Microdystrophin gene therapy administration for the treatment of dystrophinopathies

Abstract

Methods are provided for treating or ameliorating symptoms of dystrophic disorders, such as Duchenne muscular dystrophy and Becker muscular dystrophy, by administration of a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) containing a transgene encoding microdystrophin.

Description

[Technical Field]

[0001] The present invention relates to the treatment of dystrophinopathies by the administration of a gene therapy vector, such as an AAV gene therapy vector in which the transgene encodes micro-dystrophin. [Background technology]

[0002] A group of neuromuscular disorders called dystrophinopathies is caused by mutations in the DMD gene. Each dystrophinopathy has a distinct phenotype, and all patients suffer from muscle weakness and ultimately from cardiomyopathy, ranging from severe to severe. Duchenne muscular dystrophy (DMD) is a severe, X-linked, progressive neuromuscular disease that affects approximately 1 in 3,600 to 9,200 male births. The disorder is caused by a frameshift mutation in the dystrophin gene that abolishes expression of the dystrophin protein. Due to the lack of dystrophin protein, skeletal muscle, and ultimately cardiac and respiratory muscles (e.g., intercostal muscles and diaphragm), degenerate and cause premature death. Progressive weakness and muscle atrophy begin in childhood. Affected individuals experience difficulty breathing, respiratory infections, and swallowing problems. Almost all DMD patients develop cardiomyopathy. Pneumonia, exacerbated by cardiac involvement, is the most frequent cause of death, frequently occurring before the third decade of life.

[0003] Becker muscular dystrophy (BMD) has less severe symptoms than DMD, but still leads to early death. Compared to DMD, BMD is characterized by late-onset skeletal muscle weakness. DMD patients become wheelchair dependent before age 13, whereas those with BMD lose ambulation and require a wheelchair after age 16. BMD patients also exhibit preserved neck flexor strength, differing from their DMD counterparts. Despite milder skeletal muscle involvement, heart failure from DMD-associated dilated cardiomyopathy (DCM) is a common cause of morbidity and the most common cause of death in BMD, occurring on average in the mid-40s.

[0004] Dystrophin is a cytoplasmic protein encoded by the DMD gene that functions to connect cytoskeletal actin filaments to membrane proteins. Normally, the dystrophin protein is primarily localized in skeletal and cardiac muscles, with smaller amounts expressed in the brain. It acts as a shock absorber during muscle fiber contraction by connecting the actin of the contractile apparatus to the layer of connective tissue surrounding each muscle fiber. In muscle, dystrophin is localized on the cytoplasmic surface of the sarcolemma membrane.

[0005] The DMD gene is the largest known human gene. The most common mutations causing DMD or BMD are large deletions of one or more exons (60-70%), but duplication mutations (5-10%) and single-nucleotide variants (including small deletions or insertions, single-base changes, and splice-site alterations, which account for approximately 25-35% of pathogenic variants in men with DMD and approximately 10-20% of pathogenic variants in men with BMD) can also cause pathogenic dystrophin variants. In DMD, mutations often lead to frameshifts that result in premature stop codons and truncated, nonfunctional, or unstable proteins. Nonsense point mutations can also result in premature stop codons with the same consequences. While DMD-causing mutations can affect any exon, exons 2-20 and 45-55 are common hotspots for large deletions and duplications. In-frame deletions result in the less severe form of Becker muscular dystrophy (BMD), in which patients express truncated, partially functional dystrophin.

[0006] Full-length dystrophin is a large (427 kDa) protein containing multiple subdomains that contribute to its function: from the amino terminus to the carboxy terminus, these subdomains include an N-terminal actin-binding domain, a central so-called "rod" domain, a cysteine-rich domain, and finally a carboxy-terminal domain or region. The rod domain consists of four proline-rich hinge domains (abbreviated as H) and, in the following order: the first hinge domain (H1), three spectrin-like repeats (R1, R2, R3), the second hinge domain (H2), 16 or more spectrin-like repeats (R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19), the third hinge domain (H3), five or more spectrin-like repeats (R20, R21, R22, R23, R24), and 24 spectrin-like repeats (abbreviated as R) in the fourth hinge domain (H4) (including the WW domain). The rod domains are followed by a cysteine-rich domain and a COOH (C)-terminal (CT) domain.

[0007] Advances in the use of adeno-associated virus (AAV)-mediated gene therapy to potentially treat various rare diseases have raised hopes and interest that AAV can be used to treat DMD, BMD, and less severe dystrophinopathy. Due to the payload size limitations of AAV vectors, attention has focused on creating micro- or mini-dystrophins, smaller versions of dystrophin that eliminate non-essential subdomains while maintaining at least some of the functionality of the full-length protein. AAV-mediated micro-dystrophin gene therapy in mdx mice, an animal model of DMD, has been reported to demonstrate efficient expression in muscle and improved muscle function (see, e.g., Wang et al., J. Orthop. Res. 27:421 (2009)).

[0008] Thus, there is a need in the art for a method of administering an AAV vector encoding micro-dystrophin at a therapeutically effective dose to treat or ameliorate symptoms of a dystrophinopathy, including DMD or BMD, preferably while minimizing the immune response to the therapeutic protein. Summary of the Invention

[0009] Methods are provided for treating or ameliorating symptoms of dystrophinopathy by administration of rAAV vector particles ("constructs," as used herein, made from vectors, generally describe the arrangement of dystrophin protein subunits that form microdystrophin, may include regulatory elements that control microdystrophin expression, and include cis-plasmids used to produce recombinant AAV particles and recombinant genomes packaged in AAV particles) containing a nucleic acid genome encoding microdystrophin, such as the recombinant genome of Figure 2. Based on pharmacological studies, for example, as described in Examples 6, 7, and 8 (hereinafter, Sections 6.6, 6.7, and 6.8), methods are provided for treating a subject in need thereof by administration, including peripheral administration, such as intravenous administration, of therapeutically effective dosages and uses of genetic constructs encoding microdystrophin proteins for use in gene therapy. Based on the in vivo pharmacology studies described herein, methods of administering the micro-dystrophin gene therapy of the present disclosure result in improvements in dystrophinopathy disease symptoms and biomarkers such as creatine kinase activity, gastrocnemius muscle lesions, T2 relaxation times of muscle lesions, North Star Ambulatory Assessment (NSAA) scores, and other markers of mobility and muscle strength, cardiac function, and pulmonary function after at least 12, 26, or 52 weeks of administration.

[0010]

[0006] Embodiments described herein are methods of treating a dystrophinopathy in a subject, the method comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier, wherein the rAAV particles comprise a transgene encoding a micro-dystrophin protein, the micro-dystrophin protein comprising, from the amino terminus to the carboxy terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, CR is the cysteine-rich region of dystrophin or at least a portion thereof that binds to β-dystroglycan, and CT is at least a portion of the C-terminal region of dystrophin, the portion of which includes the α1-syntrophin binding site and / or the α-dystrobrevin binding site. In certain embodiments, the CT domain comprises or consists of the proximal 194 amino acids of the C-terminus of dystrophin (amino acid sequence of SEQ ID NO: 16), or at least the proximal portion of the C-terminus encoding human dystrophin amino acid residues 3361-3554 of SEQ ID NO: 92 (UniProtKB-P11532), or at least the proximal portion of the C-terminus encoded by exons 70-74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75. Alternatively, the CT domain is truncated and includes the α1-syntrophin binding site but not the α-dystrobrevin binding site, such as the amino acid sequence of SEQ ID NO: 83. The constructs include regulatory sequences, such as a muscle-specific promoter sequence, including the SPc5-12 promoter (SEQ ID NO:39), or alternatively, a truncated SPc5-12 promoter (SEQ ID NO:40) or a variant, mutant, or transcriptionally active portion thereof (e.g., the modified Spc5-12 promoter Spc5v1 (SEQ ID NO:93) or Spc5v2 (SEQ ID NO:94)), and a polyadenylation signal sequence, such as a small polyA signal sequence (SEQ ID NO:42). Specific constructs include RGX-DYS1 and RGX-DYS5 (see FIG. 2 ), which have the micro-dystrophin encoding nucleotide sequences of SEQ ID NO:20 and SEQ ID NO:81, respectively, operably linked to regulatory sequences and flanked by AAV2 ITR sequences, with the entire construct, including the recombinant genome, having the nucleotide sequence of SEQ ID NO:53 or SEQ ID NO:82, respectively.In an embodiment, the rAAV particle containing the recombinant genome is AAV8. For example, the rAAV particle or gene therapy vector is AAV8-RGX-DYS1 (recombinant AAV8 containing a polynucleotide having the nucleotide sequence of SEQ ID NO: 53).

[0011] In certain embodiments, a therapeutically effective amount of rAAV particles, including embodiments, AAV8-RGX-DYS1, comprising a transgene encoding micro-dystrophin as disclosed herein is 1×10 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 Contains 5 x 10 genome copies / kg 13 ~1×10 15 In certain embodiments, a therapeutically effective amount of rAAV particles comprising a transgene encoding micro-dystrophin disclosed herein, including AAV8-RGX-DYS1, is administered intravenously or intramuscularly at a dose of 1 x 10 genome copies / kg. 14 , 1.1×10 14 , 1.2 × 10 14 , 1.3 × 10 14 , 1.4×10 14 , 1.5×10 14 , 1.6×10 14 , 1.7×10 14 , 1.8×10 14 , 1.9×10 14 , 2 × 10 14 , 2.1×10 14 , 2.2 × 10 14 , 2.3 × 10 14 , 2.4 × 10 14 , 2.5×10 14 , 2.6×10 14 , 2.7 × 10 14 , 2.8×10 14 , 2.9 × 10 14 , or 3 × 10 14 In certain embodiments, a therapeutically effective amount of rAAV particles (comprising AAV8-RGX-DYS1) is administered intravenously or intramuscularly at a dose of 1 x 10 genome copies / kg. 14In another embodiment, a therapeutically effective amount of rAAV particles (comprising AAV8-RGX-DYS1) is administered intravenously at a dose of 2×10 14 In yet another embodiment, a therapeutically effective amount of rAAV particles (comprising AAV8-RGX-DYS1) is administered intravenously at a dose of 3×10 genome copies / kg. 14 The therapeutic agent is administered intravenously at a dose of 1000 genome copies / kg. In embodiments, subjects receiving the therapeutic agent are administered prophylactic immunosuppressants either before, concurrently with, and / or following administration of the rAAV particles carrying a transgene encoding micro-dystrophin disclosed herein, including as maintenance therapy after administration. Immunosuppressants include corticosteroids, anti-complement agents such as anti-C3 and C5 antibodies, anti-cytokine agents such as anti-IL-6 and anti-IL6R antibodies, anti-CD20 antibodies, combinations of anti-C5 and anti-CD20 antibodies, rapamycin, or anti-IgG therapy such as immunosuppressant enzymes. In embodiments, the combined immunosuppressive regimen includes a daily dose of oral prednisolone and / or multiple doses of eculizumab (anti-C5 antibody, SOLIRIS®) before and after administration of micro-dystrophin and, optionally, oral sirolimus (rapamycin, also known as RAPAMUNE®).

[0012] In certain embodiments, the pharmaceutically acceptable carrier comprises modified Dulbecco's phosphate buffered saline (DPBS) supplemented with a sucrose buffer (pH 7.4) containing 0.2 g / L potassium chloride, 0.2 g / L monobasic potassium phosphate, 1.2 g / L anhydrous dibasic sodium phosphate, 5.8 g / L sodium chloride, 40 g / L sucrose, and 0.01 g / L poloxamer 188.

[0013] A pharmaceutical composition comprising a recombinant vector encoding microdystrophin as provided herein, including a pharmaceutically acceptable excipient, and administering 1 x 10 mAbs to a subject in need of treatment for any dystrophinopathy, such as Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), X-linked dilated cardiomyopathy, and female carriers of DMD or BMD. 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 5 x 10 genome copies / kg 13 ~1×10 15 Also provided are methods of doing so by administering a gene therapy vector described herein (including AAV8-RGX-DYS1), including intravenous administration at a dose of genome copies / kg. Methods are provided for treating, ameliorating symptoms of, or managing dystrophinopathy, such as Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy, by administering an rAAV (including AAV8-RGX-DYS1) containing a transgene or gene cassette described herein, whereby microdystrophin is delivered to muscles (including skeletal, cardiac, and / or smooth muscles) upon administration to a subject in need thereof. In certain embodiments, the rAAV is administered systemically, including intravenously or intramuscularly.

[0014] Also provided are methods of reducing inflammation or fibrosis in muscle and / or muscle degeneration in a subject in need thereof comprising administering one or more of the disclosed pharmaceutical compositions.

[0015] The invention is illustrated by the following examples which describe the construction and production of micro-dystrophin vectors, as well as in vitro and in vivo assays demonstrating efficacy. 3.1 Embodiments of the present invention 1. A method of treating a dystrophinopathy in a subject in need thereof, comprising administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier; the rAAV particle comprises a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT comprises at least a portion of CT that includes an α1-syntrophin binding site; The therapeutically effective amount of the rAAV particles is 5×10 13 ~1×10 15 The method, wherein the compound is administered intravenously or intramuscularly at a dose of 1000 genome copies / kg. 2. The method of embodiment 1, wherein the CT comprises or consists of the proximal 194 amino acids of the C-terminus of dystrophin, or at least the proximal portion of the C-terminus encoding human dystrophin amino acid residues 3361-3554 of SEQ ID NO: 92 (UniProtKB-P11532), or at least the proximal portion of the C-terminus encoded by exons 70-74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75. 3. The method of embodiment 1 or 2, wherein the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 1. 4. The method of embodiment 3, wherein said micro-dystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 20. 5. The method of embodiment 1, wherein the CT comprises or consists of the amino acid sequence of SEQ ID NO: 83, or an amino acid sequence comprising the α1-syntrophin binding site but not the dystrobrevin binding site. 6. The method of embodiment 1 or 5, wherein the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 79. 7. The method of embodiment 6, wherein said microdystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 81. 8. The method of any one of embodiments 1 to 7, wherein the transgene further comprises a transcriptional regulatory element operably linked to the nucleic acid sequence encoding the micro-dystrophin protein, the transcriptional regulatory element promoting expression in muscle. 9. The method of embodiment 8, wherein the transcriptional regulatory element comprises a muscle-specific promoter. 10. The method of embodiment 9, wherein the muscle-specific promoter is a skeletal muscle, smooth muscle, or cardiac muscle-specific promoter. 11. The method of any one of embodiments 9 or 10, wherein the muscle-specific promoter is SPc5-12, or a transcriptionally active portion or variant thereof. 12. The method of embodiment 11, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 39. 13. The method of any one of embodiments 1 to 12, wherein the transgene comprises a polyadenylation signal 3' of the nucleic acid sequence encoding the micro-dystrophin protein. 14. The method of any one of embodiments 1 to 13, wherein the transgene comprises an intron sequence between the promoter and the micro-dystrophin coding sequence. 15. The method of embodiment 14, wherein the intron sequence is a VH4 intron sequence (SEQ ID NO: 41). 16. The method of any one of embodiments 1 to 4 and 8 to 13, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 53. 17. The method of any one of embodiments 1 and 5 to 13, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 82. 18. The method of any one of embodiments 1 to 17, wherein the rAAV particles have a capsid protein comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 77. 19. The method of embodiment 18, wherein the rAAV is an AAV8 serotype. 20. The method of any one of embodiments 1-19, wherein the dystrophinopathy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy. 21. The therapeutically effective amount of the rAAV particles is 1 x 10 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 21. The method of any one of embodiments 1 to 20, wherein the antibody is administered at a dose of genome copies / kg. 22. The method of any one of embodiments 1-21, wherein the pharmaceutical composition is administered intravenously. 23. The method of any one of embodiments 1-22, wherein creatine kinase activity is reduced in the subject by 12 weeks, 24 weeks, 1 year, or 2 years after said administration, compared to levels before said administration. 24. The method of embodiment 23, wherein said reduction in creatine kinase activity is 0.5-fold to 1.5-fold. 25. The method of embodiment 23, wherein said decrease in creatine kinase activity is between 3,000 and 10,000 creatine kinase units per liter. 26. The method of any one of embodiments 1-25, wherein the subject has a reduced lesion in the gastrocnemius muscle by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the lesion in the gastrocnemius muscle before the administration. 27. The method of embodiment 26, wherein the lesion in the subject's gastrocnemius muscle is assessed using magnetic resonance imaging (MRI). 28. The method of any one of embodiments 26-27, wherein the reduction in lesions in the gastrocnemius muscle after administration is about 3-10% compared to the lesions in the gastrocnemius muscle before administration. 29. The method of any one of embodiments 1-28, wherein the subject's gastrocnemius muscle volume is reduced by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the gastrocnemius muscle volume before the administration. 30. The gastrocnemius muscle volume loss is 20 to 100 mm 3 30. The method of embodiment 29, wherein 31. The method of any one of embodiments 1-30, wherein the T2 relaxation time of the lesion in muscle is decreased by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the T2 relaxation time before the administration. 32. The method of embodiment 31, wherein the decrease is between 2 and 8 milliseconds. 33. The method of any one of embodiments 31-32, wherein the lesion in the muscle is a lesion in the gastrocnemius muscle. 34. The method of any one of embodiments 1-33, wherein the subject exhibits a walking score of about -1 to 2 by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition. 35. The method of embodiment 34, wherein by 12 weeks after the administration of the pharmaceutical composition, the subject exhibits a walking score of about 1. 36. The method of any one of embodiments 1-35, wherein the North Star Ambulatory Assessment (NSAA) score is increased by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the NSAA score before the administration. 37. The method of embodiment 36, wherein the increase is from 0 to 1, from 0 to 2, or from 1 to 2. 38. The method of any one of embodiments 1-37, wherein the subject reduces the amount of time it takes to stand, run / walk a determined distance, or climb a set number of stairs by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition. 39. The method of embodiment 38, wherein the determined distance is 10 meters. 40. The method of any one of embodiments 38-39, wherein the set number of steps is four. 41. The method of any one of embodiments 38-40, wherein the decrease in the amount of time it takes to stand is at least a 5%, 10%, 20%, or 30% decrease compared to before the administration. 42. The method of any one of embodiments 38-41, wherein the reduction in the amount of time it takes to run / walk the determined distance is at least a 5%, 10%, 20%, or 30% reduction compared to before the administration. 43. The method of any one of embodiments 38-42, wherein the reduction in the amount of time it takes to climb a set number of stairs is at least a 5%, 10%, 20%, or 30% reduction compared to before the administration. 44. The method of any one of embodiments 1-43, wherein the subject exhibits improved cardiac function by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to cardiac function before the administration. 45. The method of any one of embodiments 1-44, wherein the subject exhibits improved lung function by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to lung function before the administration. 46. ​​A method for reducing inflammation and / or fibrosis in muscle in a subject in need thereof, comprising: administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier; the rAAV particle comprises a gene expression cassette comprising a nucleic acid sequence encoding a micro-dystrophin protein; the micro-dystrophin protein consists of dystrophin domains arranged from amino terminus to carboxy terminus as ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT comprises the entire C-terminus of dystrophin or a portion of CT comprising the α1-syntrophin binding site and the dystrobrevin binding site; The therapeutically effective amount of the rAAV particles is 5×10 per kilogram 13 ~1×10 15 It is administered intravenously or intramuscularly at a dose of 100 genome copies (GC / kg) The method, wherein the administering results in delivery of the micro-dystrophin protein to the muscle of the subject. 47. A method for reducing muscle degeneration in a subject in need thereof, comprising: administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier; the rAAV particle comprises a gene expression cassette comprising a nucleic acid sequence encoding a micro-dystrophin protein; the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT comprises the entire C-terminus of dystrophin or a portion of CT comprising the α1-syntrophin binding site and the dystrobrevin binding site; The therapeutically effective amount of the rAAV particles is 5×10 per kilogram 13 ~1×10 15 It is administered intravenously or intramuscularly at a dose of 100 genome copies (GC / kg) The method, wherein the administering results in delivery of the micro-dystrophin protein to the muscle of the subject. 48. The method of embodiment 46 or 47, wherein the muscle is the diaphragm of the subject. 49. A method for modifying gait in a subject in need thereof, comprising: administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier; the rAAV particle comprises a gene expression cassette comprising a nucleic acid sequence encoding a micro-dystrophin protein; the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT comprises at least a portion of CT comprising an α1-syntrophin binding site; The therapeutically effective amount of rAAV particles is 5×10 per kilogram 13 ~1×10 15 It is administered intravenously or intramuscularly at a dose of 100 genome copies (GC / kg) The method, wherein the subject's gait is changed 12 weeks after the administration compared to the subject's gait before the administration. 50. The method of embodiment 49, wherein altering the gait comprises an increase in balance, a change in stride length, a decrease in head movement, or a combination thereof. 51. The method of any one of embodiments 46 to 50, wherein the CT comprises or consists of the proximal 194 amino acids of the C-terminus of dystrophin, or at least the proximal portion of the C-terminus encoding human dystrophin amino acid residues 3361 to 3554 of SEQ ID NO: 92 (UniProtKB-P11532), or at least the proximal portion of the C-terminus encoded by exons 70 to 74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75. 52. The method of any one of embodiments 46 to 51, wherein the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 1. 53. The method of embodiment 52, wherein the micro-dystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 20. 54. A method according to any one of embodiments 46 to 53, wherein the CT comprises or consists of the amino acid sequence of SEQ ID NO: 83, or an amino acid sequence comprising the α1-syntrophin binding site but not the dystrobrevin binding site. 55. The method of any one of embodiments 46 to 54, wherein the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 79. 56. The method of embodiment 55, wherein the microdystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 81. 57. The method of any one of embodiments 46 to 56, wherein the transgene further comprises a transcriptional regulatory element operably linked to the nucleic acid sequence encoding the micro-dystrophin protein, the transcriptional regulatory element promoting expression in muscle. 58. The method of embodiment 57, wherein the transcriptional regulatory element comprises a muscle-specific promoter. 59. The method of embodiment 58, wherein the muscle-specific promoter is a skeletal muscle, smooth muscle, or cardiac muscle-specific promoter. 60. The method of any one of embodiments 58 or 59, wherein the muscle-specific promoter is SPc5-12, or a transcriptionally active portion or variant thereof. 61. The method of embodiment 58, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 39. 62. The method of any one of embodiments 46 to 61, wherein the transgene comprises a polyadenylation signal 3' of the nucleic acid sequence encoding the micro-dystrophin protein. 63. The method of any one of embodiments 46 to 62, wherein the transgene comprises an intron sequence between the promoter and the micro-dystrophin coding sequence. 64. The method of embodiment 63, wherein the intron sequence is a VH4 intron sequence (sequence number 41). 65. The method of any one of embodiments 46 to 64, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 53. 66. The method of any one of embodiments 46 to 65, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 82. 67. The method of any of embodiments 46 to 66, wherein the rAAV particles have a capsid protein comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 77. 68. The method of embodiment 67, wherein the rAAV is of the AAV8 serotype. 69. The therapeutically effective amount of the rAAV particles is 1 x 10 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 The method of any one of embodiments 46 to 68, wherein the antibody is administered at a dose of genome copies / kg. 70. The method of any one of embodiments 46-69, wherein the pharmaceutical composition is administered intravenously. 71. The method of any one of embodiments 1 to 70, further comprising prophylactically administering an immunosuppressant therapy to the subject before, simultaneously with, and / or after the administration of the AAV particles. 72. The method of any one of embodiments 71, wherein the immunosuppressant therapy is a corticosteroid, an anti-C5 antibody, an anti-IL6 or anti-IL6R antibody, and an anti-CD20 antibody, a combination of an anti-C5 antibody and an anti-CD20 antibody, rapamycin, an immurifidase, or a combination thereof. 73. A pharmaceutical composition for use in treating a dystrophinopathy in a subject in need thereof, the pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier; the rAAV particle comprises a gene expression cassette comprising a nucleic acid sequence encoding a micro-dystrophin protein; the micro-dystrophin protein comprises or consists of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT comprises at least a portion of CT comprising an α1-syntrophin binding site; The therapeutically effective amount of rAAV particles is 5×10 13 ~1×10 15 The pharmaceutical composition is administered intravenously or intramuscularly at a dose of 1 genome copy / kg. 74. The composition of embodiment 73, wherein the CT comprises or consists of the proximal 194 amino acids of the C-terminus of dystrophin, or at least the proximal portion of the C-terminus encoding human dystrophin amino acid residues 3361 to 3554 of SEQ ID NO: 92 (UniProtKB-P11532), or at least the proximal portion of the C-terminus encoded by exons 70 to 74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75. 75. The composition of embodiment 73 or 74, wherein the microdystrophin protein has the amino acid sequence of SEQ ID NO: 1. 76. The composition of embodiment 75, wherein the microdystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 20. 77. The composition described in embodiment 73, wherein the CT comprises or consists of the amino acid sequence of SEQ ID NO: 83, or an amino acid sequence comprising the α1-syntrophin binding site but not the dystrobrevin binding site. 78. The composition of embodiment 73 or 77, wherein the microdystrophin protein has the amino acid sequence of SEQ ID NO: 79. 79. The composition of embodiment 78, wherein the microdystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 81. 80. The composition of any one of embodiments 73 to 79, wherein the transgene further comprises a transcriptional regulatory element operably linked to the nucleic acid sequence encoding the micro-dystrophin protein that promotes expression in muscle. 81. The composition of embodiment 80, wherein the transcriptional regulatory element comprises a muscle-specific promoter. 82. The composition of embodiment 81, wherein the muscle-specific promoter is a skeletal muscle, smooth muscle, or cardiac muscle-specific promoter. 83. The composition of any one of embodiments 81 or 82, wherein the muscle-specific promoter is SPc5-12, or a transcriptionally active portion or variant thereof. 84. The composition of embodiment 83, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 39. 85. The composition of any one of embodiments 73 to 84, wherein the transgene comprises a polyadenylation signal 3' of the nucleic acid sequence encoding the micro-dystrophin protein. 86. The composition of any one of embodiments 73 to 85, wherein the transgene comprises an intron sequence between the promoter and the micro-dystrophin coding sequence. 87. The composition of embodiment 86, wherein the intron sequence is a VH4 intron sequence (sequence number 41). 88. The composition of any one of embodiments 73 to 76 and 80 to 85, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 53. 89. The composition of any one of embodiments 73 and 77 to 85, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 82. 90. The composition of any of embodiments 73-89, wherein the rAAV particles have a capsid protein comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 77. 91. The composition of embodiment 90, wherein the rAAV is of the AAV8 serotype. 92. The composition of any one of embodiments 73-91, wherein the dystrophinopathy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy. 93. The therapeutically effective amount of the rAAV particles is 1 x 10 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 The composition of any one of embodiments 73-92, administered at a dose of genome copies / kg. 94. The composition of any one of embodiments 73-93, wherein the pharmaceutical composition is administered intravenously. 95. The composition of any one of embodiments 73-94, wherein creatine kinase activity is reduced in the subject by 12 weeks, 24 weeks, 1 year, or 2 years after the administration, compared to levels before the administration. 96. The composition of embodiment 95, wherein the reduction in creatine kinase activity is 0.5-fold to 1.5-fold. 97. The composition of embodiment 95, wherein the reduction in creatine kinase activity is between 3,000 and 10,000 creatine kinase units per liter. 98. The composition of any one of embodiments 73-97, wherein the subject has a reduced lesion in the gastrocnemius muscle by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the lesion in the gastrocnemius muscle before the administration. 99. The composition of embodiment 98, wherein the lesion in the subject's gastrocnemius muscle is assessed using magnetic resonance imaging (MRI). 100. The composition of any one of embodiments 98 to 99, wherein the reduction in lesions in the gastrocnemius muscle after administration is about 3 to 10% compared to the lesions in the gastrocnemius muscle before administration. 101. The composition of any one of embodiments 73-100, wherein the subject's gastrocnemius muscle volume is reduced by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the gastrocnemius muscle volume before the administration. 102. The gastrocnemius muscle volume loss is 20 to 100 mm 3 102. The composition of embodiment 101, wherein 103. The composition of any one of embodiments 73-102, wherein the T2 relaxation time of the lesion in muscle is decreased by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to the T2 relaxation time before the administration. 104. The composition of embodiment 103, wherein the decrease is 2 to 8 milliseconds. 105. The composition of any one of embodiments 103-104, wherein the lesion in the muscle is a lesion in the gastrocnemius muscle. 106. The composition of any one of embodiments 73-105, wherein the subject exhibits a walking score of about -1 to 2 by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition. 107. The composition of embodiment 106, wherein the subject exhibits a walking score of about 1 by 12 weeks after the administration of the pharmaceutical composition. 108. The composition of any one of embodiments 73 to 107, wherein the North Star Ambulatory Assessment (NSAA) score is increased by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition compared to the NSAA score before the administration. 109. The composition of embodiment 108, wherein the increase is from 0 to 1, from 0 to 2, or from 1 to 2. 110. The composition of any one of embodiments 73-109, wherein the subject reduces the amount of time it takes to stand, run / walk a determined distance, or climb a set number of stairs by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition. 111. The composition of embodiment 110, wherein the determined distance is 10 meters. 112. The composition of any one of embodiments 110-111, wherein the set number of steps is 4. 113. The composition of any one of embodiments 110-112, wherein the reduction in the amount of time it takes to stand up is at least a 5%, 10%, 20%, or 30% reduction compared to before the administration. 114. The composition of any one of embodiments 110 to 113, wherein the reduction in the amount of time it takes to run / walk the determined distance is at least a 5%, 10%, 20%, or 30% reduction compared to before the administration. 115. The composition of any one of embodiments 110-114, wherein the reduction in the amount of time it takes to climb a set number of stairs is at least a 5%, 10%, 20%, or 30% reduction compared to before the administration. 116. The composition of any one of embodiments 73 to 115, wherein the subject exhibits improved cardiac function by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to cardiac function before the administration. 117. The composition of any one of embodiments 73 to 116, wherein the subject exhibits improved lung function by 12 weeks, 24 weeks, 1 year, or 2 years after the administration of the pharmaceutical composition, compared to lung function before the administration. 118. The composition of any one of embodiments 73 to 117, further comprising prophylactically administering an immunosuppressant therapy to the subject before, simultaneously with, and / or after the administration of the AAV particles. 119. The composition of embodiment 118, wherein the immunosuppressant therapy is a corticosteroid, an anti-C5 antibody, an anti-IL6 or anti-IL6R antibody, and an anti-CD20 antibody, a combination of an anti-C5 antibody and an anti-CD20 antibody, rapamycin, an immunofidase, or a combination thereof. 120. A method or composition according to any one of embodiments 1 to 119, wherein the subject is administered a prophylactic immunosuppressive regimen. 121. The method or composition of embodiment 120, wherein the prophylactic immunosuppressive regimen comprises (1) a daily dose of oral prednisolone from day 1 to week 8, (2) infusions of eculizumab before and after administration of the rAAV, and (3) daily oral sirolimus from day -7 to week 8, where day 1 is the day of rAAV administration. 122. The method or composition of embodiment 121, wherein oral prednisolone is administered at 1 mg / kg / day from day 1 to the end of week 8, where day 1 is the day of rAAV administration, and then, if no safety concerns are identified, the dose is reduced to 0.5 mg / kg / day from week 9 to week 10, and then, if no safety concerns are identified, the dose is reduced to 0.25 mg / kg / day from week 11 to week 12. 123. The method or composition of embodiment 121 or 122, wherein eculizumab is administered by infusion: (1) 600 mg eculizumab on days −9, −2, 4, and 12 for subjects weighing 10 to <20 kg; (2) 800 mg eculizumab on days −16, −9, −2, and 12 for subjects weighing 20 kg to <30 kg; (3) 900 mg eculizumab on days −16, −9, −2, and 12 for subjects weighing 30 kg to <40 kg; and (4) 1200 mg eculizumab on days −30, −23, −16, −9, −2, and 12 for subjects weighing 40 kg or more, wherein day 1 is the day of rAAV administration. 124. The sirolimus is administered at 3 mg / m on day -7. 2 1 mg / m2 divided into two doses each day from day -6 to week 8 2 / day to achieve a target blood concentration of 8-12 ng / ml and if safety studies remain stable, the dose will be reduced to 0.5 mg / m at week 9-10. 2 / day and, if safety studies remain stable, reduce the dose to 0.25 mg / m at 11-12 weeks. 2 124. The composition or method of any one of embodiments 121-123, wherein the amount of steroid hormone administered is reduced to 1 / day. 125. A pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier, the rAAV particle comprises a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT comprises at least a portion of CT that includes an α1-syntrophin binding site; The therapeutically effective amount of the rAAV particles is 5×10 13 ~1×10 15 The pharmaceutical composition is administered intravenously or intramuscularly at a dose of 1 genome copy / kg. 126. A pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier, wherein the rAAV particles comprise a transgene encoding a micro-dystrophin protein, and the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 1. 127. A pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier, wherein the rAAV particles are AAV8 particles and comprise an artificial genome having the nucleotide sequence of SEQ ID NO: 53. 128. The method of embodiments 125-127, wherein the pharmaceutically acceptable carrier comprises modified Dulbecco's phosphate buffered saline (DPBS) supplemented with a sucrose buffer (pH 7.4) comprising 0.2 g / L potassium chloride, 0.2 g / L monobasic potassium phosphate, 1.2 g / L anhydrous dibasic sodium phosphate, 5.8 g / L sodium chloride, 40 g / L sucrose, and 0.01 g / L poloxamer 188. 129. A method for treating a dystrophinopathy in a subject in need thereof, the method comprising intravenously administering to the subject a pharmaceutical composition according to any one of embodiments 125 to 128. 130. The method of embodiment 129, wherein the dystrophinopathy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy. 131. The therapeutically effective amount of the rAAV particles is 1 x 10 14 , 1.1×10 14 , 1.2 × 10 14 , 1.3 × 10 14 , 1.4×10 14 , 1.5×10 14 , 1.6×10 14 , 1.7×10 14 , 1.8×10 14 , 1.9×10 14 , 2 × 10 14 , 2.1×10 14 , 2.2 × 10 14 , 2.3 × 10 14 , 2.4 × 10 14 , 2.5×10 14 , 2.6×10 14 , 2.7 × 10 14 , 2.8×10 14 , 2.9 × 10 14 , or 3 × 10 14 The method of any one of embodiments 129-130, wherein the dose is administered in genome copies / kg. 132. The therapeutically effective amount of the rAAV particles is 1 x 10 14 The method of any one of embodiments 129-130, wherein the dose is administered in genome copies / kg. 133. The therapeutically effective amount of the rAAV particles is 2 x 10 14 The method of any one of embodiments 129-130, wherein the dose is administered in genome copies / kg. 134. The therapeutically effective amount of the rAAV particles is 3 x 10 14 The method of any one of embodiments 129-130, wherein the dose is administered in genome copies / kg. 135. A pharmaceutical composition for use in treating a dystrophinopathy, reducing inflammation and / or fibrosis in muscle, reducing muscle degeneration, or altering gait in a subject in need thereof, comprising a therapeutically effective amount of rAAV particles and a pharmaceutically acceptable carrier; the rAAV particle comprises an artificial genome including a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is a cysteine-rich region of dystrophin, and CT comprises at least a portion of CT comprising an α1-syntrophin binding site; the transgene is operably linked to regulatory elements that promote expression in muscle; and is flanked by AAV ITR sequences; The therapeutically effective amount of the rAAV particles is 5×10 per kilogram 13 ~1×10 15 It is administered intravenously or intramuscularly at a dose of 100 genome copies (GC / kg) The pharmaceutical composition, wherein said administering results in greater than 50 ng / mg of micro-dystrophin protein in the muscle of said subject. 136. A method for treating a dystrophinopathy, reducing inflammation and / or fibrosis in muscle, reducing muscle degeneration, or altering gait in a subject in need thereof, said method comprising: administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharmaceutically acceptable carrier; the rAAV particle comprises an artificial genome including a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is a cysteine-rich region of dystrophin, and CT comprises at least a portion of CT comprising an α1-syntrophin binding site; the transgene is operably linked to regulatory elements that promote expression in muscle; and is flanked by AAV ITR sequences; The therapeutically effective amount of the rAAV particles is 5×10 per kilogram 13 ~1×10 15 It is administered intravenously or intramuscularly at a dose of 100 genome copies (GC / kg) The method, wherein said administering results in greater than 50 ng / mg of micro-dystrophin protein in the muscle of said subject. 137. The composition or method of embodiment 135 or 136, wherein the amount of micro-dystrophin in the muscle of the subject is measured by a capillary-based Western assay method 5 weeks, 10 weeks, 12 weeks, 20 weeks, or 26 weeks after administration. 138. The composition or method of embodiments 135-137, wherein the CT comprises or consists of the proximal 194 amino acids of the C-terminus of dystrophin, or at least the proximal portion of the C-terminus encoding human dystrophin amino acid residues 3361-3554 of SEQ ID NO: 92 (UniProtKB-P11532), or at least the proximal portion of the C-terminus encoded by exons 70-74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75. 139. The composition or method of any one of embodiments 135 to 138, wherein the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 1. 140. The composition or method of embodiment 139, wherein the micro-dystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 20. 141. The composition or method of embodiments 135 to 137, wherein the CT comprises or consists of the amino acid sequence of SEQ ID NO: 83, or an amino acid sequence comprising the α1-syntrophin binding site but not the dystrobrevin binding site. 142. The composition or method of embodiment 135, 136, 137, or 141, wherein the micro-dystrophin protein has the amino acid sequence of SEQ ID NO: 79. 143. The composition or method of embodiment 142, wherein the microdystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO: 81. 144. A composition or method according to any one of embodiments 135 to 143, wherein the transcriptional regulatory element comprises a muscle-specific promoter. 145. The composition or method of embodiment 144, wherein the muscle-specific promoter is a skeletal muscle, smooth muscle, or cardiac muscle-specific promoter. 146. The composition or method of any one of embodiments 144 or 145, wherein the muscle-specific promoter is SPc5-12, or a transcriptionally active portion or variant thereof. 147. The composition or method of embodiment 146, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO: 39. 148. The composition or method of any one of embodiments 135 to 147, wherein the transgene comprises a polyadenylation signal 3' of the nucleic acid sequence encoding the micro-dystrophin protein. 149. The composition or method of any one of embodiments 135 to 148, wherein the transgene comprises an intron sequence between the promoter and the micro-dystrophin coding sequence. 150. The composition or method of embodiment 149, wherein the intron sequence is a VH4 intron sequence (SEQ ID NO: 41). 151. The composition or method of any one of embodiments 135-140 and 144-150, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 53. 152. The composition or method of any one of embodiments 135-137 and 141-150, wherein the transgene comprises the nucleic acid sequence of SEQ ID NO: 82. 153. The composition or method of any of embodiments 135-152, wherein the rAAV particles have a capsid protein comprising an amino acid sequence that is at least 95% identical to SEQ ID NO: 77. 154. The composition or method of embodiment 153, wherein the rAAV is of the AAV8 serotype. 155. The composition or method of any one of embodiments 135-154, wherein the dystrophinopathy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy. 156. The therapeutically effective amount of the rAAV particles is 1 x 10 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 156. The composition or method of any one of embodiments 135 to 155, administered at a dose of genome copies / kg. 157. The composition or method of any one of embodiments 135-156, wherein the pharmaceutical composition is administered intravenously. [Brief explanation of the drawings]

