Vestibular supporting cell promoter and uses thereof

Abstract

The present disclosure provides polynucleotides comprising the SLC6A14 promoter and vectors comprising the same, which can be used to promote expression of a transgene in vestibular supporting cells. The polynucleotides described herein can be operably linked to a transgene, such as a transgene encoding a protein of interest, thereby promoting vestibular supporting cell expression of the transgene. The polynucleotides described herein can be operably linked to a transgene and used to treat subjects who have or are at risk of developing vestibular dysfunction.

Description

[Technical field]

[0001] The present invention relates to compositions and methods for promoting the expression of a gene of interest in a particular cell type, such as a gene that promotes or enhances the function, regeneration, maturation, proliferation, or survival of hair cells or supporting cells.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated by reference in its entirety. The ASCII copy was created on April 28, 2022, is titled "51471-010WO2_Sequence_Listing_4_28_22_ST25", and is 41,804 bytes in size. [Background technology]

[0003] Vestibular dysfunction is a major public health problem that significantly impacts quality of life. Approximately 35% of adults over 40 years of age in the United States have balance disorders, and this rate increases dramatically with age, which leads to disruptions in daily activities, mood and cognitive decline, and increased prevalence in the elderly. Vestibular dysfunction is often acquired and has a variety of causes, including disease or infection, head trauma, ototoxic drugs, and aging. A common factor in the pathogenesis of vestibular dysfunction is damage to the vestibular hair cells of the inner ear. Thus, therapies aimed at restoring hair cell function would benefit patients suffering from vestibular dysfunction. Vestibular supporting cells are known to spontaneously differentiate into hair cells after injury and therefore may serve as suitable therapeutic targets to restore hair cell function. Summary of the Invention

[0004] The present invention provides compositions and methods for promoting expression of a gene of interest in a specific cell type, such as a gene that promotes or enhances the function, regeneration, maturation, proliferation, or survival of hair cells or supporting cells. The compositions and methods described herein relate to solute carrier family 6 member 14 (SLC6A14) promoter sequences that can be used to induce expression of a transgene in vestibular supporting cells (VSCs) of the inner ear. The SLC6A14 promoter sequences described herein can be operably linked to a transgene and administered to a patient to treat vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibular hypofunction, bilateral vestibular insufficiency, oscillopsia, or balance disorders). The SLC6A14 promoter sequences described herein exhibit high cell type specificity by inducing high expression of an operably linked transgene in vestibular supporting cells with much lower expression in other inner ear cell types, such as hair cells.

[0005] In a first aspect, the invention provides a nucleic acid vector comprising a polynucleotide having at least 85% sequence identity to SEQ ID NO:1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity). In some embodiments, the polynucleotide has at least 90% sequence to SEQ ID NO:1. In some embodiments, the polynucleotide has at least 95% sequence to SEQ ID NO:1. In some embodiments, the polynucleotide has the sequence of SEQ ID NO:1.

[0006] In some embodiments, the polynucleotide is operably linked to a transgene. In some embodiments, the transgene is a heterologous transgene. In some embodiments, the transgene encodes a protein (e.g., a therapeutic protein or a reporter protein), a short hairpin RNA (shRNA), an antisense oligonucleotide (ASO), a nuclease (e.g., CRISPR-associated protein 9 (Cas9), a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), or a guide RNA (gRNA)), or a microRNA. In some embodiments, the transgene encodes a protein.

[0007] In some embodiments, the polynucleotide induces vestibular supporting cell (VSC)-specific expression of a protein (e.g., a therapeutic protein or a reporter protein), shRNA, ASO, nuclease, or microRNA in a mammalian VSC. In some embodiments, the VSC is a human VSC.

[0008] In some embodiments, the protein encoded by the transgene operably linked to the polynucleotide is selected from the group consisting of spalt-like transcription factor 2 (Sall2), calmodulin-binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2 group F member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3). , Nescient helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4), zinc finger MIZ-Type containing 1 (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-associated high mobility group box (Tox), Prospero homeobox 1 (Prox1), nuclear factor IA (Nfia), thyroid hormone receptor receptor β (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), lysine demethylase 5A (Kdm5a), cAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), paternally expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISL·LIM homeobox 1 (Isl1), zinc finger and BTB domain containing 38 (Zbtb38), limb bud and heart development (Lbh), TubbyBipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / Knotted 1 homeobox 2 (Pknox2), AT-rich interacting domain 3B (Arid3b), MLX interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), spalt-like transcription factor 1 (Sall1), SIX homeobox These include Six2, Spalt-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), Regulatory factor X7 (Rfx7), Brain-derived neurotrophic factor (Bdnf), Growth factor-independent 1 transcriptional repressor (Gfi1), POU class 4 homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), Atuned BHLH transcription factor 1 (Atoh1), or Atoh1 mutant.

[0009] In some embodiments, the protein encoded by the transgene operably linked to the polynucleotide is Atoh1 or an Atoh1 variant. In some embodiments, the Atoh1 variant has one or more amino acid substitutions selected from the group consisting of S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334 compared to SEQ ID NO:4. In some embodiments, the protein is Atoh1 (e.g., human Atoh1). In some embodiments, the Atoh1 protein comprises the sequence of SEQ ID NO:4 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, the Atoh1 protein comprises the sequence of SEQ ID NO:6 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) amino acids of the Atoh1 protein variant are conservative amino acid substitutions. In some embodiments, the Atoh1 protein has the sequence of SEQ ID NO:4. In some embodiments, the Atoh1 protein is encoded by the sequence of SEQ ID NO:5. In some embodiments, the Atoh1 protein has the sequence of SEQ ID NO:6. In some embodiments, the Atoh1 protein is encoded by the sequence of SEQ ID NO:7.

[0010] In some embodiments, the nucleic acid vector further comprises an inverted terminal repeat (ITR). In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene, the nucleic acid vector comprises a first ITR sequence 5' of the polynucleotide and a second ITR sequence 3' of the transgene. In some embodiments, the ITR is an AAV2 ITR. In some embodiments, the ITR has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to the AAV2 ITR.

[0011] In some embodiments, the nucleic acid vector further comprises a polyadenylation (poly(A)) sequence. In some embodiments, the poly(A) sequence is the bovine growth hormone (bGH) poly(A) signal sequence. In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene, the poly(A) sequence is located 3' of the transgene. In embodiments where the nucleic acid vector comprises a first and second ITR sequence and a polynucleotide of the invention operably linked to a transgene, the poly(A) sequence is located 3' of the transgene and 5' of the second ITR sequence.

[0012] In some embodiments, the nucleic acid vector further comprises a woodchuck post-transcriptional regulatory element (WPRE). In some embodiments, the WPRE has the sequence of SEQ ID NO:8 or SEQ ID NO:9. In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene, the WPRE is located 3' of the transgene. In embodiments where the nucleic acid vector comprises a polynucleotide of the invention and a poly(A) sequence operably linked to a transgene, the WPRE is located 3' of the transgene and 5' of the poly(A) sequence.

[0013] In some embodiments, the nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 219 to 3831 of SEQ ID NO:10. In some embodiments, the nucleic acid vector comprises a polynucleotide sequence comprising the sequence of nucleotides 219 to 3822 of SEQ ID NO:11.

[0014] In some embodiments, the nucleic acid vector of the present invention comprises a SLC6A14 promoter (e.g., the polynucleotide of SEQ ID NO: 1) operably linked to a polynucleotide sequence encoding human Atoh1 (human ATOH1 protein=RefSeq Accession No. NP_005163 (SEQ ID NO: 4), mRNA sequence=RefSeq Accession No. NM_005172). In some further specific embodiments, the nucleic acid vector of the present invention comprises a SLC6A14 promoter of SEQ ID NO: 1 operably linked to a polynucleotide sequence encoding human Atoh1 (e.g., a polynucleotide sequence encoding SEQ ID NO: 4, e.g., a polynucleotide sequence of SEQ ID NO: 5). In some further specific embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat, a SLC6A14 promoter of SEQ ID NO: 1, a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter, a polyadenylation sequence, and a second inverted terminal repeat. In some further specific embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO: 1, a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter, a WPRE, a polyadenylation sequence, and a second inverted terminal repeat. In some further specific embodiments, the nucleic acid vector comprises nucleotides 219 to 3831 of SEQ ID NO: 10 flanked by the inverted terminal repeats.In further certain embodiments, the nucleic acid vector comprises nucleotides 219-3831 of SEQ ID NO:10 flanked by inverted terminal repeats, wherein the 5' inverted terminal repeats have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 162%, 163%, 164%, 165%, 166%, 167%, 168%, 169%, 170%, 171%, 1 5%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 3919 to 4048 of SEQ ID NO:10, and the 3' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 3919 to 4048 of SEQ ID NO:10.

[0015] In some embodiments, the nucleic acid vector of the present invention comprises an SLC6A14 promoter (e.g., the polynucleotide of SEQ ID NO: 1) operably linked to a polynucleotide sequence encoding mouse Atoh1 (mouse ATOH1 protein=UniProt P48985 (SEQ ID NO: 6), mRNA sequence=RefSeq accession number NM_007500.5). In some further specific embodiments, the nucleic acid vector of the present invention comprises an SLC6A14 promoter of SEQ ID NO: 1 operably linked to a polynucleotide sequence encoding mouse Atoh1 (e.g., the polynucleotide sequence encoding SEQ ID NO: 6, e.g., the polynucleotide sequence of SEQ ID NO: 7). In some further specific embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO: 1, a polynucleotide sequence encoding mouse Atoh1 operably linked to the SLC6A14 promoter, a polyadenylation sequence, and a second inverted terminal repeat. In some further specific embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO: 1, a polynucleotide sequence encoding mouse Atoh1 operably linked to the SLC6A14 promoter, a WPRE, a polyadenylation sequence, and a second inverted terminal repeat. In some further specific embodiments, the nucleic acid vector comprises nucleotides 219 to 3822 of SEQ ID NO: 11 flanked by the inverted terminal repeats.In further certain embodiments, the nucleic acid vector comprises nucleotides 219-3822 of SEQ ID NO:11 flanked by inverted terminal repeats, wherein the 5' inverted terminal repeats have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109%, 1101, 1102, 1103, 11104, 1 ... 5%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 3910 to 4039 of SEQ ID NO:11, and the 3' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 3910 to 4039 of SEQ ID NO:11.

[0016] In some embodiments, the nucleic acid vector is a viral vector, a plasmid, a cosmid, or an artificial chromosome. In some embodiments, the nucleic acid vector is a viral vector selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S capsid. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has an AAV6 capsid. In some embodiments, the AAV vector has an AAV8 capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has an Anc80L65 capsid. In some embodiments, the AAV vector has a DJ / 9 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has an AAV2 capsid. In some embodiments, the AAV vector has a PHP.B capsid. In some embodiments, the AAV vector has an AAV2quad(YF) capsid. In some embodiments, the AAV vector has a PHP.S capsid. In some embodiments, the AAV vector has a PHP.eB capsid. In some embodiments, the AAV vector has an AAV3 capsid. In some embodiments, the AAV vector has an AAV4 capsid. In some embodiments, the AAV vector has an AAV5 capsid. In some embodiments, the AAV vector has an AAV7 capsid.

[0017] Those skilled in the art will appreciate that the creation of the viral vectors of the invention typically requires the use of the plasmids of the invention together with auxiliary plasmids that provide elements required for proper viral packaging and viability (e.g., in the case of AAV, plasmids providing the appropriate AAV rep, cap, and other genes, e.g., E2A and E4). Combination of these plasmids in a producer cell line creates a viral vector. However, those skilled in the art will appreciate that any given pair of inverted terminal repeat sequences in a transfer plasmid of the invention is used to create a viral vector, and that the corresponding sequences in the viral vector may be altered due to the ITRs adopting a "flip" or "flop" orientation during genetic recombination. Thus, the sequences of the ITRs in a transfer plasmid are not necessarily the same as those found in the viral vector prepared therefrom.

[0018] In another aspect, the present invention provides a composition comprising the nucleic acid vector of the present invention. In some embodiments, the composition further comprises a pharma- ceutically acceptable carrier, diluent, or excipient.

[0019] In another aspect, the invention provides a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 1 operably linked to a transgene. In some embodiments, the polynucleotide has the sequence of SEQ ID NO:1.

[0020] In some embodiments, the transgene is a heterologous transgene.In some embodiments of the above aspect, the transgene encodes a protein (e.g., a therapeutic protein or a reporter protein), shRNA, ASO, a nuclease (e.g., Cas9, TALEN, ZFN, or gRNA) or a microRNA.In some embodiments, the transgene encodes a protein.

