CAR T cell therapy methods

Abstract

The present disclosure provides a method of preconditioning a subject for chimeric antigen receptor (CAR) T cell therapy. The method includes administering to the subject a composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, at least one day before administering CAR T cell therapy to the subject. The present disclosure also provides a method of treating a solid tumor in a subject, the method includes administering to a subject comprising a surface antigen-negative solid tumor a first composition comprising nanoparticles, the nucleic acid in the nanoparticles encoding a surface antigen, and a second composition comprising CAR T cells targeting the surface antigen.

Description

[Technical field]

[0001] The present application relates to the use of multi-layered nanoparticles to enhance chimeric antigen receptor T cell therapy.

[0002] Grant Disclosure This invention was made with United States Government support under Grant Nos. K08 CA199224 and R37 CA251978 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] CROSS-REFERENCE AND INCORPORATION BY REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 186,057, filed May 7, 2021, and U.S. Provisional Patent Application No. 63 / 313,057, filed February 23, 2022, the disclosures of which are incorporated herein by reference in their entireties. International Application No. PCT / US20 / 42606, filed July 17, 2020, International Application No. PCT / US21 / 16925, filed February 5, 2021, and International Application No. PCT / US21 / 18831, filed February 19, 2021, are also incorporated herein by reference in their entireties.

[0004] The sequence listing, which is part of this disclosure, is submitted as a text file at the same time as the specification. The name of the text file containing the sequence listing is "56528_Seqlisting.txt", which was created on May 6, 2022, and is 1,881 bytes in size. The contents of the sequence listing are incorporated herein by reference in their entirety. [Background technology]

[0005] Chimeric antigen receptor (CAR) T cells are T lymphocytes genetically engineered to express receptors that recognize specific cell surface antigens, such as cancer cell antigens. The promise of CAR T therapy has been realized for blood-borne cancers, such as leukemia, lymphoma, and multiple myeloma. However, CAR T cell therapy is still in its infancy, and despite many advances in the underlying technology, significant obstacles to widespread use remain. For example, CAR-T cell therapy has not yet been successful against solid tumors. A key challenge is the poor ability of CAR T cells to traffic to and infiltrate solid tumors, and the tumor microenvironment is primarily immunosuppressive. Notably, regulatory T cells, myeloid-derived suppressor cells, and tumor-associated macrophages (TAMs) express cell surface ligands (e.g., CD80 / CD86) that bind to inhibitory receptors (e.g., CTLA-4) on T cells, and secrete soluble factors that suppress or induce apoptosis in T cells. Another major barrier to the efficacy of CAR T-cell therapy in solid tumors is the heterogeneity of surface antigens or lack of expression of surface antigens within solid tumors. These challenges have hindered progress in applying CAR T-cell therapy to the majority of cancer patients with solid tumors.

[0006] In addition, conditioning therapy is generally required prior to CAR T cell administration. Lymphodepletion (LD) conditioning prior to CAR T cell administration is believed to create a "favorable" environment for CAR T cell proliferation and survival by eliminating regulatory T cells. LD conditioning often involves administration of chemotherapy agents such as cyclophosphamide, fludarabine, pentostatin, or bendamustine, or total body radiation. A cycle of LD conditioning, e.g., administration of chemotherapy over 1-5 days, is usually administered 2-14 days prior to infusion of CAR T cells to create "space" for CAR T cells to proliferate and activate. All CAR T cell therapeutics currently approved by the US Food and Drug Administration require a chemotherapy-based lymphodepletion conditioning therapy prior to infusion of the CAR T cell product. Although lymphodepletion conditioning therapy is tolerated by patients, it is often associated with significant side effects and places patients at significant risk of infection.

[0007] For example, there remains a need for CAR T cell therapeutic regimens that improve efficacy, expand the patient population that benefits from CAR T cell therapy, and minimize unwanted side effects. Summary of the Invention

[0008] The present disclosure provides a method of preconditioning a subject for chimeric antigen receptor (CAR) T-cell therapy. The method includes administering to the subject a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core, and (ii) at least two nucleic acid layers, each nucleic acid layer disposed between cationic lipid bilayers. The composition is administered to the subject at least one day prior to administering CAR T-cell therapy to the subject. In various aspects, the method further includes administering CAR T-cell therapy to the subject. Optionally, the first composition is administered 2-14 days (e.g., about 5 to about 8 days, such as 7 days) prior to administering CAR T-cell therapy to the subject. Also, in various aspects of the present disclosure, the subject is not administered lymphodepletion therapy within 21 days prior to administering CAR T-cell therapy. In an exemplary embodiment, the nanoparticles include at least three nucleic acid layers (e.g., at least four or at least five nucleic acid layers), each of which is disposed between cationic lipid bilayers. In various embodiments, the outermost layer of the nanoparticle comprises a cationic lipid bilayer. In various examples, the surface comprises a plurality of hydrophilic portions of the cationic lipids of the cationic lipid bilayer. In exemplary embodiments, the core comprises a cationic lipid bilayer. Optionally, the core comprises less than about 0.5% by weight of nucleic acid. The diameter of the nanoparticle is, in various embodiments, about 50 nm to about 250 nm in diameter, optionally about 70 nm to about 200 nm in diameter. In exemplary examples, the nanoparticle is characterized by a zeta potential of about +40 mV to about +60 mV, optionally about +45 mV to about +55 mV. The zeta potential of the nanoparticle is, in various examples, about +50 mV. In some embodiments, the nucleic acid molecules are present in a nucleic acid molecule:cationic lipid ratio of about 1 to about 5 to about 1 to about 25, optionally about 1 to about 15, about 1 to about 10, or about 1 to about 7.5. In various embodiments, the nucleic acid molecule is an RNA molecule, optionally messenger RNA (mRNA). In various embodiments, the mRNA is in vitro transcribed mRNA, and the in vitro transcription template is cDNA made from RNA extracted from tumor cells. In various embodiments, the nanoparticles comprise a mixture of RNA, such as RNA isolated from human tumors.In various embodiments, the nucleic acid does not encode a tumor antigen recognized by the CAR T cell. In various embodiments, the subject is afflicted with a solid tumor, such as glioblastoma, medulloblastoma, diffuse intrinsic pontine glioma, peripheral tumors with metastatic involvement of the central nervous system, or osteosarcoma.

[0009] The present disclosure further contemplates the use of a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer disposed between cationic lipid bilayers, for preconditioning a subject for CAR T cell therapy, wherein the composition is administered to the subject at least one day prior to administering CAR T cell therapy to the subject. The use of the nanoparticles in the preparation of a medicament for preconditioning a subject for CAR T cell therapy is also contemplated, as are the nanoparticle compositions described herein for use in preconditioning a subject for CAR T cell therapy.

[0010] The present disclosure also provides a method of treating a solid tumor in a subject. The method comprises administering to a subject with a surface antigen-negative solid tumor a first composition comprising a nanoparticle comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, the nucleic acid encoding the surface antigen. A second composition comprising T cells expressing a chimeric antigen receptor (CAR) that targets the surface antigen is also administered to the subject. Optionally, the first composition is administered at least one day prior to the second composition comprising CAR T cells. Also, in various aspects of the present disclosure, the subject is not administered a lymphodepleting therapy within 21 days prior to administering the CAR T cell therapy. In an exemplary embodiment, the nanoparticle comprises at least three nucleic acid layers (e.g., at least four or at least five nucleic acid layers), each of which is disposed between cationic lipid bilayers. In various aspects, the outermost layer of the nanoparticle comprises a cationic lipid bilayer. In various examples, the surface comprises a plurality of hydrophilic portions of the cationic lipids of the cationic lipid bilayer. In exemplary embodiments, the core comprises a cationic lipid bilayer. Optionally, the core comprises less than about 0.5% by weight of nucleic acid. The diameter of the nanoparticles is, in various embodiments, about 50 nm to about 250 nm in diameter, optionally about 70 nm to about 200 nm in diameter. In exemplary examples, the nanoparticles are characterized by a zeta potential of about +40 mV to about +60 mV, optionally about +45 mV to about +55 mV. The zeta potential of the nanoparticles is, in various examples, about +50 mV. In some embodiments, the nucleic acid molecules are present in a nucleic acid molecule:cationic lipid ratio of about 1 to about 5 to about 1 to about 25, optionally about 1 to about 15, about 1 to about 10, or about 1 to about 7.5. In various aspects, the nucleic acid molecule is an RNA molecule, optionally messenger RNA (mRNA). In various aspects, the solid tumor is present in the lung, liver, bone, spleen, or lymph node. An exemplary solid tumor is osteosarcoma. In various aspects, the surface antigen is CD70, and the CAR T cell expresses a CAR that binds to CD70.

[0011] The present disclosure also provides a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, the nucleic acid encoding a surface antigen, and a second composition comprising CAR T cells targeting the surface antigen, for treating a surface antigen-negative solid tumor in a subject. Optionally, the first composition is administered at least one day before the second composition (comprising CAR T cells). The use of the nanoparticles in the preparation of a medicament for treating a surface antigen-negative solid tumor with CAR T cell therapy is also contemplated, as are the nanoparticle compositions described herein for use in treating a surface antigen-negative solid tumor with CAR T cell therapy.

[0012] Additional embodiments and aspects of the presently disclosed nanoparticles, pharmaceutical compositions, and methods are provided below. [Brief description of the drawings]