[0016] [Figure 1A]This is a diagram of a sarcolemma showing the interaction between RGX-DYS1 microdystrophin (which has a C-terminal domain containing dystrobrevin) and the α1-syntrophin binding site (as well as the β1-syntrophin binding site). RGX-DYS1, which contains at least the dystrobrevin and α1-syntrophin binding sites, is thought to partially recruit nNOS to anchor it to the sarcolemma via α1-syntrophin. Syn: syntrophin; Dbr: dystrobrevin; CR: cysteine-rich domain; nNOS: neuronal nitric oxide synthase; DG: dystroglycan; H: hinge; R: spectral-like repeat; SG: sarcoglycan. [Figure 1B] (Figure 1) Diagram of a sarcolemma showing the interaction between wild-type dystrophin protein and the dystrophin-associated protein complex (DAPC) with the actin cytoskeleton. RGX-DYS1, which contains at least dystrobrevin and α1-syntrophin binding sites, is expected to partially recruit nNOS and anchor it to the sarcolemma via α1-syntrophin. Syn: syntrophin; Dbr: dystrobrevin; CR: cysteine-rich domain; nNOS: neuronal nitric oxide synthase; DG: dystroglycan; H: hinge; R: spectral-like repeat; SG: sarcoglycan. [Figure 2] Illustrated are vector gene expression cassettes (otherwise referred to as microdystrophin constructs or transgenes) for use in cis-plasmids for gene therapy resulting in AAV recombinant genomes. The DNA length of each component and the complete transgene is listed for each construct. SPc5-12: synthetic muscle-specific promoter; CT1.5: truncated / minimal CT domain containing 140 amino acids of the CT domain (SEQ ID NO: 83), including the α1-syntrophin binding site but not the dystrobrevin binding site; VH4: human immunoglobulin heavy chain variable region intron; ABD: actin-binding domain; H: hinge; R: rod; CR: cysteine-rich domain; CT: C-terminal domain; smPA: small poly(A); ABD: actin-binding domain 1 (ABD1). [Figure 3A]Western blot analysis of dystrophin extracted from gastrocnemius muscle tissue injected with the AAV-microdystrophin vector. Lanes 1–4 show protein samples from mdx mice injected with AAV8-RGX-DYS1, lanes 5–8 show protein samples from mdx mice injected with AAV8-RGX-DYS5, and lanes 9–12 show protein samples from mdx mice injected with AAV8-RGX-DYS3. α1-actin served as a loading control in each lane. mdx (lane 13) shows an uninjected mdx mouse. For dystrophin blots, a mouse anti-dystrophin monoclonal antibody was used (1:100 dilution). For anti-alpha1-actin blots, a polyclonal antibody was used at a dilution factor of 1:10,000, and a secondary (anti-rabbit) antibody was used at a dilution factor of 1:20,000. [Figure 3B] Western blot analysis of dystrophin extracted from gastrocnemius muscle tissue injected with the AAV-microdystrophin vector. Lanes 1–4 show protein samples from mdx mice injected with AAV8-RGX-DYS1, lanes 5–8 show protein samples from mdx mice injected with AAV8-RGX-DYS5, and lanes 9–12 show protein samples from mdx mice injected with AAV8-RGX-DYS3. α1-actin serves as a loading control in each lane. mdx (lane 13) shows an uninjected mdx mouse. For dystrophin blots, a mouse anti-dystrophin monoclonal antibody was used (1:100 dilution). For anti-alpha1-actin blots, a polyclonal antibody was used at a dilution factor of 1:10,000, and a secondary (anti-rabbit) antibody was used at 1:20,000. Quantification of microdystrophin bands in Western blot analysis of protein samples from A. *p<0.05, **P<0.01, ***P<0.001. [Figure 3C]Western blot analysis of dystrophin extracted from gastrocnemius muscle tissue injected with the AAV-micro-dystrophin vector. Lanes 1–4 show protein samples from mdx mice injected with AAV8-RGX-DYS1, lanes 5–8 show protein samples from mdx mice injected with AAV8-RGX-DYS5, and lanes 9–12 show protein samples from mdx mice injected with AAV8-RGX-DYS3. α1-actin serves as a loading control in each lane. mdx (lane 13) shows an uninjected mdx mouse. For dystrophin blots, a mouse anti-dystrophin monoclonal antibody was used (1:100 dilution). For anti-alpha1-actin blots, a polyclonal antibody was used at a dilution factor of 1:10,000, and a secondary (anti-rabbit) antibody was used at 1:20,000. AAV-μ-Dys vector copy number in gastrocnemius muscle was determined by ddPCR. *p<0.05, **P<0.01, ***P<0.001. [Figure 3D] Western blot analysis of dystrophin extracted from gastrocnemius muscle tissue injected with the AAV-microdystrophin vector. Lanes 1–4 show protein samples from mdx mice injected with AAV8-RGX-DYS1, lanes 5–8 show protein samples from mdx mice injected with AAV8-RGX-DYS5, and lanes 9–12 show protein samples from mdx mice injected with AAV8-RGX-DYS3. α1-actin serves as a loading control in each lane. mdx (lane 13) shows an uninjected mdx mouse. For dystrophin blots, a mouse anti-dystrophin monoclonal antibody was used (1:100 dilution). For anti-alpha1-actin blots, a polyclonal antibody was used at a dilution factor of 1:10,000, and a secondary (anti-rabbit) antibody was used at 1:20,000. Quantification of microdystrophin protein bands normalized by AAV-μ-Dys vector copy number. *p<0.05, **P<0.01, ***P<0.001. [Figure 4A]Expression of microdystrophin and wild-type (WT) dystrophin mRNA in skeletal muscle (gastrocnemius). Total RNA was extracted from skeletal muscle, and cDNA was synthesized. The copy numbers of microdystrophin, WT-dystrophin, and endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). Relative expression of microdystrophin or WT-dystrophin mRNA was normalized by GAPDH. The ratio of WT-dystrophin to GAPDH in B6-WT skeletal muscle was considered to be 1. [Figure 4B] Expression of microdystrophin and wild-type (WT) dystrophin mRNA in skeletal muscle (gastrocnemius). Total RNA was extracted from skeletal muscle, and cDNA was synthesized. The copy numbers of microdystrophin, WT-dystrophin, and endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). Relative expression of microdystrophin or WT-dystrophin mRNA in single cells. The copy numbers of microdystrophin or WT-dystrophin mRNA expression were normalized by GAPDH and the genome copy number per cell. [Figure 5A] Alpha-syntrophin expression in skeletal muscle. Gastrocnemius muscles extracted from mdx mice and mice were treated as described. Bl6 (untreated wild-type mice), RGX-DYS1 (mouse ID3553 and mouse ID3588), RGX-DYS3 (mouse ID5 and mouse ID7), and RGX-DYS5 (mouse ID9 and mouse ID11). Western blot for syntrophin from muscle tissue lysates. [Figure 5B]Alpha-syntrophin expression in skeletal muscle. Gastrocnemius muscles extracted from mdx mice and mice were treated as described. Bl6 (untreated wild-type mice), RGX-DYS1 (mouse ID3553 and mouse ID3588), RGX-DYS3 (mouse ID5 and mouse ID7), and RGX-DYS5 (mouse ID9 and mouse ID11). Quantification of Western blot bands. *p<0.05, ***p<0.0001. [Figure 5C] Alpha-syntrophin expression in skeletal muscle. Gastrocnemius muscles extracted from mdx mice and mice were treated as described. Bl6 (untreated wild-type mice), RGX-DYS1 (mouse ID3553 and mouse ID3588), RGX-DYS3 (mouse ID5 and mouse ID7), and RGX-DYS5 (mouse ID9 and mouse ID11). Western blot analysis of syntrophin from total muscle membrane protein. [Figure 5D] Alpha-syntrophin expression in skeletal muscle. Gastrocnemius muscles extracted from mdx mice and mice were treated as described. Bl6 (untreated wild-type mice), RGX-DYS1 (mouse ID3553 and mouse ID3588), RGX-DYS3 (mouse ID5 and mouse ID7), and RGX-DYS5 (mouse ID9 and mouse ID11). Quantification of Western blot bands. [Figure 6A] nNOS expression in skeletal muscle. Immunofluorescence staining for nNOS. [Figure 6B] nNOS expression in skeletal muscle. Western blot for nNOS. [Figure 6C] nNOS expression in skeletal muscle. Quantification of Western blot bands. [Figure 7A]Transduction of satellite cells with an AAV vector encoding the microdystrophin gene and improved cell regeneration. Percentage of AAV-DMD-transduced satellite cells. Primers and probes for microdystrophin were the same as those described above. The ratio of pax7 to GAPDH in B6-WT skeletal muscle was considered to be 1. Compared to untreated mdx mice, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 7B] Transduction of satellite cells with an AAV vector encoding the microdystrophin gene and improved cell regeneration. Total satellite cell counts in RNAscope® images. Primers and probes for microdystrophin were the same as previously described. The ratio of pax7 to GAPDH in B6-WT skeletal muscle was considered to be 1. Compared to untreated mdx mice, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 7C] Transduction of satellite cells with an AAV vector encoding the microdystrophin gene and improved cell regeneration. Pax7 mRNA expression in skeletal muscle from different groups revealed by ddPCR. The primers and probe for microdystrophin were the same as those described above. The ratio of pax7 to GAPDH in B6-WT skeletal muscle was considered to be 1. Compared to untreated mdx mice, **p<0.01, ***p<0.001, ****p<0.0001. [Figure 8]This figure shows a comparison of the biodistribution and transgene expression of AAV8 and AAV9 in nonhuman primates (NHPs). AAV8 and AAV9 packaging CAG-GFP cassettes with unique barcodes were individually generated and pooled with other capsids at approximately equal concentrations to generate a library of 118 barcoded AAVs. This library (PAVE118) was administered intravenously to three cynomolgus monkeys at a dose of 1.77e13GC / kg. Three weeks after administration, DNA and RNA isolated from various NHP tissues were subjected to next-generation sequencing (NGS) analysis for relative abundance. There were no significant differences in DNA and RNA levels from AAV8 and AAV9 capsids in nonhuman primate skeletal muscle (A and B, respectively), cardiac muscle (C and D, respectively), and liver (E and F, respectively). [Figure 9] Grip strength and in vitro muscle strength of EDL muscle. AAV8-RGX-DYS1 administration improved muscle function in mdx mice. (A and B) Grip strength was measured at week 5. (A) Maximum force, and (B) normalized forelimb values ​​calculated by each mouse's body weight. (C and D) In ​​vitro muscle strength of EDL muscle was performed at week 6. (C) Absolute forelimb and (D) specific EDL muscle strength, where the maximum force generated was normalized by the muscle's cross-sectional area. Wild-type (WT) data were from age-matched HCD mice at the testing facility. ***p<0.001 vs. wild-type HCD data, ***p<0.001 vs. vehicle control mdx mice, using Student's t-test. Data are presented as mean ± SEM. [Figure 10A] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Inflammation was assessed based on H&E staining. The yellow dashed line represents the area of ​​inflammatory foci within the tissue. [Figure 10B]Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Inflammation was assessed based on H&E staining. The yellow dashed line represents the area of ​​inflammatory foci within the tissue. The percentage of inflammation in the TA was measured. ***p<0.001 vs. wild-type HCD data. *p<0.05, ***p<0.001 vs. vehicle control mdx, using Student's t-test. Data are presented as mean ± SEM. [Figure 10C] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Inflammation was assessed based on H&E staining. The yellow dashed line represents the area of ​​inflammatory foci within the tissue. The percentage of inflammation in the diaphragm was measured. ***p<0.001 vs. wild-type HCD data. *p<0.05, ***p<0.001 vs. vehicle control mdx, using Student's t-test. Data are presented as mean ± SEM. [Figure 10D] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Regenerating fibers in the TA and diaphragm were examined by anti-eMHC staining, a marker of regeneration. The red dashed line represents the area of ​​the degenerated region. [Figure 10E]Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Regenerating fibers in the TA and diaphragm were examined by anti-eMHC staining, a marker of regeneration. The red dashed line represents the area of ​​the degenerated region. Positive fibers were counted in the TA and normalized across the total area (mm²) of the section (fibers / mm²). ***p<0.001 vs. wild-type HCD data. *p<0.05, ***p<0.001 vs. vehicle control mdx, using Student's t-test. Data are presented as mean ± SEM. [Figure 10F] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Regenerating fibers in the TA and diaphragm were examined by anti-eMHC staining, a marker of regeneration. The red dashed line represents the area of ​​the degenerated region. Positive fibers were counted in the diaphragm and normalized across the total area (mm²) of the section (fibers / mm²). ***p<0.001 vs. wild-type HCD data. *p<0.05, ***p<0.001 vs. vehicle control mdx, using Student's t-test. Data are presented as mean ± SEM. [Figure 10G] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Degenerated fibers in the TA and diaphragm were examined by anti-IgM staining. The red dashed line represents the area of ​​the degenerated region. [Figure 10H]Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Degenerated fibers in the TA and diaphragm were examined by anti-IgM staining. The red dashed line represents the area of ​​the degenerated region. Positive fibers were counted in the TA and normalized across the total area (mm²) of the section (fibers / mm²). ***p<0.001 vs. wild-type HCD data. *p<0.05, ***p<0.001 vs. vehicle control mdx, using Student's t-test. Data are presented as mean ± SEM. [Figure 10I] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 treatment attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Degenerated fibers in the TA and diaphragm were examined by anti-IgM staining. The red dashed line represents the area of ​​the degenerated region. Positive fibers were counted in the diaphragm and normalized across the total area (mm²) of the section (fibers / mm²). ***p<0.001 vs. wild-type HCD data. *p<0.05, ***p<0.001 vs. vehicle control mdx, using Student's t-test. Data are presented as mean ± SEM. [Figure 10J] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 administration attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Percent central nucleation (%) was performed on five random fields of TA tissue sections. In each field, centrally nucleated fibers and total fibers were counted, and the percentage of centrally nucleated fibers (CNF) was calculated. All representative images of the TA and diaphragm are shown at 20x with a zoom area (bar = 200 μm). Age-matched BL10 wild-type controls for TA muscle (n = 3) were stained from the laboratory tissue bank. Age-matched BL10 wild-type HCDs were used for the diaphragm. ***p < 0.001 vs. wild-type HCD data. *p < 0.05, ***p < 0.001 vs. vehicle control mdx, Student's t-test used. Data are presented as mean ± SEM. [Figure 10K] Muscle pathology in mdx vehicle control mice and mdx mice treated with AAV8-RGX-DYS1. AAV8-RGX-DYS1 administration attenuated skeletal muscle inflammation, degeneration, and regeneration in mdx mice. Percent central nucleation (%) was performed on five random fields of diaphragm tissue sections. In each field, centrally nucleated fibers and total fibers were counted, and the percentage of centrally nucleated fibers (CNF) was calculated. All representative images of the TA and diaphragm are shown at 20x with a zoom area (bar = 200 μm). Age-matched BL10 wild-type controls for TA muscles (n = 3) were stained from the in-house tissue bank. Age-matched BL10 wild-type HCDs were used for the diaphragm. ***p < 0.001 vs. wild-type HCD data. *p < 0.05, ***p < 0.001 vs. vehicle control mdx, Student's t-test used. Data are expressed as mean±SEM. [Figure 11] Biodistribution of RGX-DYS1 vector DNA in mdx mice at a dose of 2 × 10 GC / kg. Tissues collected from the AAV8-RGX-DYS1-treated group (n = 12) and livers collected from the vehicle control group (n = 11) were analyzed by ddPCR. All tissues collected from mice in the AAV8-RGX-DYS1-treated group exceeded the estimated lower limit of quantitation (LLOQ) (approximately 0.08 GC / dg) by 2–4 logs, while liver samples from mice in the vehicle control group were near the LLOQ. Vector genome copy data are shown as both GC / dg (A) and GC / μg DNA (B). EDL: extensor digitorum longus; TA: tibialis anterior. Data are presented as mean ± SEM. [Figure 12] RGX-DYS1 microdystrophin levels in diaphragm, gastrocnemius, and TA muscles from RGX-DYS1-treated mdx mice as measured by Western blot. Bars indicate mean percent dystrophin + SD based on a standard curve generated from a mixture of muscle lysates from BL10 wild-type mice and German Shorthaired Pointer Muscular Dystrophy (GSHPMD) dogs, n=10 per tissue. [Figure 13A]Expression of the RGX-DYS1 microdystrophin transgene by immunofluorescence. Immunofluorescence for microdystrophin / dystrophin was performed in the TA and diaphragm 6 weeks after vehicle or AAV8-RGX-DYS1 administration. [Figure 13B] Expression of the RGX-DYS1 microdystrophin transgene by immunofluorescence. Immunofluorescence for microdystrophin / dystrophin was performed on the TA and diaphragm 6 weeks after vehicle or AAV8-RGX-DYS1 administration. AAV8-RGX-DYS1 administration resulted in 96% of fibers in the TA being membrane-localized by microdystrophin. All representative images of the TA and diaphragm at 20x with a zoom area (bar = 200 μm). Age-matched BL10 wild-type controls for TA muscle (n = 3) were stained from the in-house tissue bank. Age-matched BL10 wild-type HCD from the in-house laboratory were used for the diaphragm. ***p < 0.001 vs. wild-type, *p < 0.05 vs. vehicle control mdx, ***p < 0.001 using Student's t-test. Data are presented as mean ± SEM. [Figure 13C] Expression of the RGX-DYS1 microdystrophin transgene by immunofluorescence. Immunofluorescence for microdystrophin / dystrophin was performed on the TA and diaphragm 6 weeks after vehicle or AAV8-RGX-DYS1 administration. AAV8-RGX-DYS1 administration resulted in 89.1% of fibers in the diaphragm being membrane-localized by microdystrophin. All representative images of the TA and diaphragm at 20x with a zoom area (bar = 200 μm). Age-matched BL10 wild-type controls for TA muscle (n = 3) were stained from the in-house tissue bank. Age-matched BL10 wild-type HCD from the in-house laboratory were used for the diaphragm. ***p < 0.001 vs. wild-type, *p < 0.05 vs. vehicle control mdx, ***p < 0.001 using Student's t-test. Data are presented as mean ± SEM. [Figure 14]Dystrophin-associated protein complex (DAPC) by immunofluorescence. DAPC proteins, including dystrophin, α1-syntrophin, dystrobrevin, nNOS-1, and β-dystroglycan, were measured in TA tissue by immunofluorescence. AAV8-RGX-DYS1 administration restored syntrophin and dystrobrevin expression, which was localized in RGX-DYS1 microdystrophin-positive fibers, and β-dystroglycan expression was partially restored. nNOS expression was detectable in mdx mice treated with AAV8-RGX-DYS1, higher than in vehicle-control mdx mice, but not as robust as in wild-type mice. Representative images of all TA tissues at 20x magnification with a zoomed area (bar = 100 μm). Asterisks indicate the same fibers in each group. Age-matched BL10 wild-type controls (n = 5) were stained for TA muscle from the in-house tissue bank. [Figure 15] Global gait scores from microkinetic gait analysis. Automated gait analysis was performed 6 and 12 weeks after AAV8-RGX-DYS1 administration to mdx mice (n = 8–10 per group). A clear mdx mouse model effect on global gait scores was observed 6 weeks after administration and even greater after 12 weeks. At 12 weeks, global gait scores were significantly improved in mdx mice administered AAV8-RGX-DYS1 at doses of 1 × 10 14 , 3 × 10 14 , and 5 × 10 14 GC / kg. Data are expressed as mean ± SEM. Statistical significance: *p < 0.05, ***p < 0.001 vs. wild-type vehicle (RM two-way ANOVA, Sidak's post hoc). *p < 0.05, **p < 0.01 vs. mdx vehicle (mixed-effects model ANOVA, Dunnett's post hoc). [Figure 16A] T2-magnetic resonance imaging. T2-weighted MRI was performed 6 and 12 weeks after administration of vehicle or AAV8-RGX-DYS1 to mdx mice (n = 8–10 per group). Representative images are shown. Hyperintense lesions are indicated by yellow arrows (6 weeks) and red arrows (12 weeks). [Figure 16B]T2-magnetic resonance imaging. T2-weighted MRI was performed 6 and 12 weeks after administration of vehicle or AAV8-RGX-DYS1 to mdx mice (n = 8-10 per group). Gastrocnemius muscle volume (mm3) was measured. All data were obtained from both combined legs. Data are expressed as mean ± SEM. Statistical significance: *p < 0.05, ***p < 0.001 vs. wild-type vehicle (RM two-way ANOVA, Sidak's post hoc); **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. mdx vehicle control (mixed-effects model ANOVA, Dunnett's post hoc). [Figure 16C] T2-magnetic resonance imaging. T2-weighted MRI was performed 6 and 12 weeks after administration of vehicle or AAV8-RGX-DYS1 to mdx mice (n = 8-10 per group). Percent (%) gastrocnemius hyperintensity was measured using autothreshold analysis. All data were obtained from both combined legs. Data are expressed as mean ± SEM. Statistical significance: *p < 0.05, ***p < 0.001 vs. wild-type vehicle (RM two-way ANOVA, Sidak's post hoc); **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. mdx vehicle control (mixed-effects model ANOVA, Dunnett's post hoc). [Figure 16D] T2-magnetic resonance imaging. T2-weighted MRI was performed 6 and 12 weeks after administration of vehicle or AAV8-RGX-DYS1 to mdx mice (n = 8-10 per group). T2 relaxation times (milliseconds, ms) were measured in the gastrocnemius lesion. All data were obtained from both combined legs. Data are expressed as mean ± SEM. Statistical significance: *p < 0.05, ***p < 0.001 vs. wild-type vehicle (RM two-way ANOVA, Sidak's post hoc); **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. mdx vehicle control (mixed-effects model ANOVA, Dunnett's post hoc). [Figure 16E]T2-magnetic resonance imaging. T2-weighted MRI was performed 6 and 12 weeks after administration of vehicle or AAV8-RGX-DYS1 to mdx mice (n = 8-10 per group). T2 relaxation times (milliseconds, ms) in the uninjured area were measured. All data were obtained from both combined legs. Data are expressed as mean ± SEM. Statistical significance: *p < 0.05, ***p < 0.001 vs. wild-type vehicle (RM two-way ANOVA, Sidak's post hoc); **p < 0.01, ***p < 0.001, ****p < 0.0001 vs. mdx vehicle control (mixed-effects model ANOVA, Dunnett's post hoc). [Figure 17] Grip strength (normalized to body weight) at 6, 9, and 12 weeks. Grip strength measurements were performed 6, 9, and 12 weeks after vehicle or AAV8-RGX-DYS1 administration (n = 8-10 per group) at the indicated doses. No clear mdx mouse model effects were observed at 6 and 9 weeks after administration. At 12 weeks after administration, differences between wild-type and mdx mice were noted, but were not statistically significant. At 12 weeks, grip strength was significantly improved in mdx mice administered AAV8-RGX-DYS1 at doses of 3 × 10 14 and 5 × 10 14 GC / kg compared with vehicle-control mdx mice. Data are presented as mean ± SEM. Statistical significance: *p < 0.05, ***p < 0.001 vs. mdx vehicle control (mixed-effects ANOVA, Dunnett's post-hoc). [Figure 18] Creatine kinase concentrations at 7 and 12 weeks. CK analysis was performed from serum 7 and 12 weeks after administration of vehicle or AAV8-RGX-DYS1 to mdx mice (n = 8-10 per group). Data are presented as mean ± SEM. Statistical significance: ****p<0.0001 vs. wild-type (RM two-way ANOVA, Sidak's post hoc); *p<0.05 vs. mdx vehicle control; ****p<0.0001 (mixed-effects model ANOVA, Dunnett's post hoc). [Figure 19]Biodistribution of vector DNA in liver and muscle tissues of BL10 wild-type and mdx mice (treated with vehicle or AAV8-RGX-DYS1). Bars represent mean values ​​+ SD, n = 5 per group for each tissue. Tissues collected from BL10 wild-type and mdx vehicle control mice showed vector DNA levels either below the limit of quantitation (BQL = 50 copies / μg DNA) or at the limit of detection (LOD = 11.96 copies / μg DNA). [Figure 20A] Expression of RGX-DYS1 microdystrophin / dystrophin protein in gastrocnemius muscle, diaphragm, and heart. Bars indicate mean percent dystrophin + SE based on a standard curve generated from a mixture of BL10 mouse and GSHPMD dog muscle lysates. BL10 wild-type (n = 10), mdx vehicle control (n = 9), AAV8-RGX-DYS1 mdx (n = 8-10 per dose group). ****p < 0.0001 vs. wild-type; *p < 0.05, ****p < 0.0001 vs. vehicle control mdx mice. [Figure 20B] Expression of RGX-DYS1 microdystrophin / dystrophin protein in gastrocnemius muscle, diaphragm, and heart. Representative Western blot of RGX-DYS1 microdystrophin / dystrophin protein in the diaphragm. Solid box: predicted molecular location of wild-type dystrophin. Dashed box: predicted molecular location based on RGX-DYS1 microdystrophin image analysis from serum. [Figure 21] Mouse body weights from a 26-week study of treatment with different concentrations of RGX-DYS1 are shown. [Figure 22] 1 shows T2-magnetic resonance imaging. Representative images from MRI of mice at week 17 of a 26-week study of treatment with different concentrations of RGX-DYS1. [Figure 23] 1 shows T2-magnetic resonance imaging. Representative images from MRI of mice at week 26 of a 26-week study of treatment with different concentrations of RGX-DYS1 are shown. [Figure 24]MRI results of gastrocnemius muscle (A) volume and (B) lesion are shown. Data are expressed as mean ± SEM. Statistical significance: ****p<0.0001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak post-hoc); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. mdx vehicle (mixed-effects model ANOVA, Dunnett post-hoc). [Figure 25] MRI results for (A) T2 time - lesion (%) and (B) T2 time - non-lesion (%) are shown. Data are expressed as mean ± SEM. Statistical significance: **p<0.01, ****p<0.0001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak post-hoc); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. mdx vehicle (mixed-effects model ANOVA, Dunnett post-hoc). [Figure 26] Total gait scores are shown for mdx mice 6, 17, and 26 weeks after administration of AAV8-RGX-DYS1. A clear mdx mouse model effect was observed for total gait scores at all time points. Data are expressed as mean ± SEM. Statistical significance: *p<0.05, ***p<0.001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak's post-hoc); *p<0.05, **p<0.01 vs. mdx vehicle (mixed-effects model ANOVA, Dunnett's post-hoc). [Figure 27] Examples of creatine kinase concentrations at 12, 18, and 27 weeks are shown in control mice or mice treated with different concentrations of RGX-DYS1. Data are expressed as mean ± SEM. Statistical significance: ****p<0.0001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak's post-hoc); ***p<0.001 vs. mdx vehicle, ****p<0.0001 (mixed-effects model ANOVA, Dunnett's post-hoc). [Figure 28] 1 shows exemplary data for grip strength normalized to body weight at 9, 17, and 26 weeks in treatment groups. [Figure 29]Fibrosis and inflammation in mdx mice treated with RGX-DYS1 are shown. (A) Representative Masson's Trichrome staining of the diaphragm and its quantification (C) are shown. In addition, fibrosis was measured in the diaphragm and heart (C and D). Representative H&E images of inflammatory cells in the diaphragm (B) and its quantification (E). The number of inflammatory cells was also assessed in the gastrocnemius muscle (F). Data are expressed as fold change (vs. wild-type). Four to five animals were used per group. *p<0.05 vs. wild-type, *p<0.05 vs. mdx vehicle control. [Figure 30] Figure 1 shows the biodistribution of vector DNA in liver and muscle tissues of BL10 wild-type and mdx mice (treated with vehicle or RGX-DYS1). Bars represent the mean + SD for n = 5 per group for each tissue. Tissues collected from wild-type and mdx vehicle control mice showed vector DNA levels either below the limit of quantification (BQL) = 50 copies or at LOD = 11.96 copies. All vector DNA levels < the limit of quantification (LOQ) (50 copies) were assumed to be zero for the average calculation. [Figure 31] RGX-DYS1 microdystrophin / dystrophin protein expression in the gastrocnemius muscle, diaphragm, and heart of mdx mice treated with AAV8-RGX-DYS1 is shown. Bars indicate the mean percent dystrophin + SEM based on a standard curve generated from a mixture of wild-type mouse and German Shorthaired Pointer Muscular Dystrophy (GSHPMD) dog muscle lysates. n = 7–10 per group. Comparisons between RGX-DYS1-treated mdx mice and vehicle-treated mdx mice were performed using a Kruskal-Wallis test followed by Dunn's post hoc multiple comparisons test for gastrocnemius muscle and one-way ANOVA followed by Dunn's post hoc adjustment for multiple comparisons for diaphragm and heart. Statistical significance was recognized at p < 0.002 and bp < 0.001 (AAV8-RGX-DYS1-treated mdx mice vs. vehicle-controlled mdx mice). [Figure 32]Immunofluorescence analysis of RGX-DYS1 microdystrophin expression. (A) Immunofluorescence analysis of microdystrophin / dystrophin using merosin (a muscle fiber marker) was performed on diaphragm tissue 26 weeks after vehicle or RGX-DYS1 administration. The percentage of dystrophin / microdystrophin fibers in the sarcolemma (B) and the percentage of dystrophin / microdystrophin intensity (C) were measured. All representative images of diaphragms at 20x magnification (bar = 200 μm) are shown. ***p<0.001, ****p<0.0001 vs. wild-type; **p<0.01, ***p<0.001, ****p<0.0001 vs. vehicle control mdx. Data are expressed as mean ± SD. [Figure 33] These results demonstrate that AAV8-RGX-DYS1 administration significantly increased specific muscle strength and improved the diaphragm muscle's ability to resist injury. (A) Specific muscle strength (N / cm2) of the diaphragm muscle was calculated by normalizing the maximum B force generated by the muscle to its cross-sectional area. Pink circles and arrowheads in the figure represent outliers within the expected muscle strength values. (B) Diaphragm muscles isolated from wild-type or mdx mice were subjected to five eccentric contractions (eccentric contractions), and the force measured during each contraction was expressed as a percentage of the force generated during the first contraction. Data are presented as mean ± SD. ****p<0.0001 vs. wild-type; *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. mdx vehicle control. [Figure 34] Figure 1 shows that AAV8-RGX-DYS1 administration increased specific muscle strength and improved the EDL muscle's ability to resist injury. (A) Specific muscle strength (N / cm2) of the diaphragm muscle was calculated by normalizing the maximum force generated by the muscle to its cross-sectional area. (B) EDL muscles isolated from wild-type or mdx mice were subjected to five eccentric contractions (eccentric contractions), and the force measured during each contraction was expressed as a percentage of the force generated during the first contraction. Data are presented as mean ± SD. *p<0.05, **p<0.01 vs. wild-type; *p<0.05, **p<0.01 vs. mdx vehicle control. [Figure 35]Figure 1 shows that a significant reduction in inflammation was observed in mdx mice treated with RGX-DYS1. The number of inflammatory cells in whole sections of the diaphragm (A) and TA (B) was counted and expressed as fold change (vs. wild-type). Wild-type and vehicle control mdx mice (n = 4-5 per dose group) and RGX-DYS1-treated mdx mice (n = 4-5 per dose group) were used. Statistical significance: *p < 0.05 vs. wild-type, *p < 0.05 vs. mdx vehicle control. [Figure 36] Figure 1 shows RGX-DYS1 microdystrophin protein expression in diaphragm, gastrocnemius, and cardiac muscle collected from wild-type and mdx mice at 6 weeks. Protein levels in tissues were measured by capillary-based Western immunoassay. Bars indicate mean microdystrophin percent ± SEM. Wild-type mice (n = 3) and vehicle-control mdx mice (n = 5) did not exhibit any quantifiable RGX-DYS1 microdystrophin protein levels, and all values ​​below the level of quantification (BLQ) (<5 ng / mg protein level of quantification (LOQ)) were treated as zero in the calculation of the mean. mdx mice administered RGX-DYS1 (n = 4-5 per dose group). [Figure 37] Microdystrophin stability of RGX-DYS1 (μDys-CT194) compared to RGX-DYS3 (μDys-CT48) is shown as measured by live-cell fluorescence pulse-chase imaging (A), protein gel fluorescence (B), and half-life determination by cycloheximide chase (C) methods. DETAILED DESCRIPTION OF THE INVENTION

