while the mixture has the same slope and linear correlation, simultaneous in vitro transcription (co-IVT) of DNA1 and DNA2 has a different slope and linear correlation. No obvious length bias across different input amounts of DNA was observed. [Figure 3A] Representative RNase T1 fingerprint analysis data are shown. Representative RNase T1 fingerprint data are shown, which demonstrate that simultaneous IVT RNAs mixed at different ratios (e.g., 0% RNA1 and 100% RNA2 vs. 100% RNA1 and 0% RNA2) produce different RNase T1 fingerprints. [Figure 3B] Representative RNase T1 fingerprint analysis data are shown. Representative data are shown showing that concurrent IVT RNA and mixed RNA have the same RNase T1 fingerprint. [Figure 4A] Representative data for normalization of input DNA is shown. A linear graph is shown showing the production of RNA1 at non-normalized mass ratio inputs of DNA1 and DNA2 in IVT reactions producing RNA1 and RNA2. The Y=X dotted line indicates no mass ratio compositional bias between DNA input and RNA output. The data shows mass ratio compositional bias, as no points fall within or near the dotted line. [Figure 4B] Representative data for input DNA normalization are shown. A linear graph showing the production of RNA1 at normalized molar ratio inputs of DNA1 and DNA2 IVT reactions producing RNA1 and RNA2 is shown. The Y=X dotted line indicates no compositional bias due to molar ratio between DNA input and RNA output. The data does not show compositional bias as no points for normalized DNA input fall within or near the dotted line. [Figure 4C] Representative data for input DNA normalization are shown. A linear graph is shown showing the production of RNA3 at non-normalized molar ratios of DNA3 and DNA4 input in IVT reactions using T7 polymerase variants that produce RNA1 and RNA2. The Y=X dotted line indicates no compositional bias due to mass ratio between DNA input and RNA output. The data show compositional bias due to molar ratio, as no points fall within or near the dotted line. [Figure 4D] Representative data for input DNA normalization are shown. A linear graph is shown showing the production of RNA3 at normalized molar ratio inputs for DNA3 and DNA4 IVT reactions using T7 polymerase variants that produce RNA1 and RNA2. The Y=X black dotted line indicates the absence of compositional bias due to molar ratio between DNA input and RNA output. The data do not show compositional bias, as no points for normalized DNA input fall within or near the dotted line. [Figure 5] Representative data from simultaneous IVT of two monoclonal antibodies (Ab1 and Ab2) are shown. (A) Representative data showing a higher polyA tail percentage in the LC-encoded RNA than in the HC-encoded RNA for both antibodies. (B) Representative data showing no compositional bias introduced during polyA purification. [Figure 6] Representative data are shown where normalizing the input DNA mass to the most efficient poly-A tailed RNA resulted in the production of multivalent antibody RNA compositions that not only had the correct ratio of HC:LC, but also the RNA in those compositions was poly-A tailed. [Figure 7] Mass spectra of RNA fragments containing three different IDR sequences are shown. [Figure 8A] 1 shows a mass spectrum of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. 2 shows a mass spectrum of cleavage using the first IDR sequence. [Figure 8B] Figure 8A shows the mass spectrum of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. Figure 8B shows the deconvoluted mass spectrum showing the average masses of the fragments shown in Figure 8A. [Figure 8C] Mass spectra of RNA fragments produced by RNase H-mediated cleavage are shown, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by the RNase. Mass spectra of cleavage using a second IDR sequence are shown. [Figure 8D] Figure 8C shows the mass spectrum of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. Figure 8C shows the deconvoluted mass spectrum showing the average masses of the fragments shown. [Figure 8E]Mass spectra of RNA fragments produced by RNase H-mediated cleavage are shown, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by the RNase. Mass spectra of cleavage using a third IDR sequence are shown. [Figure 8F] Figure 8D shows the mass spectrum of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. Figure 8E shows the deconvoluted mass spectrum showing the average mass of the fragments shown. [Figure 8G] Mass spectra of RNA fragments produced by RNase H-mediated cleavage are shown, where a DNA guide is hybridized to RNA and the RNA:DNA hybrid is cleaved by RNase H. Mass spectra of cleavage using a fourth IDR sequence are shown. [Figure 8H] Figure 8G shows the mass spectrum of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. Figure 8G shows the deconvoluted mass spectrum showing the average masses of the fragments shown. [Figure 8I] Mass spectra of RNA fragments produced by RNase H-mediated cleavage are shown, where a DNA guide is hybridized to RNA and the RNA:DNA hybrid is cleaved by the RNase. Mass spectra of cleavage using a fifth IDR sequence are shown. [Figure 8J] Figure 8I shows the mass spectrum of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide was hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. Figure 8I shows the deconvoluted mass spectrum showing the average masses of the fragments shown. [Figure 8K]Mass spectra of RNA fragments produced by RNase H-mediated cleavage are shown, where a DNA guide is hybridized to RNA and the RNA:DNA hybrid is cleaved by the RNase. Mass spectra of cleavage using a sixth IDR sequence are shown. [Figure 8L] Figure 8 shows mass spectra of RNA fragments produced by RNase H-mediated cleavage, where a DNA guide hybridized to RNA and the RNA:DNA hybrid was cleaved by RNase H. Figure 8K shows a deconvoluted mass spectrum showing the average mass of the fragments shown. The vertical lines in Figures 8A, 8C, 8E, 8G, 8I, and 8K represent the expected positions of RNase H-mediated cleavage. [Figure 9] Antigen-specific IgG titers in sera from mice immunized with a tetravalent mRNA mixture containing four mRNAs (RNA5, RNA6, RNA7, and RNA8). Each composition contains either mRNA without a distinguishing sequence (groups 2-5) or mRNA with a distinct distinguishing sequence (groups 6-9). Mice were immunized with 0.5 μg, 1 μg, 2 μg, or 4 μg of a given mRNA composition (N = 10 per dose group, 5 per PBS control group), and serum was collected on day 21. A shows Ag5-specific IgG titers. B shows Ag6-specific IgG titers. C shows Ag7-specific IgG titers. D shows Ag8-specific IgG titers. DETAILED DESCRIPTION OF THE INVENTION

[0089] Aspects of the present disclosure relate to methods for generating and / or analyzing compositions comprising polyvalent, distinct RNAs (e.g., two or more distinct RNAs). In some aspects, the present disclosure is based on methods for selecting the amount of input DNA for an IVT reaction, resulting in a polyvalent RNA composition with higher purity than RNA compositions generated using previous methods. As further described in the Examples, it has been observed that certain features or characteristics of co-transcribed (e.g., simultaneously transcribed in vitro) DNA molecules, such as differences in length between DNA molecules, poly-A tail efficiency of DNA molecules, and / or other reagents present in the simultaneous IVT reaction mixture (e.g., RNA polymerase, nucleotide triphosphates (NTPs), etc.), can introduce compositional bias into the resulting polyvalent RNA composition. Surprisingly, methods for reducing such compositional bias have been discovered. In some embodiments, modifying the amount of input DNA results in the generation of a polyvalent RNA composition with increased purity (e.g., as measured by the percentage of RNA containing a poly-A tail) compared to RNA compositions generated by previous methods. It was also a surprising discovery that the simultaneous IVT methods described herein result in highly pure polyvalent RNA compositions even when there is a large difference in the length of the input DNA used in the IVT reactions (e.g., more than 100 nucleotides).

[0090] Thus, in some aspects, the present disclosure relates to a method for generating a multivalent RNA composition, comprising simultaneously in vitro transcribing at least two DNA molecules in a reaction mixture comprising a first population of DNA molecules encoding a first RNA and a second population of DNA molecules encoding a second RNA different from the first RNA, and obtaining a multivalent RNA composition having a predetermined ratio of first RNA to second RNA generated by IVT.

[0091] As used herein, the term "multivalent RNA composition" refers to a composition containing more than two different mRNAs. A multivalent RNA composition can contain two or more different RNAs, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNAs. In some embodiments, a multivalent RNA composition contains more than 10 different RNAs. The term "different RNA" refers to any RNA that is not identical to another RNA in the multivalent RNA composition. For example, two RNAs are different if they have i) different lengths (regardless of whether the RNAs are identical throughout the shorter of the two lengths), ii) different nucleotide sequences, iii) different chemical modification patterns, or iv) any combination of the above.

[0092] In some embodiments, the mRNAs present in a multivalent mRNA composition are in a predetermined mRNA ratio, which can include ratios of 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNAs (e.g., depending on the number of different RNAs in the composition). In some embodiments, the predetermined ratio includes ratios between more than 10 RNAs. As used herein, "predetermined mRNA ratio" refers to the desired final ratio of RNA molecules in a multivalent RNA composition. The desired final ratio of an RNA composition varies depending on the final peptide(s) or polypeptide product(s) encoded by the RNAs. For example, a multivalent RNA mixture can include two RNAs (e.g., RNAs encoding an antibody heavy chain (HC) and an antibody light chain (LC)); in this example, the desired final ratio of RNA molecules can be 1 HC RNA:1 LC RNA. In another example, a multivalent RNA composition can include several (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more) RNAs encoding different antigenic peptides (e.g., for use as a vaccine), in which case the desired ratio can include 3 to 10 RNAs (e.g., a:b:c, a:b:c:d, a:b:c:d:e, a:b:c:d:e:f, a:b:c:d:e:f:g, a:b:c:d:e:f:g:h, a:b:c:d:e:f:g:h:i, a:b:c:d:e:f:g:h:i:j, etc., where each of a-h is a number between 1 and 100).

[0093] nucleic acid Aspects of the present disclosure relate to compositions comprising nucleic acids. As used herein, the term "nucleic acid" refers to a molecule comprising multiple nucleotides (i.e., a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and an interchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T), or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G))). As used herein, the term nucleic acid refers to polyribonucleotides and polydeoxyribonucleotides. The term nucleic acid also includes polynucleosides (i.e., polynucleotides minus the phosphate) and any other organic base containing polymers. Non-limiting examples of nucleic acids include chromosomes, genomic loci, genes or gene segments encoding polynucleotides or polypeptides, coding sequences, non-coding sequences of genes (e.g., introns, 5'-UTR, or 3'-UTR), pri-mRNA, pre-mRNA, cDNA, mRNA, etc. Nucleic acids (e.g., mRNA) can contain substitutions and / or modifications. In some embodiments, the substitutions and / or modifications are in one or more of the bases and / or sugars. For example, in some embodiments, nucleic acids (e.g., mRNA) include nucleic acids having backbone sugars covalently linked to a low molecular weight organic group other than a hydroxyl group at the 2' position and a low molecular weight organic group other than a phosphate or hydroxy group at the 5' position. Thus, in some embodiments, substituted or modified nucleic acids (e.g., mRNA) contain 2'-O-alkylated ribose groups. In some embodiments, modified nucleic acids (e.g., mRNA) include sugars such as hexose, 2'-F hexose, 2'-aminoribose, constrained ethyl (cEt), locked nucleic acid (LNA), arabinose, or 2'-fluoroarabinose instead of ribose. Thus, in some embodiments, nucleic acids (e.g., mRNA) are heterogeneous in backbone composition, thereby containing any possible combination of polymer units linked together, such as peptide-nucleic acids (having an amino acid backbone with nucleobases).

[0094] Nucleic acid sequences include nucleic acid sequences that have been removed from their naturally occurring environment, recombinant or cloned DNA isolates, and chemically synthesized analogs or biologically synthesized analogs from heterologous systems.

[0095] An "engineered nucleic acid" is a nucleic acid that does not occur in nature. However, it should be understood that an engineered nucleic acid may not occur in nature as a whole, but may contain naturally occurring nucleotide sequences. In some embodiments, an engineered nucleic acid contains nucleotide sequences from different organisms (e.g., different species). For example, in some embodiments, an engineered nucleic acid contains bacterial, human, and / or viral nucleotide sequences. Engineered nucleic acids include recombinant and synthetic nucleic acids. A "recombinant nucleic acid" is a molecule constructed by linking nucleic acids (e.g., isolated nucleic acids, synthetic nucleic acids, or a combination thereof) and, in some embodiments, capable of replicating within a living cell. A "synthetic nucleic acid" is a molecule that is amplified or synthesized chemically or by other means. Synthetic nucleic acids include those that are chemically modified or otherwise modified, but are capable of base-pairing with naturally occurring nucleic acid molecules. Recombinant and synthetic nucleic acids also include those molecules that result from replicating any of the foregoing. Nucleic acids may contain naturally occurring and / or non-naturally occurring nucleotides, such as modified nucleotides.

[0096] In some embodiments, the nucleic acid is present in (or on) a vector. Examples of vectors include, but are not limited to, bacterial plasmids, phages, cosmids, fesmids, fosmids, bacterial artificial chromosomes, yeast artificial chromosomes, viruses and retroviruses (e.g., vaccinia, adenovirus, adeno-associated virus, lentivirus, herpes simplex virus, Epstein-Barr virus, fowlpox virus, pseudorabies, baculovirus), and vectors derived therefrom. In some embodiments, the nucleic acid (e.g., DNA) used as an input molecule for in vitro transcription (IVT) is present in a plasmid vector.

[0097] The term "isolated," when applied to a nucleic acid sequence, indicates that the polynucleotide sequence has been removed from its natural genetic environment and is therefore free of other foreign or undesired coding sequences (but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators), and is in a form suitable for use in engineered protein production systems. Such isolated molecules are separated from their natural environment.

[0098] In some embodiments, input DNA for IVT is a nucleic acid vector. A "nucleic acid vector" is a polynucleotide carrying at least one foreign or heterologous nucleic acid fragment. A nucleic acid vector can function like a "molecular carrier" to deliver nucleic acids or polynucleotide fragments to a host cell or as a template for IVT. "In vitro transcription template" (IVT template), or "input DNA," as used herein, refers to deoxyribonucleic acid (DNA) suitable for use in an IVT reaction to produce messenger RNA (mRNA). In some embodiments, an IVT template encodes a 5' untranslated region, contains an open reading frame, encodes a 3' untranslated region, and a polyA tail. The specific nucleotide sequence composition and length of the IVT template will vary depending on the mRNA of interest encoded by the template.

[0099] In some embodiments, the nucleic acid vector is a circular nucleic acid such as a plasmid. In other embodiments, it is a linearized nucleic acid. According to some embodiments, the nucleic acid vector contains a predetermined restriction site that can be used for linearization. The linearization restriction site determines where the vector nucleic acid is opened / linearized. The restriction enzyme selected for linearization preferably cuts within a critical component of the vector.

[0100] A nucleic acid vector can contain an insert that may be an expression cassette or open reading frame (ORF). An "open reading frame" is a continuous stretch of DNA that begins with a start codon (e.g., methionine (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA) and encodes a protein or peptide (e.g., a therapeutic protein or peptide). In some embodiments, the expression cassette encodes an RNA that includes at least the following elements: a 5' untranslated region, an open reading frame region encoding the mRNA, a 3' untranslated region, and a polyA tail. The open reading frame can encode any mRNA sequence or portion thereof.

[0101] In some embodiments, the nucleic acid vector comprises a 5' untranslated region (UTR). A "5' untranslated region" (UTR) refers to a region of an mRNA directly upstream (i.e., 5') from the start codon (i.e., the first codon of an mRNA transcript translated by a ribosome) that does not encode a protein or peptide. 5' UTRs are further described herein, e.g., in the section entitled "Untranslated Regions."

[0102] In some embodiments, the nucleic acid vector comprises a 3' untranslated region (UTR). A "3' untranslated region" (UTR) refers to the region of an mRNA directly downstream (i.e., 3') from a stop codon (i.e., a codon in an mRNA transcript that signals translation termination) that does not encode a protein or peptide. 3' UTRs are further described herein, e.g., in the section entitled "Untranslated Regions."

[0103] The terms 5' and 3' are used herein to describe properties of nucleic acid sequences related to either the location of genetic elements and / or the direction of events (5' to 3'), such as, for example, transcription by RNA polymerase or translation by ribosomes proceeding in a 5' to 3' direction. Synonyms are upstream (5') and downstream (3'). Conventionally, DNA sequences, genetic maps, vector cards, and RNA sequences are drawn 5' to 3' from left to right, or the 5' to 3' direction is indicated by an arrow, with the arrowhead pointing in the 3' direction. Thus, 5' (upstream), when following this convention, refers to genetic elements positioned toward the left, and 3' (downstream) refers to genetic elements positioned toward the right.

[0104] Aspects of the present disclosure relate to a population of molecules.As used herein, "population" of molecules (e.g., DNA molecules) generally refers to a preparation (e.g., a plasmid preparation) that contains multiple copies of the molecule of interest (e.g., DNA), for example, a cell extract preparation that contains multiple expression vectors that code for the molecule of interest (e.g., the DNA that codes for the RNA of interest).

[0105] Nucleic acids (e.g., mRNA) typically contain multiple nucleotides. A nucleotide contains a nitrogenous base, a pentose sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) contains a nucleobase and one phosphate linked to a ribose. A nucleoside diphosphate (NDP) contains a nucleobase and two phosphates linked to a ribose. A nucleoside triphosphate (NTP) contains a nucleobase and three phosphates linked to a ribose. A nucleotide analog is a compound that has the general structure of a nucleotide or is structurally similar to a nucleotide. Nucleotide analogs include, for example, nucleobase analogs, sugar analogs, and / or analogs of the phosphate group(s) of a nucleotide.

[0106] A nucleoside contains a nitrogenous base and a pentose sugar. Thus, a nucleoside and a phosphate group form a nucleotide. A nucleoside analog is a compound that has the general structure of a nucleoside or is structurally similar to a nucleoside. For example, a nucleoside analog includes a nucleic acid base analog and / or a nucleoside sugar analog.

[0107] The term "nucleotide" should be understood to include naturally occurring, synthetic, and modified nucleotides, unless otherwise specified. Examples of naturally occurring nucleotides provided herein for use in generating RNA, e.g., in IVT reactions, include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (mTP). 5 In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used.

[0108] Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotides, trinucleotides, tetranucleotides, cap analogs, or precursors / substrates for enzymatic capping (e.g., vaccinia or ligase), nucleotides labeled with functional groups to facilitate ligation / conjugation of the cap or 5' portion (IRES), nucleotides labeled with 5'PO4 to facilitate ligation of the cap or 5' portion, or nucleotides labeled with functional groups / protecting groups that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited to, ganciclovir, entecavir, telbivudine, vidarabine, and cidofovir.

[0109] Modified nucleotides can include modified nucleobases. For example, an RNA transcript (e.g., an mRNA transcript) can include a modified nucleobase selected from pseudouridine (ψ), 1-methylpseudouridine (m1ψ), 1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine (mo5U), and 2'-O-methyluridine. In some embodiments, an RNA transcript (eg, an mRNA transcript) includes a combination of at least two (eg, 2, 3, 4 or more) of the foregoing modified nucleobases.

[0110] In vitro transcription (IVT)

[0003] Aspects of the present disclosure relate to methods for producing (synthesizing) RNA transcripts (e.g., mRNA transcripts), comprising contacting a DNA template (e.g., first input DNA and second input DNA) with an RNA polymerase (e.g., T7 RNA polymerase, a T7 RNA polymerase variant, etc.) under conditions that result in the production of an RNA transcript. This process is referred to as "in vitro transcription" or "IVT." IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system containing dithiothreitol (DTT) and magnesium ions, and an RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA required for a particular application. A typical IVT reaction is performed by incubating a DNA template with an RNA polymerase and nucleoside triphosphates containing GTP, ATP, CTP, UTP (or nucleotide analogs) in a transcription buffer. RNA transcripts with a 5'-terminal guanosine triphosphate are produced from this reaction.

[0111] In some embodiments, wild-type T7 polymerase is used in the IVT reaction. In some embodiments, modified or mutant T7 polymerase is used in the IVT reaction. In some embodiments, the T7 RNA polymerase variant comprises an amino acid sequence that shares at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity with wild-type T7 (WT T7) polymerase. In some embodiments, the T7 polymerase variant is a T7 polymerase variant described in International Application Publication No. WO 2019 / 036682 or WO 2020 / 172239, the contents of each of which are incorporated herein by reference. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase or T7 RNA polymerase variant) is present in the reaction (e.g., IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase may be present in the reaction at a concentration of 0.01 mg / mL, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml, or 1.0 mg / ml.

[0112] "Percent identity," "sequence identity," "% identity," or "% sequence identity" (which may be used interchangeably herein) of two sequences (e.g., nucleic acids or amino acids) refers to a quantitative measure of similarity between two sequences (e.g., nucleic acids or amino acids). Percent identity can be determined using the algorithm of Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul et al., J. Mol. Biol. 215:403-10, 1990. BLAST protein searches can be performed using the XBLAST program (score = 50, word length = 3) to obtain amino acid sequences homologous to a protein molecule of interest. When gaps exist between two sequences, gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. When percent identity is listed, or ranges thereof (e.g., at least, greater than, etc.), unless otherwise specified, the endpoints should be inclusive, and the range (e.g., at least 70% identity) is intended to include all ranges within the cited range.

[0113] The input deoxyribonucleic acid (DNA) serves as a nucleic acid template for an RNA polymerase. The DNA template may comprise a polynucleotide encoding a polypeptide of interest (e.g., an antigenic polypeptide). In some embodiments, the DNA template comprises an RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from the polynucleotide encoding the polypeptide of interest and operably linked to the polynucleotide. The DNA template may also comprise a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest. In some embodiments, the input DNA comprises plasmid DNA (pDNA). As used herein, "plasmid DNA" or "pDNA" refers to an extrachromosomal DNA molecule that is physically separated from chromosomal DNA in a cell and can replicate independently. In some embodiments, the plasmid DNA is isolated from the cell (e.g., as a plasmid DNA preparation). In some embodiments, the plasmid DNA comprises an origin of replication that may contain one or more heterologous nucleic acids, such as a nucleic acid encoding a therapeutic protein that can serve as a template for an RNA polymerase. Plasmid DNA can be circularized or linear (eg, plasmid DNA linearized by restriction enzyme digestion).

[0114] In some embodiments, each input DNA (e.g., population of input DNA molecules) in a simultaneous IVT reaction is obtained from a different source (e.g., separately synthesized, e.g., in a different cell or cell population). In some embodiments, each input DNA (e.g., population of input DNA) is obtained from a different bacterial cell or population of bacterial cells. For example, in a simultaneous IVT reaction having three populations of input DNA, the first input DNA is produced in bacterial cell population A, the second input DNA is produced in bacterial cell population B, and the third input DNA is produced in bacterial population C, where each of A, B, and C is not the same bacterial culture (e.g., co-cultured in the same vessel or plate). In another example, two input DNAs obtained from different sources are either i) chemically synthesized in separate synthesis reactions or ii) produced by separate amplification (e.g., polymerase chain reaction (PCR) reactions). Methods for obtaining populations of input DNA (e.g., plasmid DNA) are known, for example, as described by Sambrook, Joseph. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.

[0115] Some aspects include normalizing the amount of DNA used in the multivalent simultaneous IVT reaction. In some embodiments, normalization is based on the molar mass of the input DNA. In some embodiments, normalization is based on the degradation rate of the input DNA. In some embodiments, normalization is based on the degradation rate of the resulting mRNA (e.g., measured based on polyA variants, or T7 polymerase-deficient or truncated transcripts present in the reaction mixture). In some embodiments, normalization is based on the nucleotide content of the input DNA (e.g., the amount of A, G, C, U, or any combination thereof). In some embodiments, normalization is based on the purity of the input DNA. In some embodiments, normalization is based on the polyA tail efficiency of the input DNA. In some embodiments, normalization is based on the length of the input DNA.

[0116] In some embodiments, normalization is based on the lowest level present in the input DNA (e.g., lowest molar mass, degradation rate (e.g., of the input DNA and / or output RNA), nucleotide content, purity, and / or poly-A tail efficiency). In some embodiments, normalization is based on the highest level present in the input DNA (e.g., highest molar mass, degradation rate (e.g., of the input DNA and / or output RNA), nucleotide context, purity, and / or poly-A tail efficiency). In some embodiments, normalization is based on the rate of RNA production of the input DNA (e.g., the highest rate of RNA production of the input DNA or the lowest rate of RNA production of the input DNA in the reaction mixture).

[0117] In some aspects, the present disclosure relates to IVT methods in which the amount of input DNA (e.g., a first DNA or a second DNA) is adjusted or normalized to improve the production of a multivalent RNA composition with a predefined component mRNA ratio. The present disclosure is based, in part, on the discovery that certain factors that affect the purity of a multivalent RNA composition, such as large size differences between input DNAs (e.g., differences of 100, 200, 500, 1000, or more nucleotides in length) and / or the polyA tail efficiency of a given DNA during IVT, can be addressed prior to IVT by normalizing the amount of input DNA based on one or more of these factors. For example, in some embodiments, the amounts of two input DNAs are calculated based on the desired molar ratio of the first RNA to the second RNA to be transcribed from the input DNA. In some embodiments, the calculation includes determining a plasmid mass ratio based on the desired molar ratio of the input DNAs. In some embodiments, the amount of input DNA is normalized based on the highest polyA tail efficiency of the input DNA during IVT.