[0021] In some embodiments, the protein is selected from the group consisting of Sox9, Sall2, Camta1, Hey2, Gata2, Hey1, Lass2, Sox10, Gata3, Cux1, Nr2f1, Hes1, Rorb, Jun, Zfp667, Lhx3, Nhlh1, Mxd4, Zmiz1, Myt1, Stat3, Barhl1, Tox, Prox1, Nfia, Thrb, Mycl1, Kdm5a, Creb314, Etv1, Peg3, Bach2, Isl1, Zbtb38, Lbh, Tub, Hmg20, Rest, Zfp827, Aff3, Pk Nox2, Arid3b, Mlxip, Zfp532, Ikzf2, Sall1, Six2, Sall3, Lin28b, Rfx7, Bdnf, Gfi1, Pou4f3, Myc, Ctnnb1, Sox2, Sox4, Sox11, Tead2, Atoh1, or an Atoh1 mutant (e.g., an Atoh1 mutant having one or more amino acid substitutions selected from the group consisting of S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334). In some embodiments, the protein is Atoh1 (e.g., human Atoh1). In some embodiments, the Atoh1 protein comprises the sequence of SEQ ID NO:4 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, 10% or less (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less) amino acids of the Atoh1 protein variant are conservative amino acid substitutions. In some embodiments, the Atoh1 protein has the sequence of SEQ ID NO:4. In some embodiments, the Atoh1 protein is encoded by the sequence of SEQ ID NO:5.

[0022] In another aspect, the invention provides a cell (e.g., a mammalian cell, a human cell, such as a VSC) comprising a polynucleotide or nucleic acid vector of any of the preceding aspects and embodiments. In some embodiments, the cell is a mammalian VSC. In some embodiments, the mammalian VSC is a human VSC. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1.

[0023] In another aspect, the invention provides a method of expressing a transgene in a mammalian VSC by contacting the mammalian VSC with a nucleic acid vector or composition of any of the preceding aspects and embodiments. In some embodiments, the transgene is specifically expressed in the VSC (e.g., expressed in at least 2-fold, 5-fold, 10-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold or more of the VSC than in one or more other inner ear cells (e.g., hair cells) in which expression is observed). In some embodiments, the mammalian VSC is a human VSC.

[0024] In another aspect, the present invention provides a method for treating a subject having or at risk of developing a vestibular dysfunction by administering an effective amount of a nucleic acid vector or composition of any of the above aspects and embodiments to the inner ear of the subject. In some embodiments, the vestibular dysfunction is dizziness, vertigo, imbalance, bilateral vestibular hypofunction (also known as bilateral vestibular dysfunction), oscillopsia, or balance disorder. In some embodiments, the vestibular dysfunction is age-related vestibular dysfunction, head trauma vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic drug-induced vestibular dysfunction. In some embodiments, the vestibular dysfunction is associated with a genetic mutation. In some embodiments, the vestibular dysfunction is idiopathic vestibular dysfunction.

[0025] In another aspect, the invention provides a method of inducing or enhancing vestibular hair cell regeneration in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0026] In another aspect, the invention provides a method of inducing or enhancing proliferation of VSCs in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0027] In another aspect, the invention provides a method of inducing or enhancing vestibular hair cell proliferation in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0028] In another aspect, the invention provides a method of inducing or enhancing maturation of vestibular hair cells in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments, hi some embodiments, the vestibular hair cells are regenerated vestibular hair cells.

[0029] In another aspect, the invention provides a method of increasing or enhancing survival of VSCs in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0030] In another aspect, the invention provides a method of increasing or enhancing vestibular hair cell survival in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0031] In another aspect, the invention provides a method of inducing or enhancing vestibular hair cell innervation in a subject in need thereof by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0032] In some embodiments of any of the aforementioned aspects, the subject has or is at risk of developing vestibular dysfunction (e.g., dizziness, vertigo, disequilibrium, bilateral vestibular hypofunction (bilateral vestibular insufficiency), oscillopsia, or balance disorders).

[0033] In another aspect, the invention provides a method of treating a subject having or at risk of developing bilateral vestibular hypofunction by administering to the inner ear of the subject an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments, hi some embodiments, the bilateral vestibular hypofunction is ototoxic drug-induced bilateral vestibular hypofunction.

[0034] In some embodiments of any of the aforementioned aspects, the ototoxic agent is selected from the group consisting of an aminoglycoside, an antitumor agent, ethacrynic acid, furosemide, a salicylate, and a quinine.

[0035] In another aspect, the invention provides a method of treating a subject having or at risk of developing oscillopsia by administering to the subject's inner ear an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0036] In another aspect, the invention provides a method of treating a subject having or at risk of developing a balance disorder (e.g., disequilibrium) by administering to the subject's inner ear an effective amount of a nucleic acid vector or composition of any of the preceding aspects and embodiments.

[0037] In some embodiments of any of the aforementioned aspects, the method further comprises assessing vestibular function of the subject prior to administering the nucleic acid vector or composition. In some embodiments of any of the aforementioned aspects, the method further comprises assessing vestibular function of the subject after administering the nucleic acid vector or composition.

[0038] In some embodiments of any of the foregoing aspects, the nucleic acid vector or composition is administered locally. In some embodiments, the nucleic acid vector or composition is administered to the semicircular canal. In some embodiments, the nucleic acid vector or composition is administered transtympanically or intratympanically (e.g., via transtympanic or intratympanic injection). In some embodiments, the nucleic acid vector or composition is administered to the perilymph or endolymph, e.g., through the oval window, round window, or semicircular canal (e.g., the horizontal semicircular canal), e.g., to vestibular supporting cells. In some embodiments, the nucleic acid vector or composition of the invention is administered to the perilymph. In some embodiments, the nucleic acid vector or composition of the invention is administered to the endolymph. In some embodiments, the nucleic acid vector or composition of the invention is administered to the oval window or through the oval window. In some embodiments, the nucleic acid vector or composition of the invention is administered to the round window or through the round window.

[0039] In some embodiments of any of the foregoing aspects, the nucleic acid vector or composition is administered in an amount sufficient to prevent or reduce vestibular dysfunction, delay the onset of vestibular dysfunction, delay the progression of vestibular dysfunction, improve vestibular function, increase vestibular hair cell number, improve vestibular hair cell maturation, increase vestibular hair cell proliferation, improve vestibular hair cell regeneration, improve vestibular hair cell innervation, increase VSC proliferation, or increase VSC number.

[0040] In some embodiments of any of the aforementioned aspects, the subject is a human. In another aspect, the present invention provides a kit comprising a nucleic acid vector of the invention or a composition of the invention.

[0041] definition As used herein, "administration" refers to providing or giving a therapeutic agent (e.g., a nucleic acid vector comprising a solute carrier family 6 member 14 (SLC6A14) promoter operably linked to a transgene) to a subject by any effective route.Exemplary administration routes are described herein below.

[0042] As used herein, the phrase "administering to the inner ear" refers to providing or giving a therapeutic agent described herein to a subject by any route that allows for the introduction of inner ear cells. Exemplary routes of administration to the inner ear include administration to the perilymph or endolymph, e.g., to or through the oval window, round window, or semicircular canal (e.g., the horizontal semicircular canal), or administration to the vestibule, e.g., vestibular supporting cells, e.g., by transtympanic or intratympanic injection.

[0043] As used herein, the term "cell type" refers to a group of cells that share a statistically separable phenotype based on gene expression data. For example, cells of a common cell type may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation properties. Cells of a common cell type may include cells isolated from a common tissue (e.g., epithelial, nervous, connective, or muscle tissue) and / or a common organ, tissue system, blood vessel, or other structure and / or region within an organism.

[0044] As used herein, the terms "conservative mutation," "conservative substitution," and "conservative amino acid substitution" refer to the substitution of one or more amino acids with one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and stereochemical volume. These properties are summarized in Table 1 below for each of the 20 naturally occurring amino acids.

[0045] [Table 1-1]

[0046] [Table 1-2]

[0047] As used herein, the terms "effective amount", "therapeutically effective amount" and "sufficient amount" of a composition, vector construct, or viral vector described herein refer to an amount sufficient to produce beneficial or desired results, including clinical results, when administered to a subject, including a mammal, e.g., a human, and thus the "effective amount" or its synonyms depend on the context in which it is applied. For example, with respect to the treatment of vestibular dysfunction, it is the amount of the composition, vector construct, or viral vector sufficient to achieve a therapeutic response compared to the response obtained without administration of the composition, vector construct, or viral vector. The amount of a given composition described herein that corresponds to such an amount will vary depending on various factors, such as the given drug, pharmaceutical formulation, route of administration, type of disease or disorder, characteristics of the subject (e.g., age, sex, weight) or host to be treated, but can nevertheless be routinely determined by one of skill in the art. Also, as used herein, a "therapeutically effective amount" of a composition, vector construct, or viral vector of the present disclosure is an amount that produces beneficial or desired results in a subject compared to a control. As defined herein, a therapeutically effective amount of a composition, vector construct, or viral vector of the present disclosure can be readily determined by one of ordinary skill in the art by routine methods known in the art. Dosage regimens may be adjusted to provide the optimal therapeutic response.

[0048] As used herein, the term "endogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human vestibular supporting cell).

[0049] As used herein, the term "express" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., splicing, editing, 5' capping, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0050] As used herein, the term "exogenous" refers to a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not naturally found in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human vestibular supporting cell). Exogenous material includes materials provided from an external source to an organism or a culture extracted therefrom.

[0051] As used herein, the term "exon" refers to a region in the coding region of a gene whose nucleotide sequence determines the amino acid sequence of the corresponding protein. The term exon also refers to the corresponding region of the RNA transcribed from the gene. Exons are transcribed into pre-mRNA and are included in the mature mRNA of the gene depending on alternative splicing. The exons included in the mature mRNA after processing are translated into proteins, where the sequence of the exon determines the amino acid composition of the protein.

[0052] As used herein, the term "heterologous" refers to a combination of elements that do not occur in nature. For example, a heterologous transgene refers to a transgene that is not naturally expressed by the promoter to which it is operably linked.

[0053] As used herein, the terms "increase" and "decrease" refer to modulation that results in a greater or lesser amount of a metric of function, expression, or activity, respectively, compared to a reference. For example, following administration of a composition in the manner described herein, the amount of a metric marker described herein (e.g., expression of a transgene) may be increased or decreased in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more relative to the amount of the marker before administration. Generally, the metric is measured at a time when administration produces the described effect, e.g., at least 1 week, 1 month, 3 months, or 6 months after starting a treatment regimen.

[0054] As used herein, "local" or "local administration" refers to administration at a particular site in the body for a local effect rather than a systemic effect. Examples of local administration are onto the skin of a subject, inhalation, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intralesional administration, administration to lymph nodes, intratumor administration, administration to the middle or inner ear, and administration to mucous membranes, where administration is intended to produce a local effect rather than a systemic effect.

[0055] As used herein, the term "operably linked" refers to a first molecule being bound to a second molecule, where the first molecule is positioned such that it affects the function of the second molecule. The two molecules may or may not be part of a single, unbroken molecule, and may or may not be adjacent. For example, a promoter is operably linked to a transcribable polynucleotide molecule of interest if the promoter regulates the transcription of the transcribable polynucleotide molecule of interest in a cell. Furthermore, two parts of a transcriptional regulatory element are operably linked to each other if they are linked such that the transcriptional activation function of one part is not adversely affected by the presence of the other part. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or operably linked to each other without the presence of an intervening nucleotide.

[0056] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule into which additional DNA segments can be ligated. A plasmid is a type of vector, a nucleic acid molecule that can transport another nucleic acid to which it is linked. Certain plasmids are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Certain plasmids can induce the expression of genes to which they are operably linked.

[0057] As used herein, the term "polynucleotide" refers to a polymer of nucleosides. Generally, polynucleotides are composed of nucleosides found naturally in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) linked by phosphodiester bonds. The term encompasses molecules containing nucleosides or nucleoside analogs with chemically or biologically modified bases, modified backbones, and the like, whether or not found in natural nucleic acids, and such molecules may be preferred for certain applications. When the application refers to polynucleotides, it is understood that both DNA, RNA, and in each case both single-stranded and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, "polynucleotide sequence" can refer to the polynucleotide material itself and / or to sequence information (i.e., a series of letters used as abbreviations for bases) that biochemically characterize a particular nucleic acid. Polynucleotide sequences presented herein are presented in the 5' to 3' orientation unless otherwise indicated.

[0058] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase promotes transcription of the transgene. "Percentage of sequence identity" to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity. Alignment for the purpose of measuring percentage nucleic acid or amino acid sequence identity can be accomplished in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software, such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithm required to obtain maximum alignment over the full length of the sequences being compared. For example, percentage sequence identity values ​​can be generated using the sequence comparison computer program BLAST. As an example, the percentage sequence identity of a given nucleic acid or amino acid sequence A to a given nucleic acid or amino acid sequence B (alternatively, it can be expressed that a given nucleic acid or amino acid sequence A has a certain percentage of sequence identity to a given nucleic acid or amino acid sequence B) is calculated as follows:

[0059] 100×(fraction X / Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in a programmatic alignment of A and B, and Y is the total number of nucleic acids in B. If the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence identity of A to B will not be equal to the percent sequence identity of B to A.

[0060] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharma- ceutically acceptable excipients, diluents, and / or carriers, for administration to a subject, such as a mammal, e.g., a human, to prevent, treat, or control a particular disease or condition that affects or may affect the subject.

[0061] As used herein, the term "pharmacologically acceptable" refers to compounds, substances, compositions, and / or dosage forms that are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human), without undue toxicity, irritation, allergic response, and other problematic adverse effects, and with a reasonable benefit / risk ratio.