[0013] [Figure 1A] FIG. 1 is a series of illustrations of general schemes for deriving lipid bilayers, liposomes, and multilamellar (ML) RNA NPs (boxed). [Figure 1B] A pair of CEM images of uncomplexed NPs (left) and ML RNA NPs (right). [Figure 2A] FIG. 1 is an illustration of a general scheme for directing cationic RNA lipoplexes. [Figure 2B] FIG. 1 is an illustration of a general scheme for directing anionic RNA lipoplexes. [Figure 2C] CEM image of uncomplexed NPs. [Figure 2D] This is a CEM image of RNA LPX. [Figure 2E] CEM image of ML RNA NPs. [Figure 2F]FIG. 1 is a graph of %CD86+ of CD11c+MHC class II+ splenocytes present in the spleens of mice treated with ML RNA NP (ML RNA-NP), RNA LPX, or anionic LPX, or untreated mice. [Figure 2G] 1 is a graph of %CD44+CD62L+ of CD8+ splenocytes present in the spleens of mice treated with ML RNA NP (ML RNA-NP), RNA LPX, or anionic LPX, or untreated mice. [Figure 2H] 1 is a graph of %CD44+CD62L of CD4+ splenocytes present in the spleens of mice treated with ML RNA NP (ML RNA-NP), RNA LPX, or anionic LPX, or untreated mice. [Figure 2I] Graph of % survival of mice treated with ML RNA NP (ML RNA-NP), RNA LPX, or anionic LPX, or untreated. [Figure 2J] 1 is a graph of the amount of IFN-α produced in mice treated with ML RNA NP (ML RNA-NP), RNA LPX, or anionic LPX, or in untreated mice. [Figure 3A] Graph of % expression of CD8 or CD44 and CD8 on CD3+ cells plotted as a function of time after administration of ML RNA NPs. [Figure 3B] Graph of % PDL1, MHC II, CD86, or CD80 expression of CD11c+ cells plotted as a function of time after administration of ML RNA NPs. [Figure 3C] Graph of % CD44 and CD8 expression on CD3+ cells plotted as a function of time after administration of ML RNA NPs. [Figure 3D] Graph of % survival of dogs treated with ML RNA NPs compared to median survival (dotted line). [Figure 3E] Illustrates the percentage of lymphocytes induced (y-axis) after administration of ML RNA-NPs (x-axis) in a dog model. [Figure 3F]Illustrates interferon-α production (pg / mL, y-axis) several hours after administration of ML RNA-NPs in a canine model. [Figure 3G] Illustrates the increase in CD80+ expression (% expression, y-axis) on Cd11c+ cells several hours after administration of ML RNA-NPs (x-axis). [Figure 3H] Illustrates the expression of CD8 and CD44+CD8+ cells several hours (x-axis) following administration of ML RNA-NP to canine subjects. [Figure 4] A is a timeline of long-term survival subject treatment. The first and second tumor inoculations are shown. B is a graph of the survival rate of animals after the second tumor inoculation for each of the three groups of mice. Two groups were treated with ML RNA NPs containing non-specific RNA (RNA not specific to the tumor in the subject; Green Fluorescence Protein (GFP) or pp65) before the second tumor inoculation, and one group was treated with ML RNA NPs containing tumor-specific RNA before the second tumor inoculation, or untreated animals before the second tumor inoculation. The survival rate of the control group is marked as "untreated". [Diagram 5] Graph of the percentage of surviving mice in groups treated with ML RNA NPs alone (RNA-NP) or in combination with PDL1 monoclonal antibody (RNA-NP+PDL1 mAb) as a function of time (days) after tumor implantation. Control groups included untreated mice (naive), mice treated with ML NPs without any RNA (NP alone), and mice treated with PDL1 monoclonal antibody only (PDL1 mAb). *p<0.05, Gehan-Breslow-Wilcox. [Figure 6A] 6A and 6B are line graphs illustrating melanoma tumor volume (mm3) at various days after tumor implantation (FIG. 6A), survival rate in a sarcoma model (FIG. 6B), and survival rate in a metastatic lung model (FIG. 6C). These figures show that the ML RNA-NPs of the present disclosure mediate effective anti-tumor immune responses against immunologically cold tumors in vivo. [Figure 6B]6A and 6B are line graphs illustrating melanoma tumor volume (mm3) at various days after tumor implantation (FIG. 6A), survival rate in a sarcoma model (FIG. 6B), and survival rate in a metastatic lung model (FIG. 6C). These figures show that the ML RNA-NPs of the present disclosure mediate effective anti-tumor immune responses against immunologically cold tumors in vivo. [Figure 6C] 6A and 6B are line graphs illustrating melanoma tumor volume (mm3) at various days after tumor implantation (FIG. 6A), survival rate in a sarcoma model (FIG. 6B), and survival rate in a metastatic lung model (FIG. 6C). These figures show that the ML RNA-NPs of the present disclosure mediate effective anti-tumor immune responses against immunologically cold tumors in vivo. [Figure 7A] Figure 7A shows that non-specific ML RNA-NPs of the present disclosure mediate significant anti-tumor efficacy. Figure 7A: Tumor volume (mm3) of C57Bl / 6 mice (7-8 mice / group) bearing subcutaneous B16F0 tumors were vaccinated once a week (x3) with luciferase RNA-NPs or treated twice a week (x3) with PD-L1-mAb. Figure 7B: Survival plot (% survival; y-axis) of BALB / c mice (8 mice / group) inoculated with K7M2 lung tumors and vaccinated with GFP RNA-NPs (x3) three times a week or PD-L1 mAb twice a week. Figure 7C: Non-specific RNA-NPs (luciferase) sensitize responses to ICIs (immune checkpoint inhibitors) in a checkpoint-resistant mouse tumor model (B16F0). Tumor volume (mm3) is provided on the y-axis and days after tumor implantation are provided on the x-axis. [Figure 7B]Figure 7A shows that non-specific ML RNA-NPs of the present disclosure mediate significant anti-tumor efficacy. Figure 7A: Tumor volume (mm3) of C57Bl / 6 mice (7-8 mice / group) bearing subcutaneous B16F0 tumors were vaccinated once a week (x3) with luciferase RNA-NPs or treated twice a week (x3) with PD-L1-mAb. Figure 7B: Survival plot (% survival; y-axis) of BALB / c mice (8 mice / group) inoculated with K7M2 lung tumors and vaccinated with GFP RNA-NPs (x3) three times a week or PD-L1 mAb twice a week. Figure 7C: Non-specific RNA-NPs (luciferase) sensitize responses to ICIs (immune checkpoint inhibitors) in a checkpoint-resistant mouse tumor model (B16F0). Tumor volume (mm3) is provided on the y-axis and days after tumor implantation are provided on the x-axis. [Figure 7C] Figure 7A shows that non-specific ML RNA-NPs of the present disclosure mediate significant anti-tumor efficacy. Figure 7A: Tumor volume (mm3) of C57Bl / 6 mice (7-8 mice / group) bearing subcutaneous B16F0 tumors were vaccinated once a week (x3) with luciferase RNA-NPs or treated twice a week (x3) with PD-L1-mAb. Figure 7B: Survival plot (% survival; y-axis) of BALB / c mice (8 mice / group) inoculated with K7M2 lung tumors and vaccinated with GFP RNA-NPs (x3) three times a week or PD-L1 mAb twice a week. Figure 7C: Non-specific RNA-NPs (luciferase) sensitize responses to ICIs (immune checkpoint inhibitors) in a checkpoint-resistant mouse tumor model (B16F0). Tumor volume (mm3) is provided on the y-axis and days after tumor implantation are provided on the x-axis. [Figure 8A]RNA-NPs sensitize responses to CAR T cells. Figure 8A is a line graph illustrating tumor size (y-axis, fluorescence as a proxy for tumor size) at various days after tumor implantation (x-axis). Subjects were irradiated (5Gy) 24 hours prior to CAR T cell administration. This study utilized KR158 cells expressing CD70 (CD70KR158) prior to implantation. In this RNA-NP-resistant tumor model (CD70KR158), a significant synergistic effect was observed when CD70 CAR T cells (administered at 1x107) were administered together with nanoparticles containing nucleic acid encoding CD70. RNA-NPs (encoding CD70) were administered weekly starting 24 hours after CAR T cell infusion (p=0.05). Figure 8B is a bar graph illustrating the number of CAR T cells in peripheral blood (y-axis) with and without RNA-NP combination therapy (x-axis). Six hours after administration of RNA-NPs, RNA-NPs induced CD70 CAR T cell mobilization from peripheral blood (*, p=0.0179). [Figure 8B] RNA-NPs sensitize responses to CAR T cells. Figure 8A is a line graph illustrating tumor size (y-axis, fluorescence as a proxy for tumor size) at various days after tumor implantation (x-axis). Subjects were irradiated (5Gy) 24 hours prior to CAR T cell administration. This study utilized KR158 cells expressing CD70 (CD70KR158) prior to implantation. In this RNA-NP-resistant tumor model (CD70KR158), a significant synergistic effect was observed when CD70 CAR T cells (administered at 1x107) were administered together with nanoparticles containing nucleic acid encoding CD70. RNA-NPs (encoding CD70) were administered weekly starting 24 hours after CAR T cell infusion (p=0.05). Figure 8B is a bar graph illustrating the number of CAR T cells in peripheral blood (y-axis) with and without RNA-NP combination therapy (x-axis). Six hours after administration of RNA-NPs, RNA-NPs induced CD70 CAR T cell mobilization from peripheral blood (*, p=0.0179). [Figure 9A]RNA-NP induces IFN-α surge, activation of peripheral DCs, and margination of lymphocytes in dogs with advanced malignant tumors as early as 2 hours after injection. Figure 9A is a line graph illustrating IFN-α levels (pg / mL, y-axis) at various time points (pre-administration, 2 hours, and 6 hours after administration of RNA-NP; x-axis). Figure 9B is a line graph illustrating %CD80+ dendritic cells (y-axis) at various time points (pre-administration, 2 hours, 6 hours, 1 week, 2 weeks, and 6 weeks after administration of RNA-NP; x-axis). Figure 9C is a line graph illustrating absolute lymphocyte counts (K / μL; y-axis) at various time points (pre-administration, 2 hours, 6 hours, 1 week, 2 weeks, and 6 weeks after administration of RNA-NP; x-axis). [Figure 9B] RNA-NP induces IFN-α surge, activation of peripheral DCs, and margination of lymphocytes in dogs with advanced malignant tumors as early as 2 hours after injection. Figure 9A is a line graph illustrating IFN-α levels (pg / mL, y-axis) at various time points (pre-administration, 2 hours, and 6 hours after administration of RNA-NP; x-axis). Figure 9B is a line graph illustrating %CD80+ dendritic cells (y-axis) at various time points (pre-administration, 2 hours, 6 hours, 1 week, 2 weeks, and 6 weeks after administration of RNA-NP; x-axis). Figure 9C is a line graph illustrating absolute lymphocyte counts (K / μL; y-axis) at various time points (pre-administration, 2 hours, 6 hours, 1 week, 2 weeks, and 6 weeks after administration of RNA-NP; x-axis). [Figure 9C] RNA-NP induces IFN-α surge, activation of peripheral DCs, and margination of lymphocytes in dogs with advanced malignant tumors as early as 2 hours after injection. Figure 9A is a line graph illustrating IFN-α levels (pg / mL, y-axis) at various time points (pre-administration, 2 hours, and 6 hours after administration of RNA-NP; x-axis). Figure 9B is a line graph illustrating %CD80+ dendritic cells (y-axis) at various time points (pre-administration, 2 hours, 6 hours, 1 week, 2 weeks, and 6 weeks after administration of RNA-NP; x-axis). Figure 9C is a line graph illustrating absolute lymphocyte counts (K / μL; y-axis) at various time points (pre-administration, 2 hours, 6 hours, 1 week, 2 weeks, and 6 weeks after administration of RNA-NP; x-axis). [Figure 10A]In vitro anti-tumor specific killing. Figure 10A shows anti-tumor specific IFN-γ release after co-culture of CD70+ tumors with CD70-directed CAR T cells in K7M2 OSA mouse solid tumor model (2-way ANOVA, Turkey's multiple comparisons). K7M2 cells expressed CD70 before testing. Figure 10B shows anti-tumor specific killing correlated with increasing CAR T dose. [Figure 10B] In vitro anti-tumor specific killing. Figure 10A shows anti-tumor specific IFN-γ release after co-culture of CD70+ tumors with CD70-directed CAR T cells in K7M2 OSA mouse solid tumor model (2-way ANOVA, Turkey's multiple comparisons). K7M2 cells expressed CD70 before testing. Figure 10B shows anti-tumor specific killing correlated with increasing CAR T dose. [Figure 11] In a surface antigen-negative tumor model (K7M2 cells that did not express CD70 before implantation), administration of RNA-NPs containing nucleic acids encoding CD70 sensitized solid tumors to CD70 CAR T cells. RNA-NPs (iv) were administered 5 days after K7M2 tail vein inoculation, 7 days after CAR T administration, and weekly thereafter (x3) - (8 / group; p=0.03). "WT-NP" contains CD70-negative total tumor-derived mRNA. Survival of untreated subjects and subjects administered CD70 CAR T cells was less than 30 days. Administration of WT-NPs, NPs encoding CD70, and WT-NPs in combination with CD70 CAR T cells extended survival. Notably, administration of NPs encoding CD70 in combination with CD70 CAR T cells significantly improved survival, far beyond the other treatments offered. [Figure 12A] 12A and 12B are line graphs showing the % of CD70+ splenocytes (FIG. 12A) and % of CD70+ hepatocytes (FIG. 12B) 36 hours after injection of nanoparticles of the present disclosure (5 micrograms and 25 micrograms) containing RNA encoding CD70. Mice were injected with RNA-NPs and organs (spleen and liver) were harvested to characterize CD70 expression. Systemic administration of NPs resulted in antigen expression in splenocytes and liver. [Figure 12B]12A and 12B are line graphs showing the % of CD70+ splenocytes (FIG. 12A) and % of CD70+ hepatocytes (FIG. 12B) 36 hours after injection of nanoparticles of the present disclosure (5 micrograms and 25 micrograms) containing RNA encoding CD70. Mice were injected with RNA-NPs and organs (spleen and liver) were harvested to characterize CD70 expression. Systemic administration of NPs resulted in antigen expression in splenocytes and liver. [Figure 13A] The results of transduction studies and in vitro killing of tumor cells are illustrated. Figure 13A includes plots showing the expression of CD70 in dendritic cells (DC2.4) and brain tumor cells (KR158) after application of NPs encoding CD70. DC2.4 and KR158 cells do not naturally express CD70. Approximately 73% of DC2.4 cells and approximately 95% of KR158 cells expressed CD70 after exposure to NPs. Figure 13B is a line graph illustrating the effect of NPs containing non-specific RNA (RNA encoding ovalbumin (OVA)), NPs containing RNA encoding CD70, OVANPs in combination with CD70-targeted CAR T cells, and CD70NPs in combination with CD70-targeted CAR T cells on tumor cell viability. KR158 cells, which do not naturally express CD70, were utilized in this in vitro assay, which measured luminescence as a proxy for tumor cell viability (y-axis). The effector cell (CAR T cell) to target cell (tumor) ratio is depicted on the x-axis. The combination of CD70 CAR T cells with CD70-encoding NP mediated a significant reduction in viable tumor cells (i.e., the combination caused significantly more tumor cell death than the other treatments). [Figure 13B]The results of transduction studies and in vitro killing of tumor cells are illustrated. Figure 13A includes plots showing the expression of CD70 in dendritic cells (DC2.4) and brain tumor cells (KR158) after application of NPs encoding CD70. DC2.4 and KR158 cells do not naturally express CD70. Approximately 73% of DC2.4 cells and approximately 95% of KR158 cells expressed CD70 after exposure to NPs. Figure 13B is a line graph illustrating the effect of NPs containing non-specific RNA (RNA encoding ovalbumin (OVA)), NPs containing RNA encoding CD70, OVANPs in combination with CD70-targeted CAR T cells, and CD70NPs in combination with CD70-targeted CAR T cells on tumor cell viability. KR158 cells, which do not naturally express CD70, were utilized in this in vitro assay, which measured luminescence as a proxy for tumor cell viability (y-axis). The effector cell (CAR T cell) to target cell (tumor) ratio is depicted on the x-axis. The combination of CD70 CAR T cells with CD70-encoding NP mediated a significant reduction in viable tumor cells (i.e., the combination caused significantly more tumor cell death than the other treatments). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The present disclosure provides materials and methods, for example, to improve the efficacy of chimeric antigen receptor (CAR) T cell therapy and / or expand the patient population that responds to the therapy. For example, the present disclosure provides a method of preconditioning a subject for chimeric antigen receptor (CAR) T cell therapy. The method includes administering to the subject a first composition comprising a nanoparticle (NP), the nanoparticle comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers. The composition is administered to the subject at least one day prior to administering CAR T cell therapy to the subject. Previously, it was generally believed that lymphocyte depletion (LD) conditioning was necessary to achieve optimal T cell proliferation and activation in vivo. LD conditioning serves to purge the lymphocyte population of the subject. Such "negative conditioning" is associated with undesirable side effects such as increased susceptibility to infection, low blood counts, nausea, vomiting, fatigue, and hair loss. Surprisingly, it has been determined that administration of the nanoparticle compositions described herein sufficiently primes the body to receive CAR T cell therapy, thereby making LD conditioning unnecessary. This "positive conditioning" avoids the undesirable side effects associated with LD therapy. Furthermore, administration of the nanoparticle compositions described herein creates an immunological environment that promotes T cell trafficking to solid tumors and enhances activation in an otherwise immunosuppressive tumor microenvironment. The observations described herein represent a paradigm shift in preparing subjects for CAR T cell therapy.

[0015] The present disclosure also provides a method of treating a solid tumor in a subject, wherein the solid tumor is "surface antigen negative", meaning that the tumor does not express a sufficient level of a surface tumor antigen to be clinically responsive to CAR T cell therapy prior to the treatment disclosed herein. The method comprises administering to a subject with a surface antigen negative solid tumor a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, the nucleic acid encoding the surface antigen. The method further comprises administering a second composition comprising T cells expressing a chimeric antigen receptor (CAR) that targets the surface antigen (i.e., CAR T cells). It has been determined that administration of the nanoparticles described herein that contain mRNA encoding the surface antigen targeted by the CAR T cells can convert refractory solid tumors (i.e., tumors that do not respond to CAR T cell therapy due to lack of sufficient levels of surface antigen expression) into tumors that respond to CAR T cell therapy. The materials and methods described herein may open up the possibility of CAR T cell therapy for new patient populations (those with refractory solid tumors) as well as enabling the use of "off-the-shelf" CAR T cell therapies.

[0016] Various aspects of the method are described below. The use of section headings is for ease of reading only. It is to be understood that this disclosure should be read as a whole and that all combinations of features described herein are contemplated.

