RNAi agents for inhibiting expression of receptor for advanced glycation end products, compositions thereof, and methods of use

Abstract

Described herein are RNAi agents, compositions comprising the RNAi agents, and methods for inhibiting the receptor for advanced glycation end products (AGER or RAGE) gene. The RAGE RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of the AGER gene. Also described are pharmaceutical compositions comprising one or more RAGE RNAi agents, optionally with one or more additional therapeutic agents. Delivery of the described RAGE RNAi agents to lung cells in vivo results in the inhibition of AGER gene expression and reduction of membrane-type RAGE activity, which can provide therapeutic benefits to a subject, e.g., a human subject, for the treatment of various diseases, including pulmonary inflammatory diseases such as severe asthma.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 172,301, filed April 8, 2021, and U.S. Provisional Patent Application No. 63 / 322,603, filed March 22, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy is named SEQLIST_30691.txt and is 223kb in size.

[0003] The present disclosure relates to RNA interference (RNAi) agents, e.g., double-stranded RNAi agents, compositions comprising RAGE RNAi agents, and methods of use thereof, for inhibiting receptor for advanced glycation end products ("RAGE" or "AGER") gene expression. [Background technology]

[0004] The receptor for advanced glycation end products ("RAGE" or "AGER") is a 35-kilodalton transmembrane protein of the immunoglobulin superfamily that functions as an inflammatory pattern recognition receptor. In its full-length, membrane-bound form, the receptor has three functional domains: an extracellular ligand-binding domain, a hydrophobic transmembrane domain, and a cytoplasmic domain that mediates ligand-dependent signaling. A second, non-membrane-bound, soluble form of the receptor (sRAGE) contains only the extracellular ligand-binding domain and is formed by proteolytic cleavage (or alternative splicing) of full-length, membrane-bound RAGE; sRAGE binds the ligand but lacks the cytoplasmic signaling domain, thereby antagonizing RAGE function.

[0005] RAGE is constitutively expressed at high levels in the lung and is primarily localized in type 1 alveolar epithelial cells. Other tissues in the body normally express RAGE at low levels, but expression is upregulated in the presence of RAGE ligands and chronic inflammation. As a pattern-recognition receptor, RAGE binds to a wide variety of endogenous ligands, including advanced glycation endproducts (glycosylated proteins or lipids), high-mobility group box 1 (HMGB1), and S100 proteins. Different intermediate signaling pathways can be activated by different RAGE ligands (e.g., ERK1 / 2, p38, and JAK / STAT), resulting in the production of reactive oxygen species, persistent activation of NF-κB, and transcription of proinflammatory genes (e.g., interleukins, interferons, and TNFα). Transcription of the gene encoding RAGE itself is promoted by NF-κB, creating a positive feedback loop that perpetuates chronic inflammation.

[0006] RAGE has been implicated in chronic pathological inflammation that contributes to many diseases, including pulmonary disease (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular disease (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, non-alcoholic steatohepatitis, damage caused by certain viral infections including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle wasting.

[0007] In the area of ​​pulmonary disease, RAGE knockout (KO) mice are completely protected physiologically and histologically from allergic asthma induced by challenge with house dust mite allergen or ovalbumin. Similarly, RAGE knockout mice are protected from hyperoxia- or lipopolysaccharide-induced acute lung injury and inflammation. (See, e.g., Oczypok et al., Paediatr Respir Rev., 23:40-49 (2017); Wang et al., Shock, 50:472-482 (2018)). Genome-wide association studies (GWAS) have linked a variant gain-of-function RAGE allele (G82S) to increased inflammation, decreased lung function, and asthma risk (see, e.g., Hancock et al., Nat Genet., 42:45-52 (2010); Repapi et al., Nat Genet., 42:36-44 (2010)).

[0008] Despite the attractive potential of RAGE as a drug target, developing potent and selective RAGE inhibitors has proven extremely challenging. The diverse RAGE ligands interact with multiple binding sites within an antibody-like extracellular domain rather than binding to separate domains (see, e.g., Rojas et al., Current Drug Targets, 20:340-346 (2019)). While specific RNAi agents capable of inhibiting RAGE expression in vitro have been previously identified and reported in various studies, or are otherwise commercially available, known RNAi agent constructs are neither sufficiently potent nor sufficiently specific to be viable therapeutic candidates. Therefore, there is a need for RAGE RNAi agents suitable for use as therapeutics in the treatment of RAGE-related diseases and disorders. Summary of the Invention

[0009] There is a continuing need for novel RNA interference (RNAi) agents (also referred to as RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents, that can selectively and efficiently inhibit expression of the RAGE (AGER) gene, including for use as therapeutics or pharmaceuticals. Additionally, there is a need for novel RAGE-specific RNAi agent compositions for treating diseases or disorders associated with pathological inflammation and / or disorders that can be mediated, at least in part, by reduced AGER gene expression and / or RAGE receptor levels.

[0010] The nucleotide sequences and chemical modifications of the RAGE RNAi agents disclosed herein, and the combination of the RAGE RNAi agents with certain specific targeting ligands suitable for selectively and efficiently delivering the RAGE RNAi agents in vivo, are distinct from those previously disclosed or known in the art. For example, as shown in various examples herein, the disclosed RAGE RNAi agents provide highly potent and efficient inhibition of expression of the AGER (RAGE) gene.

[0011] In general, the disclosure features RAGE gene-specific RNAi agents, compositions comprising RAGE RNAi agents, and methods for inhibiting expression of the AGER (RAGE) gene in vitro and / or in vivo using the RAGE RNAi agents and compositions comprising the RAGE RNAi agents described herein. The RAGE RNAi agents described herein can selectively and efficiently reduce or inhibit expression of the AGER gene, thereby reducing expression of the RAGE receptor and reducing activation of RAGE receptor signaling, including NF-κB, ultimately resulting in reduced inflammation.

[0012] The described RAGE RNAi agents can be used in methods for therapeutic treatment (including preventative or prophylactic treatment) of conditions and diseases including, but not limited to, various pulmonary diseases (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular diseases (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, non-alcoholic steatohepatitis, inflammatory damage caused by certain viral infections including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle wasting.

[0013] In one aspect, the disclosure features an RNAi agent for inhibiting expression of the RAGE (AGER) gene, the RNAi agent including a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand can be partially, substantially, or fully complementary to each other. The length of the sense strand of an RNAi agent described herein can each be 15 to 49 nucleotides in length. The length of the antisense strand of an RNAi agent described herein can each be 18 to 49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 18 to 26 nucleotides in length. The sense strand and the antisense strand can be either the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit expression of one or more AGER gene variants in vivo and / or in vitro when delivered to cells that express RAGE, such as lung cells (more specifically, including type 1 alveolar epithelial cells).

[0014] The RAGE RNAi agents disclosed herein target the human AGER gene (see, e.g., SEQ ID NO: 1). In some embodiments, the RAGE RNAi agents disclosed herein target a portion of the AGER gene having a sequence of any of the sequences disclosed in Table 1.

[0015] In another aspect, the disclosure features compositions, including pharmaceutical compositions, comprising one or more of the disclosed RAGE RNAi agents that can selectively and efficiently reduce expression of the AGER gene. Compositions comprising one or more of the RAGE RNAi agents described herein can be administered to a subject, e.g., a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of conditions and diseases associated with RAGE receptor activity.

[0016] Examples of RAGE RNAi agent sense and antisense strands that can be used in RAGE RNAi agents are provided in Table 3, Table 4, Table 5, and Table 6. Examples of RAGE RNAi agent duplexes are provided in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10. Examples of 19 nucleotide core stretch sequences that may consist of or be included in the sense and antisense strands of certain RAGE RNAi agents disclosed herein are provided in Table 2.

[0017] In another aspect, the disclosure features methods for in vivo delivery of a RAGE RNAi agent to lung epithelial cells in a subject, e.g., a mammal. Compositions for use in such methods are also described herein. In some embodiments, methods are disclosed herein for delivering a RAGE RNAi agent to lung cells in vivo in a subject, including epithelial cells, macrophages, smooth muscle cells, endothelial cells, and preferably type 1 alveolar epithelial cells. In some embodiments, the subject is a human subject.

[0018] The methods disclosed herein include administering one or more RAGE RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein that include one or more RAGE RNAi agents can be administered in several ways, depending on whether local or systemic treatment is desired. Administration can be, for example, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implantable device), and intraparenchymal. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (such as dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.

[0019] In some embodiments, the RAGE RNAi agents described herein are desired to inhibit expression of the AGER gene in the lung epithelium, and therefore administration is by inhalation (e.g., by an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).

[0020] One or more RAGE RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. In some embodiments, the RAGE RNAi agent is delivered to a cell or tissue by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin alpha-v-beta-6 (αvβ6) is an epithelial-specific integrin known to be a receptor for ECM proteins and TGF-beta latency-associated peptide (LAP) and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly upregulated in injured lung epithelium. In some embodiments, the RAGE RNAi agents described herein are linked to an integrin targeting ligand with affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound having affinity for integrin αvβ6, which can be utilized as a ligand to facilitate targeting and delivery of an RNAi agent bound to a desired cell and / or tissue (i.e., a cell expressing integrin αvβ6). In some embodiments, multiple αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands are linked to a RAGE RNAi agent. In some embodiments, the RAGE RNAi agent-αvβ6 integrin targeting ligand conjugate is selectively internalized by lung epithelial cells via receptor-mediated endocytosis or by other means.

[0021] Examples of targeting groups useful for delivering RAGE RNAi agents, including αvβ6 integrin targeting ligands, are disclosed, for example, in WO 2018 / 085415 and WO 2019 / 089765, the contents of each of which are incorporated herein by reference in their entirety.

[0022] A targeting group can be linked to the 3' or 5' end of the sense strand or antisense strand of a RAGE RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked internally to a nucleotide on the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0023] In another aspect, the disclosure features a composition that includes one or more RAGE RNAi agents having a double-stranded structure disclosed in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10.

[0024] The use of RAGE RNAi agents provides a method for therapeutic (including prophylactic) treatment of diseases or disorders in which reducing RAGE receptor activity can provide a therapeutic benefit. The RAGE RNAi agents disclosed herein can be used to treat various respiratory diseases, such as pulmonary diseases (asthma, acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease, cystic fibrosis, pneumonia, lung cancer, bronchopulmonary dysplasia), cardiovascular diseases (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative diseases, rheumatoid arthritis, nonalcoholic steatohepatitis, damage caused by certain viral infections, including SARS-CoV-2, certain ocular inflammatory conditions, and skeletal muscle wasting. In some embodiments, the RAGE RNAi agents disclosed herein can be used to treat pulmonary inflammatory diseases or conditions. The RAGE RNAi agents can also be used, for example, to treat various ocular inflammatory diseases and disorders. Such methods of treatment involve the administration of a RAGE RNAi agent to a human or animal in which RAGE receptor levels or RAGE receptor activity are elevated or increased above a desirable level.

[0025] One aspect described herein is an RNAi agent for inhibiting expression of a receptor for advanced glycation end products gene, comprising: (i) an antisense strand comprising at least 17 contiguous nucleotides that differ from any one of the sequences provided in Table 3 by 0 or 1 nucleotide; and (ii) a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; and (iii) one or more targeting ligands; and is an RNAi agent comprising:

[0026] In another embodiment, there is provided an RNAi agent capable of inhibiting expression of the advanced glycation end products receptor gene, comprising: (i) an 18-49 nucleotide long antisense strand that is at least partially complementary to the receptor for advanced glycation end products gene (SEQ ID NO: 1); (ii) a sense strand that is at least partially complementary to the antisense strand; and (iii) a targeting ligand linked to the sense strand; and RNAi agents are described, including:

[0027] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7). In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7), wherein SEQ ID NO: 7 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0028] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As will be apparent to one of skill in the art, the inclusion of phosphorothioate linkages as shown in the modified nucleotide sequences disclosed herein replaces phosphodiester linkages typically present in oligonucleotides (see, e.g., Figures 11A-11J, which show all internucleoside linkages). In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0029] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3')cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0030] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8). In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8), wherein SEQ ID NO: 8 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0031] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu (SEQ ID NO: 4), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As will be apparent to one of skill in the art, the inclusion of a phosphorothioate linkage, as shown in the modified nucleotide sequences disclosed herein, replaces a phosphodiester linkage typically present in oligonucleotides (see, e.g., Figures 11A-11J, which show all internucleoside linkages). In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu (SEQ ID NO: 4), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.

[0032] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UGAUGUUUUGAGCACCUACUC (SEQ ID NO:9). In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')UGAUGUUUUGAGCACCUACUC (SEQ ID NO:9), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs by zero or one nucleobase from the nucleotide sequence (5'→3')UGAUGUUUUGAGCACCUACUC (SEQ ID NO:9), wherein SEQ ID NO:7 is located at positions 1 to 21 (5'→3') of the antisense strand.

[0033] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than one nucleotide from the nucleotide sequence (5'→3')usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. As will be apparent to one of skill in the art, the inclusion of a phosphorothioate linkage, as shown in the modified nucleotide sequences disclosed herein, is in lieu of a phosphodiester linkage typically present in oligonucleotides (see, e.g., Figures 11A-11J, which show all internucleoside linkages). In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0034] In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by no more than 1 nucleotide from the nucleotide sequence (5'→3')cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6), where a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, a RAGE RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising the nucleotide sequence (5'→3')cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6), wherein a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0035] In some embodiments, the RAGE RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7); UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8); or UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9); and an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of:

[0036] In some embodiments, the RAGE RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7); UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8); or UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9); wherein the RAGE RNAi agent comprises an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by zero or one nucleotide from one of:

[0037] In some embodiments, the RAGE RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7); UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8); or UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9); wherein the RAGE RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently attached to the 5' end, the targeting ligand comprising a compound having affinity for an integrin receptor; and the corresponding antisense strand sequence is located at positions 1-21 of the antisense strand.

[0038] In some embodiments, the RAGE RNAi agents disclosed herein comprise the following nucleotide sequence (5'→3') pair: UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7) and CGGAAUGGAAACUGAACACAA (SEQ ID NO: 19); UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8) and AGGCAAUGAACAGGAAUIGAA (SEQ ID NO: 21); or UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9) and GAGUAGGUGCUCAAAACAUCA (SEQ ID NO: 20); and an antisense strand and a sense strand that consist of, consist essentially of, or comprise a nucleotide sequence that differs by 0 or 1 nucleotide from one of:

[0039] In some embodiments, the RAGE RNAi agents disclosed herein comprise the following nucleotide sequence (5'→3') pair: UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7) and CGGAAUGGAAACUGAACACAA (SEQ ID NO: 19); UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8) and AGGCAAUGAACAGGAAUIGAA (SEQ ID NO: 21); or UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9) and GAGUAGGUGCUCAAAACAUCA (SEQ ID NO: 20); wherein all or substantially all of the nucleotides in both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted abasic residues at the 3' and 5' ends of the nucleotide sequences, and the sense strand also comprises a targeting ligand covalently attached to the 5' end, the targeting ligand comprising a compound having affinity for an integrin receptor.

[0040] In some embodiments, the RAGE RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2); cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3); usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5); cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6); usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu(SEQ ID NO:4); wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; and s represents a phosphorothioate linkage; the RAGE RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides in the sense strand are modified nucleotides.