[0017] Methods are provided for administering gene therapy vectors, particularly AAV vectors, comprising a recombinant genome carrying a transgene encoding a micro-dystrophin protein operably linked to regulatory elements for expression, e.g., in muscle cells, for the treatment of dystrophinopathies, including, but not limited to, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and X-linked dilated cardiomyopathy. The micro-dystrophin protein encoded by the transgene consists of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, and H4 is the dystrophin ligase. The CR is the hinge 4 region of dystrophin, the CR is the cysteine-rich region of dystrophin, the CT comprises at least a portion of the CT containing the α1-syntrophin binding site, and may comprise or consist of at least the proximal portion of the C-terminus encoding human dystrophin amino acid residues 3361-3354 of SEQ ID NO:92 (UniProt-KB-P111532), or the amino acid sequence of SEQ ID NO:16, or alternatively, the CT is a truncated CT comprising or consisting of SEQ ID NO:83, and the micro-dystrophin may have the amino acid sequence of SEQ ID NO:1 (RGX-DYS1) or SEQ ID NO:79 (RGX-DYS5). The transgene further comprises regulatory sequences, including, for example, a muscle-specific promoter such as SPc5-12 (SEQ ID NO:39) and a polyadenylation signal such as a small poly(A) signal (SEQ ID NO:42).Exemplary constructs (including cis-plasmids and AAV genomes) are shown, for example, in Figure 2 and may have the nucleotide sequences of SEQ ID NO:53 for RGX-DYS1 and SEQ ID NO:82 for RGX-DYS5, and may include ITR sequences (including AAV2 ITR sequences as found in the nucleotide sequences of SEQ ID NO:53 and SEQ ID NO:82). The gene therapy vector may be an AAV8 or AAV9 serotype vector. In a specific embodiment, the gene therapy vector is an AAV8 containing an artificial genome having the nucleotide sequence of SEQ ID NO:53 (RGX-DYS1), and may be referred to as AAV8-RGX-DYS1.

[0018] Based on pharmacology studies conducted in mdx mice (Examples 6, 7, and 8, below), a therapeutically effective single dose for peripheral (including intravenous) administration of rAAV containing the transgenes described herein (including RGX-DYS1 and RGX-DYS5) (including, in embodiments, AAV8-RGX-DYS1) is approximately 5×10 13 GC / kg~1×10 15 GC / kg, including doses within that range, 1 × 10 14 , 1.1×10 14 , 1.2 × 10 14 , 1.3 × 10 14 , 1.4×10 14 , 1.5×10 14 , 1.6×10 14 , 1.7×10 14 , 1.8×10 14 , 1.9×10 14 , 2 × 10 14 , 2.1×10 14 , 2.2 × 10 14 , 2.3 × 10 14 , 2.4 × 10 14 , 2.5×10 14 , 2.6×10 14 , 2.7 × 10 14 , 2.8×10 14 , 2.9 × 10 14 , or 3 × 10 14Administration of such a therapeutically effective dose of rAAV (including AAV8-RGX-DYS1) containing a transgene described herein results in an improvement in one or more indicators of a dystrophinopathy disease, such as a decrease in creatine kinase activity, muscle volume, a reduction in muscle pathology, an improvement in gait or ambulation score (such as NSAA score), or other measure of strength or mobility, within 12 weeks, 26 weeks, 52 weeks, or more of administration.

[0019] Accordingly, provided and described herein are methods for administering rAAV, including rAAV8, to a subject, including a human subject, in need thereof, comprising a recombinant genome comprising a transgene encoding micro-dystrophin, including RGX-DYS1 and RGX-DYS5 constructs, wherein the administration is at least 5×10 13 GC / kg~1×10 15 Intravenous or other peripheral administration at a dose of GC / kg, including doses within that range, 1 × 10 14 , 1.1×10 14 , 1.2 × 10 14 , 1.3 × 10 14 , 1.4×10 14 , 1.5×10 14 , 1.6×10 14 , 1.7×10 14 , 1.8×10 14 , 1.9×10 14 , 2 × 10 14 , 2.1×10 14 , 2.2 × 10 14 , 2.3 × 10 14 , 2.4 × 10 14 , 2.5×10 14 , 2.6×10 14 , 2.7 × 10 14 , 2.8×10 14 , 2.9 × 10 14 , or 3 × 10 14 Also provided are pharmaceutical compositions formulated for peripheral, including intravenous, administration of the micro-dystrophin-encoding rAAV described herein.

[0020] 5.1.Definition The term "AAV" or "adeno-associated virus" refers to a dependoparvovirus within the Parvoviridae family of viruses. The AAV can be derived from a naturally occurring "wild-type" virus, derived from a rAAV genome packaged in a capsid containing capsid proteins encoded by a naturally occurring cap gene, and / or derived from a rAAV genome packaged in a capsid containing capsid proteins encoded by a non-naturally occurring capsid cap gene. Examples of the latter include rAAVs with capsid proteins having altered sequences and / or peptide insertions within the amino acid sequence of the naturally occurring capsid.

[0021] The term "rAAV" refers to "recombinant AAV." In some embodiments, a recombinant AAV has an AAV genome in which some or all of the rep and cap genes have been replaced with heterologous sequences.

[0022] The term "rep-cap helper plasmid" refers to a plasmid that provides viral rep and cap gene functions and assists in the production of AAV from rAAV genomes that lack functional rep and / or cap gene sequences.

[0023] The term "cap gene" refers to a nucleic acid sequence that encodes a capsid protein that forms or helps form the capsid coat of a virus. In the case of AAV, the capsid protein can be VP1, VP2, or VP3.

[0024] The term "rep gene" refers to a nucleic acid sequence that encodes a nonstructural protein necessary for viral replication and production.

[0025] The terms "nucleic acid" and "nucleotide sequence" include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), combinations of DNA and RNA molecules or hybrid DNA / RNA molecules, and analogs of DNA or RNA molecules. Such analogs can be generated using nucleotide analogs, including, but not limited to, inosine or tritylated bases. Such analogs can also include DNA or RNA molecules containing modified backbones that confer beneficial attributes on the molecule, such as, for example, increased nuclease resistance or ability to cross cell membranes. A nucleic acid or nucleotide sequence can be single-stranded, double-stranded, or contain both single- and double-stranded portions, or triple-stranded portions, but is preferably double-stranded DNA.

[0026] The amino acid residues disclosed herein can be modified by conservative substitutions to maintain or substantially maintain the overall polypeptide structure and / or function. As used herein, "conservative amino acid substitution" indicates that hydrophobic amino acids (i.e., Ala, Cys, Gly, Pro, Met, Val, Li, and Leu) can be substituted with other hydrophobic amino acids, hydrophobic amino acids with bulky side chains (i.e., Phe, Tyr, and Trp) can be substituted with other hydrophobic amino acids with bulky side chains, amino acids with positively charged side chains (i.e., Arg, His, and Lys) can be substituted with other amino acids with positively charged side chains, amino acids with negatively charged side chains (i.e., Asp and Glu) can be substituted with other amino acids with negatively charged side chains, and amino acids with polar, uncharged side chains (i.e., Ser, Thr, Asn, and Gln) can be substituted with other amino acids with polar, uncharged side chains.

[0027] The terms "subject," "host," and "patient" are used interchangeably. The subject is preferably a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans), most preferably a human.

[0028] The term "therapeutically functional micro-dystrophin" means that the micro-dystrophin exhibits therapeutic efficacy in one or more of the assays for therapeutic utility described in Section 5.4 herein or in the evaluation of a method of treatment described in Section 5.5 herein.

[0029] The terms "subject," "host," and "patient" are used interchangeably. The subject is preferably a mammal, such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans), most preferably a human.

[0030] The term "therapeutic agent" refers to any agent that can be used in the treatment, management, or amelioration of symptoms associated with a disease or disorder, where the disease or disorder is related to the function provided by the transgene. A "therapeutically effective amount" refers to the amount of agent (e.g., the amount of product expressed by the transgene) that, when administered to a subject suffering from the target disease or disorder, provides at least one therapeutic benefit in the treatment or management of the target disease or disorder. Furthermore, a therapeutically effective amount with respect to an agent of the present invention means that the amount of agent, alone or in combination with other therapeutic agents, provides at least one therapeutic benefit in the treatment or management of the disease or disorder.

[0031] The term "prophylactic agent" refers to any agent that can be used in preventing, reducing the likelihood of, delaying, or slowing the progression of a disease or disorder, where the disease or disorder is related to the function provided by the transgene. A "prophylactically effective amount" refers to the amount of prophylactic agent (e.g., the amount of a product expressed by the transgene) that provides at least one prophylactic benefit in preventing or delaying a target disease or disorder when administered to a subject predisposed thereto. A prophylactically effective amount can also refer to the amount of agent sufficient to prevent, reduce the likelihood of, or delay the occurrence of, or slow the progression of, a target disease or disorder, an amount sufficient to delay or minimize the onset of, or prevent or delay the recurrence or spread of, a target disease or disorder. A prophylactically effective amount can also refer to the amount of agent sufficient to prevent or delay the worsening of symptoms of a target disease or disorder. Furthermore, a prophylactically effective amount with respect to a prophylactic agent of the present invention means that the amount of prophylactic agent, alone or in combination with other therapeutic agents, provides at least one prophylactic benefit in preventing or delaying a disease or disorder.

[0032] The prophylactic agents of the present invention can be administered to subjects who are "predisposed" to the target disease or disorder. A subject who is "predisposed" to a disease or disorder is one who exhibits symptoms associated with the development of the disease or disorder, or who has a genetic makeup, environmental exposure, or other risk factors for such a disease or disorder, but whose symptoms have not yet reached a level that allows diagnosis of the disease or disorder. For example, a patient with a family history of a disease associated with a defective gene (provided by the transgene) may qualify as a patient who is predisposed to the disease. Furthermore, a patient who has an occult tumor that persists after removal of the primary tumor may qualify as a patient who is predisposed to tumor recurrence.

[0033] The term "CpG island" refers to those unique regions of the genome that contain a high frequency of the dinucleotide CpG (e.g., a C (cytosine) base immediately followed by a G (guanine) base (CpG)); therefore, the G+C content of CpG islands is significantly higher than that of non-island DNA. CpG islands can be identified by analyzing nucleotide length, nucleotide composition, and CpG dinucleotide frequency. The CpG island content in any particular nucleotide sequence or genome can be measured using the following criteria: an island size greater than 100, a GC percent greater than 50.0%, and a ratio of the observed number of CG dinucleotides to the number expected based on the number of Gs and Cs in the segment greater than 0.6 (Obs(Obs) / Exp(Exp) greater than 0.6). Obs / Exp CpG = Number of CpGs × N / (Number of Cs × Number of Gs) where N is the length of the sequence.

[0034] Various software tools are available for such calculations, including world-wide-web.urogene.org / cgi-bin / methprimer / methprimer.cgi, world-wide-web.cpgislands.usc.edu / , world-wide-web.ebi.ac.uk / Tools / emboss / cpgplot / index.html, and world-wide-web.bioinformatics.org / sms2 / cpg_islands.html (see also Gardiner-Garden and Frommer, J Mol Biol. 1987 Jul 20;196(2):261-82; Li LC and Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002 Nov;18(11):1427-31). In one embodiment, an algorithm for identifying CpG islands can be found at www.urogene.org / cgi-bin / methprimer / methprimer.cgi.

[0035] 5.2. Microdystrophin transgene 5.2.1 Transgene-encoded microdystrophin Encoded by the transgenes provided herein for the methods of the invention is a micro-dystrophin consisting of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT is the C-terminal domain (and includes at least a portion of the CT domain including the α1-syntrophin binding site, comprising SEQ ID NO: 84). Table 1 below contains the amino acid sequences for these components, specifically from the full-length human DMD protein (UniProtDB-11532, incorporated herein by reference), which are encoded by the nucleotide sequences in Tables 3 and 4 (including wild-type and codon-optimized sequences).

[0036] To overcome the typical packaging limitations of AAV vectors, many of the microdystrophin genes developed for clinical use lack the CT domain. Some researchers have shown that DAPC does not even require the C-terminal domain for assembly, or that the C-terminus is non-essential [Crawford, et al., J Cell Biol, 2000, 150(6):1399-1409, and Ramos, JN, et al. Molecular Therapy 2019, 27(3):1-13]. However, overexpression of the microdystrophin gene, which contains helix 1 of the coiled-coil motif in the C-terminal domain, in the skeletal muscles of mdx mice increased the recruitment of α1-syntrophin and α-dystrobrevin, members of the DAP complex, and functioned as a modular adaptor for signaling proteins recruited to the sarcolemma [Koo, T., et al., Delivery of AAV2 / 9-microdystrophin genes incorporating helix 1 of the coiled-coil motif in the C-terminal domain of dystrophin improves muscle pathology and restores the levels of α1-syntrophin and α-dystrobrevin in skeletal muscles of mdx mice. Hum Gene Ther, 2011.22(11):pp.1379-88]. Overexpression of the longer version of micro-dystrophin also improved muscle resistance to prolonged contraction-induced muscle damage in mdx mice compared with the shorter version [Koo, T., et al. 2011, supra]. The CT domain plays a role in the formation of the dystrophin-associated protein complex (DAPC) (see Figure 1B).

[0037] The CT domain of dystrophin contains two polypeptide stretches predicted to form α-helical coiled coils similar to those in the rod domain (see H1, single underlined, and H2, double underlined, in SEQ ID NO: 16 in Table 1 below). Each coiled coil contains a conserved repeating heptad (a, b, c, d, e, f, g) similar to that found in leucine zippers, with leucine predominating at the "d" position. n This domain is named the CC (coiled-coil) domain. The CC region of dystrophin forms a binding site for dystrobrevin and may regulate the interaction between α1-syntrophin and other dystrophin-associated proteins.

[0038] Both syntrophin isoforms, α1-syntrophin and β1-syntrophin, are thought to interact directly with dystrophin through two or more binding sites in dystrophin exons 73 and 74 (Yang et al., JBC270(10):4975-8(1995)). α1- and β1-syntrophin bind separately to the dystrophin C-terminal domain, with the binding site for α1-syntrophin reported to reside within at least amino acid residues 3447-3481, while the binding site for β1-syntrophin is reported to reside within amino acid residues 3495-3535 (see also Table 1, SEQ ID NO: 16, italics, for numbering in the DMD protein in UniProtDB-11532 (SEQ ID NO: 92)). Alpha1-(α1-) syntrophin and alpha-syntrophin are used interchangeably throughout.

[0039] The micro-dystrophin disclosed herein was found to bind to and recruit nNOS, as well as alpha-syntrophin, alpha-dystrobrevin, and beta-dystroglycan. Binding to nNOS was determined by immunostaining micro-dystrophin expressed in muscle tissue with appropriate antibodies, in the context of micro-dystrophin containing the C-terminal domain of dystrophin that binds to nNOS, and identifying each of alpha-syntrophin, alpha-dystrobrevin, and nNOS within or near the sarcolemma in sections of transduced muscle tissue. See Examples 4 and 5 below. In certain embodiments, the micro-dystrophin protein has a C-terminal domain that "increases binding" to α1-syntrophin, β-syntrophin, and / or dystrobrevin compared to a comparable micro-dystrophin that does not include the C-terminal domain (but otherwise has the same amino acid sequence, i.e., a "reference micro-dystrophin protein"), meaning that the DAPC is stabilized or anchored to the sarcolemma to a greater extent than a reference micro-dystrophin that does not include the C-terminal domain, which is ... is close to the CR domain. The results were determined by higher levels of one or more DAPC components in the muscle membrane by immunostaining of muscle sections or Western blot analysis of muscle tissue lysates or muscle membrane preparations for one or more DAPC components, including α1-syntrophin, β-syntrophin, α-dystrobrevin, β-dystroglycan, or nNOS, in mdx mouse muscles treated with micro-dystrophin having the C-terminal domain compared to mdx mouse muscles treated with micro-dystrophin having the C-terminal domain (having the same sequence and dystrophin components except for the minimum 48 amino acids at positions 111-112).

[0040] In some embodiments, micro-dystrophins comprising the C-terminal domain of dystrophin comprise an α1-syntrophin binding site and / or a dystrobrevin binding site in the C-terminal domain. In some embodiments, the C-terminal domain comprising the α1-syntrophin binding site is a truncated C-terminal domain. The α1-syntrophin binding site functions, in part, to recruit nNOS via α1-syntrophin and anchor it to the sarcolemma (see Figures 1A and 1B).

[0041] Embodiments described herein can include all or a portion of the CT domain, including helix 1 of the coiled-coil motif. The C-terminal sequence can be defined by the coding sequence of the exons of the DMD gene, particularly exons 70-74, and a portion of exon 75 (particularly the nucleotide sequence encoding the first 36 amino acids of the amino acid sequence encoded by exon 75), or by the sequence of the human DMD protein, for example, the sequence of UniProtKB-P11532 (SEQ ID NO: 92) (CT is amino acids 3361-3554 of the UniProtKB-P11532 sequence), or comprise or consist of the binding site for dystrobrevin and / or α1-syntrophin (shown in Table 1, SEQ ID NO: 16). In certain embodiments, the CT domain consists of or comprises the 194 C-terminal amino acids of the DMD protein, e.g., residues 3361-3554 of the amino acid sequence of UniProtKB-P11532 (SEQ ID NO: 92), the amino acids encoded by exons 70-74, and the nucleotide sequence encoding the first 36 nucleotides of the nucleotide sequence of exon 75 of the DMD gene, or the amino acid sequence of SEQ ID NO: 16 (see Table 1). For example, RGX-DYS1 (also μDys-CT194) has the 194 amino acid CT sequence of SEQ ID NO: 16.

[0042] In other embodiments, the amino acid sequence of the C-terminal domain is truncated and contains at least the binding site for dystrobrevin and / or α1-syntrophin. In certain embodiments, the truncated C-terminal domain contains the amino acid sequence MENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQ (α1-syntrophin binding site) (SEQ ID NO: 84). In certain embodiments, the truncated C-terminal domain contains the α1-syntrophin binding site, the binding site having the amino acid sequence MENSNGSYLNDSISPNESIDDEHLLIQHYCQSLNQ (SEQ ID NO: 84). In certain embodiments, the CT domain sequence has the amino acid sequence of SEQ ID NO: 83, or amino acids 3361-3500 of the UniProtKB-P11532 human DMD sequence (referred to as CT140 or CT1.5). For example, RGX-DYS5(μDys-CT140) has a CT domain having the amino acid sequence of SEQ ID NO: 83. In alternative embodiments, micro-dystrophin lacks a CT domain (or includes a minimum of 48 amino acids of the CT domain, designated CT48, which are amino acids 3361-3408 of the UniProtKB-P11532 human DMD sequence, SEQ ID NO: 91) and may have a domain arranged as follows: ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR, e.g., RGX-DYS3 (μDys-CT48) (FIG. 2, SEQ ID NO: 2). In embodiments, a micro-dystrophin such as RGX-DYS1 has a half-life that is 1.5-fold, 2-fold, 2.5-fold, or 3-fold longer than a micro-dystrophin such as RGS-DYS3, which has a CT sequence of 48 amino acids (SEQ ID NO: 91), as determined by pulse-chase assays in tissue culture, e.g., as described herein in Example 11.

[0043] The NH2-terminus and regions within the rod domain of dystrophin directly bind to, but do not crosslink, cytoskeletal actin. The rod domain of wild-type dystrophin is composed of 24 repeat units similar to the triple helical repeats of spectrin. This repeat unit accounts for the majority of the dystrophin protein and is thought to give the molecule a flexible rod-like structure similar to β-spectrin. These α-helical coiled-coil repeats are interrupted by four proline-rich hinge regions. At the end of the 24th repeat is a fourth hinge region immediately followed by a WW domain [Blake, D. et al., Function and Genetics of Dystrophin and Dystrophin-Related Proteins in Muscle. Physiol. Rev. 82:291-329, 2002]. The microdystrophin disclosed herein does not include R4 through R23, but contains only three or portions of the four hinge regions. In some embodiments, no new amino acid residues or linkers are introduced into the micro-dystrophin.

[0044] In some embodiments, the microdystrophin comprises an H3 (e.g., SEQ ID NO: 1, 2, or 79). In embodiments, the H3 can be the entire endogenous H3 domain from N-terminus to C-terminus, e.g., SEQ ID NO: 11. Alternatively, some microdystrophin embodiments do not include a fragment of the H3 domain, but include the entire H3 domain. In some embodiments, the C-terminal amino acid of the R3 domain is directly (or covalently) linked to the N-terminal amino acid of the H3 domain. In some embodiments, the C-terminal amino acid of the R3 domain linked to the N-terminal amino acid of the H3 domain is Q. In some embodiments, the 5' amino acid of the H3 domain linked to the R3 domain is Q.

[0045] Without being bound by any theory, a complete hinge domain may be suitable for any micro-dystrophin to transfer full activity to the induced micro-dystrophin protein.The hinge segment of dystrophin is recognized to be naturally proline-rich, and therefore may confer flexibility to the protein product (Koenig and Kunkel, 265(6):4560-4566, 1990).Any deletion of a part of the hinge, particularly the removal of one or more proline residues, may reduce its flexibility and thus reduce its effectiveness by preventing its interaction with other proteins in the DAP complex.

[0046] The micro-dystrophin disclosed herein comprises a wild-type dystrophin H4 sequence (including a WW domain) with and containing a CR domain (including a ZZ domain (UniProtKB-P11532 aa3307-3354) represented by a single underline in SEQ ID NO: 15). The WW domain is a protein-binding module found in several signaling and regulatory molecules. The WW domain binds to proline-rich substrates in a manner similar to src homology-3 (SH3) domains. This region mediates the interaction between β-dystroglycan and dystrophin because the cytoplasmic domain of β-dystroglycan is proline-rich. The WW domain is located in hinge 4 (H4 region). The CR domain is similar to that in α-actinin and is involved in the regulation of intracellular Ca. 2+ The ZZ domain contains two EF-hand motifs that can bind to Zn. 2+ The ZZ domain contains several conserved cysteine ​​residues predicted to form coordination sites for divalent metal cations such as Ca. ZZ domains are similar to many types of zinc fingers and are found in both nuclear and cytoplasmic proteins. The ZZ domain of dystrophin binds Ca. 2+ The ZZ domain binds calmodulin in a dystrophin-dependent manner. Thus, the ZZ domain may represent a functional calmodulin-binding site and may have implications for calmodulin binding to other dystrophin-related proteins.

[0047] Micro-dystrophin embodiments can further include linkers (L1, L2, L3, L4, L4.1, and / or L4.2) or portions thereof connected to the domains shown below: ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR-CT (e.g., SEQ ID NO: 1, 79, or 91) or ABD1-L1-H1-L2-R1-R2-L3-R3-H3-L4-R24-H4-CR (e.g., SEQ ID NO: 2), where L1 can be an endogenous linker L1 (e.g., SEQ ID NO: 4) capable of connecting ABD1 to H1. L2 can be an endogenous linker L2 (e.g., SEQ ID NO: 6) capable of connecting H1 to R1. L3 can be an endogenous linker L3 (e.g., SEQ ID NO: 9) capable of connecting R2 to R3.

[0048] L4 can also be an endogenous linker that can connect H3 and R24. In some embodiments, L4 is the three amino acids preceding R24 in the native dystrophin sequence, e.g., TLE (SEQ ID NO: 12). In other embodiments, L4 can be the four amino acids preceding R24 in the native dystrophin sequence (SEQ ID NO: 17) or the two amino acids preceding R24 (SEQ ID NO: 18). In other embodiments, there is no L4 or other linker between H3 and R24. At the 5' end of H3, as described above, there is no linker; rather, R3 is directly bound to H3, or alternatively to H2.

[0049] Components of other domains of the above microdystrophins not specifically described can have amino acid sequences as provided in Table 1 below. The amino acid sequences for the domains provided herein correspond to the dystrophin isoform of UniProtKB-P11532 (DMD_HUMAN) (SEQ ID NO: 92), which is incorporated herein by reference. Other embodiments can include domains derived from naturally occurring functional dystrophin isoforms known in the art, such as UniProtKB-A0A075B6G3 (A0A075B6G3_HUMAN) (incorporated herein by reference), e.g., R24 has R substituted for Q at amino acid 3 of SEQ ID NO: 13.

[0050] Additional embodiments are disclosed in International Application PCT / US2020 / 062484, filed November 27, 2020, which is incorporated by reference in its entirety. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0051] The present disclosure also contemplates variants of these sequences, so long as the function of each domain and linker is substantially maintained, and / or the therapeutic efficacy of the microdystrophin containing such variant is substantially maintained. Functional activity includes (1) binding to one, a combination, or all of actin, β-dystroglycan, α1-syntrophin, α-dystrobrevin, and nNOS, (2) improved muscle function in an animal model (e.g., the mdx mouse model described herein) or a human subject, and / or (3) cardioprotection or improved myocardial function in an animal model or a human patient. In particular, microdystrophins include ABD consisting of SEQ ID NO:3 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:3; H1 consisting of SEQ ID NO:5 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:5; SEQ ID NO:7 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO:7; R2 consisting of SEQ ID NO: 8 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 8; H3 consisting of SEQ ID NO: 11 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 11; R24 consisting of SEQ ID NO: 13 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 13;H4 consisting of SEQ ID NO: 14 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 14, CR consisting of SEQ ID NO: 15 or 90 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 15 or 90, CT consisting of SEQ ID NO: 16 or 83 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 16 or 83, or a CT comprising SEQ ID NO: 84. In addition to the above, microdystrophin may contain a linker at the above-mentioned position comprising or consisting of a sequence such as the following: L1 consisting of SEQ ID NO: 4 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 4; L2 consisting of SEQ ID NO: 6 or an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with SEQ ID NO: 6; L3 consisting of SEQ ID NO: 9 or an amino acid sequence having at least 50% identity with SEQ ID NO: 9, or a variant having conservative substitutions in both L3 residues; and L4 consisting of SEQ ID NO: 12, 17, or 18, or an amino acid sequence having at least 50%, at least 75% sequence identity with SEQ ID NO: 12, 17, or 18.