[0017] Nanoparticles The nanoparticles of the present method include cationic lipids and nucleic acids. As used herein, the term "nanoparticles" refers to particles with a diameter of less than about 1000 nm. The nanoparticles of the present disclosure include cationic lipids that are treated to induce liposome formation, so that the nanoparticles disclosed herein in various aspects include liposomes. Liposomes are artificially prepared vesicles, and in exemplary aspects are mainly composed of lipid bilayers. Liposomes in various examples are used as delivery vehicles for the administration of nutrients and pharmaceuticals. In various embodiments, the liposomes of the present disclosure are of different sizes and the compositions may include one or more of: (a) multilamellar vesicles (MLVs), which may be hundreds of nanometers in diameter and may include a series of concentric bilayers separated by narrow aqueous compartments; (b) small unicellular vesicles (SUVs), which may be, for example, less than 50 nm in diameter; and (c) large unilamellar vesicles (LUVs), which may be, for example, 50-500 nm in diameter. The liposomes in various examples are engineered to include opsonins or ligands to improve attachment of the liposomes to unhealthy tissues or to activate events such as, but not limited to, endocytosis. In exemplary embodiments, the liposomes include a low or high pH to improve delivery of pharmaceutical formulations. In various instances, liposomes are formulated depending on physicochemical properties such as, but not limited to, the encapsulated agent and liposomal components, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the encapsulated substance and its potential toxicity, any additional processes involved during application and / or delivery of the vesicles, optimizing size, polydispersity and shelf life of the vesicles for the intended use, and batch-to-batch reproducibility and the possibility of large-scale production of safe and efficient liposomal products.

[0018] In an exemplary embodiment, the nanoparticle comprises a surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, optionally three or more nucleic acid layers. In an exemplary example, each nucleic acid layer is disposed between lipid layers, e.g., cationic lipid layers. In an exemplary aspect, the nanoparticle is multi-layered, comprising alternating layers of nucleic acid and lipid. In an exemplary embodiment, the nanoparticle comprises at least three nucleic acid layers, each of which is disposed between cationic lipid bilayers. In an exemplary aspect, the nanoparticle comprises at least four or five nucleic acid layers, each of which is disposed between cationic lipid bilayers. In an exemplary aspect, the nanoparticle comprises at least more than five (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) nucleic acid layers, each of which is disposed between cationic lipid bilayers. As used herein, the term "cationic lipid bilayer" refers to a lipid bilayer that comprises, consists essentially of, or consists of cationic lipids or mixtures thereof. Suitable cationic lipids are described herein. As used herein, the term "nucleic acid layer" refers to a layer of the nanoparticles disclosed herein that comprises, consists essentially of, or consists of nucleic acid, e.g., RNA.

[0019] The unique structure of the nanoparticles of the present disclosure results in mechanistic differences in how multilamellar nanoparticles (ML-NPs) exert their biological effects. Previously described RNA-based nanoparticles exert their effects, at least in part, through the toll-like receptor 7 (TLR7) pathway. Surprisingly, the multilamellar nanoparticles of the present disclosure mediate efficacy independent of TLR7. Without wishing to be bound by a particular theory, it appears that intracellular pathogen recognition receptors (PRRs), such as MDA-5, are more relevant to the biological activity of multilamellar nanoparticles than TLRs. This may allow ML RNA-NPs to stimulate multiple intracellular PRRs (e.g., RIG-I, MDA-5) as opposed to a single TLR (e.g., TLR7 in endosomes) to achieve greater release of type I interferons and induction of stronger innate immunity. This may allow RNA-NPs to exhibit superior efficacy with long-term survival benefit.

[0020] In various embodiments, the nanoparticles disclosed herein comprise a positively charged surface. In some examples, the positively charged surface comprises a lipid layer, e.g., a cationic lipid layer. In various embodiments, the outermost layer of the nanoparticle comprises a cationic lipid bilayer. Optionally, the cationic lipid bilayer comprises, consists essentially of, or consists of DOTAP. In various examples, the surface comprises a plurality of hydrophilic portions of the cationic lipids of the cationic lipid bilayer. In some embodiments, the core comprises a cationic lipid bilayer. In various examples, the core is devoid of nucleic acid, and optionally, the core comprises less than about 0.5% by weight of nucleic acid.

[0021] In exemplary embodiments, the nanoparticles have a diameter in the nanometer range, and therefore, in certain instances, are referred to herein as "nanoliposomes" or "liposomes." In exemplary embodiments, the nanoparticles have a diameter of about 50 nm to about 500 nm, e.g., about 50 nm to about 450 nm, about 50 nm to about 400 nm, about 50 nm to about 350 nm, about 50 nm to about 300 nm, about 50 nm to about 250 nm, about 50 nm to about 200 nm, about 50 nm to about 150 nm, about 50 nm to about 100 nm, about 100 nm to about 500 nm, about 150 nm to about 500 nm, about 200 nm to about 500 nm, about 250 nm to about 500 nm, about 300 nm to about 500 nm, about 350 nm to about 500 nm, about 400 nm to about 500 nm. In exemplary embodiments, the nanoparticles are about 50 nm to about 300 nm, e.g., about 100 nm to about 250 nm, about 110 nm±5 nm, about 115 nm±5 nm, about 120 nm±5 nm, about 125 nm±5 nm, about 130 nm±5 nm, about 135 nm±5 nm, about 140 nm±5 nm, about 145 nm±5 nm, about 150 nm±5 nm, about 155 nm±5 nm, about 160 nm±5 nm, about 165 nm±5 nm, m, about 170 nm ± 5 nm, about 175 nm ± 5 nm, about 180 nm ± 5 nm, about 190 nm ± 5 nm, about 200 nm ± 5 nm, about 210 nm ± 5 nm, about 220 nm ± 5 nm, about 230 nm ± 5 nm, about 240 nm ± 5 nm, about 250 nm ± 5 nm, about 260 nm ± 5 nm, about 270 nm ± 5 nm, about 280 nm ± 5 nm, about 290 nm ± 5 nm, or about 300 nm ± 5 nm. In exemplary embodiments, the nanoparticles are about 50 nm to about 250 nm in diameter. In some embodiments, the nanoparticles are about 70 nm to about 200 nm in diameter.

[0022] In an exemplary embodiment, the nanoparticles are present in a pharmaceutical composition that includes a heterogeneous mixture of nanoparticles ranging in diameter, e.g., from about 50 nm to about 500 nm, or from about 50 nm to about 250 nm. Optionally, the pharmaceutical composition includes a heterogeneous mixture of nanoparticles ranging in diameter from about 70 nm to about 200 nm.

[0023] In illustrative examples, the nanoparticles are characterized by a zeta potential of about +40 mV to about +60 mV, e.g., about +40 mV to about +55 mV, about +40 mV to about +50 mV, about +40 mV to about +50 mV, about +40 mV to about +50 mV, about +40 mV to about +45 mV, about +45 mV to about +60 mV, about +50 mV to about +60 mV, about +55 mV to about +60 mV. In illustrative embodiments, the nanoparticles have a zeta potential of about +45 mV to about +55 mV. The zeta potential of the nanoparticles in various examples is about 50 mV. In various embodiments, the zeta potential is greater than +30 mV or +35 mV. Zeta potential is one parameter that distinguishes the nanoparticles of the present disclosure from those described in Sayour et al., Oncoimmunology 6(1):e1256527 (2016).

[0024] In an exemplary embodiment, the nanoparticle comprises a cationic lipid. In some embodiments, the cationic lipid is a low molecular weight cationic lipid, such as those described in US Patent Publication No. 20130090372, the contents of which are incorporated herein by reference in their entirety. The cationic lipid in an exemplary embodiment is a cationic fatty acid, a cationic glycerolipid, a cationic glycerophospholipid, a cationic sphingolipid, a cationic sterol lipid, a cationic prenol lipid, a cationic glycolipid, or a cationic polyketide. In an exemplary embodiment, the cationic lipid comprises two fatty acyl chains, each of which is independently saturated or unsaturated. In some examples, the cationic lipid is a diglyceride. For example, in some examples, the cationic lipid may be a cationic lipid of formula I or formula II,

[0025] [ka]

[0026] wherein each of a, b, n, and m is independently an integer between 2 and 12 (e.g., between 3 and 10). In some embodiments, the cationic lipid is a cationic lipid of formula I, wherein each of a, b, n, and m is independently an integer selected from 3, 4, 5, 6, 7, 8, 9, and 10. In an exemplary embodiment, the cationic lipid is DOTAP (1,2-dioleoyl-3-trimethylammonium-propane), or a derivative thereof. In an exemplary embodiment, the cationic lipid is DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), or a derivative thereof.

[0027] In some embodiments, the nanoparticles include liposomes formed from 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), and MC3 (U.S. Patent Publication No. 20100324120, incorporated herein by reference in its entirety). In some embodiments, the nanoparticles comprise liposomes formed from the synthesis of stabilized plasmid-lipid particles (SPLPs) or stabilized nucleic acid lipid particles (SNALPs), which have previously been described and shown to be suitable for oligonucleotide delivery in vitro and in vivo. In some aspects, the nanoparticles are composed of three to four lipid components in addition to the nucleic acid molecule. In an exemplary aspect, the liposomes comprise 55% cholesterol, 20% distearoylphosphatidyl choline (DSPC), 10% PEG-S-DSG, and 15% 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al., Pharm Res. 2005;22(3):362-72.In an illustrative example, the liposomes comprise 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipid, which can be 1,2-distearloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al., J. Control Release, 2005;107(2):276-87 (2005).

[0028] In some embodiments, the liposomes may contain about 25.0% to about 40.0% cholesterol, about 30.0% to about 45.0% cholesterol, about 35.0% to about 50.0% cholesterol, and / or about 48.5% to about 60% cholesterol. In some embodiments, the liposomes may contain a percentage of cholesterol selected from the group consisting of 28.5%, 31.5%, 33.5%, 36.5%, 37.0%, 38.5%, 39.0%, and 43.5%. In some embodiments, the liposomes may contain about 5.0% to about 10.0% DSPC and / or about 7.0% to about 15.0% DSPC.

[0029] In some embodiments, the liposomes are DiLa2 liposomes (Marina Biotech, Bothell, Wash.), SMARTICLES® (Marina Biotech, Bothell, Wash.), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine)-based liposomes (e.g., for siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708-1713), incorporated herein by reference in its entirety), and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).

[0030] In various examples, the cationic lipid includes 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), or di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), further including neutral lipids, sterols, and molecules capable of reducing particle aggregation, such as PEG or PEG-modified lipids.

[0031] In various embodiments, the liposomes include DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids, and amino alcohol lipids. In some embodiments, the liposomes include cationic lipids such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and amino alcohol lipids. The amino alcohol cationic lipids in some embodiments include lipids described and / or made by the methods described in U.S. Patent Publication No. 20130150625, which is incorporated herein by reference in its entirety. As non-limiting examples, cationic lipids in certain embodiments include 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,2Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (Compound 1 in US Patent Publication No. 20130150625), 2-amino-3-[(9Z)-octadec-9-en-1-yloxy]-2-{[(9Z)-octadec-9-en-1-yloxy]methyl}propan-1-ol (Compound 2 in US Patent Publication No. 20130150625), 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (Compound 3 in US Patent Application Publication No. 20130150625), and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (Compound 4 in US Patent Application Publication No. 20130150625), or any pharma- ceutically acceptable salt or stereoisomer thereof.

[0032] In various embodiments, the liposome comprises (i) at least one lipid selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM; (iii) a sterol, e.g., cholesterol; and (iv) a PEG-lipid, e.g., PEG-DMG or PEG-cDMA, in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol: 0.5-15% PEG-lipid.

[0033] In some embodiments, the liposomes comprise about 25% to about 75% cationic lipid on a molar basis selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), e.g., about 35 to about 65%, about 45 to about 65%, about 60%, about 57.5%, about 50%, or about 40% on a molar basis.

[0034] In some embodiments, the liposome comprises about 0.5% to about 15% neutral lipid on a molar basis, for example, about 3% to about 12%, about 5% to about 10%, or about 15%, about 10%, or about 7.5% on a molar basis. Examples of neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE, and SM. In various aspects, the nanoparticle does not comprise a neutral lipid. In some embodiments, the formulation comprises about 5% to about 50% sterol on a molar basis (e.g., about 15 to about 45%, about 20 to about 40%, about 40%, about 38.5%, about 35%, or about 31% on a molar basis. An exemplary sterol is cholesterol. In some embodiments, the formulation comprises about 0.5% to about 20% PEG or PEG-modified lipid on a molar basis (e.g., about 0.5 to about 10%, about 0.5 to about 5%, about 1.5%, about 0.5%, about 1.5%, about 3.5%, or about 5% on a molar basis). In some embodiments, the PEG or PEG-modified lipid comprises PEG molecules having an average molecular weight of 2,000 Da. In other embodiments, the PEG or PEG-modified lipid comprises PEG molecules having an average molecular weight of less than 2,000, e.g., about 1,500 Da, about 1,000 Da, or about 500 Da. Examples of PEG-modified lipids include, but are not limited to, PEG-distearoylglycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG), PEG-cDMA (further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005), the contents of which are incorporated herein by reference in their entirety).

[0035] In exemplary embodiments, the cationic lipid is (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimeylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N,N-dimethylpentacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyl ...hexacosa-17,20-dien-9-amine, (1Z,19Z)-N,N-dimethylhexacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhexacosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N,N-dimethylhexacosa-17,20-dien Tyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimethylheptacosa-19,22-dien-9-amine, (18Z,21 Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10-amine, (21 Z,24Z)-N,N-Dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-Dimethylheptacos-18-en-10-amine, (17Z)-N,N-Dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-Dimethyloctacos-19,22-dien-7-amine, N,N-Dimethylheptacosane-10-amine, (20Z,23Z)-N-Ethyl 1-[(11Z,14Z)-1-nonyl-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacosa-20-en-10-amine, (15Z)-N,N-dimethylheptacosa-15-en-10-amine, (14Z)-N,N-dimethylnonacosa-14-en-10-amine, (17Z)-N,N-Dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16 -dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecan-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine, N,N-dimethyl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl] cyclopropyl]methyl}cyclopropyl]nonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1R,2S)-2-undecylcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecane-9-amine, 1-[(1S,2R)-2- Decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecan-8-amine, RN,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, SN,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}pyrrolidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azetidine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien- 1-yloxy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-amine; (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-o 1-[(11Z,14Z)-Icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propan-2-amine; 1-[(11Z,14Z)-Icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine; 1-[(11Z,14Z)-Icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine; (c) propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, (2S)-1-[(13Z)-docosa-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amine, 1-[(13Z)-docosa-13-en-1-yloxy]-N,N-Dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-methoylloctyl)oxyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propane- 2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-octylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-amine, and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-trien-10-amine, or a pharma- ceutically acceptable salt or stereoisomer thereof.

[0036] In some embodiments, the nanoparticles comprise lipid-polycation complexes. Formation of lipid-polycation complexes can be accomplished by methods known in the art and / or described in U.S. Patent Publication No. 20120178702, which is incorporated herein by reference in its entirety. As non-limiting examples, the polycations can comprise cationic peptides or polypeptides, such as, but not limited to, polylysine, polyornithine, and / or polyarginine. In some embodiments, the composition can comprise lipid-polycation complexes, which can further comprise non-cationic lipids, such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).