[0118] The number of input DNAs (e.g., a population of input DNA molecules) used in an IVT reaction can vary depending on the number of different RNA molecules desired to be included in a polyvalent RNA composition. In some embodiments, an IVT reaction mixture contains two or more different input DNAs, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different input DNAs. In some embodiments, an IVT reaction contains more than 10 different input DNAs. The term "different input DNAs" encompasses input DNAs that encode different RNAs, e.g., i) different lengths (whether the RNAs are identical throughout the shorter of the two lengths), ii) different nucleotide sequences, iii) different chemical modification patterns, or iv) any combination of the foregoing.

[0119] The concentration of each population of DNA molecules can also vary. In some embodiments, the concentration of each population of DNA molecules in the IVT reaction ranges from about 0.005 mg / mL to about 0.5 mg / mL. In some embodiments, the concentration of each population of DNA molecules in the IVT reaction ranges from about 0.02 mg / mL to about 0.05 mg / mL, 0.02 mg / mL to about 0.15 mg / mL, about 0.05 mg / mL to about 0.20 mg / mL, about 0.175 mg / mL to about 0.3 mg / mL, about 0.2 mg / mL to about 0.5 mg / mL, about 0.3 mg / mL to about 0.6 mg / mL, about 0.5 mg / mL to about 0.75 mg / mL, about 0.5 ...5 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.6 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.5 mg / mL, about 0.5 mg / mL to about 0.5 / ml to about 1.0 mg / ml, about 0.75 mg / ml to about 0.9 mg / ml, about 0.75 mg / ml to about 1.5 mg / ml, about 0.8 mg / ml to about 1.2 mg / ml, about 1.0 mg / ml to about 1.5 mg / ml, about 1.0 mg / ml to about 2.5 mg / ml, about 1.5 mg / ml to about 3.0 mg / ml, about 2.0 mg / ml to about 4.0 mg / ml, or about 2.5 mg / ml to about 5.0 mg / ml.

[0120] In some embodiments, the input DNA is a predetermined DNA ratio, which can include ratios between 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different input DNAs (e.g., depending on the number of different RNAs in the composition). In some embodiments, the predetermined input DNA ratio includes ratios between more than 10 input DNAs. As used herein, "predetermined input DNA ratio" refers to the desired final ratio of DNA molecules in an IVT reaction. The desired final ratio of input DNAs can vary to the final peptide(s) or polypeptide product(s) encoded by the RNAs encoded by the input DNAs. In some embodiments, the input DNA can have a desired ratio that can include 2 to 8 input DNAs (e.g., a:b, a:b:c, a:b:c:d, a:b:c:d:e, a:b:c:d:e:f, a:b:c:d:e:f:g, a:b:c:d:e:f:g:h, etc., where each of a-h is a number between 1 and 10). In some embodiments, the predetermined input DNA ratio is different from the predetermined mRNA ratio.

[0121] The size of the two or more input DNAs (e.g., DNA in two or more different populations of input DNA) can vary. In some embodiments, the input DNA comprises about 15 to about 8,000 base pairs (e.g., 15 to 50, 15 to 100, 15 to 200, 15 to 300, 15 to 400, 15 to 500, 15 to 600, 15 to 700, 15 to 800, 15 to 900, 15 to 1000, 15 to 1200, 15 to 1400, 15 to 1500, 15 to 1800, 15 to 2000, 15 to 2500, 15 to 3000, 50-100, 50-200, 50-300, 50-400, 50-500, 50-600, 50-700, 50-800, 50-900, 50-1000, 50-1200, 50-1400, 50-1500, 50-1800, 50-2000, 50-2500, 50-3000, 100-200, 100-300, 100-400, 100-500, 100-600, 100-700 , 100~800, 100~900, 100~1000, 100~1200, 100~1400, 100~1500, 100~1800, 100~2000, 100~2500, 100~3000, 200~300, 200~400, 200~500, 200~600, 200~700, 200, ~800, 200~900, 200~1000, 200~1500, 200~3000, Contains 500-1000, 500-1500, 500-2000, 500-2500, 500-3000, 1000-1500, 1000-2000, 1000-2500, 1000-3000, 1500-3000, 2500-3000, 2000-3000, 2500-4000, 3000-5000, 3500-6500, 5000-7500, or 6500-8000 base pairs.

[0122] The mass of each population of input DNA molecules in an IVT reaction can be varied. In some embodiments, the mass of each population of input DNA is a range based on the total volume of the IVT reaction mixture. In some embodiments, the mass of each population of input DNA molecules in the IVT mixture individually varies from about 0.5% to about 99.9% of the total input DNA present in the IVT reaction mixture. In some embodiments, the molar ratio of each population of input DNA molecules in the IVT reaction can be varied.

[0123] In some embodiments, two or more of the input DNA molecules used in an IVT reaction have different lengths (e.g., contain different numbers of nucleotides). In some embodiments, the difference in length between two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more) of the different input DNA molecules in the IVT reaction mixture is greater than 70, 80, 90, or 100 base pairs (e.g., no two input DNAs in the composition are within 70, 80, 90, or 100 base pairs of each other). In some embodiments, the difference in length between two or more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or more) of the different input DNA molecules is greater than 100 base pairs, e.g., 500 base pairs, 1000 base pairs, 1500 base pairs, 2000 base pairs, 3000 base pairs, 4000 base pairs, 5000 base pairs, 6000 base pairs, 7000 base pairs, 8000 base pairs, or more.

[0124] In some embodiments, two or more of the input DNA molecules used in the IVT reaction encode mRNA molecules having different lengths (e.g., containing different numbers of nucleotides). In some embodiments, the difference in length between two or more of the mRNA molecules encoded by different input DNA molecules in the IVT reaction mixture is greater than 70, 80, 90, or 100 nucleotides (e.g., two input DNA molecules in the composition encode mRNA molecules that are not within 70, 80, 90, or 100 nucleotides of each other in length). In some embodiments, the difference in length between two or more of the mRNA molecules encoded by different input DNA molecules is greater than 100 nucleotides, e.g., 500, 1000, 1500, 2000, 3000, 4000, or more nucleotides.

[0125] In some embodiments, multivalent IVT involves co-transcription of at least two different input DNAs (e.g., at least two of DNAs A, B, C, D, E, F, H, I, J, etc.) in a ratio of A:B:C:D:E:F:G:H:I:J, where if DNA A is normalized to 1, then one or more of DNAs B, C, D, E, F, G, H, I, J, etc. may each independently be present in an amount (e.g., concentration) that is 0.01x to 100x the amount of A, e.g., 0.05x to 20x the amount of A, 0.1x to 10x the amount of A, 0.2x to 5x the amount of A, 0.3x to 3x the amount of A, 0.5x to 2x the amount of A, 0.75x to 1.4x the amount of A, 0.8x to 1.25x the amount of A, or 0.9x to 1.15x the amount of A. One or more of DNA B, C, D, E, F, G, H, I, or J may also be present.

[0126] In some embodiments, polyvalent RNA compositions are produced by combining RNA transcripts (e.g., mRNA) from separate sources. In some embodiments, polyvalent RNA compositions are produced by separately transcribing two or more DNA templates in separate IVT reactions and combining the transcribed RNAs. In some embodiments, RNA transcripts are produced by IVT and then added to one or more other RNAs. RNAs can be combined in any desired amount to produce polyvalent RNA compositions containing two or more RNAs in a specific ratio.

[0127] In some embodiments, the RNA transcript is a product of an IVT reaction. In some embodiments, the RNA transcript is a messenger RNA (mRNA) that includes a nucleotide sequence encoding a polypeptide of interest (e.g., a therapeutic protein or peptide) linked to a poly-A tail. In some embodiments, the mRNA is a modified mRNA (mmRNA) that includes at least one modified nucleotide.

[0128] Nucleoside triphosphates (NTPs) described herein can include unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, the NTPs of the IVT reaction include unmodified ATP. In some embodiments, the NTPs of the IVT reaction include modified ATP. In some embodiments, the NTPs of the IVT reaction include unmodified UTP. In some embodiments, the NTPs of the IVT reaction include modified UTP. In some embodiments, the NTPs of the IVT reaction include unmodified GTP. In some embodiments, the NTPs of the IVT reaction include modified GTP. In some embodiments, the NTPs of the IVT reaction include unmodified CTP. In some embodiments, the NTPs of the IVT reaction include modified CTP.

[0129] The composition of NTPs in an IVT reaction can also vary. In some embodiments, each NTP in an IVT reaction is present in equimolar amounts. In some embodiments, each NTP in an IVT reaction is present in non-equimolar amounts. For example, ATP may be used in an amount greater than GTP, CTP, and UTP. As a non-limiting example, an IVT reaction can include 7.5 mmol of GTP, 7.5 mmol of CTP, 7.5 mmol of UTP, and 3.75 mmol of ATP. In some embodiments, the molar ratio of G:C:U:A is 2:1:0.5:1. In some embodiments, the molar ratio of G:C:U:A is 1:1:0.7:1. In some embodiments, the molar ratio of G:C:A:U is 1:1:1:1. The same IVT reaction can include 3.75 mmol of a cap analog (e.g., a trinucleotide cap or a tetranucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5. In some embodiments, the amount of NTPs in the simultaneous IVT reactions is empirically calculated. For example, the consumption rate of each NTP in the IVT reaction can be empirically determined for each individual input DNA, and then a balanced ratio of NTPs based on these individual NTP consumption rates can be added to a simultaneous IVT reaction containing multiple input DNAs.

[0130] In some embodiments, the IVT reaction mixture further comprises a cap analog (e.g., as further described herein in the section entitled "RNA Capping"). The concentrations of nucleoside triphosphate and cap analog present in the IVT reaction may vary. In some embodiments, the NTP and cap analog are present in equimolar concentrations in the reaction. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide or tetranucleotide cap) to nucleoside triphosphate in the reaction is greater than 1:1. For example, the molar ratio of cap analog to nucleoside triphosphate in the reaction can be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide or tetranucleotide cap) to nucleoside triphosphate in the reaction is less than 1:1. For example, the molar ratio of cap analog (e.g., trinucleotide cap or tetranucleotide cap) to nucleoside triphosphate in the reaction can be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100.

[0131] In some embodiments, the RNA transcript (e.g., mRNA transcript) may contain pseudouridine (ψ), 1-methylpseudouridine (m 1 ψ), 5-methoxyuridine (mo 5 U), 5-methylcytidine (m 5 C), α-thioguanosine, and α-thioadenosine. In some embodiments, an RNA transcript (e.g., an mRNA transcript) includes a combination of at least two (e.g., two, three, four, or more) of the foregoing modified nucleobases.

[0132] In some embodiments, the RNA transcript (e.g., mRNA transcript) includes pseudouridine (ψ). In some embodiments, the RNA transcript (e.g., mRNA transcript) includes 1-methylpseudouridine (m 1 In some embodiments, the RNA transcript (e.g., mRNA transcript) includes 5-methylpseudouridine (mo 5 In some embodiments, the RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (mU). 5 In some embodiments, the RNA transcript (e.g., mRNA transcript) includes α-thio-guanosine. In some embodiments, the RNA transcript (e.g., mRNA transcript) includes α-thio-adenosine.

[0133] In some embodiments, a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) is uniformly modified (e.g., fully modified, i.e., modified throughout the entire sequence) for a particular modification. For example, the polynucleotide may be modified with 1-methylpseudouridine (m 1 ψ), which means that all uridine residues in the mRNA sequence are uniformly modified with 1-methylpseudouridine (m 1 ψ). Similarly, a polynucleotide can be uniformly modified with respect to any type of nucleoside residue present in the sequence by replacing it with any of the modified residues described above. Alternatively, a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) can be non-uniformly modified (e.g., partially modified, with part of the sequence modified). Each alternative represents a separate embodiment.

[0134] The buffer system of the IVT reaction mixture can vary. In some embodiments, the buffer system includes Tris. For example, the concentration of Tris used in the IVT reaction is at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM, or at least 110 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10-100 mM.

[0135] In some embodiments, the buffer system includes dithiothreitol (DTT). The concentration of DTT used in the IVT reaction can be, for example, at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in the IVT reaction is 1 to 50 mM or 5 to 50 mM. In some embodiments, the concentration of DTT used in the IVT reaction is 5 mM.

[0136] In some embodiments, the buffer system comprises magnesium. In some embodiments, the NTPs and magnesium ions (Mg 2+ For example, the molar ratio of NTP to magnesium ions can be 1:0.25, 1:0.5, 1:1, 1:2, 1:3, 1:4, or 1:5.

[0137] In some embodiments, the NTP and cap analog (e.g., a trinucleotide cap such as GAG) present in the IVT reaction and magnesium ions (Mg 2+ For example, the molar ratio of NTP + trinucleotide cap (e.g., GAG) to magnesium ions can be 1:1, 1:2, 1:3, 1:4, or 1:5.

[0138] In some embodiments, the buffer system comprises Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), TRITON® X-100 (polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether), and / or polyethylene glycol (PEG).

[0139] In some embodiments, the IVT method further comprises separating (e.g., purifying) the in vitro transcription product (e.g., mRNA) from other reaction components. In some embodiments, the separation comprises performing chromatography on the IVT reaction mixture. In some embodiments, the chromatography comprises size-based (e.g., length-based) chromatography. In some embodiments, the chromatography comprises oligo-dT chromatography.

[0140] RNA capping The polyvalent RNA compositions described herein may contain one or more mRNAs having an open reading frame encoding a protein or peptide. Each of these mRNAs may have a 5' cap. The 5' cap may be added during a simultaneous IVT reaction (e.g., transcription co-capping) or after the IVT reaction.

[0141] The present disclosure also includes polynucleotides that include both a 5' cap and a polynucleotide (eg, a polynucleotide that includes a nucleotide sequence that encodes an expressed polypeptide).

[0142] The 5' cap structure of native mRNA is involved in nuclear export, increases mRNA stability, and binds to mRNA cap-binding proteins (CBPs), such as eIF4E, which contributes to mRNA stability and translational competence in cells through the association of CBP with poly(A)-binding protein to form mature circular mRNA species. The cap also assists in the removal of 5'-proximal introns during mRNA splicing.

[0143] Endogenous mRNA molecules can be 5'-end capped, creating a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue and the 5'-terminal transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or pre-terminal transcribed nucleotide at the 5' end of the mRNA can also optionally be 2'-O-methylated. 5' decapping and cleavage of the guanylate cap structure by hydrolysis can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0144] In some embodiments, a polynucleotide (eg, a polynucleotide comprising a nucleotide sequence encoding a polypeptide) incorporates a cap moiety.

[0145] In some embodiments, the polynucleotide comprises a non-hydrolyzable cap structure that prevents decapping and thus increases mRNA half-life. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphorodiester bond, modified nucleotides can be used during the capping reaction. For example, vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create phosphorothioate bonds in the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, can be used.

[0146] Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugar of the 5'-terminus and / or penultimate nucleotide of a polynucleotide (as described above) on the 2'-hydroxyl group of the sugar ring. Multiple distinct 5'-cap structures can be used to generate the 5'-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ in their chemical structure from the natural (i.e., endogenous, wild-type, or physical) 5'-cap while retaining cap function. Cap analogs can be synthesized chemically (i.e., non-enzymatically) or enzymatically and / or can be attached to a polynucleotide.

[0147] For example, the anti-reverse cap analog (ARCA) cap contains two guanines linked by a 5'-5'-triphosphate group, with one guanine containing an N7 methyl group as well as a 3'-O-methyl group (i.e., N7, 3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine (m 7 G-3'mppp-G, which is equivalently designated 3'O-Me-m 7 The 3'-O atom of the other unmodified guanine is linked to the 5'-terminal nucleotide of the capped polynucleotide. The N7- and 3'-O-methylated guanine provides the terminal portion of the capped polynucleotide.

[0148] Another exemplary cap is mCAP, which is similar to ARCA but replaces the 2'-O-methyl group on the guanosine (i.e., N7, 2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, mCAP). 7 Gm-ppp-G).

[0149] Another exemplary cap is m 7 G-ppp-Gm-AG (i.e., N7, guanosine-5'-triphosphate-2'-O-dimethyl-guanosine-adenosine-guanosine).

[0150] In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with boranophosphate or phosphoroselenoate groups, such as the dinucleotide cap analogs described in U.S. Pat. No. 8,519,110, the contents of which are incorporated herein by reference in their entirety.

[0151] In another embodiment, the cap is a cap analog, which is an N7-(4-chlorophenoxyethyl)-substituted dinucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide forms of cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m 3’-O G(5')ppp(5')G cap analogs (see, e.g., Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574 for various cap analogs and methods for synthesizing cap analogs, the contents of which are incorporated herein by reference in their entirety). In another embodiment, the cap analog is a 4-chloro / bromophenoxyethyl analog.

[0152] Polynucleotides can also be capped after production using enzymes (whether by IVT or chemical synthesis) to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to characteristics that closely reflect or mimic, either structurally or functionally, endogenous or wild-type characteristics. That is, "more authentic" characteristics better represent endogenous wild-type, natural, or physiological cellular functions and / or structures, or are superior in one or more respects to corresponding endogenous wild-type, natural, or physiological characteristics, compared to prior art synthetic characteristics or analogs, etc. Non-limiting examples of more authentic 5'-cap structures are those that have, among others, enhanced cap-binding protein binding, increased half-life, reduced susceptibility to 5' endonucleases, and / or reduced 5'-decapping, compared to synthetic 5'-cap structures (or wild-type, natural, or physiological 5'-cap structures) known in the art. For example, recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can create a standard 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanine cap nucleotide, where the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is called the Cap 1 structure. This cap results in higher translational competence and cellular stability, as well as reduced cellular pro-inflammatory cytokine activation, compared to, for example, other 5'-cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (Cap 0), 7mG(5')ppp(5')NlmpNp (Cap 1), and 7mG(5')-ppp(5')NlmpN2mp (Cap 2).

[0153] As a non-limiting example, capping the polynucleotides after production can be more efficient, as nearly 100% of the polynucleotides can be capped, as opposed to approximately 80% when a cap analog is attached to the polynucleotide during the in vitro transcription reaction.

[0154] In some embodiments, the 5'-end cap can comprise an endogenous cap or a cap analog. In some embodiments, the 5'-end cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0155] Also described herein are exemplary caps, including those that can be used in co-transcriptional capping methods for ribonucleic acid (RNA) synthesis using an RNA polymerase, e.g., a wild-type RNA polymerase or a variant thereof, such as a variant described herein. In one embodiment, RNA is produced in a "one-pot" reaction, and a cap can be added without the need for a separate capping reaction. Thus, the method, in some embodiments, includes reacting a polynucleotide template with an RNA polymerase variant, a nucleoside triphosphate, and a cap analog under in vitro transcription reaction conditions to produce an RNA transcript.

[0156] In some embodiments, the cap analog binds to a polynucleotide template that includes a promoter region that includes a transcription start site having a first nucleotide at nucleotide position +1, a second nucleotide at nucleotide position +2, and a third nucleotide at nucleotide position +3. In some embodiments, the cap analog hybridizes to the polynucleotide template at at least nucleotide position +1, e.g., at positions +1 and +2, or at positions +1, +2, and +3.

[0157] The cap analog can be, for example, a dinucleotide cap, a trinucleotide cap, or a tetranucleotide cap. In some embodiments, the cap analog is a dinucleotide cap. In some embodiments, the cap analog is a trinucleotide cap. In some embodiments, the cap analog is a tetranucleotide cap. As used herein, the term "cap" includes an inverted G nucleotide and can include additional nucleotides 3' of the inverted G, e.g., one, two, or more nucleotides 3' of the inverted G and 5' to the 5' UTR.

[0158] An exemplary cap has the sequence [ka] and the underlined italic G is an inverted G.

[0159] The trinucleotide cap may, in some embodiments, be a compound of formula (I) [ka] or a stereoisomer, tautomer or salt thereof, wherein: [ka] and Ring B1 is a modified or unmodified guanine, Ring B2 and Ring B3 are each independently a nucleobase or a modified nucleobase; X2 is O, S(O) p , N.R. 24 , or CR 25 R 26 and p is 0, 1, or 2; Y0 is O or CR6R7, Y1 is O, S(O) n , CR6R7, or NR8, where n is 0, 1, or 2; Each --- is a single bond or absent. When each --- is a single bond, Yi is O, S(O) n , CR6R7, or NR8, and if each --- is absent, Y1 is void; Y2 is (OP(O)R4) m (m is 0, 1, or 2) or -O-(CR 40 R 41 )u-Q0-(CR 42 R 43 )v-, where Q0 is a bond, O, S(O) r , N.R. 44 , or CR 45 R 46 wherein r is 0, 1, or 2, and each of u and v is independently 1, 2, 3, or 4; each R2 and R2' is independently halo, LNA, or OR3; each R3 is independently H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, and when R3 is C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, it is optionally substituted with one or more of halo, OH, or C1-C6 alkoxyl optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; Each R4 and R4' is independently H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3 - and Each of R6, R7, and R8 is independently -Q1-T1, where Q1 is a bond or a C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH, and C1-C6 alkoxy, and T1 is H, halo, OH, COOH, cyano, or R s1 where R s1 is C1-C3 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxyl, C(O)O-C1-C6 alkyl, C3-C8 cycloalkyl, C6-C 10 Aryl, NR 31 R 32 , (NR 31 R 32 R33 ) + , 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; R s1 is halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , C3-C8 cycloalkyl, C6-C 10 optionally substituted with one or more substituents selected from the group consisting of aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; R 10 , R 11 , R 12 , R 13 R 14 , and R 15 is independently -Q2-T2, where Q2 is a bond or a C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH, and C1-C6 alkoxy, and T2 is H, halo, OH, NH2, cyano, NO2, N3, R s2 , or OR s2 where R s2 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C 10 Aryl, NHC(O)-C1-C6 alkyl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; R s2 is halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR 31 R 32 , (NR 31 R 32 R 33 ) + , C3-C8 cycloalkyl, C6-C10 optionally substituted with one or more substituents selected from the group consisting of aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl, or alternatively, R 14 With R 12 is oxo or R 15 With R 13 is oxo, R 20 , R 21 , R 22 , and R 23 is independently -Q3-T3, where Q3 is a bond or a C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH, and C1-C6 alkoxy, and T3 is H, halo, OH, NH2, cyano, NO2, N3, R S3 , or OR S3 where R S3 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C 10 aryl, NHC(O)—C1-C6 alkyl, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; Rs3 is halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O—C1-C6 alkyl, cyano, C1-C6 alkoxyl, amino, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, C3-C8 cycloalkyl, C6-C 10 optionally substituted with one or more substituents selected from the group consisting of aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; R 24 , R 25 , and R 26 each is independently H or C1-C6 alkyl; R 27 and R 28 each independently represents H or OR 29 or R 27 and R 28 together, OR 30-O, and each R 29 are independently H, C-C alkyl, C-C alkenyl, or C-C alkynyl, and R 29 is C-C alkyl, C-C alkenyl, or C-C alkynyl, optionally substituted with one or more of halo, OH, and C-C alkoxyl optionally substituted with one or more OH or OC(O)-C-C alkyl; R 30 is C1-C6 alkylene optionally substituted with one or more of halo, OH, and C1-C6 alkoxyl; R 31 , R 32 , and R 33 each independently represents H, C1-C6 alkyl, C3-C8 cycloalkyl, C6-C 10 aryl, 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl; R 40 , R 41 , R 42 , and R 43 each independently represents H, halo, OH, cyano, N3, OP(O)R 47 R 48 , or one or more OP(O)R 47 R 48 or one R 41 and one R 43 together with the carbon atoms to which they are attached and Q0, form C4-C 10 Cycloalkyl, 4-14 membered heterocycloalkyl, C6-C 10 aryl, or 5-14 membered heteroaryl, and each of the cycloalkyl, heterocycloalkyl, phenyl, or 5-6 membered heteroaryl is selected from the group consisting of OH, halo, cyano, N3, oxo, OP(O)R 47 R 48, C-C alkyl, C-C haloalkyl, COOH, C(O)O—C-C alkyl, C-C alkoxyl, C-C haloalkoxyl, amino, mono-C-C alkylamino, and di-C-C alkylamino; R 44 is H, C1-C6 alkyl, or an amine protecting group; R 45 and R 46 each of which is independently H, OP(O)R 47 R 48 , or one or more OP(O)R 47 R 48 C1-C6 alkyl optionally substituted with R 47 and R 48 each independently represents H, halo, C1-C6 alkyl, OH, SH, SeH, or BH3 - is.