[0062] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a gene of interest. Transcriptional regulatory elements can include promoters, enhancers, and other nucleic acids (e.g., polyadenylation signals) that control or help control gene transcription. Examples of transcriptional regulatory elements are described, for example, in Lorence, Recombinant Gene Expression: Reviews and Protocols (Humana Press, New York, NY, 2012).

[0063] As used herein, the term "transfection" refers to any of a wide variety of techniques commonly used for the introduction of foreign DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, Nucleofection, squeezeporation, sonoporation, optical transfection, magnetofection, imparefection, and the like.

[0064] As used herein, the terms "subject" and "patient" refer to an animal (e.g., a mammal, such as a human). The subject treated according to the methods described herein may be a subject diagnosed with vestibular dysfunction (e.g., dizziness, vertigo, or imbalance) or at risk of developing these conditions. Diagnosis may be performed by any method or technique known in the art. One of ordinary skill in the art will understand that the subject treated according to the present disclosure may have undergone standard testing or may not have undergone testing but has been identified as at risk due to the presence of one or more risk factors associated with a disease or condition.

[0065] As used herein, the terms "transduction" and "transducing" refer to a method of introducing a vector construct or a portion thereof into a cell. When the vector construct is contained in a viral vector, such as, for example, an AAV vector, transduction refers to viral infection of a cell and the subsequent transfer and integration of the vector construct or a portion thereof into the cellular genome.

[0066] As used herein, "treatment" and "treating" in reference to a disease or condition refer to an approach to obtain a beneficial or desired result, e.g., a clinical result. Beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, whether detectable or undetectable; reduction in the extent of the disease or condition; stabilization of the state of the disease, disorder, or condition (i.e., not worsening); prevention of the spread of the disease or condition; delaying or slowing the progression of the disease or condition; amelioration or palliative relief of the disease or condition; and remission (partial or complete). "Ameliorating" or "palliative relief" of a disease or condition means reducing the extent and / or undesirable clinical manifestations of the disease, disorder, or condition and / or slowing or prolonging the time course of progression compared to the extent or time course in the absence of treatment. "Treatment" can also mean prolonging survival compared to the expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.

[0067] As used herein, the term "vector" includes nucleic acid vectors, e.g., DNA vectors such as plasmids, cosmids, or artificial chromosomes, RNA vectors, viruses, or any other suitable replicon (e.g., viral vectors). A variety of vectors have been developed to deliver polynucleotides encoding foreign proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, Massachusetts, 2006). Expression vectors suitable for use in the compositions and methods described herein include polynucleotide sequences and additional sequence elements used, for example, for protein expression and / or integration of these polynucleotide sequences into the genome of mammalian cells. Particular vectors that can be used to express the transgenes described herein include vectors that include regulatory sequences such as promoter and enhancer regions that direct gene transcription. Other useful vectors for expression of transgenes include polynucleotide sequences that enhance the translation rate of the transgene or improve the stability or nuclear export of mRNA resulting from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites to induce efficient transcription of genes incorporated on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also include a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0068] As used herein, the terms "vestibular supporting cells" and "VSCs" refer to a population of unique epithelial cells in the vestibular system of the inner ear that are involved in the development, survival, function, death, and phagocytosis of vestibular hair cells. VSCs support the structure of vestibular hair cells by anchoring them to the sensory epithelium and releasing neurotrophic factors important for hair cell innervation.

[0069] As used herein, the term "vestibular supporting cell-specific expression" or "VSC-specific expression" refers to the production of RNA transcripts or polypeptides primarily in vestibular supporting cells compared to other cell types of the inner ear (e.g., vestibular hair cells, cochlear hair cells, cochlear supporting cells, glia, or other inner ear cell types). VSC expression of a transgene can be confirmed by comparing the expression of the transgene (e.g., RNA or protein expression) among various cell types of the inner ear (e.g., VSCs versus non-VSCs) using any standard technique (e.g., quantitative RT PCR, immunohistochemistry, Western blot analysis, or fluorescence measurement of a reporter (e.g., GFP) operably linked to a promoter). Promoters that drive VSC-specific expression ("VSC-specific promoters") are selected from at least three of the following inner ear cell types: vestibular ganglion cells, nonsensory epithelial cells of the vestibular apparatus, dark cells of the vestibular apparatus, mesenchymal cells of the vestibular apparatus, spiral ganglion cells, border cells, inner phalangeal cells, inner pillar cells, outer pillar cells, first row Deiters cells, second row Deiters cells, third row Deiters cells, Hensen cells, Claudius cells, inner sulcus cells, outer sulcus cells, spiral ridge cells, root cells, interdental cells, basal cells of the stria vascularis, intermediate cells of the stria vascularis, marginal cells of the stria vascularis, inner ear hair cells, outer hair cells, vestibular hair cells, and Schwann cells. A promoter that (i) induces expression (e.g., RNA or protein expression) of a transgene to which it is operably linked and the induced expression is at least 50% (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% or more) greater in the VSC, or (ii) induces expression of a transgene to which it is operably linked and the induced expression is at least 2-fold (e.g., 5-fold, 10-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold or more) greater in the VSC, compared to a transgene to which it is operably linked and the induced expression is at least 2-fold (e.g., 5-fold, 10-fold, 50-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold or more) greater in the VSC.

[0070] As used herein, the term "wild type" refers to the most frequently occurring genotype for a particular gene in a given organism. [Brief description of the drawings]

[0071] [Figure 1A] 1 is a series of single-plane confocal fluorescence images comparing nuclear GFP expression in the utricle of adult mice transduced with a viral vector encoding nuclear GFP under the control of the SLC6A14v2 (SEQ ID NO: 3; top row) or SLC6A14v3 (SEQ ID NO: 1; bottom row) promoters. Supporting cell nuclei were immunolabeled with an antibody raised against the SRY box transcription factor 2 (Sox2) protein, and hair cell nuclei were immunolabeled with an antibody raised against the POU class 4 homeobox 3 (Pou4f3) protein. The nuclear layers of supporting cells (SCs) are shown. [Figure 1B] 1 is a series of single-plane confocal fluorescence images comparing nuclear GFP expression in the utricle of adult mice transduced with a viral vector encoding nuclear GFP under the control of the SLC6A14v2 (SEQ ID NO: 3; top row) or SLC6A14v3 (SEQ ID NO: 1; bottom row) promoters. Supporting cell nuclei were immunolabeled with an antibody raised against the SRY box transcription factor 2 (Sox2) protein, and hair cell nuclei were immunolabeled with an antibody raised against the POU class 4 homeobox 3 (Pou4f3) protein. The nuclear layers of hair cells (HCs) are shown. [Figure 1C] 1 is a series of single-plane confocal fluorescence images comparing nuclear GFP expression in the utricle of adult mice transduced with a viral vector encoding nuclear GFP under the control of the SLC6A14v2 (SEQ ID NO: 3; top row) or SLC6A14v3 (SEQ ID NO: 1; bottom row) promoters. Supporting cell nuclei were immunolabeled with an antibody raised against the SRY box transcription factor 2 (Sox2) protein, and hair cell nuclei were immunolabeled with an antibody raised against the POU class 4 homeobox 3 (Pou4f3) protein. The mesenchymal layer is shown. [Diagram 2]A-D are a series of graphs showing quantification of nuclear GFP expression in supporting cells (A), intensity of nuclear GFP expression in supporting cells (B), quantification of nuclear GFP expression in hair cells (C), and quantification of nuclear GFP expression in all cells other than supporting cells (D) in the utricle of adult mice transduced with a viral vector encoding nuclear GFP under the control of the SLC6A14v2 (sequence number 3) promoter or the SLC6A14v3 (sequence number 1) promoter. [Diagram 3] 1 is a map of plasmid P530. [Figure 4] 1 is a map of plasmid P919. [Diagram 5] 1 is a map of plasmid P990. [Figure 6] 1 is a map of plasmid P1071. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0072] Described herein are compositions and methods for inducing specific expression of a transgene in vestibular supporting cells (VSCs) of the inner ear. The invention features a polynucleotide comprising a region of the solute carrier family 6 member 14 (SLC6A14) promoter that can cause a transgene to be specifically expressed in VSCs. The invention also features a nucleic acid vector comprising the promoter operably linked to a polynucleotide encoding a polypeptide or an RNA molecule. The compositions and methods described herein can be used to express a polynucleotide encoding a protein (e.g., a therapeutic protein, a reporter protein, or other protein of interest) or an RNA molecule (e.g., an inhibitory RNA molecule) in VSCs that provide structural and trophic support to vestibular hair cells and are capable of differentiating into hair cells, such that the compositions described herein can be administered to a subject (a mammalian subject, e.g., a human) to treat a disorder caused by dysfunction of vestibular hair cells, such as dizziness, vertigo, imbalance, bilateral vestibular hypofunction, oscillopsia, or balance disorders.

[0073] supporting cells Supporting cells of the vestibular system are unique epithelial cells present in the inner ear. VSCs constitute an anatomically and morphologically homogenous class of cells that mediate critical structural, developmental, and trophic activities necessary for standard vestibular function. VSCs reside in the utricle, saccule, and semicircular canals of the inner ear and serve as structural anchors for vestibular hair cells, the primary sensory cells of the peripheral vestibular system involved in the kinesthesia responsible for balance and spatial orientation. The form of synapsis from the vestibulocochlear nerve to hair cells is mediated by neurotrophic factors secreted by VSCs, thereby promoting the establishment and maintenance of proper vestibular function. In addition, VSCs function as key mediators of vestibular hair cell survival, death, and phagocytic clearance through their control of extracellular and intracellular calcium signaling, as well as the formation of phagocytic multicellular structures called phagosomes, thereby maintaining the integrity of the sensory epithelium by removing dead and dying hair cells. Vestibular hair cell damage and genetic mutations that disrupt the function of vestibular hair cells are associated with vestibular dysfunction, such as imbalance and dizziness (e.g., vertigo). In recent years, gene therapy has emerged as an attractive therapeutic approach for treating vestibular dysfunction, but there is no method in this field that focuses on nucleic acid vectors used in gene therapy for supporting cells of the vestibular system.

[0074] The present invention is based in part on the discovery that SLC6A14 is specifically expressed in the VSCs of the inner ear. SLC6A14 is a gene encoding a sodium- and chloride-dependent neurotransmitter transporter capable of transporting both neutral and positively charged amino acids in a sodium- and chloride-dependent manner, and its expression in the inner ear has not been confirmed until now. The SLC6A14 promoter sequence disclosed herein induces VSC-specific gene expression in the inner ear. Thus, the compositions and methods described herein can be used to express a gene of interest in VSCs (e.g., a gene involved in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation, or vestibular hair cell maturation, or a gene known to be disrupted, e.g., mutated, in a subject with vestibular dysfunction) to treat a subject with or at risk of developing vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibular hypofunction (e.g., bilateral vestibular dysfunction), oscillopsia, or balance disorders). Cell type-specific gene expression can improve the safety and efficacy of gene therapy by reducing toxicity associated with off-target expression.

[0075] The compositions and methods described herein include the SLC6A14 promoter of SEQ ID NO: 1 capable of specifically expressing a transgene in VSCs, such as a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity).

[0076] The aforementioned nucleic acid sequences are shown in Table 2 below.

[0077] [Table 2-1]

[0078] [Table 2-2]

[0079] [Table 2-3]

[0080] Expression of foreign nucleic acids in mammalian cells The compositions and methods described herein can be used to induce or increase expression of a protein encoded by a gene of interest (e.g., a wild-type form of a gene involved in vestibular dysfunction, or a gene involved in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation, or vestibular hair cell maturation) in a VSC, for example, by administering a nucleic acid vector comprising an SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 1) operably linked to a nucleic acid sequence encoding a protein of interest. A wide range of methods have been established for the delivery of proteins to mammalian cells and the stable expression of genes encoding proteins in mammalian cells. The protein that may be expressed in connection with the compositions described herein (e.g., when a transgene encoding the protein is operably linked to the SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1)) is a protein expressed in healthy VSCs (e.g., a protein that plays a role in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation, or vestibular hair cell maturation, or a protein that is deficient in a subject with vestibular dysfunction), or another protein of interest. Proteins that can be expressed in VSCs using the compositions and methods described herein include Sparto-like transcription factor 2 (Sall2), calmodulin-binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2),SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), Nuclear receptor subfamily 2 group F member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), Nescient helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4), zinc finger MIZ-Type containing 1 (Zmiz1), myelin transcription factor 1 (Myt1), signal transduction and transcription Activator of thymocyte selection 3 (Stat3), BarH-like homeobox 1 (Barhl1), Thymocyte selection-associated high mobility group box (Tox), Prospero homeobox 1 (Prox1), Nuclear factor IA (Nfia), Thyroid hormone receptor β (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), Lysine demethylase 5A (Kdm5a), CAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), Paternal expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISL·LIM homeobox 1 (Isl1), Zinc finger and BTB domain containing 38 (Zbtb38), Limb bud and heart development (Lbh), Tubby Bipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / nodal 1 homeobox 2 (Pknox2), AT-rich interacting domain 3B (Arid3b), MLX interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), Spalt-like transcription factor 1 (Sall1), SIX homeobox 2 (Six2), Spalt-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor-independent 1 transcriptional repressor (Gfi1), POU class 4 homeobox 3 (Pou4f3),These include the MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), atonal BHLH transcription factor 1 (Atoh1), and Atoh1 mutants containing substitutions at amino acid positions 328, 331, and / or 334 (e.g., S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334). The polynucleotides described herein (e.g., SLC6A14 promoter) can be used to express an inhibitory RNA molecule (e.g., short hairpin RNA (shRNA), antisense oligonucleotide (ASO)), a nuclease (e.g., CRISPR-associated protein 9 (Cas9), transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), or guide RNA (gRNA)), or a microRNA in a VSC.