[0037] In various embodiments, cationic liposomes are optionally free of non-cationic lipids. Neutral molecules may interfere with coiling / condensation of multi-layered nanoparticles resulting in RNA-loaded liposomes over 200 nm in size in some embodiments. Cationic liposomes produced without helper molecules may include sizes of about 70-200 nm (or less). These constructs consist essentially of cationic lipids with negatively charged nucleic acids and may be formulated in a sealed rotary vacuum evaporator that prevents oxidation of the particles (if exposed to the ambient environment). In this embodiment, the absence of helper lipids optimizes mRNA coiling into tightly packaged multi-layered NPs, with each NP containing a higher amount of nucleic acid per particle. Due to the increased nucleic acid payload per particle, these multi-layered RNA nanoparticles drive significantly greater innate immune responses, a key predictor of efficacy for modulating the immune system.

[0038] In some embodiments, the nucleic acid molecules are present at a nucleic acid molecule:cationic lipid ratio of about 1 to about 5 to about 1 to about 25. In some embodiments, the nucleic acid molecules are present at a nucleic acid molecule:cationic lipid ratio of about 1 to about 5 to about 1 to about 20, optionally about 1 to about 15, about 1 to about 10, or about 1 to about 7.5. As used herein, the term "nucleic acid molecule:cationic lipid ratio" refers to a mass ratio, where the mass of the nucleic acid molecule is relative to the mass of the cationic lipid. Also, in exemplary embodiments, the term "nucleic acid molecule:cationic lipid ratio" refers to the ratio of the mass of the nucleic acid molecule, e.g., RNA, that is added to the liposomes that contain cationic lipids during the process of making the ML RNA NPs of the present disclosure. In exemplary embodiments, the nanoparticles contain less than or about 10 μg of RNA molecules per 150 μg of lipid mixture. In exemplary embodiments, the nanoparticles are made by incubating about 10 μg of RNA with about 150 μg of liposomes. In another embodiment, the nanoparticles contain more RNA molecules per mass of lipid mixture. For example, the nanoparticles may contain more than 10 μg RNA molecules per 150 μg liposomes. In some examples, the nanoparticles contain more than 15 μg RNA molecules per 150 μg liposomes or lipid mixture.

[0039] In various embodiments, the nucleic acid molecule is an RNA molecule, such as transfer RNA (tRNA), ribosomal RNA (rRNA), messenger RNA (mRNA). In various embodiments, the RNA molecule comprises tRNA, rRNA, mRNA, or a combination thereof. In various embodiments, the RNA is total RNA isolated from a cell. In an exemplary embodiment, the RNA is total RNA isolated from a diseased cell, such as, for example, a tumor cell or a cancer cell. Methods for obtaining total tumor RNA are known in the art and are described in Example 1 herein.

[0040] In the context of the method for treating a solid tumor in a subject, including a surface antigen-negative solid tumor, the first composition comprises a nanoparticle comprising a nucleic acid encoding a surface antigen (also referred to herein as a surface tumor antigen) recognized by CAR T cells. Some suitable cancer antigen targets for CAR T cell therapy are known and described, for example, in U.S. Patent No. 10,688,166 (incorporated by reference in its entirety, particularly with respect to the disclosure of tumor antigens). The antigen can be, for example, claudin, CD19, CD20, CD22, CD33, CD166, CD70, CD123, CEA, c-Met, PSMA, GD2, GD3, FRα, CAIX, CD171, EGFRVIII, HER2, mesothelin, CD133, CEACAM5, EGFR, GPC3, PSMA, ROR1, VEGFR2, B7-H3, IL-13Rα, PD-L1, IL-11RαEphA2, MAGE, MCAM, NKG2D ligand, TEM1, FAP, GAGE, MUC1, or NY-ESO-1. In various embodiments, the surface antigen is CD70 (i.e., the nucleic acid of the nanoparticles of the first composition encodes CD70 and the CAR T cells target CD70-expressing tumor cells). The sequence of human CD70 is known in the art. See, for example, UniProtKB number P32970.

[0041] In an exemplary embodiment, the RNA molecule is mRNA. In various embodiments of the present disclosure, nanoparticles containing total RNA isolated from cells are used. In various embodiments, the mRNA is in vitro transcribed mRNA. In various embodiments, the mRNA molecule is generated by in vitro transcription (IVT). Suitable techniques for performing IVT are known in the art. In an exemplary embodiment, an IVT kit is employed. In an exemplary embodiment, the kit includes one or more IVT reaction reagents. As used herein, the term "in vitro transcription (IVT) reaction reagent" refers to any molecule, compound, factor, or salt that functions in an IVT reaction. For example, the kit may include a prokaryotic phage RNA polymerase and a promoter (T7, T3, or SP6) with a eukaryotic or prokaryotic extract to synthesize a protein from an exogenous DNA template. Optionally, the RNA is in vitro transcribed mRNA and the in vitro transcription template is cDNA made from RNA extracted from tumor cells. In various embodiments, the nanoparticles comprise a mixture of RNA, which is RNA isolated from a human tumor. Optionally, the tumor is an osteosarcoma or a malignant brain tumor, such as glioblastoma, medulloblastoma, diffuse pontine glioma, or a peripheral tumor with metastatic invasion into the central nervous system. In various embodiments, the RNA comprises a sequence encoding a poly(A) tail, such that the in vitro transcribed RNA molecule comprises a poly(A) tail at the 3' end. In various embodiments, the method of making the nanoparticles comprises an additional processing step, such as, for example, capping the in vitro transcribed RNA molecule.

[0042] The RNA (e.g., mRNA) in exemplary embodiments encodes a protein. Optionally, the protein is selected from the group consisting of a tumor antigen, a cytokine, or a costimulatory molecule. Indeed, the protein in some embodiments is selected from the group consisting of a tumor antigen, a costimulatory molecule, a cytokine, a growth factor, a hematopoietic factor, or a lymphokine, including, for example, cytokines and growth factors effective in inhibiting tumor metastasis, and cytokines or growth factors that have been shown to have an anti-proliferative effect on at least one cell population. Such cytokines, lymphokines, growth factors, or other hematopoietic factors include, but are not limited to, M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IFN, TNFα, TNF1, TNF2, G-CSF, Meg-CSF, GM-CSF, thrombopoietin, stem cell factor, and erythropoietin.Additional growth factors for use herein include angiogenin, bone morphogenetic protein-1, bone morphogenetic protein-2, bone morphogenetic protein-3, bone morphogenetic protein-4, bone morphogenetic protein-5, bone morphogenetic protein-6, bone morphogenetic protein-7, bone morphogenetic protein-8, bone morphogenetic protein-9, bone morphogenetic protein-10, bone morphogenetic protein-11, bone morphogenetic protein-12, bone morphogenetic protein-13, bone morphogenetic protein-14, bone morphogenetic protein-15, bone morphogenetic protein-16, bone morphogenetic protein-17, bone morphogenetic protein-18, bone morphogenetic protein-19, bone morphogenetic protein-20, bone morphogenetic protein-21, bone morphogenetic protein-22, bone morphogenetic protein-23, bone morphogenetic protein-24, bone morphogenetic protein-25, bone morphogenetic protein-26, bone morphogenetic protein-27, bone morphogenetic protein-28, bone morphogenetic protein-29, bone morphogenetic protein-30, bone morphogenetic protein-31, bone morphogenetic protein-32, bone morphogenetic protein-33, bone morphogenetic protein-34, bone morphogenetic protein-35, bone morphogenetic protein-36, bone morphogenetic protein-37, bone morphogenetic protein-38, bone morphogenetic protein-39, bone morphogenetic protein-40, bone morphogenetic protein-41, bone morphogenetic protein-42, bone morphogenetic protein-43, bone morphogenetic protein-44, bone morphogenetic protein-45, bone morphogenetic protein-46, bone morphogenetic protein-47, bone morphogenetic protein-48, bone morphogenetic protein-49, bone morphogenetic protein-50, bone morphogenetic protein-5 maturation protein receptor IA, bone morphogenetic protein receptor IB, brain-derived neurotrophic factor, ciliary neurotrophic factor, ciliary neurotrophic factor receptor α, cytokine-induced neutrophil chemotactic factor 1, cytokine-induced neutrophil, chemotactic factor 2α, cytokine-induced neutrophil chemotactic factor 2β, beta endothelial growth factor, endothelin 1, epithelium-derived neutrophil attractant, glial cell line-derived neurotrophic factor receptor α1, glial cell line-derived neurotrophic factor receptor α2, growth-associated protein, growth-associated protein α, growth-associated protein β, growth-associated protein γ, heparin-binding epithelial Growth factors, hepatocyte growth factor, hepatocyte growth factor receptor, insulin-like growth factor I, insulin-like growth factor receptor, insulin-like growth factor II, insulin-like growth factor binding protein, keratinocyte growth factor, leukemia inhibitory factor, leukemia inhibitory factor receptor alpha, nerve growth factor nerve growth factor receptor, neurotrophin-3, neurotrophin-4, pre-B cell growth stimulatory factor, stem cell factor, stem cell factor receptor, transforming growth factor alpha, transforming growth factor beta, transforming growth factor beta 1, transforming growth factor beta 1.2, transforming growth factor beta 2, transforming growth factor beta 3, transforming growth factor beta 5, latent transforming growth factor beta 1, transforming growth factor beta binding protein I, transforming growth factor beta binding protein II, transforming growth factor beta binding protein III, tumor necrosis factor receptor type I, tumor necrosis factor receptor II, urokinase-type plasminogen activator receptor, and chimeric proteins and biologically or immunologically active fragments thereof.In exemplary embodiments, the tumor antigen is an antigen derived from a viral protein, an antigen derived from a point mutation, or an antigen encoded by a cancer-germline gene. In exemplary embodiments, the tumor antigen is pp65, p53, KRAS, NRAS, MAGEA, MAGEB, MAGEC, BAGE, GAGE, LAGE / NY-ESO1, SSX, tyrosinase, gp100 / pmel17, Melan-A / MART-1, gp75 / TRP1, TRP2, CEA, RAGE-1, HER2 / NEU, or WT1, or any other tumor antigen described herein. In exemplary embodiments, the costimulatory molecule is selected from the group consisting of CD80 and CD86.

[0043] In some embodiments, the methods of the present disclosure may include the use of nanoparticles that include a nucleic acid that is not an mRNA isolated from a tumor (i.e., not a tumor mRNA) or that is not a nucleic acid that encodes a protein expressed by a tumor cell or by a human (i.e., the protein is not associated with a tumor antigen or cancer antigen). In this regard, in various embodiments, the nanoparticle does not include a nucleic acid that encodes a tumor antigen that is recognized by a CAR T cell administered to a subject. In various embodiments, the nanoparticle includes a mixture of nucleic acids, where only a small percentage encodes a tumor antigen that is recognized by a CAR T cell administered to a subject (e.g., less than 10% or less than 5% of the nucleic acids encode a tumor antigen that is recognized by a CAR T cell). In some embodiments, the nucleic acid encodes a protein that is non-specific for a tumor or cancer. For example, the non-specific protein can be green, fluorescent protein (GFP) or ovalbumin (OVA). Surprisingly, a nucleic acid that encodes a tumor antigen that is recognized by a CAR T cell is not required to achieve preconditioning using the NP compositions of the present disclosure.

[0044] In aspects of the disclosure that include treating a solid tumor in a subject with a surface antigen-negative tumor, the first composition (comprising nanoparticles) may include a mixed population of nanoparticles that include a nucleic acid encoding a surface antigen and other nanoparticles that do not include a nucleic acid encoding a tumor antigen that is recognized by the CAR T cells administered to the subject.

[0045] In various aspects, the present disclosure contemplates the use of nanoparticles, where the nucleic acid layer comprises an array of nucleic acid molecules expressed by slow-cycling cells (SCCs). The term "slow-cycling cells" or "SCCs" refers to tumor or cancer cells that proliferate slowly. In exemplary aspects, SCCs have a doubling time of at least about 50 hours. SCCs have been identified in a number of cancer tissues, including melanoma, ovarian cancer, pancreatic adenocarcinoma, breast cancer, glioblastoma, and colon cancer. As taught by Deleyrolle et al., Brain 134(5):1331-1343 (2011) (incorporated herein by reference, particularly with respect to its description of SCCs), SCCs exhibit increased tumor-initiating properties and are stem cell-like. Due to their slow proliferation rate, SCCs are also referred to as label-retaining cells (LRCs). In an illustrative example, the nucleic acid molecule is RNA extracted from an isolated SCC or a nucleic acid molecule that hybridizes to RNA extracted from an isolated SCC. Optionally, the SCC is isolated from a mixed tumor cell population obtained from a subject with a tumor (e.g., glioblastoma). As used herein, the term "mixed tumor cell population" refers to a heterogeneous cell population that includes tumor cells of different subtypes and includes slow-cycling cells and at least one other tumor cell type, e.g., fast-cycling cells (FCCs). NPs that include a nucleic acid layer that includes a sequence of a nucleic acid molecule expressed by a slow-cycling cell (SCC) are further described in International Application No. PCT / US21 / 16925 (WO 2021 / 158996), which is incorporated by reference in its entirety, particularly with reference to FIG. 12.