[0041] In some embodiments, the RAGE RNAi agents disclosed herein have the following nucleotide sequence (5' to 3'): usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2); cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3); usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5); cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6); usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu(SEQ ID NO:4); and an antisense strand that consists of, consists essentially of, or comprises a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of:

[0042] In some embodiments, the RAGE RNAi agents disclosed herein comprise the following nucleotide sequence pair (5'→3'): usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2) and csggaauggAfAfAfcugaacacaa (SEQ ID NO: 13); cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3) and csggaauggAfAfAfcugaacacaa (SEQ ID NO: 13); usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5) and gsaguagGfuGfcUfcaaaacauca (SEQ ID NO: 14); cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6) and gsaguagGfuGfcUfcaaaacauca (SEQ ID NO: 14); and usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu (SEQ ID NO: 4) and asggcaaugAfAfCfaggaauigaa (SEQ ID NO: 15); wherein a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; Tri-SM6.1-αββ-(TA14) represents a tridentate αββ epithelial cell targeting ligand having the chemical structure shown in FIG. 1; and s represents a phosphorothioate linkage; the sense strand also comprises a targeting ligand having affinity for an integrin receptor, the targeting ligand optionally being linked to the 5' end of the sense strand.

[0043] In some embodiments, the RAGE RNAi agents disclosed herein comprise the following sequence pair (5'→3'): usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2) and Tri-SM6.1-αvβ6-(TA14)csggaauggAfAfAfcugaacacaas(invAb) (SEQ ID NO: No. 10); cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3) and Tri-SM6.1-αvβ6-(TA14)csggaauggAfAfAfcugaacacaas(invAb) (SEQ ID NO: 10); usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5) and Tri-SM6.1-αvβ6-(TA14)gsaguagGfuGfcUfcaaaacaucas(invAb) (SEQ ID NO: 11); cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6) and Tri-SM6.1-αvβ6-(TA14)gsaguagGfuGfcUfcaaaacaucas(invAb) (SEQ ID NO: 11); and usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu (SEQ ID NO: 4) and Tri-SM6.1-αvβ6-(TA14)asggcaaugAfAfCfaggaauigaas(invAb) (SEQ ID NO: 12); wherein a, c, g, i, and u represent 2'-O-methyladenosine, cytidine, guanosine, inosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; Tri-SM6.1-αvβ6-(TA14) represents a tridentate αvβ6 epithelial cell targeting ligand having the chemical structure shown in Figure 1; (invAb) represents an inverted abasic deoxyribonucleotide (see also Table 11), and s represents a phosphorothioate linkage.

[0044] In some embodiments, the RAGE RNAi agents disclosed herein comprise (5'→3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO: 55); UUCCAUUCCUGUUCAUUGC (SEQ ID NO: 69); and UGAUGUUUUGAGCACCUAC (SEQ ID NO: 65) and an antisense strand comprising a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of:

[0045] In some embodiments, the RAGE RNAi agents disclosed herein comprise (5'→3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO: 55); UUCCAUUCCUGUUCAUUGC (SEQ ID NO: 69); and UGAUGUUUUGAGCACCUAC (SEQ ID NO: 65) and an antisense strand comprising a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides.

[0046] In some embodiments, the RAGE RNAi agents disclosed herein comprise (5'→3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO: 55); UUCCAUUCCUGUUCAUUGC (SEQ ID NO: 69); and UGAUGUUUUGAGCACCUAC (SEQ ID NO: 65) and an antisense strand comprising a nucleobase sequence which differs by 0 or 1 nucleobase from a nucleotide sequence selected from the group consisting of: wherein all or substantially all of the nucleotides are modified nucleotides, and SEQ ID NO: 55, SEQ ID NO: 69, and SEQ ID NO: 65 are located at nucleotide positions 1 to 19 (5'→3') of the antisense strand, respectively.

[0047] In some embodiments, the RAGE RNAi agents disclosed herein comprise (5'→3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO: 55) and GAAUGGAAACUGAACACAA (SEQ ID NO: 298); UUCCAUUCCUGUUCAUUGC (SEQ ID NO: 69); and GCAAUGAACAGGAAUIGAA (SEQ ID NO: 316); or UGAUGUUUUGAGCACCUAC (SEQ ID NO: 65) and GUAGGUGCUCAAAACAUCA (SEQ ID NO: 308) The nucleotide sequence pair includes an antisense strand and a sense strand, each of which comprises a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence pair selected from the group consisting of:

[0048] In some embodiments, the RAGE RNAi agents disclosed herein comprise (5'→3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO: 55) and GAAUGGAAACUGAACACAA (SEQ ID NO: 298); UUCCAUUCCUGUUCAUUGC (SEQ ID NO: 69); and GCAAUGAACAGGAAUIGAA (SEQ ID NO: 316); or UGAUGUUUUGAGCACCUAC (SEQ ID NO: 65) and GUAGGUGCUCAAAACAUCA (SEQ ID NO: 308); and an antisense strand and a sense strand each comprising a nucleobase sequence that differs by 0 or 1 nucleobase from a nucleotide sequence pair selected from the group consisting of:

[0049] definition As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may or may not be independently modified.

[0050] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target gene in a sequence-specific manner. As used herein, an RNAi agent may act via the RNA interference mechanism (i.e., induce RNA interference via interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. Although RNAi agents, as that term is used herein, are believed to act primarily via the RNA interference mechanism, the RNAi agents of the present disclosure are not bound to or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (i.e., AGER mRNA). The RNAi agent can contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0051] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent described herein, compared to a second cell, group of cells, tissue, organ, or subject that has not been so treated.

[0052] As used herein, the terms "sequence" and "nucleotide sequence" mean the sequence or order of nucleic acid bases or nucleotides written as a sequence of letters using standard nomenclature.

[0053] As used herein, a "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified, including, but not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0054] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or target mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and form a duplex or double-helical structure with an oligonucleotide comprising the second nucleotide sequence under specific standard conditions. Those skilled in the art will be able to select the most appropriate set of conditions for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.

[0055] As used herein, "fully complementary" or "sufficiently complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0056] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0057] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.

[0058] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to matching nucleic acid bases or nucleotides between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of an AGER mRNA.

[0059] As used herein, the term "substantially identical" or "substantial identity" as applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase is present in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein.

[0060] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0061] As used herein, the phrase " introducing into cell " refers to RNAi agent, means that RNAi agent is functionally delivered to cell.The phrase "functional delivery" means that RNAi agent is delivered to cell in a manner that allows RNAi agent to have expected biological activity, for example, sequence-specific inhibition of gene expression.

[0062] Unless otherwise stated, symbols used herein [ka] The use of means that any group according to the scope of the invention described herein can be attached thereto.

[0063] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0064] As used herein, for each structure in which asymmetric centers exist and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, unless the structure is specifically identified as having a particular configuration, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.

[0065] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to particular materials or steps, and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0066] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art. Correspondingly, compounds described herein having labile protons or basic atoms should also be understood to represent salt forms of the corresponding compounds. The compounds described herein may be in the form of a free acid, a free base, or a salt. It should be understood that pharmaceutically acceptable salts of the compounds described herein are within the scope of the present invention.

[0067] As used herein, the terms "linked" or "conjugated," when referring to a connection between two compounds or molecules, mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "conjugated," as used herein, can refer to a connection between a first compound and a second compound with or without any intervening atoms or groups of atoms.

[0068] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." Unless context clearly indicates otherwise, the term "or" is used herein to mean, and is used interchangeably with, the term "and / or."

[0069] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0070] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]

[0071] [Figure 1] 1 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand referred to herein as Tri-SM6.1-αvβ6-(TA14).

[0072] [Figure 2] 1 depicts the chemical structure of the peptide αvβ6 epithelial cell targeting ligand, herein referred to as αvβ6-pep1.

[0073] [Figure 3A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292, shown as the free acid. [Figure 3B]1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292, shown as the free acid. [Figure 3C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292, shown as the free acid. [Figure 3D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292, shown as the free acid. [Figure 3E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292, shown as the free acid.

[0074] [Figure 4A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292 shown as the sodium salt. [Figure 4B] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292 shown as the sodium salt. [Figure 4C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292 shown as the sodium salt. [Figure 4D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292 shown as the sodium salt. [Figure 4E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC000292 shown as the sodium salt.

[0075] [Figure 5A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266, shown as the free acid. [Figure 5B] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266, shown as the free acid. [Figure 5C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266, shown as the free acid. [Figure 5D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266, shown as the free acid. [Figure 5E]1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266, shown as the free acid.

[0076] [Figure 6A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266 shown as the sodium salt. [Figure 6B] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266 shown as the sodium salt. [Figure 6C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266 shown as the sodium salt. [Figure 6D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266 shown as the sodium salt. [Figure 6E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001266 shown as the sodium salt.

[0077] [Figure 7A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267, shown as the free acid. [Figure 7B] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267, shown as the free acid. [Figure 7C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267, shown as the free acid. [Figure 7D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267, shown as the free acid. [Figure 7E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267, shown as the free acid.

[0078] [Figure 8A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267 shown as the sodium salt. [Figure 8B]1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267 shown as the sodium salt. [Figure 8C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267 shown as the sodium salt. [Figure 8D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267 shown as the sodium salt. [Figure 8E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001267 shown as the sodium salt.

[0079] [Figure 9A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the free acid. [Figure 9B] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the free acid. [Figure 9C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the free acid. [Figure 9D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the free acid. [Figure 9E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the free acid.

[0080] [Figure 10A] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the sodium salt. [Figure 10B] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the sodium salt. [Figure 10C] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the sodium salt. [Figure 10D] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the sodium salt. [Figure 10E] 1 depicts the chemical structure of RAGE RNAi agent conjugate AC001268 shown as the sodium salt.

[0081] [Figure 11A] Schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure AC000286 (see, e.g., Tables 8 and 10), with a tridentate αvβ6 epithelial cell targeting ligand linked to the 5' end of the sense strand. The following abbreviations are used in Figures 11A-11J: a, c, g, i, and u are 2'-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucleotides; o is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue (see, e.g., Table 11); cPrpu is a 5'-cyclopropylphosphonate-2'-O-methyluridine modified nucleotide (see, e.g., Table 11); Tri-SM6.1-αββ-(TA14) is a tridentate αββ epithelial cell targeting ligand having the structure shown in Figure 1; and (TriAlk14) is a linking group shown in Table 11 suitable for subsequent coupling to a targeting ligand (see also Example 1 herein).

[0082] [Figure 11B] Schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC000292 (see, e.g., Tables 8 and 10), with a tridentate αvβ6 epithelial cell targeting ligand linked to the 5' end of the sense strand.

[0083] [Figure 11C] Schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC001266 (see, e.g., Tables 8 and 10), with a tridentate αvβ6 epithelial cell targeting ligand linked to the 5' end of the sense strand.

[0084] [Figure 11D]Schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC001267 (see, e.g., Tables 8 and 10), with a tridentate αvβ6 epithelial cell targeting ligand linked to the 5' end of the sense strand.

[0085] [Figure 11E] Schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC001268 (see, e.g., Tables 8 and 10), with a tridentate αvβ6 epithelial cell targeting ligand linked to the 5' end of the sense strand.

[0086] [Figure 11F] FIG. 1 is a schematic diagram of modified sense and antisense strands of a RAGE RNAi agent duplex having the structure of AD07474 (see, eg, Tables 8 and 10), with a (TriAlk14) linker at the 5′ end of the sense strand.

[0087] [Figure 11G] FIG. 1 is a schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC000286 (see, eg, Tables 8 and 10), with a (TriAlk14) linker at the 5′ end of the sense strand.

[0088] [Figure 11H] FIG. 1 is a schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC000286 (see, eg, Tables 8 and 10), with a (TriAlk14) linker at the 5′ end of the sense strand.

[0089] [Figure 11I] FIG. 1 is a schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC000286 (see, eg, Tables 8 and 10), with a (TriAlk14) linker at the 5′ end of the sense strand.

[0090] [Figure 11J] FIG. 1 is a schematic diagram of modified sense and antisense strands of a RAGE RNAi agent conjugate having the structure of AC000286 (see, eg, Tables 8 and 10), with a (TriAlk14) linker at the 5′ end of the sense strand. DETAILED DESCRIPTION OF THE INVENTION

[0091] RNAi agents Described herein are RNAi agents (herein referred to as RAGE RNAi agents or RAGE RNAi triggers) for inhibiting expression of the AGER (or RAGE) gene. Each RAGE RNAi agent disclosed herein comprises a sense strand and an antisense strand. The length of the sense strand of the RNAi agent described herein can each be 15-49 nucleotides in length. The length of the antisense strand of the RNAi agent described herein can each be 18-49 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 18-26 nucleotides in length. The sense strand and the antisense strand can be either the same length or different lengths. In some embodiments, the sense strand and the antisense strand are independently 21-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are independently 21-24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0092] Examples of nucleotide sequences used to form RAGE RNAi agents are provided in Table 2, Table 3, Table 4, Table 5, Table 6, and Table 10. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences of Tables 2, 3, 4, 5, 6 are shown in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10.

[0093] In some embodiments, the region of fully, substantially, or partially complementary between the sense and antisense strands is 15 to 26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not fully, substantially, or partially complementary).

[0094] The sense strand of a RAGE RNAi agent described herein comprises at least 15 contiguous nucleotides having at least 85% identity to a core stretch sequence of the same number of nucleotides in the AGER mRNA (also referred to herein as a "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand; thus, the sense strand core stretch sequence is typically fully identical or at least about 85% identical to a nucleotide sequence of the same length present in the AGER mRNA target (e.g., sometimes referred to as a target sequence). In some embodiments, the sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length.

[0095] The antisense strand of a RAGE RNAi agent described herein comprises at least 15 contiguous nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the AGER mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the AGER mRNA target (e.g., target sequence). In some embodiments, the antisense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the antisense strand core stretch is 19 nucleotides in length. In some embodiments, the antisense strand core stretch is 17 nucleotides in length. The sense strand core stretch sequence can be the same length as the corresponding antisense core sequence, or can be a different length.

[0096] The sense and antisense strands of a RAGE RNAi agent anneal to form a duplex. The sense and antisense strands of a RAGE RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of the RAGE RNAi agent have a region of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).

[0097] In some embodiments, the antisense strand of a RAGE RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a RAGE RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0098] In some embodiments, the sense strand and / or the antisense strand can optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, the 5' end, or both the 3' and 5' ends of the core stretch sequence. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence in the AGER mRNA. The additional nucleotides of the sense strand, if present, may or may not be identical to the corresponding sequence in the AGER mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding additional nucleotides (if present) of the sense strand.

[0099] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extension nucleotides on the sense strand may or may not be complementary to the nucleotides (either the core stretch sequence nucleotides or the extension nucleotides) in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to the nucleotides (either the core stretch nucleotides or the extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent comprise a 3' extension and a 5' extension. In some embodiments, one or more of the 3' extension nucleotides of one strand are base-paired with one or more of the 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand are not base-paired with one or more of the 5' extension nucleotides of the other strand. In some embodiments, a RAGE RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extension nucleotides are unpaired and form an overhang. As used herein, "overhang" refers to a stretch of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand that does not form part of the hybridized or double-stranded portion of an RNAi agent disclosed herein.

[0100] In some embodiments, the RAGE RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the RAGE RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is complementary to the corresponding AGER mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is not complementary to the corresponding AGER mRNA sequence.

[0101] In some embodiments, the RAGE RNAi agent comprises a sense strand having a 3' extension that is 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the AGER mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').

[0102] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, a RAGE RNAi agent comprises a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises a nucleotide that corresponds to or is identical to a nucleotide in the AGER mRNA sequence.

