IL-13RA2 Chimeric Antigen Receptor and Methods of Use

Abstract

Provided are immunotherapies, particularly chimeric antigen receptors targeting IL-13Rα2, and their use for treating cancer. Provided are single chain variable fragments (scFvs) that specifically bind to IL-13Rα2, chimeric antigen receptors (CARs) comprising IL-13Rα2 scFvs, nucleic acids encoding CARs, vectors comprising nucleic acids encoding CARs, and immune cells expressing CARs. Also provided are methods of treating a subject with cancer, comprising administering to the subject immune cells expressing IL-13Rα2 scFv-CARs, alone or in combination with other cancer therapies.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This claims the benefit of U.S. Provisional Application No. 63 / 169,575, filed April 1, 2021, which is incorporated herein by reference.

[0002] Technical Field The present disclosure relates to immunotherapy, in particular to chimeric antigen receptors that target IL-13Rα2 and their use to treat cancer. [Background technology]

[0003] background IL-13Rα2 is a high-affinity receptor for the cytokine interleukin-13 (IL-13) and known tumor antigens. Although the significance of IL-13Rα2 expression in cancer is not fully understood, IL-13Rα2 has been shown to be overexpressed in a variety of human cancers, including malignant glioma, head and neck cancer, Kaposi's sarcoma, renal cell carcinoma, ovarian cancer, breast cancer and pancreatic cancer, making IL-13Rα2 a potential target for cancer immunotherapy.

[0004] Chimeric antigen receptor (CAR)-T cell therapy has become a promising immunotherapeutic strategy for treating various hematological cancers. CAR-T cells are effective in hematological malignancies such as leukemia and lymphoma, but to date, very limited activity has been seen in human solid cancers. Improved targeting of CAR-T cells in solid tumors, alone or in combination with other agents targeting the tumor stroma (the tumor microenvironment including myeloid-derived suppressor cells, tumor-associated macrophages and fibroblasts), would represent a major advance in the field of CAR-T immunotherapy. Summary of the Invention [Means for solving the problem]

[0005] Disclosure Summary IL-13Rα2 is significantly upregulated in some cancers, and therefore IL-13Rα2 is the target of immunotherapy for treating various cancers. Provided herein is a chimeric antigen receptor (CAR) that specifically targets cells that express IL-13Rα2. These CARs can be used for immunotherapy to target cancers that express or overexpress IL-13Rα2.

[0006] Disclosed herein is a single chain variable region fragment (scFv) that specifically binds to IL-13Rα2. In some embodiments, the scFv has an amino acid sequence that includes the variable heavy (VH) domain complementarity determining region 1 (CDR1), CDR2 and CDR3 amino acid sequence of SEQ ID NO:1, and the variable light (VL) domain CDR1, CDR2 and CDR3 amino acid sequence of SEQ ID NO:1. In some examples, the scFv has at least 90% identity to the amino acid sequence of SEQ ID NO:1, or includes or consists of the amino acid sequence of SEQ ID NO:1. In some examples, the scFv specifically binds to cells expressing IL-13Rα2.

[0007] Nucleic acids encoding IL-13Rα2 scFv and vectors (such as viral vectors) containing the nucleic acids are also provided. In some embodiments, the nucleic acid encoding IL-13Rα2 scFv is codon optimized. In some examples, the IL-13Rα2 scFv is encoded by a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO:2. In other examples, the IL-13Rα2 scFv is encoded by a nucleic acid comprising or consisting of the nucleic acid sequence of SEQ ID NO:2.

[0008] Also provided is a CAR comprising an IL-13Rα2 scFv, a hinge domain, a transmembrane domain, and an intracellular domain having one or more signaling domains. In some embodiments, the CAR further comprises a signal peptide. In some examples, the signal peptide is a CD8α signal peptide. In some examples, the transmembrane domain is a CD28 transmembrane domain. In some examples, the intracellular domain comprises one or more of CD28, 4-1BB and CD3ζ signaling domains, or any combination of two or more thereof. In one non-limiting embodiment, the IL-13Rα2-CAR comprises an IL-13Rα2 scFv, a CD8α hinge domain, a CD28 transmembrane domain, and an intracellular domain comprising a CD28 domain, a 4-1BB domain and a CD3ζ domain. In some examples, the IL-13Rα2-CAR comprises an amino acid sequence having at least 90% identity to the amino acid sequence of SEQ ID NO:3, or comprises or consists of the amino acid sequence of SEQ ID NO:3.

[0009] Nucleic acids encoding IL-13Rα2-CAR disclosed herein, and vectors (such as viral vectors) comprising the nucleic acids are also provided. In some embodiments, the nucleic acid encoding IL-13Rα2-CAR is codon-optimized for expression in a particular cell type (e.g., bacteria, yeast, insect, mouse, human). In some examples, the IL-13Rα2-CAR is encoded by a nucleic acid sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 4. In other examples, the IL-13Rα2-CAR is encoded by a nucleic acid comprising or consisting of the nucleic acid sequence of SEQ ID NO: 4. Vectors comprising a nucleic acid molecule encoding IL-13 Rα2-CAR are also disclosed herein. In some examples, the vector is a viral vector, such as a lentiviral vector.

[0010] Also provided are immune cells expressing the disclosed IL-13Rα2-CAR, e.g., immune cells comprising a nucleic acid encoding the disclosed IL-13Rα2-CAR or a vector encoding the disclosed IL-13Rα2-CAR. In some examples, the cells are T cells, natural killer (NK) cells, natural killer T (NKT) cells, or macrophages. In specific, non-limiting examples, the immune cells are T cells. In some examples, the immune cells are obtained from peripheral blood. Methods of producing cells expressing IL-13Rα2-CAR are provided. These methods include transducing or transfecting cells, such as T cells, NK cells, NKT cells, or macrophages, with a vector encoding the disclosed IL-13Rα2-CAR.

[0011] Also provided are methods for treating a subject with cancer, for example by administering cells (such as T cells, NK cells, NKT cells, or macrophages) that express IL-13Rα2-CAR or contain a vector encoding IL-13Rα2-CAR. In some examples, the subject has a cancer that expresses or overexpresses IL-13Rα2. In certain non-limiting examples, the subject has pancreatic cancer, glioblastoma, head and neck squamous cell carcinoma, ovarian cancer, uterine cancer, prostate cancer, breast cancer, melanoma, non-small cell lung cancer (NSCLC), renal cell carcinoma, Kaposi's sarcoma, or adrenal cancer. In some examples, the method further comprises treating the subject with one or more of surgery, radiation, chemotherapy, or additional immunotherapy. In further examples, histone deacetylase (HDAC) inhibitors, cell cycle and / or checkpoint inhibitors, adrenomedullin, IL-13-PE immunotoxin, or any combination of two or more thereof, are administered to a subject in combination with IL-13Rα2-CAR immune cells.

[0012] The above and other features of the present disclosure will become more apparent from the following detailed description which proceeds with reference to the accompanying drawings. [Brief description of the drawings]

[0013] [Figure 1] Figure 1 shows a schematic diagram of an exemplary scFv-IL-13Rα2 CAR construct. The construct comprises a 5'-CD8α signal peptide, scFv IL-13Rα2, a CD8α hinge domain, a CD28 transmembrane domain, and an endodomain derived from the CD28 cytoplasmic domain, 4-1BB, and CD3ζ. [Diagram 2] 2 shows the amino acid numbering of the heavy chain residues of the IL-13Rα2 antibody using the Kabat numbering scheme. The sequence shown is residues 22-139 of SEQ ID NO:3. [Figure 3A] 3A-B show an analysis of the heavy chain of the IL-13Rα2 antibody. FIG. 3A is a table providing the heavy chain amino acid regions, sequence, residue number and length of scFv-IL-13Rα2. FIG. 3B is the loop structure of the heavy chain CDR with amino acid residue position numbering. The sequence shown is residues 22-139 of SEQ ID NO:3. [Figure 3B] 3A-B show an analysis of the heavy chain of the IL-13Rα2 antibody. FIG. 3A is a table providing the heavy chain amino acid regions, sequence, residue number and length of scFv-IL-13Rα2. FIG. 3B is the loop structure of the heavy chain CDR with amino acid residue position numbering. The sequence shown is residues 22-139 of SEQ ID NO:3. [Figure 4] 4 shows the amino acid numbering of the light chain residues of the IL-13Rα2 antibody using the Kabat numbering scheme. The sequence shown is residues 155-263 of SEQ ID NO:3. [Figure 5A] 5A-5B show an analysis of the light chain of the IL-13Rα2 antibody. FIG. 5A is a table providing the light chain amino acid regions, sequence, residue number and length of scFv-IL-13Rα2. FIG. 5B is the loop structure of the light chain CDR with amino acid residue position number. The sequence shown is residues 155-260 of SEQ ID NO:3. [Figure 5B]5A-5B show an analysis of the light chain of the IL-13Rα2 antibody. FIG. 5A is a table providing the light chain amino acid regions, sequence, residue number and length of scFv-IL-13Rα2. FIG. 5B is the loop structure of the light chain CDR with amino acid residue position number. The sequence shown is residues 155-260 of SEQ ID NO:3. [Figure 6] FIG. 6 shows the distribution of heavy chain amino acids of the IL-13Rα2 antibody and their respective frequencies. [Figure 7] FIG. 7 shows the distribution of light chain amino acids of the IL-13Rα2 antibody and their respective frequencies. [Figure 8] FIG. 8 is a comparative sequence alignment of the heavy chain residues of the IL-13Rα2 antibody according to the IMGT, Kabat, Chothia and Martin numbering scheme (SEQ ID NO:3, residues 22-139). [Figure 9] FIG. 9 is a comparative sequence alignment of the light chain residues of the IL-13Rα2 antibody according to the IMGT, Kabat, Chothia and Martin numbering scheme (SEQ ID NO:3, residues 155-260). [Figure 10] FIG. 10 shows the amino acid sequence of an exemplary scFv IL-13Rα2 CAR and the location of each element (SEQ ID NO: 18). [Figure 11] Figure 11 shows the restriction digest of vector containing scFv IL-13Rα2 CAR. Approximately 1.0 μg of plasmid DNA was digested with BamH1 and Not1 at 37°C for 1 hour, electrophoresed on a 1% agarose gel, and then stained. Lane 1 is undigested scFv-IL-13Rα2 CAR construct plasmid, lane 2 is plasmid DNA digested with BamH1 and Not1, and lane 3 is KB reference ladder. [Figure 12]Figures 12A-B show expression of CD28 (cytoplasmic) (Figure 12A) and CD3ζ (Figure 12B) signaling domains in transduced CAR-Jurkat cells. Transduced Jurkat cells were permeabilized and immunostained with anti-CD28 (CD28.2) mouse mAb PE conjugate (catalog no. 27826, Cell Signaling Technology, Danvers, MA) and CD3ζ monoclonal antibody PE conjugate (catalog no. 12-2479-82, ThermoFisher eBioscience, Carlsbad, CA) followed by FACS analysis of CAR-Jurkat cells. Data are presented normalized to the mode. [Figure 13] Figure 13A-B show the identification of scFv IL-13Rα2 CAR transgene in transduced Jurkat and T cells by indirect immunofluorescence assay (IFA) analysis. Transduced Jurkat and T cells were incubated with 500 ng / ml of biotinylated recombinant human IL-13Rα2 Fc chimeric protein, followed by incubation with streptavidin-Alexa 594 to develop fluorescence in scFv-IL-13Rα2 expressing cells. Cells expressing 2+ or higher fluorescence intensity were counted at 200x magnification by viewing with a NIKON epifluorescence microscope. Each value is the mean ± SD of four experiments determined in a blinded fashion and expressed as % positive cells (Figure 13A). Figure 13B shows a representative IFA image of transduced Jurkat cells. [Figure 14] Figure 14 shows cell viability of scFv IL-13Rα2 CAR-Jurkat cells and scFv IL-13Rα2 CAR-T cells in cell culture over 7 days. Viability was determined by trypan blue exclusion and is expressed as the number of viable cells. [Figure 15]Figure 15 shows cell proliferation of scFv IL-13Rα2 CAR-T cells in vitro by MTS assay. Transduced Jurkat cells and T cells were monitored for cell proliferation for up to 7 days in appropriate culture medium. The proliferation activity of transduced cells was assessed by measuring the optical density of MTS tetrazolium reduced by proliferating cells at 490 nm at specific time points. Each value is the mean ± SD of four independent experiments. [Figure 16] Figure 16 shows the expression of T cell activation markers in CAR-T cells. Expression of T cell activation markers (CD25, CD44, CD69) and intracellular IFN-γ expression were measured on day 7. [Figure 17] Figure 17 shows scFv IL-13Rα2 CAR-T cell specificity and cytotoxicity against IL-13Rα2+ glioma tumor cells in co-culture. After 6 h of co-culture with a fixed number of calcein-violet-loaded tumor cells (5000) as target cells at various effector-to-target (E:T) ratios, the cytolytic activity of CAR-T cells was determined by measuring the release of fluorescent dye. IL-13Rα2 knockout (KO) tumor cells were used as a negative control. Each value is the mean ± SD of three independent experiments performed in quadruplicate. [Figure 18] Figure 18 shows IL-13Rα2 silencing siRNA in U251 and U87MG glioma cell lines. IL-13Rα2 / β-actin relative fluorescence units were measured by RT-qPCR assay. Each value represents the mean ± SD of four independent runs performed in triplicate. [Figure 19] Figure 19 shows IFN-γ release by scFv IL-13Rα2 CAR-T cells when co-cultured with tumor cells. When scFv IL-13Rα2 CAR-T was exposed to IL-13Rα2 positive tumors, the CAR-T cells produced large amounts of IFN-γ. However, when exposed to IL-13Rα2 negative T98G or IL-13Rα2 KO tumor cells, they secreted only basal amounts of IFN-γ. Representative data from three independent experiments performed in quadruplicate are shown. [Figure 20]Figure 20 shows a Boyden chamber assay. The in vitro migration assay demonstrates that scFv-IL-13Rα2 CAR-T cells can migrate from the upper chamber to the lower chamber in a concentration-dependent manner in medium containing various concentrations of HuIL-13Rα2 Fc or in conditioned medium from IL-13Rα2-positive U251 tumor cell cultures. No migration was observed in control medium or in conditioned medium from IL-13Rα2-negative T98G tumor cell cultures. Each value is the mean ± SD of four independent experiments performed in triplicate. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] Sequence Listing Any nucleic acid and amino acid sequences listed herein or in the attached sequence listing are shown using standard letter abbreviations for nucleotide bases and amino acids as defined in 37 CFR § 1.822. In at least some cases, only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. The sequence listing is submitted as a 24,576 byte ASCII text file, "Sequence.txt", created on March 30, 2022, which is incorporated herein by reference. In the attached sequence listing:

[0015] SEQ ID NO:1 is the amino acid sequence of an exemplary IL-13Rα2 scFv. [ka]

[0016] SEQ ID NO:2 is an exemplary nucleic acid sequence encoding the IL-13Rα2 scFv of SEQ ID NO:1. [ka]

[0017] SEQ ID NO:3 is the amino acid sequence of an exemplary IL-13Rα2-CAR. [ka]

[0018] SEQ ID NO:4 is an exemplary nucleic acid sequence encoding the IL-13Rα2-CAR construct of SEQ ID NO:3. [ka] [ka]

[0019] SEQ ID NO:5 is the amino acid sequence of an exemplary CD8α signal peptide. [ka]

[0020] SEQ ID NO:6 is the amino acid sequence of an exemplary CD8α hinge domain. [ka]

[0021] SEQ ID NO:7 is the amino acid sequence of an exemplary CD28 transmembrane domain (CD28TM). [ka]

[0022] SEQ ID NO:8 is the amino acid sequence of an exemplary CD28 cytoplasmic signaling domain. [ka]

[0023] SEQ ID NO:9 is the amino acid sequence of an exemplary 4-1BB cytoplasmic signaling domain. [ka]

[0024] SEQ ID NO:10 is the amino acid sequence of an exemplary CD3 zeta cytoplasmic signaling domain. [ka]

[0025] SEQ ID NO:11 is an exemplary nucleic acid sequence encoding the CD8α signal peptide of SEQ ID NO:5. [ka]

[0026] SEQ ID NO:12 is an exemplary nucleic acid sequence encoding the CD8α hinge domain of SEQ ID NO:6. [ka]

[0027] SEQ ID NO:13 is an exemplary nucleic acid sequence encoding the CD28 transmembrane domain (CD28TM) of SEQ ID NO:7. [ka]

[0028] SEQ ID NO:14 is an exemplary nucleic acid sequence encoding the CD28 cytoplasmic signaling domain of SEQ ID NO:8. [ka]

[0029] SEQ ID NO:15 is an exemplary nucleic acid sequence encoding the 4-1BB cytoplasmic signaling domain of SEQ ID NO:9. [ka]

[0030] SEQ ID NO:16 is an exemplary nucleic acid sequence encoding the CD3 zeta cytoplasmic signaling domain of SEQ ID NO:10. [ka]

[0031] SEQ ID NO:17 is the nucleic acid sequence of an exemplary siRNA for silencing IL-13Rα2. [ka]

[0032] SEQ ID NO: 18 is the amino acid sequence of an exemplary scFv IL-13Rα2 CAR [ka]

[0033] Detailed Description I. Terminology Unless otherwise stated, technical terms are used according to conventional usage. Definitions of common terms in molecular biology can be found in Lewin's Genes X, ed. Krebs et al., Jones and Bartlett Publishers, 2009 (ISBN 0763766321); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and George P. Redei, Encyclopedic Dictionary of Genetics, Genomics, Proteomics and Informatics, 3 rdEdition, Springer, 2008 (ISBN: 1402067534), as well as other similar references.

[0034] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a", "an" and "the" include plural referents unless the context clearly indicates otherwise. "Comprising A or B" means including A, or B, or A and B. Furthermore, it should be understood that all base sizes or amino acid sizes and all molecular weight or molecular mass values ​​given for nucleic acids or polypeptides are approximate and are provided for illustrative purposes.

[0035] Methods and materials similar or equivalent to those described herein can be used to carry out or test this disclosure, and suitable methods and materials are described below.All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including explanations of terms, will prevail.In addition, materials, methods, and examples are illustrative only and are not intended to be limiting.

[0036] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

[0037] Antibody: A polypeptide ligand that contains at least one variable region that recognizes and binds (e.g., specifically recognizes and binds) an epitope of an antigen. Mammalian immunoglobulin molecules are composed of heavy (H) and light (L) chains, each of which has a variable heavy (V H ) area and variable light (V L ) domain, which together form the V H Area and V LThe region is responsible for binding the antigen recognized by the antibody. There are five major heavy chain classes (or isotypes) of mammalian immunoglobulins that determine the functional activity of the antibody molecule: IgM, IgD, IgG, IgA and IgE.

[0038] Antibody variable regions contain "framework" regions and hypervariable regions known as "complementarity determining regions" or "CDRs". The CDRs are primarily responsible for binding to an epitope of an antigen. The framework regions of an antibody serve to position and align the CDRs in three-dimensional space. The amino acid sequence boundaries of a given CDR can be readily determined using any of several well-known numbering schemes, including those described by Kabat et al. (Sequences of Proteins of Immunological Interest, USDepartment of Health and Human Services, 1991; "Kabat" numbering scheme), Chothia et al. (see Chothia and Lesk, J Mol Biol 196:901-917, 1987; Chothia et al., Nature 342:877, 1989; and Al-Lazikani et al., (JMB 273, 927-948, 1997; "Chothia" numbering scheme), and the ImMunoGeneTics (IMGT) database (see Lefranc, Nucleic Acids Res 29:207-9, 2001; "IMGT" numbering scheme). The Kabat and IMGT databases are maintained online.

[0039] Single-chain variable fragment (scFv) antibodies are composed of one or more antibody variable fragments linked by a suitable polypeptide linker as a genetically fused single-chain molecule. H and V LThe V domain is a genetically engineered molecule that contains the V domain (see, e.g., Bird et al., Science, 242:423-426, 1988; Huston et al., Proc. Natl. Acad. Sci., 85:5879-5883, 1988; Ahmad et al., Clin. Dev. Immunol., 2012, doi:10.1155 / 2012 / 980250; Marbry, IDrugs, 13:543-549, 2010). H Domains and V L The intramolecular orientation of the domains is typically not critical for scFvs. Therefore, both possible configurations (V H Domain-Linker Domain-V L Domain;V L Domain-Linker Domain-V H For dsFv, a scFv having a V domain can be used. H and V L has been mutated to introduce disulfide bonds to stabilize the association of the chains. Diabodies are also included, which are H Domains and V L A bivalent, bispecific antibody is one in which the domains are expressed on a single polypeptide chain but use a linker that is too short to allow pairing between the two domains on the same chain, thereby allowing the domains to pair with complementary domains on another chain and create two antigen-binding sites (see, e.g., Holliger et al., Proc. Natl. Acad. Sci., 90:6444-6448, 1993; Poljak et al., Structure, 2:1121-1123, 1994).

[0040] Antibodies also include genetically engineered forms such as chimeric antibodies (such as humanized mouse antibodies) and heteroconjugate antibodies (such as bispecific antibodies). Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3 rdEd., W.H. Freeman & Co., New York, 1997.

[0041] Cancer: A disease characterized by abnormal or uncontrolled cell growth. Other features often associated with cancer include metastasis, interference with the normal function of neighboring cells, release of abnormal levels of cytokines or other secretory products, suppression or exacerbation of inflammatory or immunological responses, infiltration of surrounding or distant tissues or organs such as lymph nodes, etc. "Metastatic disease" refers to cancer cells that have left the original tumor site and migrated to other parts of the body, for example via the bloodstream or lymphatic system.

[0042] Checkpoint inhibitors: include inhibitors of cell cycle checkpoints as well as immune checkpoints. Cell cycle checkpoints refer to protective mechanisms that ensure cells properly complete each cell cycle stage during mitosis. Checkpoint inhibitors can sensitize cancer cells to DNA damaging drugs by causing cells with DNA damage to bypass S and G2 / M arrest and enter mitosis, causing cell death by mitotic catastrophe. Cell cycle checkpoint inhibitors are described in more detail by Visconti et al., J Exp Clin Cancer Res.35(1):153,2016. Immune checkpoints refer to protective mechanisms that prevent self-reactive immune cells. Immune checkpoints are activated when inhibitory receptors on immune cells (such as T cells) recognize antigens on cells as "self" antigens. Although immune checkpoints are an important mechanism for preventing autoimmune disorders, cancerous cells can exploit immune checkpoints to suppress or evade immune recognition. Thus, checkpoint inhibitors can help immune cells recognize and eliminate cancerous cells.

[0043] Many checkpoint inhibitors are known in the art. Some non-limiting examples include ipilimumab (Yervoy®), nivolumab (Opdivo®), pembrolizumab (Keytruda®), atezolizumab (Tencentriq®), avelumab (Bavencio®), durvalumab (Imfinzi®), cemiplimab (Libtayo®), palbociclib (Ibrance®), ribociclib (Kisquali®), and abemaciclib (Verzenio®). Further examples are provided in Qiu et al., Journal of the European Society for Therapeutic Radiology and Oncology, 126(3):450-464, 2018; Visconti et al., J Exp Clin Cancer Res. 35(1):153, 2016; and Mills et al. Cancer Res. 77(23):6489-6498, 2017.

[0044] Checkpoint inhibitors can also include spindle formation checkpoint inhibitors. For example, spindle formation checkpoint inhibitors include MK-1775 (AZD1775), taxanes or vinca alkaloids (see Zhou and Giannakakou. Curr Med Chem Anticancer Agents. 5:65-71, 2005; and Visconti et al., J Exp Clin Cancer Res. 35(1):153, 2016).

[0045] Chimeric antigen receptor (CAR): A chimeric molecule that includes an antigen-binding portion (such as a single domain antibody or scFv) and a signaling domain, such as a signaling domain from a T cell receptor (e.g., CD3ζ). Typically, a CAR includes an antigen-binding portion, a transmembrane domain, and an intracellular domain. The intracellular domain typically includes a signaling chain with an immunoreceptor tyrosine-based activation motif (ITAM), such as CD3ζ or FcεRIγ. In some examples, the intracellular domain also includes the intracellular portion of at least one additional co-stimulatory domain, such as CD28, 4-1BB (CD137), ICOS, OX40 (CD134), CD27, and / or DAP10.

[0046] Complementarity determining region (CDR): A region of hypervariable amino acid sequence that determines the binding affinity and specificity of an antibody. The light and heavy chains of mammalian immunoglobulins each have three CDRs, designated VL-CDR1, VL-CDR2, VL-CDR3 and VH-CDR1, VH-CDR2, VH-CDR3, respectively.

[0047] Effective amount: An amount of an agent, such as the disclosed IL-13Rα2-CAR-T cells or IL-13Rα2-CAR-NK cells, sufficient to treat, reduce, and / or ameliorate the symptoms and / or underlying causes of a disease or pathological condition, such as cancer, in a subject. In a non-limiting example, an effective amount is an amount sufficient to inhibit or reduce tumor growth in a subject.

[0048] Histone deacetylase (HDAC) inhibitors: Some HDAC inhibitors have been shown to induce cell growth arrest and apoptosis, and are therefore potential anticancer therapeutics.Some non-limiting examples of HDAC inhibitors include trichostatin A (TSA), suberoylanilide hydroxamic acid (SAHA), sodium butyrate (NaB), SP600125 (Sigma-Aldrich), SR11302 (Tocris Bioscience) and romidepsin (see Marks and Jiang, Cell Cycle 2005,4:549-551; Duvic et al. Blood 109:31-39,2007; and Fujisawa et al. Journal of Translational Medicine 9:37,2011).