[0046] Optionally, various aspects of the present disclosure may involve the use of nanoparticles that include an RNA molecule that binds to or codes for an epitope of a nucleic acid that codes for a fusion protein expressed by a tumor. In an exemplary aspect, the epitope includes a junction of the nucleic acid that codes for the fusion protein. In various aspects, the epitope codes for an amino acid sequence that binds to MHC class II. By way of example, the fusion protein in various examples is a C11orf95-RELA fusion protein or a fusion protein described herein or in Parker and Zhang, Chin J Cancer 32(11):594-603 (2013), Ding et al., In J Mol Sci 19(1):177(2018), Wener et al., Molecular Cancer 17, article number 28(2018), or Yu et al., Scientific Reports 9, article number 1074 (2019). See Figures 25-28 of International Application No. PCT / US21 / 16925, which is incorporated herein by reference. In an exemplary embodiment, the fusion protein is a fusion protein comprising at least a portion of two of Erdr1, Mid1, Ppp1r13b, or CKB. In an exemplary embodiment, the fusion protein is a fusion protein comprising at least a portion of Erdr1 and at least a portion of Mid1 (e.g., Erdr1 / Mid1 or Mid1 / Erdr1), or at least a portion of Ppp1r13b and at least a portion of CKB (e.g., Ppp1r13b / CKB or CKB / Ppp1r13b). In various embodiments, the fusion protein is expressed by a murine model of brain tumor. In an exemplary embodiment, the fusion protein is a fusion protein comprising at least a portion of two of EWSR1, FUSR1, FOXO1, SS18, FLI1, ERG, ETV1, ETV4, FEV, SSX1.In exemplary aspects, the fusion protein comprises at least a portion of EWSR1, FUSR1, FOXO1, or SS18, and at least a portion of FLI1, ERG, ETV1, ETV4, FEV, or SSX1 (e.g., EWSR1 / FLI1, FLI1 / EWSR1, EWSR1 / ERG, ERG / EWSR1, EWSR1 / ETV1 or ETV1 / EWSR1, EWSR1 / ETV4, ETV4 / EWSR1, EWSR1 / FEV, FEV / EWSR1, FUSR1 / FEV, FEV / FUSR1, FUSR1 / ERG, ERG / FUSR1, FOXO1 / PAX3, PAX3 / FOXO1, FOXO1 / PAX7, PAX7 / FOXO1, SS18 / SSX1, or SSX1 / SS18). In exemplary aspects, the fusion protein is expressed by a sarcoma tumor. In various aspects, the fusion protein comprises at least a portion of two of YAP1, FAM118B, MAMLD1, C11or95, RELA, EPN, MTOR, CASZ1, TP53, DEK, FXR2, BRAF, KIAA1549, or EML4. In exemplary aspects, the fusion protein comprises at least a portion of YAP1, C11or95, MTOR, TP53, or BRAF, and at least a portion of FAM118B, MAMLD1, RELA, C11orf95, EPN, CASZ1, DEK, FXR2, KIAA1549, or EML4 (e.g., YAP1 / FAM118B, FAM118B / YAP1, YAP1 / MAMLD1, MAMLD1 / YAP1, YAP1 / C11orf9). 5, c11orf95 / YAP1, C11orf95-RELA, c11orf95 / RELA, EPN-YAP1, EPN-YAP1, MTOR / MTOR, MTOR / CASZ1, CASZ1 / MTOR, TP53 / TP53, TP53 / DEK, DEK / TP53, TP53 / FXR2, FXR2 / TP53, BRAF / KIAA1549, KIAA1549 / BRAF, BRAF / EML4, or EML4 / BRAF). In an exemplary embodiment, the fusion protein is expressed by a neural tumor.The fusion protein can be any one of those described on the Catalog of Somatic Mutations in Cancer (COSMIC) website at cancer.sanger.ac.uk / cosmic / fusion or the Atlas of Genetics and Cytogenetics in Oncology and Haematology website at atlasgeneticsoncology.org / Deep / Cancer_CytogenomicsID20145.html. Nanoparticles comprising RNA molecules that bind to or encode epitopes of nucleic acids encoding fusion proteins expressed by tumors are further described in International Application No. PCT / US21 / 16925, which is incorporated herein by reference in its entirety.

[0047] In various examples, aspects of the present disclosure may involve the use of nanoparticles that contain RNA molecules that are antisense molecules, optionally siRNA, shRNA, miRNA (microRNA), or any combination thereof. The antisense molecules may mediate RNA interference (RNAi). As known to those skilled in the art, RNAi is a ubiquitous mechanism of gene regulation in plants and animals in which target mRNA is degraded in a sequence-specific manner (Sharp, Genes Dev., 15, 485-490 (2001); Hutvagner et al., Curr. Opin. Genet. Dev., 12, 225-232 (2002); Fire et al., Nature, 391, 806-811 (1998); Zamore et al., Cell, 101, 25-33 (2000)). The natural RNA degradation process is initiated by the dsRNA-specific endonuclease Dicer, which promotes the cleavage of long dsRNA precursors into 21-25 nucleotide long double-stranded fragments called small interfering RNAs (siRNAs, also known as short interfering RNAs) (Zamore et al., Cell., 101, 25-33 (2000); Elbashir et al., Genes Dev., 15, 188-200 (2001); Hammond et al., Nature, 404, 293-296 (2000); Bernstein et al., Nature, 409, 363-366 (2001)). siRNAs are incorporated into large protein complexes that recognize and cleave target mRNAs (Nykanen et al., Cell, 107, 309-321 (2001)). It has been reported that introduction of dsRNA into mammalian cells does not result in efficient Dicer-mediated production of siRNA and therefore does not induce RNAi (Caplen et al., Gene, 252, 95-105 (2000); Ui-Tei et al., FEBS Lett, 479, 79-82 (2000)).The requirement for Dicer in cellular siRNA maturation can be bypassed by introducing synthetic 21-nucleotide siRNA duplexes that inhibit the expression of transfected and endogenous genes in a variety of mammalian cells (Elbashir et al., Nature, 411:494-498 (2001)). Aspects of the present disclosure can involve the use of nanoparticles that contain RNA molecules that mediate RNAi, and in some aspects, the RNA is an siRNA molecule specific for inhibiting the expression of a protein. The term "siRNA" as used herein refers to an RNA (or RNA analog) that contains about 10 to about 50 nucleotides (or nucleotide analogs) that are capable of inducing or mediating RNAi. In exemplary embodiments, the siRNA molecule contains about 15 to about 30 nucleotides (or nucleotide analogs) or about 20 to about 25 nucleotides (or nucleotide analogs), e.g., 21 to 23 nucleotides (or nucleotide analogs). The siRNA can be double-stranded or single-stranded, preferably double-stranded.

[0048] In an alternative aspect, the present disclosure contemplates the use of nanoparticles comprising RNA molecules that are short hairpin RNA (shRNA) molecules specific for inhibiting expression of a protein. The term "shRNA" as used herein refers to a molecule of about 20 or more base pairs in which the single stranded RNA contains a partially palindromic base sequence and forms a double stranded structure (i.e., a hairpin structure) therein. The shRNA can be an siRNA (or an siRNA analog) that folds into a hairpin structure. The shRNA typically comprises about 45 to about 60 nucleotides, including antisense and sense portions of the hairpin of about 21 nucleotides, an optional overhang on the non-loop side of about 2 to about 6 nucleotides in length, and a loop portion that can be, for example, about 3 to 10 nucleotides in length.

[0049] In an exemplary embodiment, the present disclosure contemplates the use of nanoparticles comprising antisense molecules that are microRNAs (miRNAs). As used herein, the term "microRNA" refers to small (e.g., 15-22 nucleotides) non-coding RNA molecules that base pair with mRNA molecules to silence gene expression via translational repression or targeted degradation. MicroRNAs and their therapeutic potential have been described in the art. See, for example, Mulligan, MicroRNA: Expression, Detection, and Therapeutic Strategies, Nova Science Publishers, Inc., Hauppauge, NY, 2011; Bader and Lammers, "The Therapeutic Potential of microRNA" Innovations in Pharmaceutical Technology, pages 52-55 (March 2011).

[0050] In certain examples, the RNA molecule is an antisense molecule, optionally an siRNA, shRNA, or miRNA, which targets a protein in an immune checkpoint pathway for reduced expression. In various aspects, the protein in the immune checkpoint pathway is CTLA-4, PD-1, PD-L1, PD-L2, B7-H3, B7-H4, TIGIT, LAG3, CD112, TIM3, BTLA, or the costimulatory receptors ICOS, OX40, 41BB, or GITR. In certain examples, the protein in the immune checkpoint pathway is CTLA4, PD-1, PD-L1, B7-H3, B7H4, or TIM3. Immune checkpoint signaling pathways are reviewed in Pardoll, Nature Rev Cancer, 12(4):252-264 (2012).

[0051] In an exemplary embodiment, the nanoparticles of the present disclosure comprise a mixture of RNA molecules. In an exemplary aspect, the mixture of RNA molecules is RNA isolated from cells from a human, and optionally the human has a tumor. In some aspects, the mixture of RNA is RNA isolated from a human tumor. In an exemplary aspect, the human has cancer, optionally any cancer described herein. Optionally, the tumor from which the RNA is isolated is selected from the group consisting of glioma (including but not limited to glioblastoma), medulloblastoma, diffuse intrinsic pontine glioma, or peripheral tumors with metastatic invasion into the central nervous system (e.g., melanoma or breast cancer). Optionally, the tumor from which the RNA is isolated is osteosarcoma. In an exemplary aspect, the tumor from which the RNA is isolated is a cancer tumor, such as any of these cancers described herein.

[0052] In various embodiments, the nanoparticles comprise a nucleic acid molecule (e.g., an RNA molecule) that comprises a nucleic acid sequence that encodes a chimeric protein that comprises a LAMP protein. In certain embodiments, the LAMP protein is a LAMP1, LAMP2, LAMP3, LAMP4, or LAMP5 protein.

[0053] CAR T cells The compositions disclosed herein are part of a treatment regimen for a subject undergoing treatment with T cells expressing chimeric antigen receptors (CAR T cells). In general, the methods described herein are independent of a particular CAR T cell product. In various embodiments, the CAR T cells bind to a surface antigen encoded by the nanoparticles of the first composition. In various embodiments, the methods disclosed herein are independent of a particular target cell to which an immune response is desired. "Chimeric antigen receptor" or "CAR" refers to an artificial immune cell receptor that is engineered to recognize and bind to an antigen expressed by a target cell, such as a tumor cell. In general, CARs are engineered for T cells and are chimeras of the signaling domain of the T cell receptor (TCR) complex and the antigen recognition domain (e.g., a single chain fragment (scFv) of an antibody or other antibody fragment) (Enblad et al., Human Gene Therapy, 26(8):498-505 (2015)). CARs have the ability to redirect T cell specificity and reactivity towards selected targets in a non-MHC restricted manner. Non-MHC restricted antigen recognition gives CAR-expressing T cells the ability to recognize antigens independent of antigen processing, thus circumventing a major mechanism of tumor evasion. Furthermore, when expressed in T cells, CARs advantageously do not dimerize with endogenous T cell receptor (TCR) α and β chains.

[0054] There are various formats of CARs, each containing different components. "First generation" CARs join an antibody-derived scFv to the CD3 zeta (ζ or z) intracellular signaling domain of the T cell receptor through a hinge and transmembrane domain. "Second generation" CARs incorporate additional domains, such as CD28, 4-1BB (41BB), or ICOS, to provide a costimulatory signal. "Third generation" CARs contain two costimulatory domains fused to the TCR CD3 zeta chain. Third generation costimulatory domains can include combinations of, for example, CD3 zeta, CD27, CD28, 4-1BB, ICOS, or OX40. CARs, in some embodiments, comprise an endodomain with an ectodomain (e.g., CD3 zeta), a hinge, a transmembrane domain, and one (first generation), two (second generation), or three (third generation) signaling domains derived from CD3 and / or costimulatory molecules (Maude et al., Blood, 125(26):4017-4023 (2015); Kakarla and Gottschalk, Cancer J., 20(2):151-155 (2014)).

[0055] In some embodiments, the CAR T cells target tumor antigens. Tumor antigens include, for example, moieties associated with the cell surface of cancer cells, and are preferably not (or rarely) expressed in normal (non-cancerous) tissues. Some suitable cancer antigen targets for CAR T cell therapy are known and described, for example, in U.S. Pat. No. 10,688,166 (incorporated by reference in its entirety, particularly with respect to the disclosure of tumor antigens). For example, the CAR T cells can target, for example, claudins, CD19, CD20, CD22, CD33, CD70, CD123, mesothelin, CEA, c-Met, PSMA, GD-2, or NY-ESO-1 (or any other antigen described herein). Examples of CAR T cell therapeutics for the treatment of cancer include, for example, BREYANZI® (lysocabtagenemalaleucel), TECARTUS™ (brexcabtageneoutrucel), KYMRIAH™ (tisagenlecleucel), and YESCARTA™ (axicabtagenesiloleucel). Examples of non-cancer-associated antigens include viral antigens (e.g., human immunodeficiency virus (HIV) antigens, hepatitis C virus (HCV) antigens, hepatitis B virus (HBV) antigens, cytomegalovirus (CMV) antigens, Epstein Barr virus (EBV) antigens), fungal antigens, parasitic antigens, and bacterial antigens.

[0056] In various aspects, the CAR of the modified T cells comprises an antigen-binding domain that binds to Cluster of Differentiation 70 (CD70). CD70 is a type II transmembrane protein that represents the only ligand for CD27. CD70 is a glycosylated transmembrane protein of the tumor necrosis factor receptor family. CD70-CD27 interaction plays a key role in providing costimulation during the development of functional lymphocytes. Tight control of CD70 expression is required for optimal signaling for immune cell activation. CD70 expression is restricted to highly activated T / B lymphocytes and a small subset of mature dendritic cells, but distinct solid tumor malignancies, including osteosarcoma, can constitutively overexpress CD70. CD70 is not only highly expressed by primary tumors, but also in recurrent tumors, presenting a consistent therapeutic target for primary and recurrent tumors. In various aspects of the present disclosure, the CAR comprises an antigen-binding portion that comprises the extracellular portion of CD27 (ligand for CD70). Optionally, the transmembrane domain is the intracellular portion of 41BB. An exemplary sequence of a CD70 targeting CAR is encoded by SEQ ID NO: 1: TGGCAAG ACCCCACCCC TGGTGGCTGT GTGTGCTGGG CACACTGGTC GGACTGAGCG CCACCCCTGC CCCTAAGAGC TGCCCCGAGA GACACTACTG GGCTCAGGGC AAGCTGTGCT GCCAGATGTG CGAGCCCGGC ACCTTCCTGG TGAAAGACTG CGACCAGCAC CGGAAGGCCG CCCAGTGCGA TCCTTGCATC CCCGGCGTGT CCTTCAGCCC CGACCACCAC ACCAGACCCC ACTGCGAGAG CTGCCGGCAT TGCAACTCTG GCCTGCTGGT CCGCAACTGC ACCATCACCG CCAACGCCGA GTGCGCCTGC AGAAACGGCT GGCAGTGCCG GGACAAAGAA TGCACCGAGT GCGACCCTCT GCCCAACCCC AGCCTGACCG CCAGAAGCAG CCAGGCTCTG AGCCCTCACCCTCAGCCCAC CCATCTGCCC TACGTGTCCG AGATGCTGGA AGCCCGGACA GCCGGCCACA TGCAGACCCT GGCCGACTTC AGACAGCTGC CCGCCAGAAC CCTGAGCACC CACTGGCCTC CCCAGCGGAG CCTGTGCAGC AGCGACTTCA TCCGGATCCT GGTGATCTTC AGCGGCATGT TCCTGGTGTT CACCCTGGCT GGCGCCCTGT TCCTGCACAA GCGGGGCAGA AAGAAGCTGC TGTACATCTT CAAGCAGCCC TTCATGCGGC CCGTGCAGAC CACCCAGGAA GAGGACGGCT GCAGCTGCCG GTTCCCCGAG GAAGAGGAAG GCGGCTGCGA GCTGAGAGTG AAGTTCAGCA GAAGCGCCGA CGCCCCTGCC TACCAGCAGG GCCAGAACCA GCTGTACAAC GAGCTGAACC TGGGCAGACG GGAAGAGTAC GACGTGCTGG ACAAGCGGAG AGGCCGGGAC CCTGAGATGG GCGGCAAGCC CCAGAGGCGG AAGAACCCTC AGGAAGGCCT GTATAACGAA CTGCAGAAAG ACAAGATGGC CGAGGCCTAC AGCGAGATCG GCATGAAGGG CGAGCGGCGG AGAGGCAAGG GCCACGATGG CCTGTACCAG GGCCTGAGCA CCGCCACCAA GGACACCTAC GACGCCCTGC ACATGCAGGC TCTGCCTCCA AGA (SEQ ID NO: 1). Exemplary CD70-targeted CAR T cells are described in WO 2019 / 051047, which is incorporated by reference in its entirety, particularly for its disclosure of chimeric antigen receptors and the production of CAR T cells.