[0103] Examples of sequences for use in forming RAGE RNAi agents are provided in Table 2, Table 3, Table 4, Table 5, Table 6, and Table 10. In some embodiments, the RAGE RNAi agent antisense strand comprises any of the sequences in Table 2, Table 3, or Table 10. In particular embodiments, the RAGE RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the RAGE RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2 or Table 3. In some embodiments, the RAGE RNAi agent sense strand comprises any of the sequences in Table 2, Table 4, Table 5, or Table 6. In some embodiments, the RAGE RNAi agent sense strand comprises the sequence of nucleotides (5' end to 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Table 2, Table 4, Table 5, or Table 6. In certain embodiments, the RAGE RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4, Table 5, Table 6, or Table 10.

[0104] In some embodiments, the sense strand and antisense strand of an RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense strand and antisense strand of an RNAi agent described herein contain a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0105] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand and form either a 3' overhang or a 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0106] The RAGE RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides in the sense strand of the RAGE RNAi agent and substantially all of the nucleotides in the antisense strand of the RAGE RNAi agent are modified nucleotides. The RAGE RNAi agents disclosed herein may further comprise one or more modified internucleoside linkages, such as one or more phosphorothioate linkages. In some embodiments, the RAGE RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleoside linkages.

[0107] In some embodiments, the RAGE RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the RAGE RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the RAGE RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms, as are known in the art, are within the scope of the invention disclosed herein.

[0108] Modified Nucleotides Modified nucleotides, when used in various oligonucleotide constructs, can maintain the activity of compounds in cells while increasing the serum stability of these compounds and can also minimize the potential for interferon activation in humans following administration of the oligonucleotide construct.

[0109] In some embodiments, a RAGE RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein and in the art as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need be uniformly modified. Conversely, two or more modifications may be incorporated into a single RAGE RNAi agent, or even into a single nucleotide thereof. RAGE RNAi agent sense and antisense strands can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.

[0110] Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thio Included are synthetic and natural nucleobases such as cytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0111] In some embodiments, the 5' and / or 3' end of the antisense strand can include an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203.) In some embodiments, the abasic residue can be positioned internally in the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0112] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (unmodified) in both the sense strand and the antisense strand. As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand that has two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand that has two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are listed in Table 11 herein.

[0113] Modified internucleoside linkages In some embodiments, one or more nucleotides of a RAGE RNAi agent are linked by a non-canonical bond or backbone (ie, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with reverse polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0114] In some embodiments, the sense strand of a RAGE RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a RAGE RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a RAGE RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a RAGE RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0115] In some embodiments, the RAGE RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends and the optional inverted abasic residue end cap. In some embodiments, a targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0116] In some embodiments, the RAGE RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the RAGE RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0117] Capping residues or moieties In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of a nucleotide sequence of an RNAi agent disclosed herein. Capping residues can, in some cases, provide an RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues and carbon chains, such as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25(dodecyl) group. In some embodiments, the capping residue is present at either the 5'-end, the 3'-end, or both the 5'- and 3'-ends of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may contain two or more inverted abasic deoxyribose moieties as capping residues.

[0118] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, inclusion of one or more inverted abasic residues or inverted abasic sites at or near one or more ends of the sense strand of the RNAi agent allows for enhanced activity or other desired properties of the RNAi agent.

[0119] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues can be linked via phosphate, phosphorothioate (e.g., referred to herein as (invAb)s), or other internucleoside linkages. In some embodiments, including one or more inverted abasic residues at or near one or more ends of the sense strand of the RNAi agent can enhance the activity or other desired properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence can include an inverted abasic residue. The chemical structure of an inverted abasic deoxyribose residue is shown in Table 11 below.

[0120] RAGE RNAi agents The RAGE RNAi agents disclosed herein are designed to target specific positions on the AGER (RAGE) gene (e.g., SEQ ID NO: 1 (NM_001136.5)). As defined herein, an antisense strand sequence is designed to target the AGER gene at a given position on the gene, such that, when base-paired to the gene, the 5'-terminal nucleobase of the antisense strand is aligned with a position 21 nucleotides downstream (toward the 3' end) from that position on the gene. For example, as exemplified in Tables 1 and 2 herein, an antisense strand sequence designed to target the AGER gene at position 177 requires that, when base-paired to the gene, the 5'-terminal nucleobase of the antisense strand is aligned with position 197 of the AGER gene.

[0121] As provided herein, a RAGE RNAi agent does not require that the nucleobase at position 1 (5' to 3') of the antisense strand be complementary to a gene, so long as there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for a RAGE RNAi agent disclosed herein designed to target position 177 of the AGER gene, the 5'-terminal nucleobase of the antisense strand of the RAGE RNAi agent should be aligned with position 197 of the gene. However, the 5'-terminal nucleobase of the antisense strand can, but need not, be complementary to position 197 of the AGER gene, so long as there is at least 85% complementarity between the antisense strand and the gene (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) over a core stretch sequence of at least 16 contiguous nucleotides. Notably, as demonstrated by the various examples disclosed herein, the specific binding site of the gene by the antisense strand of a RAGE RNAi agent (e.g., whether the RAGE RNAi agent is designed to target the AGER gene at position 177, 90, 330, or some other position) is an important factor for the level of inhibition achieved by the RAGE RNAi agent. (See, for example, Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0122] In some embodiments, a RAGE RNAi agent disclosed herein targets the AGER gene at or near the location of an AGER sequence shown in Table 1. In some embodiments, the antisense strand of a RAGE RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target RAGE 19-mer sequence disclosed in Table 1. [Table 1]

[0123] Homo sapiens advanced glycation end-products-specific receptor (AGER), transcript variant 1, GenBank NM_001136.5 (SEQ ID NO: 1), gene transcript (1420 bases): 1 agacagagcc aggaccctgg aaggaagcag gatggctgcc ggaacagcag ttggagcctg 61 ggtgctggtc ctcagtctgt ggggggcagt agtaggtgct caaaacatca cagcccggat 121 tggcgagcca ctggtgctga agtgtaaggg ggcccccaag aaaccacccc agcggctgga 181 atggaaactg aacacaggcc ggacagaagc ttggaaggtc ctgtctcccc agggaggagg 241 cccctgggac agtgtggctc gtgtccttcc caacggctcc ctcttccttc cggctgtcgg 301 gatccaggat gaggggattt tccggtgcca ggcaatgaac aggaatggaa aggagaccaa 361 gtccaactac cgagtccgtg tctacgat tcctgggaag ccagaaattg tagattctgc 421 ctctgaactc acggctggtg ttcccaataa ggtggggaca tgtgtgtcag agggaagcta 481 ccctgcaggg actcttagct ggcacttgga tgggaagccc ctggtgccta atgagaaggg 541 agtatctgtg aaggaacaga ccaggagaca ccctgagaca gggctcttca cactgcagtc 601 ggagctaatg gtgaccccag cccggggagg agatccccgt cccaccttct cctgtagctt 661 cagcccaggc cttccccgac accgggcctt gcgcacagcc cccatccagc cccgtgtctg 721 ggagcctgtg cctctggagg aggtccaatt ggtggtggag ccagaaggtg gagcagtagc 781 tcctggtgga accgtaaccc tgacctgtga agtccctgcc cagccctctc ctcaaatcca 841 ctggatgaag gatggtgtgc ccttgcccct tccccccagc cctgtgctga tcctccctga 901 gatagggcct caggaccagg gaacctacag ctgtgtggcc acccattcca gccacgggcc 961 ccaggaaagc cgtgctgtca gcatcagcat catcgaacca ggcgaggagg ggccaactgc 1021 aggctctgtg ggaggatcag ggctgggaac tctagccctg gccctgggga tcctgggagg 1081 cctggggaca gccgccctgc tcattggggt catcttgtgg caaaggcggc aacgccgagg 1141 agaggagagg aaggccccag aaaaccagga ggaagaggag gagcgtgcag aactgaatca 1201 gtcggaggaa cctgaggcag gcgagagtag tactggaggg ccttgagggg cccacagaca 1261 gatcccatcc atcagctccc ttttcttttt cccttgaact gttctggcct cagaccaact 1321 ctctcctgta taatctctct cctgtataac cccaccttgc caagctttct tctacaacca 1381 gagccccccca caatgatgat taaacacctg acacatcttg

[0124] In some embodiments, a RAGE RNAi agent comprises an antisense strand, and position 19 (5'→3') of the antisense strand is capable of base pairing with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a RAGE RNAi agent comprises an antisense strand, and position 1 (5'→3') of the antisense strand is capable of base pairing with position 19 of a 19-mer target sequence disclosed in Table 1.

[0125] In some embodiments, a RAGE RNAi agent comprises an antisense strand, wherein position 2 (5'→3') of the antisense strand is capable of base pairing with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a RAGE RNAi agent comprises an antisense strand, wherein positions 2 through 18 (5'→3') of the antisense strand are capable of base pairing with each of the respective complementary bases located at positions 18 through 2 of a 19-mer target sequence disclosed in Table 1.

[0126] In the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the AGER gene or can be non-complementary to the AGER gene. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0127] In some embodiments, the RAGE RNAi agent antisense strand comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the RAGE RNAi sense strand comprises the sequence of nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0128] In some embodiments, the RAGE RNAi agent is composed of (i) an antisense strand comprising the sequence of nucleotides 2 to 18 or 2 to 19 (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (i) a sense strand comprising the sequence of nucleotides 1 to 17 or 1 to 18 (5' end to 3' end) of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.

[0129] In some embodiments, the RAGE RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11]

[0130] The RAGE RNAi agent sense and antisense strands comprising or consisting of the nucleotide sequences of Table 2 may be modified or unmodified nucleotides. In some embodiments, a RAGE RNAi agent having sense and antisense strand sequences comprising or consisting of any of the nucleotide sequences of Table 2 is all or substantially all modified nucleotides.

[0131] In some embodiments, the antisense strand of a RAGE RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a RAGE RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0132] In some embodiments, the antisense strand of a disclosed RAGE RNAi agent comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a RAGE RNAi agent disclosed herein comprises at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0133] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any nucleobase (including nucleobases found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase than the N nucleotide at the corresponding position on the other strand.

[0134] Particular modified RAGE RNAi agent sense and antisense strands are provided in Table 3, Table 4, Table 5, Table 6 and Table 10. Particular modified RAGE RNAi agent antisense strands, and their underlying unmodified nucleobase sequences, are provided in Table 3. Particular modified RAGE RNAi agent sense strands, and their underlying unmodified nucleobase sequences, are provided in Table 4, Table 5 and Table 6. In forming a RAGE RNAi agent, each of the nucleotides in each of the underlying base sequences listed in Table 3, Table 4, Table 5 and Table 6, and Table 2 above, may be a modified nucleotide.

[0135] The RAGE RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, so long as the two sequences, sense and antisense, have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0136] In some embodiments, the RAGE RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0137] In some embodiments, the RAGE RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, or Table 10.

[0138] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5, and 6.

[0139] As used in Tables 3, 4, 5, 6 and 10, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate A UNA = 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA = 2',3'-seco-cytidine-3'-phosphate C UNAs = 2',3'-seco-cytidine-3'-phosphorothioate G UNA = 2',3'-seco-guanosine-3'-phosphate G UNA s = 2',3'-seco-guanosine-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N = See Table 11 a_2Ns = See Table 11 (invAb) = inverted abasic deoxyribonucleotide-5'- Phosphates, see Table 11 (invAb)s = inverted abasic deoxyribonucleotide-5'- Phosphorothioates, see Table 11 s = phosphorothioate linkage p = terminal phosphate (as synthesized) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 11) CPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11) CPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 11) (Alk-SS-C6) = See Table 11 (C6-SS-Alk) = See Table 11 (C6-SS-C6) = See Table 11 (6-SS-6) = See Table 11 (C6-SS-Alk-Me) = See Table 11 (NH2-C6) = See Table 11 (TriAlk14) = See Table 11 (TriAlk14)s = See Table 11 -C6- = See Table 11 -C6s- = See Table 11 -L6-C6- = See Table 11 -L6-C6s- = See Table 11 -Alk-cyHex- = See Table 11 -Alk-cyHexs- = See Table 11 (TA14) = see Table 11 (structure of (TriAlk14)s after conjugation) (TA14)s = see Table 11 (structure of (TriAlk14)s after conjugation)

[0140] As those skilled in the art will readily understand, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), nucleotide monomers, when present in an oligonucleotide, are linked to one another by a 5'-3'-phosphodiester bond. As those skilled in the art will clearly understand, the inclusion of a phosphorothioate linkage, as shown in the modified nucleotide sequences disclosed herein, replaces the phosphodiester linkage typically present in oligonucleotides. Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group instead of a phosphate moiety at the 3' position of each given monomer ex vivo. Additionally, for the embodiments disclosed herein, when viewing each strand from 5' to 3', an inverted abasic residue is inserted such that the 3' position of the deoxyribose is linked to the 3' end of the preceding monomer on each strand (see, e.g., Table 11). Furthermore, as one of ordinary skill in the art will readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., when the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless otherwise expressly indicated herein, this understanding of one of ordinary skill in the art will be used when describing the RAGE RNAi agents and compositions of RAGE RNAi agents disclosed herein.

[0141] Specific examples of targeting groups and linking groups for use in the RAGE RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense and / or antisense strand may have any of the targeting or linking groups listed herein, as well as other targeting or linking groups, conjugated to the 5' and / or 3' ends of the sequence. [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] (A 2N ) = 2-aminoadenine-containing nucleotide; I = hypoxanthine (inosine) nucleotide [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] (A 2N ) = 2-aminoadenine-containing nucleotide; I = hypoxanthine (inosine) nucleotide [Table 6-1] [Table 6-2]

[0142] The RAGE RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, so long as the two sequences, sense and antisense, have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0143] As shown in Table 5 above, certain exemplary RAGE RNAi agent nucleotide sequences are shown to further comprise a reactive linking group at one or both of the 5' and 3' ends of the sense strand. For example, many of the RAGE RNAi agent sense strand sequences shown in Table 5 above have a (TriAlk14) linking group at the 5' end of the nucleotide sequence. Other linking groups, such as an (NH2-C6) linking group or a (6-SS-6) or (C6-SS-C6) linking group, may also or instead be present in certain embodiments. Such reactive linking groups are positioned to facilitate the attachment of targeting ligands, targeting groups, and / or PK / PD modulators to the RAGE RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and result in the formation of a covalent bond between two molecules or reactants. Conjugation reactions suitable for use within the scope of the invention herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, reverse demand Diels-Alder cycloaddition reactions, oxime ligation, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0144] In some embodiments, targeting ligands, such as the integrin targeting ligands shown in the Examples and Figures disclosed herein, can be synthesized as activated esters, e.g., tetrafluorophenyl (TFP) esters, which can be substituted with a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to a RAGE RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl (e.g., TriAlk14) or DBCO group, for example, via copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition.

[0145] In addition, certain nucleotide sequences can be synthesized with a dT nucleotide at the 3'-end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate linking to additional components, such as a PK / PD modulator or one or more targeting ligands. As described herein, the C6-SS-C6 disulfide bond is first reduced to remove the dT from the molecule, which can then facilitate conjugation of the desired PK / PD modulator. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.

[0146] In some embodiments, the antisense strand of a RAGE RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 10. In some embodiments, the sense strand of a RAGE RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4, Table 5, Table 6, or Table 10.