[0049] IL-13-PE immunotoxin: IL-13-PE is a recombinant immunotoxin composed of IL-13 and a truncated Pseudomonas exotoxin. IL-13-PE has been shown to be highly cytotoxic to tumor cells expressing high levels of IL-13Rα2 both in vitro and in vivo (see Debinski et al., Clin Cancer Res. 1:1253-1258, 1995; Debinski et al., Biol Chem. 270:16775-16780, 1995; and Joshi et al. Clin Cancer Res. 8:1948-1956, 2002).

[0050] Interleukin-13 receptor alpha 2 (IL-13 Rα2): IL-13Rα2 is a high-affinity receptor for the pleiotropic immunomodulatory cytokine interleukin-13 (IL-13) and known tumor antigens. Although the significance of IL-13Rα2 expression in cancer is not known and the mechanism of upregulation remains unclear, IL-13Rα2 has been shown to be overexpressed in a variety of human cancers, including malignant gliomas, head and neck cancer, Kaposi's sarcoma, renal cell carcinoma, and ovarian cancer. Furthermore, a recent study has shown that 71% of pancreatic tumors overexpress IL-13Rα2 (Fujisawa et al. Journal of Translational Medicine 9:37,2011).

[0051] Isolated: An "isolated" biological component, such as a nucleic acid, protein (including an antibody), or cell, has been substantially separated or purified from other biological components in the environment (such as a cell) in which it resides, such as other chromosomal and extrachromosomal DNA and RNA, proteins, and cells. "Isolated" nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. The term also encompasses nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

[0052] Macrophage: large migratory mononuclear phagocytes derived from myeloid precursors found in most tissues of the human body. Macrophages express pattern recognition receptors (PRRs), including Toll-like receptors (TLRs), C-type lectin receptors, scavenger receptors, retinoic acid-inducible gene 1 (RIG1)-like helicase receptors (RLRs) and NOD-like receptors, to recognize signals associated with pathogens, foreign bodies, and dead or dying cells.

[0053] Macrophages are highly heterogeneous and include several subclasses. Classically activated macrophages (M1 macrophages) mediate the host's defense against various pathogens (e.g., bacteria, protozoa, and viruses) and also mediate antitumor immune responses. Alternatively, activated macrophages (M2 macrophages) have an anti-inflammatory role and regulate wound healing. Regulatory macrophages secrete large amounts of interleukin-10 (IL-10) in response to Fc receptor-γ ligation. Less clearly defined macrophage subsets include tumor-associated macrophages and myeloid-derived suppressor cells, which suppress antitumor immunity (Murray et al. (2011) Nat Rev Immunol 11:723-737).

[0054] Natural killer (NK) cells: cells of the immune system that kill target cells in the absence of specific antigenic stimulation and without restriction by MHC class. Target cells can be tumor cells or virus-bearing cells. NK cells are characterized by the presence of CD56 and the absence of CD3 surface markers. NK cells typically constitute approximately 10-15% of the mononuclear cell fraction in normal peripheral blood. Historically, NK cells were first identified by their ability to lyse specific tumor cells without prior immunization or activation. NK cells are thought to provide a "backup" defense mechanism against viruses and tumors that may escape CTL responses by downregulating MHC class I presentation. In addition to participating in direct cytotoxic killing, NK cells also play a role in cytokine production that may be important for controlling cancer and infection.

[0055] In some examples, an "modified NK cell" is an NK cell that has been transduced or transfected with a heterologous nucleic acid (e.g., one or more of the nucleic acids or vectors disclosed herein) or that expresses one or more heterologous proteins. The terms "modified NK cell" and "transduced NK cell" are used interchangeably in some examples herein.

[0056] Pharmaceutically acceptable carriers: include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, etc., compatible with pharmaceutical administration (see, e.g., Remington: The Science and Practice of Pharmacy, Adejare (Ed.), Academic Press, London, United Kingdom, 23 rd (See, for example, the American College of Pharmacology, 2021 Edition (2021)). Examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, balanced salt solution, and 5% human serum albumin. Non-aqueous vehicles such as liposomes and fixed oils can also be used. Supplementary active compounds can also be incorporated into the composition. Practical methods for preparing administrable compositions include those described in Remington: The Science and Practice of Pharmacy, Adejare (Ed.), Academic Press, London, United Kingdom, 23 rd Please refer to the 2021 Edition.

[0057] Purified: The term purified does not require absolute purity, but is rather intended as a relative term. Thus, for example, a purified protein, nucleic acid or cell preparation is one in which the protein, nucleic acid or cell is more concentrated than the protein, nucleic acid or cell in its initial environment. In one embodiment, the preparation is purified such that the protein, nucleic acid or cell constitutes at least 50% of the total content of the preparation. A substantially purified protein or nucleic acid is at least 60%, 70%, 80%, 90%, 95% or 98% pure. Thus, in one specific, non-limiting example, a substantially purified protein or nucleic acid is 90% free from other components.

[0058] Recombinant: A nucleic acid or protein having a sequence that is not naturally occurring or that has been created by the artificial combination of two otherwise separated sequence segments (e.g., a "chimeric" sequence), which can be accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acid, for example, by genetic engineering techniques.

[0059] Subject: Living multi-cellular vertebrate organisms, a category that includes humans and non-human mammals, including but not limited to non-human primates, rodents, etc. In certain examples disclosed herein, the subject is a human.

[0060] T cell: White blood cell (lymphocyte) that is an important mediator of the immune response. T cells contain CD4 + T cells and CD8 + These include, but are not limited to, CD4 + T cells are immune cells that have a marker on their surface known as "cluster of differentiation 4" (CD4). Also known as helper T cells, these cells help orchestrate immune responses, including antibody responses as well as killer T cell responses. CD8 + The T cells have a "cluster of differentiation 8" (CD8) marker. In one embodiment, the CD8 + The T cells are cytotoxic T lymphocytes (CTLs). + The cells are suppressor T cells.

[0061] Activated T cells can be detected by cell proliferation and / or increased expression or secretion of one or more cytokines (such as IL-2, IL-4, IL-6, IFN-γ, or TNFα). + T cell activation can also be detected by increased cytolytic activity in response to antigen.

[0062] Natural killer T (NKT) cells are a class of T cells that express both the T cell receptor (TCR) characteristic of adaptive immunity and the surface receptors of NK cells that are part of the innate immune response (e.g., the cell surface marker NK1.1, typically associated with NK cells along with the α / β T cell receptor) (Tupin et al. (2007) Nat Rev Microbiol 5:405-417).

[0063] In some examples, an "modified T cell" is a T cell that has been transduced or transfected with a heterologous nucleic acid (e.g., one or more of the nucleic acids or vectors disclosed herein) or that expresses one or more heterologous proteins. The terms "modified T cell" and "transduced T cell" are used interchangeably in some examples herein. Similarly, an "modified NKT cell" is an NKT cell that has been transduced or transfected with a heterologous nucleic acid (e.g., one or more of the nucleic acids or vectors disclosed herein) or that expresses one or more heterologous proteins.

[0064] Transduced or transformed: A transformed cell is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. As used herein, the terms transduction and transformation encompass all techniques by which a nucleic acid molecule may be introduced into such a cell, including transduction or transfection with viral vectors, the use of plasmid vectors, and introduction of DNA by electroporation, lipofection, and particle gun acceleration.

[0065] Treating or ameliorating a disease: "Treating" refers to a therapeutic intervention that reduces or inhibits a sign or symptom of a disease or pathological condition after the disease or pathological condition has begun to develop, such as reducing tumor size or tumor burden. "Ameliorating" refers to a reduction in the number or severity of signs or symptoms of a disease, such as cancer.

[0066] Vector: A nucleic acid molecule that can be introduced into a host cell (e.g., by transfection or transduction) to produce a transformed host cell. A recombinant DNA vector is a vector that has recombinant DNA. A vector can contain a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. A vector can also contain one or more selectable marker genes and other genetic elements known in the art. A viral vector is a recombinant nucleic acid vector that has at least some nucleic acid sequences derived from one or more viruses. A replication-defective viral vector is a vector that requires complementation of one or more regions of the viral genome required for replication due to a deficiency in at least one replication-essential gene function.

[0067] II. Overview of Some Embodiments Disclosed herein are interleukin-13 receptor alpha 2 (IL-13Rα2) binding agents comprising scFvs. Also disclosed are chimeric antigen receptors (CARs) comprising IL-13Rα2 specific binding agents (such as IL-13Rα2 scFvs disclosed herein) fused to an intracellular domain comprising a hinge region, a transmembrane domain and one or more signaling domains (e.g., one or more costimulatory domains). In some examples, the one or more signaling domains are derived from CD28, 4-1BB and / or CD3ζ. In some examples, the hinge region is derived from CD8α and the transmembrane region is derived from CD28. The CAR may also encode a signal peptide, such as the CD8α signal peptide. Nucleic acids encoding IL-13Rα2 specific binding agents and IL-13Rα2-CARs and vectors comprising the nucleic acids are also provided.

[0068] Also provided herein is an immune cell (e.g., T cell, NK cell, NKT cell, or macrophage) transformed with a nucleic acid or vector encoding an IL-13Rα2-specific binding agent or IL-13Rα2-CAR. In some examples, the immune cell expresses IL-13Rα2-CAR. The cell can be obtained from a blood sample, such as the peripheral blood of a subject, before being transformed with a nucleic acid or vector.

[0069] Also provided are methods of treating a cancer expressing IL-13Rα2 in a subject. In some embodiments, the method comprises administering to the subject an effective amount of immune cells expressing IL-13Rα2-CAR. In some examples, the immune cells are autologous to the subject. In other examples, the immune cells are allogeneic. In some examples, the subject receives additional treatment, such as surgery, radiation, chemotherapy, additional immunotherapy, administration of a histone deacetylase (HDAC) inhibitor, administration of a cell cycle and / or checkpoint inhibitor, administration of adrenomedullin, administration of an IL-13-PE immunotoxin, or any combination of two or more thereof. In some examples, the subject has cancer, e.g., pancreatic cancer, glioblastoma, head and neck squamous cell carcinoma, ovarian cancer, uterine cancer, prostate cancer, breast cancer, melanoma, non-small cell lung cancer (NSCLC), renal cell carcinoma, Kaposi's sarcoma, or adrenal carcinoma.

[0070] III. IL-13Rα2-Specific Binding Agents In some examples, disclosed herein are interleukin-13 receptor alpha 2 (IL-13Rα2) binding agents used as targeting moieties of chimeric antigen receptors (CARs). In some embodiments, the IL-13Rα2 binding agent is a single chain variable fragment (scFv) that specifically binds to IL-13Rα2.

[0071] In some embodiments, the IL13-Rα2 binding agent is an antibody or scFv that comprises the CDR sequences provided in Table 1. In some examples, the antibody or scFv specifically binds to IL-13Rα2 and comprises the variable heavy (VH) domain complementarity determining region 1 (CDR1), CDR2, and CDR3 amino acid sequences of SEQ ID NO: 1, and the variable light (VL) domain complementarity determining region 1 (CDR1), CDR2, and CDR3 of SEQ ID NO: 1, respectively. In some examples, the antibody or scFv comprises the VH domain complementarity determining region 1 (CDR1), CDR2, and CDR3 amino acid sequences of SEQ ID NO: 1, respectively. H Array and V L In some examples, the V sequence includes an amino acid sequence having at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to the V sequence. H The domain comprises amino acids 1 to 118 of SEQ ID NO:1, L The domain comprises amino acids 134 to 239 of SEQ ID NO:1.

[0072] In some embodiments, the binding agent is an scFv comprising the CDR amino acid sequences provided in Table 1 and having at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to the amino acid sequence of SEQ ID NO:1. In other embodiments, the binding agent is an scFv and comprises or consists of the amino acid sequence of SEQ ID NO:1. [Table 1-1] [Table 1-2]

[0073] In some embodiments, the scFv binds to a target cell, such as a cell expressing IL-13Rα2. In some examples, the cell is a cancer cell (including a tumor cell), such as a pancreatic cancer, glioblastoma, head and neck squamous cell carcinoma, ovarian cancer, uterine cancer, prostate cancer, breast cancer, melanoma, non-small cell lung cancer (NSCLC), renal cell carcinoma, Kaposi's sarcoma, or adrenal carcinoma cell. The scFv binding may be increased or improved when IL-13Rα2 expression is upregulated in the target cell.