[0081] In some embodiments, the protein expressed in VSCs using the compositions and methods described herein is Atoh1. The SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) can be operably linked to a polynucleotide sequence encoding wild-type Atoh1, or a variant thereof, such as a polynucleotide sequence encoding a protein having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to the amino acid sequence of wild-type mammalian (e.g., human or mouse) Atoh1 (e.g., SEQ ID NO:4 or SEQ ID NO:6). Exemplary Atoh1 amino acid and polynucleotide sequences are listed in Table 3 below.

[0082] In some embodiments, the polynucleotide sequence encoding the Atoh1 protein encodes an amino acid sequence that contains one or more conservative amino acid substitutions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more conservative amino acid substitutions) compared to SEQ ID NO:4, provided that the encoded Atoh1 analog maintains the therapeutic function of wild-type Atoh1 (e.g., the ability to promote hair cell development). Less than 10% of the amino acids in the Atoh1 protein may be replaced with conservative amino acid substitutions. In some embodiments, the polynucleotide sequence encoding Atoh1 is any polynucleotide sequence that encodes SEQ ID NO:4 due to redundancy in the genetic code. The polynucleotide sequence encoding Atoh1 may be partially or completely codon-optimized for expression (e.g., in human VSCs). Atoh1 may be encoded by a polynucleotide having the sequence of SEQ ID NO:5. The Atoh1 protein may be human Atoh1 or a homologue of the human Atoh1 protein from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal).

[0083] [Table 3-1]

[0084] [Table 3-2]

[0085] [Table 3-3]

[0086] [Table 3-4]

[0087] A polynucleotide encoding a protein of interest One platform that can be used to achieve therapeutically effective intracellular concentrations of a protein of interest in mammalian cells is by stably expressing a gene encoding the protein of interest (e.g., by integration into the nuclear or mitochondrial genome of the mammalian cell, or by episomal concatemer formation in the nucleus of the mammalian cell). A gene is a polynucleotide that encodes the primary amino acid sequence of the corresponding protein. To introduce an exogenous gene into a mammalian cell, the gene can be incorporated into a vector. The vector can be introduced into the cell by a variety of methods, including transformation, transfection, transduction, direct uptake, particle bombardment, and encapsulation of the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in further detail in, for example, Green et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014); and Ausubel et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.

[0088] Proteins of interest can also be introduced into mammalian cells by targeting the vector containing the gene encoding the protein of interest to cell membrane phospholipids.For example, vector molecules can be bound to the VSV-G protein, a viral protein that has affinity for all cell membrane phospholipids, to target the vector to the phospholipids on the extracellular surface of cell membrane.Such constructs can be produced using methods well known to those skilled in the art.

[0089] It is important for gene expression that the polynucleotide encoding the protein of interest is recognized and bound by mammalian RNA polymerase. Thus, sequence elements that exhibit high affinity for transcription factors that recruit RNA polymerase and promote the assembly of a transcription complex at the transcription initiation site may be included in the polynucleotide. Such sequence elements include, for example, mammalian promoters, the sequence of which may be recognized and bound by specific transcription initiation factors and ultimately RNA polymerase. Examples of mammalian promoters are described in Smith et al., Mol. Sys. Biol., 3:73 (published online), the disclosure of which is incorporated herein by reference. The promoter used in the methods and compositions described herein is the SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1).

[0090] Once a polynucleotide encoding a protein of interest has been integrated into the nuclear DNA of a mammalian cell, transcription of the polynucleotide can be induced by methods known in the art. For example, expression can be induced by exposing the mammalian cell to an external chemical reagent, such as an agent that modulates the binding of transcription factors and / or RNA polymerase to the mammalian promoter, thus modulating gene expression. The chemical reagent can function to promote the binding of RNA polymerase and / or transcription factors to the mammalian promoter, for example, by removing a repressor protein bound to the promoter. Alternatively, the chemical reagent can function to increase the affinity of the mammalian promoter for RNA polymerase and / or transcription factors, thereby increasing the rate of transcription of genes located downstream of the promoter in the presence of the chemical reagent. Examples of chemical reagents that enhance polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, Calif.) and can be administered to mammalian cells to promote gene expression according to established protocols.

[0091] Other DNA sequence elements that may be included in polynucleotides for use in the compositions and methods described herein include enhancer sequences. Enhancers represent another class of regulatory elements that induce conformational changes in polynucleotides, including genes of interest, such that the DNA adopts a three-dimensional orientation that favors the binding of transcription factors and RNA polymerase at the transcription start site. Thus, polynucleotides for use in the compositions and methods described herein include polynucleotides that encode proteins of interest, and further include mammalian enhancer sequences. Many enhancer sequences are now known from mammalian genes, examples of which include enhancers of genes encoding mammalian globin, elastase, albumin, alpha-fetoprotein, and insulin. Enhancers for use in the compositions and methods described herein also include enhancers derived from the genetic material of viruses capable of infecting eukaryotic cells. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Additional enhancer sequences that induce the activation of eukaryotic gene transcription include the CMV enhancer and the RSV enhancer. The enhancer may be spliced ​​into the vector containing the polynucleotide encoding the protein of interest, for example, at the 5' or 3' position of the gene. In a preferred orientation, the enhancer is placed 5' to the promoter, which is then placed 5' to the polynucleotide encoding the protein of interest.

[0092] The nucleic acid vectors comprising the SLC6A14 promoter described herein may also include a WPRE. The WPRE acts at the mRNA level, increasing the total amount of mRNA in the cell by promoting nuclear export of transcripts and / or increasing the efficiency of polyadenylation of nascent transcripts. The addition of a WPRE to a vector can result in a substantial improvement in the level of transgene expression from several different promoters, both in vitro and in vivo. In some embodiments of the compositions and methods described herein, the WPRE has the following sequence:

[0093] GATCCAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATT TTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCT CCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCT TTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGA (Sequence number 8) In other embodiments, the WPRE has the sequence:

[0094] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTCTCCTGTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGCTGTGGGCACTGACAATTCCGTGGTGTTATTTGTGGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTCAAGTCTTTATTTGTGGAAATTTGTGGATGCTATTGCTTTGTTAACCATTATAAGCTGCAATAAACAAGTTAACAACAAAATTGCATTCATTTTATGTTCAGGTTCAGGGGAGAGTGTGGGAGGTTTTTTTAAA (sequence number 9) In some embodiments, the nucleic acid vectors comprising the SLC6A14 promoter described herein comprise a reporter sequence, which may be useful for verifying the expression of genes operably linked to the SLC6A14 promoter in VSCs, or may be used to determine or confirm the vestibular supporting cell specificity of the promoter.Reporter sequences that may be provided in a transgene include DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other reporters known in the art.When associated with a regulatory element, such as the SLC6A14 promoter, that drives their expression, the reporter sequences provide a signal that can be detected by conventional means, including enzyme assays, radioassays, colorimetric assays, fluorescent assays or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of the vector incorporating the signal can be detected by assaying for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the presence of the vector incorporating the signal can be visually measured by color or light production in a luminometer.

[0095] Transfer plasmids that can be used to generate nucleic acid vectors (e.g., AAV vectors) for use in the compositions and methods described herein are listed in Table 4. Transfer plasmids (e.g., plasmids containing DNA sequences delivered by a nucleic acid vector, e.g., delivered by AAV) may be co-delivered to producer cells with helper plasmids (e.g., plasmids providing proteins required for AAV production) and rep / cap plasmids (e.g., plasmids providing AAV capsid proteins and proteins that insert the transfer plasmid DNA sequence into the capsid shell) to provide a nucleic acid vector (e.g., AAV vector) for administration. The transfer plasmids listed in Table 4 can be used to generate nucleic acid vectors (e.g., AAV vectors) that include the SLC6A14 promoter operably linked to a transgene, such as a polynucleotide encoding Atoh1 (mouse (SEQ ID NO:11) or human (SEQ ID NO:10) Atoh1) or a polynucleotide encoding GFP (SEQ ID NO:2).

[0096] [Table 4-1]

[0097] [Table 4-2]

[0098] [Table 4-3]

[0099] [Table 4-4]

[0100] [Table 4-5]

[0101]

Table 4-6

[0102]

Table 4-7

[0103]

Table 4-8

[0104]

Table 4-9

[0105]

Table 4-10

[0106]

Table 4-11

[0107]

Table 4-12

[0108]

Table 4-13

[0109]

Table 4-14

[0110]

Table 4-15

[0111]

Table 4-16

[0112]

Table 4-17

[0113]

Table 4-18

[0114]

Table 4-19

[0115]

Table 4-20

[0116]

Table 4-21

[0117]

Table 4-22

[0118]

Table 4-23

[0119]

Table 4-24

[0120]

Table 4-25

[0121]

Table 4-26

[0122] Methods for delivering exogenous nucleic acid to target cells Techniques that can be used to introduce a transgene, for example a transgene operably linked to the SLC6A14 promoter described herein, into a target cell (e.g., a mammalian cell) are well known in the art. For example, electroporation can be used to permeabilize mammalian cells (e.g., human target cells) by applying an electrostatic potential to the cells of interest. Mammalian cells, such as human cells, thus exposed to an external electric field are then susceptible to the uptake of exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference. A similar technique, Nucleofection™, utilizes an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and protocols useful for carrying out this technique are described in detail, for example, in Distler et al., Experimental Dermatology 14:315 (2005), and US 2010 / 0317114, the disclosures of each of which are incorporated herein by reference.

[0123] Further techniques useful for transfection of target cells include squeeze poration. This technique induces rapid mechanical deformation of cells to stimulate the uptake of foreign DNA through membrane pores that form in response to applied stress. This technique is advantageous in that it does not require vectors to deliver nucleic acid to cells, such as human target cells. Squeeze poration is described in detail, for example, in Sharei et al., Journal of Visualized Experiments 81:e50980 (2013), the disclosure of which is incorporated herein by reference.

[0124] Lipofection is another technique that is useful for transfection of target cells. This method involves loading nucleic acid into liposomes, which often present cationic functional groups, such as quaternary amines or protonated amines, toward the exterior of the liposome. This allows the anionic nature of the cell membrane to promote electrostatic interactions between the liposome and the cell, ultimately resulting in the uptake of the foreign nucleic acid, for example, by direct fusion of the liposome with the cell membrane or by endocytosis of the complex. Lipofection is described in detail, for example, in U.S. Pat. No. 7,442,386, the disclosure of which is incorporated herein by reference. A similar technique that utilizes ionic interactions with the cell membrane to induce the uptake of foreign nucleic acid includes contacting cells with cationic polymer-nucleic acid complexes. Exemplary cationic molecules that can be associated with polynucleotides to confer a positive charge that favors interaction with cell membranes include activated dendrimers (described, for example, in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference), polyethyleneimine, and diethylaminoethyl (DEAE)-dextran, the use of which as transfection agents is described in detail, for example, in Gulick et al., Current Protocols in Molecular Biology 40:I:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner, since this methodology utilizes the application of a magnetic field to induce uptake of nucleic acids. This technique is described in detail, for example, in US2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0125] Another useful tool for inducing the uptake of exogenous nucleic acids by target cells is laserfection, also known as optical transfection, a technique that involves exposing cells to electromagnetic radiation of specific wavelengths to gently permeabilize the cells and allow polynucleotides to penetrate the cell membrane. The biological activity of this technique has been found to be similar to, and in some cases superior to, electroporation.

[0126] Imparefection is another technique that can be used to deliver genetic material to target cells. This technique relies on the use of nanomaterials such as carbon nanofibers, carbon nanotubes, and nanowires. Needle-like nanostructures are synthesized perpendicular to the surface of a substrate. DNA containing genes intended for intracellular delivery is attached to the surface of the nanostructures. A chip with an array of these needles is then pressed against a cell or tissue. Cells stimulated by the nanostructures can express the delivered gene(s). An example of this technique is described in Shalek et al., PNAS 107:1870 (2010), the disclosure of which is incorporated herein by reference.

[0127] Magnetofection can also be used to deliver nucleic acids to target cells. The principle of magnetofection is to associate nucleic acids with cationic magnetic nanoparticles. The magnetic nanoparticles are made entirely of biodegradable iron oxide and are coated with different specific proprietary cationic molecules depending on the application. Their association with gene vectors (DNA, RNA, viral vectors, etc.) is achieved by salt-induced colloidal aggregation and electrostatic interactions. The magnetic particles are then concentrated on the target cells under the influence of an external magnetic field generated by a magnet. This technique is described in detail in Scherer et al., Gene Therapy 9:102 (2002), the disclosure of which is incorporated herein by reference.