[0052] Table 2 provides amino acid sequences of microdystrophin embodiments according to the present disclosure. Other embodiments are also contemplated as substitution variants of microdystrophin defined by SEQ ID NO: 1 (RGX-DYS1), 2 (RGX-DYS3), or 79 (RGX-DYS5). For example, conservative substitutions can be made to SEQ ID NO: 1, 2, or 79 while substantially maintaining its functional activity. In embodiments, the microdystrophin has at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 1, 2, or 79 and can maintain functional microdystrophin activity, e.g., as determined by one or more in vitro or in vivo assays in animal models disclosed below in Section 5.4. RGX-DYS2 and RGX-DYS4 of the present disclosure also encode microdystrophin proteins comprising SEQ ID NO: 1. [Table 2-1] [Table 2-2] [Table 2-3]

[0053] 5.2.2 Microdystrophin-Encoding Nucleic Acid Compositions Another aspect of the present disclosure is a nucleic acid comprising a nucleotide sequence encoding a micro-dystrophin described herein. Such a nucleic acid comprises a nucleotide sequence encoding a micro-dystrophin having a domain arranged N-terminally to C-terminally as follows: ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, as detailed in Section 5.2.1 above. The nucleotide sequence can be any nucleotide sequence encoding the domain. The nucleotide sequence can be codon-optimized and / or CpG island-depleted for expression in the appropriate context. In certain embodiments, the nucleotide sequence encodes a micro-dystrophin having the amino acid sequence of SEQ ID NO: 1, 2, or 79. The nucleotide sequence can be any sequence encoding a micro-dystrophin, including the micro-dystrophin of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 79, although the nucleotide sequence can vary due to code degeneracy. Tables 3 and 4 provide exemplary nucleotide sequences encoding the DMD domain. Table 3 provides wild-type DMD nucleotide sequences for the components, and Table 4 provides nucleotide sequences for the DMD components used in the constructs herein (transgenes, expression constructs, cis-plasmids, and recombinant AAV genomes), including sequences that are codon-optimized and / or CpG-depleted in CpG islands as follows: [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2]

Table 4-3

Table 4-4

[0054] In some embodiments, such compositions encode functionally active micro-dystrophins, including a nucleic acid sequence encoding ABD1 consisting of SEQ ID NO: 22 or 57 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 22 or 57; a nucleic acid sequence encoding H1 consisting of SEQ ID NO: 24 or 59 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 24 or 59; a nucleic acid sequence encoding R1 consisting of SEQ ID NO: 26 or 61 or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 26 or 61; a nucleic acid sequence encoding R2 consisting of a sequence having 98%, or at least 99%, identity to SEQ ID NO: 29 or 64, or a nucleic acid sequence encoding R3 consisting of a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 or 64, SEQ ID NO: 30 or 65, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 30 or 65; a nucleic acid sequence encoding H3 consisting of a sequence having 8%, or at least 99% identity to SEQ ID NO: 32 or 67, or a nucleic acid sequence encoding R24 consisting of a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 32 or 67, SEQ ID NO: 33 or 68, or a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% identity to SEQ ID NO: 33 or 68;or a nucleic acid sequence encoding H4 consisting of a sequence having at least 99% identity thereto; a nucleic acid sequence encoding CR consisting of SEQ ID NO: 34, 47, or 69, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto; and / or a nucleic acid sequence encoding CT consisting of SEQ ID NO: 35 or 70, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity thereto.

[0055] In some embodiments, such compositions comprise a nucleic acid sequence encoding ABD1, SEQ ID NO: 22 or 57, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 22 or 57; encoding the ABD1 domain of SEQ ID NO: 3, SEQ ID NO: 24 or 59, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 24 or 59; encoding the H1 domain of SEQ ID NO: 5, SEQ ID NO: 26 or 61, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 26 or 61; encoding the R1 domain of SEQ ID NO: 7, SEQ ID NO: 27 or 62, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 27 or 62. a nucleic acid sequence encoding R2, SEQ ID NO: 29 or 64, which comprises a sequence having 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 or 64 and encodes the R2 domain of SEQ ID NO: 8; or a nucleic acid sequence encoding R3, SEQ ID NO: 3, which comprises a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 or 64 and encodes the R3 domain of SEQ ID NO: 10. 0 or 65, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 30 or 65, encoding the H3 domain of SEQ ID NO: 11, comprising a nucleic acid sequence encoding H3, SEQ ID NO: 32 or 67, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 32 or 67;a nucleic acid sequence encoding R24, encoding the R24 domain of SEQ ID NO: 13, SEQ ID NO: 33 or 68, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 33 or 68; a nucleic acid sequence encoding H4, encoding the H4 domain of SEQ ID NO: 14, SEQ ID NO: 34, 47, or 69, or a sequence having at least 75%, at least 80%, at least 85%, at least 90% identity to SEQ ID NO: 34, 47, or 69; , a nucleic acid sequence encoding a CR consisting of a sequence having at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 15 or 89, and encoding the CR domain of SEQ ID NO: 15 or 89; and / or a nucleic acid sequence encoding a CT consisting of SEQ ID NO: 35, 70, or 80, or a sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 35, 70, or 80, and encoding the CT domain of SEQ ID NO: 16 or 83.

[0056] In addition to the above, the nucleic acid composition optionally comprises nucleotide sequences encoding linkers comprising or consisting of the following sequences at the above positions: a nucleic acid sequence encoding L1 consisting of SEQ ID NO:23 or 58, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:23 or 58 (e.g., encoding the L1 domain of SEQ ID NO:4); a nucleic acid sequence encoding L2 consisting of SEQ ID NO:25 or 60, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:25 or 60; a nucleic acid sequence encoding an L3 consisting of SEQ ID NO: 28 or 63 or a sequence having at least 50% identity to SEQ ID NO: 28 or 63, and encoding the L3 domain of SEQ ID NO: 9 or a variant with conservative substitutions at both L3 residues; and a nucleic acid sequence encoding an L4 consisting of SEQ ID NO: 19, 31, 36, 37, 38, 46, or 66 or a sequence having at least 50%, at least 75%, sequence identity to SEQ ID NO: 19, 31, 36, 37, 38, 46, or 66 (e.g., encoding the L4 domain of SEQ ID NO: 12, 17, or 18, or a variant with conservative substitutions at any of the L4 residues).

[0057] In various embodiments, the nucleic acid comprises a nucleotide sequence encoding a micro-dystrophin having the amino acid sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:79. In embodiments, the nucleic acid comprises a nucleotide sequence that is SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:81 (encoding the micro-dystrophin of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:79, respectively). In various embodiments, the nucleotide sequence encoding the micro-dystrophin may have at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% sequence identity to the nucleotide sequence of SEQ ID NO:20, 21, or 83 (Table 5), or its reverse complement, and encodes a therapeutically effective micro-dystrophin. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7]

[0058] 5.2.2.1 Codon optimization and CpG depletion In one embodiment, the nucleotide sequence encoding the microdystrophin cassette is modified by codon optimization and CpG dinucleotide and CpG island depletion. Immune responses to the microdystrophin transgene are a concern for human clinical applications, as demonstrated in the first Duchenne muscular dystrophy (DMD) gene therapy clinical trial and several adeno-associated virus (AAV)-mini-dystrophin gene therapies in canine models [Mendell, JR, et al., Dystrophin immunity in Duchenne's muscular dystrophy. N Engl J Med, 2010. 363(15): pp. 1429-37; and Kornegay, JN, et al., Widespread muscle expression of an AAV9 human mini-dystrophin vector after intravenous injection in neonatal dystrophin-deficient dogs. Mol Ther, 2010. 18(8): pp. 1501-8].

[0059] AAV-directed immune responses can be inhibited by reducing the number of CpG dinucleotides in the AAV genome [Faust, SM, et al., CpG-depleted adeno-associated viral vectors evade immune detection. J Clin Invest, 2013. 123(7): pp. 2994-3001]. Depleting the transgene sequence of CpG motifs reduces the role of TLR9 in activating innate immunity upon recognition of the transgene as non-self, thus providing stable, long-term transgene expression. [See also Wang, D., P. W. L. Tai, and G. Gao, Adeno-associated virus vector as a platform for gene therapy delivery. Nat Rev Drug Discov, 2019. 18(5): pp. 358-378; and Rabinowitz, J., Y. K. Chan, and R. J. Samulski, Adeno-associated virus (AAV) versus immune response. Viruses, 2019. 11(2)]. In an embodiment, the micro-dystrophin cassette is human codon-optimized along with CpG depletion. Codon-optimized and CpG-depleted nucleotide sequences can be designed by any method known in the art, including, for example, Thermo Fisher Scientific GeneArt Gene Synthesis tools using GeneOptimizer (Waltham, MA USA). The nucleotide sequences of SEQ ID NOs: 20, 21, 57-72, 80, 81, and 101-103 described herein represent codon-optimized and CpG-depleted sequences.

[0060] Micro-dystrophin transgenes are provided that have a reduced number of CpG dinucleotide sequences, and consequently, a reduced number of CpG islands. In certain embodiments, the micro-dystrophin nucleotide sequence has fewer than two (2) CpG islands, or one (1) CpG island, or zero (0) CpG islands. In embodiments, micro-dystrophin transgenes are provided that have reduced immunogenicity, as measured by anti-drug antibody titers, compared to micro-dystrophin transgenes with more than two CpG islands. In certain embodiments, a micro-dystrophin nucleotide sequence consisting essentially of SEQ ID NO: 20, 21, or 81 has zero (0) CpG islands. In other embodiments, a micro-dystrophin transgene nucleotide sequence consisting essentially of a micro-dystrophin gene operably linked to a promoter, wherein the micro-dystrophin coding sequence consists of SEQ ID NO: 20, 21, or 81, has fewer than two (2) CpG islands. In yet other embodiments, the microdystrophin transgene nucleotide sequence, consisting essentially of a microdystrophin gene operably linked to a promoter, wherein the microdystrophin coding sequence consists of SEQ ID NO: 20, 21, or 81, has one (1) CpG island.

[0061] 5.3. Gene Cassettes and Regulatory Elements Another aspect of the present invention relates to nucleic acid expression cassettes containing regulatory elements designed to confer or enhance micro-dystrophin expression. The invention further involves engineering regulatory elements, including promoter elements, and optionally enhancer elements and / or introns, to enhance or promote transgene expression. In some embodiments, the rAAV vector also contains such regulatory control elements known to those skilled in the art to affect expression of the RNA and / or protein product encoded by the nucleic acid (transgene) in target cells of interest. The regulatory control elements can be tissue-specific, i.e., active (or substantially more active or more markedly active) only in the target cells / tissues.

[0062] 5.3.1 Promoter 5.3.1.1 Tissue-specific promoters In certain embodiments, the expression cassette of the AAV vector contains a regulatory sequence, such as a promoter, operably linked to the transgene, enabling expression in the target tissue. The promoter may be a muscle promoter. In certain embodiments, the promoter is a muscle-specific promoter. The phrases "muscle-specific," "muscle-selective," or "muscle-tropic" refer to nucleic acid elements that adapt their activity in muscle cells or tissues due to the interaction of such elements with the intracellular environment of the muscle cells. Such muscle cells may include myocytes, myotubes, cardiomyocytes, etc. Specialized forms of muscle cells with distinct properties, such as cardiomyocytes, skeletal muscle cells, and smooth muscle cells, are included. Various therapeutics can benefit from muscle-specific expression of transgenes. Specifically, gene therapies that treat various forms of muscular dystrophy and enable high transduction efficiency in muscle cells have the added advantage of directing transgene expression in cells where the transgene is most needed. Cardiac tissue would also benefit from muscle-tropic expression of transgenes. A muscle-specific promoter may be operably linked to the transgene of the present invention. In some embodiments, the muscle-specific promoter is selected from the SPc5-12 promoter (SEQ ID NO: 39), the muscle creatine kinase myosin light chain (MLC) promoter, the myosin heavy chain (MHC) promoter, the desmin promoter (SEQ ID NO: 119), the MHCK7 promoter (SEQ ID NO: 120), the CK6 promoter, the CK8 promoter (SEQ ID NO: 115), the MCK promoter (or a truncated form thereof) (SEQ ID NO: 121), the alpha-actin promoter, the beta-actin promoter, the gamma-actin promoter, the E-syn promoter, the cardiac troponin C promoter, the troponin I promoter, the myoD gene family promoter, or the muscle-selective promoter present within intron 1 of the eye form of Pitx3.

[0063] The synthetic promoter c5-12, known as the SPc5-12 promoter (Li, X. et al., Nature Biotechnology Vol. 17, pp. 241-245, March 1999), has been shown to have cell-type restricted expression, specifically muscle cell-specific expression. At less than 350 bp in length, the SPc5-12 promoter is shorter than most endogenous promoters, which can be advantageous when the length of the nucleic acid encoding the therapeutic protein is relatively long.

[0064] To further reduce the length of the vector, the regulatory element can be a shortened or truncated version of any one of the promoters described herein (referred to herein as a "minimal promoter"). A minimal promoter contains at least the full-length transcriptional activation domain and can therefore still drive expression. For example, in some embodiments, the AAV vector can contain the transcriptional activation domain of a muscle-specific promoter, such as the minimal SPc5-12 promoter (e.g., SEQ ID NO: 40), operably linked to a therapeutic protein transgene. In embodiments, the therapeutic protein is microdystrophin, as described herein. The minimal promoter of the present disclosure may or may not contain portions of the promoter sequence that contribute to regulating expression in a tissue-specific manner.

[0065] Thus, in embodiments, gene therapy cassettes are provided that contain the SPc5-12 promoter (SEQ ID NO: 39) or SPc5-12 promoter variants, mutants, or fragments thereof. For example, RGX-DYS1 and RGX-DYS5 (FIG. 2) contain the Spc5-12 promoter. The sequences of these promoters are provided in Table 6.

[0066] In some embodiments, modified or mutated SPc5-12 promoters are provided. The mutant SPc5-12 promoters can comprise the nucleic acid sequence of SEQ ID NO: 93 or SEQ ID NO: 94. These unique SPc5-12 promoter sequences can promote muscle-specific expression and increase the yield of capsids produced in the complete genome. Thus, in some embodiments, a gene therapy vector is provided that includes the mutant SPc5-12 promoter (SEQ ID NO: 93 or 94).

[0067] In some embodiments, variants of SEQ ID NO: 93 are provided. In some embodiments, the disclosed nucleic acids can comprise muscle-specific promoter activity, a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 93, and in certain embodiments, 100% sequence identity across nucleotides 121-129 and 197-209 of SEQ ID NO: 93. In some embodiments, the disclosed nucleic acids can comprise muscle-specific promoter activity, a nucleotide sequence having at least 85, 90, 95, or 100% sequence identity to SEQ ID NO: 93, and in some embodiments, 100% sequence identity across nucleotides 121-129 and 197-209 of SEQ ID NO: 93. A variant of SEQ ID NO: 93 can be SEQ ID NO: 93 but with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, or 70 nucleic acid substitutions. In some embodiments, any of the variants retain 100% sequence identity over nucleotides 121-129 and 197-209 of SEQ ID NO:93 and retain muscle-specific promoter activity. In some embodiments, variants of SEQ ID NO:94 are provided. In some embodiments, the disclosed nucleic acids can comprise muscle-specific promoter activity, a nucleotide sequence having at least 80% sequence identity to SEQ ID NO:94, and in some embodiments, 100% sequence identity over nucleotides 113-131 and 191-212 of SEQ ID NO:94. In some embodiments, the disclosed nucleic acids can comprise muscle-specific promoter activity, a nucleotide sequence having at least 85, 90, 95, or 100% sequence identity to SEQ ID NO:94, and in some embodiments, 100% sequence identity over nucleotides 113-131 and 191-212 of SEQ ID NO:94. A variant of SEQ ID NO: 94 can be the sequence of SEQ ID NO: 94 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, or 70 nucleic acid substitutions.In some embodiments, any of the variants retain 100% sequence identity across nucleotides 113-131 and 191-212 of SEQ ID NO: 94 and retain muscle-specific promoter activity.

[0068] Alternatively, the promoter may be a constitutive promoter, such as a CB7 promoter. Additional promoters include a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter (SEQ ID NO: 54), a UB6 promoter, a chicken beta-actin promoter, a CAG promoter (SEQ ID NO: 52), an RPE65 promoter, an opsin promoter, a TBG (thyroxine-binding globulin) promoter, an APOA2 promoter, a SERPINA1 (hAAT) promoter, or an MIR122 promoter. In some embodiments, an inducible promoter, such as a hypoxia-inducible or rapamycin-inducible promoter, is used, particularly when it is desired to turn off transgene expression. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5]

[0069] In certain embodiments, the promoter is a CNS-specific promoter. For example, the expression cassette can comprise a promoter selected from any neuronal promoter, such as the promoter isolated from the neuron-specific enolase (NSE) gene, the promoter of dopamine-1 receptor or dopamine-2 receptor, the synapsin promoter, the CB7 promoter (chicken β-actin promoter and CMV enhancer), the RSV promoter, the GFAP promoter (glial fibrillary acidic protein), the MBP promoter (myelin basic protein), the MMT promoter, the EF-1α, the U86 promoter, the RPE65 promoter or the opsin promoter, an inducible promoter, for example, a hypoxia-inducible promoter, and a drug-inducible promoter, such as the promoter induced by rapamycin and related drugs.

[0070] In yet other embodiments, the expression cassette can include multiple promoters that can be arranged in tandem within the expression cassette containing the microdystrophin transgene. Thus, tandem or hybrid promoters can be used to enhance expression and / or direct expression to multiple tissue types (see, e.g., PCT International Publication No. 2019154939A1, published August 15, 2019, which is incorporated herein by reference), particularly LMTP6, LMTP13, LMTP14, LMTP15, LMTP18, LMTP19, or LMTP20, as disclosed in PCT International Application No. PCT / US2020 / 043578, filed July 24, 2020.

[0071] 5.3.2 Introns Certain gene expression cassettes further include an intron, such as a 5' intron, of the microdystrophin coding sequence, which can enhance proper splicing and thus microdystrophin expression. Thus, in some embodiments, the intron is attached to the 5' end of the sequence encoding the microdystrophin protein. In particular, the intron nucleotide sequence can be linked to a nucleotide sequence linked to an actin-binding domain. In other embodiments, the intron is less than 100 nucleotides in length.

[0072] In an embodiment, the intron is a VH4 intron. The VH4 intron nucleic acid may comprise SEQ ID NO: 41, as shown in Table 7 below. [Table 7]

[0073] In another embodiment, the intron is a chimeric intron derived from human β-globin and Ig heavy chain (also known as a β-globin splice donor / immunoglobulin heavy chain splice acceptor intron, or a β-globin / IgG chimeric intron) (Table 7, SEQ ID NO: 75). Other introns known to those skilled in the art can be used, such as the chicken β-actin intron, minute virus of mice (MVM) intron, human factor IX intron (e.g., FIX cleavage intron 1), β-globin splice donor / immunoglobulin heavy chain splice acceptor intron, adenovirus splice donor / immunoglobulin splice acceptor intron, SV40 late splice donor / splice acceptor (19S / 16S) intron (Table 7, SEQ ID NO: 76).

[0074] 5.3.3 Other regulatory elements 5.3.3.1 PolyA Another aspect of the present disclosure relates to an expression cassette comprising a polyadenylation (polyA) site downstream of the coding region of the microdystrophin transgene. Any polyA site that signals the termination of transcription and directs the synthesis of a polyA tail is suitable for use in the AAV vector of the present disclosure. Exemplary polyA signals include, but are not limited to, those derived from the SV40 late gene, rabbit β-globin gene, bovine growth hormone (BPH) gene, human growth hormone (hGH) gene, and synthetic polyA (SPA) sites. In one embodiment, the polyA signal comprises SEQ ID NO: 42, as shown in Table 8. [Table 8]

[0075] 5.3.4 Viral vectors A micro-dystrophin transgene according to the present disclosure can be included in an AAV vector for gene therapy administration to a human subject. In some embodiments, a recombinant AAV (rAAV) vector can comprise an AAV viral capsid and a viral or artificial genome comprising an expression cassette flanked by AAV inverted terminal repeats (ITRs), the expression cassette comprising a micro-dystrophin transgene operably linked to one or more regulatory sequences controlling transgene expression in human muscle or CNS cells for the expression and delivery of micro-dystrophin. The provided methods are suitable for use in methods of treating a disease or disorder amenable to micro-dystrophin treatment in a subject in need thereof, including producing any of the isolated recombinant AAV particles for delivery of micro-dystrophin described herein, producing compositions comprising any of the isolated recombinant AAV particles encoding micro-dystrophin, or administering any of the isolated recombinant AAV particles encoding micro-dystrophin described herein. Thus, rAAV can be any serotype, variant, modified, hybrid, or derivative thereof, or any combination thereof (collectively referred to as "serotypes") known in the art. In certain embodiments, the AAV serotype has a tropism for muscle tissue, and in other embodiments, the AAV serotype has a tropism for the liver, where AAV-transduced liver cells form depots of microdystrophin-secreting cells and secrete microdystrophin into the circulation.

[0076] In some embodiments, the rAAV particles have capsid proteins from the AAV8 or AAV9 serotype. Provided herein are RGX-DYS1 constructs (recombinant AAV genomes comprising a polynucleotide having the nucleotide sequence of SEQ ID NO: 53) in rAAV particles having AAV8 capsids and RGX-DYS1 constructs (recombinant AAV genomes) in rAAV particles having AAV9 capsids. Also provided are RGX-DYS5 constructs (recombinant AAV genomes comprising a polynucleotide having the nucleotide sequence of SEQ ID NO: 82) in rAAV particles having AAV8 capsids and RGX-DYS5 constructs (recombinant AAV genomes) in rAAV particles having AAV9 capsids. In some embodiments, the rAAV particles comprise capsid proteins from an AAV capsid serotype selected from the group consisting of AAV7, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, and AAV.7m8. In some embodiments, the rAAV particles comprise capsid proteins with high sequence homology to AAV8 or AAV9, such as AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37. In some embodiments, the rAAV particles have an AAV capsid serotype of AAV1, or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV particles have an AAV4 AAV capsid serotype or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV particles have an AAV5 AAV capsid serotype or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV particles have an AAV8 AAV capsid serotype or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV particles have an AAV9 AAV capsid serotype or a derivative, modification, or pseudotype thereof.

[0077] In some embodiments, rAAV particles comprise capsid proteins that are derivatives, modified, or pseudotypes of AAV8 or AAV9 capsid proteins. In some embodiments, rAAV particles comprise capsid proteins that have at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity, to the VP1, VP2, and / or VP3 sequences of AAV8 capsid proteins (the amino acid sequence of VP3 is SEQ ID NO: 77). In some embodiments, rAAV particles comprise capsid proteins that are derivatives, modified, or pseudotypes of the AAV9 capsid protein (amino acid sequence SEQ ID NO: 78). In some embodiments, the rAAV particles comprise capsid proteins having AAV8 capsid proteins that are at least 80% identical to the VP1, VP2, and / or VP3 sequences of the AAV9 capsid protein, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical.

[0078] In some embodiments, the rAAV particles comprise capsid proteins that have at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity, to the VP1, VP2, and / or VP3 sequences of an AAV7, AAV8, AAV9, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.PHP.B, AAV.PHP.eB, or AAV.7m8 capsid protein. In some embodiments, the rAAV particles comprise capsid proteins that have at least 80% or more identity, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identity, to the VP1, VP2, and / or VP3 sequences of AAV capsid proteins that have high sequence homology to AAV8 or AAV9, such as AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, and AAV.hu37.

[0079] Alternatively, rAAV particles can include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AA V.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tY and having a capsid protein of a serotype selected from AAV.F, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or a derivative, modification, or pseudotype thereof.In some embodiments, the rAAV particles may be any of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, rAAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAV.HSC18, AAV.HSC19 ... and / or AAV.HSC16, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or a capsid protein that is at least 80% identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical, to the VP1, VP2, and / or VP3 sequences of an AAV capsid serotype selected from AAV.HSC16, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or a derivative, modification, or pseudotype thereof.

[0080] For example, a population of rAAV particles can include two or more serotypes, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHPB, AAV. and two or more of PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or other rAAV particles, or a combination of two or more thereof.

[0081] In some embodiments, the rAAV particles comprise capsids of Anc80 or Anc80L65, as described in Zinn et al., 2015, Cell Rep. 12(6):1056-1068 (incorporated by reference in their entireties). In certain embodiments, the rAAV particles comprise capsids with one of the following amino acid insertions: LGETTRP (SEQ ID NO: 87) or LALGETTRP (SEQ ID NO: 88), as described in U.S. Patent Nos. 9,193,956, 9,458,517, and 9,587,282, and U.S. Patent Application Publication No. 2016 / 0376323 (each of which is incorporated by reference in its entirety). In some embodiments, the rAAV particles comprise the AAV.7m8 capsid described in U.S. Patent Nos. 9,193,956, 9,458,517, and 9,587,282, and U.S. Patent Application Publication No. 2016 / 0376323 (each of which is incorporated by reference in its entirety). In some embodiments, the rAAV particles comprise any AAV capsid disclosed in U.S. Patent No. 9,585,971 (e.g., AAVPHP.B). In some embodiments, the rAAV particles comprise any AAV capsid disclosed in U.S. Patent No. 9,840,719 and WO 2015 / 013313 (each of which is incorporated by reference in its entirety) (e.g., AAV.Rh74 and RHM4-1). In some embodiments, the rAAV particles comprise any AAV capsid (e.g., AAVrh.74) disclosed in WO2014 / 172669 (incorporated herein by reference in its entirety). In some embodiments, the rAAV particles comprise an AAV2 / 5 capsid described in Georgiadis et al., 2016, Gene Therapy 23:857-862 and Georgiadis et al., 2018, Gene Therapy 25:450 (each of which is incorporated herein by reference in its entirety). In some embodiments, the rAAV particles comprise any AAV capsid (e.g., AAV2tYF) disclosed in WO2017 / 070491 (incorporated herein by reference in its entirety).In some embodiments, the rAAV particles comprise the AAVLK03 or AAV3B capsid described in Puzzo et al., 2017, Sci. Transl. Med. 29(9):418 (incorporated herein by reference in its entirety). In some embodiments, the rAAV particles comprise any AAV capsid (e.g., HSC1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15, or HSC16) disclosed in U.S. Patent Nos. 8,628,966, 8,927,514, 9,923,120, and WO 2016 / 049230 (each of which is incorporated by reference in its entirety).

[0082] In some embodiments, the rAAV particles comprise AAV disclosed in any of the following patents and patent applications, which are incorporated by reference herein in their entireties: U.S. Patent Nos. 7,282,199, 7,906,111, 8,524,446, 8,999,678, 8,628,966, 8,927,514, 8,734,809, 9,284,357, 9,409,953, 9,169,299, 9,193,956, 9,458,517, and 9 ,587,282; U.S. Patent Application Nos. 2015 / 0374803, 2015 / 0126588, 2017 / 0067908, 2013 / 0224836, 2016 / 0215024, and 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799 and PCT / EP2015 / 053335. In some embodiments, the rAAV particles have capsid proteins that are at least 80% identical or greater, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, etc., i.e., up to 100% identical, to the VP1, VP2, and / or VP3 sequences of the AAV capsid disclosed in any of the following patents and patent applications, each of which is incorporated herein by reference in its entirety: U.S. Pat. Nos. 7,282,199, 7,906,111, 8,524,446, and 8,999,678. , 8,628,966, 8,927,514, 8,734,809, 9,284,357, 9,409,953, 9,169,299, 9,193,956, 9458517, and 9,587,282; U.S. Patent Application No. 2015 / 03748 Nos. 2015 / 0126588, 2017 / 0067908, 2013 / 0224836, 2016 / 0215024, and 2017 / 0051257; and International Patent Application Nos. PCT / US2015 / 034799 and PCT / EP2015 / 053335.

[0083] In some embodiments, the rAAV particles are prepared using the methods described in International Patent Publication Nos. 2003 / 052051 (see, e.g., SEQ ID NO: 2 of '051), 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88 of '321), 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97 of '397), 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6 of '888), 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38 of '689), 2009 Nos. 2010 / 127097 (see, e.g., SEQ ID NOS: 5-38 of '097), and 2015 / 191508 (see, e.g., SEQ ID NOS: 80-294 of '508), and U.S. Application Publication No. 2015 / 0023924 (see, e.g., SEQ ID NOS: 1, 5-10 of '924), the contents of each of which are incorporated herein by reference in their entireties.In some embodiments, the rAAV particles are prepared using the methods described in International Patent Publication Nos. 2003 / 052051 (see, e.g., SEQ ID NO: 2 of '051), 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88 of '321), 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85, and 97 of '397), 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6 of '888), 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38 of '689), 2009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24, and 31 of '964), and the like. and U.S. Patent Publication No. 20150023924 (see, e.g., SEQ ID NOS: 1, 5-10 in '924).

[0084] Nucleic acid sequences of AAV-based viral vectors and methods for producing recombinant AAV and AAV capsids are described in, for example, U.S. Patent Nos. 7,282,199, 7,906,111, 8,524,446, 8,999,678, 8,628,966, 8,927,514, 8,734,809, 9,284,357, 9,409,953, 9,169,299, 9,193,956, 9458517, and 9,587,282; U.S. Patent Application Publication Nos. 2015 / 0374803, 2015 / 0126588, and 2015 / 0126589. Nos. 2017 / 0067908, 2013 / 0224836, 2016 / 0215024, 2017 / 0051257, International Patent Application Nos. PCT / US2015 / 034799, PCT / EP2015 / 053335, 2003 / 052051, 2005 / 033321, 03 / 042397, 2006 / 068888, 2006 / 110689, 2009 / 104964, 2010 / 127097, and 2015 / 191508, and U.S. Patent Application Publication No. 2015 / 0023924.

[0085] In additional embodiments, the rAAV particles comprise pseudotyped AAV capsids. In some embodiments, the pseudotyped AAV capsids are rAAV2 / 8 or rAAV2 / 9 pseudotyped AAV capsids. Methods for producing and using pseudotyped rAAV particles are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081 (2001)).

[0086] In certain embodiments, single-stranded AAV (ssAAV) can be used. In certain embodiments, self-complementary vectors, such as scAAV, can be used (see, for example, Wu, 2007, Human Gene Therapy, 18(2):171-82; McCarty et al, 2001, Gene Therapy, Vol. 8, Number 16, Pages 1248-1254; and U.S. Patent Nos. 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference in its entirety).

[0087] In additional embodiments, the rAAV particles comprise a mosaic capsid. Mosaic AAV particles are composed of a mixture of viral capsid proteins from different serotypes of AAV. In some embodiments, the rAAV particles comprise any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PH and a mosaic capsid comprising capsid proteins of a serotype selected from P.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16.

[0088] In some embodiments, the rAAV particles comprise a mosaic capsid comprising capsid proteins of a serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10.

[0089] In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles. In some embodiments, the pseudotyped rAAV particles comprise (a) a nucleic acid vector comprising AAV ITRs, and (b) a capsid composed of capsid proteins derived from an AAVx (e.g., AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16). In some additional embodiments, the rAAV particles are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu31, AAV.hu32, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV. In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles comprised of capsid proteins of an AAV serotype selected from AAV.PHP.eB, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles comprised of AAV8 capsid proteins. In additional embodiments, the rAAV particles comprise pseudotyped rAAV particles comprised of AAV9 capsid proteins. In some embodiments, the pseudotyped rAAV8 or rAAV9 particles are rAAV2 / 8 or rAAV2 / 9 pseudotyped particles.Methods for producing and using pseudotyped rAAV particles are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001)).

[0090] In additional embodiments, the rAAV particles comprise capsids comprising capsid protein chimeras of two or more AAV capsid serotypes, hi further embodiments, the capsid proteins are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, and AAV.PHP.eB. A chimera of two or more AAV capsid proteins from an AAV serotype selected from AAV2.5, AAV2tYF, AAV3B, rAAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In a further embodiment, the capsid protein is a chimera of two or more AAV capsid proteins from an AAV serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.8, and AAVrh.10.

[0091] In some embodiments, the rAAV particles comprise an AAV8 capsid protein and one or more of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.e and AAV capsid protein chimeras with one or more AAV capsid proteins from an AAV serotype selected from B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16. In some embodiments, the rAAV particles comprise an AAV capsid protein chimera of an AAV8 capsid protein and one or more AAV capsid proteins from an AAV serotype selected from AAV1, AAV2, AAV5, AAV6, AAV7, AAV9, AAV10, AAVrh.8, and AAVrh.10.

[0092] In some embodiments, the rAAV particles comprise an AAV9 capsid protein and one of the following: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV.PHP.e and AAV capsid protein chimeras with capsid proteins of one or more AAV capsid serotypes selected from B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16.

[0093] In some embodiments, the rAAV particles comprise an AAV capsid protein chimera of an AAV9 capsid protein and a capsid protein of one or more AAV capsid serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.8, and AAVrh.10.

[0094] In some embodiments, the rAAV particles comprise clade A, B, E, or F AAV capsid proteins. In some embodiments, the rAAV particles comprise clade F AAV capsid proteins. In some embodiments, the rAAV particles comprise clade E AAV capsid proteins.

[0095] Table 9 below provides examples of the amino acid sequences of AAV8, AAV9, AAV.rh74, AAV.hu31, AAV.hu32, and AAV.hu37 capsid proteins, and the nucleic acid sequences of the AAV2 5'- and 3' ITRs.

Table 9-1

Table 9-2

Table 9-3

Table 9-4

Table 9-5

Table 9-6

[0096] The provided methods are suitable for use in producing recombinant AAVs encoding transgenes. In certain embodiments, the transgene is a microdystrophin described herein. In some embodiments, the rAAV genome (or cis-plasmid) comprises the following components: (1) AAV inverted terminal repeats flanking the expression cassette, (2) regulatory control elements, such as a) a promoter / enhancer, b) a poly(A) signal, and c) optionally an intron, and (3) a nucleic acid sequence encoding the transgene. In certain embodiments, the constructs (cis-plasmids or recombinant AAV genome sequences) described herein comprise the following components: (1) AAV2 or AAV8 inverted terminal repeats (ITRs) flanking the expression cassette, (2) control elements, including the muscle-specific SPc5-12 promoter and a small poly(A) signal, and (3) a transgene providing (e.g., encoding) a nucleic acid encoding a microdystrophin described herein, including the microdystrophin-coding sequence of the RGX-DYS1 transgene (SEQ ID NO: 20) or the RGX-DYS5 transgene (SEQ ID NO: 81). In certain embodiments, the constructs (cis-plasmids or recombinant AAV genomes) described herein contain the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette, (2) regulatory elements including a) the muscle-specific SPc5-12 promoter, b) a small polyA signal, and (3) a micro-dystrophin cassette comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein CT comprises a CT having the amino acid sequence of SEQ ID NO: 16 or 83, and comprising at least a portion of CT comprising an α1-syntrophin binding site.In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 or AAV8 ITRs flanking the expression cassette; (2) regulatory elements including a) the muscle-specific SPc5-12 promoter, b) an intron (e.g., VH4), and c) a small polyA signal; and (3) a micro-dystrophin cassette comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT, wherein CT comprises a CT having the amino acid sequence of SEQ ID NO: 16 or 83, and comprising at least a portion of CT comprising an α1-syntrophin binding site, and wherein ABD1 is directly bound to VH4.