[0074] IV. IL-13Rα2 Chimeric Antigen Receptor Provided herein is an IL-13Rα2 chimeric antigen receptor (IL-13Rα2-CAR) comprising an IL13-Rα2 specific binding agent described in Section III. In some embodiments, the IL-13Rα2 CAR comprises (a) an antigen binding domain comprising an IL-13Rα2 specific scFv (e.g., SEQ ID NO:1), (b) a hinge domain, (c) a transmembrane domain, and (d) an intracellular domain comprising one or more signaling domains. The CAR may also comprise a signal peptide, a linker, and / or sequences for recombinant construction (such as restriction enzyme sites).

[0075] In some embodiments, the antigen binding domain is an IL-13Rα2-specific scFv, such as those described in Section II. In some examples, the CAR comprises an IL-13Rα2 scFv that comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:1 (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity), or that comprises or consists of the amino acid sequence of SEQ ID NO:1.

[0076] In some embodiments, the hinge domain is a CD8α hinge domain, for example, comprising or consisting of the amino acid sequence of SEQ ID NO: 6. Other hinge domains can be used, such as hinge regions from other immunoglobulins (e.g., IgG1, IgG4, or IgD), or from CD28 or CD40. In some embodiments, the transmembrane domain is a CD28 transmembrane domain, for example, comprising or consisting of the amino acid sequence of SEQ ID NO: 7. Transmembrane domains can also be derived from other T cell proteins, such as CD8, CD4, CD3ζ, CD40, OX40-L, 4-1BB, ICOS, ICOS-L, CD80, CD86, ICAM-1, LFA-1, ICAM-1, CD56, CTLA-4, PD-1, TIM-3, NKP30, NKP44, NKP40, NKP46, B7-H3, PD-L1, PD-2, and CD70.

[0077] In some embodiments, the one or more signaling domains include one or more of CD28, 4-1BB (CD137), CD8, CD40, OX40 (CD134), ICOS, CD27, DAP10, DAP12, OX40-L, 4-1BBL, ICOS-L, CD80, CD86, ICAM-1, LFA-1, CD56, CTLA-4, PD-1, PDK, TIM-3, NKP30, NKP44, NKP40, NKP46, B7-H3, PD-L1, PD-2, CD70, CD3ζ, and FcεRIγ domains, or any combination of two or more thereof. In a specific non-limiting example, the one or more signaling domains are CD28, 4-1BB, and CD3ζ signaling domains, e.g., comprising or consisting of the amino acid sequences of SEQ ID NOs: 8, 9, and 10, respectively. In some embodiments, the chimeric antigen receptor further comprises a signal peptide located at the N-terminus of the scFv. In some examples, the signal peptide is a CD8α signal peptide, e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 5. Other signal peptides include the IgG signal sequence or the GM-CSF signal sequence.

[0078] In certain examples, the IL-13Rα2-CAR comprises an amino acid sequence having at least 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity) to the amino acid sequence of SEQ ID NO: 3. In some examples, the IL-13Rα2-CAR comprises or consists of the amino acid sequence of SEQ ID NO: 3. In other examples, the IL-13Rα2 CAR does not include a signal peptide, e.g., does not include amino acids 1-21 of SEQ ID NO: 3.

[0079] In other embodiments, the IL-13Rα2-CAR further comprises a domain that increases the survival or persistence of immune cells expressing the CAR. In some examples, the domain is an intracellular domain from a cytokine receptor, such as an intracellular domain from an interleukin (IL)-15 receptor, an IL-12 receptor, or an IL-18 receptor. In other examples, the domain is an intracellular domain from a growth factor receptor, such as an intracellular domain from CD40, NKG2D, NKP40, or NKP46. In some examples, the domain is located at the C-terminus of the CD3ζ domain of the CAR. In additional embodiments, the IL-13Rα2-CAR further comprises an inducible gene (such as caspase 9) that can be used to eliminate IL-13Rα2-CAR-expressing cells (e.g., a "suicide" gene). The inducible gene can be activated in the event of off-target side effects (or on-target / off-tumor effects), such as cytokine release syndrome ("cytokine storm").

[0080] Also provided are functional variants of the IL-13Rα2-CAR or domains thereof described herein that retain the biological activity of the CAR, that is a variant of the biological activity of the CAR, or that retain the biological activity of a particular domain. A functional variant can be at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more identical in amino acid sequence to the parent CAR or domain. Substitutions can be made, for example, in one or more of the extracellular targeting domain, hinge domain, transmembrane domain, and intracellular domain.

[0081] In some examples, the functional variant comprises the amino acid sequence of the parent CAR or domain with at least one conservative amino acid substitution (e.g., up to 10 conservative amino acid substitutions, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative substitutions). In other examples, the functional variant comprises the amino acid sequence of the parent CAR or domain with at least one non-conservative amino acid substitution (e.g., up to 10 non-conservative amino acid substitutions, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-conservative substitutions). In this case, the non-conservative amino acid substitution does not interfere with or inhibit the biological activity of the functional variant. The non-conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased compared to the parent CAR or domain.

[0082] A CAR or a domain thereof may, in some instances, include one or more synthetic amino acids in place of one or more naturally occurring amino acids, such as, for example, aminocyclohexanecarboxylic acid, norleucine, a-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxamide, cyclohexylglycine ... Examples of CARs include carboxyl, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, oc-aminocycloheptanecarboxylic acid, -(2-amino-2-norbornane)-carboxylic acid, γ-diaminobutyric acid, α,β-diaminopropionic acid, homophenylalanine, and α-tert-butylglycine. CARs can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized, for example via disulfide bridges, or converted to acid addition salts, and / or dimerized or polymerized or conjugated as required.

[0083] V. Nucleic Acids and Vectors Nucleic acids encoding the IL13-Rα2 binding agents or IL-13Rα2-chimeric antigen receptors (IL-13Rα2-CARs) disclosed herein are also provided.

[0084] In some embodiments, the nucleic acid encodes an IL13-Rα2 binding agent. In some examples, the nucleic acid encodes each of the CDR sequences provided in Table 1, for example, the nucleic acid encodes the VH domain CDR1, CDR2 and CDR3 of SEQ ID NO:1, and encodes the VL domain CDR1, CDR2 and CDR3 of SEQ ID NO:1, respectively. In some examples, the nucleic acid encodes an amino acid sequence comprising each of the CDR sequences provided in Table 1 and having at least 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity) with SEQ ID NO:1. In some examples, the nucleic acid encodes an amino acid sequence comprising or consisting of SEQ ID NO:1. In further examples, the nucleic acid encodes each of the CDR sequences provided in Table 1 and has at least 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to SEQ ID NO:2. In some examples, the nucleic acid encoding an IL13-Rα2 binding agent comprises or consists of SEQ ID NO:2.

[0085] In some embodiments, the nucleic acid encodes an IL-13Rα2-CAR disclosed herein. In some examples, the nucleic acid molecule encodes an amino acid sequence having at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) with SEQ ID NO:3. In some examples, the nucleic acid molecule encodes an amino acid sequence that includes each of the CDR sequences provided in Table 1 (the nucleic acid encodes the VH domain CDR1, CDR2, and CDR3 and the VL domain CDR1, CDR2, and CDR3 of SEQ ID NO:1) and has at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) with SEQ ID NO:3. In some examples, the nucleic acid molecule encodes an amino acid sequence that comprises or consists of SEQ ID NO:3. In further examples, the nucleic acid molecule encoding IL-13Rα2-CAR comprises a nucleic acid sequence having at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to SEQ ID NO:4. In some examples, the nucleic acid molecule encoding IL-13Rα2-CAR comprises a nucleic acid sequence encoding each of the CDR sequences provided in Table 1, wherein the nucleic acid has at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to SEQ ID NO:4. In other examples, the nucleic acid molecule encoding IL-13Rα2-CAR comprises or consists of SEQ ID NO:4.

[0086] Also provided are vectors (e.g., plasmids, viral vectors, cosmids, artificial chromosomes) encoding the nucleic acids disclosed herein (e.g., nucleic acids encoding IL-13Rα2-specific binding agents or IL-13Rα2-CAR). Certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors may be referred to as "expression vectors." In some embodiments, the nucleic acid molecules encoding the disclosed IL-13Rα2 scFv or IL-13Rα2-CAR are included in a vector (such as a viral vector) for expression in a host cell, such as an immune cell (e.g., a T cell, a NK cell, a NKT cell, or a macrophage).

[0087] One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, in which DNA or RNA sequences from a virus are present in the vector for packaging into the virus (e.g., retroviruses, replication-deficient retroviruses, adenoviruses, replication-deficient adenoviruses, and adeno-associated viruses). Replication-deficient viral vectors are vectors that require complementation of one or more regions of the viral genome required for replication due to a deficiency in at least one replication-essential gene function.

[0088] In some embodiments, the vector is a viral vector, such as a retrovirus (e.g., MoMLV or lentivirus) or an adeno-associated virus (AAV) vector. Other suitable viral vectors include polyoma, SV40, vaccinia virus, herpes viruses including HSV and EBV, Sindbis virus, alphaviruses and retroviruses of avian, murine and human origin, baculovirus (Autographa californica nuclear polyhedrosis virus; AcMNPV) vectors, retrovirus vectors, polio vectors, orthopox vectors, avipox vectors, fowlpox vectors, capripox vectors, chickenpox vectors, adenovirus vectors, herpes virus vectors, alphavirus vectors, baculovirus vectors, Sindbis virus vectors, vaccinia virus vectors and poliovirus vectors. Specific exemplary pox viruses that may be used include orthopox, chickenpox, avipox and capripox viruses. Orthopox include vaccinia, ectromelia, and raccoon pox. An example of an orthobox of use is vaccinia. Avipox include chicken pox, canary pox, and pigeon pox. Capripox include goat pox and sheep pox. In one example, chicken pox is swinepox. In a specific, non-limiting example, the vector is pCDH-MSCV-MCS-EF1a-GFP-T2A-Puro lentiviral vector (e.g., catalog number CD713B-1, System Biosciences, Palo Alto, CA 94303).

[0089] A vector may contain one or more regulatory elements operably linked to the nucleic acid sequence to be expressed, which may be selected based on the host cell used for expression (e.g., a promoter (such as CMV, SV40, EF1α, β-actin, hPGK, or RPBSA); a transcription start site (TSS); an enhancer; an insulator; an A / T-rich region; a transcription factor (TF) binding site; a transcription and / or translation terminator; an initiation sequence, or other regulatory elements). "Operably linked" means that the nucleotide sequence of interest is linked to a regulatory element in a manner that allows expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into a host cell). Vector expression may be constitutive (e.g., SV40, CMV, UBC, EF1α, PGK, and CAGG), inducible (e.g., IPTG), or cell / tissue specific (e.g., T cell specific, such as dLck or CD3δ). In some examples, the promoter is a synthetic promoter inducible upon CAR T cell or TCR activation (e.g., "iSynPro" promoter, see WO 2018 / 213332). The vector can be introduced into a host cell to express a product (e.g., an IL13-Rα2-binding agent or an IL-13Rα2-CAR) encoded by a nucleic acid described herein. The vector can also include one or more selectable marker genes, such as an antibiotic (e.g., puromycin, hygromycin) or a detectable marker (e.g., GFP, YFP, RFP, luciferase, X-gal). In some examples, a selectable marker or reporter is not included in the vector.

[0090] The vector may include a safety switch system, such as an inducible pro-apoptotic molecule (e.g., Fas-associated death domain-containing protein (FADD), Bcl-2-associated death promoter (BAD) or inducible caspase 9 (iCasp9)) or an inducible activation system (e.g., My88 / CD40 (iMC)). Further information regarding safety switch systems can be found, for example, in Gargett and Brown (2014) Front. Pharmacol. 5:235 and Gerken et al. (2017) Cancer Discov. 7(11):1306-1319. In some examples, the vector encoding the safety switch is a different vector than the vector encoding the IL-13Rα2-CAR or IL13-Rα2 binding agent disclosed herein. In some examples, the vector encoding the safety switch also encodes an IL-13Rα2-CAR or IL13-Rα2 binding agent.

[0091] In some examples, the safety switch is a pro-apoptotic molecule fused to an FKBP (FK 506 binding protein) variant that binds a chemical inducer of dimerization (CID) (e.g., AP1903, AP20187, AP21967). In some examples, the pro-apoptotic molecule is activated to control the growth or to eliminate cells transduced or transformed with a vector, such as a vector encoding an IL-13Rα2-CAR or IL13-Rα2 binding agent disclosed herein. In some examples, activation of the inducible pro-apoptotic molecule eliminates the transduced or transformed cells, for example, by eliminating at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the transduced or transformed cells. In some instances, the pro-apoptotic molecule is activated by contacting the transduced or transformed cell with a CID.