[0147] In some embodiments, the RAGE RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the RAGE RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In certain embodiments, the RAGE RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0148] In some embodiments, the sense strand of a RAGE RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the antisense strand of a RAGE RNAi agent comprises the sequence of nucleotides (5' to 3') 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10. In certain embodiments, the RAGE RNAi agent sense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0149] In the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the AGER gene or can be non-complementary to the AGER gene. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT (or a modified version of U, A, or dT). In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0150] In some embodiments, the RAGE RNAi agent antisense strand comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2, Table 3, or Table 10. In some embodiments, the sense strand of the RAGE RNAi comprises the sequence of nucleotides 1-17 or 1-18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0151] In some embodiments, the RAGE RNAi agent comprises (i) an antisense strand comprising the sequence of nucleotides 2 to 18 or 2 to 19 (5' to 3') of any of the antisense strand sequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising the sequence of nucleotides 1 to 17 or 1 to 18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0152] A sense strand comprising a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand comprising a sequence listed in Table 2 or Table 3, so long as the two sequences, sense and antisense, have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, a RAGE RNAi agent has a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 10. Certain representative sequence pairs are exemplified by the duplex ID numbers shown in Tables 7A, 7B, 8, 9A, and 9B.

[0153] In some embodiments, a RAGE RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, a RAGE RNAi agent consists of any of the duplex ID numbers presented herein. In some embodiments, a RAGE RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, a RAGE RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers presented herein, and targeting groups, linking groups, and / or other non-nucleotide groups, which are covalently attached (i.e., conjugated) to the sense or antisense strand. In some embodiments, a RAGE RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, the RAGE RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein, and a targeting group, linking group, and / or other non-nucleotide group, which are covalently attached to the sense strand or the antisense strand.

[0154] In some embodiments, a RAGE RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 7A, Table 7B, Table 8, Table 9A, Table 9B, or Table 10, and comprises a targeting group. In some embodiments, a RAGE RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 7A, Table 7B, Table 8, Table 9A, Table 9B, or Table 10, and comprises one or more αvβ6 integrin targeting ligands.

[0155] In some embodiments, a RAGE RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 7A, Table 7B, Table 8, Table 9A, Table 9B, or Table 10, and comprises a targeting group that is an integrin targeting ligand. In some embodiments, a RAGE RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, Table 7A, Table 7B, Table 8, Table 9A, Table 9B, or Table 10, and comprises one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligands).

[0156] In some embodiments, a RAGE RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10.

[0157] In some embodiments, the RAGE RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10, and comprises an integrin targeting ligand.

[0158] In some embodiments, the RAGE RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10.

[0159] [Table 7A-1] [Table 7A-2] [Table 7A-3]

[0160]

Table 7B-1

Table 7B-2

Table 7B-3

[0161]

Table 8-1

Table 8-2

[0162]

Table 9A-1

Table 9A-2

[0163]

Table 9B-1

Table 9B-2

[0164]

Table 10-1

Table 10-2

[0165] In some embodiments, the RAGE RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the RAGE RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the RAGE RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. The RNAi agents described herein inhibit or knockdown expression of one or more AGER genes in vivo and / or in vitro when delivered to cells expressing the AGER gene.

[0166] Targeting Groups, Linking Groups, Pharmacokinetic / Pharmacodynamic (PK / PD) Modulators, and Delivery Vehicles In some embodiments, the RAGE RNAi agent contains or is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or binding of the RNAi agent. The non-nucleotide group can be covalently attached to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the RAGE RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the RAGE RNAi agent sense strand. The non-nucleotide group can be linked to the RNAi agent directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0167] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving tissue-specific distribution and cell-specific uptake of the conjugate, hi some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0168] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or can have a higher valency relative to the target to which they are directed. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can function as the linker in some instances.

[0169] A targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense strands and / or antisense strands disclosed in Table 2, Table 3, Table 4, Table 5, Table 6, and Table 10. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense strands and / or antisense strands disclosed in Table 2, Table 3, Table 4, Table 5, Table 6, and Table 10.

[0170] The RAGE RNAi agents described herein may be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods typical in the art.

[0171] For example, in some embodiments, a RAGE RNAi agent disclosed herein is synthesized with an NH2-C6 group at the 5'-end of the sense strand of the RNAi agent. The terminal amino group can then be reacted to form a conjugate with a group comprising, for example, an αvβ6 integrin targeting ligand. In some embodiments, a RAGE RNAi agent disclosed herein is synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent. The terminal alkyne groups can then be reacted to form a conjugate with a group comprising, for example, an αvβ6 integrin targeting ligand.

[0172] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells having αvβ6 on their respective surfaces, and binding of the integrin targeting ligand can facilitate entry of a therapeutic agent, such as an RNAi agent, to which it is linked into cells, e.g., epithelial cells such as lung epithelial cells and renal epithelial cells. The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety), or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. Preparation of targeting groups such as αvβ6 integrin targeting ligands is described, for example, in WO 2018 / 085415 and WO 2019 / 089765, the contents of each of which are incorporated herein in their entirety.

[0173] In some embodiments, the targeting group is linked to the RAGE RNAi agent without the use of an additional linker. In some embodiments, the targeting group is designed to easily have a linker present to facilitate linking to the RAGE RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents can be linked to their respective targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents are linked to their respective targeting groups using different linkers.

[0174] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be attached to the 3' and / or 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and / or PEG groups. Examples of specific linking groups are provided in Table 11.

[0175] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, a pharmacokinetic modulator, or a delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage includes a labile bond. A linkage can optionally include a spacer that increases the distance between the two linked atoms. The spacer may further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the preceding list is not meant to limit the scope of the description. In some embodiments, a RAGE RNAi agent is conjugated to a polyethylene glycol (PEG) moiety or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.

[0176] In some embodiments, a RAGE RNAi agent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulators. PK / PD modulators can extend the circulation time of the conjugated drug and / or increase the activity of the RNAi agent through improved cell receptor binding, improved cellular uptake, and / or other means. A variety of PK / PD modulators suitable for use with RNAi agents are known in the art. In some embodiments, the PK / PD modulator can be a cholesterol or cholesteryl derivative, or in some circumstances, the PK / PD modulator can be comprised of an alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, or aralkynyl group, each of which can be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, the attachment position of these moieties is at the 5' or 3' end of the sense strand, the 2' position of the ribose ring of any given nucleotide of the sense strand, and / or attached to a phosphate or phosphorothioate backbone at any position of the sense strand.

[0177] Any of the RAGE RNAi agent nucleotide sequences listed in Table 2, Table 3, Table 4, Table 5, Table 6, and Table 10, whether modified or not, can include a 3' and / or 5' targeting group, linking group, and / or PK / PD modulator. Any of the RAGE RNAi agent sequences listed in Table 3, Table 4, Table 5, Table 6, and Table 10, or otherwise described herein, that contain a 3' or 5' targeting group, linking group, and / or PK / PD modulator may alternatively not contain a 3' or 5' targeting group, linking group, or PK / PD modulator, or may contain a different 3' or 5' targeting group, linking group, or pharmacokinetic modulator, including, but not limited to, those depicted in Table 11. Any of the RAGE RNAi agent duplexes listed in Tables 7A, 7B, 8, 9A, 9B, and 10, whether modified or not, can further comprise a targeting group or linking group, including but not limited to those depicted in Table 11, which can be attached to the 3' or 5' end of either the sense or antisense strand of the RAGE RNAi agent duplex.

[0178] Examples of specific modified nucleotides, capping moieties, and linking groups are provided in Table 11. [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4] [Table 11-5] [Table 11-6] [Table 11-7] [Table 11-8] [Table 11-9] [Table 11-10] [Table 11-11] [Table 11-12] [Table 11-13] [Table 11-14] [Table 11-15]

[0179] Alternatively, other linking groups known in the art can be used. In many cases, linking groups are commercially available or incorporated into commercially available nucleotide phosphoramidites. (See, for example, International Publication No. 2019 / 161213, the entirety of which is incorporated herein by reference).

[0180] In some embodiments, RAGE RNAi agents are delivered without being conjugated to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as "naked" or "naked RNAi agents").

[0181] In some embodiments, the RAGE RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the RAGE RNAi agent to selected cells or tissues in vivo, for example, to epithelial cells. In some embodiments, the RAGE RNAi agent is conjugated to a targeting group comprising an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. In some embodiments, the targeting group comprises one or more αvβ6 integrin targeting ligands.

[0182] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of an RNAi agent to a cell or tissue. The delivery vehicle can include or consist of, but is not limited to, a polymer, such as an amphiphilic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine.

[0183] In some embodiments, the RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesteryl and cholesteryl derivatives), encapsulated in nanoparticles, liposomes, micelles, conjugated to polymers or DPCs (see, e.g., WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors. In some embodiments, the RNAi agent can be conjugated to an antibody with affinity for lung epithelial cells. In some embodiments, the RNAi agent can be linked to a targeting ligand that has affinity for pulmonary epithelial cells or receptors present on pulmonary epithelial cells.

[0184] Pharmaceutical Compositions and Formulations The RAGE RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medications"). In some embodiments, the pharmaceutical compositions comprise at least one RAGE RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting AGER mRNA expression in a target cell, cell population, tissue, or organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from a reduction in the level of a target mRNA or an inhibition of expression of a target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from a reduction in the level of a target mRNA or an inhibition of expression of a target gene. In one embodiment, the method comprises administering to the subject to be treated a RAGE RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising a RAGE RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, e.g., a human.

[0185] Pharmaceutical compositions comprising a RAGE RNAi agent and methods disclosed herein reduce the level of target mRNA in a cell, a group of cells, a tissue, an organ, or a subject, for example, by administering a therapeutically effective amount of a RAGE RNAi agent described herein to a subject, thereby inhibiting expression of AGER mRNA in the subject. In some embodiments, the subject has previously been identified or diagnosed with a disease or disorder that may be mediated, at least in part, by reduced RAGE expression. In some embodiments, the subject has previously been diagnosed with one or more pulmonary diseases, such as asthma (including severe asthma), acute respiratory distress syndrome, idiopathic pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), cystic fibrosis, pneumonia, lung cancer, or bronchopulmonary dysplasia. In some embodiments, the pulmonary disease is severe asthma.

[0186] In some embodiments, the subject has previously been diagnosed with cardiovascular disease (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative disease, rheumatoid arthritis, non-alcoholic steatohepatitis, damage caused by certain viral infections including SARS-CoV-2, certain ocular inflammatory conditions, or skeletal muscle wasting.

[0187] In some embodiments, the subject has previously been diagnosed with one or more ocular diseases associated with ocular inflammation.

[0188] Embodiments of the present disclosure include pharmaceutical compositions for in vivo delivery of a RAGE RNAi agent to lung epithelial cells. Such pharmaceutical compositions can include, for example, a RAGE RNAi agent conjugated to a targeting group that includes an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αβ integrin ligand.

[0189] In some embodiments, the described pharmaceutical compositions comprising a RAGE RNAi agent are used to treat or manage a clinical condition in a subject that would benefit from inhibition of RAGE expression. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed RAGE RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0190] In some embodiments, the described RAGE RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent may be another RAGE RNAi agent (e.g., a RAGE RNAi agent that targets a different sequence within the AGER (RAGE) gene). In some embodiments, the second therapeutic agent may be an RNAi agent that targets the AGER gene. The additional therapeutic agent may also be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The RAGE RNAi agent, with or without one or more additional therapeutic agents, may be combined with one or more excipients to form a pharmaceutical composition.

[0191] The described pharmaceutical compositions comprising a RAGE RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reducing or inhibiting expression of AGER mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising a RAGE RNAi agent, thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more RAGE RNAi agents, thereby preventing or inhibiting at least one symptom.

[0192] In some embodiments, one or more of the described RAGE RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.

[0193] The route of administration is the route by which the RAGE RNAi agent comes into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The RAGE RNAi agents disclosed herein can be administered via any suitable route, in preparations appropriately tailored for the particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, intraocularly, or intraperitoneally, or topically.

[0194] Pharmaceutical compositions comprising the RAGE RNAi agents described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or by subcutaneous, intravenous, intraperitoneal, or parenteral routes, such as intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration, or intratracheal administration. For example, in some embodiments, the RAGE RNAi agents described herein are desired to inhibit expression of the AGER gene in pulmonary epithelium, for which administration by inhalation (e.g., by an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.

[0195] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0196] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one described therapeutic compound and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., a RAGE RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dose. An excipient may a) aid in the operation of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) act to enhance any other attribute of the overall safety, efficacy, or efficacy of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0197] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0198] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0199] Sterile injection solution can be prepared by incorporating the required amount of active compound into suitable solvent with one or combination of the ingredients listed above as necessary, and then sterilize by filtration.Generally, dispersion is prepared by incorporating active compound into sterile vehicle that contains basic dispersion medium and other ingredients listed above as necessary.For the preparation of sterile powder for sterile injection solution, the preparation method includes vacuum drying and freeze-drying, and obtains powder of active ingredient and any other desired ingredients from the solution that has been previously sterilized and filtered.

[0200] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ocular administration.

[0201] The formulation suitable for inhalation administration can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration.Generally, the formulation for inhalation administration is a sterile solution at physiological pH and has low viscosity (<5cP).Salt can be added to the formulation to balance tonicity.Optionally, surfactant or cosolvent can be added to increase the solubility of active compound and improve aerosol properties.Optionally, excipient can be added to adjust viscosity and ensure the size and distribution of sprayed droplets.

[0202] In some embodiments, pharmaceutical formulations comprising the RAGE RNAi agents disclosed herein suitable for inhaled administration can be prepared in water for injection (sterile water) or aqueous sodium phosphate buffer (e.g., RAGE RNAi agents formulated in 0.5 mM monobasic sodium phosphate, 0.5 mM dibasic sodium phosphate in water).

[0203] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used.The method for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0204] For ease of administration and uniformity of dosage, RAGE RNAi agents can be formulated into compositions in unit dosage forms. Unit dosage forms refer to physically discrete units suitable as a single dose for the subject to be treated, each unit containing a predetermined amount of active compound calculated to produce the desired therapeutic effect in association with the necessary pharmaceutical carrier. The specifications for the unit dosage forms of the present disclosure are determined and directly influenced by the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the technical field of compounding such active compounds for the treatment of individuals.

[0205] Pharmaceutical compositions can contain other additional ingredients that are commonly found in pharmaceutical compositions.Such additional ingredients include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.).It is also envisioned that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as a "pharmaceutical composition".As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces pharmacological, therapeutic, or preventive results.

[0206] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another RAGE RNAi agent (e.g., a RAGE RNAi agent that targets a different sequence within the RAGE target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer.

[0207] In some embodiments, compositions are described herein that include a combination or cocktail of at least two RAGE RNAi agents having different sequences. In some embodiments, the two or more RAGE RNAi agents are each separately and independently linked to a targeting group. In some embodiments, the two or more RAGE RNAi agents are each linked to a targeting group that comprises or consists of an integrin targeting ligand. In some embodiments, the two or more RAGE RNAi agents are each linked to a targeting group that comprises or consists of an αvβ6 integrin targeting ligand.

[0208] Described herein are compositions for delivery of RAGE RNAi agents to lung epithelial cells. Further, generally described herein are compositions for in vivo delivery of RAGE RNAi agents to cells, such as renal epithelial cells and / or epithelial cells in the digestive or reproductive tract and / or ocular surface epithelial cells in the eye.

[0209] Generally, an effective amount of a RAGE RNAi agent disclosed herein ranges from about 0.0001 to about 20 mg / kg of body weight / deposited dose, e.g., from about 0.001 to about 5 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a RAGE RNAi agent ranges from about 0.01 mg / kg to about 3.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a RAGE RNAi agent ranges from about 0.03 mg / kg to about 2.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a RAGE RNAi agent ranges from about 0.01 to about 1.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of a RAGE RNAi agent ranges from about 0.50 to about 1.0 mg / kg of body weight / deposited dose. The amount administered will also likely depend on variables such as the patient's overall health, the relative biological potency of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that the initial dosage administered may be increased beyond the upper levels noted above to rapidly achieve desired blood or tissue levels, or the initial dosage may be less than optimal. In some embodiments, the dose is administered daily. In some embodiments, the dose is administered weekly. In further embodiments, the dose is administered every other week, every three weeks, once a month, or once a quarter (i.e., once every three months).