[0097] In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 ITRs flanking an expression cassette, (2) control elements including a) a muscle-specific SPc5-12 promoter and b) a small polyA signal, and (3) a nucleic acid encoding an RGX-DYS1 micro-dystrophin having the amino acid sequence of SEQ ID NO: 1, comprising encoded by the nucleotide sequence of SEQ ID NO: 20. In certain embodiments, the constructs described herein comprise the following components: (1) AAV2 ITRs flanking an expression cassette, (2) control elements including a) a muscle-specific SPc5-12 promoter and b) a small polyA signal, and (3) a nucleic acid encoding an RXG-DYS5 micro-dystrophin having the amino acid sequence of SEQ ID NO: 79, comprising encoded by the nucleotide sequence of SEQ ID NO: 81. In some embodiments, constructs described herein comprising AAV ITRs flanking a micro-dystrophin expression cassette comprising, from N- to C-terminus, ABD1-H1-R1-R2-R3-H2-R24-H4-CR-CT, wherein CT comprises a CT having the amino acid sequence of SEQ ID NO: 16 or 83, and at least a portion of the CT comprising an α1-syntrophin binding site, can be 4000 to 5000 nucleotides in length. In some embodiments, such constructs (recombinant AAV genomes including ITR sequences) are less than 4900, 4800, 4700, 4600, 4500, 4400, or 4300 nucleotides in length.

[0098] Some nucleic acid embodiments of the present disclosure include a rAAV vector (cis-plasmid or recombinant AAV genome) encoding microdystrophin comprising or consisting of the nucleotide sequence of SEQ ID NO: 53, 55, or 82, as provided in Table 10 below. In various embodiments, the rAAV vector comprises a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 53, 55, or 82, or its reverse complement, and encodes an rAAV vector suitable for expressing therapeutically effective microdystrophin in muscle cells. In embodiments, the construct having the nucleotide sequence of SEQ ID NO: 53, 55, or 82 is in a recombinant rAAV8 or rAAV9 particle. In embodiments, the recombinant AAV vector or particle is AAV8-RGX-DYS1. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7] [Table 10-8] [Table 10-9] [Table 10-10] [Table 10-11] [Table 10-12] [Table 10-13] [Table 10-14] [Table 10-15]

[0099] 5.3.5 Methods for producing rAAV particles Another aspect of the invention involves producing the molecules disclosed herein. In some embodiments, the molecules of the invention are produced by providing nucleotides comprising a nucleic acid sequence encoding any of the capsid protein molecules described herein and using a packaging cell system to prepare corresponding rAAV particles having a capsid coat composed of the capsid proteins. Such capsid proteins are described above in Section 5.3.4. In some embodiments, the nucleic acid sequence encodes a sequence having at least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 96%, 97%, 98%, 99%, or 99.9%, identity to the sequence of a capsid protein molecule described herein, and retains (or substantially retains) the biological function of the capsid protein and any inserted peptides from a heterologous protein or domain thereof. In some embodiments, the nucleic acid encodes a sequence that has at least 60%, 70%, 80%, 85%, 90%, or 95%, preferably 96%, 97%, 98%, 99%, or 99.9%, identity to the sequence of the AAV8 capsid protein while retaining (or substantially retaining) the biological function of the AAV8 capsid protein and the inserted peptide.

[0100] Capsid proteins, coats, and rAAV particles can be produced by techniques known in the art. In some embodiments, the viral genome contains at least one inverted terminal repeat to allow packaging into a vector. In some embodiments, the viral genome further contains a cap gene and / or a rep gene for expression and splicing of the cap gene. In embodiments, the cap and rep genes are provided by the packaging cell and are not present in the viral genome.

[0101] In some embodiments, the nucleic acid encoding the engineered capsid protein is cloned into an AAV Rep-Cap plasmid in place of the existing capsid gene. When co-introduced into a host cell, this plasmid assists in packaging the rAAV genome into the modified capsid protein as the capsid coat. Packaging cells can be any cell type that harbors the genes necessary to facilitate AAV genome replication, capsid assembly, and packaging.

[0102] Numerous cell culture-based systems are known in the art for producing rAAV particles, any of which can be used to carry out the methods disclosed herein. Cell culture-based systems include transfection, stable cell line production, and infectious hybrid virus production systems, including, but not limited to, adenovirus-AAV hybrids, herpesvirus-AAV hybrids, and baculovirus-AAV hybrids. rAAV production cultures for the production of rAAV viral particles require (1) suitable host cells, including, for example, human-derived, mammalian, or insect-derived cell lines; (2) suitable helper virus functions, provided by wild-type or mutant adenovirus (such as a temperature-sensitive adenovirus), herpesvirus, baculovirus, or a plasmid construct providing helper functions; (3) AAV rep and cap genes and gene products; (4) a transgene (such as a therapeutic transgene) flanked by AAV ITR sequences and, optionally, regulatory elements; and (5) suitable media and media components (nutrients) that support cell growth / survival and rAAV production.

[0103] Non-limiting examples of host cells include A549, WEHI, 10T1 / 2, BHK, MDCK, COS1, COS7, BSC1, BSC40, BMT10, VERO, W138, HeLa, HEK293, and their derivatives (HEK293T cells, HEK293F cells), Saos, C2C12, L, HT1080, HepG2, primary fibroblasts, hepatocytes, myoblasts, CHO cells or CHO-derived cells, or insect-derived cell lines such as SF-9 (e.g., in the case of baculovirus production systems). For a review, see Aponte-Ubillus et al., 2018, Appl. Microbiol. Biotechnol. 102:1045-1054 (incorporated herein by reference in its entirety for production techniques).

[0104] In one aspect, provided herein are methods for producing rAAV particles, comprising: (a) providing a cell culture comprising insect cells; (b) introducing into the cells one or more baculovirus vectors encoding at least one of: i. an rAAV genome to be packaged; ii. an AAV rep protein sufficient for packaging; and iii. an AAV cap protein sufficient for packaging; and (c) supplementing the cell culture with sufficient nutrients and maintaining the cell culture under conditions that permit the production of rAAV particles. In some embodiments, the method comprises using a first baculovirus vector encoding the rep and cap genes and a second baculovirus vector encoding the rAAV genome. In some embodiments, the method comprises using a baculovirus encoding the rAAV genome and insect cells that express the rep and cap genes. In some embodiments, the method comprises using a baculovirus vector encoding the rep and cap genes and the rAAV genome. In some embodiments, the insect cells are Sf-9 cells. In some embodiments, the insect cells are Sf-9 cells that contain one or more stably integrated heterologous polynucleotides encoding the rep and cap genes.

[0105] In some embodiments, the methods disclosed herein use a baculovirus production system. In some embodiments, the baculovirus production system uses a first baculovirus encoding the rep and cap genes and a second baculovirus encoding the rAAV genome. In some embodiments, the baculovirus production system uses a baculovirus encoding the rAAV genome and a host cell that expresses the rep and cap genes. In some embodiments, the baculovirus production system uses a baculovirus encoding the rep and cap genes and the rAAV genome. In some embodiments, the baculovirus production system uses insect cells such as Sf-9 cells.

[0106] Those skilled in the art are aware of numerous methods by which the AAV rep and cap genes, AAV helper genes (e.g., adenovirus E1a, E1b, E4, E2a, and VA genes), and rAAV genome (comprising one or more genes of interest flanked by inverted terminal repeats (ITRs)) can be introduced into cells to produce or package rAAV. The phrase "adenovirus helper functions" refers to the numerous viral helper genes expressed (as RNA or protein) within the cell so that AAV propagates efficiently in the cell. Those skilled in the art will appreciate that helper viruses, including adenovirus and herpes simplex virus (HSV), facilitate AAV replication, and specific genes that provide essential functions have been identified, e.g., helpers can induce changes to the cellular environment that facilitate such AAV gene expression and replication. In some embodiments of the methods disclosed herein, the AAV rep and cap genes, helper genes, and rAAV genome are introduced into a cell by transfection of one or more plasmid vectors encoding the AAV rep and cap genes, helper genes, and rAAV genome. In some embodiments of the methods disclosed herein, the AAV rep and cap genes, helper genes, and rAAV genome can be introduced into a cell by transduction with a viral vector, e.g., an rHSV vector, encoding the AAV rep and cap genes, helper genes, and rAAV genome. In some embodiments of the methods disclosed herein, one or more of the AAV rep and cap genes, helper genes, and rAAV genome are introduced into a cell by transduction with an rHSV vector. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes the helper genes. In some embodiments, the rHSV vector encodes the rAAV genome. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper genes and the rAAV genome.In some embodiments, the rHSV vector encodes helper genes and the AAV rep and cap genes.

[0107] In one aspect, provided herein are methods for producing rAAV particles, comprising: (a) providing a cell culture comprising host cells; (b) introducing into the cells one or more rHSV vectors encoding at least one of: i. the rAAV genome to be packaged; ii. helper functions necessary for packaging the rAAV particles; iii. AAV rep protein sufficient for packaging; and iv. AAV cap protein sufficient for packaging; and (c) adding sufficient nutrients to the cell culture and maintaining the cell culture under conditions that permit the production of rAAV particles. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions. In some embodiments, the rHSV vector comprises one or more endogenous genes encoding helper functions. In some embodiments, the rHSV vector comprises one or more heterologous genes encoding helper functions. In some embodiments, the rHSV vector encodes the rAAV genome. In some embodiments, the rHSV vector encodes the AAV rep and cap genes. In some embodiments, the rHSV vector encodes helper functions and the rAAV genome. In some embodiments, the rHSV vector encodes helper functions and the AAV rep and cap genes. In some embodiments, the cells contain one or more stably integrated heterologous polynucleotides encoding the rep and cap genes.

[0108] In one aspect, provided herein are methods for producing rAAV particles, including: (a) providing a cell culture comprising mammalian cells; (b) introducing into the cells one or more polynucleotides encoding at least one of: i. an rAAV genome to be packaged (e.g., comprising a recombinant AAV genome having the nucleotide sequence of SEQ ID NO: 53); ii. helper functions necessary for packaging the rAAV particles; iii. AAV rep protein sufficient for packaging; and iv. AAV cap protein sufficient for packaging; and (c) adding sufficient nutrients to the cell culture and maintaining the cell culture under conditions that permit the production of rAAV particles. In some embodiments, the helper functions are encoded by adenovirus genes. In some embodiments, the mammalian cells contain one or more stably integrated heterologous polynucleotides encoding the rep and cap genes.

[0109] Molecular biology techniques for developing plasmids or viral vectors encoding AAV rep and cap genes, helper genes, and / or rAAV genomes are generally known in the art. In some embodiments, the AAV rep and cap genes are encoded by a single plasmid vector. In some embodiments, the AAV helper genes (e.g., the adenovirus E1a, E1b, E4, E2a, and VA genes) are encoded by a single plasmid vector. In some embodiments, the E1a or E1b gene is stably expressed by the host cell, and the remaining AAV helper genes are introduced into the cell by transfection with a single viral vector. In some embodiments, the E1a and E1b genes are stably expressed by the host cell, and the E4, E2a, and VA genes are introduced into the cell by transfection with a single plasmid vector. In some embodiments, one or more helper genes are stably expressed by the host cell, and one or more helper genes are introduced into the cell by transfection with a single plasmid vector. In some embodiments, the helper genes are stably expressed by the host cell. In some embodiments, the AAV rep and cap genes are encoded by a single viral vector. In some embodiments, the AAV helper genes (e.g., the adenovirus E1a, E1b, E4, E2a, and VA genes) are encoded by a single viral vector. In some embodiments, the E1a or E1b gene is stably expressed by the host cell, and the remaining AAV helper genes are introduced into the cell by transfection with a single viral vector. In some embodiments, the E1a and E1b genes are stably expressed by the host cell, and the E4, E2a, and VA genes are introduced into the cell by transfection with a single viral vector.In some embodiments, one or more helper genes are stably expressed by the host cell, and the one or more helper genes are introduced into the cell by transfection with a viral vector. In some embodiments, the AAV rep and cap genes, adenoviral helper functions required for packaging, and the rAAV genome to be packaged are introduced into the cell by transfection with one or more polynucleotides, e.g., vectors. In some embodiments, the methods disclosed herein involve transfecting a cell with a mixture of three polynucleotides: one encoding the cap and rep genes, one encoding the adenoviral helper functions required for packaging (e.g., the adenoviral E1a, E1b, E4, E2a, and VA genes), and one encoding the rAAV genome to be packaged. In some embodiments, the AAV cap gene is an AAV8 or AAV9 cap gene. In some embodiments, the AAV cap gene is an AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.PHB, or AAV.7m8 cap gene. In some embodiments, the AAV cap gene encodes a capsid protein with high sequence homology to AAV8 or AAV9, such as AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, and AAV.hu37. In some embodiments, the vector encoding the rAAV genome to be packaged contains a gene of interest flanked by AAV ITRs.In some embodiments, the AAV ITRs are selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or from other AAV serotypes.

[0110] Any combination of vectors can be used to introduce the AAV rep and cap genes, AAV helper genes, and rAAV genome into cells where rAAV particles are produced or packaged. In some embodiments of the methods disclosed herein, a first plasmid vector encoding an rAAV genome containing a gene of interest flanked by AAV inverted terminal repeats (ITRs), a second vector encoding the AAV rep and cap genes, and a third vector encoding the helper genes can be used. In some embodiments, a mixture of the three vectors is co-transfected into cells. In some embodiments, a combination of transfection and infection is used by using both a plasmid vector and a viral vector.

[0111] In some embodiments, the rep and cap genes and one or more of the AAV helper genes are constitutively expressed by the cells, and the cells do not need to be transfected or transduced. In some embodiments, the cells constitutively express the rep and / or cap genes. In some embodiments, the cells constitutively express one or more AAV helper genes. In some embodiments, the cells constitutively express E1a. In some embodiments, the cells contain a stable transgene encoding the rAAV genome.

[0112] In some embodiments, the AAV rep, cap, and helper genes (e.g., Ela, E1b, E4, E2a, or VA genes) can be of any AAV serotype. Similarly, the AAV ITRs can be of any AAV serotype. For example, in some embodiments, the AAV ITRs are from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF, AAV3B, AA In some embodiments, the AAV cap gene is from AAV V.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or other AAV serotypes (e.g., hybrid serotypes having sequences from two or more serotypes). In some embodiments, the AAV cap gene is from an AAV8 or AAV9 cap gene.In some embodiments, the AAV cap gene is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15 and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV. The AAV serotypes may be from AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.rh74, AAV.hu31, AAV.hu32, or AAV.hu37, or other AAV serotypes (e.g., hybrid serotypes having sequences from two or more serotypes). In some embodiments, the AAV rep and cap genes for production of rAAV particles are from different serotypes. For example, the rep gene is from AAV2 while the cap gene is from AAV8. In another example, the rep gene is from AAV2 while the cap gene is from AAV9.

[0113] In some embodiments, the rep gene is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, and AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV2.5, AAV2tYF ... , AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, or AAV.HSC16, or other AAV serotypes (e.g., hybrid serotypes having sequences from two or more serotypes). In other embodiments, the rep and cap genes are from the same serotype. In yet other embodiments, the rep and cap genes are from the same serotype, and the rep gene comprises at least one modified protein domain or modified promoter domain. In certain embodiments, at least one modified domain comprises a nucleotide sequence of a serotype different from the capsid serotype. The modified domain within the rep gene may be a hybrid nucleotide sequence consisting of fragments of different serotypes.

[0114] The hybrid rep gene provides improved packaging efficiency for rAAV particles, including packaging of viral genomes containing micro-dystrophin transgenes of greater than 4 kb, greater than 4.1 kb, greater than 4.2 kB, greater than 4.3 kB, greater than 4.4 kB, greater than 4.5 kB, or greater than 4.6 kb. The AAV rep gene consists of nucleic acid sequences encoding nonstructural proteins necessary for viral replication and production. Transcription of the rep gene initiates from the p5 or p19 promoter to produce two large (Rep78 and Rep68) and two small (Rep52 and Rep40) nonstructural Rep proteins, respectively. In addition, the Rep78 / 68 domain contains a DNA-binding domain that recognizes specific ITR sequences within the ITRs. All four Rep proteins share a common helicase and ATPase domain that functions in genome replication and / or encapsidation (Maurer AC, 2020, DOI: 10.1089 / hum.2020.069). It has been suggested that transcription of the cap gene initiates from the p40 promoter, whose sequence is located within the C-terminus of the rep gene, and that other elements within the rep gene may induce p40 promoter activity. The p40 promoter domain contains transcription factor binding elements EF1A, MLTF, and ATF, a Fos / Jun binding element (AP-1), an Sp1-like element (Sp1 and GGT), and a TATA element (Pereira and Muzyczka, Journal of Virology, June 1997, 71(6):4300-4309). In some embodiments, the rep gene contains a modified p40 promoter. In some embodiments, the p40 promoter is modified with any one or more of an EF1A-binding element, an MLTF-binding element, an ATF-binding element, a Fos / Jun-binding element (AP-1), an Sp1-like element (Sp1 or GGT), or a TATA element. In other embodiments, the rep gene is of serotype 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, rh8, rh10, rh20, rh39, rh.74, RHM4-1, or hu37, and portions or elements of the p40 promoter domain are modified to serotype 2.In yet other embodiments, the rep gene is of serotype 8 or 9 and portions or elements of the p40 promoter domain are modified to serotype 2.

[0115] The ITRs contain A and A' complementary sequences, B and B' complementary sequences, and C and C' complementary sequences, and the D sequence is contiguous with the ssDNA genome. The ITR complementary sequences form a hairpin structure by self-annealing (Berns KI. The Unusual Properties of the AAV Inverted Terminal Repeat. Hum Gene Ther 2020). The D sequence contains the Rep binding element (RBE) and terminal release site (TRS), which together constitute the AAV origin of replication. The ITRs are also required as packaging signals for genome encapsidation after replication. In some embodiments, the ITR sequences and cap gene are from the same serotype, except that one or more of the A and A' complementary sequences, B and B' complementary sequences, C and C' complementary sequences, or D sequence may be modified to include sequences from a different serotype than the capsid. In some embodiments, the modified ITR sequences are from the same serotype as the rep gene. In other embodiments, the ITR sequences and cap gene are from different serotypes, except that one or more of the ITR sequences selected from A and A' complementary sequences, B and B' complementary sequences, C and C' complementary sequences, or D sequences are from the same serotype as the capsid (cap gene), and one or more of the ITR sequences are from the same serotype as the rep gene.

[0116] In some embodiments, the rep and cap genes are from the same serotype, and the rep gene comprises a modified Rep78 domain, a DNA-binding domain, an endonuclease domain, an ATPase domain, a helicase domain, a p5 promoter domain, a Rep68 domain, a p5 promoter domain, a Rep52 domain, a p19 promoter domain, a Rep40 domain, or a p40 promoter domain. In other embodiments, the rep and cap genes are from the same serotype, and the rep gene comprises at least one protein domain or promoter domain from a different serotype. In one embodiment, the rAAV comprises a transgene flanked by AAV2 ITR sequences, an AAV8 cap, and a hybrid AAV2 / 8 rep. In another embodiment, the AAV2 / 8 rep comprises serotype 8 rep, except that the p40 promoter domain, or a portion thereof, is from serotype 2 rep. In other embodiments, the AAV2 / 8 rep comprises serotype 2 rep, except that the p40 promoter domain, or a portion thereof, is from serotype 8 rep. In some embodiments, three or more serotypes may be utilized to construct a hybrid rep / cap plasmid.

[0117] Any suitable method known in the art can be used to transfect cells that can be used for producing rAAV particles according to the methods disclosed herein. In some embodiments, the methods disclosed herein involve transfecting cells using a chemical-based transfection method. In some embodiments, the chemical-based transfection method uses calcium phosphate, highly branched organic compounds (dendrimers), cationic polymers (e.g., DEAE-dextran or polyethyleneimine (PEI)), or lipofection. In some embodiments, the chemical-based transfection method uses a cationic polymer (e.g., DEAE-dextran or polyethyleneimine (PEI)). In some embodiments, the chemical-based transfection method uses polyethyleneimine (PEI). In some embodiments, the chemical-based transfection method uses DEAE-dextran. In some embodiments, the chemical-based transfection method uses calcium phosphate.

[0118] Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures may generally be performed according to conventional methods well known in the art and as described in various general and more specific references cited and discussed throughout the specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)), incorporated herein by reference for all purposes. Unless specific definitions are provided, the nomenclature utilized in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein, as well as laboratory procedures and techniques, are those well known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and patient delivery and treatment.

[0119] Nucleic acid sequences of AAV-based viral vectors and methods for producing recombinant AAV and AAV capsids are taught, for example, in US 7,282,199, US 7,790,449, US 8,318,480, US 8,962,332 and PCT / EP2014 / 076466, each of which is incorporated by reference in its entirety.

[0120] Host cell lines are provided for the production of rAAV particles containing the micro-dystrophin-encoding constructs (genomes) disclosed herein, including constructs of SEQ ID NO: 53 or 82 (RGX-DYS1 or RGX-DYS5).

[0121] In a preferred embodiment, rAAV provides a transgene delivery vector that can be used in therapeutic and prophylactic applications, as discussed in more detail below.

[0122] 5.4. Therapeutic utility Methods are provided for assaying constructs, including recombinant gene therapy vectors and recombinant AAV genomes, encoding microdystrophin as disclosed herein for therapeutic efficacy, including both in vitro and in vivo testing in animal models, as described herein or using any other method known in the art for testing the activity and efficacy of microdystrophin.

[0123] 5.4.1 In vitro assays 5.4.1.1 In vitro infection system for muscle cells Methods for testing the infectivity of the recombinant vectors disclosed herein, such as rAAV particles, are provided. For example, the infectivity of recombinant gene therapy vectors in muscle cells can be tested using C2C12 myoblast cells. Several muscle or cardiac cell lines can be used, including, but not limited to, T0034 (human), L6 (rat), MM14 (mouse), P19 (mouse), G-7 (mouse), G-8 (mouse), QM7 (quail), H9c2(2-1) (rat), Hs74.Ht (human), and Hs171.Ht (human) cell lines. Vector copy number can be assessed using polymerase chain reaction technology, and the level of microdystrophin expression can be tested by measuring the level of microdystrophin mRNA in the cells.

[0124] 5.4.2 Animal models The efficacy of viral vectors containing the microdystrophin-encoding transgenes described herein can be tested by administering them to animal models to replace mutated dystrophin, for example, using mdx mice and / or golden retriever muscular dystrophy (GRMD) models, and evaluating the biodistribution, expression, and therapeutic effects of transgene expression. Therapeutic efficacy can be evaluated, for example, by assessing changes in muscle strength in animals receiving the microdystrophin transgene. Animal models using larger mammals and non-mammalian vertebrates and invertebrates can also be used to evaluate the preclinical therapeutic efficacy of the vectors described herein. Thus, compositions and methods for therapeutic administration are provided that include a dose of the microdystrophin-encoding vector disclosed herein in an amount demonstrated to be effective according to the methods for evaluating therapeutic efficacy disclosed herein.

[0125] 5.4.2.1 Murine model The efficacy of gene therapy vectors can be evaluated in murine models of DMD. The mdx mouse model (Yucel, N., et al., Humanizing the mdx mouse model of DMD: the long and the short of it, Regenerative Medicine volume 3, Article number: 4 (2018)) harbors a nonsense mutation in exon 23, resulting in a premature termination codon and a truncated protein (mdx). mdx mice have threefold higher serum levels of pyruvate kinase activity compared to littermate controls. Similar to human DMD disease, mdx skeletal muscle exhibits active myofiber necrosis, cellular infiltration, a wide range of myofiber sizes, and numerous centrally nucleated regenerating myofibers. This phenotype is exacerbated in the diaphragm, which undergoes progressive degeneration and myofiber loss, resulting in an approximately fivefold decrease in muscle isometric contractile force. Necrosis and regeneration in hindlimb muscles peak at approximately 3–4 weeks of age but plateau thereafter. A mild but significant reduction in cardiac ejection fraction has been observed in mdx mice and mdx mice crossed with other mouse backgrounds (e.g., DBA / 2J) (Van Westering, Molecules 2015, 20, 8823-8855). Such DMD model mice with cardiac function defects can be used to evaluate the cardioprotective effects of the gene therapy vectors described herein, or the improvement or maintenance of cardiac function, or the attenuation of cardiac dysfunction. Examples 5-8 herein detail the use of the mdx mouse model to evaluate gene therapy vectors encoding microdystrophin.

[0126] Additional mdx mouse models: Numerous alternative versions in different genetic backgrounds have been generated, including the mdx2cv, mdx3cv, mdx4cv, and mdx5cv strains (C57BL / 6 genetic background). These models were created by treating mice with the chemical mutagen N-ethyl-N-nitrosourea. Each strain harbors a different point mutation. Overall, there is little difference in the presentation of the disease phenotype in the mdxcv model compared to mdx mice. Additional mouse models have been developed by combining the mdx strain with various knockout mouse models (e.g., Myod1). - / - , α-integrin 7 - / - , α-dystrobrevin - / - , and utrophin - / - All mouse models currently used to test for DMD are described in detail by Yucel, N., et al., Humanizing the mdx mouse model of DMD: the long and the short of it, npj Regenerative Medicine volume 3, Article number: 4 (2018) (incorporated herein by reference).

[0127] Cardiac function Efficacy assessment of cardiac function can be performed in mice, including mdx mice. To measure blood pressure (BP), mice are sedated using 1.5% isofluorane while constantly monitoring the anesthesia plane and maintaining body temperature at 36.5-37.5°C. Heart rate is maintained at 450-550 beats / min. A BP cuff is placed around the tail, and the tail is then placed into the sensor assembly for noninvasive BP monitoring during anesthesia. Ten consecutive BP measurements are taken. Qualitative and quantitative measurements of tail BP, including systolic, diastolic, and mean pressure, are performed offline using analysis software. See, for example, Wehling-Henricks et al., Human Molecular Genetics, 2005, Vol. 14, No. 14; Uaesoontrachoon et al., Human Molecular Genetics, 2014, Vol. 23, No. 12.

[0128] A radiotelemetry device was used to monitor ECG amplitude and interval duration in awake, freely moving mice. A transmitter unit was implanted into the abdominal cavity of anesthetized mice, and two electrical leads were fixed near the apex and right acromion of the heart in lead II orientation. Mice were housed singly in cages on an antenna receiver connected to a computer system for data recording. Unfiltered ECG data were collected for 10 seconds every hour for 35 days. The first 7 days of data were discarded to allow recovery from the surgical procedure and confirm that the effects of anesthesia had disappeared. Data waveforms and parameters were analyzed with DSI analysis packages (ART3.01 and Physiostat4.01), and measurements were compiled and averaged to determine heart rate, ECG amplitude, and interval duration. Raw ECG waveforms were examined for arrhythmias by two independent observers.

[0129] Picro-Sirius Red staining was performed to measure the degree of fibrosis in the hearts of study mice. Briefly, at the end of the study, immediately after euthanasia, myocardium was removed and fixed in 10% formalin for further processing. Hearts were sectioned, and paraffin sections were deparaffinized in xylene, followed by nuclear staining with Weigert's hematoxylin for 8 minutes. They were then washed and then stained with Picro-Sirius Red (0.5 g of Sirius Red F3B in a saturated aqueous solution of picric acid) for an additional 30 minutes. Sections were cleared in three changes of xylene and mounted with Permount. Five random digital images were acquired using an Eclipse E800 (Nikon, Japan) microscope, and blinded analysis was performed using Image J (NIH). Blood samples were collected via cardiac puncture upon euthanasia, and the collected serum was used to measure muscle CK levels.

[0130] 5.4.2.2 Dogs Most canine studies are performed in the Golden Retriever Muscular Dystrophy (GRMD) model (Korneygay, JN, et al., The golden retriever model of Duchenne muscular dystrophy. Skeleton Muscle. 2017;7:9, incorporated herein by reference in its entirety). Dogs with GRMD suffer from a progressive, fatal disease with skeletal and cardiac phenotypes and selective muscle involvement—a severe phenotype that more closely mirrors that of DMD. GRMD dogs carry a single nucleotide change that results in exon skipping and out-of-frame DMD transcripts. Phenotypic features in dogs include elevated serum CK, CRD on EMG, and histopathological evidence of clustered muscle fiber necrosis and regeneration. Phenotypic variation is frequently observed in GRMD, as in humans. Dogs with GRMD develop paradoxical muscle hypertrophy, which appears to play a role in the phenotype of affected dogs; stiffness during gait, reduced range of joint motion, and trismus are common features. Objective biomarkers for assessing disease progression include tetanic flexion, tibial ankle angle, % eccentric contraction loss, maximum hip flexion angle, pelvic angle, cranial sartorius circumference, and quadriceps weight.

[0131] 5.5. Treatment method Methods are provided for treating human subjects for any muscular dystrophic disease that can be treated by providing functional dystrophin. Although DMD is the most common such disease, the gene therapy vectors expressing microdystrophin provided herein can be administered to treat Becker muscular dystrophy (BMD), myotonic muscular dystrophy (Steiner's disease), facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy. The micro-dystrophin of the present disclosure can be any micro-dystrophin described herein, including those having domains in the following order from N-terminus to C-terminus: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, CR is the cysteine-rich region of dystrophin, and CT is at least a portion of the C-terminal region of dystrophin containing the α1-syntrophin binding site, and in certain embodiments, SEQ ID NO: 16 or SEQ ID NO: 83. In embodiments, the micro-dystrophin has the amino acid sequence of SEQ ID NO: 1, 2, or 79. Microdystrophin-encoding vectors include those having the nucleic acid sequence of SEQ ID NO: 20, 21, or 81, which in certain embodiments are operably linked to regulatory elements for constitutive, muscle-specific (including skeletal, smooth, and cardiac) expression, or CNS-specific expression, and other regulatory elements such as polyA sites. In the context of the rAAV genome, such nucleic acids may be flanked, for example, by ITR sequences, particularly AAV2 ITR sequences. In certain embodiments, methods and compositions involve administering to a subject in need thereof an rAAV containing a construct (recombinant genome) having the nucleic acid sequence of SEQ ID NO: 53, 55, or 82.In embodiments, the construct or recombinant genome is within an rAAV8 or rAAV9 particle. In embodiments, the recombinant AAV is AABV8-RGX-DYS1. In embodiments, the patient has been diagnosed with DMD and / or has a symptom(s) associated therewith.

[0132] Based on pharmacological studies in mice, see Examples 6, 7, and 8 herein (hereinafter, Sections 6.6, 6.7, and 6.8), 1 x 10 rAAV particles (e.g., AAV8-RGX-DYS1), including rAAV8 or rAAV9 particles containing a recombinant genome encoding micro-dystrophin, as described herein, are administered. 14 GC / kg or 2 x 10 14 GC / kg dose, including 5 × 10 13 ~1×10 15 Methods are provided for treating human patients with dystrophinopathy, such as DMD or BMD, that are amenable to treatment with functional dystrophin by peripheral administration, including intravenously, at a dose of 1 x 10 GC / kg. 8 Vector genome copies (GC / kg) ~ 1 x 10 15 In some embodiments, the dose can range from 3×10 GC / kg. 13 , 1×10 14 , 3×10 14 , 5×10 14 In some embodiments, the dose can be 1 x 10 GC / kg. 14 , 1.1×10 14 , 1.2 × 10 14 , 1.3 × 10 14 , 1.4×10 14 , 1.5×10 14 , 1.6×10 14 , 1.7×10 14 , 1.8×10 14 , 1.9×10 14 , 2 × 10 14 , 2.1×10 14 , 2.2 × 10 14 , 2.3 × 10 14 , 2.4 × 10 14 , 2.5×10 14, 2.6×10 14 , 2.7 × 10 14 , 2.8×10 14 , 2.9 × 10 14 , or 3 × 10 14 The therapeutically effective dose can be GC / kg. The therapeutically effective dose can be administered as a single dose and can be administered intravenously or intramuscularly. Alternatively, multiple doses can be administered over the course of a treatment regimen (i.e., over the course of several days, weeks, months, etc.).

[0133] The dosage is therapeutically effective and can be assessed at appropriate time points after administration, including 12 weeks, 26 weeks, 52 weeks, or more, including assessment for improvement or amelioration of dystrophinopathy symptoms and / or biomarkers known in the art and described in detail herein. Recombinant vectors used to deliver transgenes encoding microdystrophin are described herein. Such vectors should have tropism for human muscle cells (including skeletal, smooth, and / or cardiac cells) and can include non-replicating rAAVs, particularly those carrying AAV8 capsids. Recombinant vectors (see Figure 2) including vectors carrying RGX-DYS1 or RGX-DYS5 recombinant constructs or genomes (including AAV8 or AAV9 recombinant vectors, e.g., AAV8-RGX-DYS1) can be administered by any means that introduces the recombinant vector into the bloodstream, allowing the recombinant vector to enter muscle tissue or the CNS, preferably by intravenous administration.