[0160] It is understood that the cap analogs described herein may include any of the cap analogs described in International Publication No. WO2017 / 066797, published April 20, 2017, the entire contents of which are incorporated herein by reference.

[0161] In some embodiments, the middle position of B2 can be a non-ribose molecule, for example, arabinose.

[0162] In some embodiments, R2 is ethyl.

[0163] Thus, in some embodiments, the trinucleotide cap comprises the following structure: [ka]

[0164] In yet other embodiments, the trinucleotide cap comprises the following structure: [ka]

[0165] In yet other embodiments, the trinucleotide cap comprises the following structure: [ka]

[0166] In some embodiments, R is an alkyl (e.g., a C-C alkyl). In some embodiments, R is a methyl group (e.g., a C alkyl). In some embodiments, R is a methyl group (e.g., a C alkyl).

[0167] The trinucleotide cap, in some embodiments, comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA, GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, the trinucleotide cap comprises GAA. In some embodiments, the trinucleotide cap comprises GAC. In some embodiments, the trinucleotide cap comprises GAG. In some embodiments, the trinucleotide cap comprises GAU. In some embodiments, the trinucleotide cap comprises GCA. In some embodiments, the trinucleotide cap comprises GCC. In some embodiments, the trinucleotide cap comprises GCG. In some embodiments, the trinucleotide cap comprises GCU. In some embodiments, the trinucleotide cap comprises GGA. In some embodiments, the trinucleotide cap comprises GGC. In some embodiments, the trinucleotide cap comprises GGG. In some embodiments, the trinucleotide cap comprises GGU. In some embodiments, the trinucleotide cap comprises GUA. In some embodiments, the trinucleotide cap comprises GUC. In some embodiments, the trinucleotide cap comprises GUG. In some embodiments, the trinucleotide cap comprises GUU.

[0168] In some embodiments, the trinucleotide cap has the sequence: 7 GpppApA, m 7 GpppApC, m 7 GpppApG, m 7 GpppApU, m 7 GpppCpA, m 7 GpppCpC, m 7 GpppCpG, m 7 GpppCpU, m 7 GpppGpA, m 7 GpppGpC, m 7 GpppGpG, m 7 GpppGpU, m 7 GpppUpA,m7 GpppUpC, m 7 GpppUpG, and m 7 GpppUpU.

[0169] In some embodiments, the trinucleotide cap is m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises GpppCpG. 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises GpppGpC. 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 In some embodiments, the trinucleotide cap comprises m 7 Includes GpppUpU.

[0170] The trinucleotide cap, in some embodiments, has the sequence:7 G 3’OMe pppApA, m 7 G 3’OMe pppApC, m 7 G 3’OMe pppApG, m 7 G 3’OMe pppApU, m 7 G 3’OMe pppCpA, m 7 G 3’OMe pppCpC, m 7 G 3’OMe pppCpG, m 7 G 3’OMe pppCpU, m 7 G 3’OMe pppGpA, m 7 G 3’OMe pppGpC, m 7 G 3’OMe pppGpG, m 7 G 3’OMe pppGpU,m 7 G 3’OMe pppUpA,m 7 G 3’OMe pppUpC,m 7 G 3’OMe pppUpG, and m 7 G 3’OMe pppUpU.

[0171] In some embodiments, the trinucleotide cap is m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMeIn some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe Includes pppUpU.

[0172] In other embodiments, the trinucleotide cap has the sequence: 7 G 3’OMe pppA 2’OMe pA, m 7 G 3’OMe pppA 2’OMe pC, m 7 G 3’OMe pppA 2’OMe pG, m 7 G 3’OMe pppA 2’OMe pU, m 7 G 3’OMe pppC 2’OMe pA, m 7 G 3’OMe pppC 2’OMepC, m 7 G 3’OMe pppC 2’OMe pG, m 7 G 3’OMe pppC 2’OMe pU, m 7 G 3’OMe pppG 2’OMe pA, m 7 G 3’OMe pppG 2’OMe pC, m 7 G 3’OMe pppG 2’OMe pG, m 7 G 3’OMe pppG 2’OMe pU, m 7 G 3’OMe pppU 2’OMe pA, m 7 G 3’OMe pppU 2’OMe pC, m 7 G 3’OMe pppU 2’OMe pG, and m 7 G 3’OMe pppU 2’OMe pU.

[0173] In some embodiments, the trinucleotide cap is m 7 G 3’OMe pppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppC 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppC 2’OMeIn some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppC 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppC 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppU 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppU 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppU 2’OMe In some embodiments, the trinucleotide cap comprises m 7 G 3’OMe pppU 2’OMe Contains pU.

[0174] In yet other embodiments, the trinucleotide cap has the sequence: 7 GpppA 2’OMe pA, m 7 GpppA 2’OMe pC, m 7 GpppA 2’OMe pG, m 7 GpppA 2’OMe pU, m 7GpppC 2’OMe pA, m 7 GpppC 2’OMe pC, m 7 GpppC 2’OMe pG, m 7 GpppC 2’OMe pU, m 7 GpppG 2’OMe pA, m 7 GpppG 2’OMe pC, m 7 GpppG 2’OMe pG, m 7 GpppG 2’OMe pU, m 7 GpppU 2’OMe pA, m 7 GpppU 2’OMe pC, m 7 GpppU 2’OMe pG, and m 7 GpppU 2’OMe pU.

[0175] In some embodiments, the trinucleotide cap is m 7 GpppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppA 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppC 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppC 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppC 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppC 2’OMe In some embodiments, the trinucleotide cap comprises m7 GpppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppG 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppU 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppU 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppU 2’OMe In some embodiments, the trinucleotide cap comprises m 7 GpppU 2’OMe Contains pU.

[0176] In some embodiments, the trinucleotide cap is m 7 Gpppm 6 A 2’Ome In some embodiments, the trinucleotide cap comprises m 7 Gpppe 6 A 2’Ome Contains pG.

[0177] In some embodiments, the trinucleotide cap comprises GAG. In some embodiments, the trinucleotide cap comprises GCG. In some embodiments, the trinucleotide cap comprises GUG. In some embodiments, the trinucleotide cap comprises GGG.

[0178] In some embodiments, the trinucleotide cap comprises any one of the following structures: [ka]

[0179] In some embodiments, the cap analog comprises a tetranucleotide cap. In some embodiments, the tetranucleotide cap comprises a trinucleotide as described above. In some embodiments, the tetranucleotide cap comprises m7 In some embodiments, the nucleoside bases include GpppN1N2N3, where N1, N2, and N3 are optional (i.e., can be absent, or one or more can be present) and are independently natural, modified, or non-natural nucleoside bases. m7 The G is further methylated, for example, at the 3' position. m7 G comprises an O-methyl at the 3' position. In some embodiments, N1, N2, and N3, when present, are optionally independently adenine, uracil, guanidine, thymine, or cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, when present, are methylated, e.g., at the 2' position. In some embodiments, one or more (or all) of N1, N2, and N3, when present, have an O-methyl at the 2' position.

[0180] In some embodiments, the tetranucleotide cap comprises the following structure: [ka] wherein B1, B2, and B3 are independently a natural, modified, or non-natural nucleoside base, and R1, R2, R3, and R4 are independently OH or O-methyl. In some embodiments, R3 is O-methyl and R4 is OH. In some embodiments, R3 and R4 are O-methyl. In some embodiments, R4 is O-methyl. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is OH. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl.

[0181] In some embodiments, B1, B2, and B3 are natural nucleoside bases. In some embodiments, at least one of B1, B2, and B3 is a modified or non-natural base. In some embodiments, at least one of B1, B2, and B3 is N6-methyladenine. In some embodiments, B1 is adenine, cytosine, thymine, or uracil. In some embodiments, B1 is adenine, B2 is uracil, and B3 is adenine. In some embodiments, R1 and R2 are OH, R3 and R4 are O-methyl, B1 is adenine, B2 is uracil, and B3 is adenine.

[0182] In some embodiments, the trinucleotide cap comprises a sequence selected from the sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments, the trinucleotide cap comprises a sequence selected from the sequences: GAAG, GACG, GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments, the trinucleotide cap comprises a sequence selected from the sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments, the trinucleotide cap comprises a sequence selected from the sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC.

[0183] In some embodiments, the tetranucleotide cap has the sequence: 7 G 3’OMe pppApApN, m 7 G 3’OMe pppApCpN, m 7 G 3’OMe pppApGpN, m 7 G 3’OMe pppApUpN, m 7 G 3’OMe pppCpApN, m 7 G 3’OMe pppCpCpN, m 7 G 3’OMe pppCpGpN, m 7 G 3’OMe pppCpUpN, m 7 G 3’OMe pppGpApN, m 7 G 3’OMe pppGpCpN, m 7 G 3’OMe pppGpGpN, m 7 G 3’OMe pppGpUpN,m7 G 3’OMe pppUpApN,m 7 G 3’OMe pppUpCpN,m 7 G 3’OMe pppUpGpN, and m 7 G 3’OMe pppUpUpN, where N is a natural, modified, or unnatural nucleoside base.

[0184] In other embodiments, the tetranucleotide cap has the sequence: 7 G 3’OMe pppA 2’OMe pApN, m 7 G 3’OMe pppA 2’OMe pCpN, m 7 G 3’OMe pppA 2’OMe pGpN, m 7 G 3’OMe pppA 2’OMe pUpN, m 7 G 3’OMe pppC 2’OMe pApN, m 7 G 3’OMe pppC 2’OMe pCpN, m 7 G 3’OMe pppC 2’OMe pGpN, m 7 G 3’OMe pppC 2’OMe pUpN, m 7 G 3’OMe pppG 2’OMe pApN, m 7 G 3’OMe pppG 2’OMe pCpN, m 7 G 3’OMe pppG 2’OMe pGpN, m 7 G 3’OMe pppG 2’OMe pUpN, m 7 G 3’OMe pppU 2’OMe pApN, m 7 G 3’OMe pppU 2’OMe pCpN, m 7 G 3’OMe pppU2’OMe pGpN, and m 7 G 3’OMe pppU 2’OMe pUpN, where N is a natural, modified, or unnatural nucleoside base.

[0185] In yet other embodiments, the tetranucleotide cap has the sequence: 7 GpppA 2’OMe pApN, m 7 GpppA 2’OMe pCpN, m 7 GpppA 2’OMe pGpN, m 7 GpppA 2’OMe pUpN, m 7 GpppC 2’OMe pApN, m 7 GpppC 2’OMe pCpN, m 7 GpppC 2’OMe pGpN, m 7 GpppC 2’OMe pUpN, m 7 GpppG 2’OMe pApN, m 7 GpppG 2’OMe pCpN, m 7 GpppG 2’OMe pGpN, m 7 GpppG 2’OMe pUpN, m 7 GpppU 2’OMe pApN, m 7 GpppU 2’OMe pCpN, m 7 GpppU 2’OMe pGpN, and m 7 GpppU 2’OMe pUpN, where N is a natural, modified, or unnatural nucleoside base.

[0186] In other embodiments, the tetranucleotide cap has the sequence: 7 G 3’OMe pppA 2’OMe pA 2’OMe pN, m 7 G 3’OMe pppA 2’OMePC 2’OMe pN, m 7 G 3’OMe pppA 2’OMe p.g. 2’OMe pN, m 7 G 3’OMe pppA 2’OMe pU 2’OMe pN, m 7 G 3’OMe pppC 2’OMe pA 2’OMe pN, m 7 G 3’OMe pppC 2’OMe PC 2’OMe pN, m 7 G 3’OMe pppC 2’OMe p.g. 2’OMe pN, m 7 G 3’OMe pppC 2’OMe pU 2’OMe pN, m 7 G 3’OMe pppG 2’OMe pA 2’OMe pN, m 7 G 3’OMe pppG 2’OMe PC 2’OMe pN, m 7 G 3’OMe pppG 2’OMe p.g. 2’OMe pN, m 7 G 3’OMe pppG 2’OMe pU 2’OMe pN, m 7 G 3’OMe pppU 2’OMe pA 2’OMe pN, m 7 G 3’OMe pppU 2’OMe PC 2’OMe pN, m 7 G 3’OMe pppU 2’OMe p.g. 2’OMe pN, and m 7 G 3’OMe pppU 2’OMe pU 2’OMe pN, where N is a natural, modified, or unnatural nucleoside base.

[0187] In yet other embodiments, the tetranucleotide cap has the sequence: 7 GpppA 2’OMe pA 2’OMe pN, m 7 GpppA 2’OMe PC 2’OMe pN, m 7 GpppA 2’OMe p.g. 2’OMe pN, m 7 GpppA 2’OMe pU 2’OMe pN, m 7 GpppC 2’OMe pA 2’OMe pN, m 7 GpppC 2’OMe PC 2’OMe pN, m 7 GpppC 2’OMe p.g. 2’OMe pN, m 7 GpppC 2’OMe pU 2’OMe pN, m 7 GpppG 2’OMe pA 2’OMe pN, m 7 GpppG 2’OMe PC 2’OMe pN, m 7 GpppG 2’OMe p.g. 2’OMe pN, m 7 GpppG 2’OMe pU 2’OMe pN, m 7 GpppU 2’OMe pA 2’OMe pN, m 7 GpppU 2’OMe PC 2’OMe pN, m 7 GpppU 2’OMe p.g. 2’OMe pN, and m 7 GpppU 2’OMe pU 2’OMe pN, where N is a natural, modified, or unnatural nucleoside base.

[0188] In some embodiments, the tetranucleotide cap comprises GGAG. In some embodiments, the tetranucleotide cap comprises the following structure: [ka]

[0189] The capping efficiency of post-transcriptional or co-transcriptional capping reactions can vary. As used herein, "capping efficiency" refers to the amount (e.g., expressed as a percentage) of mRNA containing a cap structure relative to the total mRNA in a mixture (e.g., a post-translational capping reaction or a co-transcriptional capping reaction). In some embodiments, the capping efficiency of the capping reaction is at least 60%, 70%, 80%, 90%, 95%, 99%, or 99.9% (e.g., after the capping reaction, at least 60%, 70%, 80%, 90%, 95%, 99%, or 99.9% of the input mRNA contains a cap). In some embodiments, the multivalent co-IVT reaction described herein does not affect the capping efficiency of mRNA resulting from the IVT reaction.

[0190] Untranslated Regions (UTRs) An untranslated region (UTR) is a section of nucleic acid that is not translated, preceding the start codon (5'UTR) and following the stop codon (3'UTR). In some embodiments, a nucleic acid (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the disclosure that includes an open reading frame (ORF) encoding one or more peptide epitopes further includes one or more UTRs (e.g., a 5'UTR or functional fragment thereof, a 3'UTR or functional fragment thereof, or a combination thereof).

[0191] The UTR can be homologous or heterologous to the coding region in the nucleic acid. In some embodiments, the UTR is homologous to the ORF encoding one or more peptide epitopes. In some embodiments, the UTR is heterologous to the ORF encoding one or more peptide epitopes. In some embodiments, the nucleic acid comprises two or more 5'UTRs or functional fragments thereof, each of which has the same or different nucleotide sequence. In some embodiments, the nucleic acid comprises two or more 3'UTRs or functional fragments thereof, each of which has the same or different nucleotide sequence.

[0192] In some embodiments, the 5'UTR or a functional fragment thereof, the 3'UTR or a functional fragment thereof, or any combination thereof, is sequence-optimized.

[0193] In some embodiments, the 5'UTR or a functional fragment thereof, the 3'UTR or a functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, for example, 5-methoxyuracil.

[0194] UTRs can have features that provide a regulatory role, e.g., stability, localization, and / or increased or decreased translational efficiency. Nucleic acids containing UTRs can be administered to cells, tissues, or organisms, and one or more regulatory features can be measured using routine methods. In some embodiments, functional fragments of 5' or 3' UTRs contain one or more regulatory features of the full-length 5' or 3' UTR, respectively.

[0195] Naturally occurring 5'UTRs possess features that play a role in translation initiation. They contain signatures such as the Kozak sequence, which are commonly known to be involved in the process by which ribosomes initiate translation of many genes. 5'UTRs are also known to form secondary structures involved in elongation factor binding.

[0196] Manipulation of features typically found in abundantly expressed genes in specific target organs can enhance nucleic acid stability and protein production. For example, introduction of the 5' UTR of liver-expressed mRNAs, such as albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII, can enhance nucleic acid expression in hepatic cell lines or the liver. Similarly, use of 5'UTRs from other tissue-specific mRNAs to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), endothelial cells (e.g., Tie-1, CD36), bone marrow cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), leukocytes (e.g., CD45, CD18), adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin), and lung epithelial cells (e.g., SP-A / B / C / D).

[0197] In some embodiments, UTR is selected from a family of transcripts whose proteins share common functions, structures, characteristics or properties.For example, the encoded polypeptide can belong to a family of proteins (i.e., share at least one function, structure, characteristic, localization, origin or expression pattern) that are expressed in a specific cell, tissue, or at a certain time during development.The UTR from either gene or mRNA can be exchanged with other UTRs from either the same or different protein family to create new nucleic acid.

[0198] In some embodiments, the 5'UTR and 3'UTR can be heterologous. In some embodiments, the 5'UTR can be derived from a different species than the 3'UTR. In some embodiments, the 3'UTR can be derived from a different species than the 5'UTR.

[0199] International Patent Application No. PCT / US2014 / 021522 (Publication No. WO / 2014 / 164253) provides a list of exemplary UTRs that can be utilized as regions flanking an ORF in a nucleic acid, and this publication is incorporated herein by reference for this purpose.

[0200] Additional exemplary UTRs that can be utilized in nucleic acids include those from globins such as α- or β-globin (e.g., Xenopus, mouse, rabbit, or human globin); strong Kozak translation initiation signals; CYBA (e.g., human cytochrome b-245 α polypeptide); albumins (e.g., human albumin 7); HSD17B4 (hydroxysteroid (17-β) dehydrogenase); viruses (e.g., tobacco etch virus (TEV), Venezuelan equine encephalitis virus (VEEV), dengue virus, cytomegalovirus (CMV, e.g., CMV immediate early 1 (IE1)), hepatitis viruses (e.g., hepatitis B virus), Sindbis virus, and the like). heat shock proteins (e.g., hsp70); translation initiation factors (e.g., eIF4G); glucose transporters (e.g., hGLUT1 (human glucose transporter 1)); actin (e.g., human α- or β-actin); GAPDH; tubulin; histones; citric acid cycle enzymes; topoisomerases (e.g., the 5'UTR of the TOP gene lacking the 5'TOP motif (oligopyrimidine tract)); ribosomal protein large 32 (L32); ribosomal proteins (e.g., human or mouse ribosomal proteins, such as rps9); ATP synthases (e.g., ATP5A1 or mitochondrial H +-β subunit of ATP synthase; growth hormone (e.g., bovine (bGH) or human (hGH)); elongation factors (e.g., elongation factor 1 alpha 1 (EEF1A1)); manganese superoxide dismutase (MnSOD); myocyte enhancer factor 2A (MEF2A); β-F1-ATPase, creatine kinase, myoglobin, granulocyte colony-stimulating factor (G-CSF); collagen (e.g., collagen type I alpha 2 (Col1A2), collagen type I alpha 1 (Col1A1), collagen type VI alpha 2 (Col6A2), These include, but are not limited to, one or more 5'UTRs and / or 3'UTRs derived from the nucleic acid sequences of collagen type VI alpha 1 (Col6A1); ribophorin (e.g., ribophorin I (RPNI)); low-density lipoprotein receptor-related protein (e.g., LRP1); cardiotrophin-like cytokine factor (e.g., Nnt1); calreticulin (Calr); procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plod1); and nucleobindin (e.g., Nucb1).

[0201] In some embodiments, the 5'UTR is selected from the group consisting of a β-globin 5'UTR; a 5'UTR containing a strong Kozak translation initiation signal; a cytochrome b-245 alpha polypeptide (CYBA) 5'UTR; a hydroxysteroid (17-beta) dehydrogenase (HSD17B4) 5'UTR; a tobacco etch virus (TEV) 5'UTR; a Venezuelan equine encephalitis virus (TEEV) 5'UTR; a 5' proximal open reading frame of rubella virus (RV) RNA encoding a nonstructural protein; a dengue virus (DEN) 5'UTR; a heat shock protein 70 (Hsp70) 5'UTR; an eIF4G 5'UTR; a GLUT1 5'UTR; a functional fragment thereof, and any combination thereof.

[0202] In some embodiments, the 3'UTR is selected from the group consisting of β-globin 3'UTR; CYBA 3'UTR; albumin 3'UTR; growth hormone (GH) 3'UTR; VEEV 3'UTR; hepatitis B virus (HBV) 3'UTR; α-globin 3'UTR; DEN 3'UTR; PAV barley yellow dwarf virus (BYDV-PAV) 3'UTR; elongation factor 1 alpha 1 (EEF1A1) 3'UTR; manganese superoxide dismutase (MnSOD) 3'UTR; β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'UTR; GLUT1 3'UTR; MEF2A 3'UTR; β-F1-ATPase 3'UTR; functional fragments thereof, and combinations thereof.

[0203] The wild-type UTR from any gene or mRNA can be incorporated into the nucleic acid of the present disclosure.In some embodiments, UTR can be modified with respect to wild-type or natural UTR, for example, by changing the orientation or position of UTR relative to ORF, or by including additional nucleotides, deleting nucleotides, exchanging or rearranging nucleotides, to produce variant UTR.In some embodiments, 5' or 3' UTR variants can be utilized, for example, mutants or variants of wild-type UTR, and one or more nucleotides are added or removed from the end of UTR.

[0204] Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, and the sequences available at www.addgene.org / Derrick_Rossi / , the contents of each of which are incorporated herein by reference in their entirety. UTRs, or portions thereof, can be positioned in the same orientation as in the transcript from which they were selected, or their orientation or location can be changed. Thus, 5' and / or 3' UTRs can be inverted, shortened, extended, or combined with one or more other 5' or 3' UTRs.

[0205] In some embodiments, the nucleic acid may contain multiple UTRs, such as double, triple, or quadruple 5'UTRs or 3'UTRs. For example, a double UTR contains two copies of the same UTR, contiguous or substantially contiguous. For example, a double beta globin 3'UTR may be used (see, for example, US2010 / 0129877, the contents of which are incorporated herein by reference).

[0206] Nucleic acids of the present disclosure can comprise a combination of features. For example, an ORF can be flanked by a 5' UTR containing a strong Kozak translation initiation signal and / or a 3' UTR containing an oligo(dT) sequence for templated addition of a polyA tail. The 5' UTR can comprise a first nucleic acid fragment and a second nucleic acid fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625, which is incorporated by reference in its entirety for this purpose). In some embodiments, a UTR comprises one or more IDR sequences. In some embodiments, a 5' UTR comprises one or more IDR sequences. In some embodiments, a 3' UTR comprises one or more IDR sequences.

[0207] Other non-UTR sequences can be used as regions or subregions within the nucleic acids of the present disclosure. For example, introns or portions of intron sequences can be incorporated into the nucleic acids of the present disclosure. Incorporation of intron sequences can increase protein production and nucleic acid expression levels. In some embodiments, the nucleic acids of the present disclosure contain an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1):189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the nucleic acid contains an IRES instead of a 5'UTR sequence. In some embodiments, the nucleic acid contains an ORF and a viral capsid sequence. In some embodiments, the nucleic acid contains a synthetic 5'UTR in combination with a non-synthetic 3'UTR.

[0208] In some embodiments, a UTR may also contain at least one translation enhancer nucleic acid, translation enhancer element(s) (collectively, "TEE," which refers to a nucleic acid sequence that increases the amount of polynucleotide or protein produced from a polynucleotide). Non-limiting examples of TEEs include those described in US2009 / 0226470, the entire contents of which are incorporated herein by reference for this purpose, and others known in the art. Non-limiting examples of TEEs include those located between the transcription promoter and the start codon. In some embodiments, a 5' UTR contains a TEE. In one aspect, a TEE is a conserved element within a UTR that can promote translational activity of a nucleic acid, such as, but not limited to, cap-dependent or cap-independent translation. In one non-limiting example, a TEE includes a TEE sequence in the 5' leader of a Gtx homeodomain protein. See Chappell et al., PNAS 2004 101:9590-9594, the entire contents of which are incorporated herein by reference for this purpose.