[0210] For the treatment of disease or to form a medicament or composition for treating disease, the pharmaceutical compositions described herein comprising a RAGE RNAi agent may be combined with an excipient or with a second therapeutic agent or treatment, such as, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer.

[0211] The described RAGE RNAi agents, when added to a pharmaceutically acceptable excipient or adjuvant, may be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein may be packaged in a dry powder or aerosol inhaler, other metered dose inhaler, nebulizer, pre-filled syringe, or vial.

[0212] Methods of Treatment and Inhibition of RAGE Expression The RAGE RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from reducing and / or inhibiting expression of AGER mRNA and / or reducing RAGE receptor levels.

[0213] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) with a disease or disorder that would benefit from reduced RAGE receptor activity, including, but not limited to, pulmonary diseases such as asthma (including severe asthma), acute respiratory distress syndrome, idiopathic pulmonary fibrosis, lung cancer, bronchopulmonary dysplasia, chronic obstructive pulmonary disease (COPD), or cystic fibrosis. In some embodiments, the pulmonary disease is severe asthma. In some embodiments, the subject has previously been diagnosed with cardiovascular disease (atherosclerosis, myocardial infarction, heart failure, peripheral vascular disease), cancer, diabetes, chronic kidney disease, neurodegenerative disease, rheumatoid arthritis, nonalcoholic steatohepatitis, damage caused by certain viral infections, including SARS-CoV-2, certain ocular inflammatory conditions, or skeletal muscle wasting. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more RAGE RNAi agents described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein may be to a human or an animal.

[0214] Increased membrane-type RAGE activity is known to promote inflammation in tissues. In some embodiments, the described RAGE RNAi agents are used to treat at least one symptom mediated, at least in part, by reduced RAGE levels in a subject. The subject is administered a therapeutically effective amount of any one or more of the described RAGE RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting at least one symptom.

[0215] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by AGER gene expression in a patient in need thereof, comprising administering to the patient any of the RAGE RNAi agents described herein.

[0216] In some embodiments, a RAGE RNAi agent is used to treat or manage a clinical condition or pathological condition in a subject, wherein the clinical condition or pathological condition is mediated at least in part by reduced RAGE expression. The subject is administered a therapeutically effective amount of one or more of the RAGE RNAi agents or RAGE RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising a RAGE RNAi agent described herein to the subject to be treated.

[0217] In a further aspect, the disclosure features a method of treating (including prophylactic or preventative treatment) a disease or condition that can be addressed by reducing RAGE receptor levels, comprising administering to a subject in need of treatment a RAGE RNAi agent that includes an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 10. Compositions for use in such methods are also described herein.

[0218] The described RAGE RNAi agents and / or compositions comprising the RAGE RNAi agents can be used in methods for the therapeutic treatment of diseases or conditions caused by enhanced or elevated levels of RAGE receptor activity. Such methods comprise administering a RAGE RNAi agent described herein to a subject, e.g., a human or animal subject.

[0219] In another aspect, the present disclosure provides a method for treating (including prophylactic treatment) a pathological condition (such as a pathology or disease) mediated at least in part by RAGE expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 10.

[0220] In some embodiments, disclosed herein are methods for inhibiting expression of the AGER gene, comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 10.

[0221] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological condition mediated at least in part by RAGE expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0222] In some embodiments, disclosed herein are methods for inhibiting expression of the AGER gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0223] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological condition mediated at least in part by RAGE expression, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising any of the sequences in Table 3 or Table 10.

[0224] In some embodiments, disclosed herein are methods for inhibiting expression of the AGER (RAGE) gene, comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising any of the sequences in Table 3 or Table 10.

[0225] In some embodiments, disclosed herein are methods for inhibiting expression of the AGER gene, comprising administering to a subject a RAGE RNAi agent comprising a sense strand consisting of a nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of a nucleobase sequence of any of the sequences in Table 3 or Table 10. In other embodiments, disclosed herein are methods for inhibiting expression of the AGER gene, comprising administering to a subject a RAGE RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 10.

[0226] In some embodiments, disclosed herein are methods for inhibiting expression of the AGER gene in a cell, the method comprising administering one or more RAGE RNAi agents comprising a duplex structure of one of the duplexes set forth in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, and Table 10.

[0227] In some embodiments, the gene expression level and / or mRNA level of the AGER gene in specific epithelial cells of a subject to which a described RAGE RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject prior to administration of the RAGE RNAi agent or to a subject not administered the RAGE RNAi agent. In some embodiments, RAGE receptor or RAGE protein levels in specific epithelial cells of a subject administered a described RAGE RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject prior to administration of the RAGE RNAi agent or a subject not administered the RAGE RNAi agent. Gene expression levels, protein levels, and / or mRNA levels in a subject may be reduced in cells, cell populations, and / or tissues of the subject. In some embodiments, AGER mRNA levels in specific epithelial cells of a subject administered a described RAGE RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject prior to administration of the RAGE RNAi agent or to a subject not administered the RAGE RNAi agent.

[0228] The reduction of gene expression, mRNA, and protein levels can be assessed by any method known in the art. A reduction or decrease in RAGE receptor activity levels and / or RAGE protein levels is collectively referred to herein as a reduction, reduction, or inhibition of RAGE expression. The examples described herein illustrate known methods for assessing RAGE expression and inhibition of AGER gene expression.

[0229] Cells, tissues, organs, and non-human organisms Contemplated are cells, tissues, organs, and non-human organisms comprising at least one of the RAGE RNAi agents described herein, wherein the cell, tissue, organ, or non-human organism is produced by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

[0230] Further Exemplary Embodiments Certain further exemplary embodiments of the disclosed technology are provided herein, which are merely illustrative and do not limit the scope of the disclosure or the claims appended hereto.

[0231] Embodiment 1. An RNAi agent for inhibiting expression of the receptor for advanced glycation end products gene, comprising: an antisense strand comprising at least 15 consecutive nucleotides that differ from any one of the antisense strands disclosed in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand. an RNAi agent comprising:

[0232] Embodiment 2. An RNAi agent for inhibiting expression of the receptor for advanced glycation end products gene, comprising:

[0233] a sense strand comprising at least 15 consecutive nucleotides that differ from a stretch of nucleotides of the same length of SEQ ID NO: 1 by 0, 1, 2, or 3 nucleotides; and an antisense strand comprising a nucleotide sequence that is at least partially complementary to the sense strand. an RNAi agent comprising:

[0234] Embodiment 3. An inhibitor of the AGER (RAGE) gene, comprising an antisense strand comprising a nucleotide sequence having at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides that is complementary to any of the target nucleotide sequences in Table 1.

[0235] Embodiment 4. An RNAi agent comprising: (i) an antisense strand comprising a nucleotide sequence having at least 15 contiguous nucleotides that differ by 0, 1, 2, or 3 nucleotides from any of the nucleotide sequences of Table 2, Table 3, or Table 10; and (ii) a sense strand that is at least partially complementary to the antisense strand.

[0236] Embodiment 5. An RNAi agent comprising: (i) an antisense strand comprising, consisting of, or consisting essentially of a nucleotide sequence derived from any of the antisense strand nucleotide sequences in Table 2, Table 3, or Table 10; and (ii) a sense strand comprising, consisting of, or consisting essentially of a nucleotide sequence derived from any of the sense strand nucleotide sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.

[0237] Embodiment 6. An RNAi agent comprising an antisense strand and a sense strand that anneal to form a duplex, wherein the duplex has the structure of any of the duplexes set forth in Table 7A, Table 7B, Table 8, Table 9, or Table 10.

[0238] Embodiment 7. An RNAi agent capable of inhibiting expression of the receptor for advanced glycation end products gene, comprising: (i) an 18-49 nucleotide long antisense strand that is at least partially complementary to the receptor for advanced glycation end products gene (SEQ ID NO: 1); (ii) a sense strand that is at least partially complementary to the antisense strand; and (iii) a targeting ligand linked to the sense strand; and an RNAi agent comprising:

[0239] Embodiment 8. An RNAi agent for inhibiting expression of an advanced glycation end product receptor gene, comprising: an antisense strand comprising at least 17 consecutive nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; an RNAi agent comprising:

[0240] Embodiment 9. The RNAi agent of any one of embodiments 1 to 8, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences provided in Table 2 or Table 3.

[0241] Embodiment 10. The RNAi agent of any one of embodiments 1 to 9, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 4, and the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.

[0242] Embodiment 11. The RNAi agent of any one of embodiments 1 to 10, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

[0243] Embodiment 12. The RNAi agent of any one of embodiments 1 to 11, wherein all or substantially all of the nucleotides are modified nucleotides.

[0244] Embodiment 13. The RNAi agent of any one of embodiments 11-12, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

[0245] Embodiment 14. The RNAi agent of embodiment 12, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0246] Embodiment 15. The RNAi agent of any one of embodiments 1 to 14, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3.

[0247] Embodiment 16 The RNAi agent of any one of embodiments 1 to 15, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

[0248] Embodiment 17. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4.

[0249] Embodiment 18. The RNAi agent of any one of embodiments 1 to 17, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0250] Embodiment 19. The RNAi agent of embodiment 18, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.

[0251] Embodiment 20. The RNAi agent of embodiment 19, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

[0252] Embodiment 21 The RNAi agent of embodiment 20, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0253] Embodiment 22. The RNAi agent of embodiment 21, having two blunt ends.

[0254] Embodiment 23. The RNAi agent of any one of embodiments 1 to 22, wherein the sense strand comprises one or two terminal caps.

[0255] Embodiment 24. The RNAi agent of any one of embodiments 1 to 23, wherein the sense strand comprises one or two inverted abasic residues.

[0256] Embodiment 25. The RNAi agent of embodiment 8, which is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, or Table 10.

[0257] Embodiment 26. The RNAi agent of embodiment 25, wherein all or substantially all of the nucleotides are modified nucleotides.

[0258] Embodiment 27. The following nucleotide sequence (5'→3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO: 55); UGAUGUUUUGAGCACCUAC (SEQ ID NO: 65); UUCCAUUCCUGUUCAUUGC (SEQ ID NO: 73); UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7); UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9); or UUCCAUUCCUGUUCAUUGCCU (SEQ ID NO: 8) 10. The RNAi agent of embodiment 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of

[0259] Embodiment 28. The sense strand has the following nucleotide sequence (5'→3'): GAAUGGAAACUGAACACAA (SEQ ID NO: 298); GUAGGUGCUCAAAACAUCA (SEQ ID NO: 308); GCAAUGAACAGGAAUIGAA (SEQ ID NO: 316); CGGAAUGGAAACUGAACACAA (SEQ ID NO: 19); GAGUAGGUGCUCAAAACAUCA (SEQ ID NO: 20); or AGGCAAUGAACAGGAAUIGAA (SEQ ID NO: 21) 28. The RNAi agent of embodiment 27, consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of

[0260] Embodiment 29. The RNAi agent of embodiment 27 or 28, wherein all or substantially all of the nucleotides are modified nucleotides.

[0261] Embodiment 30. The following nucleotide sequence (5'→3'): usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 2); cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3); usGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 5); cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO: 6); usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu(SEQ ID NO:4); wherein a, c, g, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; and s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. 2. The RNAi agent of embodiment 1.

[0262] Embodiment 31. The sense strand has the following nucleotide sequence (5'→3'): gsaguagGfuGfcUfcaaaacauca (SEQ ID NO: 14); asggcaaugAfAfCfaggaauigaa (SEQ ID NO: 15); csggaauggAfAfAfcugaacacaa (SEQ ID NO: 13); wherein a, c, g, i, and u represent 2'-O-methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, 2'-O-methyl inosine, and 2'-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, 2'-fluoro cytidine, 2'-fluoro guanosine, and 2'-fluoro uridine, respectively; s represents a phosphorothioate linkage; and all or substantially all of the nucleotides on the antisense strand are modified nucleotides. 2. The RNAi agent of embodiment 1.

[0263] Embodiment 32. The RNAi agent of any one of embodiments 27 to 31, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.

[0264] Embodiment 33. The RNAi agent of any one of embodiments 1 to 32, which is linked to a targeting ligand.

[0265] Embodiment 34 The RNAi agent of embodiment 33, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells.

[0266] Embodiment 35 The RNAi agent of embodiment 34, wherein the targeting ligand comprises an integrin targeting ligand.

[0267] Embodiment 36 The RNAi agent of embodiment 35, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.

[0268] Embodiment 37. The targeting ligand has the following structure: [ka] or a pharmaceutically acceptable salt thereof, or [ka] or a pharmaceutically acceptable salt thereof, [ka] indicates the point of attachment to the RNAi agent, 37. The RNAi agent of embodiment 36.

[0269] Embodiment 38. The targeting ligand is: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] having a structure selected from the group consisting of: [ka] indicates the point of attachment to the RNAi agent, 37. The RNAi agent according to any one of embodiments 33 to 36.

[0270] Embodiment 39. The following structure: [ka] 39. The RNAi agent of embodiment 38, wherein the RNAi agent is conjugated to a targeting ligand having the following structure:

[0271] Embodiment 40. The targeting ligand has the following structure: [ka] 37. The RNAi agent according to any one of embodiments 33 to 36, comprising:

[0272] Embodiment 41 The RNAi agent of any one of embodiments 33 to 36, wherein the targeting ligand is conjugated to the sense strand.

[0273] Embodiment 42 The RNAi agent of embodiment 41, wherein the targeting ligand is conjugated to the 5' end of the sense strand.

[0274] Embodiment 43. The RNAi agent of any of embodiments 1 to 42, conjugated to a targeting ligand and having the double-stranded structure of AC000292, AC001266, AC001267, or AC001268.

[0275] Embodiment 44. A composition comprising the RNAi agent of any one of embodiments 1 to 43, further comprising a pharmaceutically acceptable excipient.

[0276] Embodiment 45 The composition of embodiment 44, further comprising a second RNAi agent capable of inhibiting expression of the receptor for advanced glycation end products gene expression.

[0277] Embodiment 46. The composition of embodiment 44 or 45, further comprising one or more additional therapeutic agents.

[0278] Embodiment 47. The composition of any one of embodiments 44 to 46, which is formulated for administration by inhalation.

[0279] Embodiment 48. The composition of embodiment 47, delivered by a metered dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.

[0280] Embodiment 49. The composition of any of embodiments 44-48, wherein the RNAi agent is a sodium salt.

[0281] Embodiment 50. The composition of any one of embodiments 44-49, wherein the pharmaceutically acceptable excipient is water for injection.

[0282] Embodiment 51. The composition of any one of embodiments 44-49, wherein the pharmaceutically acceptable excipient is buffered saline.

[0283] Embodiment 52. A method for inhibiting expression of an advanced glycation end products receptor gene in a cell, comprising introducing into the cell an effective amount of an RNAi agent described in any one of embodiments 1 to 43 or a composition described in any one of embodiments 44 to 51.

[0284] Embodiment 53. The method of embodiment 52, wherein the cell is present in a subject.

[0285] Embodiment 54. The method of embodiment 53, wherein the subject is a human subject.