[0092] In some examples, the safety switch is an inducible activation system (e.g., My88 / CD40 (iMC)). In some examples, the inducible activation system is activated to increase the activity of a cell transduced or transformed with a vector (e.g., a vector encoding an IL-13Rα2-CAR or an IL13-Rα2 binding agent disclosed herein). In some examples, activation of the inducible activation system increases the activity of the transformed cell, for example, by increasing proliferation, cytokine production, or tumor targeting by at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 400% or more. In some examples, the inducible activation system is activated by contacting the transformed cell with a CID (e.g., AP1903, AP20187, AP21967).

[0093] VI. Cells expressing IL-13Rα2 CAR Also provided herein are cells (e.g., immune cells) that express the disclosed IL-13Rα2-CAR, e.g., cells comprising a nucleic acid disclosed herein (e.g., a nucleic acid encoding an IL13-Rα2-binding agent or IL-13Rα2-CAR disclosed herein) or a vector encoding the nucleic acid. Exemplary immune cells include T cells, NK cells, NKT cells, and / or macrophages. In some examples, the cell is a T cell. In some examples, the cell expresses an IL-13Rα2-CAR having at least 90% identity to SEQ ID NO:3 or amino acids 22-538 of SEQ ID NO:3. In some examples, the cell expresses an IL-13Rα2-CAR comprising or consisting of SEQ ID NO:3 or amino acids 22-538 of SEQ ID NO:3. In some examples, the cell is transduced or transfected with an amino acid sequence comprising or consisting of SEQ ID NO:3, or a nucleic acid sequence encoding amino acids 22-538 of SEQ ID NO:3. In further examples, the cells are transduced or transfected with a nucleic acid sequence having at least 90% identity to SEQ ID NO: 4. In some examples, the nucleic acid sequence comprises or consists of SEQ ID NO: 4.

[0094] In some embodiments, the cell is an isolated immune cell, such as an isolated T cell (such as a primary T cell or a T cell obtained from a subject), an isolated NK cell (such as a primary NK cell or a NK cell obtained from a subject), an isolated NKT cell, or an isolated macrophage. The cell type can be identified based on the presence or absence of expressed markers, for example, NK cells are CD56 positive and CD3 negative, T cells can be CD4 or CD8 positive, NKT cells are NK1.1 positive and α / β T cell receptor positive, and macrophages express several receptors, including PRRs, TLRs, C-type lectin receptors, scavenger receptors, RLRs, and NOD-like receptors. In some examples, the cell is an isolated T cell. In further examples, the cell is an isolated CD8+ T cell. In some examples, the cell is an isolated naive T cell. Naive T cells express CD45RA, CCR7, CD62L, CD127, and CD132 surface markers and lack CD25, CD44, CD69, CD45RO, or HLA-DR markers. In some examples, the immune cells are obtained from the subject's peripheral blood, lymph nodes, thymus, bone marrow, tumor tissue, adipose tissue, human embryonic stem cells (hESCs), induced pluripotent stem cells (iPSCs), or umbilical cord blood. In a non-limiting example, the cells are T cells isolated from the subject's peripheral blood. In a further example, the immune cells obtained from the subject are enriched, purified, and / or expanded, for example, before and / or after transformation or transduction with the vector or nucleic acid disclosed herein. In some examples, the immune cells (e.g., T cells, NK cells, NKT cells, or macrophages) are collected and expanded from a subject with cancer. In some examples, immune cells (e.g., T cells, NK cells, NKT cells, or macrophages) are obtained and expanded from a non-cancer subject.

[0095] In some embodiments, the cells are of a cell type suitable for protein expression and / or virus production (e.g., retrovirus production). Exemplary cell types include microbial (e.g., bacteria or yeast), archaea, insect, fungal, plant, or mammalian cells. Non-limiting examples of specific cell lines include Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Salmonella typhimurium, SF9 cells, C129 cells, 293 cells, Neurospora, and immortalized mammalian myeloid and lymphoid cell lines. Non-limiting examples of commonly used mammalian host cell lines include VERO and HeLa, HEK293T, CHO, WI38, BHK, and COS cell lines, although other cell lines, such as cells designed to provide higher expression, or desirable post-translational modifications (e.g., glycosylation patterns), or other characteristics, may be used. In some examples, a nucleic acid or vector disclosed herein (e.g., a nucleic acid or vector encoding an IL13-Rα2 binding agent or IL-13Rα2-CAR disclosed herein) is codon-optimized for expression in a particular organism, such as bacteria (e.g., E. coli), fungi (e.g., S. cerevisiae), plants (e.g., N. tabacum NT-1), or animals (e.g., human HEK293T cells or T cells). Suitable examples of vectors (e.g., expression vectors) are provided above.

[0096] In some embodiments, cells are transduced or transformed (including transfected) with a nucleic acid encoding an IL13-Rα2 binding agent or IL-13Rα2-CAR disclosed herein, or a vector encoding the nucleic acid. Exemplary methods of transforming cells (e.g., immune cells) include chemical transformation (calcium phosphate), electroporation, microinjection, heat shock, lipofection, and particle bombardment. In some examples, the nucleic acid or vector is introduced by contacting the cell with a nanoparticle containing the nucleic acid or vector. Transformation can be used for stable or transient expression. After transformation or transduction, cells expressing IL-13Rα2-CAR can be detected and / or enriched, for example, by flow cytometry using a labeled antibody that binds to IL-13Rα2. In some examples, the transduced or transformed cells (e.g., T cells, NK cells, NKT cells, or macrophages) are expanded by cell culture, for example, for a period of time after transformation or transduction. In some instances, some or all of the transduced or transformed immune cells are cryopreserved for later use.

[0097] VII. Immunotherapy Methods Also disclosed herein are methods of treating a subject having cancer, comprising administering an effective amount of cells expressing the disclosed IL-13Rα2-CAR (e.g., immune cells expressing an IL-13Rα2-CAR, e.g., IL-13Rα2-CAR-T cells, IL-13Rα2-CAR-NK cells, IL-13Rα2-CAR-NKT cells, or IL-13Rα2-CAR-macrophage cells). In a specific, non-limiting example, an effective amount of IL-13Rα2-CAR-T cells is administered to the subject. Cells expressing the disclosed IL-13Rα2-CAR can be generated from immune cells (e.g., T cells, NK cells, NKT cells, or macrophages) isolated from a sample, e.g., a peripheral blood sample of the subject, and then transformed or transduced with an IL-13Rα2-CAR. In some examples, the cells are autologous (derived from the subject) to the subject. In other examples, the cells are allogeneic (derived from a donor). In some examples, the sample is from a subject with cancer. In some examples, the cells are enriched, purified and / or expanded after isolation from the sample and / or transformation or transfection with IL-13Rα2-CAR.

[0098] In some embodiments, the method includes administering to the subject a composition comprising a cell expressing IL-13Rα2-CAR and a pharma- ceutically acceptable carrier. In some examples, the cell comprises a vector encoding a safety switch system. In some embodiments, the method includes administering to the subject a pharmaceutical composition comprising a vector encoding IL-13Rα2-CAR and a pharma- ceutically acceptable carrier. In some examples, the vector encodes a safety switch system.

[0099] "Pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration (see, e.g., Remington: The Science and Practice of Pharmacy, Adejare (Ed.), Academic Press, London, United Kingdom, 23 rd(See, for example, the American College of Pharmacology, 2021 Edition (2021)). Examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, balanced salt solution, and 5% human serum albumin. Non-aqueous vehicles such as liposomes and fixed oils can also be used. Supplementary active compounds can also be incorporated into the composition. Practical methods for preparing administrable compositions include those described in Remington: The Science and Practice of Pharmacy, Adejare (Ed.), Academic Press, London, United Kingdom, 23 rd Please refer to the 2021 Edition.

[0100] In some examples, the composition comprises about 10 4 ~10 12 IL-13Rα2-CAR cells (e.g., about 10 4 ~10 8 cells, approximately 10 6 ~10 8 cells, or approximately 10 6 ~10 12 In some examples, the composition comprises at least about 10 4 , 10 5 , 10 6 or 10 7 In another example, the composition comprises about 10 IL-13Rα2-CAR cells. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 or 10 10 In some examples, the composition comprises about 10 IL-13Rα2-CAR cells or less. 4 ~10 10 IL-13Rα2-CAR cells / kg (e.g., approximately 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or 10 10The amount of the cells / kg of the subject can be adjusted to be administered. The appropriate dose can be determined through clinical trials.

[0101] A population of IL-13Rα2-CAR cells is typically administered parenterally, e.g., intravenously, although injection or infusion into or near a tumor (e.g., local administration), or administration into the peritoneal cavity can also be used. The appropriate route of administration can be determined by a skilled clinician based on factors such as the subject, the condition being treated, and other factors.

[0102] Multiple doses of a population of IL-13Rα2-CAR cells can be administered to a subject.For example, IL-13Rα2-CAR cells can be administered daily, every other day, twice a week, weekly, every other week, every three weeks, monthly, or less frequently.A skilled clinician can select the administration schedule based on the subject, the condition being treated, previous treatment history, and other factors.

[0103] In some examples, an effective amount of cells expressing the disclosed IL-13Rα2-CAR is sufficient to prevent, treat, reduce and / or ameliorate one or more signs or symptoms of cancer in a subject. In other examples, an effective amount is sufficient to target and eliminate tumor cells expressing IL-13Rα2. In some examples, an effective amount is sufficient to inhibit or delay the growth or metastasis of cancer in a subject. In another example, an effective amount is sufficient to reduce tumor burden or tumor density in a subject.

[0104] In some embodiments, the subject is further administered one or more cytokines (e.g., one or more of IL-2, IL-7, IL-15, IL-21 and / or IL-12), e.g., to support survival and / or growth of the IL-13Rα2-CAR cells. The cytokine(s) can be administered before, after, or substantially simultaneously with the IL-13Rα2-CAR cells. In some examples, about 1 to about 5 cytokines are administered to the subject, e.g., about 1 to about 4, about 1 to about 3, about 1 to about 2, about 2 to about 5, about 2 to about 4, about 2 to about 3, about 3 to about 5, about 3 to about 4, or about 4 to about 5 cytokines are administered before, after, or substantially simultaneously with the IL-13Rα2-CAR cells. In some examples, at least one of IL-2, IL-7, or IL-15 is administered to the subject before, after, or substantially simultaneously with the IL-13Rα2-CAR cells. In some examples, at least one cytokine (e.g., IL-2, IL-7 and / or IL-15) is administered simultaneously, for example, with the IL-13Rα2-CAR cells.

[0105] In some examples, cells expressing the disclosed IL-13Rα2-CAR (e.g., IL-13Rα2-CAR-T cells, IL-13Rα2-CAR-NK cells, IL-13Rα2-CAR-NKT cells, or IL-13Rα2-CAR-macrophage cells) are transformed or transfected with a vector encoding a safety switch system. In some examples, a therapeutically effective amount of a CID (e.g., AP1903, AP20187, AP21967) is administered to the subject to activate the safety switch system. The safety switch system can be activated at any desired time, for example, at the end of treatment. In some examples, the CID is administered to control the growth or increase the activity of transformed or transfected cells in the subject. In some examples, the safety switch is an inducible pro-apoptotic molecule, and the inducible pro-apoptotic molecule is activated by administering a therapeutically effective amount of a CID to the subject. In some examples, administering the CID eliminates transformed or transfected cells in the subject, for example, by eliminating at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of transformed or transfected cells in the subject. In other examples, the safety switch is an inducible activation system, and the inducible activation system is activated by administering an effective amount of the CID to the subject. In some examples, administering the CID increases the activity of transformed or transfected cells in the subject compared to a suitable control. For example, by increasing proliferation, cytokine production, or tumor targeting of transformed or transfected cells in the subject by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 200%, at least 400% or more.Further information regarding safety switch systems can be found, for example, in Gargett and Brown (2014) Front. Pharmacol. 5:235 and Gerken et al. (2017) Cancer Discov. 7(11):1306-1319.

[0106] In some examples, the subject has a cancer that expresses IL-13Rα2. Exemplary cancers include sarcoma, carcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma and other sarcomas, synovium, mesothelioma, Ewing's tumor, Kaposi's sarcoma, leiomyosarcoma, rhabdomyosarcoma, colon cancer, lymphoid malignancies, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, uterine cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, adrenal gland carcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder cancer, melanoma, and CNS tumors (gliomas (brain stem glioma and Cancers include: mixed gliomas, glioblastomas (also known as glioblastoma multiforme), astrocytomas, CNS lymphomas, germinomas, medulloblastomas, schwannomas, craniopharyogiomas, ependymomas, pinealomas, hemangioblastomas, acoustic neuromas, oligodendroglioma, meningiomas, head and neck cancers, neuroblastomas, retinoblastomas and brain metastases. Cancers also include hematologic (or blood-borne) cancers such as lymphomas, Hodgkin's disease, non-Hodgkin's lymphomas (indolent or aggressive), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndromes, leukemias such as hairy cell leukemia or myelodysplasia.