[0128] Another useful tool for inducing the uptake of exogenous nucleic acids by target cells is sonoporation, a technique that involves using sound waves (usually ultrasonic frequencies) to modify the permeability of cell plasma membranes, rendering the cells permeable and allowing polynucleotides to penetrate the cell membrane. This technique is described in detail, for example, in Rhodes et al., Methods in Cell Biology 82:309 (2007), the disclosure of which is incorporated herein by reference.

[0129] Microvesicles represent another potential vehicle that can be used to modify the genome of target cells according to the methods described herein. For example, microvesicles derived by co-overexpression of glycoprotein VSV-G and genome-modifying proteins, such as nucleases, can be used to efficiently deliver proteins to cells and then catalyze the site-specific cleavage of endogenous polynucleotide sequences, thereby preparing the genome of the cells for covalent incorporation of a polynucleotide of interest, such as a gene or regulatory sequence. The use of such vesicles, also called Gesicle, for genetic modification of eukaryotic cells is described in detail, for example, in Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein[abstract] In:Methylation changes in early embryonic genes in cancer[abstract], in:Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy;2015 May 13, Abstract No.122.

[0130] Vectors for delivering exogenous nucleic acids to target cells In addition to achieving high rates of transcription and translation, stable expression of an exogenous gene in a mammalian cell can be achieved by integrating a polynucleotide containing the gene into the nuclear genome of the mammalian cell. A variety of vectors have been developed for delivering and integrating a polynucleotide encoding an exogenous protein into the nuclear DNA of a mammalian cell. Examples of expression vectors are described, for example, in Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, Massachusetts, 2006). Expression vectors for use in the compositions and methods described herein include the SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) operably linked to a polynucleotide sequence encoding a protein of interest, as well as additional sequence elements used, for example, for expression of these agents and / or integration of these polynucleotide sequences into a mammalian cell genome. Vectors that can contain the SLC6A14 promoter operably linked to a transgene encoding a protein of interest include plasmids (e.g., circular DNA molecules that can replicate autonomously in cells), cosmids (e.g., pWE or sCos vectors), artificial chromosomes (e.g., human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs)), and viral vectors. Particular vectors that can be used to express a protein of interest include plasmids that contain regulatory sequences, such as enhancer regions, that induce gene transcription. Other vectors useful for expressing a protein of interest contain polynucleotide sequences that increase the translation rate of these genes or improve the stability or nuclear export of mRNA resulting from gene transcription.These sequence elements include, for example, 5' and 3' untranslated regions, an internal ribosome entry site (IRES), and a polyadenylation signal site to induce efficient transcription of the gene carried by the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also contain a polynucleotide encoding a marker for selecting cells containing such a vector. Examples of suitable markers include genes encoding resistance to antibiotics such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0131] Viral Vectors for Nucleic Acid Delivery Viral genomes provide a rich source of vectors that can be used to efficiently deliver genes of interest into the genome of target cells (e.g., mammalian cells such as human cells). Viral genomes are particularly useful vectors for gene delivery because polynucleotides contained within such genomes are typically integrated into the nuclear genome of mammalian cells by generalized or specific transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors include retroviruses (e.g., Retroviridae family viral vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative strand RNA viruses such as orthomyxoviruses (e.g., influenza viruses), rhabdoviruses (e.g., rabies virus and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai), positive strand RNA viruses such as picornaviruses and alphaviruses, as well as double-stranded DNA viruses including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, mutated vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include: avian leukosis sarcoma, avian C virus, mammalian C, B, and D viruses, oncoretroviruses, HTLV-BLV complex, lentiviruses, alpharetroviruses, gammaretroviruses, and spumaviruses (Coffin, JM, Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, 1996)).Other examples include murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon leukemia virus, Mason-Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentivirus. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which is incorporated herein by reference as it pertains to viral vectors for use in gene therapy.

[0132] AAV vectors for nucleic acid delivery In some embodiments, the polynucleotides of the compositions and methods described herein are incorporated into rAAV vectors and / or viral particles to facilitate their introduction into cells (e.g., VSCs). The rAAV vectors useful for the compositions and methods described herein are recombinant nucleic acid constructs that include (1) the SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1), (2) the heterologous sequence to be expressed, and (3) viral sequences that facilitate the stability and expression of the heterologous gene. The viral sequences may include sequences of AAV required in cis for DNA replication and packaging into viral particles (e.g., functional ITRs). In general applications, the transgene encodes a protein that can promote or enhance vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation, or vestibular hair cell maturation, or a wild-type form of a vestibular hair cell protein that is mutated in a subject with a form of inherited vestibular dysfunction, which may be useful for improving vestibular function in a subject with a mutation that is associated with vestibular dysfunction (e.g., dizziness, vertigo, imbalance, bilateral vestibular hypofunction, bilateral vestibular insufficiency, oscillopsia, or balance disorders). Such rAAV vectors may also include a marker or reporter gene. In useful rAAV vectors, one or more AAV WT genes have been deleted in whole or in part, but functional flanking ITR sequences are retained. The AAV ITRs may be of any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITRs may be AAV2 ITRs. Methods for the use of rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated by reference herein as they pertain to AAV vectors for gene delivery.

[0133] To facilitate the introduction of a polynucleotide or vector into a cell (e.g., VSC), the polynucleotides and vectors described herein (e.g., SLC6A14 promoter operably linked to a transgene encoding a protein of interest) can be incorporated into rAAV viral particles. The capsid protein of AAV constitutes the outer non-nucleic acid portion of the viral particle and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins VP1, VP2, and VP3, which are required for viral particle assembly. Construction of rAAV viral particles has been described, for example, in US 5,173,414; US 5,139,941; US ​​5,863,541; US ​​5,869,305; US 6,057,152; and US 6,376,237; as well as Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), the disclosures of each of which are incorporated by reference herein as they pertain to AAV vectors for gene delivery.

[0134] rAAV viral particles useful in combination with the compositions and methods described herein include viral particles derived from various AAV serotypes, including AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, and PHP.S. When targeting VSCs, AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Anc80, Anc80L65, 7m8, PHP.B, PHP.eB, or PHP.S serotypes may be particularly useful. Serotypes evolved for retinal transduction may also be used in the methods and compositions described herein. The construction and use of AAV vectors and AAV proteins of different serotypes have been described, for example, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), the disclosures of each of which are incorporated by reference herein as they pertain to AAV vectors for gene delivery.

[0135] Useful in combination with the compositions and methods described herein are pseudotyped rAAV vectors. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene from a serotype other than the given serotype (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). Techniques involving the construction and use of pseudotyped rAAV viral particles are known in the art and are described, for example, in Duan et al., J. Virol. 75:7662 (2001); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001).

[0136] AAV viral particles with mutations in the capsid of the viral particle can be used to infect specific cell types more effectively than non-mutated capsid viral particles. For example, suitable AAV mutants can have ligand insertion mutations to facilitate targeting of AAV to specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine screening mutants, and epitope tag mutants, are described in Wua et al., J. Virol. 74:8635 (2000). Other rAAV viral particles that can be used in the methods described herein include capsid hybrids generated by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001).

[0137] In some embodiments, the nucleic acid vector (e.g., AAV vector) comprises a SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) operably linked to a polynucleotide sequence encoding human Atoh1 (human ATOH1 protein=RefSeq Accession No. NP_005163 (SEQ ID NO:4), mRNA sequence=RefSeq Accession No. NM_005172). In some embodiments, the SLC6A14 promoter is the SLC6A14 promoter of SEQ ID NO:1 (also represented by nucleotides 219-1977 of SEQ ID NO:10) and is operably linked to a polynucleotide sequence encoding human Atoh1. In some embodiments, the polynucleotide sequence encoding human Atoh1 is SEQ ID NO:5. In some embodiments, the polynucleotide sequence encoding human Atoh1 is any polynucleotide sequence that encodes SEQ ID NO:4 due to redundancy in the genetic code. The polynucleotide sequence encoding human Atoh1 may be partially or fully codon-optimized for expression. In some embodiments, the vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO:1, a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter, a polyadenylation sequence, and a second inverted terminal repeat. In some embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO:1, a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter, a woodchuck posttranscriptional regulatory element (WPRE), a polyadenylation sequence, and a second inverted terminal repeat. In some embodiments, the WPRE has the sequence of SEQ ID NO:8 or SEQ ID NO:9. In some embodiments, the WPRE has the sequence of SEQ ID NO:8. In some embodiments, the WPRE has the sequence of nucleotides 3064 to 3611 of SEQ ID NO:10.In some embodiments, the polyadenylation sequence has the sequence of nucleotides 3624-3831 of SEQ ID NO: 10. In certain embodiments, the nucleic acid vector comprises nucleotides 219-3831 of SEQ ID NO: 10 flanked by inverted terminal repeats. In some embodiments, the inverted terminal repeats are AAV2 inverted terminal repeats. In some embodiments, the inverted terminal repeats are any variant of the AAV2 inverted terminal repeats that can be encapsidated by a plasmid carrying the AAV2 Rep gene. In certain embodiments, the nucleic acid vector comprises nucleotides 219-3831 of SEQ ID NO:10 flanked by inverted terminal repeats, wherein the 5' inverted terminal repeats have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 162%, 163%, 164%, 165%, 166%, 167%, 168%, 169%, 170%, 171%, 17 6%, 97%, 98%, or 99% sequence identity) and the 3' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 3919 to 4048 of SEQ ID NO: 10. In some embodiments, the nucleic acid vector is a viral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has an AAV8 capsid.

[0138] In some embodiments, the nucleic acid vector (e.g., AAV vector) comprises a SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) operably linked to a polynucleotide sequence encoding mouse Atoh1 (mouse ATOH1 protein=UniProt P48985 (SEQ ID NO:6); mRNA sequence=RefSeq accession number NM_007500.5). In some embodiments, the SLC6A14 promoter is the SLC6A14 promoter of SEQ ID NO:1 (also represented by nucleotides 219-1977 of SEQ ID NO:11) and is operably linked to a polynucleotide sequence encoding mouse Atoh1. In some embodiments, the polynucleotide sequence encoding mouse Atoh1 is SEQ ID NO:7. In some embodiments, the polynucleotide sequence encoding mouse Atoh1 is any polynucleotide sequence that encodes SEQ ID NO:6 due to redundancy in the genetic code. The polynucleotide sequence encoding mouse Atoh1 may be partially or fully codon-optimized for expression. In some embodiments, the vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO:1, a polynucleotide sequence encoding mouse Atoh1 operably linked to the SLC6A14 promoter, a polyadenylation sequence, and a second inverted terminal repeat. In some embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat, an SLC6A14 promoter of SEQ ID NO:1, a polynucleotide sequence encoding mouse Atoh1 operably linked to the SLC6A14 promoter, a woodchuck post-transcriptional regulatory element (WPRE), a polyadenylation sequence, and a second inverted terminal repeat. In some embodiments, the WPRE has a sequence of SEQ ID NO:8 or SEQ ID NO:9. In some embodiments, the WPRE has a sequence of SEQ ID NO:8. In some embodiments, the WPRE has the sequence of nucleotides 3055 to 3602 of SEQ ID NO:11.In some embodiments, the polyadenylation sequence has the sequence of nucleotides 3615-3822 of SEQ ID NO: 11. In certain embodiments, the nucleic acid vector comprises nucleotides 219-3822 of SEQ ID NO: 11 flanked by inverted terminal repeats. In some embodiments, the inverted terminal repeats are AAV2 inverted terminal repeats. In some embodiments, the inverted terminal repeats are any variant of the AAV2 inverted terminal repeats that can be encapsidated by a plasmid carrying the AAV2 Rep gene. In certain embodiments, the nucleic acid vector comprises nucleotides 219-3822 of SEQ ID NO:11 flanked by inverted terminal repeats, wherein the 5' inverted terminal repeats have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109%, 1101, 1102, 1103, 11104, 1 ... 6%, 97%, 98%, or 99% sequence identity) and the 3' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 3910 to 4039 of SEQ ID NO: 11. In some embodiments, the nucleic acid vector is a viral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has an AAV8 capsid.

[0139] Those skilled in the art will appreciate that the creation of the viral vectors of the invention typically requires the use of the plasmids of the invention together with auxiliary plasmids that provide elements required for proper viral packaging and viability (e.g., in the case of AAV, plasmids providing the appropriate AAV rep, cap, and other genes, e.g., E2A and E4). Combination of these plasmids in a producer cell line creates a viral vector. However, those skilled in the art will appreciate that any given pair of inverted terminal repeat sequences in a transfer plasmid of the invention can be used to create a viral vector, and that the corresponding sequences in the viral vector can be altered by ITRs that incorporate a "flip" or "flop" orientation during genetic recombination. Thus, the sequences of the ITRs in a transfer plasmid are not necessarily the same as those found in the viral vector prepared from it.