[0286] Embodiment 55. The method of any one of embodiments 52-54, wherein after administration of the RNAi agent, expression of the receptor for advanced glycation end products gene is inhibited by at least about 30%.

[0287] Embodiment 56. A method for treating one or more conditions or diseases associated with enhanced or elevated levels of membrane-type RAGE activity, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition described in any one of embodiments 44 to 51.

[0288] Embodiment 57. The method of embodiment 56, wherein the disease is a respiratory disease.

[0289] Embodiment 58. The method of embodiment 57, wherein the respiratory disease is cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, a respiratory tract infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis.

[0290] Embodiment 59. The method of embodiment 58, wherein the disease is chronic obstructive pulmonary disease (COPD).

[0291] Embodiment 60. The method of embodiment 56, wherein the disease is an eye disease.

[0292] Embodiment 61. The method of embodiment 60, wherein the ocular disease is dry eye syndrome.

[0293] Embodiment 62. The method of any one of embodiments 52-61, wherein the RNAi agent is administered at a deposited dose of about 0.01 mg to about 5.0 mg per kg of subject body weight.

[0294] Embodiment 63. The method of any one of embodiments 52-61, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg to about 2.0 mg per kg of subject body weight.

[0295] Embodiment 64 The method of any of embodiments 52-61, wherein the RNAi agent is administered in two or more doses.

[0296] Embodiment 65. Use of an RNAi agent according to any one of embodiments 1 to 43 for treating a disease, disorder or condition mediated at least in part by membrane-type RAGE activity and / or AGER gene expression.

[0297] Embodiment 66. Use of a composition according to any one of embodiments 44 to 51 for treating a disease, disorder, or condition mediated at least in part by receptor activity for advanced glycation end products receptor and / or expression of the advanced glycation end products receptor gene.

[0298] Embodiment 67. Use of a composition according to any one of embodiments 44 to 51 for the manufacture of a medicament for treating a disease, disorder, or condition mediated at least in part by receptor activity for advanced glycation end products receptor and / or expression of the advanced glycation end products receptor gene.

[0299] Embodiment 68. The use according to any one of embodiments 65 to 67, wherein the disease is pulmonary inflammation.

[0300] Embodiment 69. A method of making an RNAi agent according to any one of embodiments 1 to 43, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

[0301] Embodiment 70. The method of embodiment 69, wherein the sense strand comprises a targeting ligand.

[0302] Embodiment 71 The method of embodiment 70, comprising conjugating a targeting ligand to the sense strand.

[0303] The embodiments and items provided above will now be illustrated by the following non-limiting examples. [Example]

[0304] Example 1. Synthesis of RAGE RNAi agents. The RAGE RNAi agent duplexes disclosed herein were synthesized as follows.

[0305] A. Synthesis. The sense and antisense strands of the RAGE RNAi agent were synthesized according to the solid-phase phosphoramidite technique used in oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) was used. Synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). The monomer located at the 3' end of each strand was attached to the solid support as the starting point for synthesis. All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used were the following: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5'-O-dimethoxytrityl-N 2The protecting groups used were 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2'-Deoxy-2'-fluorophosphoramidite had the same protecting groups as 2'-O-methyl RNAamidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were purchased: 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. )-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were used. TFA Aminolink phosphoramidite was also purchased commercially (ThermoFisher). Linker L6 was propargyl-PEG from BroadPharm. It was purchased as 5-NHS (catalog no. BP-20907) and coupled to the NH2-C6 group from the aminolink phosphoramidite to form -L6-C6- using standard coupling conditions.The linker Alk-cyHex was similarly purchased commercially as a propargyl-containing phosphoramidite compound from Lumiprobe (alkyne phosphoramidite, 5'-terminus) to form the linker-Alk-cyHex-. In each case, the phosphorothioate bond was introduced as specified using the conditions described herein. The cyclopropylphosphonate phosphoramidite was synthesized according to WO 2017 / 214112.

[0306] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM). All other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0307] Alternatively, the tri-alkyne moiety was introduced post-synthetically (see Section E below). For this route, the sense strand was functionalized with 5'- and / or 3'-terminal nucleotides containing primary amines. TFA Aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce the phosphorothioate linkage, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0308] B. Cleavage and deprotection of support-bound oligomers. After completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% aqueous methylamine and 28%-31% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0309] C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and buffer B was the same as buffer A supplemented with 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then subjected to size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine, with a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system via tangential flow filtration.

[0310] D. Annealing. RNAi agents were formed by mixing the complementary strands by combining equimolar RNA solutions (sense and antisense) in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the solution absorbance in 1x PBS with a UV-Vis spectrometer. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL cm)) and a dilution factor to determine the duplex concentration.

[0311] E. Conjugation of Tri-Alkyne Linkers. In some embodiments, a tri-alkyne linker is conjugated to the sense strand of an RNAi agent on the resin as a phosphoramidite (see Example 1G for synthesis of an exemplary tri-alkyne linker phosphoramidite, and Example 1A for conjugation of the phosphoramidite). In other embodiments, the tri-alkyne linker can be conjugated to the sense strand after cleavage from the resin, as described below: before or after annealing, in some embodiments, a 5' or 3' amine-functionalized sense strand is conjugated to a tri-alkyne linker. Exemplary tri-alkyne linker structures that can be used to form the constructs disclosed herein are as follows: [ka] To conjugate the tri-alkyne linker to the annealed duplex, the amine-functionalized duplex was dissolved at approximately 50-70 mg / mL in 90% DMSO / 10% HO. 40 equivalents of triethylamine were added, followed by 3 equivalents of tri-alkyne-PNP. Upon completion, the conjugate was precipitated twice in a solvent system of 1x phosphate-buffered saline / acetonitrile (1:14 ratio) and dried.

[0312] F. Synthesis of Targeting Ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-1-yl)phenyl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butanamido)acetamido)propanoic acid) [ka]

[0313] Compound 5 (tert-butyl (4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equiv.) was dissolved in DMF (17 mL). To the mixture was added NaH (0.116 mg, 3.01 mmol, 1.25 equiv., 60% dispersion in oil). After stirring the mixture for 10 min, compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 h, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with saturated aqueous NaCl (1 × 50 mL), dried over NaSO, filtered, and concentrated. The product was purified on a silica column using a gradient of 0–5% methanol in DCM. [ka]

[0314] Compound 21 (0.80 g, 2.378 mmol) was dissolved in 100 mL of acetone:0.1 M NaOH [1:1]. The reaction was monitored by TLC (5% ethyl acetate in hexanes). The organics were concentrated and the residue was acidified to pH 3-4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3 × 75 mL). The organics were pooled, dried over NaSO, filtered, and concentrated. The product was used without further purification. [ka]

[0315] To a solution of compound 22 (1.1 g, 3.95 mmol, 1 equiv.), compound 45 (595 mg, 4.74 mmol, 1.2 equiv.), and TBTU (1.52 g, 4.74 mmol, 1.2 equiv.) in anhydrous DMF (10 mL) was added diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for 3 h. The reaction was quenched with saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 × 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase. LC-MS: calculated [M+H]+ 366.20, found 367. [ka]

[0316] To a solution of compound 61 (2 g, 8.96 mmol, 1 eq.) and compound 62 (2.13 mL, 17.93 mmol, 2 eq.) in anhydrous DMF (10 mL) was added K2CO3 (2.48 g, 17.93 mmol, 2 eq.) at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3 × 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase. [ka]

[0317] To a solution of compound 60 (1.77 g, 4.84 mmol, 1 equiv.) in THF (5 mL) and HO (5 mL) was added lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equiv.) portionwise at 0 °C. The reaction mixture was warmed to room temperature. After stirring at room temperature for 3 h, the reaction mixture was acidified to pH 3.0 with HCl (6 N). The aqueous phase was extracted with ethyl acetate (3 × 20 mL), and the organic layers were combined, dried over NaSO, and concentrated. LC-MS: calculated [M+H] 352.18, found 352. [ka]

[0318] To a solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equiv.) in anhydrous THF (20 mL) was added n-BuLi (3.6 mL, 9.0 mmol, 1.5 equiv.) in hexanes dropwise at −78° C. The reaction was maintained at −78° C. for an additional 1 h. Triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equiv.) was then added to the mixture at −78° C. The reaction was then warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated NH4Cl solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3×20 mL), and the organic phases were combined, dried over Na2SO4, and concentrated. [ka]

[0319] Compound 12 (300 mg, 0.837 mmol, 1.0 equiv.), compound 65 (349 mg, 1.256 mmol, 1.5 equiv.), XPhos Pd G2 (13 mg, 0.0167 mmol, 0.02 equiv.), and K3PO4 (355 mg, 1.675 mmol, 2.0 equiv.) were mixed in a round-bottom flask. The flask was sealed with a screw-cap septum, then evacuated and backfilled with nitrogen (this process was repeated a total of three times). THF (8 mL) and water (2 mL) were then added via syringe. Nitrogen was bubbled through the mixture for 20 minutes, and the reaction was maintained at room temperature overnight. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (3 × 10 mL). The organic phase was dried over Na2SO4, concentrated and purified by CombiFlash® using silica gel as the stationary phase and eluted with 15% EtOAc / hexane. LC-MS: calculated [M+H]+ 512.24, found 512.56. [ka]

[0320] Compound 66 (858 mg, 1.677 mmol, 1.0 equiv) was cooled in an ice bath. HCl in dioxane (8.4 mL, 33.54 mmol, 20 equiv) was added to the flask. The reaction was allowed to warm to room temperature and stirred for an additional hour. The solvent was removed on a rotary evaporator and the product was used directly without further purification. LC-MS: calculated [M+H]+ 412.18, found 412.46. [ka]

[0321] To a solution of compound 64 (500 mg, 1.423 mmol, 1 equiv.), compound 67 (669 mg, 1.494 mmol, 1.05 equiv.), and TBTU (548 mg, 0.492 mmol, 1.2 equiv.) in anhydrous DMF (15 mL) was added diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated aqueous NaHCO (10 mL), and the product was extracted with ethyl acetate (3 × 20 mL). The organic phases were combined, dried over NaSO, and concentrated. The product was purified by CombiFlash® using silica gel as the stationary phase and eluted with 3–4% methanol in DCM. The yield was 96.23%. LC-MS: calculated [M+H]+ 745.35, found 746.08. [ka]

[0322] To a solution of compound 68 (1.02 g, 1.369 mmol, 1 equiv.) in ethyl acetate (10 mL) was added 10% Pd / C (0.15 g, 50% HO) at room temperature. The reaction mixture was warmed to room temperature and the reaction was monitored by LC-MS. The reaction was maintained at room temperature overnight. The solid was filtered through Celite® and the solvent was removed by rotary evaporation. The product was used directly without further purification. LC-MS: [M+H]+ 655.31, found 655.87. [ka]

[0323] To a solution of compound 69 (100 mg, 0.152 mmol, 1 equiv.) and azido-PEG5-OTs (128 mg, 0.305 mmol, 2 equiv.) in anhydrous DMF (2 mL) was added K2CO3 (42 mg, 0.305 mmol, 2 equiv.) at 0 °C. The reaction mixture was stirred at 80 °C for 6 h. The reaction was quenched with saturated NaHCO3 solution, and the aqueous layer was extracted with ethyl acetate (3 × 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. LC-MS: calculated [M+H]+ 900.40, found 901.46. [ka]

[0324] To a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equiv.) in THF (2 mL) and water (2 mL) was added lithium hydroxide (5 mg, 0.197 mmol, 3.0 equiv.) at room temperature. The mixture was stirred for another 1 h at room temperature. The pH was adjusted to 3.0 with HCl (6 N), and the aqueous phase was extracted with EtOAc (3 × 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. TFA (0.5 mL) and DCM (0.5 mL) were added to the residue, and the mixture was stirred for another 3 h at room temperature. The solvent was removed on a rotary evaporator. LC-MS: calculated [M+H]+ 786.37, found 786.95.

[0325] G. Synthesis of TriAlk 14

[0326] TriAlk14s and (TriAlk14)s, as shown in Table 11 above, can be synthesized using the synthetic routes shown below: Compound 14 can be added to the sense strand as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 can be conjugated to an amine-containing sense strand in an amide coupling reaction. [ka]

[0327] To a 3 L jacketed reactor was added 500 ml of DCM and 4 (75.0 g, 0.16 mol). The internal temperature of the reaction was cooled to 0 °C, and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol), maintaining the internal temperature below 5 °C. The reaction was then slowly treated with DIPEA (72.3 g, 0.56 mol), maintaining the internal temperature below 5 °C. After the addition was complete, the reaction was warmed to 23 °C over 1 h and stirred for 3 h. A 10% kicker charge of all three reagents was added and stirred for an additional 3 h. The reaction was deemed complete when less than 1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2 × 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. The crude oil was carried on to the next step. 46 H 60 N4O 11 The calculated mass was 845.0 m / z. The observed mass [M+H] was 846.0. [ka]

[0328] 121.2 g of crude oil containing 72% by weight of compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while maintaining the internal temperature below 23 °C. The formation of dibenzofulvene (DBF) relative to the consumption of Fmoc-amine 6 was monitored by HPLC Method 1 (Figure 2), and the reaction was complete within 10 h. Glutaric anhydride (12.8 g, 0.11 mol) was added to this solution, and the intermediate amine 7 was converted to compound 8 within 2 h. Upon completion, DMF and TEA were removed under reduced pressure at 30 °C to give 100 g of crude oil. Due to the high solubility of compound 7 in water, an aqueous workup could not be used, and chromatography was the only method for removing DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in three batches on a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-20% methanol / DCM over 30 min to give 42 g of compound 8 (54% yield over three steps). 36 H 55 N4O 12 The calculated mass was 736.4 m / z. The observed mass [M+H] was 737.0. [ka]

[0329] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent prior to use. The oil was redissolved in DMF (210 mL) and cooled to 0°C. This solution was treated with 4-nitrophenol (8.7 g, 0.063 mol) followed by EDC-hydrochloride (12.0 g, 0.063 mol) and was confirmed to be complete within 10 hours. The solution was cooled to 0°C, and 10 volumes of ethyl acetate, followed by 10 volumes of saturated ammonium chloride solution, were added while maintaining the internal temperature below 15°C. The layers were separated, and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give an oil. The crude oil (55 g) was purified in three batches on a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-10% methanol / DCM over 30 min to give 22 g of pure 9 (compound 22) (50% yield). 42 H 59 N5O 14 The calculated mass was 857.4 m / z. The observed mass [M+H] was 858.0. [ka]

[0330] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by HPLC Method 1 by observing the disappearance of compound 9 and was found to be complete in 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to give an oil. The crude oil was purified on a Teledyne ISCO Combi-Flash® purification system using a 330 g silica column. 4-Nitrophenol was eluted with 100% ethyl acetate, and 10 was washed off the column with 20% methanol / DCM to give a colorless oil (39 g, 81% yield). 42 H 69 N5O 12 The calculated mass was 836.0 m / z. The observed mass [M+H] was 837.0. [ka]

[0331] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent, and then co-stripped again with dry dichloromethane (KF < 60 ppm) to remove traces of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of dry dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was confirmed to be complete within 3-6 h. The reaction mixture was cooled to 0 °C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then warmed to ambient temperature over 1 min and stirred at 20 °C for an additional 3 min. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted bisphosphonate reagent. The organic layer was dried over sodium sulfate and concentrated to an oil, yielding 3.08 g of 94% by weight of compound 14. 51 H 86 N7O 13 The calculated mass of P was 1035.6 m / z. The observed mass [M+H] = 1036.