[0107] In some examples, the subject has a cancer that overexpresses IL-13Rα2, for example, compared to non-cancerous cells of the same type. In some examples, the subject has a solid tumor. In further examples, the subject has pancreatic cancer, glioblastoma, head and neck squamous cell carcinoma, ovarian cancer, uterine cancer, prostate cancer, breast cancer, melanoma, non-small cell lung cancer (NSCLC), renal cell carcinoma, Kaposi's sarcoma, or adrenal cancer. In some embodiments, a subject with a cancer that expresses or overexpresses IL-13Rα2 is selected for treatment.

[0108] In some embodiments, the subject undergoes further treatment, such as one or more of surgery, radiation, chemotherapy, additional immunotherapy or other treatments. Exemplary chemotherapeutic agents include (but are not limited to) alkylating agents, such as nitrogen mustards (such as mechlorethamine, cyclophosphamide, melphalan, uracil mustard or chlorambucil), alkylsulfonates (such as busulfan), nitrosoureas (such as carmustine, lomustine, semustine, streptozocin or dacarbazine); folic acid analogs (such as methotrexate), pyrimidine analogs (such as 5-FU or cytarabine). or antimetabolites such as vinca alkaloids (such as vinblastine, vincristine, or vindesine), epipodophyllotoxins (such as etoposide or teniposide), antibiotics (such as dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, or mitomycin C), and enzymes (such as L-asparaginase). Additional agents include platinum coordination complexes (such as cis-diamine-dichloroplatinum II, also known as cisplatin), substituted ureas (such as hydroxyurea), methylhydrazine derivatives (such as procarbazine), and adrenal cortical suppressants (such as mitotane and aminoglutethimide); hormones and antagonists such as corticosteroids (such as prednisone), progestins (such as hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate), estrogens (such as diethylstilbestrol and ethinyl estradiol), antiestrogens (such as tamoxifen), and androgens (such as testosterone propionate and fluoxymesterone).Examples of the most commonly used chemotherapy drugs include adriamycin, melphalan (Alkeran®), Ara-C (cytarabine), carmustine, busulfan, lomustine, carboplatin, cisplatin, cyclophosphamide (Cytoxan®), daunorubicin, dacarbazine, 5-fluorouracil, fludarabine, hydroxyurea, idarubicin, ifosfamide, methotrexate, mithramycin, mitomycin, mitoxantrone, nitrogen mustard, paclitaxel (or or other taxanes, e.g., docetaxel), vinblastine, vincristine, VP-16, while newer drugs include gemcitabine (Gemzar®), trastuzumab (Herceptin®), irinotecan (CPT-11), leustatin, navelbine, rituximab (Rituxan®) imatinib (STI-571), topotecan (Hycamtin®), capecitabine, ibritumomab (Zevalin®) and calcitriol. A skilled clinician can select an appropriate additional therapy for a subject (from those listed herein or other current therapies) depending on factors such as the subject, the cancer being treated, treatment history, and other factors.

[0109] In some examples, the subject is administered an additional therapeutic agent, such as a checkpoint inhibitor (e.g., anti-CTLA-4, anti-PD1 or anti-PDL1), a histone deacetylase (HDAC) inhibitor, a cell cycle checkpoint inhibitor, adrenomedullin, an IL-13-PE immunotoxin, or any combination of two or more thereof. The administration of the additional therapeutic agent may occur before, after, or substantially simultaneously with the administration of the cells expressing IL-13Rα2-CAR.

[0110] In some instances, the additional therapeutic agent increases the expression of IL-13Rα2 on tumor cells. For example, treatment with HDAC inhibitors has been reported to dramatically upregulate IL-13Rα2 in pancreatic cancer cell lines that express little or no IL-13Rα2. These inhibitors also modestly upregulate IL-13Rα2 in cells that express higher levels of IL-13Rα2. It has been found that upregulation of IL-13Rα2 sensitizes pancreatic tumor cells to IL-13-PE, an immunotoxin that targets cells that express IL-13Rα2, resulting in a synergistic antitumor effect (see Fujisawa et al. Journal of Translational Medicine 9:37,2011). Thus, in some examples, the subject is administered an HDAC inhibitor, such as one or more of trichostatin A (TSA), suberoylanilide hydroxamic acid (SAHA), sodium butyrate (NaB), SP600125 (Sigma-Aldrich), SR11302 (Tocris Bioscience), or romidepsin. In a further example, the subject is administered adrenomedullin, which has also been shown to increase IL-13Rα2 expression (Joshi et al., Cancer Res. 68:9311-9317, 2008). In some examples, the HDAC inhibitor or adrenomedullin is administered substantially simultaneously with the cells expressing IL-13Rα2-CAR. In other examples, the HDAC inhibitor or adrenomedullin is administered prior to administration of the cells expressing IL-13Rα2-CAR, e.g., at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 12 days, at least 14 days, at least 3 weeks, at least 4 weeks, at least 1 month or more. Multiple doses of the HDAC inhibitor or adrenomedullin can be administered to the subject, e.g., twice daily, once daily, every other day, twice weekly, weekly, every other week, every third week, monthly, or less frequently.A skilled clinician can select an administration schedule based on the subject, the condition being treated, previous treatment history, tumor burden and type, clinical stage and grade of the disease, the subject's general health, and other factors.

[0111] In some examples, the subject is administered a checkpoint inhibitor. In some examples, the checkpoint inhibitor targets PD-1, PD-L1, CTLA-4, CDK4, and / or CDK6. Exemplary inhibitors include ipilimumab, nivolumab, pembrolizumab, atezolizumab, avelumab, durvalumab, cemiplimab, palbociclib, ribociclib, and abemaciclib. The checkpoint inhibitor can be administered substantially simultaneously with the cells expressing IL-13Rα2-CAR. In some examples, the checkpoint inhibitor is administered at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 12 days, at least 14 days, at least 3 weeks, at least 4 weeks, at least 1 month, or more prior to administering the cells expressing IL-13Rα2-CAR. Multiple doses of checkpoint inhibitors can be administered to the subject, for example, twice a day, once a day, every other day, twice a week, weekly, every other week, every three weeks, monthly, or less frequently.A skilled clinician can select the administration schedule based on the subject, the condition being treated, previous treatment history, tumor mass and type, clinical stage and grade of disease and the subject's general health, and other factors.

[0112] In some embodiments, the subject is administered an IL-13PE immunotoxin, such as a recombinant protein comprising IL-13 conjugated to a truncated Pseudomonas exotoxin (see, e.g., Kioi et al., Mol. Cancer Ther. 7(6):1579-1587, 2008). The IL-13PE immunotoxin may be administered substantially simultaneously with the cells expressing IL-13Rα2-CAR. In some examples, the IL-13PE immunotoxin is administered at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 12 days, at least 14 days, at least 3 weeks, at least 4 weeks, at least 1 month or more prior to administering the cells expressing IL-13Rα2-CAR. Multiple doses of IL-13PE immunotoxin can be administered to a subject, for example, twice a day, once a day, every other day, twice a week, weekly, every other week, every three weeks, monthly, or less frequently. A skilled clinician can select an administration schedule based on the subject, the condition being treated, previous treatment history, tumor mass and type, clinical stage and grade of disease, and the subject's general health, as well as other factors. Without being bound to any particular theory, it is believed that administration of IL-13-PE prior to administration of IL-13Rα2-CAR cells reduces the density of tumor stromal cells, thereby creating space in the tumor microenvironment for IL-13Rα2-CAR cells to infiltrate the tumor. EXAMPLES

[0113] The following examples are provided to illustrate particular features and / or embodiments, and should not be construed as limiting the disclosure to the particular features or embodiments described.

[0114] Example 1 material and method Cell line: Human Jurkat-T cells, A172, U87MG and T98G glioma cell lines were obtained from ATCC and grown according to the supplier's instructions. U251 glioma cell line was obtained from National Cancer Institute and maintained in RPMI complete medium with 10% FBS. T98G and U87MG glioma cell lines were maintained in EMEM complete medium supplemented with 10% FBS. These cell lines were previously characterized for IL-13Rα2 expression by RT-PCR of mRNA and immunocytochemistry (ICC) analysis of protein expression (Joshi et al. (2000) Cancer Res. 60:1168-1172). Two IL-13Rα2 positive glioma cell lines, U251 and U87MG, were used for IL-13Rα2 gene silencing by siRNA technology using SureSilencing® shRNA Plasmids (Qiagen, Gaithersburg, MD) according to the manufacturer's instructions. These cell lines served as negative controls in some biological assays.

[0115] Design of lentiviral vector encoding scFv-IL-13Rα2-CAR: A third generation CAR construct consisting of a single chain Fv (scFv) antibody sequence against IL-13Rα2 (as the ectodomain), CD3ζ and CD28 transmembrane domain together with CD28 and 4-1BB endodomain sequences was designed, codon optimized and synthesized in pUC57 simple subcloning vector by GenScript® (GenScript, NJ). The new scFvs were derived by recloning the VH and VL human synthetic Fab Lox library vectors previously cloned using the Griffin.1 library (a scFv library made from synthetic v gene segments) into the phagemid vector pHEN2 as previously described (Kioi et al. (2008) Mol Cancer Ther. 7:1579-1587). A novel approach was used to repann the segments to improve binding affinity to the huIL-13Rα2 Fc chimeric protein. The CAR-T construct was codon-optimized and flanked by BamHI and NotI sites into the pCDH-MSCV-MCS-EF1-copGFP-T2A-Puro lentiviral vector (Systems Biosciences, MA). This transfer plasmid was packaged into 293T cells by co-transfection with three helper plasmids (pCD / NL-BHΔ1, pCEF-VSV-G and pCMV-Rev) to generate a self-inactivating (SIN) lentiviral vector expressing the CAR-IL13 Rα2-CAR pseudo-lentivector, which was further purified by ultracentrifugation.

[0116] Analysis of antigen-binding residues and complementarity determining regions (CDRs) in scFv IL-13Rα2: A standardized numbering method was used to define the CDRs, frameworks and residues from the light and heavy chains that affect the interaction and / or affinity of the antibody to its target antigen. The amino acid sequences were analyzed using the general numbering scheme of antibody variable domains to study the statistical variability of amino acid composition using the Kabat numbering scheme (ncbi.nlm.nih.gov / igblast). Analysis of the residue distribution of both the heavy and light chains, as well as the CDR sequences including their lengths, was performed.

[0117] These data were compiled using a structure-based numbering scheme for antibody variable regions that formed the CDRs and corrected the position numbering of the points in CDRL1 and CDRH1 according to the Chothia numbering scheme, the Martin numbering scheme that was used to correct the insertion points in the framework regions of the heavy and light chains, and the ImMunoGeneTics® (IMGT®, The International ImMunoGeneTics® information system, Montpellier, France) numbering scheme that highlights protein sequences of the immunoglobulin superfamily, including variable domains from antibody light and heavy chains and T-cell receptor chains (imgt.org; github.com / oxpig / ANARCI, academic.oup.com / bioinformatics / article / 32 / 2 / 298 / 1743894; abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi; imgt.org / 3Dstructure-DB / cgi / Collier-de-Perles.cgi; and Further analysis and comparison were performed by chemogenomix.com.

[0118] CAR-T cell manufacturing: Human PBMCs were isolated from the buffy coats of normal healthy blood donors who donated blood to the Division of Transfusion Medicine at the NIH. CAR-T cells were generated from CD4 and CD8 positive T cells isolated from normal human blood donor buffy coats using the StraightFrom® Buffy Coat kit (Miltenyi Biotec, Waltham, MA). For CD4 / CD8 T cell activation, cells were activated with magnetic Dynabeads™ (Invitrogen, Carlsbad, CA) coated with anti-CD3 / CD28 antibodies at a ratio of 3:1 (T cells to beads) and transduced with lentiviral vectors at different multiplicities of infection (moi). T cells were cultured at 0.6–1 × 10 in T cell culture medium (TCM) supplemented with 50 ng / ml IL-2 and 10 ng / ml each of IL-7 and IL-15 (Miltenyi Biotec, Waltham, MA). 6 These PBMC-derived CAR-T cells are referred to as CAR-T throughout the manuscript.

[0119] To confirm the identity of the transgene and signaling domain in human Jurkat T cells (termed CAR-Jurkat), a parallel set of experiments was used for transduction and expansion.

[0120] Indirect immunofluorescence assay for transgenes in transduced CAR-Jurkat and CAR-T cells: For detection of scFv-IL-13Rα2 expression on transduced Jurkat or T cells, a novel indirect immunofluorescence assay was used by seeding 75,000 of either Jurkat-CAR or CAR-T cells on poly-L-lysine-coated 4-well chamber slides. Briefly, biotinylated recombinant human IL-13Rα2 Fc chimeric protein (R&D Biosystems, Minneapolis, MN) was produced using EZ-Link™ Microsulfo-NHS-Biotinylation Kit (Thermo Scientific, Waltham, MA). Transduced Jurkat and T cells were then incubated with 500ng / ml of purified biotinylated recombinant human IL-13Rα2 Fc chimeric protein, followed by incubation with streptavidin-Alexa 594® (0.5μg / ml) to generate red fluorescence in scFv-IL-13Rα2 expressing cells. Cells expressing a fluorescence intensity of 2+ or higher were counted using a Nikon® epifluorescence microscope at 200x magnification. Each value is the mean ± SD of four experiments determined in a blinded fashion and expressed as % positive cells.