[0140] Pharmaceutical Compositions A polynucleotide described herein (e.g., an SLC6A14 promoter having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) can be operably linked to a transgene (e.g., a transgene encoding a protein of interest, an shRNA, an ASO, or a nuclease (e.g., Cas9, TALEN, ZFN, or gRNA), or a transgene that can be transcribed to create a microRNA) and incorporated into a vehicle for administration to a patient, such as a human patient suffering from vestibular dysfunction. Pharmaceutical compositions comprising a vector, such as a viral vector, comprising a polynucleotide described herein operably linked to a transgene can be prepared using methods known in the art. For example, such compositions can be prepared in a desired form, such as a lyophilized formulation or an aqueous solution, using, for example, physiologically acceptable carriers, excipients or stabilizers (Remington: The Science and Practice of Pharmacology 22nd edition, Allen, L. Ed. (2013); incorporated herein by reference).

[0141] A mixture of a nucleic acid vector (e.g., a viral vector) comprising a SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 1) operably linked to a transgene can be prepared by mixing appropriately with one or more excipients, carriers, or diluents in water. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. These preparations may contain a preservative to prevent the growth of microorganisms under ordinary storage and use conditions. Pharmaceutical forms suitable for injection use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of injectable sterile solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, the formulation may be sterile and may have sufficient fluidity for easy injection. The formulation may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms may be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions may be brought about by the use in the composition of agents which delay absorption, for example, aluminum monostearate and gelatin.

[0142] For example, solutions containing the pharmaceutical compositions described herein may be suitably buffered if necessary, and liquid diluents may first be made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous media that may be employed will be known to those of skill in the art in light of the present disclosure. For example, one dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution or injected at the intended site of injection. Some variation in dose will necessarily occur depending on the condition of the subject being treated. For local administration to the middle or inner ear, the composition may be formulated to contain a synthetic perilymph solution. An exemplary synthetic perilymph solution contains 20-200 mM NaCl, 1-5 mM KCl, 0.1-10 mM CaCl2, 1-10 mM glucose, and 2-50 mM HEPES, and has a pH of about 6-9 and an osmolality of about 300 mOsm / kg. The individual responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[0143] Treatment method The compositions described herein may be administered to a subject having or at risk of developing vestibular dysfunction by a variety of routes, including, for example, local administration to the middle or inner ear (e.g., administration to the perilymph or endolymph via the oval window, round window, or semicircular canal (e.g., the horizontal semicircular canal), or administration to, for example, vestibular supporting cells or hair cells by transtympanic or intratympanic injection), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, transdermal, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. The most appropriate route for administration in a given case depends on the particular composition administered, the patient, the pharmaceutical formulation method, the method of administration (e.g., time of administration and route of administration), the patient's age, weight, sex, severity of the disease being treated, the patient's diet, and the patient's excretion rate. The compositions may be administered once, or more than once (e.g., once a year, twice a year, three times a year, bimonthly, monthly, or biweekly).

[0144] The subjects that may be treated as described herein are those who have or are at risk of developing vestibular dysfunction. The compositions and methods described herein can be used to treat subjects who have or are at risk of developing vestibular hair cell damage (e.g., disease or infection, head trauma, ototoxic drugs (e.g., aminoglycosides), or age-related damage), subjects who have or are at risk of developing vestibular dysfunction (e.g., dizziness, vertigo, imbalance, bilateral vestibular hypofunction (also called bilateral vestibular dysfunction), oscillopsia, or balance disorders), subjects who have a genetic mutation associated with vestibular dysfunction, or subjects who have a family history of inherited vestibular dysfunction. In some embodiments, the disease associated with damage to hair cells (e.g., vestibular hair cells) or loss of hair cells is an autoimmune disease or condition in which an autoimmune response leads to hair cell damage or death. Autoimmune diseases associated with vestibular dysfunction include autoimmune inner ear disease (AIED), polyarteritis nodosa (PAN), Cogan's syndrome, relapsing polychondritis, systemic lupus erythematosus (SLE), Wegener's granulomatosis, Sjogren's syndrome, and Behcet's disease. Some infectious diseases, such as Lyme disease and syphilis, may also cause vestibular dysfunction (e.g., by inducing autoantibody production). Viral infections, such as rubella, cytomegalovirus (CMV), lymphocytic choriomeningitis virus (LCMV), HSV type 1&2, West Nile virus (WNV), human immunodeficiency virus (HIV), varicella zoster virus (VZV), measles, and mumps, may also cause vestibular dysfunction. In some embodiments, the subject has vestibular dysfunction associated with or resulting from the loss of hair cells (e.g., vestibular hair cells). In some embodiments, the compositions and methods described herein can be used to treat a subject who has or is at risk of developing oscillopsia. In some embodiments, the compositions and methods described herein can be used to treat a subject who has or is at risk of developing bilateral vestibular hypofunction.In some embodiments, the compositions and methods described herein can be used to treat subjects who have or are at risk of developing a balance disorder (e.g., imbalance). The methods described herein can include screening the subject for one or more mutations in genes known to be associated with vestibular dysfunction prior to treatment or administration with the compositions described herein. The subject can be screened for genetic mutations using standard methods known to those skilled in the art (e.g., genetic testing). The methods described herein can also include evaluating the subject's vestibular function prior to treatment or administration with the compositions described herein. Vestibular function can be assessed using standard tests such as eye movement tests (e.g., electronystagmography (ENG) or videonystagmography (VNG)), tests of the vestibulo-ocular reflex (VOR) (e.g., head impulse testing (Halmagyi-Curthoys test), which may be performed at the bedside or using video head impulse testing (VHIT), or thermoreflex testing), postural sway tests, rotation chair tests, ECOG, vestibular evoked myogenic potentials (VEMPs), and dedicated clinical balance tests such as those described in Mancini and Horak, Eur J Phys Rehabil Med, 46:239 (2010). These tests can also be used to assess vestibular function in a subject following treatment or administration of a composition described herein. The compositions and methods described herein may also be administered as a prophylactic treatment to patients at risk of developing vestibular dysfunction, such as patients with a family history of vestibular dysfunction (e.g., inherited vestibular dysfunction), patients who have a genetic mutation associated with vestibular dysfunction but have not yet shown symptoms of vestibular dysfunction, or patients who are exposed to risk factors for acquired vestibular dysfunction (e.g., disease or infection, head trauma, ototoxic drugs, or aging). The compositions and methods described herein may also be used to treat subjects with idiopathic vestibular dysfunction.

[0145] The compositions and methods described herein can be used to induce or enhance hair cell regeneration (e.g., vestibular hair cell regeneration) and / or induce or increase proliferation of vestibular hair cells and / or VSCs in a subject. Subjects who may benefit from compositions that promote or induce vestibular hair cell regeneration, vestibular hair cell innervation, and / or vestibular hair cell and / or VSC proliferation include subjects who have or are at risk of developing vestibular dysfunction as a result of hair cell loss (e.g., vestibular hair cell loss associated with trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), as well as subjects who have abnormal vestibular hair cells (e.g., vestibular hair cells that do not function properly compared to normal vestibular hair cells), damaged vestibular hair cells (e.g., vestibular hair cell damage associated with trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), or subjects who have a reduced number of vestibular hair cells due to genetic mutations or congenital abnormalities. The compositions and methods described herein can be used to promote or improve vestibular hair cell maturation, which can result in improved vestibular function. In some embodiments, the compositions and methods described herein promote or improve the maturation of regenerated vestibular hair cells (e.g., promote or improve the maturation of vestibular hair cells that occurs in response to expression of a composition described herein in VSCs, such as a composition comprising a SLC6A14 promoter operably linked to a transgene). The compositions and methods described herein can also promote or increase VSC and / or vestibular hair cell survival and / or improve VSC function.

[0146] The compositions and methods described herein can also be used to prevent or reduce vestibular dysfunction due to ototoxicity-induced hair cell damage or death (e.g., vestibular hair cell damage or death) in subjects who have been treated with ototoxic drugs or who are currently being treated or will be starting treatment with ototoxic drugs. Ototoxic drugs can be toxic to inner ear cells and cause vestibular dysfunction (e.g., dizziness, vertigo, imbalance, bilateral vestibular hypofunction, or oscillopsia). Drugs that have been found to be ototoxic include aminoglycoside antibiotics (e.g., gentamicin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, and amikacin), viomycin, antineoplastic agents (e.g., platinum-containing chemotherapeutic agents such as cisplatin, carboplatin, and oxaliplatin), loop diuretics (e.g., ethacrynic acid and furosemide), salicylates (e.g., aspirin, especially at high doses), and quinines. In some embodiments, the methods and compositions described herein can be used to treat bilateral vestibular hypofunction. In some embodiments, the methods and compositions described herein can be used to treat bilateral vestibular hypofunction or oscillopsia resulting from aminoglycoside ototoxicity (e.g., the methods and compositions described herein can be used to reduce aminoglycoside-induced vestibular hair cell damage or death, or promote or enhance hair cell regeneration and / or hair cell or VSC proliferation in patients with aminoglycoside-induced bilateral vestibular hypofunction or oscillopsia).

[0147] A transgene operably linked to the SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) for treating a subject as described herein can be a transgene encoding a protein expressed in healthy VSCs (e.g., a protein that plays a role in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell maturation, or vestibular hair cell innervation, or a protein that is deficient in a subject with vestibular dysfunction), another protein of interest (e.g., a therapeutic or reporter protein such as a fluorescent protein, lacZ, or luciferase), an shRNA, an ASO, a nuclease, or a microRNA. The transgene may be selected based on the cause of the subject's vestibular dysfunction (e.g., if the subject's vestibular dysfunction is associated with a particular genetic mutation, the transgene can be a wild-type form of the gene that is mutated in the subject, or if the subject has a vestibular dysfunction associated with hair cell loss, the transgene can encode a protein that promotes vestibular hair cell regeneration, vestibular hair cell innervation, or vestibular hair cell and / or VSC proliferation), the severity of the subject's vestibular dysfunction, the health of the subject's hair cells, the subject's age, the subject's family history of vestibular dysfunction, or other factors.Proteins that can be expressed by a transgene operably linked to the SLC6A14 promoter for treatment of a subject as described herein include, but are not limited to, Sox9, Sall2, Camta1, Hey2, Gata2, Hey1, Lass2, Sox10, Gata3, Cux1, Nr2f1, Hes1, Rorb, Jun, Zfp667, Lhx3, Nhlh1, Mxd4, Zmiz1, Myt1, Stat3, Barhl1, Tox, Prox1, Nfia, Thrb, Mycl1, Kdm5a, Creb314, Etv1, Peg3, Bach2, Isl1, Zbtb38, Lbh, These include Tub, Hmg20, Rest, Zfp827, Aff3, Pknox2, Arid3b, Mlxip, Zfp532, Ikzf2, Sall1, Six2, Sall3, Lin28b, Rfx7, Bdnf, Gfi1, Pou4f3, Myc, Ctnnb1, Sox2, Sox4, Sox11, Tead2, Atoh1, and Atoh1 mutants having substitutions at amino acid positions 328, 331, and / or 334 (e.g., S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and 328A / S331A / S334).