[0332] H. Conjugation of the Targeting Ligand. Either before or after annealing, the 5' or 3' tridentate alkyne-functionalized sense strand is conjugated to a targeting ligand. The following example describes the conjugation of a targeting ligand to an annealed duplex: Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate were prepared in deionized water. A 75 mg / mL DMSO solution of the targeting ligand was made. 25 μL of 1 M Hepes pH 8.5 buffer was added to a 1.5 mL centrifuge tube containing the tri-alkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol). After vortexing, 35 μL of DMSO was added and the solution was vortexed. The targeting ligand was added to the reaction (6 equivalents / duplex, 2 equivalents / alkyne, approximately 15 μL) and the solution was vortexed. The pH was checked using pH paper to confirm that the pH was approximately 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO4·5H2O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equivalents 5:1 THPTA:Cu) was added to the reaction vial and vortexed. Immediately after, 2 M ascorbate (5 μL, 50 equivalents per duplex, 16.7 equivalents per alkyne) was added to the reaction vial and vortexed. Once the reaction was complete (typically in 0.5-1 h), the reaction was immediately purified by non-denaturing anion exchange chromatography.

[0333] Example 2. In vivo intratracheal administration of RAGE RNAi agents in rats. On study day 1, male Sprague Dawley rats were administered 200 microliters of isotonic saline or 1.0 mg / kg of one of the following RAGE RNAi agents via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration:

[0334] [Table 12]

[0335] As shown in Table 12, each of the RAGE RNAi agents was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) and formulated in isotonic saline.

[0336] The chemically modified sequences of RAGE RNAi agents AD07474, AD07475, AD07476, and AD07477 are shown in Table 7B (showing the duplex), Table 3 (showing the corresponding antisense strand), and Table 5 (showing the corresponding sense strand with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0337] AD06949 and AD07256 are rat- and mouse-specific sequences that have no homology to the human AGER gene and were chemically modified as follows. Tri-SM6.1-αvβ6-AD06949 Modified sense strand (5'→3'): Tri-SM6.1-αvβ6-(TA14)cscacaugaUfCfCfaugcuiaguas(invAb) (SEQ ID NO: 888) Modified antisense strand (5'→3'): usAfscsUfcAfgCfaUfgGfaUfcAfuGfuGfsg (SEQ ID NO: 889) Tri-SM6.1-αvβ6-AD07256 Modified sense strand (5'→3'): Tri-SM6.1-αvβ6-(TA14)cscacaugaUfCfCfaugcuiaguas(invAb) (SEQ ID NO: 890) Modified antisense strand (5'→3'): cPrpusAfscsUfcAfgCfaUfgGfaUfcAfuGfuGfsg (SEQ ID NO: 891)

[0338] Five rats were dosed per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after collection and homogenization. Rat AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0339] [Table 13]

[0340] As shown in the data in Table 13 above, each of the RAGE RNAi agents showed significant AGER gene inhibition, with the RAGE RNAi agents targeted to inhibit expression at position 177 (Group 4 (80.5% inhibition) and Group 5 (87.5% inhibition)) providing slightly better inhibition compared to the RAGE RNAi agents targeting position 178 of the AGER gene (Group 6 (70.6% inhibition) and Group 7 (77% inhibition)).

[0341] Example 3. In vivo intratracheal administration of RAGE RNAi agents in mice. On study day 1, male C57BL / 6 mice were administered 50 microliters of isotonic saline or 3.0 mg / kg of one of the following RAGE RNAi agents via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration:

[0342] [Table 14]

[0343] As shown in Table 14, each of the RAGE RNAi agents was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) and formulated in isotonic saline.

[0344] The chemically modified sequences of RAGE RNAi agents AD07478, AD07479, AD07480, and AD07481 are shown in Table 7B (showing the duplex), Table 3 (showing each antisense strand), and Table 5 (showing each sense strand with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0345] The chemically modified sequences of RAGE RNAi agents AD06949 and AD07256 are shown in Example 2 above.

[0346] Five mice were dosed per group. Mice were sacrificed on study day 8, and total RNA was isolated from both lungs after collection and homogenization. Mouse AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0347] [Table 15]

[0348] As shown in the data in Table 15 above, RAGE RNAi agents in groups 4 and 5 (targeting position 384) showed no inhibition and were completely inactive in vivo. RAGE RNAi agents in groups 6 and 7 (targeting position 391) showed relatively limited inhibition in vivo and appear to be insufficiently active to be considered viable therapeutic candidates for treating humans.

[0349] Example 4. In vivo intratracheal administration of RAGE RNAi agents in rats. On study day 1, male Sprague Dawley rats were administered 200 microliters of isotonic saline or 0.5 mg / kg of one of the following RAGE RNAi agents via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration:

[0350] [Table 16]

[0351] As shown in Table 16, each of the RAGE RNAi agents was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) and formulated in isotonic saline.

[0352] The chemically modified sequences of RAGE RNAi agents AD07474, AD07475, AD07700, AD07701, AD07702, AD07703, AD07704, AD07705, AD07706, AD07707, and AD07708 are shown in Table 7B (duplexes shown), Table 3 (respective antisense strands shown), and Table 5 (respective sense strands shown with linkers but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0353] Five rats were dosed per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after collection and homogenization. Rat AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0354] [Table 17]

[0355] As shown in the data in Table 17 above, each of the RAGE RNAi agents demonstrated significant AGER gene inhibition at doses as low as 0.5 mg / kg. Each of the RAGE RNAi agents tested contained different chemical modifications, but all contained the basic nucleotide sequence targeting position 177 of the AGER gene.

[0356] Example 5. In vivo inhalation aerosol administration of RAGE RNAi agents in rats. On study day 1, male Sprague Dawley rats were administered a single lung-deposited dose (PDD) of 0.5 mg / kg of the RAGE RNAi agent Tri-SM6.1-αvβ6-AD07475. A jet nebulizer (Misty Max 10) was used to deliver the aerosol into a single-stage, flow-through, nose-inhalation rodent exposure chamber (CH Technologies). A filter housing was attached to one of the ports to allow assessment of RNAi agent aerosol concentration. Using the estimated respiratory minute volume, allometrically scaled to rodent body weight, along with the aerosol concentration determined from filter collection and RNAi agent quantification, exposure time was adjusted to target the reported PDD of 0.5 mg / kg. As indicated, the RAGE RNAi agent was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell-targeting ligand (Tri-SM6.1, see Figure 1) and formulated in isotonic saline. The chemically modified sequence of the RAGE RNAi agent AD07475 is shown in Table 7B (showing the duplex), Table 3 (showing each antisense strand), and Table 5 (showing each sense strand with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0357] Five rats were dosed per group. Rats were sacrificed on various study days after dosing according to the following schedule:

[0358] [Table 18]

[0359] After sacrifice on each day, total RNA was isolated from both lungs after collection and homogenization. Rat AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0360] [Table 19]

[0361] As shown in the data in Table 19 above, the RAGE RNAi agent AD07475 demonstrated significant AGER gene inhibition at doses as low as 0.5 mg / kg, with the duration of knockdown being maintained until at least day 22, after which it began to slowly return to baseline levels, suggesting that monthly dosing (e.g., administration every 28 days) may be feasible.

[0362] Example 6. In vivo inhalation aerosol administration of RAGE RNAi agents and targeted ligand effects in rats. On study day 1, male Sprague Dawley rats received a single dose of various concentrations of the RAGE RNAi agent Tri-SM6.1-αvβ6-AD07475 or the RAGE RNAi agent AD7475 without the αvβ6 epithelial cell targeting ligand. A jet nebulizer (Misty Max 10) was used to deliver aerosols to a single-stage, flow-through, nose-inhalation rodent exposure chamber (CH Technologies). A filter housing was attached to one of the ports to allow assessment of RNAi agent aerosol concentration. Estimated respiratory minute volumes, allometrically scaled for rodent body weight, along with aerosol concentrations determined from filter collection and RNAi agent quantification, were used to adjust exposure times to target the reported PDDs listed in Table 20. For the group containing a targeting ligand, the RAGE RNAi agent was conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) at the 5' end of the sense strand and formulated in isotonic saline. The chemical modification sequence of the RAGE RNAi agent AD07475 is shown in Table 7B (showing the duplex), Table 3 (showing each antisense strand), and Table 5 (showing each sense strand with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)). The dosing groups were as follows:

[0363] [Table 20]

[0364] Five rats were dosed per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after collection and homogenization. Rat AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0365] [Table 21]

[0366] As shown in the data in Table 21 above, at each time point measured, the RAGE RNAi agent AD07475, both with and without a targeting ligand, demonstrated substantial inhibition compared to the control. Indeed, even at the lowest deposition dose tested, 0.015 mg / kg, the level of inhibition approached 50% (see Group 6 (with targeting ligand Tri-SM6.1-αvβ6; 56.4% gene inhibition) and Group 11 (without targeting ligand; 46.3% gene inhibition)). Furthermore, at each dose level measured, the RNAi agent conjugated to a targeting ligand was numerically superior to the RNAi agent without a targeting ligand (the difference generally becoming more pronounced at lower dose levels), indicating the presence of a ligand effect that can increase inhibitory activity in vivo.

[0367] Example 7. In vivo intratracheal administration of RAGE RNAi agents in rats. On study day 1, male Sprague Dawley rats were administered 200 microliters of isotonic saline or 0.25 mg / kg of one of the following RAGE RNAi agents via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration:

[0368] [Table 22]

[0369] As shown in Table 22, each of the RAGE RNAi agents was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) and formulated in isotonic saline.

[0370] The chemically modified sequences of RAGE RNAi agents AD07474, AD07475, AD07972, AD07973, AD07974, AD07975, and AD07976 are shown in Table 7B (duplexes shown), Table 3 (respective antisense strands shown), and Table 5 (respective sense strands shown with linkers but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0371] Five rats were dosed per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after collection and homogenization. Rat AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0372] [Table 23]

[0373] As shown in the data in Table 23 above, each RAGE RNAi agent demonstrated significant AGER gene inhibition at a dose of only 0.25 mg / kg. Each RAGE RNAi agent tested contained a different chemical modification, but all contained the basic nucleotide sequence targeting position 177 of the AGER gene.

[0374] Example 8. In vivo intratracheal administration of RAGE RNAi agents in rats.

[0375] On study day 1, male Sprague Dawley rats were administered 200 microliters of isotonic saline or 0.25 mg / kg of one of the following RAGE RNAi agents via a microspray device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration:

[0376] [Table 24]

[0377] As shown in Table 24, each of the RAGE RNAi agents was conjugated at the 5' end of the sense strand to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) and formulated in isotonic saline.

[0378] The chemically modified sequences of the RAGE RNAi agents in Example 8 are shown in Table 7B (showing the duplexes), Table 3 (showing each antisense strand), and Table 5 (showing each sense strand with the linker but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0379] Five rats were dosed per group. On study day 8, rats were sacrificed, and total RNA was isolated from both lungs after collection and homogenization. Rat AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to rat GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0380] [Table 25]

[0381] As shown in the data in Table 25 above, each of the RAGE RNAi agents demonstrated significant AGER gene inhibition at doses as low as 0.1 mg / kg. Each of the RAGE RNAi agents tested contained different chemical modifications, but all contained the basic nucleotide sequence targeting position 177 of the AGER gene.

[0382] Example 9. In vivo inhalation aerosol administration of RAGE RNAi agents in cynomolgus monkeys. On study day 1, female cynomolgus monkeys were administered a single dose of the RAGE RNAi agent Tri-SM6.1-αvβ6-AD09150, Tri-SM6.1-αvβ6-AD09151, or Tri-SM6.1-αvβ6-AD09152 at a PDD of 1 mg / kg. A vibrating mesh nebulizer (Aeroneb® Solo) was used to deliver aerosol to restrained, anesthetized monkeys wearing primate inhalation helmets. A filter housing was attached to one of the helmets so that RNAi agent aerosol concentration could be assessed. Estimated respiratory minute volumes, allometrically scaled to rodent body weight, along with aerosol concentrations determined from filter collection and RNAi agent quantification, were used to adjust exposure times to target the reported PDDs listed in Table 26. The RAGE RNAi agents were conjugated to a tridentate small molecule αvβ6 integrin receptor targeting ligand (Tri-SM6.1, see Figure 1) at the 5' end of the sense strand and formulated in isotonic saline. The chemically modified sequences of the RAGE RNAi agents are shown in Table 7B (showing the duplex), Table 3 (showing each antisense strand), and Table 5 (showing each sense strand with the linker but without the tridentate small molecule αvβ6 integrin receptor targeting ligand (Tri-SM6.1)). The dosing groups were as follows:

[0383] [Table 26]

[0384] Three monkeys were dosed per group. On day 15 of the study, the monkeys were sacrificed, and total RNA was isolated from lung samples after collection and homogenization. The data in Table 27 below show mRNA expression sampled from the distal left caudal lobe. The data in Table 28 below show mRNA expression sampled from the distal right caudal lobe. Cynomolgus monkey AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to cynomolgus monkey beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0385] [Table 27]

[0386] [Table 28]

[0387] As shown in the data in Table 28 above, RNAi agents AD09150 and AD09151 showed substantial inhibition (93%) compared to the control, demonstrating their ability to robustly silence AGER expression in non-human primates.

[0388] Cynomolgus monkey AGER mRNA expression was quantified in a separate qPCR assay. The data in Tables 29-42 below show mRNA expression from samples of cynomolgus monkey lung samples. Cynomolgus monkey AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to cynomolgus monkey beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). Some lung tissues were repeated on different tissue samples, when available, for example, the distal left posterior lobe and the distal left anterior lobe.

[0389] [Table 29]

[0390]

Table 30

[0391] Table 31

[0392] Table 32

[0393] Table 33

[0394] Table 34

[0395] Table 35

[0396] Table 36

[0397] Table 37

[0398] Table 38

[0399] Table 39

[0400] [Table 40]

[0401] [Table 41]

[0402] [Table 42]

[0403] As shown by the data in Tables 29-42 above, RNAi agents AD09150 and AD09151 showed substantial inhibition (up to 92%) compared to controls, demonstrating their ability to robustly silence AGER expression in non-human primates.

[0404] Example 10. In vivo anti-inflammatory effects of RAGE knockdown in a rat model of airway inflammation (delivered by aerosol). On Study Day 1 and again on Study Day 15, male Sprague Dawley rats were administered a 0.5 mg / kg deposition dose of the RAGE RNAi agent Tri-SM6.1-αvβ6-AD07475 or a vehicle control without RNAi agent, according to Table 43 below. A jet nebulizer (Misty Max 10) was used to deliver aerosol to a single-stage, flow-paste nose-inhalation rodent exposure chamber (CH Technologies). A filter housing was attached to one of the ports so that RNAi agent aerosol concentration could be assessed. Estimated respiratory minute volumes, allometrically scaled to rodent body weight, were used in conjunction with aerosol concentrations determined from filter collection and RNAi agent quantification.

[0405] On day 40, rats in groups 4 and 5 were challenged with a single intratracheal dose of 400 μg / rat of Alternaria alternata (Alt) prepared in saline, while rats in groups 2 and 3 received a saline control dose of 400 μg / rat. Rats in group N-1 were naive and received no treatment.

[0406] [Table 43]

[0407] Forty-eight hours after Alternaria administration (i.e., day 42), rats were anesthetized with isoflurane / O2, bled, and euthanized by exsanguination. The trachea was cannulated and washed with 2 × 10 mL of ice-cold PBS, after which bronchoalveolar lavage fluid (BAL) was collected. BAL samples were spun down, and cells were resuspended in 1 mL of ice-cold PBS. An aliquot was mixed with Turk's solution (1:1 ratio), and total cell numbers were counted using a hemocytometer. Cytospins were prepared, stained, and cell-specific counts were performed. Supernatants were used for soluble RAGE (sRAGE) and cytokine measurements. One lobe was used to measure AGER mRNA expression, and tissue samples were analyzed to assess RAGE protein concentration.