[0134] The subject to be administered such gene therapy can be one that responds to gene therapy-mediated delivery of micro-dystrophin to muscle.In certain embodiments, the method involves treating a patient who has been diagnosed with or has one or more symptoms associated with DMD or other muscular dystrophy diseases, such as Becker muscular dystrophy (BMD), myotonic muscular dystrophy (Steiner's disease), facioscapulohumeral disease (FSHD), limb-girdle muscular dystrophy, X-linked dilated cardiomyopathy, or oculopharyngeal muscular dystrophy, and has been identified as being responsive to treatment with micro-dystrophin or is considered a good candidate for therapy involving gene-mediated delivery of micro-dystrophin.In specific embodiments, the patient has previously been treated with synthetic versions of dystrophin and has been found to respond to one or more of the synthetic versions of dystrophin.To determine responsiveness, synthetic versions of dystrophin (e.g., produced in human cell culture, bioreactor, etc.) can be directly administered to the subject.

[0135] A therapeutically effective dose of any such recombinant vector should be administered by any means that allows the recombinant vector to enter muscle (e.g., skeletal or cardiac muscle), preferably by introducing the recombinant vector into the bloodstream. In a specific embodiment, the vector is administered subcutaneously, intramuscularly, or intravenously. Intramuscular, subcutaneous, or intravenous administration should result in expression of a soluble transgene product in cells of muscle (including skeletal, cardiac, and / or smooth muscle). Expression of the transgene product results in delivery and maintenance of the transgene product in muscle. Alternatively, delivery can result in gene therapy delivery and expression of microdystrophin in the liver, with the soluble microdystrophin product then transported through the bloodstream to muscle where it can impart its therapeutic effect.

[0136] Administration of a gene therapy vector described herein, including AAV8-RGX-DYS1, results in microdystrophin expression in a subject's tissues, including muscle tissue, within, for example, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 10 weeks, 12 weeks, 20 weeks, or 26 weeks after administration. The amount of microdystrophin in muscle tissue can be measured by any method known in the art, including, for example, a capillary-based Western immunoassay, as described in Example 12 herein (and shown in Example 8). In embodiments, administering gene therapy results in greater than 10 ng / mg, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, or 150 ng / mg of microdystrophin protein in the muscle of the subject administered the gene therapy vector encoding microdystrophin, including within 5, 6, 10, 12, 20, or 26 weeks after administration. 14 GC / kg or 2 x 10 14 Including GC / kg, 5 x 10 13 GC / kg~1×10 15 It may be administered intravenously at GC / kg.

[0137] Pharmaceutical compositions suitable for intravenous, intramuscular, subcutaneous, or hepatic administration include a suspension of a recombinant vector containing a transgene encoding micro-dystrophin in a formulation buffer containing a physiologically compatible aqueous buffer. The formulation buffer can include one or more of a polysaccharide, a surfactant, a polymer, or an oil. The disclosed pharmaceutical compositions can include any of the micro-dystrophin-encoding rAAV vectors disclosed herein, particularly those containing a transgene encoding micro-dystrophin, and can be used in the disclosed methods.

[0138] For example, pharmaceutical compositions comprising rAAV, including rAAV8 containing a transgene encoding RGX-DYS1, including an RGX-DYS1 recombinant genome having the nucleotide sequence of SEQ ID NO: 53, can be used in the disclosed methods. In some embodiments, the pharmaceutical composition can comprise a recombinant adeno-associated virus serotype 8 (AAV8) containing a vector (a recombinant AAV genome encoding microdystrophin). rAAV particles containing the recombinant genome encoding microdystrophin disclosed herein, including RGX-DYS1 and RGX-DYS5, and in embodiments, AAV8-RGX-DYS1, can be formulated in modified Dulbecco's phosphate-buffered saline (DPBS) supplemented with a sucrose buffer (pH 7.4) containing 0.2 g / L potassium chloride, 0.2 g / L monobasic potassium phosphate, 1.2 g / L anhydrous dibasic disodium phosphate, 5.8 g / L sodium chloride, 40 g / L sucrose, and 0.01 g / L poloxamer 188. The pharmaceutical composition can be supplied as a frozen suspension in a sterile, single-use vial for intravenous (IV) administration. In some embodiments, the pharmaceutical composition can be filled into a Crystal Zenith® (CZ) vial sealed with a latex-free rubber stopper and a flip-off aluminum seal. In some embodiments, the pharmaceutical composition can be available in one configuration: a deliverable volume of 5.0 mL in a 10 mL vial.

[0139] In embodiments, immunosuppressant prophylaxis is administered along with a therapeutic agent, such as AAV8-RGX-DYS1 (or other micro-dystrophin-encoding vectors disclosed herein). See, e.g., Chu and Ng, Frontiers in Immunology, 12:, article 658038 (April 2021), incorporated herein by reference in its entirety. In embodiments, a corticosteroid, such as prednisone, prednisolone, methylprednisolone, dexamethasone, or betamethasone, is administered starting at least one day and up to one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve weeks prior to gene therapy delivery, including RGX-DYS1. In certain embodiments, the patient is administered an oral corticosteroid such as prednisone or prednisolone (e.g., at a dose of 0.5 mg / kg, 0.75 mg / kg, 1 mg / kg, 1.5 mg / kg) for 12 weeks prior to gene therapy delivery, and then either continues at the same dose for the next year, or the dose is gradually reduced over 4, 8, or 12 weeks. In embodiments, the prophylactic immunosuppressive regimen is administered in addition to the subject's baseline glucocorticoid dose of 1 mg / kg / day from day -1 (the day before AAV8-RGX-DYS1 administration) through the end of week 8, if there are no safety concerns at week 8, then 0.5 mg / kg / day from week 9 to week 10, if there are no safety concerns at week 10, then 0.25 mg / kg / day, and if there are no safety concerns at week 12, no additional prednisolone is administered. In embodiments, the total daily steroid dose (baseline regimen dose plus immunosuppressant dose) does not exceed a dose equivalent to 60 mg per day.Patients may also be pretreated with acetaminophen and H1-antihistamine, including within 2 hours or 1 hour, on the day of gene therapy administration. Day 0 is the day of gene therapy administration.

[0140] Alternatively, or in addition to corticosteroid prophylaxis, patients may be administered a nonsteroidal immunosuppressant prophylactically before, concurrently with, and / or after gene therapy, e.g., administration of AAV8-RGX-DYS1, e.g., at least one day prior to gene therapy and up to one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve weeks prior to gene therapy, including periodically prior to gene therapy delivery, and / or for up to one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve months after gene therapy, e.g., for up to one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve months, or even indefinitely as maintenance therapy. Such immunosuppressants include, but are not limited to, cyclosporine, rapamycin, anti-cytokine antibody treatments such as anti-IL-6 or IL-6 receptor antibodies such as satralizumab, sarilumab, siltuximab, clazakizumab, sirukumab, olokizumab, gerilizumab, and tocilizumab, or anti-complement antibodies including anti-C5 antibodies such as, but not limited to, eculizumab, ravulizumab, or tesidolumab, or anti-C3 antibodies such as NGM621. Other immunosuppressants that may be used include, for example, anti-CD20 antibodies such as rituximab (including biosimilar forms thereof such as rituximab-abbs and rituximab-arrx) and obinutuzumab, and anti-TNF-α antibodies such as, but not limited to, etanercept, adalimumab, infliximab, daclizumab, or golimumab. In one embodiment, the preventive regimen is a combination of anti-CD-20 antibody and anti-C5 antibody, for example, rituximab and eculizumab or ravulizumab.In one embodiment, the combination of rituximab and eculizumab or ravulizumab is administered after gene therapy administration.Other preventive agents include immunofidase.In one embodiment, in combination with microdystrophin therapy, an anti-complement (anti-C5) immunosuppressive regimen is provided, which involves administering eculizumab before administering the AAV vector containing microdystrophin transgene, and then up to 12 days after administration.Eculizumab is administered by IV infusion according to the subject's weight.For subjects weighing between 10 kg and less than 20 kg, a 600 mg dose is administered on days −9, −2, 4, and 12; for subjects weighing between 20 kg and less than 30 kg, a 800 mg dose is administered on days −16, −9, −2, and 12; for subjects weighing between 30 kg and less than 40 kg, a 900 mg dose is administered on days −16, −9, −2, and 12; and for subjects weighing more than 40 kg, a 1200 mg dose is administered on days −30, −23, −16, −9, −2, and 12, where day 0 is the day of administration of micro-dystrophin gene therapy.

[0141] In other embodiments, the gene therapy administration is in combination with an immunosuppressive regimen of administration of sirolimus (also known as rapamycin), which inhibits the ability of cytokines to promote T cell proliferation and maturation by blocking intracellular signaling and metabolic pathways. In embodiments, the gene therapy administration is administered in combination with oral sirolimus, which is administered at 3 mg / m on day -7. 2 loading dose, followed by oral sirolimus 1 mg / m divided twice daily (BID) from Day -6 to Week 8. 2 The patients will receive sirolimus daily, with a target blood concentration of 8-12 mg / ml using a chromatographic assay. Trough monitoring may be performed on days -2, 2, 6, 12, and 14, and then as needed (day 0 is the day of gene therapy administration). If liver function tests, platelets, and any other relevant safety laboratory measurements are stable, the daily dose of sirolimus will be reduced by 50% (0.5 mg / ml) for weeks 9-10. 2 / day) and if liver function tests, platelets, and any other relevant safety laboratory measurements are stable, the daily dose of sirolimus will be reduced by 50% (0.25 mg / m) for 11 to 12 weeks. 2 / day), after which sirolimus administration can be discontinued after week 12 if liver function tests, platelets, and any other relevant safety laboratory measurements are stable. In embodiments, the immunosuppressive regimen administered with gene therapy can be a combination of a prednisolone dosage regimen and / or an eculizumab dosage regimen and / or a sirolimus dosage regimen, as described above. Generally, patients are pretreated with a prophylactic immunosuppressant, and immunosuppressant therapy can be continued after gene therapy administration, including for days, weeks, months, or years.

[0142] The gene therapy vectors provided herein can be administered in combination with other treatments for muscular dystrophies, including corticosteroids, beta-blockers, and ACE inhibitors.

[0143] Gene therapy administration as described herein can result in improvements in disease parameters and / or symptoms associated with muscular dystrophy, including, but not limited to, an increase or delay in muscle strength loss, an improvement or delay in the rate or extent of muscle degeneration, inflammation, fibrosis, muscle pathology, and other clinical endpoints discussed below.

[0144] The disclosed therapeutic methods can result in one of many endpoints that indicate therapeutic efficacy as described herein.In some embodiments, the endpoint can be monitored 6 weeks, 12 weeks, 24 weeks, 30 weeks, 36 weeks, 42 weeks, 48 ​​weeks, 1 year, 2 years, 3 years, 4 years or 5 years after administration of rAAV particles that contain a transgene encoding one of the disclosed micro-dystrophins.

[0145] In some embodiments, creatine kinase activity can be used as an endpoint for determining the therapeutic efficacy of the treatment and administration methods disclosed herein. Creatine kinase activity can be decreased in a subject compared to the level (creatine kinase activity) before the administration. In some embodiments, creatine kinase activity can be decreased in a subject compared to the level (creatine kinase activity) in the subject before treatment, or compared to the level (creatine kinase activity) in an untreated subject with a dystrophinopathy (e.g., a reference level identified in a natural history study). Creatine kinase activity measured in a human subject after administration of an rAAV carrying a transgene encoding micro-dystrophin can be relative to a control value, which can be the creatine kinase activity in the subject before administration, the creatine kinase activity in an untreated subject with a dystrophinopathy, the creatine kinase activity in a subject without a dystrophinopathy, or the creatine kinase activity in a standard.

[0146] In some embodiments, 1 x 10 of a rAAV vector comprising a micro-dystrophin recombinant genome disclosed herein, including AAV8-RGX-DYS1. 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 Contains 5 x 10 genome copies / kg 13 Genome copies / kg ~ 1 x 10 15Methods are provided for treating dystrophinopathy, including DMD and BMD, by peripheral administration, including intravenous administration, at dosages disclosed herein, including genome copies / kg doses, where creatine kinase activity is reduced by 0.5-1.5-fold at least 12, 26, or 52 weeks after administration of the rAAV therapeutic. In some embodiments, the reduction in creatine kinase activity can be a reduction of 1000-10,000 units / liter compared to a control or compared to the value measured in the subject prior to administration of the therapeutic. In some embodiments, a post-administration endpoint of 1000, 2000, 3000, 4000, or 5000 units / liter indicates a reduction.

[0147] In some embodiments, reduction in gastrocnemius (or other muscle) lesions can be used as an endpoint measure of therapeutic efficacy in the methods of treatment and administration disclosed herein. Gastrocnemius lesions can be reduced in a subject compared to pre-administration levels (levels of gastrocnemius lesions) of an rAAV carrying a transgene encoding micro-dystrophin. In some embodiments, gastrocnemius lesions can be reduced in a subject compared to levels (of gastrocnemius lesions) in untreated subjects with dystrophinopathy. Comparison of gastrocnemius lesions can be relative to a standard, which can be a number or set of numbers representing lesions in subjects without dystrophinopathy or lesions in untreated subjects with dystrophinopathy. Thus, in some embodiments, comparison of gastrocnemius lesions after administration of an rAAV carrying a transgene encoding micro-dystrophin can be relative to a control subject. The control can be a lesion in the gastrocnemius muscle of a subject with an untreated dystrophinopathy prior to administration, a lesion in the gastrocnemius muscle of a subject without a dystrophinopathy, or a lesion in a normal gastrocnemius muscle.

[0148] In some embodiments, lesions in the subject's gastrocnemius muscle are assessed using magnetic resonance imaging (MRI). MRI can be a good tool for imaging muscles, ligaments, and tendons, and thus muscle disorders can be detected and / or characterized using MRI. In some embodiments, 1×10 rAAV vectors containing the micro-dystrophin constructs disclosed herein, including AAV8-RGX-DYS1, are administered. 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 Contains 5 x 10 genome copies / kg 13 Genome copies / kg ~ 1 x 10 15 Methods are provided for treating dystrophinopathy, including DMD and BMD, by peripheral administration, including intravenous administration, at dosages disclosed herein, including genome copies / kg dosages, resulting in a reduction in pathology in the peroneal muscle after administration, for example, about 1-100%, 2-50%, or 3-10%, compared to the pathology in the subject's peroneal muscle before said administration. For example, a subject treated with an rAAV carrying a transgene encoding micro-dystrophin can have a 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50% or greater reduction in pathology compared to a control.

[0149] In some embodiments, gastrocnemius muscle volume (or any other muscle volume) can be used as an endpoint of therapeutic efficacy. The gastrocnemius muscle volume can be reduced in a subject compared to the level (gastrocnemius muscle volume) before administration of an rAAV (e.g., AAV8-RGX-DYS1) with a transgene encoding micro-dystrophin. In some embodiments, the gastrocnemius muscle volume can be reduced in a subject compared to the level (gastrocnemius muscle volume) in a subject without a dystrophinopathy. In some embodiments, the gastrocnemius muscle volume can be reduced in a subject compared to the level (gastrocnemius muscle volume) in an untreated subject with a dystrophinopathy. The comparison of gastrocnemius muscle volume can be relative to a standard, where the standard is a number or set of numbers representing the volume in a subject without a dystrophinopathy or the volume in an untreated subject with a dystrophinopathy. Thus, in some embodiments, the comparison of gastrocnemius muscle volume after administration of an rAAV with a transgene encoding micro-dystrophin can be relative to a control. The control can be gastrocnemius muscle volume in a subject before administration, gastrocnemius muscle volume in a subject with an untreated dystrophinopathy, gastrocnemius muscle volume in a subject without a dystrophinopathy, or gastrocnemius muscle volume in a standard.

[0150] In some embodiments, the subject's gastrocnemius muscle volume can be assessed using MRI. In some embodiments, 1 x 10 rAAV vectors containing the micro-dystrophin constructs disclosed herein, including AAV8-RGX-DYS1, are administered. 14 Genome copies / kg, 2 × 10 14 genome copies / kg, or 3 × 10 14 Contains 5 x 10 genome copies / kg 13 Genome copies / kg ~ 1 x 10 15Methods are provided for treating dystrophinopathy, including DMD and BMD, by peripheral administration, including intravenous administration, at dosages disclosed herein, including genome copies / kg dosages, resulting in, for example, a reduction in gastrocnemius muscle volume of about 1-100%, 2-50%, or 3-20% compared to the subject's peroneal muscle volume prior to said administration. In some embodiments, the reduction in gastrocnemius muscle volume following administration of an rAAV containing a transgene encoding micro-dystrophin is about 2-400 mm compared to a control. 3 , 5~200mm 3 , or 20 to 100 mm 3 For example, subjects treated with an rAAV carrying a transgene encoding micro-dystrophin may experience a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 mm decrease in gastrocnemius muscle volume compared to controls. 3 It is possible to have a reduction of more than

[0151] In some embodiments, muscle fat fraction can be used as an endpoint for the therapeutic efficacy of a method of administering a therapeutic agent encoding rAAV micro-dystrophin disclosed herein. The muscles can be muscles in the pelvic girdle and thigh (gluteus maximus, adductor magnus, rectus femoris, vastus lateralis, vastus medialis, biceps femoris, semitendinosus, and gracilis). The muscle fat fraction can be reduced in a subject compared to the level (muscle fat fraction) before administration of an rAAV carrying a transgene encoding micro-dystrophin disclosed herein. In some embodiments, the muscle fat fraction can be reduced in a subject compared to the level (muscle fat fraction) in an untreated subject with a dystrophinopathy. The comparison of muscle fat fraction can be relative to a standard, which is a number or set of numbers representing the amount or percentage of fat fraction in a subject without a dystrophinopathy or the amount or percentage in an untreated subject with a dystrophinopathy. Thus, in some embodiments, the comparison of muscle fat fraction after administration of an rAAV carrying a transgene encoding micro-dystrophin can be to a control, which can be the muscle fat fraction in a subject before administration, the muscle fat fraction in a subject with an untreated dystrophinopathy, the muscle fat fraction in a subject without a dystrophinopathy, or a normal muscle fat fraction.

[0152] In some embodiments, the fat fraction of the muscle of a subject is assessed using magnetic resonance imaging (MRI). In some embodiments, 1 x 10 of a rAAV vector comprising a micro-dystrophin construct disclosed herein, including AAV8-RGX-DYS1, is administered. 14 Genome copies / kg, 2 × 10 14 genome copies / kg, and 3 × 10 14 Contains 5 x 10 genome copies / kg 13 Genome copies / kg ~ 1 x 10 15Methods are provided for treating dystrophinopathy, including DMD and BMD, by peripheral administration, including intravenous, at dosages disclosed herein, including genome copies / kg, resulting in a reduction in muscle fat fraction after administration of an rAAV containing a transgene encoding micro-dystrophin, for example, by about 1-100%, 2-50%, or 3-10%, compared to the muscle fat fraction prior to administration. For example, subjects treated with an rAAV carrying a transgene encoding micro-dystrophin can have a 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50% or greater reduction in muscle fat fraction compared to controls.

[0153] In some embodiments, the T2 relaxation time of the muscle lesion can be used as an endpoint for treatment. The muscle can be any muscle, for example, the gastrocnemius muscle. The T2 relaxation time of the muscle lesion can be reduced in a subject compared to the level (T2 relaxation time of the muscle lesion) before administration of an rAAV carrying a transgene encoding micro-dystrophin. In some embodiments, the T2 relaxation time of the muscle lesion can be reduced in a subject compared to the level (T2 relaxation time of the muscle lesion) in a subject without a dystrophinopathy. In some embodiments, the T2 relaxation time of the muscle lesion can be reduced in a subject compared to the level (T2 relaxation time of the muscle lesion) in an untreated subject with a dystrophinopathy. The comparison of the T2 relaxation time of the muscle lesion can be made to a standard, and the standard is a number or set of numbers representing the T2 relaxation time of the muscle lesion in a subject without a dystrophinopathy or the T2 relaxation time of the muscle lesion in an untreated subject with a dystrophinopathy. Thus, in some embodiments, the comparison of the T2 relaxation time of a lesion in muscle after administration of an rAAV carrying a transgene encoding micro-dystrophin can be to a control, which can be the T2 relaxation time of a lesion in the muscle of a subject before administration, the T2 relaxation time of a lesion in the muscle of a subject with an untreated dystrophinopathy, the T2 relaxation time of a lesion in the muscle of a subject without a dystrophinopathy, or the T2 relaxation time of a lesion in a normal muscle.

[0154] In some embodiments, the T2 relaxation time of a lesion in a subject's muscle is assessed using magnetic resonance imaging (MRI). In some embodiments, the reduction in the T2 relaxation time of the lesion in the muscle after administration of an rAAV comprising a transgene encoding micro-dystrophin can be about 1-100%, 5-50%, or 10-30% compared to a control, e.g., compared to the T2 relaxation time of the lesion in the muscle before administration. In some embodiments, 1 x 10 of an rAAV vector comprising a micro-dystrophin construct disclosed herein, including AAV8-RGX-DYS1, can be administered. 14 Genome copies / kg, 2 × 10 14 genome copies / kg, and 3 × 10 14 Contains 5 x 10 genome copies / kg 13 Genome copies / kg ~ 1 x 10 15 Methods are provided for treating dystrophinopathy, including DMD and BMD, by peripheral administration, including intravenous, at dosages disclosed herein, including genome copy / kg dosages, resulting in a reduction in relaxation time of lesions in muscle following administration of an rAAV containing a transgene encoding micro-dystrophin, for example, by about 1-500 milliseconds (ms), 1-400 ms, 1-300 ms, 1-200 ms, 1-100 ms, 1-50 ms, 1-25 ms, or 1-10 ms, compared to a control. In some embodiments, the reduction in T2 relaxation time of lesions in muscle following administration of an rAAV containing a transgene encoding micro-dystrophin can be about 2-8 ms. For example, a subject treated with an rAAV carrying a transgene encoding micro-dystrophin can have a decrease in the T2 relaxation time of the lesion in muscle compared to a control of 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, or more ms.

[0155] In some embodiments, the walking score can be used as an endpoint for treatment. The walking score can be about -1 to 2 after administration of an rAAV containing a transgene encoding microdystrophin. In some embodiments, the walking score can be about 1 after administration of an rAAV containing a transgene encoding microdystrophin.

[0156] In some embodiments, North Star Ambulatory Assessment (NSAA) can be used as the endpoint for treatment.The NSAA of treated subject can be compared with the NSAA before administration of rAAV containing the transgene encoding micro-dystrophin.The NSAA of treated subject can be compared with the NSAA of a subject without dystrophinopathy.The NSAA of treated subject can be compared with the NSAA of an untreated subject with dystrophinopathy.The NSAA of treated subject can be compared with a standard, and the standard is a score or a set of scores that represent the NSAA of a subject without dystrophinopathy or the NSAA of an untreated subject with dystrophinopathy.

[0157] In some embodiments, the NSAA of a subject treated with an rAAV containing a transgene encoding microdystrophin is increased compared to the NSAA score before administration or compared to any of the above NSAA comparisons. In some embodiments, the increase can be from 0 to 1, from 0 to 2, or from 1 to 2.

[0158] In some embodiments, any of the 17 items used in the NSAA can be used as individual endpoints for treatment. Any of the following can be endpoints for treatment: standing, walking, standing from a chair, standing on one leg (right), standing on one leg (left), climbing a box (right leg first), climbing a box (left leg first), descending a box (right leg first), descending a box (left leg first), lying to sitting, rising from floor, head lift, heel stand, jumping, right leg hopping, left leg hopping, and running (10 m). Each of these assessments is well known in the art. Improvement in one or more of these endpoints can be observed after administration of an rAAV containing a transgene encoding microdystrophin. Those skilled in the art will understand what constitutes an improvement. For example, in some embodiments, a subject treated with an rAAV containing a transgene encoding microdystrophin can achieve a reduction in the amount of time it takes to stand, run / walk a determined distance, and / or climb a set number of stairs.

[0159] The reduction in the amount of time it takes a subject administered an rAAV containing a transgene encoding micro-dystrophin to run / walk the determined distance can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50%, or more, compared to a control, e.g., the amount of time it took the subject before administration of the rAAV. In some embodiments, the determined distance run and / or walked can be 10 meters.

[0160] The reduction in the amount of time it takes a subject administered an rAAV containing a transgene encoding micro-dystrophin to stand can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50%, or more, compared to a control, e.g., the amount of time it took the subject before administration of the rAAV.

[0161] The reduction in the amount of time it takes a subject administered an rAAV containing a transgene encoding micro-dystrophin to climb a set number of stairs can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50%, or more, compared to a control, e.g., the amount of time it took the subject before administration of the rAAV. In some embodiments, the set number of stairs can be, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0162] In some embodiments, questionnaires can be used as endpoints for treatment. For example, the Pediatric Outcomes Data Collection Instrument (PODCI) questionnaire can be used to quantify a subject's functional capacity before and after treatment with an rAAV containing a transgene encoding micro-dystrophin.

[0163] 5.5.1 Cardiac output Skeletal muscle symptoms are considered the defining feature of DMD, but patients most commonly die of respiratory or cardiac failure. DMD patients develop dilated cardiomyopathy (DCM) due to the absence of dystrophin in cardiomyocytes, which is required for contractile function. This leads to extracellular calcium influx, causing protease activation, cardiomyocyte death, tissue necrosis, and inflammation, ultimately resulting in fat accumulation and fibrosis. This process first affects the left ventricle (LV), responsible for pumping blood throughout the body; it thickens and therefore experiences a greater workload. Atrophic cardiomyocytes exhibit loss of striations, vacuolization, fragmentation, and nuclear degeneration. Functionally, atrophy and scarring lead to structural instability and reduced LV motor function, ultimately progressing to generalized DCM. DMD can be associated with various ECG changes, such as sinus tachycardia, a decreased circadian index, decreased heart rate variability, short PR interval, right ventricular hypertrophy, ST-segment depression, and QTc prolongation.

[0164] The gene therapy treatments provided herein (including administration with AAV8-RGX-DYS1) can slow or prevent the progression of DMD and other dystrophinopathy, particularly reducing or attenuating the progression of cardiac dysfunction and / or maintaining or improving cardiac function. Efficacy can be monitored by periodic assessment of signs and symptoms of cardiac involvement or heart failure, appropriate for the age and disease stage of the study population, using serial electrocardiograms and serial noninvasive imaging tests (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)). CMR can be used to monitor changes from baseline in forced vital capacity (FVC), forced expiratory volume (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak expiratory flow rate during coughing, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), inflammation, and fibrosis. ECG can be used to monitor conduction abnormalities and arrhythmias. In particular, the ECG may be used to assess normalization of the PR interval, R waves in V1, Q waves in V6, ventricular repolarization, QS waves in the inferior and / or superior walls, conduction disturbances in right bundle branch block, QTC, and QRS.

[0165] Thus, provided are recombinant AAV compositions (including AAV8-RGX-DYS1), including compositions comprising a gene expression cassette and a viral vector containing a nucleic acid encoding the micro-dystrophin protein disclosed herein, as well as methods of administering these compositions to improve or maintain cardiac function or slow the loss of cardiac function by, for example, reducing LVEF to less than 45% and / or preventing a decline in normal function (LVFS≧28%) as measured by serial electrocardiograms and / or serial non-invasive imaging tests (e.g., echocardiography or cardiac magnetic resonance imaging (CMR)). Measurements can be compared to untreated controls or subjects prior to treatment with the nucleic acid compositions. Alternatively, the nucleic acid compositions and administration methods of nucleic acid compositions described herein result in an improvement in cardiac function or a reduction in the loss of cardiac function, as assessed by monitoring changes from baseline in forced vital capacity (FVC), forced expiratory volume (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak cough flow rate, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), inflammation, and fibrosis. ECG can be used to monitor conduction abnormalities and arrhythmias. In particular, ECG can be used to assess normalization of the PR interval, R waves in V1, Q waves in V6, ventricular repolarization, QS waves in the inferior and / or superior wall, conduction disorders in right bundle branch block, QTC, and QRS.

[0166] In some embodiments, cardiac and / or pulmonary function can be used as an endpoint for evaluating the therapeutic efficacy of administration. Cardiac and / or pulmonary function can be improved or increased in a subject compared to the level (cardiac and / or pulmonary function) before the administration. In some embodiments, cardiac and / or pulmonary function can be improved or increased in a subject compared to the level (cardiac and / or pulmonary function) in a subject without a dystrophinopathy. In some embodiments, cardiac and / or pulmonary function can be decreased in a subject compared to the level (cardiac and / or pulmonary function) in an untreated subject with a dystrophinopathy. The comparison of cardiac and / or pulmonary function can be relative to a standard, which is a number or set of numbers representing cardiac and / or pulmonary function in a subject without a dystrophinopathy or in an untreated subject with a dystrophinopathy. Thus, in some embodiments, the comparison of cardiac and / or pulmonary function after administration of an rAAV carrying a transgene encoding micro-dystrophin can be relative to a control. The control can be cardiac and / or pulmonary function in a subject before administration, cardiac and / or pulmonary function in a subject with an untreated dystrophinopathy, cardiac and / or pulmonary function in a subject without a dystrophinopathy, or cardiac and / or pulmonary function in a standard.

[0167] In some embodiments, the improvement or increase in cardiac and / or pulmonary function is 1-100% compared to a control, e.g., compared to the subject prior to administration of an rAAV comprising a transgene encoding micro-dystrophin. In some embodiments, cardiac function can be measured using impedance, electrical activity, and calcium handling.

[0168] 5.5.2 Central nervous system Some patients with DMD may also have epilepsy, learning and cognitive disabilities, dyslexia, neurodevelopmental disorders such as attention deficit hyperactivity disorder (ADHD), autism, and / or psychiatric disorders such as obsessive-compulsive disorder, anxiety, or sleep disorders.

[0169] The goal of the gene therapy treatments disclosed herein may be to improve cognitive function or alleviate symptoms of epilepsy and / or psychiatric disorders. Efficacy may be assessed by periodic assessment of behavioral and cognitive function, as well as by quantification and qualification of seizure events, appropriate to the age and disease stage of the study population.

[0170] Thus, provided are recombinant AAV compositions and methods of administering micro-dystrophin gene therapy compositions that improve cognitive function, reduce the occurrence or severity of seizures, and alleviate symptoms of ADHD, obsessive-compulsive disorder, anxiety, and / or sleep disorders.

[0171] 5.5.3 Primary Patient Endpoint The efficacy of the compositions, including the dosage of the compositions, and the methods described herein can be assessed by clinical evaluation of the treated subjects. Primary patient endpoints include forced vital capacity (FVC), forced expiratory volume (FEV1), maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), peak expiratory flow (PEF), peak expiratory flow rate during coughing, left ventricular ejection fraction (LVEF), left ventricular fractional shortening (LVFS), change from baseline in NSAA, change from baseline in Performance of Upper Limb (PUL) score, and Brooke Upper Extremity Scale (BUE). Changes in brachial (bicep) muscle fat and fibrosis assessed by MRI; measurement of leg strength using a dynamometer; 6-minute walk test; 10-minute walk test; gait analysis - 3D recording of gait; change in utrophin membrane staining via quantifiable imaging of immunostained biopsy sections; and change in regenerating fibers by measuring fiber size in combination with neonatal myosin positivity (via muscle biopsy).For example, Mazzone E et al,North Star Ambulatory Assessment,6-minute walk test and timed items in ambulant boys with Duchenne muscular dystrophy.Neuromuscular Disorders20(2010)712-716,Abdelrahim Abdrabou Sadek,et al,Evaluation of cardiac functions in children with Duchenne Muscular Dystrophy:A prospective case-control study.Electron Physician(2017)Nov;9(11):5732-5739, Magrath,P.et al,Cardiac MRI biomarkers for Duchenne muscular dystrophy.BIOMARKERS IN MEDICINE(2018)VOL.12,NO.11, Pane,M.et al,Upper limb function in Duchenne month longitudinal data.PLoS One.2018 Jun See 20;13(6):e0199223. [Example]

[0172] 6.1 Example 1 - Construction of a micro-dystrophin (DMD) gene expression cassette for cis-plasmid insertion. The DMD constructs encode microdystrophins with a core backbone: 5' (N-terminus)-ABD-H1-R1-R2-R3-H3-R24-H4-CR-3' (C-terminus) (Figure 2), but differ in the presence and length of the C-terminus (CT). Microdystrophin encoded by RGX-DYS1 has the proximal 194 amino acids of the wild-type DMD protein C-terminal domain (SEQ ID NO: 16) as its C-terminus. Microdystrophin-encoding RGX-DYS3 has a short C-terminus (48 amino acids of SEQ ID NO: 91) without a functional syntrophin or α-dystrobrevin binding domain. RGX-DYS5 encodes microdystrophin with a 140 amino acid C-terminal domain (SEQ ID NO: 83) that contains the α1-syntrophin binding site but does not contain the dystrobrevin binding site (see Figures 1A and 1B). The construct contained the Spc5-12 promoter (SEQ ID NO: 39) and smPA regulatory sequences, and RGX-DYS3 contained the VH4 intron sequence (SEQ ID NO: 41). All were cloned into a cis-plasmid flanked by ITRs. All DNA sequences encoding the DMD gene were codon-optimized and CpG-depleted.