[0121] Flow cytometry analysis: Immunofluorescence data were acquired using BD® FACSCanto™ or FACSCalibur™ (BD Bioscience, San Jose, CA) instruments and analyzed with CellQuest™ (BD Bioscience) or FlowJo® v.7 (FlowJo, LLC, Ashland, OR) software for final data analysis and graph display. Isotype control was immunoglobulin IgG1-PE (IgG1-PE, Cell Signaling Technology, Denver, MA). CD28 cytoplasm and CD3ζ endodomain were immunostained with anti-CD28.2 mouse mAb PE conjugate or CD3ζ monoclonal antibody PE conjugate (Thermofisher eBioscience, Carlsbad, CA). Permeabilized CAR-Jurkat or CAR-T cells were immunostained with anti-CD28 and CD3ζ antibodies. Data were expressed normalized to the mode.

[0122] Assessment of T cell activation marker expression in CAR-T cells: T cell activation of CAR-T cells was assessed by indirect immunofluorescence assay (IFA, abCAM, Cambridge, MA) and intracellular expression of CD44, CD25, CD69 and interferon-γ as T cell activation markers after treating cells with Brefeldin A (BioLegend, San Diego, CA). Each value is expressed as the mean ± SD of four independent readings scored in a blinded fashion for % positive cells expressing immunofluorescence intensity ≥2+.

[0123] CAR-T cell viability and proliferation analysis: The cell viability of CAR-T cell cultures was examined during cell proliferation by trypan blue exclusion technique. To further evaluate the health of CAR-T cells, cell proliferation was evaluated by CellTiter 96R® AQueous one solution kit (Promega, Madison, WI; Fisher, Waltham, MA, USA). A known number of CAR-T cells (2,500 cells / well) was seeded into quadruplicate wells of a 96-well culture plate and maintained at 37°C in a CO2 incubator. On days 3, 5, and 7, 20 microliters of MTS reagent was added to each well. The number of proliferating cells in each well was determined by measuring the optical density of reduced MTS tetrazolium by measuring the absorbance at 490 nm. Experiments were performed in quadruplicate and the results were expressed as mean ± SD.

[0124] Analysis of CAR-T cell migration and invasion The cell migration and invasion ability of CAR-T cells was evaluated in 24-well ChemoTx® plates (abCam, Cambridge, MA) with a pore size of 5 μm (chemotaxis assay). The lower chamber was loaded with 600 μL of non-conditioned Dulbecco's modified Eagle medium (R&D Systems) containing 10, 50 and 1000 ng / ml hU-IL-13Rα2 Fc, U251 or T98G tumor cell culture-conditioned Dulbecco's modified Eagle medium containing 1% fetal bovine serum, or control medium. The upper chamber was loaded with 500,000 CAR-T cells / 200 μl. After 6 and 20 hours at 37° C., the remaining cells were scraped off the polycarbonate filter and the plate was centrifuged at 400×g for 2 minutes. The filter was removed and the cells in the lower chamber were counted by trypan blue exclusion technique. The migration percentage was calculated as the number of cells in the lower chamber divided by the total number of cells seeded per well. Each value is expressed as the mean ± SD of four independent experiments.

[0125] Cytotoxic activity: To determine the cell killing activity of CAR-T cells, a robust homogeneous fluorescence-based nonisotopic cytotoxicity assay was performed. U251 and U87MG glioma cell lines, which are positive for IL-13Rα2 expression, were tested. In addition, the IL-13Rα2 gene was silenced by SureSilencing™ shRNA plasmid technology using the following siRNA sequence GCTACCATTTGGTTTCATCTT (SEQ ID NO: 17) for transfection of U251 and U87 MG cell lines according to the manufacturer's protocol (Cat. No. 336313 KH00597N, QIAGEN, Germantown, MD). IL-13Rα2-positive and IL-13Rα2-silenced tumor cells were labeled with intracellular calcein violet-acetoxymethyl ester (Lichtenfels et al. (1994) J Immunol Methods 172:227-239; Neri et al. (2001) Clin Diagn Lab Immunol 8:1131-1135). Calcein violet release was quantitatively measured in a fluorescent plate reader in supernatants collected at the end of a 6-h coculture of target:effector cells at ratios of 1:10, 1:20, 1:30, 1:40 and 1:50. Data are presented as the mean ± SD of four independent experiments performed in quadruplicate, including coculture of target and effector CAR-T cells.

[0126] IFN-γ release: IL13Rα2-CAR-T cells (100,000) were co-cultured in equal parts with IL-13Rα2-positive, IL-13Rα2-negative or IL-13Rα2 KO tumor cells for 20 hours in 96-well round-bottom plates. At the end of the incubation period, cultures were centrifuged at 3,500×g for 10 minutes and supernatants were collected for quantitative measurement of IFN-γ secretion by ELISA assay (BioLegend).

[0127] Statistical analysis: Data were compared using unpaired Student's t-test analysis. P values ​​were calculated using GraphPad Prism® software (GraphPad Software, La Jolla, CA). P values ​​less than 0.05 were considered significant. Two-way ANOVA was used to compare labeling conditions (n=4), and Wilcoxon test was used to obtain two-tailed global P values ​​for cell survival or proliferation (n=4).

[0128] Example 2 Identification and characterization of scFv-IL-13Rα2 Genes for scFv of IL-13Rα2 were identified using an scFv phase display library of synthetic v gene segments and improved versions of VH and VL showing hypervariable amino acid structure composition from a human synthetic Fab Lox library. Novel conserved scFv fragments that provided optimal antigen binding were selected based on amino acid residue analysis by four different schemes. The analysis revealed structure-based scFv variable regions, defined loop structures forming the CDRs, and insertion points within the CDRs showing hypervariable amino acid composition. The clone-derived protein showed more than four-fold higher binding affinity to recombinant IL-13Rα2 Fc protein compared to the previously cloned scFv ECD-IL-13Rα2 (Kioi et al, Mol Cancer Ther, 7(6):1579-87, 2008).

[0129] The improved scFv-IL-13Rα2 is sequence-specific for higher binding affinity and codon-optimized for better expression in human cells. Furthermore, since the improved scFv-IL-13Rα2 was generated from a library made from synthetic V gene segments, its binding spectrum to IL-13Rα2 is expected to be more specific compared to scFvs derived from single monoclonal antibodies (e.g., Balyasnikova, et al, J Biol Chem., 287(36):30215-30227, 2012).

[0130] The variable domain of IL-13Rα2 was analyzed by residue numbering scheme to define the CDRs, frameworks, and amino acid residues from the light and heavy chains that may affect binding affinity and specificity. The analysis revealed eight different regions with various numbers of residues and lengths for the heavy chain (FIG. 2 and FIG. 3A). The analyzed sequences showed variable length gaps where insertions could only be included at precise positions. The distribution of residues in the heavy chain is shown in FIG. 3A. The data analysis further revealed that amino acid residues 27-38 in ascending loop B (CDR1), amino acid residues 55-59 in ascending C loop, amino acid residues 62-65 in descending C loop C (CDR2), amino acid residues 105-110 in ascending loop F, and amino acid residues 113-117 in descending loop F (CDR3) are structural components of the heavy chain (FIG. 3B).

[0131] Analysis of the light chain showed nine distinct regions, including a tail region of 275 amino acids (Figure 5A). Similar to the heavy chain structural analysis of amino acid residues, light chain amino acids 24-29 in the ascending B loop and amino acids 36-39 in the descending C loop belong to CDR1-light, amino acids 56-57 in the ascending C loop and amino acids 65-69 in the descending C loop belong to CDR2-light, and amino acids 105-108 in the ascending F loop and amino acids 114-117 in the descending G loop belong to CDR3-light and are conserved (Figure 5B). The distribution of amino acids in the heavy and light chains after analysis according to the Kabat numbering scheme is shown in Figures 6 and 7, respectively.

[0132] The Kabat numbering of the scFv residue sequences was also analyzed for comparative alignment analysis using the IMGT, Chothia and Martin numbering schemes for the antibody variable regions, loop structures forming the CDRs, position numbers of insertion points within the CDR-H (heavy) and CDR-L (light) chains including variable domains from the antibody heavy (Figure 8) and light (Figure 9) chains, and amino acid sequence alignment of germline V. These analyses revealed the structural positions of amino acids involved in antigen binding and exhibiting hypervariable amino acid composition.

[0133] Example 3 Development of scFv-IL-13Rα2 CAR construct The optimized CAR-T construct was placed into the pCDH-MSCV-MCS-EF1-copGFP-T2 A-Puro lentiviral vector (System Biosciences, MA). Sequencing data confirmed that the CAR construct was 1631 bp long, contained 60.35% GC, and consisted of a CD8 signal peptide, scFv-IL-13Rα2 transgene, CD8 hinge, CD28 transmembrane domain, CD28 cytoplasmic domain, 4-1BB, and CD3ζ domain. Figure 10 shows the corresponding amino acid sequence of the CAR-T construct with a 5'BamH1 restriction site, as well as the location and sequence of each feature or domain. Restriction digestion of the CAR-T plasmid DNA revealed a 1640 bp band insert and a second band of the cleaved vector (Figure 11).

[0134] The recombinant lentiviral vector was packaged with three helper plasmids (pCD / NL-BHΔ1, pCEF-VSV-G and pCMV-Rev) to produce the final scFv-CAR-lentivirus in the HEK293T producer cell line.

[0135] Example 4 Generation and characterization of IL-13Rα2-CAR-T cells The scFv-IL-13Rα2 CAR construct was transduced into Jurkat cells (an immortalized T cell line) to generate IL-13Rα2-CAR-Jurkat cells. Similarly, IL-13Rα2-CAR-T cells were generated from human peripheral blood mononuclear cells (PBMCs) that were activated, transduced with the vector, and expanded in culture.

[0136] Fluorescence-activated cell sorting (FACS) analysis confirmed the expression of CD28 and CD3ζ in transduced CAR-Jurkat cells (Figure 12A and Figure 12B). Transduced Jurkat cells were permeabilized and immunostained with anti-CD28 (CD28.2) mouse mAb PE conjugate (Cat. No. 27826, Cell Signaling Technology, Danvers, MA) and CD3ζ monoclonal antibody PE conjugate (Cat. No. 12-2479-82, ThermoFisher eBioscience, Carlsbad, CA) followed by FACS analysis. Data were expressed normalized to the mode. Both CD28 cytoplasmic and CD3ζ signaling domains were detected.

[0137] The expression of the scFv-IL-13Rα2-CAR transgene was confirmed by indirect immunofluorescence assay (IFA) (FIG. 13A and FIG. 13B). IFA assay was performed on transduced Jurkat cells and T cells. Cells expressing 2+ or higher fluorescence intensity were counted at 200x magnification by viewing under a Nikon® epifluorescence microscope. The percentage of positive cells with immunostaining intensity above 2+ was slightly higher in Jurkat cells than in CAR-T cells. A representative IFA image of transduced Jurkat cells is shown in FIG. 13B. Each value is the mean ± SD of four experiments determined in a blinded fashion and expressed as % positive cells.

[0138] The viability of IL-13Rα2-CAR-Jurkat and CAR-T cells in cell culture was evaluated over the course of 7 days by trypan blue exclusion technique. As shown in Figure 14, both CAR-Jurkat and CAR-T cells continued to grow and maintained cell viability over 7 days. Similarly, both CAR-Jurkat and CAR-T maintained metabolic and proliferative activity over 7 days as determined by MTS assay (Figure 15).

[0139] The cell phenotype and function of CAR-T cells were evaluated by FACS analysis of cell surface and intracellular markers and compared to resting T cells. CAR-T cells expressed CD25, CD44 and CD69 cell surface markers indicative of T cell activation, and expression of all three markers was preserved during the expansion phase of CAR-T cell cultures, as measured on day 7 (Figure 16). Similarly, CAR-T cells expressed intracellular interferon-γ, whereas resting T cells did not show any expression of IFN-γ (Figure 16).

[0140] Example 5 CAR-T cells are cytotoxic against IL-13Rα2+ glioma tumor cells in vitro The efficacy of IL-13Rα2-CAR-T cells was examined by measuring cytotoxicity against two IL-13Rα2-positive malignant glioma tumor cell lines (U251 and U87MG) known to express high levels of IL-13Rα2. IL-13Rα2-CAR-T cells were found to specifically kill IL-13 Rα2-expressing tumor cells (IL-13Rα2+) in a manner dependent on the number of effector cells (Figure 17). Tumor cell killing was highly specific to IL-13Rα2 expression on the target tumor cells, as gene silencing of IL-13Rα2 on the target tumor cells nearly eliminated all cytotoxic activity of CAR-T cells.