[0209] Identification and / or ratio determination (IDR) sequences Aspects of the present disclosure relate to RNA compositions (e.g., polyvalent RNA compositions) containing mRNAs having one or more (e.g., one, two, three, four, or more) unique sequences, or sequences for discrimination and / or ratio determination (IDR), as well as methods for analyzing such RNA compositions. As used herein, "IDR sequence" (as well as the terms "barcode sequence," "identifier sequence," and "identifying sequence") refers to a sequence of a biological molecule (e.g., a nucleic acid, a protein, etc.) that functions to distinguish other biological molecules. Typically, an IDR sequence is a heterologous sequence that is incorporated into or added to the sequence of a target biological molecule and used as a reference to identify a target molecule of interest. In some embodiments, an IDR sequence is a sequence of a nucleic acid (e.g., a heterologous or synthetic nucleic acid) that is incorporated into or added to a target nucleic acid and used as a reference to identify the target nucleic acid. Such use of an IDR sequence to identify a reference nucleic acid allows for the evaluation of an RNA composition containing a single RNA species, and the presence and / or amount of an RNA species of interest having the IDR sequence can be determined. Additionally, incorporating different IDR sequences into different RNA species allows the presence and / or abundance of different IDR sequences to be measured to distinguish between RNA species present in a composition comprising multiple RNA species. In some embodiments, the IDR sequences are represented by the formula (N): nIn some embodiments, n is an integer ranging from 3 to 20, 3 to 10, 5 to 20, 5 to 10, 10 to 20, 7 to 20, or 7 to 30. In some embodiments, n is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more. In some embodiments, N is each nucleotide independently selected from A, G, T, U, and C, or analogs thereof. Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotides, trinucleotides, tetranucleotides, cap analogs, or precursors / substrates for enzymatic capping (vaccinia or ligase), nucleotides labeled with functional groups to facilitate ligation / conjugation of the cap or 5' portion (IRES), nucleotides labeled with 5'PO4 to facilitate ligation of the cap or 5' portion, or nucleotides labeled with functional groups / protecting groups that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited to, ganciclovir, entecavir, telbivudine, vidarabine, and cidofovir. Modified nucleotides may contain modified nucleobases. In some embodiments, the nucleotide analog is xanthine, allylaminouracil, allylaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylester uracil, 5-carboxyuracil,5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chlorouracil troprin, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-Propargylaminocytosine, cyanine 3-6-Propargylaminouracil, cyanine 3-Aminoallylcytosine, cyanine 3-Aminoallyluracil, cyanine 5-6-Propargylaminocytosine, cyanine 5-6-Propargylaminouracil, cyanine 5-Aminoallylcytosine, cyanine 5-Aminoallyluracil, cyanine 7-Aminoallyluracil, Dabsyl-5-3-aminoallyluracil, Desthiobiotin-16-aminoallyl-uracil, Desthiobiotin-6-aminoallylcytosine, Isoguanine, N1-Ethylpseudouracil, N1-Methoxymethylpseudouracil, N1-Methyladenine, N1-Methylpseudouracil, N1-Propylpseudouracil, N2-Methylguanine, N4-Bio cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A),2-Methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6- The modified nucleotide may comprise a modified sugar. In some embodiments, the nucleotide analogs are 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3'-dideoxyribose , 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked, and 2'-O,4'-C-thio-linked ribose. Modified nucleotides may include a modified phosphate. In some embodiments, the nucleotide analog is a phosphorothioate (PS), a thiophosphate, a 5'-O-methylphosphonate, a 3'-O-methylphosphonate, a 5'-hydroxyphosphonate, a hydroxyphosphate, a phosphoroselenoate, a selenophosphate, a phosphoramidate, a carbophosphonate, a methylphosphonate, a phenylphosphonate, an ethylphosphonate,The nucleotide analog comprises a modified phosphate selected from the group consisting of H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, the nucleotide analog comprises two or more of a modified nucleobase, a modified sugar, and a modified phosphate. In some embodiments, the IDR sequence comprises multiple nucleotide analogs. In some embodiments, the IDR sequence comprises multiple different nucleotide analogs. Thus, some embodiments include a nucleic acid (e.g., mRNA) that (i) has a target sequence of interest (e.g., a coding sequence (e.g., encoding a therapeutic peptide or protein)) and (ii) comprises a unique IDR sequence.

[0210] In some embodiments, the IDR sequence has the formula AN n -A, AN n -C, AN n -G, AN n -U,CN n -A, CN n -C, CN n -G, CN n -U, GN n -A, GN n -C, GN n -G, GN n -U, UN n -A, UN n -A, UN n -G, or UN n -U, where n is an integer in the range of 3 to 20, inclusive, and each N is independently selected from A, C, G, or U, or an analog of A, C, G, or U. In some embodiments, the IDR sequence has the formula AN m -AN n , N m -AN n -A, AN m -CN n , N m -AN n -C, AN m -GN n , N m -AN n-G、A-N m -U-N n 、N m -A-N n -U、C-N m -A-N n 、N m -C-N n -A、C-N m -C-N n 、N m -C-N n -C、C-N m -G-N n 、N m -C-N n -G、C-N m -U-N n 、N m -C-N n -U、G-N m -A-N n 、N m -G-N n -A、G-N m -C-N n 、N m -G-N n -C、G-N m -G-N n 、N m -G-N n -G、G-N m -U-N n 、N m -G-N n -U、U-N m -A-N n 、N m -U-N n -A、U-N m -C-N n 、N m -U-N n -C、U-N m -G-N n 、N m -U-N n -G、U-N m -U-N n 、N m -U-N n -U、N m -AA-N n 、N m -AC-N n, N m -AG-N n, N m-AU-N n, N m -CA-N n 、N m -CC-N n 、N m -CG-N n 、N m -CU–N n 、N m -GA-N n 、N m -GC-N n 、N m -GG-N n 、N m -GU-N n 、N m -UA-N n 、N m -UC-N n 、N m -UG-N n, N m -UU-N nwherein m and n are each independently an integer selected from the range of 3 to 20, inclusive, and each N is independently selected from A, C, G, or U, or an analog of A, C, G, or U. Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotides, trinucleotides, tetranucleotides, e.g., cap analogs, or precursors / substrates for enzymatic capping (vaccinia or ligase), nucleotides labeled with a functional group to facilitate ligation / conjugation of the cap or 5' portion (IRES), nucleotides labeled with 5'PO4 to facilitate ligation of the cap or 5' portion, or nucleotides labeled with a functional group / protecting group that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited to, ganciclovir, entecavir, telbivudine, vidarabine, and cidofovir. Modified nucleotides can include modified nucleobases. In some embodiments, the nucleotide analog is xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propanol]-3-one ... [propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil,5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-Propargylaminocytosine, cyanine 3-6-Propargylaminouracil, cyanine 3-Aminoallylcytosine, cyanine 3-Aminoallyluracil, cyanine 5-6-Propargylaminocytosine, cyanine 5-6-Propargylaminouracil, cyanine 5-Aminoallylcytosine, cyanine 5-Aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil, desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, Thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-daminoguanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A),The modified nucleotide may comprise a modified nucleobase selected from the group consisting of N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). The modified nucleotide may comprise a modified sugar. In some embodiments, the nucleotide analogs are 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3'-dideoxyribose , 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked, and 2'-O,4'-C-thio-linked ribose. Modified nucleotides may include a modified phosphate. In some embodiments, the nucleotide analog comprises a modified phosphate selected from the group consisting of phosphorothioate (PS), thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropylphosphoramidate. In some embodiments, the nucleotide analog comprises a modified nucleobase,In some embodiments, the IDR sequence comprises two or more of a modified sugar and a modified phosphate. In some embodiments, the IDR sequence comprises multiple nucleotide analogs. In some embodiments, the use of an IDR sequence corresponding to a particular formula involves an internal N, m and / or N n This allows variable sequences, such as nucleotides, to vary between RNA species, while the presence of conserved first, last, and / or internal nucleotides allows for the identification of contaminating RNAs or RNA fragments that do not contain the correct conserved nucleotide(s) of the formula. Furthermore, the presence of one or more conserved nucleotides at the beginning or end of the IDR sequence allows for the use of the conserved nucleotides in sequence-dependent cloning methods (e.g., restriction enzyme digestion and ligation), such that IDR sequences containing diverse internal sequences can be inserted into a DNA template using the same cloning method. In some embodiments, the IDR sequence has the formula AN n -A, where n is 3 to 20. In some embodiments, the IDR sequence is of the formula AN n -C, where n is 3 to 20. In some embodiments, the IDR sequence has the formula AN n -G, where n is 3 to 20. In some embodiments, the IDR sequence has the formula AN n -U, where n is 3 to 20. In some embodiments, the IDR sequence has the formula CN n -A, where n is 3 to 20. In some embodiments, the IDR sequence has the formula CN n -C, where n is 3 to 20. In some embodiments, the IDR sequence has the formula CN n -G, where n is 3 to 20. In some embodiments, the IDR sequence has the formula CN n -U, where n is 3 to 20. In some embodiments, the IDR sequence has the formula GN n -A wherein n is 3 to 20. In some embodiments, the IDR sequence has the formula GN n-C, where n is 3 to 20. In some embodiments, the IDR sequence has the formula GN n -G, where n is 3 to 20. In some embodiments, the IDR sequence has the formula GN n -U, where n is 3 to 20. In some embodiments, the IDR sequence has the formula UN n -A, where n is 3 to 20. In some embodiments, the IDR sequence has the formula UN n -C, where n is 3 to 20. In some embodiments, the IDR sequence has the formula UN n -G, where n is 3 to 20. In some embodiments, the IDR sequence has the formula UN n -U, where n is 3 to 20. In some embodiments, the IDR sequence has the formula AN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula AN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AN n -C, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula AN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula AN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AN n-U, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula CN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula CN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CN n -C, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula CN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula CN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CN n -U, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula GN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula GN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GN n-C, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula GN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula GN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GN n -U, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula UN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UN n -A, wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula UN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UN n -C, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula UN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula UN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UN n-U, where m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence is of the formula N m -AA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -AU-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -CU-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -GU-N nwherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UU-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, the IDR sequence has the formula N m -UG-N n wherein m is 3 to 20 and n is 21 or greater. In some embodiments, the IDR sequence has the formula N m -UG-N n wherein m is 21 or more and n is 3 to 20 or more. In some embodiments, the IDR sequence has the formula N m -UG-N n wherein each of m and n is 21 or greater. In some embodiments, m is 21 or greater, 30 or greater, 40 or greater, 50 or greater, 60 or greater, 70 or greater, 80 or greater, 90 or greater, 100 or greater, or greater. In some embodiments, n is 21 or greater, 30 or greater, 40 or greater, 50 or greater, 60 or greater, 70 or greater, 80 or greater, 90 or greater, 100 or greater, or greater.

[0211] In some embodiments, one or more RNA species (e.g., RNAs of a given sequence) in an RNA composition (e.g., a multivalent RNA composition) comprise IDR sequences with different masses. The IDR sequences can differ in mass due to differences in sequence length, base composition, or sequence length and base composition. In some embodiments, each RNA species in a multivalent RNA composition comprises an IDR sequence that differs in mass from all other IDR sequences in the multivalent RNA composition (i.e., associated with other RNA species) by about 9 to about 8,000 Da or more, such as 50 to 2,000 Da, 100 to 1,500 Da, 200 to 1,000 Da, or 400 to 800 Da. In some embodiments, each RNA species in a multivalent RNA composition has a mass that is at least 50 Da, at least 100 Da, at least 200 Da, at least 300 Da, at least 400 Da, at least 500 Da, at least 600 Da, at least 700 Da, at least 800 Da, at least 900 Da, at least 1000 Da, at least 1100 Da, at least 1200 Da, at least and / or at least 1300 Da, at least 1400 Da, at least 1500 Da, at least 1600 Da, at least 1700 Da, at least 1800 Da, at least 1900 Da, at least 1900 Da, at least 2000 Da, at least 3000 Da, at least 4000 Da, at least 5000 Da, at least 6000 Da, at least 7000 Da, or at least 8000 Da, or more. In some embodiments, the RNA species in the RNA composition have IDR sequences with a mass of about 9 Da or more, e.g., about 50 Da, about 100 Da, about 200 Da, about 300 Da, about 400 Da, about Da, about 600 Da, about 700 Da, about 800 Da, about 900 Da, about 1000 Da, about 1100 Da, about 1200 Da, about 1300 Da, about 1400 Da, about 1500 Da, about 1600 Da, about 1700 Da, about 1800 Da, about 1900 Da, about 1900 Da, about 2000 Da, about 3000 Da, about 4000 Da, about 5000 Da, about 6000 Da, about 7000 Da, or about 8000 Da, or more. In some embodiments, the RNA species in the RNA composition have IDR sequences with masses of about 50 Da or less.

[0212] In some embodiments, each RNA species in a multivalent RNA composition comprises an IDR sequence of a different length. In some embodiments, one RNA species in a multivalent RNA composition comprises an IDR sequence of length 0. An IDR sequence of length 0 refers to the absence of nucleotides at positions where other RNA species in the multivalent RNA composition comprise IDR sequences. RNA species with an IDR sequence of length 0 can be distinguished from other RNA species because they lack nucleotides at positions where other RNA species have IDR sequences, which reduces their mass compared to other RNA species. In some embodiments, each RNA species in a multivalent RNA composition comprises an IDR sequence of 0 to 100, 0 to 50, 0 to 30, 0 to 20, 0 to 10, or 0 to 5 nucleotides in length. In some embodiments, each RNA species in a multivalent RNA composition comprises an IDR sequence of 1 to 100, 1 to 50, 1 to 30, 1 to 20, 1 to 10, or 1 to 5 nucleotides in length.

[0213] In some embodiments, two or more RNA species in a multivalent RNA composition contain IDR sequences of the same length but different masses. In some embodiments, the RNA species in a multivalent RNA composition do not contain IDR sequences that are sequence isomers of IDR sequences contained on different RNA species. As used herein, "sequence isomer" refers to a nucleic acid sequence that contains the same number of bases as a reference sequence, but the order of bases in the sequence isomer is different from the order of the reference sequence. For example, the RNA sequences AGUU, GUUA, and UUGA are each sequence isomers of the reference sequence UGUA. Methods for determining the mass of nucleic acid sequences, such as IDR sequences, are known in the art and include methods such as mass spectrometry. In some embodiments, cleavage of each different RNA species with RNase H produces RNA fragments with different masses. In some embodiments, the mass of each RNA or RNA fragment is determined by mass spectrometry. In some embodiments, cleavage of at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or up to 100% of the RNA of a given RNA species produces RNA fragments with approximately the same mass. Two RNA fragments are said to have "approximately the same mass" if the mass of one RNA fragment is at least 90% but not more than 110% of the mass of the other RNA fragment.In some embodiments, cleavage of each RNA species in a multivalent RNA composition differs in mass from the RNA fragments generated by cleavage of all other RNA species in the composition by at least 9 Da, e.g., at least 50 Da, at least 100 Da, at least 200 Da, at least 300 Da, at least 400 Da, at least 500 Da, at least 600 Da, at least 700 Da, at least 800 Da, at least 900 Da, at least 1000 Da, at least 1100 Da, at least In some embodiments, cleavage of each RNA species in a multivalent RNA composition generates RNA fragments having a mass that differs by 9-8000 Da, 50-2000 Da, 100-1500 Da, 200-1000 Da, or 400-800 Da, or more, from the mass of RNA fragments generated by cleavage of all other RNA species in the composition. Exemplary IDR sequences with different masses include - (0 length IDR sequence), A, GG, CC, GGA, CCA, GGAA, GGUUA, GACCA, GGACCA, GGCCAAA, GGCCAAGA, GGCCAAGGA, and CCCGUACCCCC (SEQ ID NO: 1).

[0214] In some embodiments, two or more RNA species in a multivalent RNA composition comprise IDR sequences having the same length but different masses, and each RNA species comprises an IDR sequence having the same first and last nucleotides. In some embodiments, the IDR sequence of each RNA species in a multivalent RNA composition is of the formula: AN n -A, AN n -C, AN n -G, AN n -U,CN n -A, CN n-C, CN n -G, CN n -U, GN n -A, GN n -C, GN n -G, GN n -U, UN n -A, UN n -A, UN n -G, or UN n -U, where n is an integer in the range of 3 to 20, inclusive, and each N is independently selected from A, C, G, or U, or an analog of A, C, G, or U. In some embodiments, each RNA is independently selected from the group consisting of AN n -A, AN n -C, AN n -G, AN n -U,CN n -A, CN n -C, CN n -G, CN n -U, GN n -A, GN n -C, GN n -G, GN n -U, UN n -A, UN n -A, UN n -G, UN n -U, AN m -AN n , N m -AN n -A, AN m -CN n , N m -AN n -C, AN m -GN n , N m -AN n -G, AN m -UN n , N m -AN n -U,CN m -AN n , N m -CN n -A, CN m -CN n , N m -CNn -C, CN m -GN n , N m -CN n -G, CN m -UN n , N m -CN n -U, GN m -AN n , N m -GN n -A, GN m -CN n , N m -GN n -C, GN m -GN n , N m -GN n -G, GN m -UN n , N m -GN n -U, UN m -AN n , N m -UN n -A, UN m -CN n , N m -UN n -C, UN m -GN n , N m -UN n -G, UN m -UN n , and N m -UN n -U, where m and n are each independently an integer selected from the range of 3 to 20, inclusive, and each N is independently selected from A, C, G, or U, or an analog of A, C, G, or U. In some embodiments, each RNA comprises an IDR sequence having a formula selected from the group consisting of AN n -A, AN n -C, AN n -G, AN n -U,CN n -A, CN n -C, CN n -G, CN n -U, GN n-A、G-N n -C、G-N n -G、G-N n -U、U-N n -A、U-N n -A、U-N n -G、U-N n -U、A-N m -A-N n 、N m -A-N n -A、A-N m -C-N n 、N m -A-N n -C、A-N m -G-N n 、N m -A-N n -G、A-N m -U-N n 、N m -A-N n -U、C-N m -A-N n 、N m -C-N n -A、C-N m -C-N n 、N m -C-N n -C、C-N m -G-N n 、N m -C-N n -G、C-N m -U-N n 、N m -C-N n -U、G-N m -A-N n 、N m -G-N n -A、G-N m -C-N n 、N m -G-N n -C、G-N m -G-N n 、N m -G-N n -G、G-N m -U-N n 、N m -G-N n -U、U-N m -A-N n 、N m-UN n -A, UN m -CN n , N m -UN n -C, UN m -GN n , N m -UN n -G, UN m -UN n , and N m -UN n -U, where m and n are each independently an integer selected from the range of 3 to 20, inclusive, and each N is independently selected from A, C, G, or U, or an analog of A, C, G, or U. In some embodiments, each RNA species comprises an IDR sequence having the same formula selected from the group consisting of: AN n -A, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN n -C, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN n -G, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN n -U, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN n -A, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN n -C, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN n -G, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN n -U, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN n -A, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN n-C, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN n -G, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN n -U, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN n -A, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN n -C, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN n -G, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN n -U, where n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AN n -C, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula AN m-UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AN n -U, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CN n -C, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula CN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CN n -U, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m-GN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GN n -C, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula GN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GN n -G, wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species , the formula GN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GN n -U, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN m -AN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UN n -A, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN m -CN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UN n-C, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN m -GN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UN n -G, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula UN m -UN n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UN n -U, where m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -AU-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CG-N nwherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -CU-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -GU-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UA-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UC-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UG-N n wherein m is 3 to 20 and n is 3 to 20. In some embodiments, each RNA species comprises an IDR sequence having the formula N m -UU-N n wherein m is 3 to 20 and n is 3 to 20.

[0215] In some embodiments, one or more in vitro transcribed mRNAs comprise one or more IDR sequences in an untranslated region (UTR), such as the 5' UTR or 3' UTR. Including an IDR sequence in a UTR of an mRNA prevents the IDR sequence from being translated into a peptide. In some embodiments, including an IDR sequence in a UTR does not adversely affect translation of the mRNA into a protein (e.g., reducing translation). In some embodiments, the IDR sequence is located in the 3' UTR of the mRNA. In some embodiments, the IDR sequence is located upstream of the polyA tail of the mRNA. In some embodiments, the IDR sequence is located downstream (e.g., after) the polyA tail of the mRNA. In some embodiments, the IDR sequence is located between the last codon of the ORF of the mRNA and the first "A" of the polyA tail of the mRNA. In some embodiments, a polynucleotide IDR sequence located in a UTR comprises 1 to 30 nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides). In some embodiments, a UTR comprising a polynucleotide IDR sequence further comprises one or more (e.g., 1, 2, 3, or more) RNase cleavage sites, such as an RNase H cleavage site.

[0216] In some embodiments, each different RNA in a polyvalent RNA composition comprises a different (e.g., unique) IDR sequence. In some embodiments, each IDR sequence has a length independently selected from 0 to 25 nucleotides. An IDR sequence of length 0 refers to the absence of nucleotides where other RNA species comprise IDR sequences of length 1 or greater. RNA species or mRNA fragments comprising an IDR sequence of length 0 can be distinguished from RNA species or mRNA fragments comprising IDR sequences of one or more nucleotides based on mass (due to the low mass of RNAs with IDR sequences of length 0) and / or sequence (due to the absence of nucleotides corresponding to the IDR sequence within the nucleotide sequence of the RNA). In some embodiments, each IDR sequence has a length independently selected from 1 to 25 nucleotides. In some embodiments, each RNA species comprises an IDR sequence of a different length. In some embodiments, the UTR comprises a recognition sequence complementary to an RNase H guide.

[0217] An RNase H guide refers to a polynucleotide comprising one or more DNA nucleotides that can hybridize to RNA to form an RNA:DNA hybrid, thereby facilitating cleavage of the RNA of the RNA:DNA hybrid by RNase H. In some embodiments, the RNase H guide is a chimeric polynucleotide comprising one or more DNA nucleotides and one or more RNA nucleotides. In some embodiments, the RNase H guide has the formula [R] q D1D2D3D4[R] p or [R] q D1D2D3[R] p wherein each R is an RNA nucleotide, each D is a DNA nucleotide, and each of p and q is independently an integer selected from 0 to 50. In some embodiments, the method comprises: p D1D2D3D4[R] qwherein each R is an RNA nucleotide, each D is a DNA nucleotide, and each of p and q is independently an integer between 1 and 50. In some embodiments, the method includes cleaving an RNA fragment comprising an IDR sequence from the RNA by hybridizing one or more oligonucleotides to the RNA (e.g., hybridizing in the presence of an RNase H enzyme), wherein the one or more oligonucleotides have a nucleotide sequence represented by the formula [R] p D1D2D3D4[R] q wherein each R is an RNA nucleotide, each D is a DNA nucleotide, and p and q are each independently an integer from 1 to 50.

[0218] In some embodiments, the method includes contacting an RNA composition with two or more RNase H guide oligonucleotides. In some embodiments, the two or more RNase H guide oligonucleotides are oligonucleotides that hybridize to different nucleotide sequences present on different RNAs in the RNA composition. Binding of two or more RNase H guide oligonucleotides to different sequences of different RNAs in the composition allows targeted cleavage of RNAs with different sequences. In some embodiments, a first RNase H guide oligonucleotide is capable of hybridizing to a first nucleotide sequence of the RNA, and a second RNase H guide oligonucleotide is capable of hybridizing to a second nucleotide sequence of the RNA. Binding of two or more RNase guide oligonucleotides to the same RNA can direct RNase H to cleave the RNA at multiple sites, allowing for the release of RNA fragments containing nucleotide sequences located between the sites of RNase H-mediated cleavage.

[0219] In some embodiments, the method comprises hybridizing one or more RNase H guide oligonucleotides to a sequence in the 5' UTR of the RNA. In some embodiments, the method comprises cleaving the 5' UTR of the RNA (e.g., in the presence of an RNase H enzyme) by hybridizing one or more oligonucleotides to a sequence in the 5' UTR of the RNA to release an RNA fragment comprising an IDR sequence. In some embodiments, the released RNA fragment comprising the IDR sequence further comprises a cap. In some embodiments, the method comprises cleaving the 5' UTR of the RNA at a position upstream of the IDR sequence and at a position downstream of the IDR sequence, thereby releasing an RNA fragment comprising the IDR sequence, but not a 5' cap or a portion of the open reading frame. In some embodiments, the method involves contacting RNA with a first RNase H guide oligonucleotide that hybridizes to a nucleotide sequence in the 5' UTR upstream of the IDR sequence and a second RNase H guide oligonucleotide that hybridizes to a nucleotide sequence in the 5' UTR downstream of the IDR sequence. Hybridization of the first (or leading) RNase H guide oligonucleotide upstream from the IDR sequence allows RNase H to recognize and cleave the portion of the RNA upstream from the IDR sequence, thereby releasing the 5' cap from the RNA fragment containing the IDR sequence. Hybridization of the second (or trailing) RNase H guide oligonucleotide downstream of the IDR sequence allows RNase H to recognize and cleave the portion of the RNA downstream of the IDR sequence, thereby releasing the open reading frame and downstream elements from the RNA fragment containing the IDR sequence. The combined use of a first (front) and a second (rear) RNase H guide oligonucleotide to cleave at positions within the 5' UTR upstream and downstream of the IDR sequence, respectively, allows for the release of an RNA fragment containing the IDR sequence, but not the 5' cap or open reading frame and downstream elements (e.g., the 3' UTR and polyA tail).