[0173] 6.1.1. Recombinant Engineering of RGX-DYS1, RGX-DYS3, and RGX-DYS5 Transgenes Briefly, the human codon-optimized and CpG-depleted nucleotide sequence of the microdystrophin construct in RGX-DYS1 shown in Figure 2, encoding the N-terminus ABD1-H1-R1-R2-R3-H3-R24-H4-CR-CT-C-terminus (having the amino acid sequence of SEQ ID NO: 1), was synthesized using GeneArt Gene Synthesis (Invitrogen, Thermo Fisher, Waltham, MA). The desired C-terminus was generated by site-directed mutagenesis using the following two primers: 5': TGACTCGAGAGGCCTAATAAAGAGC (SEQ ID NO: 43), 3': CCTTGGAGACTGTGGAGAGGTG (SEQ ID NO: 44). The construct also contains a synthetic muscle promoter (e.g., SPc5-12, SEQ ID NO: 39) and a small poly(A) signal sequence (sm pA (SEQ ID NO: 42)) and has the nucleotide sequence of SEQ ID NO: 53.

[0174] Construct RGX-DYS3 (Figure 2) was engineered to encode the microdystrophin of the RGX-DYS1 construct detailed above (microdystrophin with the amino acid sequence of SEQ ID NO:2) along with a small portion of the CT domain (48 amino acids, SEQ ID NO:91). The construct contains the SPc5-12 promoter, sm pA polyA sequence, and VH4 intron at the 5' end of the microdystrophin coding sequence. The transgene construct has the nucleotide sequence of SEQ ID NO:21.

[0175] Construct RGX-DYS5 (FIG. 2) was engineered to encode microdystrophin DYS5 (amino acid sequence of SEQ ID NO:79), which is the DYS1 microdystrophin except that the C-terminal domain is truncated and is 140 amino acids in length (SEQ ID NO:83). The construct contains the SPc5-12 promoter and sm pA signal sequence and has the nucleotide sequence of SEQ ID NO:82.

[0176] Plasmid RGX-DYS5 was generated by replacing the C-terminal long version of DYS1 in plasmid RGX-DYS1 with a medium-length version of the C-terminal tail. Briefly, the gBlock-DMD-1.5 tail was synthesized using integrated DNA technology, containing the C-terminal medium version flanked by EcoRV and NheI sites and 17 bp of overlapping sequence from the RGX-DYS1 plasmid. The source plasmid RGX-DYS1 was digested with the restriction enzymes NheI and EcoRV (New England Biolabs) and then fusion-ligated with the gBlock-DMD1.5 tail. The final plasmid RGX-DYS5 was verified by enzyme digestion and subsequent sequencing. RGX-DYS2 and RGX-DYS4 were similarly constructed and each encode the same microdystrophin protein as RGX-DYS1; RGX-DYS2 contains a VH4 intron downstream of the promoter, while RGX-DYS4 has a truncated muscle-specific promoter.

[0177] All constructs were inserted into cis plasmids so that they were flanked by ITRs (nucleotide sequences of SEQ ID NO: 82). The RGX-DYS1 cassette contains the nucleotide sequence of SEQ ID NO: 20 encoding DYS1 micro-dystrophin, the RGX-DYS3 cassette contains the nucleotide sequence of SEQ ID NO: 21 encoding DYS3 micro-dystrophin, and the RGX-DYS5 cassette contains the nucleotide sequence of SEQ ID NO: 81 encoding DYS5 micro-dystrophin (see also Table 5). Table 10 provides the nucleotide sequences of the RGX-DYS1 (SEQ ID NO: 53), RGS-DYS3 (SEQ ID NO: 54), and RGX-DYS5 (SEQ ID NO: 82) artificial genomes (including flanking ITR sequences shown in lowercase).

[0178] Protein length and expression were confirmed by expressing the different plasmids in C2C12 cells and assaying cell lysates by Western blot.

[0179] To examine the packaging efficiency of RGX-DYS5, RGX-DYS5 was packaged into an AAV8 vector using HEK293 cells, and the titer of the AAV8-packaged vector RGX-DYS5 was determined after shake-flask culture and affinity purification. The average titer was higher than that of AAV8-packaged RGX-DYS1 and comparable to that of AAV8-packaged RGX-DYS3 in these benchtop production runs (data not shown).

[0180] 6.2 Example 2: Comparative study of construct expression in mdx mice 6.2.1 Comparison of μ-Dys expression by Western blot, mRNA expression, and DNA vector copy number. Data and samples described in this Example related to the RGX-DYS1 experiments were collected after the procedures described in Section 6.5 below (Proof of Concept, Example 5) (n=13 mice administered AAV8-RGX-DYS1). In vivo testing of the AAV8-RGX-DYS3 and AAV8-RGX-DYS5 vectors was performed in 13 male C57BL / 10ScSn-Dmd mice. mdx The study was conducted in / J (mdx) mice. All vectors were delivered systemically via tail vein injection to 5-week-old mdx mice at a dose of 2E14 vg / kg (Group 1: n = 5, AAV8-RGX-DYS3; Group 2: n = 5, AAV8-RGX-DYS5; n = 3, mdx negative (untreated) control). Animals weighed between 15.9 g and 22.0 g on the day of administration. Six weeks after vector administration, blood was collected for serum, and animals were euthanized and necropsied for tissue collection. Major skeletal muscles, including the gastrocnemius (GAS), tibialis anterior (TA), diaphragm, triceps brachii, quadriceps femoris, heart, liver, and major organs, were collected, snap-frozen in an isopentane / liquid nitrogen double bath, and placed in pre-cooled cryotubes.

[0181] Body weights were recorded twice weekly for each animal and the mean change in body weight was calculated for each group. All animals gained weight as expected over the 7 week period, except for one animal.

[0182] Experiments with RGX-DYS1 treated mice were performed in a different facility than experiments with RGX-DYS3 and RGX-DYS5 treated mice.

[0183] Microdystrophin protein expression from gastrocnemius muscles collected from treated mdx mice was examined by Western blot. Briefly, 20–30 mg of tissue was homogenized in protein lysis buffer (15% SDS, 75 mM Tri-HCl, pH 6.8, protease inhibitors, 20% glycerol, 5% beta-mercaptoethanol) (Bead Mill homogenizer Bead Ruptor12, SKU: 19050A, OMNI International). After homogenization, samples were spun down at maximum speed for 5 minutes at room temperature, and the supernatant was subjected to protein quantification. Protein stock supernatants were quantified using the Qubit Protein Assay Kit (Cat. No. Q33211, ThermoFisher Scientific). The total protein concentration per stock was calculated, and then 20 μg of protein stock supernatant was loaded onto an SDS-PAGE gel. Western blots were performed using a primary anti-dystrophin antibody (MANEX1011B(1C7), Developmental Studies Hybridoma Bank) at a dilution of 1:1000, and the secondary antibody applied was a goat anti-mouse IgG2a conjugate with horseradish peroxidase (HRP) (Thermo Fisher Scientific, catalog no. 62-6520). α1-actin served as a loading control in each lane of the gel. For anti-α1-actin blots, a rabbit polyclonal anti-α1-actin antibody (PA5-78715, Thermo Fisher Scientific) was used at a dilution factor of 1:10,000, and a secondary goat anti-rabbit antibody (Thermo Fisher Scientific, catalog no. 31460) was used at a dilution factor of 1:20,000. Protein signals were detected using ECL Prime Western blotting detection reagents (following the manufacturer's instructions, AMERSHAM, RPN2232) and quantified by densitometry guided by Image Lab software (Bio-Rad).

[0184] The Western blot results (Figure 3A) revealed several observations: First, the estimated size of each microdystrophin protein corresponded well to its observed migration on the gel; for example, the RGX-DYS1 microdystrophin protein was 148 kDa, while the RGX-DYS5 and RGX-DYS3 proteins were 142 kDa and 132 kDa, respectively. Second, the band intensity varied for each protein present in gastrocnemius muscle tissue. The RGX-DYS1 vector, which is the longer version of microdystrophin, showed the strongest transgene expression, followed by the intermediate version RGX-DYS5 and the shorter version RGX-DYS3 (Figures 3A and 3B). The difference in microdystrophin expression levels among these three constructs could be due to either variations in the AAV vector genome level or protein stability of the different length microdystrophin constructs.

[0185] To elucidate the genome copies per cell, ddPCR was performed to examine the AAV-micro-dystrophin vector genome copy number in those tissues, and the copy number of delivered vector in a particular tissue per diploid cell was calculated as follows:

number

[0186] In addition, the mRNA expression of μ- and wild-type (WT) dystrophin in skeletal muscle of untreated wild-type B6 and mdx mice was measured by ddPCR compared with that of treated mice. Total RNA was extracted from muscle tissue using the RNeasy Fibrous Tissue Mini Kit (REF74704, Qiagen). cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit with RNAse Inhibitor (Ref4374966, Applied Biosystems by Thermo Fisher Scientific). RNA concentration was measured using a Nanodrop spectrophotometer. The copy numbers of μ-dystrophin, WT-dystrophin, and endogenous control glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). Primers and probes for mouse WT-dystrophin (mm01216951_m1, Thermo Fisher Scientific) (also described in the biodistribution study in Section 6.5 (Example 5) above) and mouse GAPDH (mm99999915_g1, Thermo Fisher Scientific) were commercially available. As shown in Figure 4A, the relative WT-dystrophin transcript in naive B6 mice was 1 ± 0.64, and the WT-dystrophin mRNA expression in mdx mice was 1.55 ± 0.77 (p = 0.15, n = 4). The relative microdystrophin mRNA in treated animals was as follows: RGX-DYS1-treated muscle, 22.66 ± 11.6 (p < 0.01, n = 5), RGX-DYS5-treated muscle, 16.83 ± 11.07 (p = 0.06, n = 3), and RGX-DYS3-treated muscle, 11.87 ± 7.90 (p < 0.05, n = 4). This data indicated that delivery of the microdystrophin vector in the RGX-DYS1, RGX-DYS5, and RGX-DYS3 groups all produced microdystrophin transcripts significantly higher than wild-type levels.In addition to GAPDH normalization, the copy number of microdystrophin mRNA was normalized to the copy number of the AAV vector genome per cell, and WT-dystrophin mRNA was normalized to the copy number of the genome per cell (2 copies / cell). As shown in Figure 4B, all groups showed essentially similar levels of mRNA expression on a per genome basis (n = 3-5, p > 0.05). This indicated that the muscle-specific SPc5-12 promoter driving expression of the AAV-microdystrophin transgene was as potent as the native dystrophin promoter in mouse skeletal muscle cells.

[0187] 6.2.2 Microdystrophin Expression and Dystrophin-Associated Protein Complex (DAPC) Assembly by Immunofluorescence (IF) Staining Next, immunofluorescence (IF) staining was performed to examine the expression of dystrophin and the dystrophin-associated protein complex, including dystrobrevin, β-dystroglycan, syntrophins, and nNos, in the gastrocnemius muscles from the different groups. The IF staining protocol and applied antibodies were as previously described in Section 6.2 (Example 2) above. Dystrophin protein and the examined DAPC proteins were all absent in untreated mdx muscles, but they were strongly present in wild-type B6 muscle membranes. In all three treatment groups, microdystrophin protein was expressed in nearly 100% of muscle fibers, and these were indistinguishable between the different treatment groups. The three treatment groups showed restoration of dystrobrevin expression in the muscle membrane, with very similar patterns observed. β-dystroglycan staining revealed more uniform and stronger β-dystroglycan staining (expression) in muscles from the AAV8-RGX-DYS1 treatment group (data not shown).

[0188] More dramatic differences between treatment groups were observed in syntrophin staining. Syntrophin expression in the muscle membrane was significantly enhanced in the AAV8-RGX-DYS1 group, which contained longer-length microdystrophins, followed by RGX-DYS5 and RGX-DYS3 (data not shown). The same trend was further demonstrated by Western blot analysis of muscle lysates (Figure 5A). Western blots for syntrophin were performed on skeletal muscle tissue lysates (gastrocnemius muscle tissue from three mice each from the mdx-treated and untreated groups, as well as one gastrocnemius and two triceps muscles from the B6 mouse group). A polyclonal anti-syntrophin antibody (Abcam, ab11187) was used at 1:10,000 and incubated for 1 hour at room temperature. A rabbit monoclonal antibody against α-actinin (ab68167, Abcam) was applied at a 1:5000 dilution. A secondary goat anti-rabbit antibody (Thermo Fisher Scientific, catalog number A-10685) was applied. The ratio of syntrophin expression to endogenous control actinin expression in WT muscle was 4.56 ± 0.76 (n = 3, p < 0.001 by one-way ANOVA) compared with the mdx group (0.84 ± 0.22). The ratios in the AAV8-RGX-DYS1 and AAV8-RGX-DYS5 groups were 2.72 ± 0.97 (n = 3, p < 0.05 compared with the mdx group) and 1.35 ± 0.03, respectively (Figure 5B). The level of syntrophin expression in skeletal muscle was examined by Western blot analysis using total muscle membrane extracts. Total skeletal muscle protein was extracted using the Mem-Per Plus Membrane Protein Extraction Kit (catalog no. 89842, Thermo Fisher Scientific). Gastrocnemius muscle tissue from each of the mdx-treated and untreated groups, and quadriceps muscle from the B6 mouse group, were used. 20 μg of total membrane protein was loaded per lane (Figure 5C). Polyclonal anti-syntrophin antibody (Abcam, ab11187) was applied at a 1:10,000 dilution for overnight incubation at 4°C. A loading control polyclonal anti-actin antibody (PA5-78715, Thermo Fisher Scientific) was applied at a 1:10,000 dilution for overnight incubation at 4°C.As shown in Figure 5D, slightly different from the total lysate Western blot, in which WT muscle showed the highest syntrophin expression level, total membrane protein Western blot analysis showed the highest relative syntrophin expression in the RGX-DYS1 group (0.81 ± 0.26, n = 3), followed by the B6_WT group (0.6623 ± 0.05, n = 3), the RGX-DYS3 group (0.59 ± 0.08), and the mdx group (0.32 ± 0.07, n = 3). These results clearly demonstrated that microdystrophin generated by the microdystrophin vector was able to restore muscle membrane syntrophin expression, and that the long version, RGX-DYS1, had a better ability to anchor syntrophin to the muscle membrane than the shorter version, RGX-DYS3.

[0189] nNOS Western blots were similarly prepared using muscle membranes (gastrocnemius tissue from the mdx and quadriceps femoris groups) from the B6 group. Total muscle membrane protein was extracted using the Mem-Per Plus Membrane Protein Extraction Kit (catalog no. 89842, Thermo Fisher Scientific). 20 μg of total membrane protein was loaded per lane of an SDS-PAGE gel. A primary antibody against nNOS (SC-5302, Santa Cruz Biotechnology) was used at a dilution of 1:500, and a polyclonal anti-actin antibody (PA5-78715, Thermo Fisher Scientific) was applied at a dilution of 1:10,000. A secondary goat anti-mouse IgG antibody with HRP (62-6520, Thermo Fisher Scientific) was applied. Significant differences in nNOS expression were observed between the RGX-DYS1 and RGX-DYS3 groups after IF staining (Figure 6A). However, the Western blot results did not reveal any significant differences between the RGX-DYS1 group, the RGX-DYS3 group, and the untreated mdx group ( Figures 6B–C ), indicating that the restoration of nNOS by the RGX-DYS1 vector was low.

[0190] Overall, delivery of the RGX-DYS1, RGX-DYS3, and RGX-DYS5 vectors in mdx mice all resulted in robust microdystrophin expression and restoration of the dystrophin-associated protein complex (DAPC). The longer version of the RGX-DYS1 vector enhanced DAPC restoration, particularly for syntrophins and β-dystroglycan. The ability of the RGX-DYS1 vector to restore nNOS to membrane DAPCs was low, but visible by IF staining.

[0191] 6.2.3 Transduction of Satellite Cells with AAV8-RGX-DYS1 Vectors and Improved Dystrophic Muscle Regeneration Skeletal muscle stem cells, or satellite cells (SCs), are normally quiescent and localized between the basal lamina and sarcolemma of muscle fibers. During growth and after muscle injury, the myogenic program of SCs is activated, and SCs self-renew to maintain their pool and / or form myoblasts, ultimately forming muscle fibers. Because adeno-associated virus (AAV) vectors are well known for transducing differentiated muscle fibers, we investigated whether satellite cells could also be transduced by AAV vectors. Satellite cells are small and possess very little cytoplasm, making it technically challenging to test transgene expression in these cells. In this regard, we applied RNAscope® to investigate whether AAV can transduce satellite cells. RNAscope® is an in situ hybridization (ISH) technique that simultaneously enables signal amplification and background noise suppression, allowing for the direct visualization of single-molecule gene expression in intact tissue with single-cell dissociation. Colocalization of three microdystrophin proteins (DYS1, DYS3, or DYS5) and Pax7 mRNA in skeletal muscle of untreated mdx mice, RGX-DYS1-treated mdx mice, and wild-type C57BL / 6 mice. RNAscope® multiplexed fluorescence analysis utilized an AAV microdystrophin probe labeled with the fluorophore Opal570 (red) and the muscle satellite cell marker pax7 labeled with the fluorophore Opal520 (green). RNAscope® multiplexed fluorescence analysis of AAV transgene and Pax7 mRNA expression was performed at Advanced Cell Diagnostics Inc. (Newark, CA). Total RNA was extracted from skeletal muscle using the RNeasy® Fibrous Tissue Mini Kit (Qiagen catalog no. 74704), and cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems catalog no. 4374966). The absolute copy numbers of microdystrophin mRNA and endogenous control GAPDH mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla technologies).Primers and probes for microdystrophin were the same as previously described. Mouse pax7 primer and probe set (TaqMan™ MGB Probe, Applied Biosystems catalog number 4316034) was purchased commercially.

[0192] The microdystrophin-transduced satellite cells were counted and the satellite cell transduction rate was calculated. In AAV-microdystrophin-transduced skeletal muscle, the satellite cell transduction rate was 23 ± 1.5% (Figure 7A). This indicated that the AAV vector was able to transduce muscle satellite cells, albeit at a much lower transduction rate than mature muscle fibers.

[0193] The total number of pax7+ satellite cells was then counted within RNAscope images to determine whether satellite cell numbers were similar across different treatment groups. As shown in Figure 7B, the number of pax7-positive cells per image in untreated mdx mice was 39.12 ± 15.14, while the number of positive cells in wild-type B6 mice and DMD vector-treated mice was 11.87 ± 3.23 (8 images counted, one-way ANOVA p < 0.0001) and 14.66 ± 5.91 (12 images counted, one-way ANOVA p < 0.0001), respectively. The increased number of satellite cells in untreated mdx muscles indicated the regenerative nature of dystrophic muscle. Delivery of microdystrophin using the RGX-DYS1 vector reversed this pathology and alleviated muscle regeneration.

[0194] In addition to RNAscope analysis, total muscle RNA was extracted and cDNA synthesis was performed. Total RNA was extracted from skeletal muscle using the RNeasy® Fibrous Tissue Mini Kit (Qiagen catalog no. 74704), and cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems catalog no. 4374966). Samples were subjected to ddPCR using mouse pax7-specific primers and probe sets (commercially available: mm01354484_m1 Pax7, Thermo Fisher Scientific, and TaqMan™ MGB probe from Applied Biosystems catalog no. 4316034, respectively). RNA and cDNA inputs were normalized using mouse GAPDH primers and probe sets. Absolute copy numbers of microdystrophin mRNA and endogenous control GAPDH mRNA were measured using digital PCR (Naica Crystal Digital PCR system, Stilla Technologies). The ratio of pax7 mRNA copy number to GAPDH mRNA copy number was compared between groups (Figure 7C). As expected, the relative expression of Pax7 in mdx mice was 7.56 ± 3.14, which was significantly higher than that in WT-B6 mice (1 ± 0.68, n = 5, p < 0.001 by one-way ANOVA). Relative Pax7 expression was significantly reduced in the three different microdystrophin vector-treated groups (4.40 ± 1.50 in RGX-DYS5 (n = 3, p = 0.06), 3.12 ± 0.74 in RGX-DYS3 (n = 5, p < 0.01), and 2.98 ± 0.68 in RGX-DYS1 (n = 5, p < 0.01)). The number of Pax+ satellite cells was elevated in mdx mice, consistent with the active cycle of muscle degeneration and regeneration in this dystrophin model. The reduction in pax7 mRNA expression in satellite cells of microdystrophin-treated mdx mice indicates that the present microdystrophin vector corrects satellite cell hyperplasia in dystrophic muscle through improved muscle regeneration.

[0195] DYS1 treatment significantly reduces satellite cell hyperplasia in mdx, as measured by both satellite cell counts and Pax7 mRNA expression (FIGS. 7B and 7C). 6.3 Example 3 Testing AAV8 Compared to AAV9 RNA / DNA AAV8 and AAV9 have similar transduction efficiencies in the skeletal and cardiac muscles of non-human primates (NHPs) via systemic delivery (Figures 8A-8F). AAV8 and AAV9 packaging CAG-GFP cassettes with unique barcodes were individually generated and pooled with other capsids at approximately equal concentrations to generate a library of 118 barcoded AAVs. This library (PAVE118) was intravenously administered to three cynomolgus monkeys at a dose of 1.77e13 GC / kg. Three weeks after administration, DNA and RNA isolated from various NHP tissues were subjected to NGS analysis for relative abundance. There were no significant differences in DNA and RNA levels from AAV8 and AAV9 capsids in NHP skeletal muscle (Figures 8A and B, respectively), cardiac muscle (Figures 8C and D, respectively), and liver (Figures 8E and F, respectively).

[0196] 6.4 Example 4 - In Vitro Studies (DMD Patient-Derived Induced Pluripotent Stem Cells (iPSCs)) Although the mdx / BL10 mouse model is a well-established mouse model of DMD, cardiomyopathy, the leading cause of death in patients with DMD, is not demonstrated or the phenotype is limited to mild ventricular dilation during aging (Yucel et al., 2018). Recent publications have shown that iPSC-derived cardiomyocytes (iPSC-CMs) from DMD patients can be used to model dilated cardiomyopathy (Laurila et al., 2016; Lin et al., 2015).

[0197] This study will establish an in vitro cardiac model of DMD using patient-derived iPSC-CMs and evaluate the biological activity of RGX-DYS1 in dystrophin-deficient human cardiomyocytes. iPSCs from DMD patients and healthy donors obtained from the European Bank for Induced Pluripotent Stem Cells (EBiSC) can be differentiated into cardiomyocytes. Once mature cardiomyocytes are generated, the functional phenotypes of DMD and healthy control human cell lines can be characterized.

[0198] Upon establishment of a functional phenotype, RGX-DYS1 can be incubated with DMD iPSC-CMs. RGX-DYS1 vector (DNA) and RGX-DYS1 microdystrophin expression can be determined by qPCR and immunocytochemistry, respectively. In addition, cardiac function endpoints (i.e., impedance, electrical activity, and calcium handling) can be assessed to evaluate the benefits of RGX-DYS1 in DMD cardiomyocytes.

[0199] 6.5 Example 5 - Proof of Concept - 6-Week Study in mdx Mice 6.5.1 6-week study in mdx mice To evaluate the biological activity of AAV8-RGX-DYS1 in mdx mice, AAV8-RGX-DYS1 was administered to 5-week-old mdx male mice (C57BL / 10ScSn-Dmdmdx / J, n = 13 per group) at a dose of 0 (vehicle) or 2 × 10 14The drug was administered intravenously at a dose of 0.05 GC / kg. The study included the following parameters and endpoints: mortality, clinical observations, body weight, forelimb grip strength, and in vitro force on the extensor digitorum longus (EDL). At necropsy (6 weeks post-administration), a gross examination of the tissues, including tissue weight, was performed. Muscle tissues were collected separately for evaluation of muscle pathology. AAV8-RGX-DYS1 micro-dystrophin expression was assessed by Western blot and immunofluorescence, and RGX-DYS1 vector DNA biodistribution was also assessed. Finally, DAPC protein expression and localization were also assessed in the tibialis anterior (TA) and diaphragm tissues using immunofluorescence.

[0200] AAV8-RGX-DYS1: 2 × 10 14 GC / kg was well tolerated. There were no AAV8-RGX-DYS1-related deaths or adverse clinical observations. One mouse was euthanized due to hydrocephalus 3 weeks after AAV8-RGX-DYS1 administration. However, this finding was not considered test-article related because hydrocephalus was commonly observed in mdx mice and was also observed in vehicle-controlled mdx mice in a 12-week pharmacology study (Xu et al., 2015, Example 6).

[0201] Consistent with natural history data for mdx mice (Coley et al., 2016), mean body weight in vehicle-controlled mdx mice was significantly higher (+11%) than age-matched historical controls. Absolute and normalized muscle tissue weights were also significantly higher (+18% to +53% and +7% to +36%, respectively) compared with wild-type historical controls (HCD) at the laboratory (AGADA Biosciences). AAV8-RGX-DYS1 administration reduced body weight in mdx mice (-13%), which was comparable to the historical data of wild-type controls at the laboratory. Concomitantly, absolute and normalized weights of all skeletal muscles (including the diaphragm) were lower (-17% to -29% and -4% to -18%, respectively) than in vehicle-controlled mdx mice.

[0202] Muscle function was assessed by grip strength at week 5, and in vitro force of the EDL muscle was assessed at necropsy (week 6). Vehicle-control mdx mice showed significantly decreased absolute and normalized forelimb grip strength compared with age-matched historical wild-type control data. AAV8-RGX-DYS1 administration increased absolute and normalized forelimb grip strength in mdx mice compared with vehicle-control mdx mice (+14.5% and +33.7%, respectively), and these data were comparable to historical wild-type control data in the experimental laboratory. As shown in Figures 9A-9D, both maximal and specific muscle force output were significantly decreased in vehicle-control mdx mice compared with wild-type HCD mice. In contrast, administration of AAV8-RGX-DYS1 to mdx mice resulted in significant increases in maximal and specific force output of the EDL muscle compared with vehicle-control mdx mice (+21% and +47.2%, respectively). To determine grip strength, mice were gently placed on a wire grid with their forelimbs and allowed to grasp one of the horizontal bars with only their forepaws. After ensuring that both forepaws firmly gripped the same bar and that the torso was perpendicular to the ground and parallel to the bar, the mouse was steadily pulled back with uniform force across the entire length of the grid until the grip was released. Each animal was required to perform five successful pulls over five consecutive days for acclimation and testing. For analysis of individual mouse maximal strength, the single highest recorded value (maximum force) was calculated. Normalized strength (kgf / kg) was calculated based on body weight. To determine in vitro force, the EDL muscle from the right hindlimb was removed from each mouse and immersed in an oxygenated bath (95% O2, 5% CO2) containing Ringer's solution (pH 7.4) at 25°C. Using non-fatiguing twitch contractions, the muscle was adjusted to its optimal length for force generation. The muscle was stimulated with electrodes to elicit isolated tetanic contractions with a 2-minute rest interval. With each subsequent tetanic contraction, the stimulation frequency was increased in steps of 20, 30, or 50 Hz until the force reached a plateau, which typically occurred at approximately 250 Hz. The cross-sectional area of ​​the muscle was measured based on muscle mass, fiber length, and tissue density. Finally, muscle specific strength (kN / m2) was calculated based on the cross-sectional area.

[0203] To determine whether AAV8-RGX-DYS1 treatment not only improved muscle function but also attenuated the dystrophic phenotype in mdx mice, we examined muscle pathology (i.e., inflammation, degeneration, regeneration, and central nucleation) in the TA and diaphragm of AAV8-RGX-DYS1-treated mdx mice at the end of the study (week 6). Wild-type control tissue from the tissue bank at our testing facility (AGADA Biosciences) was used as a comparator for the TA muscle (n = 2–3), and age-matched wild-type HCD from our testing facility was used for the diaphragm.

[0204] Inflammation was examined using hematoxylin and eosin (H&E) staining. Regenerating and degenerating fibers in the muscles were determined by immunostaining for embryonic myosin heavy chain (eMHC) and IgM, respectively. Central nucleation, another indicator of muscle regeneration, was also measured by H&E staining.

[0205] As shown in Figures 10A-10K, dystrophic pathology (inflammation, degeneration, and regeneration) was evident in the TA and diaphragm of vehicle-controlled mdx mice compared with wild-type mice. Additionally, the percentage of centrally nucleated fibers (CNF), recognized as regenerated fibers, in vehicle-controlled mdx mice was significantly higher than in historical wild-type control data (TA: 2.92% in wild-type vs. 70.81% in mdx; diaphragm: 1.46% in wild-type vs. 41.63% in mdx). AAV8-RGX-DYS1 administration attenuated dystrophic changes in mdx mice (Figures 10A-10K), and significant reductions in inflammation, regeneration, and degeneration were observed in both TA and diaphragm tissues, similar to wild-type HCD in our laboratory. AAV8-RGX-DYS1 administration also significantly reduced the percentage of CNFs in the TA (-18.4%) and diaphragm (-48.9%) in mdx mice, although the percentage of CNFs in both tissues was higher than that in wild-type controls (Figures 10A-10K). These observations are likely due to the early onset of muscle cell replication (approximately 3 weeks of age) in mdx mice before AAV8-RGX-DYS1 administration and the superior regenerative capacity of mdx-BL10 background mice, unlike DMD patients (Turk et al., 2005).

[0206] To confirm the success of AAV8-RGX-DYS1 transduction in mdx mice, RGX-DYS1 biodistribution (vector DNA) was examined by ddPCR, and transgene levels of RGX-DYS1 microdystrophin (protein) were determined by immunofluorescence and Western blot. Dystrophin levels were also measured as a control.

[0207] Vector DNA levels were quantifiable by ddPCR in all tissues (liver, heart, diaphragm, TA, EDL, and triceps) collected from all AAV8-RGX-DYS1-treated animals (Figures 11A and 11B). Liver had the highest vector DNA levels, but levels were comparable across tissues. In vehicle-control mdx mice, liver was analyzed in all other muscles and several selected animal tissues for each muscle group to confirm that vector DNA levels were absent or near the lower limit of quantitation (LLOQ) (~0.08 gc / dg).

[0208] For Western blot analysis, proteins were extracted from diaphragm, gastrocnemius, and TA muscles collected from AAV8-RGX-DYS1-treated mdx mice. Microdystrophin levels in the samples were calculated as a percentage of normal dystrophin based on a standard curve derived from measurements of dystrophin in a mixture of muscle lysates from BL10 mice and German Shorthaired Pointer Muscular Dystrophy (GSHPMD) dogs. AAV8-RGX-DYS1-treated mdx mice showed AAV8-RGX-DYS1 microdystrophin expression, reported as a percentage of dystrophin, of 159.5% in the diaphragm, 191.8% in the gastrocnemius, and 225.2% in the TA muscle (Figure 12). AAV8-RGX-DYS1 microdystrophin expression in the diaphragm, gastrocnemius, and TA muscles was consistent with widespread distribution of vector DNA throughout all muscle tissues at 6 weeks.

[0209] To further confirm AAV8-RGX-DYS1 microdystrophin expression in muscle fibers, immunofluorescence was performed in the TA and diaphragm. Six weeks after administration, vehicle-controlled mdx mice had no dystrophin-positive fibers in the TA or diaphragm (i.e., no dystrophin expression at the sarcolemma), except for very few somatic revertant muscle fibers. In contrast, AAV8-RGX-DYS1-treated mdx mice showed robust and precise microdystrophin expression at the sarcolemma of TA (96%) and diaphragm (89.1%) muscle tissues (Figures 13A-13C). These results were similar to those of wild-type controls. As previously reported, uniform dystrophin expression is required to stabilize muscle fiber turnover and attenuate pathology in dystrophic muscle (van Westering et al., 2020).

[0210] Dystrophin deficiency leads to the entire degradation of the DAPC, which is involved in maintaining muscle integrity and cell signaling during repeated muscle contraction and relaxation (Sancar et al., 2011; Duan et al., 2018). Thus, the absence of dystrophin and destabilization of the DAPC are thought to increase susceptibility to muscle damage, accumulate intracellular calcium influx, and result in a severe dystrophic phenotype (Cirak et al., 2012).

[0211] To assess whether AAV8-RGX-DYS1 administration could also restore DAPC protein stabilization, immunofluorescence was performed with anti-α1-syntrophin, dystrobrevin, nNOS-1, and β-dystroglycan in TA and diaphragm muscles (Figure 14).