[0057] CAR T therapy can be an immunotherapy that utilizes a subject's or patient's own immune cells that have been engineered to produce a specific CAR on their surface. In some situations, T cells are collected from the subject's or patient's body via apheresis, a process in which blood is drawn from the body and one or more blood components (such as plasma, platelets, or white blood cells) are removed. The T cells collected from the body are then genetically engineered to produce a specific chimeric antigen receptor on their surface. The CAR T cells are expanded by growing in the laboratory and then administered to the subject or patient, or to another subject or patient. The CAR T cells recognize and kill cancer cells that express the target antigen on their surface. The cells can be isolated from the subject who will be the recipient of the therapy, or from a donor subject who is not the ultimate recipient of the therapy.

[0058] use The present disclosure provides, for example, a method for enhancing the efficacy of CAR T cell therapy and / or sensitizing a tumor to treatment using CAR T cells. For example, the present disclosure provides a method of preconditioning a subject for chimeric antigen receptor (CAR) T cell therapy, comprising administering to the subject a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, at least one day prior to administering CAR T cell therapy to the subject. In an exemplary embodiment, the nucleic acid molecule is mRNA. Optionally, the composition is administered systemically to the subject. For example, the composition is administered intravenously. In various embodiments, the pharmaceutical composition is administered in an amount effective to activate dendritic cells (DCs) in the subject.

[0059] The first nanoparticle composition, in various embodiments of the disclosure, is administered to the subject at least one day prior to administration of the CAR T cells (i.e., one or more days prior to administration of the CAR T cells). In exemplary embodiments of the disclosure, the first composition is administered to the subject at least one day prior to administration of the CAR T cells, but not more than about 30 days prior to administration of the CAR T cells. For example, the first composition is optionally administered about 2 to about 21 days prior to administration of the CAR T cells (e.g., about 2 to about 14 days prior to administration of the CAR T cells). For example, the method can include administering the composition about 5 to about 8 days prior to administering the CAR T cell therapy to the subject, such as about 7 days prior to administering the CAR T cell therapy. In various embodiments, the first composition is administered 2 hours to 72 hours prior to administration of the CAR T cells. Multiple administrations of the composition can be given to the subject, so long as the administration is at least one day prior to administration of the CAR T cells. Preconditioning with the first nanoparticle composition of the present disclosure primes the body for receipt of the CAR T cell product, promotes trafficking to target cells, and enhances the persistence and activation of the CAR T cells, hi some embodiments, the method further comprises administering the CAR T cells to a subject.

[0060] The present disclosure further provides a method of treating a solid tumor in a subject, comprising administering to a subject comprising a surface antigen-negative solid tumor a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, the nucleic acid encoding the surface antigen, and administering a second composition comprising CAR T cells targeting the surface antigen. In an exemplary embodiment, the nucleic acid molecule is mRNA. The first nanoparticle composition is optionally administered to the subject at least one day prior to administration of the second composition comprising the CAR T cells (i.e., one or more days prior to administration of the CAR T cells). In various embodiments, the first composition is administered to the subject at least one day prior to administration of the CAR T cells but within about 30 days. For example, the first composition is optionally administered at least once about 2 to about 21 days prior to administration of the CAR T cells (e.g., about 2 to about 14 days prior to administration of the CAR T cells). For example, the method can include administering the first composition about 2 to about 5 days prior to administering CAR T cell therapy to the subject. Multiple doses of the first composition can be given to the subject prior to administration of the CAR T cells, and multiple doses of the first composition can be given to the subject after administration of the CAR T cells. Optionally, the first and / or second composition are administered systemically to the subject. For example, the first and / or second composition are administered intravenously.

[0061] In various aspects of the present disclosure, the subject includes a surface antigen-negative tumor. In this regard, a surface antigen-negative tumor is a tumor that expresses insufficient levels of surface tumor antigens to achieve a clinically relevant response to CAR T cell therapy prior to the present method. A "surface antigen-negative tumor" does not necessarily require that surface antigens are completely absent from the tumor, although this is contemplated by the present disclosure. In various aspects, a surface antigen-negative tumor is a tumor in which less than 20% of the cells of the tumor (e.g., as measured by tumor biopsy) express the surface antigen (e.g., less than 18%, less than 15%, less than 13%, less than 10%, less than 8%, less than 5%, or less than 3% of the cells express the surface antigen). Thus, in various aspects, a surface antigen-negative tumor is one in which, prior to the subject method, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the cells in the tumor express the surface antigen. Methods for characterizing the presence or absence of surface tumor antigens on tumor cells are well known in the art and include, for example, PCR detection, next generation sequencing, fluorescence-activated cell sorting (FACS), and immunostaining.

[0062] Optionally, the subject is not administered lymphodepleting therapy within 21 days prior to administration of the CAR T cell therapy. Lymphodepleting therapy is understood in the art and includes, for example, administration of chemotherapy drugs such as cyclophosphamide, fludarabine, pentostatin, or bendamustine, or radiation (e.g., total body radiation). Optionally, the subject is not administered lymphodepleting therapy within 18 days, 14 days, 10 days, 7 days, or 3 days prior to administration of the CAR T cell therapy. Also, optionally, the subject is not administered lymphodepleting therapy within 21 days prior to administration of the first nanoparticle composition. Optionally, the subject is not administered lymphodepleting therapy within 18 days, 14 days, 10 days, 7 days, or 3 days prior to administration of the first nanoparticle composition.

[0063] In various aspects, the method further comprises administering to the subject an additional (second or third) composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers. The above discussion regarding nanoparticles, nucleic acids, etc. applies to both the first composition and the additional composition disclosed herein. The first composition and the additional composition can be the same composition or can be different. For example, the nanoparticles of the additional composition can comprise a different nucleic acid compared to the nanoparticles of the first composition. In various aspects, the nucleic acid incorporated into the nanoparticles of the additional composition is tumor mRNA, e.g., the mRNA is in vitro transcribed mRNA and the in vitro transcription template is cDNA made from RNA extracted from tumor cells. In various aspects, the additional composition is administered 2 hours to 72 hours after administration of the CAR T cells, although the disclosure contemplates other administration timings.

[0064] The present disclosure also provides a method of increasing the sensitivity of solid tumors to treatment with CAR T cells. In an exemplary embodiment, the method includes administering to a subject a first crude comprising a nanoparticle as described herein, e.g., a nanoparticle comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers. Optionally, the nucleic acid encodes a tumor surface antigen. Optionally, the first composition is administered at least one day prior to administering the CAR T cells. In an exemplary embodiment, "sensitivity" refers to "responsiveness to treatment," and the concepts of "sensitivity" and "responsiveness" are positively related in that tumors or cancer cells that respond to a drug / compound treatment are said to be sensitive to that drug. "Sensitivity" can be quantitatively measured or described in terms of the intersection of the abscissa value axis of the dose-effect curve with a line parallel thereto, such a point corresponding to the dose required only to produce a given degree of effect. Similarly, the "sensitivity" of a measurement system is defined as the minimum input (minimum dose) required to produce a given degree of output (effect). The increase in sensitivity provided by the method of the present disclosure can be at least or about 1% to about 10% increase (e.g., at least or about 1% increase, at least or about 2% increase, at least or about 3% increase, at least or about 4% increase, at least or about 5% increase, at least or about 6% increase, at least or about 7% increase, at least or about 8% increase, at least or about 9% increase, at least or about 9.5% increase, at least or about 9.8% increase, at least or about 10% increase) compared to the control. The increased susceptibility provided by the methods of the present disclosure can be at least or about a 10% to greater than about a 95% increase (e.g., at least or about a 10% increase, at least or about a 20% increase, at least or about a 30% increase, at least or about a 40% increase, at least or about a 50% increase, at least or about a 60% increase, at least or about a 70% increase, at least or about an 80% increase, at least or about a 90% increase, at least or about a 95% increase, at least or about a 98% increase, at least or about a 100% increase) compared to a control.In an exemplary embodiment, the control is a subject or population of subjects that have not been treated with a cancer or tumor or a pharmaceutical composition disclosed herein, or a subject or population of subjects that have been treated with a placebo. In an exemplary embodiment, the control is a pre-treatment tumor disclosed herein.

[0065] Increased sensitivity to CAR T therapy can be determined in any of several ways. For example, the methods described herein can enhance T cell survival, promote T cell longevity, and / or limit loss of replicative capacity, as well as shrink tumors and / or mediate tumor cell death. Methods for measuring T cell activity and immune responses are known in the art. T cell activity can be measured by cytotoxicity assays, such as those described in, for example, Fu et al., PLoS ONE 5(7):e11867 (2010). Other T cell activity assays are described in Bercovici et al., Clin Diagn Lab Immunol. 7(6):859-864 (2000). Methods for measuring immune responses are described, for example, in Macatangay et al., Clin Vaccine Immunol, 17(9):1452-1459 (2010), and Clay et al., Clin Cancer Res., 7(5):1127-35 (2001).

[0066] The materials and methods described herein are useful for treating a subject for a disease or disorder, such as, for example, cancer (e.g., solid tumors). As used herein, the term "treat" and related words do not necessarily imply 100% or complete cure or remission. Rather, there are various degrees of treatment that one of skill in the art recognizes as having potential benefit or therapeutic effect. In this regard, the method of treating a disease or disorder can provide any amount or level of treatment. Furthermore, the treatment provided by the method can include treatment of one or more conditions or symptoms or signs of the disease being treated. For example, the treatment method of the present disclosure can inhibit one or more symptoms of the disease. The treatment provided by the method of the present disclosure can also include slowing down the progression of the disease.

[0067] The term "treating" also encompasses prophylactic treatment of a disease. Thus, the treatment provided by the methods disclosed herein may delay the onset or recurrence / relapse of the disease being prophylactically treated. In exemplary embodiments, the methods delay the onset of a disease by 1 day, 2 days, 4 days, 6 days, 8 days, 10 days, 15 days, 30 days, 2 months, 4 months, 6 months, 1 year, 2 years, 4 years, or more. Prophylactic treatment encompasses reducing the risk of the disease being treated. In exemplary embodiments, the methods reduce the risk of a disease by 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or more.

[0068] In certain aspects, a method of treating a disease may be considered as a method of inhibiting a disease or its symptoms. As used herein, the term "inhibit" and words derived therefrom may not be 100% or complete inhibition or elimination. Rather, there are various degrees of inhibition that one of skill in the art recognizes as having potential benefits or therapeutic effects. The methods disclosed herein may inhibit the onset or recurrence of a disease or its symptoms to any amount or level. In exemplary embodiments, the inhibition provided by the methods is at least or about 10% inhibition (e.g., at least or about 20% inhibition, at least or about 30% inhibition, at least or about 40% inhibition, at least or about 50% inhibition, at least or about 60% inhibition, at least or about 70% inhibition, at least or about 80% inhibition, at least or about 90% inhibition, at least or about 95% inhibition, at least or about 98% inhibition). The materials and methods may inhibit tumor spread or growth at any amount or level.

[0069] Treatment of cancer (e.g., solid tumors) can be determined by any of several methods. Any improvement in the subject's health status is contemplated (e.g., at least or about 10% reduction, at least or about 20% reduction, at least or about 30% reduction, at least or about 40% reduction, at least or about 50% reduction, at least or about 60% reduction, at least or about 70% reduction, at least or about 80% reduction, at least or about 90% reduction, or at least or about 95% reduction of any parameter described herein). For example, a therapeutic response refers to one or more of the following improvements in a disease: (1) a reduction in the number of neoplastic cells, (2) an increase in neoplastic cell death, (3) an inhibition of neoplastic cell survival, (5) an inhibition (i.e., slowing to some extent, preferably stopping) of tumor growth or the appearance of new lesions, (6) a reduction in tumor size or tumor burden, (7) an absence of clinically detectable disease, (8) a reduction in the level of a cancer marker, (9) an increase in patient survival, and / or (10) some alleviation of one or more symptoms (e.g., pain) associated with a disease or condition. For example, the efficacy of a treatment can be determined by detecting a change in tumor mass and / or volume after treatment. The size of a tumor can be compared to its initial size and dimensions, as measured by CT, PET, mammogram, ultrasound, or palpation, as well as by caliper measurements or pathological examination of the tumor after biopsy or surgical resection. Responses may be quantitatively characterized, for example, using the percentage change in tumor volume (e.g., the methods of the disclosure result in a reduction in tumor volume of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%).Alternatively, tumor or cancer response may be characterized in a qualitative manner, such as "pathological complete response" (pCR), "clinical complete remission" (cCR), "clinical partial remission" (cPR), "clinical stable disease" (cSD), "clinical progressive disease" (cPD), or other qualitative criteria. In addition, therapeutic efficacy may also be characterized with respect to responsiveness to other immunotherapy treatments or chemotherapy. In various aspects, the methods of the present disclosure further include monitoring the treatment in the subject.