[0220] In some embodiments, the method comprises hybridizing one or more RNase H guide oligonucleotides to a sequence in the 3' UTR of the RNA. In some embodiments, the method comprises cleaving the 3' UTR of the RNA (e.g., in the presence of an RNase H enzyme) by hybridizing one or more oligonucleotides to a sequence in the 3' UTR of the RNA to release an RNA fragment comprising an IDR sequence. In some embodiments, the released RNA fragment comprising the IDR sequence further comprises a poly(A) tail. In some embodiments, the method comprises cleaving the 3' UTR of the RNA at a position upstream of the IDR sequence and at a position downstream of the IDR sequence, such that cleaving the 3' UTR upstream and downstream from the IDR sequence releases an RNA fragment comprising the IDR sequence, but not a polyA tail or a portion of the open reading frame. In some embodiments, the method involves contacting an RNA with a first RNase H guide oligonucleotide that hybridizes to a nucleotide sequence in the 3' UTR upstream of the IDR sequence and a second RNase H guide oligonucleotide that hybridizes to a nucleotide sequence in the 3' UTR downstream of the IDR sequence. Hybridization of the first (or front) RNase H guide oligonucleotide upstream of the IDR sequence allows RNase H to recognize and cleave a portion of the RNA upstream of the IDR sequence, thereby releasing the open reading frame and upstream elements (e.g., the 5' cap and 5' UTR) from the RNA fragment containing the IDR sequence. Hybridization of the second (or rear) RNase H guide oligonucleotide downstream of the IDR sequence allows RNase H to recognize and cleave a portion of the RNA downstream of the IDR sequence, thereby releasing the polyA tail. The combined use of a first (front) and a second (rear) RNase H guide oligonucleotide to cleave at positions in the 3'UTR upstream and downstream of the IDR sequence, respectively, allows for the release of an RNA fragment containing the IDR sequence, but not the open reading frame and upstream elements (e.g., 5' cap and 5'UTR) or polyA tail.

[0221] In some embodiments, cleaving an RNA in a multivalent RNA composition at two positions within the 5' UTR or two positions within the 3' UTR comprises contacting the multivalent RNA composition with a first and a second RNase H guide oligonucleotide, wherein the first RNase H guide oligonucleotide can hybridize to a sequence upstream from the IDR sequence, and the second RNase H guide oligonucleotide can hybridize to a sequence downstream from the IDR sequence. Hybridization of both the first and second RNase H guide oligonucleotides to the RNA allows RNase H to cleave the RNA at positions upstream and downstream from the IDR sequence, resulting in the release of RNA fragments containing the IDR sequence from each RNA. In some embodiments, cleaving upstream from the IDR sequence, such as when the IDR sequence is located in the 3' UTR of the RNA, releases RNA fragments from the upstream coding sequence of the RNA, while cleaving downstream from the IDR sequence releases RNA fragments from the poly(A) tail. Releasing the poly(A) tail in this manner prevents the generation of RNA fragments with identical IDR sequences but different poly(A) tail lengths, which may have different masses.

[0222] In some embodiments, the leading RNase H guide oligonucleotide is capable of binding to a nucleotide sequence present in each RNA of the RNA composition. In some embodiments, the trailing RNase H guide oligonucleotide is capable of binding to a nucleotide sequence present in each RNA of the RNA composition. By contacting an RNA composition containing multiple RNAs with leading and / or trailing RNase H guide oligonucleotides capable of binding to each RNA in the composition, the same RNase H guide oligonucleotide can direct RNase H-mediated cleavage of each RNA in the composition.

[0223] In some embodiments, the method comprises contacting the RNA composition with a first leading RNase H guide oligonucleotide and a second leading RNase H guide oligonucleotide. In some embodiments, the method comprises contacting the RNA composition with a first trailing RNase H guide oligonucleotide and a second trailing RNase H guide oligonucleotide. In some embodiments, the first and / or second RNase H guide oligonucleotide are incapable of binding to each RNA in the RNA composition. Thus, in some embodiments, RNase H guide oligonucleotides are used to induce cleavage of different RNAs in the RNA composition.

[0224] In some embodiments, at least one R is a modified RNA nucleotide, for example, a 2'-O-methyl modified RNA nucleotide. In some embodiments, each R is a modified RNA nucleotide. In some embodiments, at least one R is a 2'-O-methyl modified RNA nucleotide. In some embodiments, each R is a 2'-O-methyl modified RNA nucleotide.

[0225] In some embodiments, at least one D is a modified DNA nucleotide. Non-limiting examples of modified deoxyribonucleotides from which the modified DNA nucleotides of the RNase H guide oligonucleotide may be selected include 5-nitroindole, inosine, 4-nitroindole, 6-nitroindole, 3-nitropyrrole, 2-6-diaminopurine, 2-amino-adenine, or 2-thio-thiamine DNA nucleotides. In some embodiments, each D is a modified DNA nucleotide. In some embodiments, each of D1 and D2 is an unmodified (e.g., natural) deoxyribonucleotide base. As used herein, "unmodified deoxyribonucleotide base" refers to a natural DNA base such as adenosine, guanosine, cytosine, thymine, or uracil. In some embodiments, D3, D4, or D3 and D4 are unnatural (e.g., modified) deoxyribonucleotide bases.

[0226] [R] q and [R] p The length of each of the following can independently vary in length. For example, in some embodiments, q is an integer between 0 and 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or is 50), and p is an integer between 0 and 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50).

[0227] In some embodiments, q is an integer between 0 and 30 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) and p is an integer between 0 and 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30).

[0228] In some embodiments, q is an integer between 0 and 15 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) and p is an integer between 0 and 15 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15).

[0229] In some embodiments, q is an integer between 0 and 6 (e.g., 0, 1, 2, 3, 4, 5, or 6) and p is an integer between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10). In some embodiments, p is an integer between 0 and 6 (e.g., 0, 1, 2, 3, 4, 5, or 6) and q is an integer between 1 and 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).

[0230] In some embodiments, one or more RNAs of the RNA composition contain one or more recognition sequences for one or more RNase H guide oligonucleotides. In some embodiments, the RNA contains one or more recognition sequences upstream from the IDR sequence on the RNA and one or more recognition sequences downstream from the IDR sequence. The recognition sequence upstream of the IDR sequence may be referred to as the "front" recognition sequence, and the RNase H guide oligonucleotide capable of hybridizing to the front recognition sequence may be referred to as the "front" RNase H guide oligonucleotide. In some embodiments, the front RNase H guide binds to a nucleotide sequence that is 5-10, 10-20, 20-30, 30-50, 50-75, 75-100, 100-150, 150-200, 200-300, 300-400, or 400-500 nucleotides upstream from the IDR sequence. The recognition sequence downstream from the IDR sequence may be referred to as the "rear" recognition sequence, and the RNase H guide oligonucleotide capable of hybridizing to the rear recognition sequence may be referred to as the "rear" RNase H guide oligonucleotide. In some embodiments, the rear RNase H guide binds to a nucleotide sequence that is 5-10, 10-20, 20-30, 30-50, 50-75, 75-100, 100-150, 150-200, 200-300, 300-400, or 400-500 nucleotides downstream from the IDR sequence. In some embodiments, hybridizing the front RNase H guide oligonucleotide to the front recognition sequence and the rear RNase H guide oligonucleotide to the rear recognition sequence cleaves the RNA at positions upstream and downstream from the IDR sequence, thereby releasing RNA fragments containing the IDR sequence. In some embodiments, the released RNA fragments do not contain a 5' cap, open reading frame, or polyA tail.

[0231] In some embodiments, the recognition sequence includes all nucleotides of the RNA bound by the RNase H guide. In some embodiments, the recognition sequence includes nucleotides bound by the DNA nucleotides of the RNase H guide. In some embodiments, the RNase H guide includes one or more RNA nucleotides, and the recognition sequence includes RNA nucleotides of the mRNA bound by the DNA nucleotides of the RNase H guide. In some embodiments, the nucleotide sequence of the RNA bound by the RNase H guide oligonucleotide is referred to as an RNase H cleavage sequence.

[0232] In some embodiments, the RNA recognition sequence and / or RNase H cleavage sequence does not contain homopolymeric repeats. In some embodiments, the leading RNase H guide oligonucleotide does not contain homopolymeric repeats. In some embodiments, the leading RNase H guide oligonucleotide does not contain homopolymeric repeats of DNA nucleotides. In some embodiments, the trailing RNase H guide oligonucleotide does not contain homopolymeric repeats. In some embodiments, the trailing RNase H guide oligonucleotide does not contain homopolymeric repeats of DNA nucleotides. A homopolymeric repeat refers to a sequence of consecutive nucleotides containing the same nucleobase. For example, the nucleotide sequence CCCC is a homopolymeric repeat of four cytidine bases in length. The presence of homopolymeric repeats in the mRNA recognition sequence and / or RNase H cleavage sequence, or corresponding homopolymeric repeats in the RNase H guide nucleotide sequence, can reduce the specificity of binding by the RNase H guide because portions of the RNase H guide can bind at multiple different positions within the mRNA recognition sequence. This reduced binding specificity can result in cleavage of the same mRNA into different RNA fragments depending on where the RNase H guide or DNA portion of the RNase H guide binds, thus hindering analysis of RNA fragments, as multiple RNA fragments may correspond to the same mRNA, or the same RNA fragment may correspond to multiple different mRNAs. Reducing the number and length of homopolymer repeats in the recognition sequence of an mRNA and / or the RNase H cleavage sequence, and therefore the number and length of homopolymer repeats in the complementary RNase H guide or DNA portion of the RNase H guide, can improve the specificity of RNase H guide binding and subsequent RNase H-mediated cleavage.

[0233] In some embodiments, the recognition sequence and / or RNase H cleavage sequence does not contain homopolymer repeats that are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more identical bases in length. In some embodiments, the leading RNase H guide oligonucleotide sequence does not contain homopolymer repeats that are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more identical bases in length. In some embodiments, the leading RNase H guide oligonucleotide sequence does not contain homopolymer repeats of DNA nucleotides that are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more identical bases in length. In some embodiments, the trailing RNase H guide oligonucleotide sequence does not contain homopolymer repeats that are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more identical bases in length. In some embodiments, the trailing RNase H guide oligonucleotide sequence does not contain homopolymeric repeats of DNA nucleotides that are 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more identical bases in length.

[0234] In some embodiments, the recognition sequence and / or RNase H cleavage sequence does not contain any homopolymeric repeats that are 3 or more bases in length. In some embodiments, the front RNase H guide oligonucleotide does not contain any homopolymeric repeats that are 3 or more bases in length. In some embodiments, the front RNase H guide oligonucleotide does not contain any homopolymeric repeats of DNA nucleotides that are 3 or more bases in length. In some embodiments, the rear RNase H guide oligonucleotide does not contain any homopolymeric repeats that are 3 or more bases in length. In some embodiments, the rear RNase H guide oligonucleotide does not contain any homopolymeric repeats of DNA nucleotides that are 3 or more bases in length. In some embodiments, the recognition sequence and / or RNase H cleavage sequence does not contain any homopolymeric repeats that are 3 bases in length (homotrimers). In some embodiments, the front RNase H guide oligonucleotide sequence does not contain any homopolymeric repeats that are 3 bases in length (homotrimers). In some embodiments, the front RNase H guide oligonucleotide sequence does not contain any homopolymeric repeats of DNA nucleotides that are 3 bases in length (homotrimers). In some embodiments, the trailing RNase H guide oligonucleotide sequence does not include any homopolymeric repeats (homotrimers) that are three bases in length. In some embodiments, the trailing RNase H guide oligonucleotide sequence does not include any homopolymeric repeats (homotrimers) of DNA nucleotides that are three bases in length.

[0235] In some embodiments, the recognition sequence, identifier sequence, 5'UTR, or 3'UTR does not contain a start codon. In some embodiments, the recognition sequence, identifier sequence, 5'UTR, or 3'UTR does not contain the sequence "AUG." The absence of a start codon in the 5'UTR or 3'UTR prevents sequences in the 3'UTR of an mRNA from being translated into an undesired protein. In some embodiments, the recognition sequence, identifier sequence, 5'UTR, or 3'UTR does not contain an XbaI recognition site. In some embodiments, the recognition sequence, identifier sequence, 5'UTR, or 3'UTR does not contain the nucleic acid sequence "UCUAG." The absence of an XbaI recognition site in a 5'UTR or 3'UTR sequence allows the restriction enzyme XbaI to be used to generate and modify DNA templates for in vitro transcription without affecting the 5'UTR or 3'UTR sequence of the transcribed mRNA. In some embodiments, the recognition sequence, identifier sequence, 5'UTR, or 3'UTR does not contain a palindromic sequence. With respect to nucleic acid sequences, a palindromic sequence contains the same bases in 5' to 3' order as in 3' to 5' order. For example, the nucleic acid sequence 5'-TACACAT-3' is a palindromic sequence. In some embodiments, the recognition sequence, discrimination sequence, or 3' UTR is 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more nucleotides in length and does not contain a nucleic acid sequence complementary to a sequence on an mRNA. An mRNA containing a nucleic acid sequence complementary to a nucleic acid sequence on an mRNA can hybridize with other identical mRNA molecules to form double-stranded RNA (dsRNA). Intracellular dsRNA induces an innate immune response with multiple undesirable effects, such as RNA hydrolysis and changes in cellular physiology, including cell death. In some embodiments, the recognition sequence, discrimination sequence, 5' UTR, or 3' UTR does not contain a microRNA (miRNA) binding site.Information regarding the sequence, origin, and function of known microRNAs can be found in publicly available databases (e.g., mirbase.org, all versions, Kozomara et al., Nucleic Acids Res 2014 42:D68-D73, Kozomara et al., Nucleic Acids Res 2011 39:D152-D157, Griffiths-Jones et al., Nucleic Acids Res 2008 36:D154-D158, Griffiths-Jones et al., Nucleic Acids Res 2006 34:D140-D144, and Griffiths-Jones et al., Nucleic Acids Res 2004 32:D109-D111 (including the most recently released version, miRBase 21, which contains "high-confidence" microRNAs)).

[0236] In some embodiments, each RNA species in the multivalent RNA composition comprises an IDR sequence having a different length. In some embodiments, an RNase H guide directs cleavage of different RNA species in the multivalent RNA composition into RNA fragments with different masses. In some embodiments, an RNase H guide directs cleavage of different RNA species in the multivalent RNA composition into RNA fragments with different lengths. In some embodiments, two or more RNA species in the multivalent RNA composition comprise IDR sequences of the same length but different masses. In some embodiments, an RNase H guide directs cleavage of different RNA species in the multivalent RNA composition into RNA fragments of the same length but different masses. In some embodiments, an RNA species in the multivalent RNA composition does not comprise an IDR sequence that is a sequence isomer of an IDR sequence contained on a different RNA species. In some embodiments, an RNase H guide directs cleavage of different RNA species in the multivalent RNA composition into RNA fragments that comprise IDR sequences that are not sequence isomers of each other.

[0237] In some embodiments, the RNA of a polyvalent RNA composition is detected and / or purified according to the RNA's polynucleotide IDR sequence. In some embodiments, the mRNA IDR sequence is used to identify the presence of mRNA in a sample (e.g., a reaction product or drug product) or to determine the relative ratio of different mRNAs. In some embodiments, the mRNA IDR sequence is detected using one or more of deep sequencing, PCR, and Sanger sequencing. In some embodiments, the mRNA IDR sequence is detected via liquid chromatography-ultraviolet (UV) detection (LC-UV). LC-UV is a technique that combines liquid chromatography to separate molecules in a composition based on properties including size and surface charge, and detects the amount of different molecules using ultraviolet spectroscopy. See, e.g., Russell and Limbach. J Chromatogr B Analyt Technol Biomed Life Sci. 2013. 923-924:74-82. In some embodiments, the detection of the amounts of different molecules (e.g., RNA species of a multivalent RNA composition) is used to calculate the concentration of each molecule, and the amounts of two molecules are divided to calculate the ratio between the different molecules. For example, in some embodiments, LC-UV is used to detect the amounts of detected RNA fragments containing different IDR sequences to calculate the amounts of RNA fragments containing IDR sequences corresponding to different RNA species in the multivalent RNA composition, and one or more ratios of the corresponding RNA species in the multivalent RNA composition.

[0238] In some embodiments, mRNA IDR sequences are detected via HPLC. In some embodiments, mRNAs with different IDR sequences are detected using mass spectrometry of RNA fragments generated by RNase cleavage. Mass spectrometry determines the mass-to-charge ratio of analytes (e.g., nucleic acids) in a composition by ionizing the analytes and accelerating them through a magnetic field, which deflects ions based on their size, with lighter, more highly charged ions being deflected more strongly. In some embodiments, RNA fragments are analyzed by liquid chromatography-mass spectrometry (LC-MS). LC-MS is a technique that combines the use of liquid chromatography (e.g., HPLC) to separate molecules in a composition based on properties including size and charge, followed by mass spectrometry to determine the mass-to-charge ratio of the separated molecules. See, for example, Russell and Limbach. J Chromatogr B Analyt Technol Biomed Life Sci. 2013. 923-924:74-82. In some embodiments, the amounts of RNA fragments detected by LC-MS corresponding to different mRNA species are used to calculate the ratios between different mRNA species in a multivalent RNA composition. For example, in some embodiments, LC-MS is used to detect the amounts of detected RNA fragments containing different IDR sequences to calculate the amounts of RNA fragments containing IDR sequences corresponding to different RNA species in a multivalent RNA composition and one or more ratios of the corresponding RNA species in the multivalent RNA composition.

[0239] In some embodiments, analyzing the multivalent RNA composition includes detecting the amount of RNA fragments containing IDR sequences corresponding to RNA species in the multivalent RNA composition and using the detected amount of RNA fragments to calculate the ratio between two RNA species in the multivalent RNA composition. For example, in some embodiments, the amount of a first RNA fragment corresponding to a first RNA species is divided by the amount of a second RNA fragment corresponding to a second RNA species, and the resulting quotient represents the ratio between the first RNA species and the second RNA species. In some embodiments, the amount of each RNA species is determined by measuring the amount of RNA fragments corresponding to each RNA species, and the ratio between each pair of RNA species is calculated. In some embodiments, the ratio between each pair of three RNA species is calculated. In some embodiments, the ratio between each pair of four RNA species is calculated. In some embodiments, the ratio between each pair of five RNA species is calculated. In some embodiments, the ratio between each pair of six RNA species is calculated. In some embodiments, the ratio between each pair of seven RNA species is calculated. In some embodiments, the ratio between each pair of eight RNA species is calculated. In some embodiments, the ratio between each pair of nine RNA species is calculated. In some embodiments, the ratio between each pair of 10 RNA species is calculated. In some embodiments, the ratio between each pair of 11 RNA species is calculated. In some embodiments, the ratio between each pair of 12 RNA species is calculated. In some embodiments, the ratio between each pair of 13 RNA species is calculated. In some embodiments, the ratio between each pair of 14 RNA species is calculated. In some embodiments, the ratio between each pair of 15 RNA species is calculated. In some embodiments, the ratio between each pair of 16 RNA species is calculated. In some embodiments, the ratio between each pair of 17 RNA species is calculated. In some embodiments, the ratio between each pair of 18 RNA species is calculated. In some embodiments, the ratio between each pair of 19 RNA species is calculated. In some embodiments, the ratio between each pair of 20 RNA species is calculated. In some embodiments, the ratio between each pair of 21 RNA species is calculated. In some embodiments, the ratio between each pair of 22 RNA species is calculated. In some embodiments, the ratio between each pair of 23 RNA species is calculated.In some embodiments, the ratio between each pair of 24 RNA species is calculated. In some embodiments, the ratio between each pair of 25 RNA species is calculated.

[0240] In some embodiments, a multivalent RNA composition comprises two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more, twenty-one or more, twenty-two or more, twenty-four or more, or twenty-five or more RNA species. In some embodiments, a multivalent RNA composition comprises two RNA species. In some embodiments, a multivalent RNA composition comprises three RNA species. In some embodiments, a multivalent RNA composition comprises four RNA species. In some embodiments, a multivalent RNA composition comprises five RNA species. In some embodiments, a multivalent RNA composition comprises six RNA species. In some embodiments, a multivalent RNA composition comprises seven RNA species. In some embodiments, a multivalent RNA composition comprises eight RNA species. In some embodiments, a multivalent RNA composition comprises nine RNA species. In some embodiments, a multivalent RNA composition comprises ten RNA species. In some embodiments, a multivalent RNA composition comprises eleven RNA species. In some embodiments, the multivalent RNA composition comprises 12 RNA species. In some embodiments, the multivalent RNA composition comprises 13 RNA species. In some embodiments, the multivalent RNA composition comprises 14 RNA species. In some embodiments, the multivalent RNA composition comprises 15 RNA species. In some embodiments, the multivalent RNA composition comprises 16 RNA species. In some embodiments, the multivalent RNA composition comprises 17 RNA species. In some embodiments, the multivalent RNA composition comprises 18 RNA species. In some embodiments, the multivalent RNA composition comprises 19 RNA species. In some embodiments, the multivalent RNA composition comprises 20 RNA species. In some embodiments, the multivalent RNA composition comprises 21 RNA species. In some embodiments, the multivalent RNA composition comprises 22 RNA species. In some embodiments, the multivalent RNA composition comprises 23 RNA species. In some embodiments, the multivalent RNA composition comprises 24 RNA species. In some embodiments, the multivalent RNA composition comprises 25 RNA species. In some embodiments, the multivalent RNA composition consists of two RNA species.In some embodiments, the multivalent RNA composition consists of three RNA species. In some embodiments, the multivalent RNA composition consists of four RNA species. In some embodiments, the multivalent RNA composition consists of five RNA species. In some embodiments, the multivalent RNA composition consists of six RNA species. In some embodiments, the multivalent RNA composition consists of seven RNA species. In some embodiments, the multivalent RNA composition consists of eight RNA species. In some embodiments, the multivalent RNA composition consists of nine RNA species. In some embodiments, the multivalent RNA composition consists of ten RNA species. In some embodiments, the multivalent RNA composition consists of eleven RNA species. In some embodiments, the multivalent RNA composition consists of twelve RNA species. In some embodiments, the multivalent RNA composition consists of thirteen RNA species. In some embodiments, the multivalent RNA composition consists of fourteen RNA species. In some embodiments, the multivalent RNA composition consists of fifteen RNA species. In some embodiments, the multivalent RNA composition consists of sixteen RNA species. In some embodiments, the multivalent RNA composition consists of seventeen RNA species. In some embodiments, the multivalent RNA composition consists of eighteen RNA species. In some embodiments, the multivalent RNA composition consists of 19 RNA species. In some embodiments, the multivalent RNA composition consists of 20 RNA species. In some embodiments, the multivalent RNA composition consists of 21 RNA species. In some embodiments, the multivalent RNA composition consists of 22 RNA species. In some embodiments, the multivalent RNA composition consists of 23 RNA species. In some embodiments, the multivalent RNA composition consists of 24 RNA species. In some embodiments, the multivalent RNA composition consists of 25 RNA species.