[0141] The efficacy and specificity of IL-13Rα2-CAR-T cells were also evaluated based on the release of IFN-γ upon exposure to IL-13Rα2-expressing tumor cells. As shown in Figure 19, CAR-T cells produced large and nearly equal amounts of IFN-γ in the supernatant when co-cultured with three IL-13Rα2-positive glioma cell lines (U251, A172, and U87MG). In contrast, CAR-T cells secreted only basal amounts of IFN-γ when co-cultured with IL-13Rα2-negative or IL-13Rα2 KO tumor cell lines, indicating a specific response to IL-13Rα2-positive tumor cells.

[0142] Finally, the migration and invasion of IL-13Rα2-CAR-T cells was examined using a Boyden chamber assay. CAR-T cells were exposed to three different concentrations of recombinant IL-13Rα2Fc chimeric protein or conditioned medium obtained from IL-13Rα2 positive and IL-13Rα2 negative gene-silencing human glioma cell lines. As shown in Figure 20, CAR-T cell cultures from day 8 of the expansion phase invaded and migrated into human IL-13Rα2Fc in a concentration-dependent manner at 6 hours and 20 hours. Similarly, CAR-T cells invaded and migrated into conditioned medium from IL-13Rα2 positive glioma cells but not into conditioned medium from IL-13Rα2 negative glioma cells.

[0143] Example 6 Testing the in vivo efficacy of IL-13Rα2-CAR-T cells This example describes a method that can be used to test the efficacy of IL-13Rα2-CAR cells in vivo. Although specific methods are provided, those skilled in the art will recognize that methods that deviate from these specific methods can also be used, including adding or omitting one or more steps.

[0144] The efficacy of IL-13Rα2-CAR-T cells can be assessed using mouse solid tumor models, in which immunodeficient mice are implanted subcutaneously or orthotopically with human tumor cells derived from brain, pancreatic, prostate, or other tumors.

[0145] In one example, athymic nude mice are implanted with human brain tumor cells (U251 and U87MG gliomas). In another example, NOD / Shi-scid / IL-2Rγ null Tumor cells are implanted into NOG mice. NOG mice lack mature T cells, B cells and mononuclear cells due to their NOD (non-obese diabetic) background and SCID mutation. In addition to immune deficiency, interleukin-2 receptor gamma deficiency in NOG mice allows the engrafted human T cells to subsequently differentiate.

[0146] In one example, humanized PBMC-reconstituted NOG mice are used. NOG mice reconstituted with human PBMCs develop mature human immune cells in the peripheral blood and spleen (Brady et al. (2014) Clin Transl Immunology 19:3(12)). These mice are subcutaneously or orthotopically implanted with tumor cells such as U251 and U87 glioma tumor cells, or HS766, MiaPaca2, BXPC-3, Panc-1, HPAF-II, or ASPC-1 pancreatic tumor cells. The mice are then administered IL-13-Rα2-CAR-T cells. A dose titration study is used to determine the optimal cell dose for each tumor model. An additional group of NOG mice may be included that is injected with IL-13Rα2 gene knockout (KO) tumor cells to delineate the role of IL-13Rα2 as a tumor target.

[0147] The animals are followed for regression of established tumors, metastasis and survival of the control animals along with the CAR-T cell treated animals. The immune response of the animals is monitored by CD4 + and CD8 + The overall health of each animal is assessed at various time points by measuring body weight and through histological studies of vital organs at the time of sacrifice.

[0148] The efficacy of IL-13Rα2-CAR-T cell therapy is also evaluated in combination with various tumor pretreatments. Methods are similar, except that tumor-bearing animals are pretreated with HDAC inhibitors (e.g., trichostatin A (TSA), sodium butyrate (NaB), SP600125, SR11302, or suberoylanilide hydroxamic acid (SAHA)), adrenomedullin (AM), or IL-13-PE prior to CAR-T cell administration and compared to appropriate control treatments (e.g., animals not receiving CAR-T therapy, animals not receiving combination therapy, and / or animals with IL-13Rα2 knockdown tumor cells).

[0149] Example 7 Testing the in vivo efficacy of IL-13Rα2-CAR-T cells in combination with HDAC inhibitor treatment This example describes a method that can be used to test the efficacy of IL-13Rα2-CAR cells in combination with HDAC inhibitors in vivo. Although specific methods are provided, those skilled in the art will recognize that methods that deviate from these specific methods can also be used, including adding or omitting one or more steps.

[0150] The efficacy of IL-13Rα2-CAR-T cell therapy in combination with HDAC inhibitors can be evaluated in cancer models using subcutaneous and orthotopic tumor implants in immunodeficient mice. In this example, pancreatic cancer cell lines (such as Panc-1 or ASPC-1) are used to generate subcutaneous tumor implants in the flanks of female athymic nude or NOG mice. Approximately 4-6 days after tumor implantation, TSA or SAHA is administered. Approximately 5 days after the start of TSA or SAHA administration, IL13Rα2-CAR-T cells or a control are also administered.

[0151] Mice are monitored and the weight and tumor size are measured periodically. + , CD8 + The number of Treg cells and the cytokine profile in the blood will also be measured periodically. 2Continue until a 100% CI is reached. Animals are monitored during the entire course of the experiment for adverse toxic effects. An additional group of animals implanted with IL-13Rα2 knockdown tumor cells and treated with IL-13Rα2-CAR-T cell therapy can also be included as a control.

[0152] Example 8 Testing the in vivo efficacy of IL-13Rα2-CAR-T cell therapy in combination with adrenomedullin This example describes a method that can be used to test the efficacy of IL-13Rα2-CAR cells in combination with adrenomedullin treatment in vivo. Although specific methods are provided, those skilled in the art will recognize that methods that deviate from these specific methods can also be used, including adding or omitting one or more steps.

[0153] In one example, AM-transfected or mock-transfected PC-3 prostate cancer cells, or non-transfected controls, are injected subcutaneously into immunodeficient mice, such as male athymic nude mice. 2 Once this is reached (approximately one week), the mice will be administered CAR-T cells and then monitored for their response to treatment.

[0154] In another example, mice were injected with PC-3 tumor cells and tumors grew to approximately 20 mm 2 Once the tumor reaches a certain threshold, AM peptide (or control) is injected intratumorally at regular intervals. Approximately 48 hours after the last AM treatment, the sensitivity of PC-3 tumors to CAR-T cells is examined. Animals injected with PC-3 cells can be included as additional controls.

[0155] Mice will be followed over several weeks to assess the effectiveness of the CAR-T treatment, including tumor shrinkage, the animals' general health, CD4+, CD8+, T reg and blood cytokine levels.

[0156] Example 9 Testing the in vivo efficacy of IL-13Rα2-CAR-T cell therapy in combination with IL-13-PE This example describes a method that can be used to test the efficacy of IL-13Rα2-CAR cells in combination with IL-13PE treatment in vivo. Although specific methods are provided, one skilled in the art will recognize that methods can be used that deviate from these specific methods, including adding or omitting one or more steps.

[0157] In this example, mice are treated with TGFβRI and PTEN in the oral epithelium to develop spontaneous squamous cell carcinoma of the head and neck.Then, mice are treated with IL-13-PE.About one week later, mice are treated with IL-13Rα2-CAR-T cells.

[0158] Mice are examined for antitumor activity and immunological changes in response to treatment.Some animals are sacrificed about 3 days after the last dose of CAR-T cell therapy to perform FACS analysis on splenocytes.MDSCs are analyzed by FACS analysis using monocyte / macrophage marker CD11b+ and granulocyte antigen Gr-1+.

[0159] In view of the many possible embodiments to which the principles of this disclosure may be applied, it should be recognized that the illustrated embodiments are merely examples and should not be construed as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. 1. A single chain variable fragment (scFv) that specifically binds to interleukin-13 receptor alpha 2 (IL-13Rα2), the scFv comprising an amino acid sequence comprising variable heavy chain (VH) domain complementarity determining region 1 (CDR1), CDR2, and CDR3 amino acid sequences at amino acid positions 31-35, 50-66, and 99-107, respectively, of SEQ ID NO:1, and variable light chain (VL) domain complementarity determining region 1 (CDR1), CDR2, and CDR3 amino acid sequences at amino acid positions 157-167, 183-189, and 222-229, respectively, of SEQ ID NO:

1.

2. The scFv of claim 1, wherein the amino acid sequence has at least 90% identity with SEQ ID NO:

1.

3. The scFv of claim 1 , wherein the amino acid sequence comprises SEQ ID NO:

1.

4. The scFv of claim 1, wherein the scFv binds to a cell expressing IL-13Rα2.

5. A nucleic acid molecule encoding the scFv of claim 1.

6. The nucleic acid molecule of claim 5, comprising a nucleic acid sequence having at least 90% identity to SEQ ID NO:

2.

7. The nucleic acid molecule of claim 6 comprising SEQ ID NO:

2.

8. A vector comprising the nucleic acid sequence according to any one of claims 5 to 7.

9. A chimeric antigen receptor, (a) an antigen-binding domain comprising the scFv according to any one of claims 1 to 4; (b) a hinge domain; and (c) a transmembrane domain; and (d) an intracellular domain comprising one or more signaling domains; and A chimeric antigen receptor comprising:

10. The chimeric antigen receptor of claim 9, further comprising a signal peptide.

11. The chimeric antigen receptor of claim 10, wherein the signal peptide is a CD8α signal peptide.

12. 10. The chimeric antigen receptor of claim 9, wherein the one or more signaling domains comprise a CD28 domain, a 4-1BB domain, a CD3ζ domain, or any combination of two or more thereof.

13. The chimeric antigen receptor of claim 12, wherein the one or more signaling domains comprise a CD28 domain, a 4-1BB domain, and a CD3ζ domain.

14. The chimeric antigen receptor of claim 9, wherein the hinge domain comprises a CD8α hinge domain.

15. The chimeric antigen receptor of claim 9, wherein the transmembrane domain is a CD28 transmembrane domain.

16. 10. The chimeric antigen receptor of claim 9, comprising an amino acid sequence having at least 90% identity to SEQ ID NO:3 or amino acids 22 to 538 of SEQ ID NO:

3.

17. The chimeric antigen receptor of claim 9, comprising SEQ ID NO:3 or amino acids 22 to 538 of SEQ ID NO:

3.

18. A nucleic acid molecule encoding the chimeric antigen receptor of claim 9.

19. 19. The nucleic acid molecule of claim 18, comprising a nucleic acid sequence having at least 90% identity to SEQ ID NO:

4.

20. 20. The nucleic acid molecule of claim 19 comprising SEQ ID NO:

4.

21. A vector comprising the nucleic acid molecule of claim 18.

22. The vector of claim 21 , wherein the vector is a viral vector.

23. The vector of claim 22 , wherein the viral vector is a lentiviral vector.

24. An immune cell expressing the chimeric antigen receptor of claim 9.

25. 20. An immune cell comprising the nucleic acid of claim 18.

26. 25. The immune cell of claim 24, wherein the immune cell is obtained from a peripheral blood sample.

27. The immune cell of claim 24, wherein the immune cell is a T cell, a NK cell, a NKT cell or a macrophage.

28. 22. A method of producing IL-13Rα2-CAR cells, comprising transforming or transfecting a population of immune cells with the vector of claim 21.

29. 29. The method of claim 28, wherein the population of immune cells is a population of T cells, NK cells, NKT cells, or macrophages.

30. 30. The method of claim 29, wherein the T cells, NK cells, NKT cells, or macrophages are obtained from a peripheral blood sample of the subject.

31. 25. A composition for treating a subject with cancer, comprising the immune cell of claim 24.

32. 32. The composition of claim 31 , wherein the immune cells are autologous or allogeneic to the subject with cancer.

33. The composition of claim 31 , wherein the subject has a cancer that expresses IL-13Rα2.

34. 32. The composition of claim 31 , wherein the subject has a solid tumor.

35. 32. The composition of claim 31, wherein the subject has pancreatic cancer, glioblastoma, head and neck squamous cell carcinoma, ovarian cancer, renal cell carcinoma, uterine cancer, prostate cancer, breast cancer, melanoma, non-small cell lung cancer (NSCLC), Kaposi's sarcoma, or adrenal cancer.

36. 32. The composition of claim 31, administered to the subject in combination with one or more of surgery, radiation, chemotherapy, or additional immunotherapy.

37. The composition of claim 31, wherein the composition is administered to the subject in combination with a histone deacetylase (HDAC) inhibitor, a cell cycle or checkpoint inhibitor, adrenomedullin, an IL-13-PE immunotoxin, or any combination of two or more thereof.

Images