[0148] The treatment may include administration of a composition comprising a nucleic acid vector (e.g., AAV viral vector) comprising the SLC6A14 promoter (e.g., SEQ ID NO: 1) described herein in various unit doses. Each unit dose typically contains a predetermined amount of the therapeutic composition. The amount administered, as well as the specific route of administration and formulation, are within the skill of the art. The unit dose need not be administered as a single injection, but may comprise a continuous infusion over a set period of time. Administration may be performed using a syringe pump to control the rate of infusion in order to minimize damage to the inner ear (e.g., the vestibular labyrinth). If the nucleic acid vector is an AAV vector (e.g., an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S vector), the viral vector can be, for example, about 1×10 9 Vector genome (VG) / mL ~ approx. 1x10 16 VG / mL (e.g., 1x10 9 VG / mL, 2x10 9 VG / mL, 3x10 9 VG / mL, 4x10 9 VG / mL, 5x10 9 VG / mL, 6x10 9 VG / mL, 7x10 9 VG / mL, 8x10 9 VG / mL, 9x10 9 VG / mL, 1x10 10 VG / mL, 2x10 10 VG / mL, 3x10 10 VG / mL, 4x10 10 VG / mL, 5x10 10 VG / mL, 6x10 10 VG / mL, 7x10 10 VG / mL, 8x10 10 VG / mL, 9x10 10 VG / mL, 1x10 11 VG / mL, 2x10 11 VG / mL, 3x10 11 VG / mL, 4x10 11VG / mL、5x10 11 VG / mL、6x10 11 VG / mL、7x10 11 VG / mL、8x10 11 VG / mL、9x10 11 VG / mL、1x10 12 VG / mL、2x10 12 VG / mL、3x10 12 VG / mL、4x10 12 VG / mL、5x10 12 VG / mL、6x10 12 VG / mL、7x10 12 VG / mL、8x10 12 VG / mL、9x10 12 VG / mL、1x10 13 VG / mL、2x10 13 VG / mL、3x10 13 VG / mL、4x10 13 VG / mL、5x10 13 VG / mL、6x10 13 VG / mL、7x10 13 VG / mL、8x10 13 VG / mL、9x10 13 VG / mL、1x10 14 VG / mL、2x10 14 VG / mL、3x10 14 VG / mL、4x10 14 VG / mL、5x10 14 VG / mL、6x10 14 VG / mL、7x10 14 VG / mL、8x10 14 VG / mL、9x10 14 VG / mL、1x10 15 VG / mL、2x10 15 VG / mL、3x10 15 VG / mL、4x10 15 VG / mL、5x10 15 VG / mL、6x10 15 VG / mL、7x10 15 VG / mL、8x10 15 VG / mL、9x10 15 VG / mL、or 1x10 16The AAV vector may be administered to a patient in a dose of 1 μL to 200 μL (e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μL). 7 VG / ear ~ approx. 2x10 15 VG / ear (e.g. 1x10 7 VG / ear, 2x10 7 VG / ear, 3x10 7 VG / ear, 4x10 7 VG / ear, 5x10 7 VG / ear, 6x10 7 VG / ear, 7x10 7 VG / ear, 8x10 7 VG / ear, 9x10 7 VG / ear, 1x10 8 VG / ear, 2x10 8 VG / ear, 3x10 8 VG / ear, 4x10 8 VG / ear, 5x10 8 VG / ear, 6x10 8 VG / ear, 7x10 8 VG / ear, 8x10 8 VG / ear, 9x10 8 VG / ear, 1x10 9 VG / ear, 2x10 9 VG / ear, 3x10 9 VG / ear, 4x10 9 VG / ear, 5x10 9 VG / ear, 6x10 9 VG / ear, 7x10 9 VG / ear, 8x10 9 VG / ear, 9x10 9 VG / ear, 1x10 10 VG / ear, 2x10 10 VG / ear, 3x10 10 VG / ear, 4x10 10 VG / ear, 5x10 10 VG / ear, 6x10 10 VG / ear, 7x10 10 VG / ear, 8x10 10 VG / ear, 9x10 10VG / ear, 1x10 11 VG / ear, 2x10 11 VG / ear, 3x10 11 VG / ear, 4x10 11 VG / ear, 5x10 11 VG / ear, 6x10 11 VG / ear, 7x10 11 VG / ear, 8x10 11 VG / ear, 9x10 11 VG / ear, 1x10 12 VG / ear, 2x10 12 VG / ear, 3x10 12 VG / ear, 4x10 12 VG / ear, 5x10 12 VG / ear, 6x10 12 VG / ear, 7x10 12 VG / ear, 8x10 12 VG / ear, 9x10 12 VG / ear, 1x10 13 VG / ear, 2x10 13 VG / ear, 3x10 13 VG / ear, 4x10 13 VG / ear, 5x10 13 VG / ear, 6x10 13 VG / ear, 7x10 13 VG / ear, 8x10 13 VG / ear, 9x10 13 VG / ear, 1x10 14 VG / ear, 2x10 14 VG / ear, 3x10 14 VG / ear, 4x10 14 VG / ear, 5x10 14 VG / ear, 6x10 14 VG / ear, 7x10 14 VG / ear, 8x10 14 VG / ear, 9x10 14 VG / ear, 1x10 15 VG / ear, or 2x10 15 The subject may be administered a dose of 100 mg / ear (VG / ear).

[0149] The compositions described herein are administered in an amount sufficient to improve vestibular function (e.g., improve balance or reduce dizziness or vertigo), treat bilateral vestibular hypofunction, treat oscillopsia, treat balance disorders, increase expression of a protein encoded by a transgene operably linked to the SLC6A14 promoter, improve function of a protein encoded by a transgene operably linked to the SLC6A14 promoter, promote or enhance hair cell development, increase cell number (e.g., promote or induce hair cell regeneration or proliferation), enhance or induce hair cell maturation (e.g., maturation of regenerated hair cells), improve hair cell function, improve VSC function, promote or increase VSC and / or vestibular hair cell survival, and / or promote or increase VSC proliferation. Vestibular function may be assessed using standard tests for balance and vertigo (e.g., eye movement tests (e.g., ENG or VNG), VOR tests (e.g., head impulse tests (Halmagyi-Curthoys tests, e.g., VHIT) or thermoreflex tests), postural sway tests, rotation chair tests, ECOG, VEMP, and dedicated clinical balance tests) and may improve by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to measurements obtained before treatment. The compositions described herein may also be administered in an amount sufficient to delay or prevent the onset or progression of vestibular dysfunction (e.g., in subjects who have a genetic mutation associated with vestibular dysfunction, who have a family history of vestibular dysfunction (e.g., genetic vestibular dysfunction), or who have been exposed to risk factors associated with vestibular dysfunction (e.g., ototoxic drugs, head trauma, or disease or infection), but who do not exhibit vestibular dysfunction (e.g., dizziness, vertigo, or disequilibrium), or who exhibit mild to moderate vestibular dysfunction).Expression of the protein encoded by the transgene operably linked to the SLC6A14 promoter in the nucleic acid vector administered to the subject may be assessed using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detecting protein or mRNA, and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to expression prior to administration of the compositions described herein. Hair cell number, hair cell function, hair cell maturation, hair cell regeneration, or function of a protein encoded by a nucleic acid vector administered to a subject may be indirectly assessed based on testing of vestibular function and may be improved by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to hair cell number, hair cell function, hair cell maturation, hair cell regeneration, or protein function prior to administration of a composition described herein, or compared to an untreated subject. These effects may occur within, for example, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more after administration of a composition described herein. Depending on the dose and route of administration used for the treatment, the patient may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more after administration of the composition, and depending on the results of the evaluation, the patient may be subjected to additional treatments.

[0150] kit The compositions described herein can be provided in a kit for use in treating vestibular dysfunction. The compositions can include the SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO: 1), a nucleic acid vector comprising such a polynucleotide, and a nucleic acid vector comprising the polynucleotide described herein operably linked to a transgene encoding a protein of interest (e.g., a protein that can be expressed in VSCs to treat vestibular dysfunction). The nucleic acid vector may be packaged in an AAV viral capsid (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Anc80, 7m8, PHP.B, PHP.eB, or PHP.S). The kit may further include a package insert instructing a user of the kit, e.g., a physician, to practice the methods described herein. The kit may optionally include a syringe or other device for administering the composition.

[0151] Working Example The following examples are presented to provide one of ordinary skill in the art with a description of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely illustrative of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0152] Example 1. Measurement of SLC6A14v2 and SLC6A14v3 promoter activity in the mouse vestibular organ in vivo To compare the activity of the SLC6A14v2 and SLC6A14v3 promoters in vivo, the human SLC6A14 promoter (SEQ ID NO: 3) driving a nuclear-inducible H2B-GFP fusion protein (derived from plasmid P530; FIG. 3) and the mouse SLC6A14 promoter (SEQ ID NO: 1) driving a nuclear-inducible H2B-GFP fusion protein (derived from plasmid P919 (SEQ ID NO: 2); FIG. 4) were separately packaged into AAV8, and 1 μL of virus was injected into the posterior semicircular canal of male 8-week-old C57BL / 6 mice (n=6 mice per virus) using 2.0 × 10 10 vg / ear by injection. After 2 weeks, animals were euthanized by CO2 and perfused with PBS followed by neutral buffered formalin (NBF). Temporal bones were removed and utricles were microdissected and subjected to fluorescent immunolabeling for the hair cell nucleus marker Pou4f3 (1:200, sc-1980, Santa Cruz Biotechnology, Dallas, TX, USA) and supporting cell nucleus marker Sox2 (1:200, AF2018, R&D Systems, Inc., Minneapolis, MN, USA).

[0153] Organs were all mounted on glass slides and imaged on a Zeiss LSM 800 confocal microscope (Figures 1A-1C). For each utricle, a z-stack of confocal images was collected using a 20x / 0.8NA objective with a field of view large enough to capture the entire utricle. Each z-stack spanned the nuclear layer of hair cells, the nuclear layer of supporting cells, and the mesenchymal layer, with the z-thickness set to the Nyquist criterion. Images in Figures 1A-1C show a magnified region of a single z-plane within a z-stack at the indicated depth. Nuclear GFP expression is seen in the nuclear layer of supporting cells inside the sensory epithelium (Figure 1A), the nuclear layer of hair cells inside the sensory epithelium (Figure 1B), and the mesenchymal layer beneath the sensory epithelium (Figure 1C). Comparable levels of nuclear GFP expression were detected throughout the nuclear layer of supporting cells with both promoters. Although there was substantially less nuclear GFP expression in the nuclear layer of hair cells and in the mesenchyme, more labeling was observed in the mesenchyme with the SLC6A14v2 promoter (Fig. 1C, top row) compared with the SLC6A14v3 promoter (Fig. 1C, bottom row).

[0154] Quantitative measurements of GFP-expressing nuclei were performed using an automated algorithm for 3D counting in Imaris software that determined the number of GFP-positive nuclei within the entire utricle, the intensity of GFP fluorescence, and co-positivity for Pou4f3 and / or Sox2 immunolabeling. Statistical analysis was performed in GraphPad Prism.

[0155] The percentage of supporting cells with detectable levels of nuclear GFP was comparable between SLC6A14v2 and SLC6A14v3 promoters (Figure 2A; box plot points represent individual utricles). However, the average intensity of nuclear GFP in supporting cells with detectable levels above background was significantly higher with SLC6A14v3 promoter compared to SLC6A14v2 (Figure 2B; scatter plot circles represent individual cells across all samples, black line is population average; Student's t-test, p<0.0001). In addition, the percentage of hair cell nuclei with detectable levels of GFP above background was significantly higher with SLC6A14v2 promoter compared to SLC6A14v3 (Figure 2C; Student's t-test, p=0.001), as was the percentage of all non-supporting cell GFP+ nuclei as measured by positive Sox2 immunolabeling (Figure 2D; Student's t-test, p=0.022).

[0156] Example 2. Administration of a composition containing a nucleic acid vector comprising an SLC6A14 promoter to a subject with vestibular dysfunction According to the methods disclosed herein, a practitioner of skill in the art can treat a patient, for example a human patient, having a vestibular dysfunction, thereby improving or restoring vestibular function. To this end, a practitioner of skill in the art can administer to a human patient a composition comprising an AAV vector (e.g., AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Anc80, 7m8, PHP.B, PHP.eB, or PHP.S) comprising the SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1) operably linked to a transgene encoding a therapeutic protein (e.g., asynchronous BHLH transcription factor 1 (Atoh1)). In one example, the vector has an AAV8 capsid and includes nucleotides 219 to 3831 of SEQ ID NO: 10. A composition comprising an AAV vector can be administered to a patient, for example, by local administration to the inner ear (e.g., injection into the semicircular canal) to treat vestibular dysfunction.

[0157] After administering the composition to the patient, a practitioner skilled in the art can monitor the expression of the therapeutic protein encoded by the transgene and the improvement of the patient in response to the treatment in various ways. For example, the practitioner can monitor the patient's vestibular function by performing standard tests such as electronystagmography, videonystagmography, VOR test (e.g., head impulse test (Halmagyi-Curthoys test, e.g., VHIT) or thermoreflex test), rotation test, vestibular evoked myogenic potential, or computerized dynamic postural stabilization test. If it is determined that the patient's vestibular function is improved in one or more tests after administering the composition compared to the test results obtained before administering the composition, it can be said that the patient is responding well to the treatment. Subsequent doses can be determined and administered as necessary.

[0158] Exemplary embodiments of the present invention are described in the following enumerated paragraphs. E1. A nucleic acid vector comprising a polynucleotide having at least 85% sequence identity to SEQ ID NO:1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity).

[0159] E2. The nucleic acid vector of any one of E1, wherein the polynucleotide is operably linked to a transgene. E3. The nucleic acid vector of E2, wherein the transgene is a heterologous transgene.

[0160] E4. The nucleic acid vector of E2 or E3, wherein the transgene encodes a protein, a short hairpin RNA (shRNA), an antisense oligonucleotide (ASO), a nuclease, or a microRNA.

[0161] E5. The nucleic acid vector described in E4, wherein the polynucleotide is capable of inducing vestibular supporting cell (VSC)-specific expression of the protein, the shRNA, the ASO, the nuclease, or the microRNA in a mammalian VSC.

[0162] E6. The nucleic acid vector of E5, wherein the VSC is a human VSC. E7. The proteins include Sparto-like transcription factor 2 (Sall2), calmodulin-binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2 group F member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), Nescient helix-loop-helix ux1 (Nhlh1), MAX dimerization protein 4 (Mxd4), zinc finger MIZ-Type containing 1 (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-associated high mobility group box (Tox), Prospero homeobox 1 (Prox1), nuclear factor IA (Nfia), thyroid hormone receptor β (Thrb), M YCL proto-oncogene BHLH transcription factor (Mycl1), Lysine demethylase 5A (Kdm5a), CAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), Paternal expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISL·LIM homeobox 1 (Isl1), Zinc finger and BTB domain containing 38 (Zbtb38), Limb bud and heart development (Lbh), TubbyBipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / nodal 1 homeobox 2 (Pknox2), AT-rich interacting domain 3B (Arid3b), MLX interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), Spalt-like transcription factor 1 (Sall1), SIX homeobox 2 (Six2), Spalt-like The nucleic acid vector of any one of E4 to E6, which is a transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor-independent 1 transcriptional repressor (Gfi1), POU class 4 homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), beta-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), atonal BHLH transcription factor 1 (Atoh1), or an Atoh1 mutant.