[0241] In some embodiments, the mass of an RNA fragment generated by RNase cleavage of a given RNA species in a multivalent RNA composition is at least 9 Da, at least 50 Da, at least 100 Da, at least 200 Da, at least 300 Da, at least 400 Da, at least 500 Da, at least 600 Da, at least 700 Da, at least 800 Da, at least 900 Da, at least 1 ... In some embodiments, the mass of an RNA fragment generated by RNase cleavage of a given RNA species in a multivalent RNA composition differs from the mass of an RNA fragment generated by RNase cleavage of all other RNA species in the composition by 50 to 2000 Da, 100 to 1500 Da, 200 to 1000 Da, or 400 to 800 Da. Exemplary IDR sequences with different masses include -(0 length IDR sequence), A, GG, CC, GGA, CCA, GGAA, GGUUA, GACCA, GGACCA, GGCCAAA, GGCCAAGA, GGCCAAGGA, and CCCGUACCCCC (SEQ ID NO: 1). Other exemplary IDR sequences include AACGUGAU, AAACAUCG, AUGCCUAA, AGUGGUCA, ACCACUGU, ACAUUGGC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, CUGUAGCC, AGUACAAG, AACAACCA, AACCGAGA, AACGCUUA, AAGACGGA, AAGGUACA, ACACAGAA, ACAGCAGA, ACCUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAGUCAA, AGAUCGCA, AGCAGGAA, AGUCACUA, AUCCUGUA, AUUGAGGA,CAACCACA, GACUAGUA, GUCCAUCA, CAAUGGAA, CACUUCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC, AUCACG, UGACCA, GACCUACGA, CCAA, GUUA, CCUUA, AGACC, UUACCA, GGAGGA, GUACGGA, GCACACA, GUUCAUU, GGCUUCUGACCA (SEQ ID NO: 2), GGCCACUCGUUAAGA (SEQ ID NO: 3), GGCCACUGAAGCCAUUGAAG (SEQ ID NO: 4), GGCCACUGAAGCCAUUGUCAAGGA (SEQ ID NO: 5), GGCCACUGAAGCCAUUGUCACCGAA (SEQ ID NO: 6), GGCGAAGCACUCG Examples include UGGCCAUUCGCA (SEQ ID NO: 7), GGCCAAGGA, GGCCAAGGAA (SEQ ID NO: 8), GGCCAAGGAAA (SEQ ID NO: 9), GGCCACUGAAGA (SEQ ID NO: 10), GGCCACUGAAGCCAUU (SEQ ID NO: 11), GGCCACUGAAGGAAG (SEQ ID NO: 12), CCGGACUAGAGA (SEQ ID NO: 13), GAAUAGAGAGGAA (SEQ ID NO: 14), GGCCACUGAAGGAAGA (SEQ ID NO: 15), GAACACUGAUCGUAGAA (SEQ ID NO: 16), GGCCACUGAAGGAAGAGA (SEQ ID NO: 17), GGAUAGAUAGCGAA (SEQ ID NO: 18), GGAGUGAGAGAGAA (SEQ ID NO: 19), or GGCCACAUAGCGAA (SEQ ID NO: 20). In some embodiments, each RNA species in the multivalent RNA composition comprises a different IDR sequence having a different mass than each IDR sequence of each other RNA species in the composition, and each RNA species comprises one of the following: -(0 length IDR sequence), A, GG, CC, GGA, CCA, GGAA, GGUUA, GACCA, GGACCA, GGCCAAA, GGCCAAGA, GGCCAAGGA, CCCGUACCCCC, AACGUGAU, AAACAUCG, AUGCCUAA, AGUGGUCA, ACCACUGU, ACAUUGGC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, CUGUAGCC, AGUACAAG, AACAACCA, AACCGAGA, AACGCUUA, AAGACGA, AAGGUACA,ACACAGAA, ACAGCAGA, ACCUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAGUCAA, AGAUCGCA, AGCAGGAA, AGUCACUA, AUCCUGUA, AUUGAGGA, CAACCACA, GACUAGUA, GUCCAUCA, CAAUGGAA, CACUUCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC, AUCACG, UGACCA, GACCUACGA, CCAA, GUUA, CCUUA, AGACC, UUACCA, GGAGGA, GUACGGA, GCACACA, GUUCAUU, GGCUUCUGACCA (SEQ ID NO: 2), GGCCACUCGUUAAGA (SEQ ID NO: 3), GGCCACUGAAGCCAUUGAAG (SEQ ID NO: 4), GGCCACUGAAGCCAUUGUCAAGGA (SEQ ID NO: 5) , GGCCACUGAAGCCAUUGUCACCGAA (SEQ ID NO: 6), GGCGAAGCACUCGUGGCCAUUCGCA (SEQ ID NO: 7), GGCCAAGGA, GGCCAAGGAA (SEQ ID NO: 8), GGCCAAGGAAA (SEQ ID NO: 9), GGCCACUGAAGA (SEQ ID NO: 10), GGCCACUGAAGCCAUU (SEQ ID NO: 11), GGCCACUGAAGGAAG (SEQ ID NO: 12), CCGGACUAGAGA (SEQ ID NO: 13), GAAUAGAGAGGAA (SEQ ID NO: 14), GGCCACUGAAGGAAGA (SEQ ID NO: 15), GAACACUGAUCGUAGAA (SEQ ID NO: 16), GGCCACUGAAGGAAGAGA (SEQ ID NO: 17), GGAUAGAUAGCGAA (SEQ ID NO: 18), GGAGUGAGAGAGAA (SEQ ID NO: 19), or GGCCACAUAGCGAA (SEQ ID NO: 20). In some embodiments, each RNA species in a multivalent RNA composition comprises a different IDR sequence that has a different mass from each IDR sequence of each other RNA species in the composition, and the IDR sequence of each RNA in the multivalent RNA composition is selected from the group consisting of A, GG, CC, GGA, CCA, GGAA, GGUUA, GACCA, GGACCA, GGCCAAA, GGCCAAGA, GGCCAAGGA, CCCGUACCCCC, AACGUGA, AAACAUCG, AUGCCUAA, AGUGGUCA,ACCACUGU, ACAUUGGC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, CUGUAGCC, AGUACAAG, AACAACCA, AACCGAGA, AACGCUUA, AAGACGGA, AAGGUACA, ACACA GAA, ACAGCAGA, ACCUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAGUCAA, AGAUCGCA, AGCAGGAA, AGUCACUA, AUCCUGUA, AUUGAGGA, CAACCACA, GACUAGUA, G UCCAUCA, CAAUGGAA, CACUUCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC, AUCACG, UGACCA, GACCUACGA, CCAA, GUUA, CCUUA, AGACC, UUACCA, GGAGGA, GUACGGA, GCACACA, GUUCAUU, GGCUUCUGACCA (SEQ ID NO: 2), GGCCACUCGUUAAGA (SEQ ID NO: 3), GGCCACUGAAGCCAUUGAAG (SEQ ID NO: 4), GGCCAC UGAAGCCAUUGUCAAGGA (SEQ ID NO: 5), GGCCACUGAAGCCAUUGUCACCGAA (SEQ ID NO: 6), GGCGAAGCACUCGUGGCCAUUCGCA (SEQ ID NO: 7), GGCCAAGGA, GGCCAAGGAA (SEQ ID NO: 8), GGCCAAGGAAA (SEQ ID NO: 9), GGCCACUGAAGA (SEQ ID NO: 10), GGCCACUGAAGCCAUU (SEQ ID NO: 11), GGCCACUGAAGGAAG (SEQ ID NO: 12), CCGGACUAGAGA (SEQ ID NO: 13), GAAUAGAGAGGAA ( The IDR sequence may comprise a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 97% sequence identity to an IDR sequence selected from the group consisting of: SEQ ID NO: 14), GGCCACUGAAGGAAGA (SEQ ID NO: 15), GAACACUGAUCGUAGAA (SEQ ID NO: 16), GGCCACUGAAGGAAGAGA (SEQ ID NO: 17), GGAUAGAUAGCGAA (SEQ ID NO: 18), GGAGUGAGAGAGAA (SEQ ID NO: 19), or GGCCACAUAGCGAA (SEQ ID NO: 20).

[0242] In some embodiments, each RNA species in a multivalent RNA composition comprises an IDR sequence having a different mass such that the RNA fragments generated by RNase cleavage of a given RNA species differ in mass from the RNA fragments generated by RNase cleavage of each other RNA species in the composition, and the RNA species do not comprise an IDR sequence with a length of 4 or more homopolymer repeats, and each RNA species does not comprise an IDR sequence with a length of 4 or more homopolymer repeats, and each RNA species does not comprise an IDR sequence with a length of 4 or more homopolymer repeats, and UACCCCC, AACGUGAU, AAACAUCG, AUGCCUAA, AGUGGUCA, ACCACUGU, ACAUUGGC, CAGAUCUG, CAUCAAGU, CGCUGAUC, ACAAGCUA, CUGUAGCC, AGUACAAG, AACAACC A, AACCGAGA, AACGCUUA, AAGACGGA, AAGGUACA, ACACAGAA, ACAGCAGA, ACCUCCAA, ACGCUCGA, ACGUAUCA, ACUAUGCA, AGAGUCAA, AGAUCGCA, AGCAGGAA, AGUCA CUA, AUCCUGUA, AUUGAGGA, CAACCACA, GACUAGUA, GUCCAUCA, CAAUGGAA, CACUUCGA, CAGCGUUA, CAUACCAA, CCAGUUCA, CCGAAGUA, ACAGUG, CGAUGU, UUAGGC , AUCACG, UGACCA, GACCUACGA, CCAA, GUUA, CCUUA, AGACC, UUACCA, GGAGGA, GUACGGA, GCACACA, GUUCAUU, GGCUUCUGACCA (SEQ ID NO. 2), GGCCACUCGUUAAGA (SEQ ID NO. No. 3), GGCCACUGAAGCCAUUGAAG (SEQ ID NO: 4), GGCCACUGAAGCCAUUGUCAAGGA (SEQ ID NO: 5), GGCCACUGAAGCCAUUGUCACCGAA (SEQ ID NO: 6), GGCGAAGCACUCGUGGCCAUUCGCA (SEQ ID NO: 7), GGCCAAGGA, GGCCAAGGAA (SEQ ID NO: 8), GGCCAAGGAAA (SEQ ID NO: 9), GGCCACUGAAGA (SEQ ID NO: 10), GGCCACUGAAGCCAUU (SEQ ID NO: 11), GGCCACUGAAGGAAG (SEQ ID NO: 12),The IDR sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or up to 100% sequence identity to a nucleotide sequence selected from the group consisting of CCGGACUAGAGA (SEQ ID NO: 13), GAAUAGAGAGGAA (SEQ ID NO: 14), GGCCACUGAAGGAAGA (SEQ ID NO: 15), GAACACUGAUCGUAGAA (SEQ ID NO: 16), GGCCACUGAAGGAAGAGA (SEQ ID NO: 17), GGAUAGAUAGCGAA (SEQ ID NO: 18), GGAGUGAGAGAGAA (SEQ ID NO: 19), or GGCCACAUAGCGAA (SEQ ID NO: 20).

[0243] PolyA tail Embodiments of the present disclosure relate to methods for producing polyvalent RNA compositions with improved purity (e.g., as measured by the percentage of mRNA containing a poly-A tail) over previous simultaneous IVT methods. A "poly-A tail" is a region of an mRNA downstream, e.g., directly downstream (i.e., 3'), from the 3' UTR that contains multiple consecutive adenosine monophosphates. A poly-A tail can contain 10 to 300 adenosine monophosphates. For example, a poly-A tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, the poly(A) tail comprises 50 to 250 adenosine monophosphates. In relevant biological environments (e.g., intracellularly, in vivo, etc.), the poly(A) tail functions, for example, to protect the mRNA from enzymatic degradation in the cytoplasm and assists in transcription termination, transport of the mRNA from the nucleus, and translation.

[0244] Some embodiments include normalizing the molar amounts of the first and second populations of DNA molecules present in the IVT reaction mixture before the start of IVT according to the poly-A tail efficiency of the first or second population of DNA molecules, resulting in a polyvalent RNA composition in which at least 85% of the RNA in the composition contains a poly-A tail. As used herein, "poly-A tail efficiency" refers to the amount (e.g., expressed as a percentage) of poly-A-tailed mRNA produced by an IVT reaction using input DNA relative to the total amount of mRNA produced in the IVT reaction using input DNA. The poly-A tail efficiency of an IVT reaction can vary depending on, for example, the RNA polymerase used, the amount or purity of input DNA used, etc. In some embodiments, the poly-A tail efficiency of an IVT reaction is greater than 85%, 90%, 95%, or 99.9%. Methods for calculating poly-A tail efficiency are known, for example, by determining the amount of poly-A-tail-containing mRNA relative to the total mRNA produced in the IVT reaction by column chromatography (e.g., oligo-dT chromatography). In some embodiments, normalization involves dividing the final molar percentage of the desired RNA by the poly-A tail efficiency of the most efficient poly-A RNA in the composition. In some embodiments, normalization further involves determining the mass of each input DNA to add based on calculating the desired molar amount of input DNA or RNA at a predetermined ratio. In some embodiments, normalization involves dividing the final molar percentage of the desired RNA (e.g., a predetermined ratio of RNAs) by the poly-A tail efficiency of the final processed (e.g., purified) poly-A RNA efficiency of each different RNA in the polyvalent RNA composition. In some embodiments, normalization further involves determining the ratio of the RNA production ratios of each different RNA to determine the input DNA ratio of the different RNAs to achieve the predetermined ratio.

[0245] In some embodiments, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% of the RNAs in a multivalent RNA composition produced by the methods described herein comprise a poly-A tail. In some embodiments, at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% of each RNA in a multivalent RNA composition produced by the methods described herein comprises a poly-A tail. The amount (e.g., percentage) of poly-A tailed RNA in a multivalent RNA composition can be measured i) after the IVT reaction and before purification, or ii) after the multivalent RNA composition has been purified (e.g., by chromatography, such as oligo-dT chromatography).

[0246] In some embodiments, terminal groups on the polyA tail can be incorporated for stabilization. Polynucleotides can include des-3' hydroxyl tails. They can also include structural moieties or 2'-O methyl modifications as taught by Junjie Li et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in their entirety for this purpose).

[0247] The length of a unique poly-A tail provides certain advantages to the nucleic acid. Generally, the length of the poly-A tail, if present, is greater than 30 nucleotides in length. In another embodiment, the poly-A tail is greater than 35 nucleotides in length (e.g., at least about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, or 3,000 nucleotides or more).

[0248] In some embodiments, the poly-A tail is designed for the length of the entire nucleic acid or for the length of a particular region of the nucleic acid, which can be based on the length of the coding region, the length of a particular feature or region, or the length of the final product expressed from the nucleic acid.

[0249] In this context, the polyA tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the nucleic acid or feature thereof. The polyA tail can also be designated as a fraction of the nucleic acid to which it belongs. In this context, the polyA tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a region of the construct, or the total length of the construct minus the polyA tail. Furthermore, conjugation of an engineered binding site of a polyA binding protein and a nucleic acid site can enhance expression.

[0250] lipid composition In some embodiments, the nucleic acid is formulated as a lipid composition, such as a composition comprising lipid nanoparticles, liposomes, and / or lipoplexes. In some embodiments, the nucleic acid is formulated as a lipid nanoparticle (LNP) composition. Lipid nanoparticles typically comprise an amino lipid, a non-cationic lipid, a sterol, and a PEG lipid component, along with the nucleic acid cargo of interest. Lipid nanoparticles can be produced using components, compositions, and methods generally known in the art, such as those described in PCT / US2016 / 052352, PCT / US2016 / 068300, PCT / US2017 / 037551, PCT / US2015 / 027400, PCT / US2016 / 047406, PCT / US2016 / 000129 ... See US2016 / 014280, PCT / US2017 / 038426, PCT / US2014 / 027077, PCT / US2014 / 055394, PCT / US2016 / 052117, PCT / US2012 / 069610, PCT / US2017 / 027492, PCT / US2016 / 059575, PCT / US2016 / 069491, PCT / US2016 / 069493, and PCT / US2014 / 66242.

[0251] In some embodiments, the lipid nanoparticles comprise at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)-modified lipid.

[0252] In some embodiments, the lipid nanoparticles comprise a molar ratio of 20-60% ionizable amino lipid, 5-25% non-cationic lipid, 25-55% structural lipid, and 0.5-15% PEG-modified lipid.

[0253] In some embodiments, the lipid nanoparticles comprise a molar ratio of 20-60% ionizable amino lipid, 5-30% non-cationic lipid, 10-55% structural lipid, and 0.5-15% PEG-modified lipid.

[0254] In some embodiments, the lipid nanoparticles comprise 40-50 mol% ionizable lipid, optionally 45-50 mol%, e.g., 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol%, e.g., about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%.

[0255] In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable amino lipids. For example, the lipid nanoparticles may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% ionizable amino lipids. In some embodiments, the lipid nanoparticles comprise 35 mol%, 36 mol%, 37 mol%, 38 mol%, 39 mol%, 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, 51 mol%, 52 mol%, 53 mol%, 54 mol%, or 55 mol% ionizable amino lipids.

[0256] In some embodiments, the lipid nanoparticles comprise 45 to 55 mole percent (mol%) of ionizable amino lipids. For example, the lipid nanoparticles may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% of ionizable amino lipids.

[0257] Ionizable amino lipids In some embodiments, the ionizable amino lipid of the present disclosure is a compound of formula (AI): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, In the formula, R aα , R aβ , R aγ , and R aδ However, independently, H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 independently, C 1-3 Alkyl, C2-3 selected from the group consisting of alkenyl, and H; Each R 6 independently, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C 1-12 Alkyl or C 2-12 is alkenyl, 1 is selected from the group consisting of 1, 2, 3, 4, and 5; m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13, or an N-oxide thereof, or a salt or isomer thereof.

[0258] In some embodiments of the compound of Formula (AI), R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aα , R aβ , R aγ , and R aδ are H and R, respectively. 2 and R 3 However, each 1-14 alkyl, and R 4 But -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0259] In some embodiments of the compound of Formula (AI), R'a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aα , R aβ , R aγ , and R aδ are H and R, respectively. 2 and R 3 However, each 1-14 alkyl, and R 4 But -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 3, and m is 7.

[0260] In some embodiments of the compound of Formula (AI), R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aα But C 2-12 alkyl, and R aβ , R aγ , and R aδ are H and R, respectively. 2 and R 3 However, each 1-14 alkyl, and R 4 but, [ka] and R 10 However, NH(C 1-6 alkyl), n2 is 2, and R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0261] In some embodiments of the compounds of Formula (I), R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aα , R aβ , and R aδ are H and R, respectively. aγ But C 2-12 alkyl, and R 2 and R 3 However, each 1-14 alkyl, and R 4 But -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0262] In some embodiments, the compound of Formula (I) is selected from the group consisting of: [ka]

[0263] In some embodiments, the ionizable amino lipid is a compound of formula (AIa): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, In the formula, R aβ , R aγ , and R aδ However, independently, H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 independently, C 1-3Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R 6 independently, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C 1-12 Alkyl or C 2-12 is alkenyl, 1 is selected from the group consisting of 1, 2, 3, 4, and 5; The compound or an N-oxide thereof, or a salt or isomer thereof, wherein m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0264] In some embodiments, the ionizable amino lipid is a compound of formula (AIb): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, In the formula, R aα , R aβ , R aγ , and R aδ However, independently, H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 However, each independently, C1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, and n is selected from the group consisting of 1, 2, 3, 4, and 5; Each R 5 independently, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R 6 independently, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C 1-12 Alkyl or C 2-12 is alkenyl, 1 is selected from the group consisting of 1, 2, 3, 4, and 5; The compound or an N-oxide thereof, or a salt or isomer thereof, wherein m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0265] In some embodiments of formula (AI) or (AIb), ​​R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aβ , R aγ , and R aδ are H and R, respectively. 2 and R 3 However, each 1-14 alkyl, and R 4 But -(CH2) n OH, n is 2, and each R 5 is H, and each R6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0266] In some embodiments of formula (AI) or (AIb), ​​R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aβ , R aγ , and R aδ are H and R, respectively. 2 and R 3 However, each 1-14 alkyl, and R 4 But -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 3, and m is 7.

[0267] In some embodiments of formula (AI) or (AIb), ​​R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aβ and R aδ are H and R, respectively. aγ But C 2-12 alkyl, and R 2 and R 3 However, each1-14 alkyl, and R 4 But -(CH2) n OH, n is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0268] In some embodiments, the ionizable amino lipid is a compound of formula (AIc): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, In the formula, R aα , R aβ , R aγ , and R aδ However, independently, H, C 2-12 Alkyl, and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 but, [ka] and [ka] indicates the attachment point, and R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R 5 independently, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R 6 independently, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C 1-12 Alkyl or C 2-12 is alkenyl, 1 is selected from the group consisting of 1, 2, 3, 4, and 5; The compound or an N-oxide thereof, or a salt or isomer thereof, wherein m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0269] In some embodiments, R' a But R' 分岐 and R' 分岐 but, [ka] and [ka] indicates the attachment point, and R aβ , R aγ , and R aδ are H and R, respectively. aα But C 2-12 alkyl, and R 2 and R 3 However, each 1-14 alkyl, and R 4 but, [ka] and [ka] indicates the attachment point, and R 10 However, NH(C 1-6 alkyl), n2 is 2, and each R 5 is H, and each R 6 is H, M and M' are each -C(O)O-, and R' is C 1-12 alkyl, l is 5, and m is 7.

[0270] In some embodiments, the compound of formula (AIc) is [ka] is.

[0271] In some embodiments, the ionizable amino lipid is a compound of formula (AII): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' 環状 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγ and R aδ However, independently, H, C 1-12 Alkyl, and C 2-12 alkenyl; R aγ and R aδ At least one of the 1-12 Alkyl and C 2-12 alkenyl, R bγ and R bδ However, independently, H, C 1-12 Alkyl, and C 2-12 alkenyl; R bγ and R bδ At least one of the 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C1-12 Alkyl or C 2-12 is alkenyl, Y a But C 3-6 is a carbocyclic ring, R * ” a But C 1-15 Alkyl and C 2-15 alkenyl, s is 2 or 3, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9, or an N-oxide thereof, or a salt or isomer thereof.

[0272] In some embodiments, the ionizable amino lipid is a compound of formula (AII-a): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγ and R aδ However, independently, H, C 1-12 Alkyl, and C 2-12 alkenyl; R aγ and R aδ At least one of the1-12 Alkyl and C 2-12 alkenyl, R bγ and R bδ However, independently, H, C 1-12 Alkyl, and C 2-12 alkenyl; R bγ and R bδ At least one of the 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9, or an N-oxide thereof, or a salt or isomer thereof.

[0273] In some embodiments, the ionizable amino lipid is a compound of formula (AII-b): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγ and R bγ However, each independently, C 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9, or an N-oxide thereof, or a salt or isomer thereof.

[0274] In some embodiments, the ionizable amino lipid is a compound of formula (AII-c): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγ But C 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; R' is C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9, or an N-oxide thereof, or a salt or isomer thereof.

[0275] In some embodiments, the ionizable amino lipid is a compound of formula (AII-d): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγand R bγ However, each independently, C 1-12 Alkyl and C 2-12 alkenyl, R 4 But -(CH2) n OH, where n is 1, 2, 3, 4, 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 is N(R)2, and each R is independently C 1-6 Alkyl, C 2-3 alkenyl, and H, and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; Each R' is independently C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9, or an N-oxide thereof, or a salt or isomer thereof.

[0276] In some embodiments, the ionizable amino lipid is a compound of formula (AII-e): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγ But C 1-12 Alkyl and C 2-12 alkenyl, R 2 and R 3 However, each independently, C 1-14 Alkyl and C 2-14 alkenyl, R 4 But -(CH2) n OH, and n is selected from the group consisting of 1, 2, 3, 4, and 5; R' is C 1-12 Alkyl or C 2-12 is alkenyl, m is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9; 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, and 9, or an N-oxide thereof, or a salt or isomer thereof.

[0277] In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each independently selected from 4, 5, and 6. In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each 5.

[0278] In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), each R′ is independently C 1-12In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), each R' is independently C 2-5 It is alkyl.

[0279] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' b but, [ka] and R 2 and R 3 However, each independently, C 1-14 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. b but, [ka] and R 2 and R 3 However, each independently, C 6-10 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. b but, [ka] and R 2 and R 3 are each a C8 alkyl.

[0280] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] and R aγ But C 1-12 alkyl, and R 2 and R 3 However, each independently, C 6-10 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐 but, [ka] and R' b but, [ka] and R aγ But C 2-6 alkyl, and R 2 and R 3 However, each independently, C 6-10 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐 but, [ka] and R' b but, [ka] and R aγ But C 2-6 alkyl, and R 2 and R 3 are each a C8 alkyl.

[0281] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] and R aγ and R bγ However, each 1-12 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐 but, [ka] and R' b but, [ka] and R aγ and R bγ However, each 2-6 It is alkyl.

[0282] In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 In some embodiments of a compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), m and l are each 5 and each R' is independently C 2-5 It is alkyl.

[0283] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 alkyl, and R aγ and R bγ are respectively, C 1-12 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' is alkyl. 分岐 but, [ka] and R' b but, [ka] wherein m and l are each 5, and each R' is independently selected from the group consisting of C 2-5 alkyl, and R aγ and R bγ are respectively, C 2-6 It is alkyl.

[0284] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each independently selected from 4, 5, and 6; and R′ is C 1-12 alkyl, and R aγ But C 1-12 alkyl, and R 2 and R 3 However, each independently, C 6-10 It is alkyl.