[0212] Vehicle-control mdx mice showed negligible / undetectable DAPC protein in the sarcolemma of muscle fibers in the TA and diaphragm compared with wild-type controls. AAV8-RGX-DYS1 administration completely restored sarcolemmal expression of α1-syntrophin (9 / 10 in the TA, 10 / 10 in the diaphragm) and dystrobrevin (8 / 10 in the TA, 10 / 10 in the diaphragm) in both tissues. More importantly, the expression of both α1-syntrophin and dystrobrevin in AAV8-RGX-DYS1-treated mdx mice appeared colocalized with anti-dystrophin staining, similar to that in wild-type mice. These results demonstrated that the C-terminal domain (CT194) of RGX-DYS1 microdystrophin can recruit α-dystrobrevin and α-syntrophin, as previously reported (Constantin et al., 2014; Koo et al., 2011). The presence of β-dystroglycan in the sarcolemma was also restored in AAV8-RGX-DYS1-treated mdx mice compared with vehicle-controlled mdx mice. However, AAV8-RGX-DYS1-treated mdx mice showed broad areas of robust expression (6 / 10) and lower expression (4 / 10) in the TA compared with wild-type mice. A similar pattern was observed in diaphragm tissue from AAV8-RGX-DYS1-treated mdx mice. Although AAV8-RGX-DYS1 treatment did not appear to completely restore nNOS presence in the sarcolemma, nNOS was detectable at higher levels in the TA and diaphragm sarcolemma than in vehicle-controlled mdx mice. Collectively, AAV8-RGX-DYS1 treatment increased the expression of DAPC protein, including CT domain-specific proteins, in the sarcolemma of TA and diaphragm muscles, suggesting improved structural integrity of myofibers.

[0213] 6.6. Example 6: 12-Week Pharmacology Study in mdx Mice 6.6.1 12-week study in mdx mice The pharmacology of AAV8-RGX-DYS1 was evaluated in mdx mice after a single IV injection.

[0214] Groups of mdx male mice (n = 10 per group) received a single IV injection of AAV8-RGX-DYS1 at 0 (vehicle), 3 × 10 13 , 1×10 14 , 3×10 14 , or 5 × 10 14 The mice were administered 100 mg / kg (maximum feasible dose). An additional group of wild-type mice (C57BL / 10ScSn) was included as a control. The following parameters and endpoints were included: mortality, clinical observations, body weight, in vivo muscle function (grip strength, automated gait analysis), biomarkers (T2-MRI imaging and CK from serum), AAV8-RGX-DYS1 biodistribution (vector DNA), RGX-DYS1 microdystrophin expression (protein), gross examination, tissue weight, and histopathology including spermatogenesis. In vivo endpoints (grip strength, locomotor gait analysis, and T2-MRI imaging) were performed at weeks 6 and 12. An additional time point (week 9) was added for grip strength measurements. Serum for CK analysis was collected at week 7 after examining the in vivo endpoints and at terminal necropsy. 12 weeks after AAV8-RGX-DYS1 administration, animals were sacrificed and a terminal necropsy was performed.

[0215] AAV8-RGX-DYS1 can express up to 5 × 10 14 Doses up to GC / kg were well tolerated, with no AAV8-RGX-DYS1-related mortality. There were four early deaths due to hydrocephalus, including one male in the vehicle control group (3 × 10 13 Two males administered GC / kg, and 1 × 10 14 The study consisted of one male receiving GC / kg of AAV8-RGX-DYS1. However, this finding was not considered test product-related because hydrocephalus is associated with the mdx mouse phenotype (Xu et al., 2015). There were no AAV8-RGX-DYS1-related clinical observations during the study period.

[0216] Fine motor kinematic gait analysis (in vivo functional testing) The functional effects of AAV8-RGX-DYS1 were demonstrated using fine motor kinematic analysis. Briefly, mouse movements were captured using a high-speed camera (300 frames / s) from three different perspectives: below, right, and left. Fine motor skills and gait characteristics were then assessed using a high-precision kinematic analysis method (MotoRater, TSE Systems, Homburg, Germany) using walking mode. When vehicle-controlled mdx mice were observed using fine motor kinematic analysis, a phenotype was observed in lower body posture, observed as increased hip, knee, and ankle extension, as well as increased overall hip height and decreased forelimb toe clearance, compared to wild-type mice.

[0217] As shown in Figure 15, the total gait score, which combines kinematic parameters into a single score, was significantly higher in vehicle-control mdx mice than in wild-type mice at week 6 (0.77 in wild-type vs. 3.84 in vehicle-control mdx), with a more pronounced difference between vehicle-control mdx and wild-type mice at week 12 (-0.77 in wild-type vs. 4.25 in vehicle-control mdx). At week 6 (11-12 weeks of age), the effect of AAV8-RGX-DYS1 was significantly higher than that of 1 x 10 14 GC / kg and 3×10 14 This was evident at a dose of 5 × 10 14 The total gait score at the AAV8-RGX-DYS1 dose of GC / kg was similar to that of the wild type. At 12 weeks (17-18 weeks of age), the total gait score was ≥ 1 × 10 14 Total gait scores at the GC / kg AAV8-RGX-DYS1 dose were significantly improved, normalized to wild-type levels (−0.77 vs. 1 × 10 in wild-type). 14 , 3×10 14 , 5×10 14 GC / kg, respectively (0.76, 0.57, and 0.30).

[0218] T2-magnetic resonance imaging (biomarkers) In DMD patients, muscle MRI has emerged as a powerful tool for assessing muscle damage and inflammation (Forbes et al., 2020). In this study, T2-mapping MRI was performed 6 and 12 weeks after administration to assess gastrocnemius muscle volume, percent hyperintense lesion, and T2 relaxation time in lesioned (hyperintense) and non-lesioned (normally appearing muscle) gastrocnemius muscles (Figures 16A-16E). Gastrocnemius muscle volume (both legs combined) was significantly increased in vehicle-control mdx mice compared to wild-type mice at both 6 weeks and 12 time points due to compensatory hypertrophy. At 6 weeks, AAV8-RGX-DYS1 administration significantly increased gastrocnemius muscle volume by 3 × 10 compared to vehicle-control mdx mice. 14 and 5 x 10 14 At week 12, the dose-response bioactivity of AAV8-RGX-DYS1 on gastrocnemius muscle volume was significantly reduced with AAV8-RGX-DYS1 at 3 × 10 14 and 5 x 10 14 This was clearly observed in mdx mice administered with a dose of GC / kg.

[0219] Hyperintense lesions, as a marker of muscle edema, were quantified based on automated threshold analysis from both legs. Increased hyperintense lesions (expressed as % lesions) were clearly observed in vehicle control mdx mice when compared to wild-type controls at weeks 6 and 12. At week 6, decreased lesions were observed in mice with 3 × 10 13 Already evident at a dose of AAV8-RGX-DYS1 of GC / kg, 1 × 10 14 , 3×10 14 , and 5 × 10 14 At week 12, a clear difference was observed between the 1 × 10 GC / kg and 1 × 10 GC / kg AAV8-RGX-DYS1 groups. 14 , 3×10 14 , and 5 × 10 14 This was observed in mdx mice treated with a dose of GC / kg and was comparable to wild-type.

[0220] T2 time is usually increased in pathological processes accompanied by changes in the aqueous environment, such as edema, inflammation, and some degree of fibrosis (Hogrel et al., 2016; Wokke et al., 2016). Therefore, T2 relaxation times were assessed for both hyperintense lesions and normal-appearing gastrocnemius muscles (non-lesioned) (Figures 16D and 16E). Although no lesions were observed in images of wild-type animals, the low percentage reported in Figure 16A should be considered background levels. Increased T2 relaxation times were observed in vehicle-control mdx mice at both time points (6 and 12 weeks) when compared with wild-type. AAV8-RGX-DYS1 administration increased T2 relaxation times in mdx mice by 1 × 10 14 , 3×10 14 , and 5 × 10 14 A dose of GC / kg significantly reduced T2 relaxation times, and these times were comparable to wild-type at weeks 6 and 12. Thus, in AAV8-RGX-DYS1-treated mice, T2 relaxation times were >1 × 10 by week 12. 14 GC / kg dose was comparable to wild-type animals.

[0221] In AAV8-RGX-DYS1-treated mice, T2 relaxation times were >1 × 10 by week 12. 14 GC / kg dose was comparable to wild-type animals.

[0222] Grip strength (in vivo functional test) Grip strength measurements at 6 and 9 weeks did not clearly reveal differences between vehicle control mdx and wild-type mice (Figure 17). At 12 weeks, minimal differences in grip strength between vehicle control mdx and wild-type mice were observed without statistical significance. 3 x 10 14 and 5 x 10 14 Grip strength in mdx mice treated with AAV8-RGX-DYS1 at a dose of GC / kg was significantly increased compared to vehicle-controlled mdx mice. These inconsistent observations are likely due to the fact that grip strength testing in rodents can be affected by various factors other than motor function (Maurissen et al., 2003; Nagaraju et al., 2008).

[0223] Creatine kinase As expected, mean CK levels were 21- and 30-fold higher in vehicle-control mdx mice compared to wild-type controls at weeks 7 and 12, respectively. In AAV8-RGX-DYS1-treated mdx mice, CK levels were >1 × 10 14 GC / kg dose, and decreased to 3 × 10 14 Significance was reached at the dose of GC / kg (Figure 18).

[0224] RGX-DYS1 biodistribution (vector DNA) The biodistribution of DNA vectors was assessed using qPCR. Gastrocnemius, diaphragm, heart, and liver tissues from AAV8-RGX-DYS1-treated mdx mice contained high levels of vector DNA at the end of the study (week 12). A dose-proportional increase in vector DNA levels was observed in all examined tissues of AAV8-RGX-DYS1-treated mice, but did not reach significance (Figure 19). Liver contained higher vector DNA levels compared to muscle tissue in all AAV8-RGX-DYS1-treated mice. Tissues collected from wild-type BL10 mice and mdx vehicle-control mice showed vector DNA levels at either the limit of quantification (BQL) of less than 50 copies / μg DNA or the limit of detection (LOD) of 11.96 copies / μg DNA.

[0225] RGX-DYS1 microdystrophin expression (protein) Western blot analysis was performed to examine RGX-DYS1 microdystrophin expression in mdx mice.

[0226] At week 12, AAV8-RGX-DYS1 was administered at 1 × 10 14 , 3×10 14 , and 5 × 10 14Mdx mice treated with the lowest AAV8-RGX-DYS1 dose (3 × 10 GC / kg) showed significantly higher RGX-DYS1 micro-dystrophin expression in all three muscles (gastrocnemius, diaphragm, and heart) when compared to vehicle control mdx mice (p < 0.05-0.001). 13 GC / kg), RGX-DYS1 microdystrophin levels were higher than vehicle control mdx mice, but not significantly.

[0227] In all AAV8-RGX-DYS1-treated mdx mice, RGX-DYS1 microdystrophin expression was higher in cardiac tissue compared with gastrocnemius muscle and diaphragm, whereas expression in gastrocnemius muscle and diaphragm was generally comparable (Figures 20A and 20B). Compared with dystrophin protein expression in wild-type mice, AAV8-RGX-DYS1 at 3 × 10 14 and 5 x 10 14 Mdx mice receiving GC / kg showed significantly higher RGX-DYS1 microdystrophin expression in the gastrocnemius muscle, diaphragm, and heart.

[0228] Overall, the presence of RGX-DYS1 micro-dystrophin protein in muscles from AAV8-RGX-DYS1-treated mdx mice was consistent with the detection of vector DNA levels. Despite the fact that RGX-DYS1 vector DNA levels across all muscles were comparable in each dose group, RGX-DYS1 micro-dystrophin expression in cardiac tissue was generally higher than that in gastrocnemius and diaphragm, whereas expression in gastrocnemius and diaphragm was generally comparable.

[0229] In this study, the minimal effective dose after IV administration of AAV8-RGX-DYS1 to mdx mice is currently 1 × 10 14 GC / kg, based on significant improvements in muscle function as measured by fine motor kinematic gait analysis and improved muscle preservation as measured by MRI.

[0230] 6.7 Example 7: 26-Week Pharmacology Study in mdx Mice The long-term bioactivity of RGX-DYS1 was evaluated in mdx mice after a single IV injection.

[0231] Groups of male mdx mice (n=10 per group) received a single IV injection of RGX-DYS1 at 0 (vehicle), 3 × 10 13 , 1×10 14 , 3×10 14 , or 5 × 10 14 GC / kg. An additional group of wild-type mice (C57BL / 10ScSn) was included as a control. Animals were euthanized 26 weeks after dosing. The following parameters and endpoints were included: mortality, clinical observations, weekly body weight, in vivo muscle function (grip strength at weeks 6, 9, 17, and 26, automated gait analysis at weeks 9, 17, and 26), biomarkers (T2-MRI imaging at weeks 6, 17, and 26, and CK from serum at weeks 17 and 26), biodistribution (vector DNA), transgene expression (protein), macroscopic examination, tissue weight, and histopathology, including spermatogenesis and muscle pathology.

[0232] The long-term efficacy of RGX-DYS1 in mdx mice after a single IV injection and the long-term toxicity of RGX-DYS1 in relevant models of DMD were also examined.

[0233] Groups of mdx male mice (n=10 per group per time point) received a single IV injection of RGX-DYS1 at 0 (vehicle), 3x10 13 , 1×10 14 , 3×10 14 , or 5 × 10 14 GC / kg. An additional group of wild-type mice (C57BL / 10ScSn) was included as a control. Animals were sacrificed 26 weeks after treatment. The following parameters and endpoints were included: mortality, clinical observations, grip strength, gait analysis, MRI, creatine kinase (CK) analysis, weekly body weights, gross examination, tissue weights, and histopathology including spermatogenesis.

[0234] Figure 21 shows the weight results confirmed in the study. Lower mean weights > 3 x 10 14 This was observed in mdx mice administered RGX-DYS1 at 1000 mg / kg. There is a statistical difference between wild-type and vehicle-controlled mdx mice, with higher body weights observed in mdx mice up to 13 weeks. Pre-sacrifice deaths at 26 weeks were observed in each group of mice administered the human micro-dystrophin protein, RGX-DYS1, delivered via gene therapy, and were caused by hydrocephalus.

[0235] At week 17, representative images of muscles were obtained using T2-magnetic resonance imaging to assess the development of muscle lesions (Figure 22). Lesions were observed in vehicle-treated, 3x10 13 GC / Kg and 1×10 14 Indicated by arrow in mice receiving GC / kg. 3 × 10 14 or 5×10 14 In mice receiving a dose of RGX-DYS1 of GC / kg, no lesions or at least significantly reduced lesions were observed. At 26 weeks, representative images of muscle were obtained again using T2-magnetic resonance imaging (Figure 23). Lesions were observed in the vehicle-treated, 3x10 13 GC / Kg and 1×10 14 Indicated by arrow in mice receiving GC / kg. 3 × 10 14 or 5×10 14 No lesions, or at least significantly reduced lesions, were observed in mice receiving the GC / kg AAV8-RGX-DYS1 dose.

[0236] Figures 24A and 24B also show an analysis of MRI results at weeks 6, 17, and 26, showing gastrocnemius muscle volume (A) and changes in observed hyperintense lesions (% lesion) (B). Data are expressed as mean ± SEM. Statistical significance: ****p<0.0001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak's post-hoc); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. mdx vehicle (mixed-effects model ANOVA, Dunnett's post-hoc). Compared to vehicle control mice, treatment with RGX-DYS1 resulted in a reduction in muscle volume and lesions at all time points. Higher doses of RGX-DYS1 performed better than lower doses.

[0237] Figures 25A and 25B show T2 time - % lesion (A) and T2 time - % non-lesion (B) at weeks 6, 17, and 26. Data are expressed as mean ± SEM. Statistical significance: **p<0.01, ****p<0.0001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak's post-hoc); *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 vs. mdx vehicle (mixed effects model ANOVA, Dunnett's post-hoc). In general, higher doses (3x10 14 or 5×10 14 GC / kg) provided better results compared to vehicle control mice.

[0238] Gait analysis was performed at weeks 6, 17, and 26. As shown in Figure 26, clear differences in fine motor kinematic gait analysis were observed between vehicle control mdx mice and wild-type controls at week 9 and continued at all other time points. At week 9, a dose-related improvement in total gait score was observed in RGX-DYS1-treated mdx mice compared to vehicle controls at doses ≥ 3 x 10 13 Expressed as GC / kg, dose ≥ 3 × 10 14 Ambulation scores at GC / kg were similar to those of wild-type mice (Figure 26). At 17 weeks, ≥ 3 x 10 14At week 26, there was an improvement in walking score at doses of 1 x 10 14 Observed in GC / kg, ≥ 3 × 10 14 This was more evident in GC / kg.

[0239] In patients with DMD, CK is significantly elevated compared to the normal range and has diagnostic value. Furthermore, maximum serum CK activity is usually observed between 2 and 5 years of age in DMD and progressively declines as the disease progresses. Kim et al., Ann. Rehabil. Med. 41:306-312 (2017). Figure 27 shows that treatment with AAV8-RGX-DYS1 significantly reduced CK concentrations compared to vehicle-treated controls. Data are expressed as mean ± SEM. Statistical significance: ****p<0.0001 vs. wild-type vehicle (repeated measures (RM) two-way analysis of variance (ANOVA), Sidak's post-hoc); ***p<0.001 vs. mdx vehicle, ****p<0.0001 (mixed-effects model ANOVA, Dunnett's post-hoc). High dose (3 × 10 14 or 5×10 14 In GC / kg)-treated mice, CK concentrations were similar to those in wild-type control mice.

[0240] Figure 28 shows grip strength in different groups of mice at weeks 9, 17, and 26. No difference was evident in grip strength in vehicle control mdx mice when compared to wild type.

[0241] To evaluate the effects of RGX-DYS1 on dystrophic pathology, muscle tissues (diaphragm, heart, and gastrocnemius) were collected and analyzed at the end of the study (32–33 weeks of age). Fibrosis (collagen accumulation) in the extracellular matrix is ​​a hallmark of DMD (Kharraz et al., 2014). Notably, the diaphragm in mdx mice was severely affected, closely resembling DMD pathology with progressive muscle fiber degeneration and concomitant connective tissue infiltration (Lynch et al., 1997; Swiderski and Lynch, 2021). As expected, vehicle-control mdx mice showed increased amounts of fibrosis in the diaphragm compared to wild-type controls, as measured by Masson's Trichrome staining (Figure 29A). Notably, accumulated fibrosis was observed in the gastrocnemius muscle and heart of vehicle-controlled mdx mice, as previously reported (Coley et al., 2016; Shin et al., 2011), but was relatively very low compared to the diaphragm (less than 3% in skeletal and cardiac muscle compared to 16.8% in the diaphragm). Administration of RGX-DYS1 in mdx mice resulted in a reduction in the amount of fibrosis (p>0.05) in all muscle tissues examined. Furthermore, the amount of fibrosis in the diaphragm was ≥1 × 10 14 The dose of GC / kg significantly decreased (p<0.05).

[0242] Increased inflammation was evident in the diaphragm (Figures 29B and E) and gastrocnemius muscle (Figure 29F) of vehicle-control mdx mice compared to wild-type controls. Inflammation was not evident in the heart of any animal, including vehicle mdx mice (Figure 29D). AAV8-RGX-DYS1-treated mdx mice had ≥1 x 10 inflammation compared to control vehicle mdx mice. 14 GC / kg significantly reduced the number of inflammatory cells in the diaphragm and gastrocnemius muscles.

[0243] Additionally, dystrophic pathology (regeneration, degeneration, fibrosis, and centrosome formation) was assessed in three muscle tissues by qualitative evaluation (manually scored) using the following manual scoring scale: 0 (normal), 1 (minimal), 2 (mild), 3 (marked), and 4 (severe).

[0244] As expected, dystrophic pathology of the diaphragm muscle was evident (marked to severe) in vehi...

Claims

1. 1. A pharmaceutical composition for use in treating a dystrophinopathy in a subject in need thereof, the pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharma- ceutical acceptable carrier; The rAAV particle comprises an artificial genome including an expression cassette, the expression cassette comprising a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, and R2 is the dystrophin cascade domain. R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine ​​rich region of dystrophin, CT comprises at least a portion of CT that includes an α1-syntrophin binding site, and is operably linked to regulatory elements that promote expression in muscle, said expression cassette being flanked by AAV ITR sequences; the rAAV particles are of the AAV8 serotype; The pharmaceutical composition, wherein the therapeutically effective amount of the rAAV particles is administered intravenously at a dose of 1×10 14 or 2×10 14 genome copies / kg.

2. 2. The pharmaceutical composition of claim 1, wherein the CT comprises or consists of: a) the proximal 194 amino acids of the C-terminus of dystrophin; or b) at least the proximal portion of the C-terminus corresponding to human dystrophin amino acid residues 3361-3554 of SEQ ID NO:92 (UniProtKB-P11532); or c) at least the proximal portion of the C-terminus encoded by exons 70-74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75.

3. The pharmaceutical composition of claim 1 , wherein the microdystrophin protein has the amino acid sequence of SEQ ID NO:

1.

4. 4. The pharmaceutical composition of claim 3, wherein the microdystrophin protein is encoded by the nucleotide sequence of SEQ ID NO:

20.

5. 2. The pharmaceutical composition of claim 1, wherein the microdystrophin protein has the amino acid sequence of SEQ ID NO:

79.

6. 6. The pharmaceutical composition of claim 5, wherein the microdystrophin protein is encoded by the nucleotide sequence of SEQ ID NO:

81.

7. The pharmaceutical composition of claim 1, wherein the muscle-specific promoter is SPc5-12 or a transcriptionally active portion or mutant thereof.

8. The pharmaceutical composition of claim 7 , wherein the promoter consists of the nucleic acid sequence of SEQ ID NO:

39.

9. The pharmaceutical composition of claim 1, wherein the transgene comprises a polyadenylation signal 3' of the nucleic acid sequence encoding the micro-dystrophin protein.

10. The pharmaceutical composition of claim 1 , wherein the artificial genome comprises the nucleic acid sequence of SEQ ID NO:

53.

11. The pharmaceutical composition of claim 1 , wherein the rAAV is an AAV8 serotype.

12. The pharmaceutical composition according to claim 1, wherein the dystrophinopathy is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or X-linked dilated cardiomyopathy.

13. The therapeutically effective amount of the rAAV particles is 1×10 １４ Genome copies / kg, or 2 x 10 １４ The pharmaceutical composition of claim 1 , administered intravenously at a dose of genome copies / kg.

14. The rAAV particles are AAV8-RGX-DYS1 and 1×10 １４ Genome copies / kg or 2 x 10 １４ The pharmaceutical composition of claim 1 , administered intravenously at a dose of genome copies / kg.

15. Within 12 weeks, 24 weeks, 1 year, or 2 years after said administration, a. creatine kinase activity in said subject is reduced 0.5-fold to 1.5-fold in said subject as compared to levels prior to said administration; b. the subject's lesions in the gastrocnemius muscle are reduced by 3-10% as assessed by magnetic resonance imaging (MRI) compared to the lesions in the gastrocnemius muscle prior to the administration; c. The subject's gastrocnemius muscle volume is increased by 20 to 100 mm compared to the gastrocnemius muscle volume before the administration. ３ Decreased, d. the T2 relaxation time of a lesion in the gastrocnemius muscle of the subject is decreased by 2-8 milliseconds compared to the T2 relaxation time before the administration; e. the subject exhibits a walking score of about -1 to 2; f. The subject's North Star Ambulatory Assessment (NSAA) score is increased from 0 to 1, 0 to 2, or 1 to 2, compared to the NSAA score before the administration. g. The amount of time it takes the subject to stand, run / walk 10 meters, and / or climb four flights of stairs is reduced by at least 5%, 10%, 20%, or 30%. h. the subject exhibits improved cardiac function compared to cardiac function prior to said administration; and / or i. The pharmaceutical composition of claim 1, wherein the subject exhibits improved pulmonary function as compared to pulmonary function prior to said administration.

16. 1. A pharmaceutical composition for use in reducing inflammation and / or fibrosis in muscle in a subject in need thereof, the pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharma- ceutical acceptable carrier; The rAAV particle comprises an artificial genome including an expression cassette, the expression cassette comprising a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, and R2 is the dystrophin chromosome 1 domain. R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine ​​rich region of dystrophin, CT comprises at least a portion of CT that includes an α1-syntrophin binding site, and is operably linked to regulatory elements that promote expression in muscle, said expression cassette being flanked by AAV ITR sequences; the rAAV particles are of the AAV8 serotype; the therapeutically effective amount of the rAAV particles is administered intravenously at a dose of 1×10 14 or 2×10 14 genome copies per kilogram (GC / kg); The pharmaceutical composition, wherein said administration results in delivery of said micro-dystrophin protein to said muscle of said subject.

17. 1. A pharmaceutical composition for use in reducing muscle degeneration in a subject in need thereof, the pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharma- ceutical acceptable carrier; The rAAV particle comprises an artificial genome including an expression cassette, the expression cassette comprising a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, and R2 is the dystrophin chromosome 1 domain. R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine ​​rich region of dystrophin, CT comprises at least a portion of CT that includes an α1-syntrophin binding site, and is operably linked to regulatory elements that promote expression in muscle, said expression cassette being flanked by AAV ITR sequences; the therapeutically effective amount of the rAAV particles is administered intravenously at a dose of 1×10 14 or 2×10 14 genome copies per kilogram (GC / kg); The pharmaceutical composition, wherein said administration results in delivery of said micro-dystrophin protein to said muscle of said subject.

18. 1. A pharmaceutical composition for use in treating a dystrophinopathy, reducing inflammation and / or fibrosis in muscle, reducing muscle degeneration, or altering gait in a subject in need thereof, the pharmaceutical composition comprising a therapeutically effective amount of rAAV particles and a pharma- ceutical acceptable carrier; The rAAV particle comprises an artificial genome including an expression cassette, the expression cassette comprising a transgene encoding a micro-dystrophin protein consisting of dystrophin domains arranged from amino terminus to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, and R2 is the dystrophin chromosome 1 domain. R1 is the spectrin 2 region of dystrophin, R2 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is the cysteine ​​rich region of dystrophin, CT comprises at least a portion of CT that includes an α1-syntrophin binding site, and is operably linked to regulatory elements that promote expression in muscle, said expression cassette being flanked by AAV ITR sequences; the rAAV particles are of the AAV8 serotype; the therapeutically effective amount of the rAAV particles is administered intravenously at a dose of 1×10 14 or 2×10 14 genome copies per kilogram (GC / kg); The pharmaceutical composition, wherein said administering results in delivery of micro-dystrophin protein to muscle of the subject, and optionally, said administering results in greater than 50 ng / mg of micro-dystrophin protein in muscle tissue of the subject 12 weeks after said administering as determined by a capillary-based Western assay.

19. 17. The pharmaceutical composition of claim 16, wherein the CT comprises or consists of: a) the proximal 194 amino acids of the C-terminus of dystrophin, b) or at least the proximal portion of the C-terminus corresponding to human dystrophin amino acid residues 3361-3554 of SEQ ID NO: 92 (UniProtKB-P11532), or c) at least the proximal portion of the C-terminus encoded by exons 70-74 and the first 36 amino acids of the amino acid sequence encoded by the nucleotide sequence of exon 75.

20. 17. The pharmaceutical composition of claim 16, wherein the microdystrophin protein has the amino acid sequence of SEQ ID NO:

1.

21. 21. The pharmaceutical composition of claim 20, wherein the microdystrophin protein is encoded by the nucleic acid sequence of SEQ ID NO:

20.

22. 22. The pharmaceutical composition of claim 21, wherein the transcriptional regulatory element comprises a muscle-specific promoter.

23. 23. The pharmaceutical composition of claim 22, wherein the promoter consists of the nucleic acid sequence of SEQ ID NO:

39.

24. The pharmaceutical composition of claim 16, wherein the artificial genome comprises the nucleotide sequence of SEQ ID NO:

53.

25. The pharmaceutical composition of claim 16, wherein the rAAV is an AAV8 serotype.

26. The therapeutically effective amount of the rAAV particles is 1×10 １４ Genome copies / kg or 2 x 10 １４ 17. The pharmaceutical composition of claim 16, administered intravenously at a dose of genome copies / kg.

27. The pharmaceutical composition of claim 1, further comprising prophylactically administering an immunosuppressant therapy to the subject prior to, concurrently with, and / or after the administration of the AAV particles.

28. 28. The pharmaceutical composition of claim 27, wherein the immunosuppressant therapy is prednisolone, eculizumab, or sirolimus, or a combination thereof.

29. A pharmaceutical composition comprising a therapeutically effective amount of recombinant adeno-associated vector (rAAV) particles and a pharma- ceutical acceptable carrier, wherein the rAAV particles are recombinant AAV8 comprising an artificial genome comprising the nucleotide sequence of SEQ ID NO:

53.

30. 30. The pharmaceutical composition of claim 29, wherein the pharma- ceutically acceptable carrier comprises modified Dulbecco's phosphate buffered saline (DPBS) supplemented with sucrose buffer (pH 7.4) containing 0.2 g / L potassium chloride, 0.2 g / L potassium phosphate monobasic, 1.2 g / L sodium phosphate dibasic anhydrous, 5.8 g / L sodium chloride, 40 g / L sucrose, and 0.01 g / L poloxamer 188.

31. A combination comprising an effective amount of oral prednisolone, an effective amount of eculizumab, and an effective amount of oral sirolimus, administered in combination with a pharmaceutical composition comprising recombinant adeno-associated vector (rAAV) particles, the rAAV comprising a micro-dystrophin transgene for the treatment of DMD, and the oral prednisolone, eculizumab, and oral sirolimus are administered before, simultaneously with, and / or after administration of the rAAV, thereby preventing or suppressing an immune response to the rAAV.

32. The combination of claim 31, wherein the oral prednisolone is administered from at least day 1, the day 1 being the day of administration of rAAV, and optionally the oral prednisolone is administered daily from day 1 through week 8.

33. The combination of claim 32, wherein the oral prednisolone is administered at 1 mg / kg / day from day 1 to the end of week 8, where day 1 is the day of administration of rAAV, then the dose is reduced to 0.5 mg / kg / day from week 9 to week 10 if no safety concerns are identified, and then the dose is reduced to 0.25 mg / kg / day from week 11 to week 12 if no safety concerns are identified.

34. The combination of claim 31, wherein the patient has been pre-treated with oral sirolimus, and optionally the oral sirolimus is administered from day -7 to week 8, with day 1 being the day of administration of rAAV.

35. The combination of claim 34, wherein the sirolimus is administered at a dose of 3 mg / m2 on day -7 and 1 mg / m2 / day divided into two doses each day from day -6 to week 8 to achieve a target blood concentration of 8-12 ng / mL, and if safety studies remain stable, the dose is reduced to 0.5 mg / m2 / day in weeks 9-10, and if safety studies remain stable, the dose is reduced to 0.25 mg / m2 / day in weeks 11-12.

36. The combination of claim 31, wherein four doses of eculizumab are administered by injection before, simultaneously with, and / or after administration of the rAAV, optionally including: (1) 600 mg of eculizumab on days -9, -2, 4, and 12 for subjects weighing 10 to <20 kg; (2) 800 mg of eculizumab on days -16, -9, -2, and 12 for subjects weighing 20 kg to <30 kg; (3) 900 mg of eculizumab on days -16, -9, -2, and 12 for subjects weighing 30 kg to <40 kg; and (4) 1200 mg of eculizumab on days -30, -23, -16, -9, -2, and 12 for subjects weighing 40 kg or more, where day 1 is the day of administration of rAAV.

37. The combination of claim 31, wherein the micro-dystrophin transgene encodes a micro-dystrophin protein consisting of dystrophin domains arranged from amino to carboxy terminus as follows: ABD-H1-R1-R2-R3-H3-R24-H4-CR-CT, where ABD is the actin-binding domain of dystrophin, H1 is the hinge 1 region of dystrophin, R1 is the spectrin 1 region of dystrophin, R2 is the spectrin 2 region of dystrophin, R3 is the spectrin 3 region of dystrophin, H3 is the hinge 3 region of dystrophin, R24 is the spectrin 24 region of dystrophin, H4 is the hinge 4 region of dystrophin, CR is a cysteine-rich region of dystrophin, and CT comprises at least a portion of CT comprising the α1-syntrophin binding site.

38. The rAAV is 1 x 10, 1.1 x 10, 1.2 x 10, 1.3 x 10, 1.4 x 10, 1.5 x 10, 1.6 x 10, 1.7 x 10, 1.8 x 10, 1.9 x 10, 2 x 10, 2.1 x 10, 2.2 x 10, 2.3 x 10, 2.4 x 10, 2.5 x 10, 2.6 x 10, 2.7 x 10, 2.8 x 10, 2.9 x 10, or 3 x 10.

32. The combination of claim 31 administered at a dose of genome copies / kg.

39. The rAAV is 1x10, 1.1x10, 1.2x10, 1.3x10, 1.4x10, 1.5x10, 1.6x10, 1.7x10, 1.8x10, 1.9x10, 2x10, 2.1x10, 2.2x10, 2.3x10, 2.4x10, 2.5x10, 2.6x10, 2.7x10, 2.8x10, 2.9x10, or 3x10.

38. The combination of claim 37 administered at a dose of genome copies / kg.

Images