[0408] Granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. Total and specific cell counts were performed on BAL samples to derive inflammatory cell counts. Group 5 (administered RAGE RNAi agent and tissue challenged with Alternaria) showed a decrease in inflammatory cells compared to Group 4 (no RNAi agent administered).

[0409] Furthermore, VEGF is known to cause vascular remodeling and is induced by inflammation. The groups receiving the RAGE RNAi agent (Groups 3 and 5) showed decreased VEGF levels in the BAL samples tested.

[0410] Example 11. In vivo anti-inflammatory effects of RAGE knockdown in a rat model of airway inflammation (delivered by intratracheal microspray). Male Brown-Norway rats were administered the RAGE RNAi agent Tri-SM6.1-αvβ6-AD07475 at a dose of 3 mg / kg (1.5 mL / kg) or vehicle on study days 1, 8, and 29. The calculated volume of 1.5 mL / kg was loaded into a syringe connected to a microspray device (Penn Century, Philadelphia, PA).

[0411] On day 43, rats in groups 3 and 4 were challenged with a single intratracheal dose of 400 μg / rat of Alternaria alternata prepared in saline, while rats in groups 1 and 2 received a saline control dose of 400 μg / rat. Rats in group N-1 were naive and received no treatment.

[0412] [Table 44]

[0413] Forty-eight hours after Alternaria administration (i.e., day 45), rats were anesthetized with isoflurane / O2, bled, and euthanized by exsanguination. The trachea was cannulated and washed with 2 × 10 mL of ice-cold PBS, after which bronchoalveolar lavage fluid (BAL) was collected. BAL samples were spun down, and cells were resuspended in 1 mL of ice-cold PBS. An aliquot was mixed with Turk's solution (1:1 ratio), and total cell numbers were counted using a hemocytometer. Cytospins were prepared, stained, and cell-specific counts were performed. The supernatant was used for soluble RAGE (sRAGE) and cytokine measurements. One lobe was used to measure AGER mRNA expression, and a portion of the tissue was used to measure tissue concentrations of RAGE protein.

[0414] Soluble RAGE (sRAGE) was measured by ELISA in serum and bronchoalveolar lavage fluid (BALF) samples and was almost completely reduced by administration of the RAGE RNAi agent (see groups 2 and 4).

[0415] Furthermore, as noted in the previous examples, granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. Total and specific cell counts were performed on BAL samples to derive inflammatory cell counts. The effect of RAGE inhibition by the RAGE RNAi agent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. Group 4 (treated with RAGE RNAi agent) showed a decrease in total granulocytes compared to Group 3 (not administered RAGE RNAi agent).

[0416] Other biomarkers, such as MIP1a, IL-13, IP-10, and VEGF, also indicate cellular inflammation. For the Alternaria-challenged group, administration of the RAGE RNAi agent (Group 4) resulted in a decrease in each of these inflammatory biomarkers compared to the group not treated with the RAGE RNAi agent (Group 3).

[0417] Example 12. Dose response of in vivo inhaled aerosol administration of RAGE RNAi agents in cynomolgus monkeys. Fifteen female cynomolgus monkeys were randomly assigned to five treatment groups. Animals were dosed as summarized in Table 45 below. The night before the test day requiring anesthesia, animals were fasted but provided with water ad libitum. Animals were anesthetized with ketamine hydrochloride (5–10 mg / kg, IM) followed by isoflurane inhalation. Animals were first anesthetized with isoflurane (4–5%) via mask until an appropriately sized cuffed endotracheal tube was inserted just proximal to the carina to allow insertion of a pediatric fiberoptic bronchoscope for bronchoalveolar lavage (BAL) and exposure through the endotracheal tube. Anesthetized animals were transferred to the exposure system and connected to a ventilator. Anesthetized and ventilated animals received a single inhalation exposure with either isotonic saline or the RAGE RNAi agent Tri-SM6.1-αvβ6-AD09151 (AC001267). During the exposure period, animals were ventilated using a Harvard pump set at a tidal volume of 10–15 mL / kg, 30 breaths / min, and an inspiratory volume of 35:65. After the end of the exposure, anesthesia was removed, and the animals were placed in a recovery station, covered with a blanket or Bair Hugger, and connected to a monitoring device for continuous heart rate and O2 saturation monitoring. RAGE RNAi agents were conjugated to a tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1, see Figure 1) at the 5' end of the sense strand and formulated in isotonic saline. The chemical modification sequences of the RAGE RNAi agents are shown in Table 7B (duplexes shown), Table 3 (corresponding antisense strands shown), and Table 5 (corresponding sense strands with linkers but without the tridentate small molecule αvβ6 epithelial cell targeting ligand (Tri-SM6.1)).

[0418] [Table 45] [Table 46]

[0419] Bronchoalveolar lavage (BAL) and blood (serum) samples were taken 7 days before and 2 to 4 weeks after inhalation exposure (days -7, 15, and 29). All animals were euthanized immediately prior to sampling on day 29, and lung tissue was collected.

[0420] The left lung of each animal was harvested for histological examination. The right lung was obtained, and the lobes were separated, weighed individually, and flash-frozen. The isolated lobes were cut into three approximately equal pieces, sliced ​​along a longitudinal plane perpendicular to the airways: proximal, middle, and distal. For the anterior and middle lobes, two to three equal pieces were collected from the proximal section and three from the other two sections. Approximately equal-sized tissue cubes were obtained, regardless of whether or not there was a visible airway.

[0421] The data in Tables 47-71 below show mRNA expression sampled from cynomolgus monkey lung samples. Cynomolgus monkey AGER mRNA expression was quantified by probe-based quantitative PCR, normalized to cynomolgus monkey GAPDH expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0422] [Table 47]

[0423] [Table 48]

[0424] [Table 49]

[0425] [Table 50]

[0426] [Table 51]

[0427] [Table 52]

[0428] Table 53

[0429] Table 54

[0430] Table 55

[0431] Table 56

[0432] Table 57

[0433] Table 58

[0434] Table 59

[0435] Table 60

[0436] Table 61

[0437] Table 62

[0438] Table 63

[0439] Table 64

[0440] Table 65

[0441] Table 66

[0442] Table 67

[0443] Table 68

[0444] Table 69

[0445] Table 70

[0446] Table 71

[0447] As shown in the data in Tables 47-71 above, the RNAi agent AD09151 showed substantial inhibition compared to the control (greater than 70% inhibition observed at single inhaled doses of 0.31 mg / kg and 0.47 mg / kg), demonstrating its ability to robustly silence AGER expression in non-human primates.

[0448] Tissue RAGE protein was analyzed by Western blot. Based on tissue availability, pulverized lung tissue aliquots, including distal posterior and median lobe tissue, were homogenized in radioimmunoprecipitation assay buffer (RIPA) using a Qiagen bead-based homogenizer. Protein concentration was determined by bicinchoninic acid assay (BCA assay). Samples were prepared in Laemelli buffer and boiled. Gels were loaded with 10 μg of total protein and semi-dry transferred to polyvinylidene difluoride (PVDF) membranes. Blots were assayed using the Pierce Fast-Western kit (primary antibody (ab216329) at 1:1000 in the original blocking buffer for 30 minutes, HRP for 15 minutes, three 5-minute washes, and detection substrate West Pico for 5 minutes). The resulting blots were imaged on iBright for RAGE and total protein staining using membranes treated with total protein normalization reagent. Background signal-subtracted densitometry of both the bands of interest and the total protein band was quantified using iBright software.

[0449] Dose-response studies in cynomolgus monkeys following administration of RAGE RNAi agents showed that increasing dose concentrations of the RAGE RNAi agent resulted in steadily increasing RAGE protein inhibition in both the median and posterior lobes, with a maximum of approximately 80-88% RAGE protein inhibition at 0.47 mg / kg.

[0450] Serum samples were collected from cynomolgus monkeys on days 15 and 29 after administration of the RAGE RNAi agent, and serum sRAGE levels were quantified using a Gyros Protein Technologies assay. Table 72 below shows serum sRAGE levels normalized to baseline on day 15, along with standard deviations. Table 73 below shows serum sRAGE levels normalized to baseline on day 29, along with standard deviations.

[0451] [Table 72]

[0452] [Table 73]

[0453] After dosing with the RAGE RNAi agents, cynomolgus monkeys showed a significant reduction in serum sRAGE levels compared to baseline levels. As shown in Tables 72 and 73, a dose response was observed in which increasing dose concentrations of the RAGE RNAi agents resulted in a steady reduction in sRAGE levels (greater sRAGE inhibition), with a maximum of about 39-43% serum sRAGE levels (about 57-61% inhibition) at days 15 and 29 after exposure to the RAGE RNAi agents.

[0454] Other embodiments While the invention has been described in conjunction with the detailed description, it should be understood that the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. An RNAi agent for inhibiting expression of an advanced glycation end products receptor gene, comprising: an antisense strand comprising the nucleotide sequence of any one of the modified sequences provided in Table 3; a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; Including, The RNAi agent, wherein all or substantially all of said nucleotides are modified nucleotides.

2. 2. The RNAi agent of claim 1, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

3. The RNAi agent of claim 1, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

4. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence of any one of the modified sequences provided in Table 4.

5. The RNAi agent of claim 1, which is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, Table 9B, or Table 10.

6. The RNAi agent has the following nucleotide sequence (5' to 3'): UUGUGUUCAGUUUCCAUUC (SEQ ID NO:55); UGAUGUUUUGAGCACCUAC (SEQ ID NO:65); UUCCAUUCCUGUUCAUUGC (SEQ ID NO:73); UUGUGUUCAGUUUCCAUUCCG (SEQ ID NO: 7); UGAUGUUUUGAGCACCUACUC (SEQ ID NO: 9); or UUCCAUUCCUGUUCAUGCCU (SEQ ID NO: 8) and an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of The RNAi agent of claim 1 , wherein all or substantially all of the nucleotides are modified nucleotides.

7. The sense strand has the following nucleotide sequence (5' to 3'): GAAUGGAAACUGAACACAA (SEQ ID NO: 298); GUAGGUGCUCAAAACAUCA (SEQ ID NO: 308); GCAAUGAACAGGAAUIGAA (SEQ ID NO: 316); CGGAAUGGAAACUGAACACAA (SEQ ID NO: 19); GAGUAGGUGCUCAAAACAUCA (SEQ ID NO: 20); or AGGCAAUGAAACAGGAAUIGAA (SEQ ID NO: 21) or consisting essentially of, or comprising, a nucleotide sequence that differs by 0 or 1 nucleotide from one of The RNAi agent of claim 6, wherein all or substantially all of the nucleotides are modified nucleotides.

8. The following nucleotide sequence (5' to 3'): usUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO:2); cPrpusUfsgsUfgUfuCfaGfuUfuCfcAfuUfcCfsg (SEQ ID NO: 3); usGfsasuuguuuugaGfcAfcCfuacusc (SEQ ID NO:5); cPrpusGfsasuuguuuugaGfcAfcCfuacusc (SEQ ID NO:6); usUfscsCfaUfuCfcUfgUfuCfaUfuGfcCfsu (SEQ ID NO: 4); an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of: wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, Uf represents 2'-fluoro uridine; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; s represents a phosphorothioate linkage; all or substantially all of the nucleotides on the sense strand are modified nucleotides; and the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both. The RNAi agent of claim 1.

9. The sense strand has the following nucleotide sequence (5' to 3'): gsagagGfuGfcUfcaaaacauca (SEQ ID NO: 14); asggcaaugAfAfCfaggaauigaa (SEQ ID NO: 15); csggaauggAfAfAfcugaacacaa (SEQ ID NO: 13); comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of: wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, i represents 2'-O-methyl inosine, u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, Uf represents 2'-fluoro uridine; s represents a phosphorothioate linkage; all or substantially all of the nucleotides on the antisense strand are modified nucleotides; and the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both. The RNAi agent of claim 1.

10. The RNAi agent of claim 1 , wherein the RNAi agent is linked to a targeting ligand, the targeting ligand having affinity for a cellular receptor expressed on an epithelial cell.

11. The RNAi agent of claim 10 , wherein the targeting ligand comprises an integrin targeting ligand.

12. The RNAi agent of claim 11, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.

13. The targeting ligand has the following structure: 【Chemistry 1】 or a pharma- ceutically acceptable salt thereof, or 【Chemistry 2】 or a pharma- ceutically acceptable salt thereof, 【Chemistry 3】 indicates a point of attachment to the RNAi agent; The RNAi agent of claim 12.

14. The targeting ligand is: 【Chemistry 4】 【Chemistry 5】 【Chemistry 6】 【Chemistry 7】 【Chemistry 8】 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】 【Chemistry 12】 having a structure selected from the group consisting of: 【Chemistry 13】 indicates a point of attachment to the RNAi agent; The RNAi agent of claim 10.

15. The RNAi agent of claim 10, wherein the targeting ligand is conjugated to the 5' end of the sense strand.

16. 2. The RNAi agent of claim 1, conjugated to a targeting ligand and having a double-stranded structure of AC000292, AC001266, AC001267, or AC001268.

17. 17. A composition comprising the RNAi agent of any one of claims 1 to 16, wherein the RNAi agent further comprises a pharma- ceutically acceptable excipient, and the RNAi agent is a sodium salt.

18. 20. The composition of claim 17, formulated for administration by inhalation.

19. 20. The composition of claim 18, delivered by a metered dose inhaler, a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler.

20. A method for inhibiting expression of an advanced glycation end products receptor gene in a cell, the method comprising introducing into the cell an effective amount of an RNAi agent described in any one of claims 1 to 16 or a composition described in any one of claims 17 to 19.

21. 14. The RNAi agent of any one of claims 1 to 13 for use in the treatment of a disease, disorder or condition mediated at least in part by membrane-based RAGE activity and / or AGER gene expression.

22. The RNAi agent of claim 21 , wherein the disease is a respiratory disease.

23. 23. The RNAi agent of claim 22, wherein the respiratory disease is cystic fibrosis, pneumonia, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, airway infection, primary ciliary dyskinesia, or lung cancer cystic fibrosis.

24. 22. The RNAi agent of claim 21, wherein the disease is chronic obstructive pulmonary disease (COPD).

25. The RNAi agent of claim 21 , wherein the disease is an ocular disease, and the ocular disease is dry eye syndrome.

26. The RNAi agent of any one of claims 21 to 25, wherein the RNAi agent is administered at a deposited amount of about 0.01 mg / kg to about 5.0 mg / kg of subject body weight.

27. The RNAi agent of any one of claims 21 to 25, wherein the RNAi agent is administered at a deposition amount of about 0.03 mg / kg to about 2.0 mg / kg of subject body weight.

28. A composition according to any one of claims 17 to 19 for use in the treatment of a disease, disorder or condition mediated at least in part by receptor activity of the receptor for advanced glycation endproducts and / or expression of the receptor for advanced glycation endproducts gene.

29. Use of a composition according to any one of claims 17 to 19 for the manufacture of a medicament for treating a disease, disorder or condition mediated at least in part by receptor activity of the receptor for advanced glycation endproducts and / or expression of the receptor for advanced glycation endproducts gene.

30. 30. The use according to claim 28 or 29, wherein the disease is pulmonary inflammation.

31. A method of making an RNAi agent according to any one of claims 1 to 16, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

Images