[0285] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each 5, and R' is C 2-5 alkyl, and R aγ But C 2-6 alkyl, and R 2 and R 3 are each C8 alkyl.

[0286] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 but, [ka] where R 10 However, NH(C 1-6 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 but, [ka] where R 10 is NH(CH3) and n2 is 2.

[0287] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R'b but, [ka] wherein m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 alkyl, and R aγ and R bγ are respectively, C 1-12 alkyl, and R 4 but, [ka] where R 10 However, NH(C 1-6 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each 5, and each R' is independently selected from the group consisting of C 2-5 alkyl, and R aγ and R bγ are respectively, C 2-6 alkyl, and R 4 but, [ka] where R 10 is NH(CH3) and n2 is 2.

[0288] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each independently selected from 4, 5, and 6; and R′ is C 1-12 alkyl, and R 2 and R 3 However, each independently, C 6-10 alkyl, and R aγ But C 1-12 alkyl, and R 4 but, [ka] where R 10 However, NH(C 1-6 In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each 5, and R' is C 2-5 alkyl, and R aγ But C 2-6 alkyl, and R 2 and R 3 are each C8 alkyl, and R 4 but, [ka] and R 10 is NH(CH3) and n2 is 2.

[0289] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 But -(CH2) n OH and n is 2, 3, or 4. In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R 4 But -(CH2) n OH and n is 2.

[0290] In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each independently selected from 4, 5, and 6; and each R′ is independently selected from C 1-12 alkyl, and R aγ and R bγ are respectively, C 1-12 alkyl, and R 4 But -(CH2) n OH and n is 2, 3, or 4. In some embodiments of the compound of Formula (AII), (AII-a), (AII-b), (AII-c), (AII-d), or (AII-e), R' 分岐 but, [ka] and R' b but, [ka] wherein m and l are each 5, and each R' is independently selected from the group consisting of C 2-5alkyl, and R aγ and R bγ are respectively, C 2-6 alkyl, and R 4 But -(CH2) n OH and n is 2.

[0291] In some embodiments, the ionizable amino lipid is a compound of formula (AII-f): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, R' a But R' 分岐 or R' 環状 and R' 分岐 but, [ka] and R' b but, [ka] and [ka] indicates the attachment point, R aγ But C 1-12 is alkyl, R 2 and R 3 However, each independently, C 1-14 is alkyl, R 4 But -(CH2) n OH, and n is selected from the group consisting of 1, 2, 3, 4, and 5; R' is C 1-12 is alkyl, m is selected from 4, 5, and 6; 1 is selected from 4, 5, and 6, or an N-oxide thereof, or a salt or isomer thereof.

[0292] In some embodiments of compounds of Formula (AII-f), m and l are each 5; and n is 2, 3, or 4.

[0293] In some embodiments of the compound of Formula (AII-f), R' is C 2-5 alkyl, and R aγ But C 2-6 alkyl, and R 2 and R 3 are respectively, C 6-10 It is alkyl.

[0294] In some embodiments of compounds of Formula (AII-f), m and l are each 5; n is 2, 3, or 4; and R′ is C 2-5 alkyl, and R aγ But C 2-6 alkyl, and R 2 and R 3 are respectively, C 6-10 It is alkyl.

[0295] In some embodiments, the ionizable amino lipid is a compound of formula (AII-g): [ka] R aγ But C 2-6 is alkyl, R' is C 2-5 is alkyl, R 4 But -(CH2) n OH, where n is 3, 4, and 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 However, NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3.

[0296] In some embodiments, the ionizable amino lipid is a compound of formula (AII-h): [ka] R aγ and R bγ However, each independently, C 2-6 is alkyl, Each R' is independently C 2-5 is alkyl, R 4 But -(CH2) n OH, where n is 3, 4, and 5, and [ka] is selected from the group consisting of [ka] indicates the attachment point, and R 10 However, NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1, 2, and 3.

[0297] In some embodiments of compounds of Formula (AII-g) or (AII-h), R 4 but, [ka] and R 10 is NH(CH3) and n2 is 2.

[0298] In some embodiments of compounds of Formula (AII-g) or (AII-h), R 4 is -(CH2)2OH.

[0299] In some embodiments, the ionizable amino lipids of the present disclosure are one or more of compounds of formula (VI): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein: R1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is hydrogen, C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is a carbocycle, a heterocycle, -OR, -O(CH) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R , -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R8, -N(R)S(O)2R8, -O(CH2) n-OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)C(O)OR; each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O)—, —SS—, an aryl group, and a heteroaryl group; M″ is a bond, C 1-13 Alkyl, or C 2-13 is alkenyl, R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles, and heterocycles; Each R is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R" is independently C 3-15 Alkyl and C 3-15 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; R4 is -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), (i) Q is not -N(R) when n is 1, 2, 3, 4, or 5, or (ii) Q is not a 5-, 6-, or 7-membered heterocycloalkyl when n is 1 or 2.

[0300] In some embodiments, another subset of compounds of formula (VI) includes: R1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6Carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S, including oxo (=O), OH, amino, mono- or di-alkylamino, and C(O)N(R)OR, -N(R)C(=NR)N(R), -N(R)C(=CHR)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR)N(R), -N(OR)C(=CHR)N(R), -C(=NR)N(R), -C(=NR)R, -C(O)N(R)OR, and 5-14 membered heterocycloalkyl having one or more heteroatoms selected from N, O, and S, including oxo (=O), OH, amino, mono- or di-alkylamino, and C(O)N(R)OR. 1-3 alkyl, wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles, and heterocycles; Each R is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R” is independent, C 3-14 Alkyl and C 3-14 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; Another subset of compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0301] In some embodiments, another subset of compounds of formula (VI) includes: R1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 Carbocycle, 5-14 membered heterocycle having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n OR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R)2, each n is independently selected from 1, 2, 3, 4, and 5, and Q is a 5-14 membered heterocycle, and (i) R4 is -(CH2) n Q, where n is 1 or 2, or (ii) R4 is -(CH2) n CHQR, where n is 1, or (iii) when R4 is -CHQR and -CQ(R)2, Q is either a 5- to 14-membered heteroaryl or an 8- to 14-membered heterocycloalkyl; Each R5 is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles, and heterocycles; Each R is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R” is independent, C 3-14 Alkyl and C 3-14 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; Another subset of compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0302] In some embodiments, another subset of compounds of formula (VI) includes: R1 is C 5-30Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, wherein Q is selected from the group consisting of C 3-6 Carbocycle, 5-14 membered heteroaryl having one or more heteroatoms selected from N, O, and S, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -C(O)N(R)2, -N(R)C(O)R, -N( R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -CRN(R)2C(O)OR, -N(R)R8, -O(CH2) n -OR, -N(R)C(=NR9)N(R), -N(R)C(=CHR9)N(R), -OC(O)N(R), -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)R, -N(OR)C(O)OR, -N(OR)C(O)N(R), -N(OR)C(S)N(R), -N(OR)C(=NR9)N(R), -N(OR)C(=CHR9)N(R), -C(=NR9)R, -C(O)N(R)OR, and -C(=NR9)N(R), wherein each n is independently selected from 1, 2, 3, 4, and 5; Each R5 is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently 1-3 Alkyl, C 2-3selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R8, C 3-6 selected from the group consisting of carbocycles and heterocycles; R9 is H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles, and heterocycles; Each R is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R” is independent, C 3-14 Alkyl and C 3-14 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; Another subset of compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0303] In some embodiments, another subset of compounds of formula (VI) includes: R1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R"M'R'; R2 and R3 are independently H, C 2-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q or -(CH2) n CHQR, where Q is —N(R)2 and n is selected from 3, 4, and 5; Each R5 is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R” is independent, C 3-14 Alkyl and C3-14 alkenyl, Each R * independently, C 1-12 Alkyl and C 1-12 alkenyl, Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; Another subset of compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0304] In some embodiments, another subset of compounds of formula (VI) includes: R1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R"M'R'; R2 and R3 are independently C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR" or R2 and R3 together with the atoms to which they are attached form a heterocycle or carbocycle; R4 is -(CH2) n Q, -(CH2) n -CHQR, -CHQR, and -CQ(R), where Q is -N(R) and n is selected from 1, 2, 3, 4, and 5; Each R5 is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R6 is independently 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -SS-, an aryl group, and a heteroaryl group; R7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R is independent, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R” is independent, C 3-14 Alkyl and C 3-14 alkenyl, Each R * independently, C 1-12 Alkyl and C 1-12 alkenyl, Each Y is independent, C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; Another subset of compounds wherein m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; or a salt or isomer thereof.

[0305] In certain embodiments, a subset of compounds of formula (VI) includes compounds of formula (VI-a): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M′; and R is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2)n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 For example, Q is selected from the group consisting of alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(O)N(R)2. For example, Q is -N(R)C(O)R, or -N(R)S(O)2R.

[0306] In certain embodiments, a subset of compounds of formula (VI) includes compounds of formula (VI-B): [ka] or an N-oxide thereof, or a salt or isomer thereof, all variables of which are as defined herein. For example, m is selected from 5, 6, 7, 8, and 9; R4 is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where Q is H, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1-14 Alkyl, and C2-14 For example, Q is selected from the group consisting of alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(O)N(R)2. For example, Q is -N(R)C(O)R, or -N(R)S(O)2R.

[0307] In another embodiment, the subset of compounds of formula (VI) is the subset of compounds of formula (VII): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; M is a bond or M′; and R is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where n is 2, 3, or 4; Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0308] In some embodiments, the compound of Formula (VI) is a compound of Formula (VIIa): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as described herein.

[0309] In another embodiment, the compound of formula (VI) is a compound of formula (VIIb): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as described herein.

[0310] In another embodiment, the compound of formula (VI) is a compound of formula (VIIc) or (VIIe): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein R4 is as described herein.

[0311] In another embodiment, the compound of formula (VI) is a compound of formula (VIIf): [ka] or an N-oxide thereof, or a salt or isomer thereof, In the formula, M is —C(O)O— or —OC(O)—, and M″ is C 1-6 Alkyl or C 2-6 alkenyl, and R and R are independently C 5-14 Alkyl and C 5-14 alkenyl, wherein n is selected from 2, 3, and 4.

[0312] In a further embodiment, the compound of formula (VI) is a compound of formula (VIId): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein n is 2, 3, or 4; and m, R′, R″, and R2 through R6 are as described herein. For example, each of R2 and R3 independently represents C5-14 Alkyl and C 5-14 alkenyl.

[0313] In some embodiments, ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0314] In some embodiments, ionizable amino lipids of the present disclosure include compounds having the following structure: [ka]

[0315] In a further embodiment, the compound of formula (VI) is a compound of formula (VIIg): [ka] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M1 is a bond or M'; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M"-C(O)O-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; R2 and R3 are independently selected from H, C 1-14 Alkyl, and C 2-14 For example, M" is selected from the group consisting of C 1-6 Alkyl (e.g., C 1-4 alkyl) or C 2-6 Alkenyl (e.g., C 2-4 alkenyl). For example, R2 and R3 are independently C 5-14 Alkyl and C 5-14 alkenyl.

[0316] In some embodiments, the ionizable amino lipid is one or more of the compounds described in U.S. Application Nos. 62 / 220,091, 62 / 252,316, 62 / 253,433, 62 / 266,460, 62 / 333,557, 62 / 382,740, 62 / 393,940, 62 / 471,937, 62 / 471,949, 62 / 475,140, ​​and 62 / 475,166, and PCT Application No. PCT / US2016 / 052352.

[0317] The central amine moiety of the lipid according to formula (VI), (VI-A), (VI-B), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), (VIIf), or (VIIg) can be protonated at physiological pH. Thus, the lipid can have a positive or partial positive charge at physiological pH. Such amino lipids can be referred to as cationic lipids, ionizable lipids, cationic amino lipids, or ionizable amino lipids. Amino lipids can also be zwitterionic, i.e., neutral molecules with both positive and negative charges.

[0318] In some embodiments, the ionizable amino lipids of the present disclosure are one or more compounds of formula (VIII): [ka] or a salt or isomer thereof, wherein: W is, [ka] and Ring A is [ka] and t is 1 or 2, A1 and A2 are each independently selected from CH or N; Z is CH2 or absent, where when Z is CH2, dashed lines (1) and (2) each represent a single bond, and when Z is absent, dashed lines (1) and (2) are both absent; R1, R2, R3, R4, and R5 are independently C 5-20 Alkyl, C 5-20 Alkenyl, -R"MR', -R * YR”, -YR”, and -R * OR" R X1 and R X2 are each independently H or C alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M * is C1-C6 alkyl, W 1 and W 2 are each independently selected from the group consisting of —O— and —N(R6)—; Each R6 is independently H and C 1-5 is selected from the group consisting of alkyl, X 1 , X 2 , and X 3 are independently a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, or -(CH2) n -C(O)-, -C(O)-(CH2) n -, -(CH2) n -C(O)O-, -OC(O)-(CH2) n -, -(CH2) n -OC(O)-, -C(O)O-(CH2) n is selected from the group consisting of -, -CH(OH)-, -C(S)-, and -CH(SH)-; Each Y is independent, C 3-6 is a carbocyclic ring, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each R is independent, C 1-3 Alkyl and C 3-6 is selected from the group consisting of carbocycles; Each R' is independently C 1-12 Alkyl, C 2-12 selected from the group consisting of alkenyl, and H; Each R" is independently C 3-12 Alkyl, C 3-12 alkenyl, and -R * MR′, n is an integer from 1 to 6, In the formula, ring A is [ka] If i)X 1 , X 2 , and X 3 is not -CH2-, and / or ii) At least one of R1, R2, R3, R4, and R5 is -R"MR'.

[0319] In some embodiments, the compound is a compound of any of Formulae (VIIIa1)-(VIIIa8). [ka] [ka]

[0320] In some embodiments, the ionizable amino lipid is [ka] or a salt thereof.

[0321] The central amine moiety of a lipid according to formula (VIII), (VIIIa1), (VIIIa2), (VIIIa3), (VIIIa4), (VIIIa5), (VIIIa6), (VIIIa7), or (VIIIa8) can be protonated at physiological pH. Thus, the lipid can have a positive or partial positive charge at physiological pH.

[0322] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein: R 1 optionally substituted C1-C 24 Alkyl or optionally substituted C-C 24 is alkenyl, R 2 and R 3 each independently represents an optionally substituted C-C 36 is alkyl, R 4 and R 5 are each independently an optionally substituted C1-C6 alkyl, or R 4 and R 5 are joined together with the N to which they are attached to form a heterocyclyl or heteroaryl; L 1 , L 2 , and L 3 each independently represents an optionally substituted C-C 18 is alkylene, G 1 is a direct bond, -(CH2) n O(C=O)-, -(CH2) n (C=O)O-, or -(C=O)-; G 2 and G 3 are each independently —(C═O)O— or —O(C═O)—, and n is an integer greater than 0.

[0323] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, or stereoisomer thereof, wherein: G 1 But -N(R 3 )R 4 -OR 5 and R 1 optionally substituted branched, saturated, or unsaturated C 12 -C 36 is alkyl, R 2 When L is -C(=O)-, optionally substituted branched or unbranched, saturated or unsaturated C 12 -C 36 alkyl or R 2 But L is C6-C 12 Alkylene, C6-C 12 When alkenylene or C2-C6 alkynylene, optionally substituted branched or unbranched, saturated or unsaturated C4-C 36 is alkyl, R 3 and R 4 are each independently H, optionally substituted branched or unbranched, saturated or unsaturated C-C alkyl, or R 3 and R 4 However, independently, L is C6-C 12 Alkylene, C6-C 12 When R is alkenylene or C2-C6 alkynylene, it is an optionally substituted branched or unbranched, saturated or unsaturated C1-C6 alkyl, or 3 and R 4 are joined together with the nitrogen to which they are attached to form a heterocyclyl; R 5 is H or optionally substituted C1-C6 alkyl; L is -C(=O)-, C6-C 12Alkylene, C6-C 12 alkenylene, or C2-C6 alkynylene; n is an integer from 1 to 12.

[0324] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 1a are independently hydrogen, R 1c , or R 1d and Each R 1b But independently, R 1c or R 1d and Each R 1c are independently -[CH2]2C(O)X 1 R 3 and Each R 1d But independently, -C(O)R 4 and Each R 2 independently, -[C(R 2a )2] c R 2b and Each R 2a are independently hydrogen or C1-C6 alkyl; R 2b is -N(L1-B)2, -(OCH2CH2)6OH, or -(OCH2CH2) b OCH3, Each R 3 and R 4 But independently, C6-C 30 is aliphatic, Each L3 independently 10 is alkylene, each B is independently hydrogen or an ionizable nitrogen-containing group; each X 1 are independently a covalent bond or O; each a is independently an integer from 1 to 10; each b is independently an integer from 1 to 10; Each c is independently an integer from 1 to 10.

[0325] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: X is N and Y is absent, or X is CR and Y is NR; L 1 But -O(CO)R 1 , -(C=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NR a C(=O)OR 1 and L 2 But -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f, -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to L 3 But -O(C=O)R 3 or -(C=O)OR 3 and G 1 and G 2 However, each independently, C2-C 12 Alkylene or C2-C 12 is alkenylene, G 3 If X is CR and Y is NR, then C1-C 24 Alkylene, C2-C 24 Alkenylene, C1-C 24 Heteroalkylene, or C2-C 24 heteroalkenylene or G 3 If X is N and Y is absent, then C1-C 24 Heteroalkylene or C2-C 24 heteroalkenylene, R a , R b , R d , and R e are each independently H or C1-C 12 Alkyl, or C1-C 12 is alkenyl, R c and R f However, each independently, C1-C 12 Alkyl or C2-C 12 is alkenyl, Each R is independently H or C1-C 12 is alkyl, R 1 , R 2 , and R 3 However, each independently, C1-C 24 Alkyl or C2-C 24alkenyl, where x is 0, 1, or 2; wherein each alkyl, alkenyl, alkylene, alkenylene, heteroalkylene, and heteroalkenylene is independently substituted or unsubstituted, unless specified otherwise.

[0326] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: L 1 and L 2 are each independently -0(C=0)-, -(C=0)0-, -C(=0)-, -0-, -S(0)x- s -SS-, -C(=0)S-, -SC(=0)-, -NR a C(=0)-, -C(=0)NR a -, -NR a C(=0)NR a -, -OC(=0)NR a -, -NR a C(=0)0- or a direct bond, G 1 C, -C2 alkylene, -(C=0)-, -0(C=0)-, -SC(=0)-, -NR a C(=0)- or a direct bond, G 2 is -C(0)-, -(CO)O-, -C(=0)S-, -C(=0)NR a - or a direct bond, G 3 is C1-C6 alkylene, R a But H or C1-C 12 is alkyl, R 1a and R 1b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 1a But H or C1-C 12alkyl, and R 1b together with the carbon atom to which it is attached, form an adjacent R 1b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 2a and R 2b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 2a But H or C1-C 12 alkyl, and R 2b together with the carbon atom to which it is attached, form an adjacent R 2b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 3a and R 3b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 3a But H or C1-C 12 alkyl, and R 3b together with the carbon atom to which it is attached, together with the adjacent R and the carbon atom to which it is attached, form a carbon-carbon double bond; R 4A and R 4B is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 4A But H or C1-C 12 alkyl, and R 4B together with the carbon atom to which it is attached, form an adjacent R 4B and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 5 and R 6 are each independently H or methyl; R 7 But H or C, -C 20 is alkyl, R 8 OH, -N(R 9 )(C=0)R 10, -(C=0)NR 9 R 10 , -NR 9 R 10 , -(C=0)0R” 1 , or -0(C=0)R”, where R 8 Ga-NR 9 R 10 If G 3 is C4-C6 alkylene; R 9 and R 10 are each independently H or C1-C 12 is alkyl, R" is aralkyl; a, b, c, and d are each independently an integer of 1 to 24, and x is 0, 1, or 2; wherein each alkyl, alkylene, and aralkyl is optionally substituted.

[0327] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: X and X' are each independently N or CR; Y and Y′ are each independently absent, —O(C═O)—, —(C═O)O—, or NR, with the proviso that: a) when X is N, Y is absent; b) if X' is N, then Y' is absent; c) Y is —O(C═O)—, —(C═O)O—, or NR when X is CR; d) Y' is -O(C=O)-, -(C=O)O-, or NR when X' is CR; L 1 and L 1’ each independently represents -O(C=O)R', -(C=O)OR', -C(=O)R', -OR 1 , -S(O) z R', -S-SR1 , -C(=O)SR', -SC(=O)R', -NR a C(=O)R', -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NR a C(=O)OR', L 2 and L 2’ are each independently -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) z R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to G 1 , G 1’ , G 2 , and G 2’ each independently represents C2-Ci2 alkylene or C2-C 12 is alkenylene, G is C2-C 24 Heteroalkylene or C2-C 24 heteroalkenylene, R a , R b , R d , and R e but in each occurrence independently, H, C1-C 12 Alkyl, or C2-C 12is alkenyl, R c and R f But in each occurrence, independently, C1-C 12 Alkyl or C2-C 12 is alkenyl, R, in each occurrence, is independently H or C-C 12 is alkyl, R 1 and R 2 but in each occurrence independently, branched C6-C 24 Alkyl or branched C6-C 24 is alkenyl, z is 0, 1, or 2, and each alkyl, alkenyl, alkylene, alkenylene, heteroalkylene, and heteroalkenylene is independently substituted or unsubstituted, unless otherwise specified.

[0328] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: L 1 But -O(C=O)R 1 , -(C=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NR a C(=O)OR 1 and L2 But -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR 2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to G 1 and G 2 However, each independently, C2-C 12 Alkylene or C2-C 12 is alkenylene, G 3 But C1-C 24 Alkylene, C2-C 24 alkenylene, C3-C8 cycloalkylene, or C3-C8 cycloalkenylene; R a , R b , R d , and R e are each independently H or C1-C 12 Alkyl, or C1-C 12 is alkenyl, R c and R f However, each independently, C1-C 12 Alkyl or C2-C 12 is alkenyl, R 1 and R 2 but in each occurrence independently, branched C6-C 24 Alkyl or branched C6-C 24 is alkenyl, R 3 But -N(R 4 )R 5 and R 4 But C1-C 12 is alkyl, R 5 But substitution C1-C 12 is alkyl, x is 0, 1, or 2; wherein each alkyl, alkenyl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, aryl, and aralkyl is independently substituted or unsubstituted, unless specified otherwise.

[0329] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: L 1 But -O(C=O)R 1 , -(C=O)OR 1 , -C(=O)R 1 , -OR 1 , -S(O) x R 1 , -S-SR 1 , -C(=O)SR 1 , -SC(=O)R 1 , -NR a C(=O)R 1 , -C(=O)NR b R c , -NR a C(=O)NR b R c , -OC(=O)NR b R c , or -NR a C(=O)OR 1 and L 2 But -O(C=O)R 2 , -(C=O)OR 2 , -C(=O)R 2 , -OR2 , -S(O) x R 2 , -S-SR 2 , -C(=O)SR 2 , -SC(=O)R 2 , -NR d C(=O)R 2 , -C(=O)NR e R f , -NR d C(=O)NR e R f , -OC(=O)NR e R f , -NR d C(=O)OR 2 , or R 2 is a direct bond to G 1a and G 2b However, each independently, C2-C 12 Alkylene or C2-C 12 is alkenylene, G 1b and G 2b However, each independently, C1-C 12 Alkylene or C2-C 12 is alkenylene, G 3 But C1-C 24 Alkylene, C2-C 24 alkenylene, C3-C8 cycloalkylene, or C3-C8 cycloalkenylene; R a , R b , R d , and R e are each independently H or C1-C 12 Alkyl, or C2-C 12 is alkenyl, R c and R f However, each independently, C1-C 12 Alkyl or C2-C 12 is alkenyl, R 1 and R 2 but in each occurrence independently, branched C6-C 24 Alkyl or branched C6-C 24is alkenyl, R 3a But -C(=O)N(R 4a )R 5a or -C(=O)OR 6 and R 3b But, -NR 4b C(=O)R 5b and R 4a But C1-C 12 is alkyl, R 4b But, H, C1-C 12 Alkyl, or C2-C 12 is alkenyl, R 5a is H, C1-C8 alkyl, or C2-C8 alkenyl; R 5b But R 4b If is H, C2-C 12 Alkyl or C2-C 12 alkenyl, or R 4b is C1-C 12 Alkyl or C2-C 12 When R is alkenyl, 5b But C1-C 12 Alkyl or C2-C 12 is alkenyl, R 6 is H, aryl, or aralkyl; x is 0, 1, or 2; Each alkyl, alkenyl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, aryl, and aralkyl is independently substituted or unsubstituted.