[0070] With respect to the aforementioned method, the composition comprising the nanoparticles is administered systemically to the subject in some aspects. Optionally, the method includes administering any of the compositions described herein by parenteral administration. The parenteral dosage form of any of the agents described herein can be administered to the subject by various routes, including, but not limited to, epidural, intracerebral, intraventricular, epicutaneous, intraarterial, intraarticular, intracardiac, intracavernous injection, intradermal, intralesional, intramuscular, intraocular, intraosseous injection, intraperitoneal, intrathecal, intrauterine, intravaginal administration, intravenous, intravesical, intravitreal, subcutaneous, transdermal, perivascular administration, or transmucosal. For administration to the brain, the pharmaceutical composition can be introduced into the tumor tissue using an intratumoral delivery catheter, a ventricular shunt catheter attached to a reservoir (e.g., Omaya reservoir), an infusion pump, or can be introduced into the tumor resection cavity (Gliasite, Proxima Therapeutics, etc.). Tumor tissue in the brain can also be contacted by administering the pharmaceutical composition via convection using a continuous infusion catheter or through the cerebrospinal fluid. In various examples, the composition is administered to the subject intravenously.

[0071] The amount or dose of active agent administered (i.e., an "effective amount") should be sufficient to achieve a desired biological effect, e.g., a therapeutic or prophylactic response, in the subject over a reasonable time frame. For example, one or more doses of the composition may be sufficient to, for example, prime a subject for CAR T cell therapy and / or induce CAR T cell therapy within a clinically acceptable period of time from the time of administration. In the case where a first composition is administered, comprising nanoparticles comprising a nucleic acid encoding a surface antigen, one or more doses of the first composition should be sufficient to increase the presence of the surface antigen in the tumor. For example, in exemplary embodiments, one or more doses of the first composition are provided to a subject to achieve expression of the surface antigen in 20% or more of the tumor cells in the tumor (e.g., to achieve expression of the surface antigen in at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the tumor cells in a solid tumor within a clinically acceptable time period from the time of administration). By way of example, and without intending to limit the disclosure, the dose of an active agent of the present disclosure can be from about 0.0001 to about 1 g / kg body weight of the subject being treated / day, from about 0.0001 to about 0.001 g / kg body weight, or from about 0.01 mg to about 1 g / kg body weight.

[0072] In various embodiments, the nanoparticle composition is administered according to any regimen, including, for example, daily (once per day, twice per day, three times per day, four times per day, five times per day, six times per day), three times per week, twice per week, every other day, every third day, every fourth day, every fifth day, every sixth day, every week, every other week, etc. In various embodiments, the composition is administered to the subject once a week. The administration regimen of the first composition and the additional nanoparticle composition can be the same or different. For example, the administration regimen of the additional nanoparticle-containing composition provided after CAR T cell administration can occur at different intervals than the first composition and for a longer period of time (i.e., a longer overall treatment period) than the first composition. The composition comprising CAR T cells can be administered according to the treatment regimen of the particular CAR T cell employed and the cancer being treated.

[0073] The disclosed method may include the above steps alone or in combination with other steps. The disclosed method may include repeating any one of the above steps and / or may include additional steps apart from the above. For example, the disclosed method may further include a step for making or preparing the disclosed nanoparticles or compositions. For example, the disclosed method may further include obtaining a sample of the subject's tumor, optionally via biopsy. The disclosed method may also further include isolating total RNA from cells of the tumor, generating cDNA from the total RNA via reverse transcription, and amplifying mRNA from the cDNA. Optionally, the mRNA is incorporated into the nanoparticles of, for example, the second composition. The methods disclosed herein also, in some embodiments, further comprise mixing the mRNA and cationic lipids at an RNA:cationic lipid ratio of about 1 to about 10 to about 1 to about 20 (e.g., about 1 to about 19, about 1 to about 18, about 1 to about 17, about 1 to about 16, about 1 to about 15, about 1 to about 14, about 1 to about 13, about 1 to about 12, about 1 to about 11). In illustrative examples, the methods disclosed herein further comprise mixing the mRNA and cationic lipids at an RNA:cationic lipid ratio of about 1 to about 15.

[0074] subject The subject is a mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Lagomorpha, such as rabbits, mammals of the order Carnivora, including Felines (cats) and Canidae (dogs), mammals of the order Artiodactyla, including Bovidae (cows) and Suidae (pigs), or mammals of the order Perissodactyla, including Equidae (horses). In some embodiments, the mammal belongs to the order Primates, Ceboids, or Simoids (monkeys), or belongs to the suborder Anthropoids (humans and apes). In some embodiments, the mammal is a human. In some embodiments, the human is an adult, 18 years of age or older. In some embodiments, the human is a child, 17 years of age or younger.

[0075] In various aspects, the subject has a surface antigen-negative solid tumor.

[0076] cancer The cancer treatable by the methods disclosed herein can be any cancer, for example, any malignant growth or tumor caused by abnormal and uncontrolled cell division that can optionally spread to other parts of the body through the lymphatic system or bloodstream. In various aspects, the subject has a solid tumor. In this regard, the present disclosure provides a method of treating a solid tumor in a subject in need thereof, comprising administering to the subject at least one day prior to administering CAR T cell therapy to the subject, a first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid layers, each nucleic acid layer being disposed between cationic lipid bilayers, and optionally thereafter administering CAR T cell therapy. Also optionally, the method further comprises administering, after administering the CAR T cells, an additional (second) composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core, and (ii) at least two nucleic acid layers, each nucleic acid layer disposed between cationic lipid bilayers.

[0077] In some embodiments, the cancer is acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bone cancer, brain cancer (e.g., glioma), breast cancer (e.g., triple negative breast cancer), anal cancer, anal canal cancer, anorectal cancer, eye cancer, intrahepatic bile duct cancer, joint cancer, head, neck, gallbladder, or pleural cancer, nose, nasal cavity, or middle ear cancer, oral cavity cancer, vulvar cancer, chronic lymphocytic leukemia, chronic bone marrow cancer, colon cancer, esophageal cancer, cervical cancer. , gastrointestinal cancer (e.g., gastrointestinal carcinoid tumors), Hodgkin's lymphoma, endometrial or hepatocellular carcinoma, hypopharyngeal cancer, renal cancer, laryngeal cancer, liver cancer, lung cancer (e.g., non-small cell lung cancer, bronchioloalveolar carcinoma), malignant mesothelioma, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin's lymphoma, ovarian cancer, osteosarcoma, pancreatic cancer, peritoneal cancer, omental cancer, mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer (e.g., renal cell carcinoma (RCC)), small intestine cancer, soft tissue cancer, stomach cancer, testicular cancer, thyroid cancer, ureter cancer, and bladder cancer. In certain aspects, the cancer is selected from the group consisting of head and neck, ovarian, cervical, bladder, and esophageal cancer, pancreatic cancer, gastrointestinal cancer, gastric, breast, endometrial, and colon cancer, hepatocellular carcinoma, glioblastoma, bladder, and lung cancer (e.g., non-small cell lung cancer (NSCLC), bronchioloalveolar carcinoma). Optionally, the subject is afflicted with a malignant brain tumor, such as glioblastoma, medulloblastoma, diffuse intrinsic pontine glioma, or a peripheral tumor with metastatic infiltration into the central nervous system. Optionally, the subject is afflicted with an osteosarcoma, such as recurrent or metastatic osteosarcoma.

[0078] In various aspects, the subject suffers from a refractory malignant tumor. In this regard, a tumor that evades a particular therapy or host immune response is "refractory" (or refractory). A tumor that is "sensitive" to a therapy exhibits a beneficial clinical response to the treatment. A tumor that is "sensitive" to a host immune response is recognized by the host immune system and attacked by immune effector cells.

[0079] In addition to preconditioning a subject for CAR T cell therapy, the RNA-LPs of the present disclosure can transition immunologically "cold" tumors, e.g., tumors that lack infiltrating T cells and / or are not recognized by the immune system, to immunologically "hot" tumors, i.e., tumors that exhibit, for example, activated myeloid and / or lymphocytic infiltration and interferon production in the tumor microenvironment. Immunotherapy of "cold" tumors presents a significant challenge, at least in part due to the absence of an adaptive immune response. Cancers that tend to cause immunologically "cold" tumors include, but are not limited to, glioblastoma, ovarian cancer, prostate cancer, pancreatic cancer, and many breast cancers. However, although "cold" tumors are limited to these types of cancer, as the cancer progresses in a subject, some cancers develop resistance mechanisms that allow them to evade the immune system. Surprisingly, the nanoparticles of the present disclosure "reprogram" tumors to be recognized by the host immune system.

[0080] In an exemplary embodiment, the subject is afflicted with a malignant tumor that is immune checkpoint inhibitor (ICI) resistant. The susceptibility of the tumor to an immune response (or ICI), or, alternatively, the effectiveness of the immune response (or ICI) against the tumor, can be determined in a variety of ways, such as those known in the art.

[0081] In some embodiments, the methods described herein further comprise administration of one or more other therapeutic agents. In some aspects, the other therapeutic agents are intended to treat or prevent cancer. In some embodiments, the other therapeutic agents are chemotherapeutic agents. Common chemotherapeutic agents include adriamycin, asparaginase, bleomycin, busulfan, cisplatin, carboplatin, carmustine, capecitabine, chlorambucil, cytarabine, cyclophosphamide, camptothecin, dacarbazine, dactinomycin, daunorubicin, dexrazoxane, docetaxel, doxorubicin, etoposide, floxuridine, fludarabine, fluorouracil, gemcitabine, hydroxyurea, idarubicin, ifosfamide, isoflurane, cyclophosphamide ... These include, but are not limited to, rinotecan, lomustine, mechlorethamine, mercaptopurine, melphalan, methotrexate, mitomycin, mitotane, mitoxantrone, nitrosourea, paclitaxel, pamidronate, pentostatin, plicamycin, procarbazine, rituximab, streptozocin, teniposide, thioguanine, thiotepa, vinblastine, vincristine, vinorelbine, taxol, transplatinum, 5-fluorouracil, etc. If chemotherapy is a lymphodepleting therapy, in various instances, as described above, it is not administered within a time frame prior to CAR T cell therapy.

[0082] In some embodiments, the other therapeutic agent is an agent used in radiation therapy for the treatment of cancer, and indeed in some embodiments, the method is part of a treatment regimen that includes radiation therapy. Additionally, the methods of the present disclosure may be performed in conjunction with surgical resection of tumors, such as gliomas (e.g., glioblastomas).

[0083] In an exemplary embodiment, the method includes administering an immune checkpoint inhibitor (ICI) to the subject. An "immune checkpoint inhibitor" or "ICI" is any agent (e.g., a compound or molecule) that reduces, blocks, inhibits, abrogates, or interferes with the function of a protein in an immune checkpoint pathway. A protein in an immune checkpoint pathway regulates the immune response and, in some cases, prevents T cells from attacking cancer cells. In various embodiments, the protein in an immune checkpoint pathway is, for example, CTLA-4, PD-1, PD-L1, PD-L2, B7-H3, B7-H4, TIGIT, VISTA, LAG3, CD112, TIM3, BTLA, or the costimulatory receptors ICOS, OX40, 41BB, or GITR. In various embodiments, the ICI is a small molecule, an inhibitory nucleic acid, or an inhibitory polypeptide. In various embodiments, the ICI is an antibody, an antigen-binding antibody fragment, or an antibody protein product that binds to and inhibits the function of a protein in an immune checkpoint pathway. Suitable ICIs that are antibodies, antigen-binding antibody fragments, or antibody protein products are known in the art and include, but are not limited to, ipilimumab (CTLA-4; Bristol Meyers Squibb), nivolumab (PD-1; Bristol Meyers Squibb), pembrolizumab (PD-1; Merck), atezolizumab (PD-L1; Genentech), avelumab (PD-L1; Merck), and durvalumab (PD-L1; Mediimmune) (Wei et al., Cancer Discovery 8:1069-1086 (2018)).Other examples of ICIs include, but are not limited to, IMP321 (LAG3: Immuntep); BMS-986016 (LAG3; Bristol Meyers Squibb), IPH2101 (KIR; Innate Pharma), tremelimumab (CTLA-4; Medimmune), pidilizumab (PD-1; Medivation), MPDL3280A (PD-L1; Roche), MEDI4736 (PD-L1; AstraZeneca), MSB0010718C (PD-L1; EMD Serono), AUNP12 (PD-1; Aurigene), MGA271 (B7-H3: MacroGenics), and TSR-022 (TIM3; Tesaro).

[0084] Method for producing nanoparticles Nanoparticles comprising a positively charged surface and an interior comprising (i) a core and (ii) at least two nucleic acid (e.g., RNA) layers, each nucleic acid layer disposed between cationic lipid bilayers, may be produced by a method comprising (A) mixing nucleic acid molecules and liposomes at a nucleic acid (e.g., RNA):liposome ratio of about 1 to about 5 to about 1 to about 25, e.g., about 1 to about 5 to about 1 to about 20, optionally about 1 to about 15, to obtain liposomes coated with nucleic acid (e.g., RNA). The liposomes are produced by a process for making liposomes comprising drying a lipid mixture comprising cationic lipids and an organic solvent by evaporating the organic solvent under vacuum. The method further comprises (B) mixing the RNA-coated liposomes with an excess of liposomes. In an exemplary embodiment, the nanoparticles produced by the methods disclosed herein are consistent with the description of the nanoparticles described herein. For example, nanoparticles produced by the methods disclosed herein have a zeta potential of about +40 mV to about +60 mV, optionally about +45 mV to about +55 mV. Optionally, the zeta potential of nanoparticles produced by the methods disclosed herein is about +50 mV. In various embodiments, the core of the nanoparticles produced herein comprises less than about 0.5% by weight of nucleic acid, and / or the core comprises a cationic lipid bilayer, and / or the outermost layer of the nanoparticle comprises a cationic lipid bilayer, and / or the surface of the nanoparticle comprises a plurality of hydrophilic moieties of the cationic lipids of the cationic lipid bilayer.

[0085] In an exemplary embodiment, the lipid mixture comprises cationic lipid and organic solvent in a ratio of about 40 mg cationic lipid per mL organic solvent to about 60 mg cationic lipid per mL organic solvent, optionally about 50 mg cationic lipid per mL organic solvent. In various examples, the process of making liposomes further comprises rehydrating the lipid mixture with a rehydration solution to form a rehydrated lipid mixture, then stirring, settling, and sizing the rehydrated lipid mixture. Optionally, sizing the rehydrated lipid mixture comprises sonicating, extruding, and / or filtering the rehydrated lipid mixture.