[0163] E8. The nucleic acid vector of E7, wherein the protein is Atoh1. E9. The nucleic acid vector of E7, wherein the Atoh1 mutant has one or more amino acid substitutions selected from the group consisting of S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334.

[0164] E10. The nucleic acid vector according to any one of E2 to E9, further comprising a first inverted terminal repeat 5' of the polynucleotide and 3' of the transgene, and optionally including, in 5' to 3' order, a post-transcriptional regulatory element, a polyadenylation signal, and a second inverted terminal repeat.

[0165] E11. The nucleic acid vector of E10, comprising: a first inverted terminal repeat 5' from nucleotides 219 to 3831 of SEQ ID NO: 10, said first inverted terminal repeat 5' from nucleotides 219 to 3831 of SEQ ID NO: 10, said 5' inverted terminal repeat having at least 80% sequence identity to nucleotides 1 to 130 of SEQ ID NO: 10; and a second inverted terminal repeat 3' from nucleotides 219 to 3831 of SEQ ID NO: 10, said 3' inverted terminal repeat having at least 80% sequence identity to nucleotides 3919 to 4048 of SEQ ID NO: 10.

[0166] E12. The nucleic acid vector of E10, comprising: a first inverted terminal repeat 5' from nucleotides 219 to 3822 of SEQ ID NO:11, said first inverted terminal repeat 5' from nucleotides 219 to 3822 of SEQ ID NO:11, said 5' inverted terminal repeat having at least 80% sequence identity to nucleotides 1 to 130 of SEQ ID NO:11; and a second inverted terminal repeat 3' from nucleotides 219 to 3822 of SEQ ID NO:11, said 3' inverted terminal repeat having at least 80% sequence identity to nucleotides 3910 to 4039 of SEQ ID NO:11.

[0167] E13. The nucleic acid vector according to any one of E1 to E12, wherein the nucleic acid vector is a viral vector, a plasmid, a cosmid, or an artificial chromosome. E14. The nucleic acid vector of E13, wherein the nucleic acid vector is a viral vector selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus.

[0168] E15. The nucleic acid vector of E14, wherein the viral vector is an AAV vector. E16. The nucleic acid vector of E15, wherein the AAV vector has an AAV1, AAV2, AAV2quad(YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S capsid.

[0169] E17. A composition comprising the nucleic acid vector according to any one of E1 to E16. E18. The composition of E17, further comprising a pharma- ceutically acceptable carrier, diluent, or excipient.

[0170] E19. A polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity) to SEQ ID NO:1 operably linked to a transgene.

[0171] E20. The polynucleotide of E19, wherein said transgene is a heterologous transgene. E21. The polynucleotide of E20, wherein the transgene encodes a protein, shRNA, ASO, nuclease, or microRNA.

[0172] E22. The proteins include Sox9, Sall2, Camta1, Hey2, Gata2, Hey1, Lass2, Sox10, Gata3, Cux1, Nr2f1, Hes1, Rorb, Jun, Zfp667, Lhx3, Nhlh1, Mxd4, Zmiz1, Myt1, Stat3, Barhl1, Tox, Prox1, Nfia, Thrb, Mycl1, Kdm5a, Creb314, Etv1, Peg3, Bach2, I The polynucleotide of E21, which is sl1, Zbtb38, Lbh, Tub, Hmg20, Rest, Zfp827, Aff3, Pknox2, Arid3b, Mlxip, Zfp532, Ikzf2, Sall1, Six2, Sall3, Lin28b, Rfx7, Bdnf, Gfi1, Pou4f3, Myc, Ctnnb1, Sox2, Sox4, Sox11, Tead2, Atoh1, or an Atoh1 mutant.

[0173] E23. The polynucleotide of E22, wherein the protein is Atoh1. E24. A cell comprising the polynucleotide according to any one of E19 to E23 or the nucleic acid vector according to any one of E1 to E16.

[0174] E25. The cell of E24, wherein the cell is a mammalian VSC. E26. The cell of E25, wherein the mammalian VSC is a human VSC. E27. A method for expressing an introduced gene in a mammalian VSC, the method comprising contacting the mammalian VSC with a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0175] E28. The method of E27, wherein the transgene is specifically expressed in VSCs. E29. The method of E27 or E28, wherein the mammalian VSC is a human VSC.

[0176] E30. A method for treating a subject having or at risk of developing a vestibular dysfunction, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0177] E31. The method of E30, wherein said vestibular dysfunction comprises dizziness, vertigo, disequilibrium, bilateral vestibular hypofunction (also known as bilateral vestibular insufficiency), oscillopsia, or balance disorders.

[0178] E32. The method according to E30 or E31, wherein the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease- or infection-related vestibular dysfunction, or ototoxic drug-induced vestibular dysfunction.

[0179] E33. The method according to any one of E30 to E32, wherein the vestibular dysfunction is associated with a genetic mutation. E34. The method of E30 or E31, wherein the vestibular dysfunction is idiopathic vestibular dysfunction.

[0180] E35. A method for inducing or enhancing vestibular hair cell regeneration in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0181] E36. A method for inducing or increasing VSC proliferation in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0182] E37. A method for inducing or increasing vestibular hair cell proliferation in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0183] E38. A method for inducing or enhancing vestibular hair cell maturation (e.g., maturation of regenerated hair cells) in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0184] E39. A method for inducing or enhancing vestibular hair cell innervation in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0185] E40. A method for increasing VSC and / or vestibular hair cell survival in a subject in need thereof, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0186] E41. The method of any one of E35 to E40, wherein the subject has or is at risk of developing a vestibular dysfunction (e.g., dizziness, vertigo, disequilibrium, bilateral vestibular hypofunction (bilateral vestibular insufficiency), oscillopsia, or balance disorder).

[0187] E42. A method for treating a subject having or at risk of developing bilateral vestibular hypofunction (also known as bilateral vestibular dysfunction), comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0188] E43. A method for treating a subject having or at risk of developing oscillopsia, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0189] E44. The method of E42 or E43, wherein the bilateral vestibular hypofunction or the oscillopsis is ototoxic drug-induced bilateral vestibular hypofunction or ototoxic drug-induced oscillopsis. E45. The method of E32 or E44, wherein said ototoxic drug is selected from the group consisting of aminoglycosides, antitumor drugs, ethacrynic acid, furosemide, salicylates, and quinines.

[0190] E46. A method for treating a subject having or at risk of developing a balance disorder, comprising administering to the subject an effective amount of a nucleic acid vector described in any one of E1 to E16, or a composition described in E17 or E18.

[0191] E47. The method of any one of E30 to E46, wherein the method further comprises assessing vestibular function of the subject prior to administering the nucleic acid vector or the composition. E48. The method of any one of E30 to E47, wherein the method further comprises evaluating vestibular function of the subject after administering the nucleic acid vector or the composition.

[0192] E49. The method of any one of E30 to E48, wherein the nucleic acid vector or composition is administered locally. E50. The method of E49, wherein the nucleic acid vector or the composition is administered to the semicircular canal.

[0193] E51. The method of E49, wherein the nucleic acid vector or the composition is administered transtympanically or intratympanically. E52. The method of E49, wherein the nucleic acid vector or the composition is administered into the perilymph.

[0194] E53. The method of E49, wherein the nucleic acid vector or the composition is administered into the endolymph. E54. The method of E49, wherein the nucleic acid vector or the composition is administered to or through the oval window.

[0195] E55. The method of E49, wherein the nucleic acid vector or the composition is administered to or through the round window. E56. The method of any one of E30-E55, wherein the nucleic acid vector or composition is administered in an amount sufficient to prevent or reduce vestibular dysfunction, delay onset of vestibular dysfunction, delay progression of vestibular dysfunction, improve vestibular function, increase vestibular hair cell number, improve vestibular hair cell maturation (e.g., maturation of regenerated hair cells), increase vestibular hair cell proliferation, improve vestibular hair cell regeneration, improve vestibular hair cell innervation, increase VSC proliferation, increase VSC number, increase VSC survival, increase vestibular hair cell survival, or improve VSC function.

[0196] E57. The method of any one of E30 to E56, wherein the subject is a human. E58. A kit comprising the nucleic acid vector according to any one of E1 to E16, or the composition according to E17 or E18.

[0197] Other embodiments Various modifications and variations of the invention described herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unnecessarily limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. Other embodiments are found within the scope of the claims.

Claims

1. A nucleic acid vector comprising a solute carrier family 6 member 14 (SLC6A14) promoter comprising a polynucleotide sequence having at least 85% sequence identity to SEQ ID NO:

1.

2. The nucleic acid vector of claim 1 , wherein the SLC6A14 promoter has the sequence of SEQ ID NO:

1.

3. The nucleic acid vector of claim 1 , wherein the SLC6A14 promoter is operably linked to a transgene.

4. The nucleic acid vector of claim 3 , wherein the transgene is a heterologous transgene.

5. 4. The nucleic acid vector of claim 3, wherein the transgene encodes a protein, a short hairpin RNA (shRNA), an antisense oligonucleotide (ASO), a nuclease, or a microRNA.

6. The nucleic acid vector of claim 5 , wherein the transgene encodes a protein.

7. The proteins include Atonal BHLH transcription factor 1 (Atoh1), Spalt-like transcription factor 2 (Sall2), Calmodulin-binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), S RY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2 group F member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), Nesc ent helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4), zinc finger MIZ-Type containing 1 (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-associated high mobility group box (Tox), Prospero homeobox 1 (Prox1), nuclear factor IA (Nfia), thyroid hormone receptor β (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), lysine demethylase 5A (Kdm5a), cAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), paternally expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISL LIM homeobox 1 (Isl1), zinc finger and BTB domain containing 38 (Zbtb38), limb bud and heart development (Lbh), and TubbyBipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / Knotted 1 homeobox 2 (Pknox2), AT-rich interacting domain 3B (Arid3b), MLX interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), spalt-like transcription factor 1 (Sall1), SIX homeobox 7. The nucleic acid vector of claim 6, wherein the nucleic acid vector is selected from the group consisting of Six2, Spalt-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor independent 1 transcriptional repressor (Gfi1), POU class 4 homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), and Atoh1 mutant.

8. The nucleic acid vector of claim 7 , wherein the protein is Atoh1.

9. The nucleic acid vector of claim 3, further comprising a first inverted terminal repeat sequence 5' of the SLC6A14 promoter, 3' of the introduced gene, and optionally including post-transcriptional regulatory elements, a polyadenylation signal, and a second inverted terminal repeat sequence in 5' to 3' order.

10. 10. The nucleic acid vector of claim 9, comprising: a first inverted terminal repeat sequence 5' from nucleotides 219 to 3831 of SEQ ID NO:10, wherein the 5' inverted terminal repeat sequence has at least 80% sequence identity to nucleotides 1 to 130 of SEQ ID NO:10; and a second inverted terminal repeat sequence 3' from nucleotides 219 to 3831 of SEQ ID NO:10, wherein the 3' inverted terminal repeat sequence has at least 80% sequence identity to nucleotides 3919 to 4048 of SEQ ID NO:

10.

11. 10. The nucleic acid vector of claim 9, comprising: a first inverted terminal repeat sequence 5' from nucleotides 219 to 3822 of SEQ ID NO:11, said first inverted terminal repeat sequence 5' from nucleotides 219 to 3822 of SEQ ID NO:11, said 5' inverted terminal repeat sequence having at least 80% sequence identity to nucleotides 1 to 130 of SEQ ID NO:11; and a second inverted terminal repeat sequence 3' from nucleotides 219 to 3822 of SEQ ID NO:11, said 3' inverted terminal repeat sequence having at least 80% sequence identity to nucleotides 3910 to 4039 of SEQ ID NO:

11.

12. The nucleic acid vector according to any one of claims 1 to 11, wherein the nucleic acid vector is a plasmid.

13. The nucleic acid vector according to any one of claims 1 to 11, wherein the nucleic acid vector is an adeno-associated virus (AAV) vector.

14. The nucleic acid vector of claim 13, wherein the AAV vector has an AAV8 capsid.

15. A pharmaceutical composition comprising the nucleic acid vector described in any one of claims 1 to 11 and a pharma- ceutically acceptable carrier, diluent or excipient.

16. A composition comprising a nucleic acid vector according to any one of claims 1 to 11 for use in a method for expressing a transgene in a mammalian vestibular supporting cell (VSC).

17. The composition of claim 16 , wherein the mammalian VSC is a human VSC.

18. A composition comprising the nucleic acid vector of any one of claims 1 to 11 for use in a method for treating a subject having or at risk of developing a vestibular dysfunction.

19. 12. A composition comprising a nucleic acid vector according to any one of claims 1 to 11 for use in a method for inducing or enhancing vestibular hair cell regeneration in a subject in need thereof.

20. 12. A composition comprising the nucleic acid vector of any one of claims 1 to 11 for use in a method for treating a subject having or at risk of developing bilateral vestibular hypofunction.

Images