[0330] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: G 1 -OH, -R 3 R4 , -(C=0)R 5 , or -R 3 (C=0)R 5 and G 2 is -CH2- or -(C=0)-, R, in each occurrence, is independently H or OH; R 1 and R 2 each independently an optionally substituted branched, saturated, or unsaturated C 12 -C 36 is alkyl, R 3 and R 4 are each independently H or an optionally substituted straight or branched chain, saturated or unsaturated Ci-C6 alkyl; R 5 is an optionally substituted straight or branched chain, saturated or unsaturated Ci-C6 alkyl; n is an integer of 2 to 6.

[0331] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: G 1 or G 2 and one of, in each occurrence, is selected from -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O), -SS-, -C(=O)S-, SC(=O)-, -N(R a )C(=O)-, -C(=O)N(R a )-, -N(R a )C(=O)N(R a )-, -OC(=O)N(R a )-, or -N(R a )C(=O)O-, and G 1 or G 2and the other of each occurrence is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O), -SS-, -C(=O)S-, -SC(=O)-, -N(R a )C(=O)-, -C(=O)N(R a )-, -N(R a )C(=O)N(R a )-, -OC(=O)N(R a )- or -N(R a )C(=O)O-, or a direct bond; L, in each occurrence, is ~O(C=O)-, and ~ represents a covalent bond to X; X is CR a and Z is an alkyl, cycloalkyl, or monovalent moiety containing at least one polar functional group when n is 1, or Z is an alkylene, cycloalkylene, or polyvalent moiety containing at least one polar functional group when n is greater than 1; R a is, in each occurrence independently, H, C1-C 12 Alkyl, C1-C 12 Hydroxyalkyl, C1-C 12 Aminoalkyl, C1-C 12 Alkylaminylalkyl, C1-C 12 Alkoxyalkyl, C1-C 12 Alkoxycarbonyl, C1-C 12 Alkylcarbonyloxy, C1-C 12 Alkylcarbonyloxyalkyl, or C1-C 12 alkylcarbonyl, R, in each occurrence, is independently: (a) H or C1-C 12 alkyl, or (b) R, taken together with the carbon atom to which it is attached, forms a carbon-carbon double bond with the adjacent R and the carbon atom to which it is attached; R 1 and R 2 Each occurrence of [ka] a 1 and a 2 is, in each occurrence, independently an integer from 3 to 12; b 1 and b 2 is, in each occurrence, independently 0 or 1; c 1 and c 2 is, independently in each occurrence, an integer from 5 to 10; and d 1 and d 2 is independently in each occurrence an integer from 5 to 10, y is independently in each occurrence an integer from 0 to 2, and n is an integer from 1 to 6; wherein each alkyl, alkylene, hydroxylalkyl, aminoalkyl, alkylaminylalkyl, alkoxyalkyl, alkoxycarbonyl, alkylcarbonyloxy, alkylcarbonyloxyalkyl, and alkylcarbonyl is optionally substituted with one or more substituents.

[0332] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, prodrug, or stereoisomer thereof, wherein: L 1 or L 2 One of the groups is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, -SC(=O)-, -R a C(=O)-, -C(=O)R a -, R a C(=O)R a -, -OC(=O)R a - or -R a C(=O)O-, and L 1 or L 2 The other of the groups is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x-, -SS-, -C(=O)S-, SC(=O)-, -R a C(=O)-, -C(=O)R a -, R a C(=O)R a -, -OC(=O)R a - or -NR a C(=O)O- or a direct bond, G 1 and G 2 are each independently unsubstituted C-C 12 Alkylene or C1-C 12 is alkenylene, G 3 But C1-C 24 Alkylene, C1-C 24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene; R a But H or C1-C 12 is alkyl, R 1 and R 2 However, each independently, C6-C 24 Alkyl or C6-C 24 is alkenyl, R 3 But, H, OR 5 , CN, -C(=O)OR 4 , -OC(=O)R 4 , or -R 5 C(=O)R 4 and R 4 But C1-C 12 is alkyl, R 5 is H or C1-C6 alkyl; x is 0, 1, or 2.

[0333] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: L1 and L 2 are each independently -0(C=0)-, -(C=0)0-, -C(=0)-, -0-, -S(0) x -, -SS-, -C(=0)S-, -SC(=0)-, -R a C(=0)-, -C(=0)R a -, -R a C(=0)R a -, -OC(=0)R a -, -R a C(=0)0- or a direct bond, G 1 Ci-C2 alkylene, -(C=0)-, -0(C=0)-, -SC(=0)-, -R a C(=0)- or a direct bond, G 2 is -C(=0)-, -(C=0)0-, -C(=0)S-, -C(=0)NR a - or a direct bond, G 3 is C1-C6 alkylene, R a But H or C1-C 12 is alkyl, R 1a and R 1b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 1a But H or C1-C 12 alkyl, and R 1b together with the carbon atom to which it is attached, form an adjacent R 1b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 2a and R 2b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 2a But H or C1-C 12 alkyl, and R 2b together with the carbon atom to which it is attached, form an adjacent R 2band together with the carbon atom to which it is attached form a carbon-carbon double bond, R 3a and R 3b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 3a But H or C1-C 12 alkyl, and R 3b together with the carbon atom to which it is attached, together with the adjacent R and the carbon atom to which it is attached, form a carbon-carbon double bond; R 4a and R 4b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 4a But H or C1-C 12 alkyl, and R 4b together with the carbon atom to which it is attached, form an adjacent R 4b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 5 and R 6 are each independently H or methyl; R 7 But C4-C 20 is alkyl, R 8 and R 9 However, each independently, C1-C 12 alkyl or R 8 and R 9 together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered heterocyclic ring, a, b, c, and d are each independently an integer of 1 to 24; and x is 0, 1, or 2.

[0334] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer thereof, wherein: L 1 and L 2 are each independently -0(C=0)-, -(C=0)0-, or a carbon-carbon double bond; R 1a and R 1b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 1a But H or C1-C 12 alkyl, and R 1b together with the carbon atom to which it is attached, form an adjacent R 1b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 2a and R 2b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 2a But H or C1-C 12 alkyl, and R 2b together with the carbon atom to which it is attached, form an adjacent R 2b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 3a and R 3b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 3a But H or C1-C 12 alkyl, and R 3b together with the carbon atom to which it is attached, form an adjacent R 3b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 4a and R 4b is, in each occurrence independently: (a) H or C1-C 12 alkyl, or (b) R 4a But H or C1-C 12 alkyl, and R4b together with the carbon atom to which it is attached, form an adjacent R 4b and together with the carbon atom to which it is attached form a carbon-carbon double bond, R 5 and R 6 are each independently methyl or cycloalkyl; R 7 is, in each occurrence, independently H or C1-C 12 alkyl, and R 8 and R 9 are each independently unsubstituted C-C 12 alkyl, or R 8 and R 9 together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered heterocyclic ring containing one nitrogen atom, a and d are each independently an integer of 0 to 24, b and c are each independently an integer of 1 to 24, and e is 1 or 2; however, R 1a , R 2a , R 3a , or R 4a At least one of the 12 alkyl or L 1 Or L 2 at least one of is -0(C=0)- or -(C=0)0-; R 1a and R 1b However, when a is 6, it is not isopropyl, and when a is 8, it is not n-butyl.

[0335] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof, wherein: R1 and R2 are the same or different and each is a straight or branched chain alkyl having 1 to 9 carbon atoms, or an alkenyl or alkynyl having 2 to 11 carbon atoms; L1 and L2 are the same or different and each is a linear alkyl group having 5 to 18 carbon atoms or forms a heterocyclic ring together with N; X1 is a bond or -CG-G-, thereby forming L2-CO-O-R2; X2 is S or O; L3 is a bond or lower alkyl, or forms a heterocycle together with N; R3 is lower alkyl, R4 and R5 are the same or different and each is lower alkyl.

[0336] In some embodiments, the lipid nanoparticles comprise an ionizable lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0337] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0338] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0339] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0340] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0341] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0342] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0343] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0344] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0345] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0346] In some embodiments, the lipid nanoparticles comprise a lipid having the following structure: [ka] or a pharmaceutically acceptable salt thereof.

[0347] Non-cationic lipids In certain embodiments, the lipid nanoparticles described herein comprise one or more non-cationic lipids. The non-cationic lipids may be phospholipids.

[0348] In some embodiments, the lipid nanoparticles comprise 5-25 mol% non-cationic lipids. For example, the lipid nanoparticles may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipids. In some embodiments, the lipid nanoparticles comprise 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipids.

[0349] In some embodiments, the non-cationic lipids of the present disclosure are 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dilinoleo ... 1-Oleoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, or a mixture thereof.

[0350] In some embodiments, the lipid nanoparticles contain 5-15 mol%, 5-10 mol%, or 10-15 mol% DSPC. For example, the lipid nanoparticles may contain 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% DSPC.

[0351] In certain embodiments, the lipid composition of the lipid nanoparticle compositions disclosed herein may comprise one or more phospholipids, such as one or more saturated or (poly)unsaturated phospholipids, or a combination thereof. Generally, a phospholipid comprises a phospholipid moiety and one or more fatty acid moieties.

[0352] The phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0353] The fatty acid moiety may be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, α-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0354] Certain phospholipids can promote fusion with membranes.For example, cationic phospholipids can interact with one or more negatively charged phospholipids in membranes (for example, cell membranes or intracellular membranes).By fusion of phospholipids with membranes, one or more components (for example, therapeutic agents) of lipid-containing compositions (for example, LNPs) can pass through the membrane, and for example, one or more components can be delivered to target tissues.

[0355] Non-natural phospholipid species, including natural species with modifications and substitutions, including branching, oxidation, and cyclization, as well as alkynes, are also contemplated. For example, phospholipids can be functionalized with or crosslinked to one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, alkyne groups can undergo copper-catalyzed cycloaddition reactions when exposed to azides. Such reactions can be useful for functionalizing the lipid bilayer of nanoparticle compositions to facilitate membrane permeation or cell recognition, or for linking nanoparticle compositions to useful components such as targeting or imaging moieties (e.g., dyes).

[0356] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidyglycerol, and phosphatidic acid. Phosphosphingolipids also include phospholipids such as sphingomyelin.

[0357] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1 , 2-Dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-Diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-Di-O-Octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-Oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-Hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3 -phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, or a mixture thereof.

[0358] In certain embodiments, the phospholipid is an analog or variant of DSPC. In certain embodiments, the phospholipid is a compound of formula (IX): [ka] or a salt thereof, wherein Each R 1 are independently optionally substituted alkyl, or optionally two R 1 are joined together with the intervening atoms to form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl, or optionally three R 1 are joined together with the intervening atoms to form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the following formula: [ka] It is of L 2 Each instance of is independently a bond or an optionally substituted C 1-6 alkylene and optionally substituted C 1-6 One methylene unit of the alkylene is optionally O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), -NR N C(O)O, or NR N C(O)N(R N ) and R 2 Each instance of is independently an optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30 alkynyl, and optionally R 2one or more methylene units of are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), -OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, -OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or -N(R N )S(O)2O, R N is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; p is 1 or 2; However, this compound has the following formula: [ka] (In the formula, R 2 each instance of is independently an unsubstituted alkyl, an unsubstituted alkenyl, or an unsubstituted alkynyl.

[0359] In some embodiments, the phospholipid can be one or more of the phospholipids described in PCT Application No. PCT / US2018 / 037922.

[0360] In some embodiments, lipid nanoparticles comprise a molar ratio of 5-25% non-cationic lipid relative to other lipid components. For example, lipid nanoparticles may comprise a molar ratio of 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, 20-25%, or 25-30% non-cationic lipid. In some embodiments, lipid nanoparticles comprise a molar ratio of 5%, 10%, 15%, 20%, 25%, or 30% non-cationic lipid.

[0361] In some embodiments, lipid nanoparticles comprise a molar ratio of 5-25% phospholipids relative to other lipid components. For example, lipid nanoparticles may comprise a molar ratio of 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, 20-25%, or 25-30% phospholipids. In some embodiments, lipid nanoparticles comprise a molar ratio of 5%, 10%, 15%, 20%, 25%, or 30% phospholipids.

[0362] structured lipids The lipid composition of the pharmaceutical compositions disclosed herein may comprise one or more structured lipids. As used herein, the term "structured lipid" includes sterols and also includes lipids containing sterol moieties.

[0363] The introduction of structured lipids into lipid nanoparticles can help reduce aggregation of other lipids within the particles. The structured lipids can be selected from the group including, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structured lipid is a sterol. As defined herein, "sterol" is a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structured lipid is a steroid. In certain embodiments, the structured lipid is cholesterol. In certain embodiments, the structured lipid is a cholesterol analog. In certain embodiments, the structured lipid is alpha-tocopherol.

[0364] In some embodiments, the structured lipid can be one or more of the structured lipids described in US Application No. 16 / 493,814.

[0365] In some embodiments, lipid nanoparticles comprise a molar ratio of structural lipids to other lipid components of 25-55%. For example, lipid nanoparticles may comprise a molar ratio of structural lipids of 10-55%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45-50%, or 50-55%. In some embodiments, lipid nanoparticles comprise a molar ratio of structural lipids of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 55%.

[0366] In some embodiments, the lipid nanoparticles comprise 30-45 mol% sterol, optionally 35-40 mol%, e.g., 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 35-35 mol%, 35-36 mol%, 36-37 mol%, 38-38 mol%, 38-39 mol%, or 39-40 mol%. In some embodiments, the lipid nanoparticles comprise 25-55 mol% sterol. For example, the lipid nanoparticles may contain 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, the lipid nanoparticles contain 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol.

[0367] In some embodiments, the lipid nanoparticles comprise 35-40 mol% cholesterol, for example, the lipid nanoparticles may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol.

[0368] Polyethylene glycol (PEG)-lipids The lipid composition of the pharmaceutical compositions disclosed herein may include one or more polyethylene glycol (PEG) lipids.

[0369] As used herein, the term "PEG lipid" or "PEG-modified lipid" refers to a polyethylene glycol (PEG)-modified lipid. Non-limiting examples of PEG lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, and PEG-modified 1,2-diacyloxypropan-3-amine. Such lipids are also referred to as PEGylated lipids. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0370] In some embodiments, PEG lipids include, but are not limited to, 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterglycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristylpropyl-3-amine (PEG-c-DMA).

[0371] In some embodiments, the PEG-lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG.

[0372] In some embodiments, the lipid portion of the PEG-lipid is about C 14 ~About C 22 , preferably about C14 ~About C 16 In some embodiments, the PEG moiety, e.g., mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In some embodiments, the PEG lipid is 2k -DMG.

[0373] In some embodiments, the lipid nanoparticles described herein can include a PEG-lipid that is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

[0374] PEG lipids are known in the art and are described, for example, in U.S. Pat. No. 8,158,601 and International Publication No. WO 2015 / 130584 A2 (incorporated herein by reference in their entireties), which are incorporated herein by reference in their entireties.

[0375] Generally, some of the other lipid components (e.g., PEG lipids) of the various formulas described herein can be synthesized as described in International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled "Compositions and Methods for Delivery of Therapeutic Agents," which is incorporated by reference in its entirety.

[0376] The lipid component of the lipid nanoparticle composition may include one or more molecules containing polyethylene glycol, such as PEG or PEG-modified lipids. Such species may alternatively be referred to as PEGylated lipids. PEG lipids are lipids modified with polyethylene glycol. The PEG lipids may be selected from the non-limiting group including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. For example, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0377] In some embodiments, the PEG-modified lipid is a modified form of PEG-DMG. PEG-DMG has the following structure: [ka]

[0378] In some embodiments, the PEG lipid may be a PEGylated lipid described in International Publication No. WO2012099755, the contents of which are incorporated herein by reference in their entirety. Any of these exemplary PEG lipids described herein may be modified to include a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, the PEG-OH or hydroxy-PEGylated lipid includes an -OH group at the end of the PEG chain. Each option represents a separate embodiment.

[0379] In certain embodiments, the PEG lipid is a compound of formula (X): [ka] or a salt thereof, wherein R 3 But, -OR O and R O is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer from 1 to 100, L 1 optionally substituted C 1-10 alkylene and optionally substituted C 1-10 At least one methylene of the alkylene is independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ) and D is a moiety obtained by click chemistry or cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the following formula: [ka] It is of L 2 Each instance of is independently a bond or an optionally substituted C 1-6 alkylene and optionally substituted C 1-6 One methylene unit of the alkylene is optionally O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), -NRN C(O)O, or NR N C(O)N(R N ) and R 2 Each instance of is independently an optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30 alkynyl, and optionally R 2 one or more methylene units of are independently an optionally substituted carbocyclylene, an optionally substituted heterocyclylene, an optionally substituted arylene, an optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), -OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, -OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N), OS(O)2N(R N ), or -N(R N )S(O)2O, R N is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; p is 1 or 2.

[0380] In certain embodiments, the compound of formula (X) is a PEG-OH lipid (i.e., R 3 -OR O and R O is hydrogen). In certain embodiments, the compound of formula (X) is a compound of formula (X-OH): [ka] or a salt thereof.

[0381] In certain embodiments, the PEG lipid is a PEGylated fatty acid. In certain embodiments, the PEG lipid is a compound of formula (XI). The compound of formula (XI): [ka] or a salt thereof, provided herein, wherein: R 3 But, -OR O and R O is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer from 1 to 100, R 5 optionally substituted C 10-40 Alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted C 10-40 alkynyl, and optionally R 5one or more methylene units of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), -C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), -C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, -OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, -N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O, R N Each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0382] In certain embodiments, the compound of formula (XI) is a compound of formula (XI-OH): [ka] or a salt thereof. In some embodiments, r is 40-50.

[0383] In yet another embodiment, the compound of formula (XI) is [ka] or a salt thereof.

[0384] In some embodiments, the compound of formula (XI) is [ka] is.

[0385] In some embodiments, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG lipid.

[0386] In some embodiments, the PEG lipid can be one or more of the PEG lipids described in US Application No. US 15 / 674,872.

[0387] In some embodiments, lipid nanoparticles comprise a molar ratio of 0.5-15% PEG-lipid relative to other lipid components. For example, lipid nanoparticles may comprise a molar ratio of 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10%, or 10-15% PEG-lipid. In some embodiments, lipid nanoparticles comprise a molar ratio of 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% PEG-lipid.

[0388] In some embodiments, the lipid nanoparticles comprise 1-5% PEG-modified lipid, optionally 1-3 mol%, e.g., 1.5-2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol%. In some embodiments, the lipid nanoparticles comprise 0.5-15 mol% PEG-modified lipid. For example, the lipid nanoparticles may comprise 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, the lipid nanoparticles comprise 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipids.

[0389] Some embodiments include adding PEG to a composition containing LNPs encapsulating nucleic acids (e.g., already containing PEG in the amounts listed above). Without being bound by theory, it is believed that spiking an LNP composition with additional PEG can provide benefits during lyophilization. Thus, some embodiments include adding additional PEG compared to the amount used in a non-lyophilized LNP composition. In embodiments, after formation of the LNP composition (e.g., already containing PEG in the amounts listed elsewhere herein), about 0.5 mol% or more of PEG, e.g., about 1 mol%, about 1.5 mol%, about 2 mol%, about 2.5 mol%, about 3 mol%, about 3.5 mol%, about 4 mol%, about 5 mol%, or more, is added to the LNP composition.

[0390] In some embodiments, the lipid nanoparticles comprise 20-60 mol % ionizable amino lipid, 5-25 mol % non-cationic lipid, 25-55 mol % sterol, and about 0.5-15 mol % PEG-modified lipid.

[0391] In some embodiments, the LNPs of the present disclosure comprise an ionizable amino lipid of Compound 1, where the non-cationic lipid is DSPC, the structural lipid is cholesterol, and the PEG lipid is DMG-PEG.

[0392] In some embodiments, the LNP comprises an ionizable amino lipid of any of formulas VI, VII, or VIIII, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.

[0393] In some embodiments, the LNP comprises an ionizable amino lipid of any of formulas VI, VII, or VIII, a phospholipid comprising DSPC, a structured lipid, and a PEG lipid comprising a compound having formula XI.

[0394] In some embodiments, the LNP comprises an ionizable amino lipid of formula VI, VII, or VIII, a phospholipid comprising a compound having formula VIII, a structured lipid, and a PEG lipid comprising a compound having formula X or XI.

[0395] In some embodiments, the LNP comprises an ionizable amino lipid of formula VI, VII, or VIII, a phospholipid comprising a compound having formula IX, a structured lipid, and a PEG lipid comprising a compound having formula X or XI.

[0396] In some embodiments, the LNP comprises an ionizable amino lipid of formula VI, VII, or VIII, a phospholipid having formula IX, a structured lipid, and a PEG lipid comprising a compound having formula XI.

[0397] In some embodiments, the lipid nanoparticles comprise 49 mol% ionizable amino lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.

[0398] In some embodiments, the lipid nanoparticles comprise 49 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG.

[0399] In some embodiments, the lipid nanoparticles comprise 48 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG.

[0400] In some embodiments, the LNPs comprise an N:P ratio of about 2:1 to about 30:1.

[0401] In some embodiments, the LNPs comprise an N:P ratio of about 6:1.

[0402] In some embodiments, the LNPs comprise an N:P ratio of about 3:1, 4:1, or 5:1.

[0403] In some embodiments, the LNPs comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 10:1 to about 100:1.

[0404] In some embodiments, the LNPs comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 20:1.

[0405] In some embodiments, the LNPs comprise a wt / wt ratio of ionizable amino lipid components to RNA of about 10:1.

[0406] Some embodiments include compositions having one or more LNPs with a diameter of about 150 nm or less, e.g., about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. Some embodiments include compositions having an average LNP diameter of about 150 nm or less, e.g., about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. In some embodiments, the compositions have an average LNP diameter of about 30 nm to about 150 nm, or an average diameter of about 60 nm to about 120 nm.

[0407] LNPs can comprise one or more types of lipids, including, but not limited to, amino lipids (e.g., ionizable amino lipids), neutral lipids, non-cationic lipids, charged lipids, PEG-modified lipids, phospholipids, structured lipids, and sterols. In some embodiments, LNPs can further comprise one or more cargo molecules, including, but not limited to, nucleic acids (e.g., mRNA, plasmid DNA, DNA or RNA oligonucleotides, siRNA, shRNA, snRNA, snoRNA, lncRNA, etc.), small molecules, proteins, and peptides.

[0408] In some embodiments, the composition comprises a liposome. A liposome is a lipid particle comprising lipids arranged in one or more concentric lipid bilayers around a central region. The central region of the liposome may comprise an aqueous solution, suspension, or other aqueous composition.

[0409] In some embodiments, lipid nanoparticles can comprise two or more components (e.g., amino lipids and nucleic acids, PEG lipids, phospholipids, structured lipids). For example, lipid nanoparticles can comprise amino lipids and nucleic acids. Compositions comprising lipid nanoparticles, such as those described herein, can be used in a wide variety of applications, including stealth delivery of therapeutic payloads with minimal adverse innate immune responses.

[0410] Effective in vivo delivery of nucleic acids represents an ongoing medical challenge. Exogenous nucleic acids (i.e., derived from outside a cell or organism) are easily degraded in the body, for example, by the immune system. Therefore, effective delivery of nucleic acids to cells often requires the use of particulate carriers (e.g., lipid nanoparticles). Particulate carriers should be formulated to have minimal particle aggregation, be relatively stable before intracellular delivery, effectively deliver nucleic acids into cells, and provoke no or minimal illicit immune responses. To achieve minimal particle aggregation and pre-delivery stability, many conventional particulate carriers rely on the presence and / or concentration of certain components (e.g., PEG-lipids). However, it has been discovered that certain components can reduce the stability of encapsulated nucleic acids (e.g., mRNA molecules). Reduced stability can limit the broad applicability of particulate carriers. Therefore, there remains a need for methods to improve the stability of nucleic acids (e.g., mRNA) encapsulated in lipid nanoparticles.

[0411] In some embodiments, the lipid nanoparticles comprise one or more ionizable molecules, polynucleotides, and optional components such as structural lipids, sterols, neutral lipids, phospholipids, and molecules that can reduce particle aggregation (e.g., polyethylene glycol (PEG), PEG-modified lipids), such as those described above.

[0412] In some embodiments, the LNPs described herein may contain one or more ionizable molecules (e.g., amino lipids or ionizable lipids). The ionizable molecules may contain ch...

Claims

[Claim 1] 1. A method for analyzing a polyvalent RNA composition, comprising: (i) contacting a multivalent RNA composition comprising a first RNA species and a second RNA species with two or more RNase H guide oligonucleotides; (ii) digesting the first and second RNA species with RNase H enzyme to release a plurality of first and second RNA fragments; (iii) determining the presence and / or amount of the released first and second RNA fragments.

Images