[0086] A description of an exemplary method of making nanoparticles is provided in Example 1 herein. It is understood that any one or more of the steps described in Example 1 may be adjusted as necessary. For example, in some embodiments, the method includes one or more steps required to prepare the RNA prior to complexing with liposomes. In exemplary aspects, downstream steps are included to prepare the nanoparticles for administration to a subject, e.g., a human. In an exemplary example, the method includes formulating the NPs for intravenous injection. In various aspects, the method includes adding one or more pharma- ceutically acceptable carriers, diluents, or excipients, and optionally packaging the resulting composition in a container, e.g., a vial, syringe, bag, ampoule, or the like. The container in some aspects is a ready-to-use container, optionally for disposable use.

[0087] Pharmaceutical Compositions Provided herein is a composition comprising the nanoparticles of the present disclosure and a pharma- ceutically acceptable carrier, excipient, or diluent. In an exemplary embodiment, the composition is a sterile composition. In an exemplary example, the composition comprises a plurality of nanoparticles of the present disclosure. Optionally, at least 50% of the nanoparticles of the plurality have a diameter of about 100 nm to about 250 nm. In various embodiments, the composition comprises a concentration of about 10 nanoparticles per mL. 10 Nanoparticles ~ approx. 10 per mL 15 Nanoparticles, optionally about 10 per mL 12 Contains nanoparticles ±10%.

[0088] In exemplary aspects, the compositions of the present disclosure may include additional components other than nanoparticles, cells comprising nanoparticles, populations of cells comprising nanoparticles, or CAR T cells. The compositions may, in various aspects, include, for example, acidifiers, additives, adsorbents, aerosol propellants, air displacing agents, alkalizing agents, anti-caking agents, anticoagulants, antimicrobial preservatives, antioxidants, preservatives, bases, binders, buffers, chelating agents, coating agents, colorants, drying agents, detergents, diluents, disinfectants, disintegrants, dispersants, solubility enhancers, dyes, softeners, emulsifiers, emulsion stabilizers, fillers, film formers, flavor enhancers, flavorings, flow enhancers, and the like. The composition may include any pharma- ceutical or pharmaceutical acceptable ingredients, including, but not limited to, agents, gelling agents, granulating agents, moisturizing agents, lubricants, mucoadhesives, ointment bases, ointments, oily vehicles, organic bases, pastille bases, pigments, plasticizers, abrasives, preservatives, sequestering agents, skin-penetrating agents, solubilizing agents, solvents, stabilizing agents, suppository bases, surfactants, surface active agents, suspending agents, sweetening agents, therapeutic agents, thickening agents, tonicity agents, toxicity agents, thickening agents, water-absorbing agents, water-miscible cosolvents, water softeners, or humectants. See, for example, the Handbook of Pharmaceutical Excipients, Third Edition, A.H. Kibbe (Pharmaceutical Press, London, UK, 2000), which is incorporated by reference in its entirety; Remington's Pharmaceutical Sciences, Sixteenth Edition, E.W. Martin (Mack Publishing Co., Easton, Pa., 1980), which is incorporated by reference in its entirety.

[0089] The compositions of the present disclosure may be suitable for administration by any acceptable route, including parenteral and subcutaneous. Other routes include, for example, intravenous, intradermal, intramuscular, intraperitoneal, intranodal, and intrasplenic. In an exemplary aspect, the compositions are suitable for systemic (e.g., intravenous) administration. When the composition is in a form intended for administration to a subject, it can be made isotonic with the intended site of administration. For example, when a solution is in a form intended for parenteral administration, it can be isotonic with blood. The compositions are typically sterile. In certain embodiments, this may be accomplished by filtration through a sterile filtration membrane. In certain embodiments, parenteral compositions are generally placed into a container having a sterile access port, such as an intravenous solution bag, or a vial having a stopper that can be pierced by a hypodermic injection needle, or a prefilled syringe. In certain embodiments, the compositions may be stored either in a ready-to-use form or in a form that is reconstituted or diluted prior to administration (e.g., lyophilized). EXAMPLES

[0090] The following examples are provided merely to illustrate the present invention and not to limit its scope in any way.

[0091] Example 1 This example illustrates a method for making nanoparticles of the present disclosure.

[0092] Preparation of DOTAP liposomes On day 1, the following steps were carried out in a fume hood: Water was added to the rotavapor bath. Chloroform (20 mL) was poured into a sterile glass graduated cylinder. After opening a vial containing 1 g of DOTAP, 5 mL of chloroform was added to the DOTAP vial using a glass pipette. An amount of chloroform and DOTAP was then transferred to a 1 L evaporating flask. The DOTAP vial was washed by adding a second volume of 5 mL of chloroform to the DOTAP vial to dissolve the DOTAP remaining in the vial, and then transferring this amount of chloroform from the DOTAP vial to the evaporating flask. This washing step was repeated two more times until all the chloroform in the graduated cylinder was used. The evaporating flask was then placed in a Buchi rotavapor. The water bath was turned on and adjusted to 25° C. The evaporating flask was moved down until it touched the water bath. The rotation speed of the rotavapor was adjusted to 2. The vacuum system was turned on and adjusted to 40 mbar. After 10 minutes, the vacuum system was turned off and the chloroform was collected from the collector flask. The amount of chloroform collected was measured. Once the collector flask was repositioned, the vacuum was turned back on and the contents of the evaporation flask were allowed to dry overnight until the chloroform had completely evaporated.

[0093] On the second day, PBS (200 mL) was added to a new sterile 500 mL PBS bottle maintained at room temperature using a sterile graduated cylinder. A second 500 mL PBS bottle was prepared to collect DOTAP. A Buchi rotavapor water bath was set to 50 °C. PBS (50 mL) was added to the evaporation flask using a 25 mL disposable serological pipette. The evaporation flask was placed in a Buchi rotavapor and moved down until 1 / 3 of the flask was submerged in the water bath. The rotavapor was set to a rotation speed of 2 and rotated for 10 minutes before stopping the rotation. The 50 mL of PBS containing DOTAP from the evaporation flask was transferred to a second 500 mL PBS bottle. This process was repeated (3 times) until the entire amount of PBS in the PBS bottle was used. The final volume of the second 500 mL PBS bottle was 400 mL. The lipid solution in the second 500 mL PBS bottle was vortexed for 30 seconds and then incubated at 50 °C for 1 hour. The bottle was vortexed every 10 min during the 1 h incubation. The second 500 mL PBS bottle was left at room temperature overnight.

[0094] On the third day, PBS (200 mL) was added to the second 500 mL PBS bottle containing DOTAP and PBS. The second 500 mL PBS bottle was placed in an ultrasonic bath. Water was filled into the ultrasonic bath and the second 500 mL PBS bottle was sonicated for 5 min. The extruder was washed with PBS (100 mL) and this washing step was repeated. A 0.45 μm pore filter was attached to the filtration unit and a new (third) 500 mL PBS bottle was placed in the output tube of the extruder. In a biological safety cabinet, the DOTAP-PBS mixture was loaded into the extruder until the third PBS bottle was approximately 70% full. The extruder was then turned on and the DOTAP PBS mixture was added until all the mixture had passed through the extruder. A 0.22 μm pore filter was then attached to the filtration unit and a new (third) 500 mL PBS bottle was placed in the output tube of the extruder. The previously filtered DOTAP-PBS mixture was loaded and run again throughout. Samples containing DOTAP lipid nanoparticles (NPs) in PBS were then stored at 4°C.

[0095] RNA preparation Prior to incorporation into the NPs, RNA was prepared in one of several ways. Total tumor RNA was prepared by isolating total RNA (including rRNA, tRNA, and mRNA) from tumor cells. In vitro transcribed mRNA was prepared by performing an in vitro transcription reaction using a cDNA template generated by reverse transcription of total tumor RNA. Tumor antigen-specific and non-specific RNA were either generated in-house or purchased from a supplier.

[0096] Total tumor RNA: Total tumor-derived RNA from tumor cells (eg, B16F0, B16F10, and KR158-luc) was isolated using a commercially available RNeasy mini kit (Qiagen) according to the manufacturer's instructions.

[0097] In vitro transcribed mRNA: Briefly, RNA was isolated using the commercially available RNeasy mini kit (Qiagen) according to the manufacturer's instructions, and cDNA libraries were generated by RT-PCR. A PCR-based reverse transcriptase reaction was performed on total tumor RNA to generate cDNA libraries using the SMARTScribe Reverse Transcriptase kit (Takara). The resulting cDNA was then amplified using Takara Advantage 2 Polymerase mix with T7 / SMART and CDS III primers, and the total number of amplification cycles was determined by gel electrophoresis. Purification of cDNA was performed using the Qiagen PCR purification kit according to the manufacturer's instructions. To isolate sufficient mRNA for use in each RNA nanoparticle vaccine, in vitro transcription was performed overnight on the cDNA library using the mMESAGE mMACHINE (Invitrogen) kit with T7 enzyme mix. Housekeeping genes were evaluated to ensure fidelity of transcription. The resulting mRNA was then purified with the Qiagen RNeasy Maxi kit to obtain the final mRNA product.

[0098] Tumor antigen-specific and non-specific mRNA: Plasmids containing DNA encoding tumor antigen-specific RNA (e.g., RNA encoding pp65, OVA) and non-specific RNA (e.g., RNA encoding green fluorescent protein (GFP), luciferase) are linearized using a restriction enzyme (i.e., SpeI) and purified using a Qiagen PCR MiniElute kit. The linearized DNA was then transcribed using an mmRNA in vitro transcription kit (Life technologies, Invitrogen) and cleaned up using an RNA Maxi kit (Qiagen). In an alternative method, non-specific RNA is purchased from Trilink Biotechnologies (San Diego, CA).

[0099] Preparation of multi-layered RNA nanoparticles (NPs) DOTAP lipid NPs were complexed with RNA to create multi-layered RNA-NPs designed to have several layers of mRNA contained within tightly coiled liposomes with positively charged surfaces and empty cores (Figure 1A). Briefly, in a safety cabinet, RNA was thawed from -80°C and then placed on ice, while samples containing PBS and DOTAP (e.g., DOTAP lipid NPs) were allowed to warm to room temperature. Once the components were prepared, the desired amount of RNA was mixed with PBS in a sterile tube. To the sterile tube containing the mixture of RNA and PBS, an appropriate amount of DOTAP lipid NPs was added without physical mixing (e.g., without inverting the tube, without vortexing, without stirring). The mixture of RNA, PBS, and DOTAP was incubated for approximately 15 minutes to allow the formation of multi-layered RNA-NPs. After 15 minutes, the mixture was gently mixed by repeatedly inverting the tube. At this point, the mixture was considered ready for systemic (i.e., intravenous) administration.

[0100] The amount of RNA and DOTAP lipid NPs (liposomes) used in the above preparations is pre-determined or pre-selected. In some examples, a ratio of about 15 μg liposomes per about 1 μg RNA was used. For example, about 75 μg liposomes per about 5 μg RNA was used, or about 375 μg liposomes per about 25 μg RNA was used. In other examples, about 7.5 μg liposomes per 1 μg RNA were used. Thus, in illustrative examples, about 1 μg to about 20 μg liposomes are used for every μg RNA used.

[0101] Example 2 This example illustrates the characterization of the nanoparticles of the present disclosure.

[0102] Cryo-Electron Microscopy (CEM) CEM was used to analyze the structure of multi-layered RNA-NPs prepared as described in Example 1 and control NPs without RNA (uncomplexed NPs) made according to all steps of Example 1 except for the steps "RNA preparation" and "Preparation of multi-layered RNA nanoparticles (NPs)". CEM was performed essentially as described in Sayour et al., Nano Lett 17(3)1326-1335 (2016). Briefly, samples containing multi-layered RNA-NPs or control NPs were kept on ice before loading and flash freezing in a Vitrobot (and an automated plunge freezer for cryo-TEM, which freezes samples without ice crystal formation by controlling temperature, relative humidity, blotting conditions and freezing rate). Samples were then imaged on a Tecnai G2 F20 TWIN 200kV / FEG transmission electron microscope equipped with a Gatan UltraScan 4000 (4k×4k) CCD camera. The resulting CEM image is shown in FIG. 1B. The right panel is a CEM image of the multi-layered RNA-NPs, and the left panel is a CEM image of the control NPs (uncomplexed NPs). As shown in Figure 1B, the control NPs contained a maximum of two layers, whereas the multi-layered RNA NPs contained multiple layers.

[0103] Zeta potential The zeta potential of multilayered RNA NPs was measured by phase analysis light scattering (PALS) using a Brookhaven ZetaPlus instrument (Brookhaven Instruments Corporation, Holtsville, NY) essentially as described in Sayour et al., Nano Lett 17(3) 1326-1335 (2016). Briefly, uncomplexed NPs or RNA-NPs (200 μL) were resuspended in PBS (1.2 mL) and loaded into the instrument. Samples were run five times per sample, with 25 cycles per run, using the Smoluchowski model.

[0104] The zeta potential of the multi-layered RNA NPs prepared as described in Example 1 was measured at about +50 mV. Interestingly, this zeta potential of the multi-layered RNA NPs was much higher than that measured at around +27 mV, as described in Sayour et al., Oncoimmunology 6(1):e1256527 (2016). Without being bound to a particular theory, the method of preparing DOTAP lipid NPs for use in preparing multi-layered RNA NPs (Example 1), which includes a vacuum seal method to evaporate chloroform, may result in less environmental oxidation of the DOTAP lipid NPs, which may allow a greater amount of RNA to form complexes with the DOTAP NPs and / or a greater incorporation of RNA into the DOTAP lipid NPs.

[0105] RNA capture by gel electrophoresis: Gel electrophoresis experiments were performed to measure the amount of RNA incorporated into ML liposomes. Based on this experiment, it was qualitatively shown that nearly all, if not all, of the RNA used in the procedure described in Example 1 was incorporated into DOTAP lipid NPs. Additional experiments to characterize the extent of RNA incorporation will be performed by measuring RNA-NP density and comparing this parameter to that of lipoplexes.

[0106] Example 3 This example describes a comparison of the nanoparticles of the present disclosure with cationic and anionic RNA lipoplexes.

[0107] Cationic lipoplexes (LPX) were first developed with mRNA in a lipid core shielded by a net positive charge on the outer surface (Figure 2A). Anionic RNA lipoplexes (Figure 2B) were developed with excess RNA tethered to the surface of bilayer liposomes. RNA-LPX was made by mixing RNA and lipid NPs in a charge-equalizing ratio. Anionic RNA-NPs were made by mixing RNA and lipid NPs in a ratio that supersaturated the negatively charged lipid NPs. Next, various aspects of RNA-LPX and anionic RNA LPX were compared to the multi-layered RNA NPs described in the above examples.

[0108] Cryo-electron microscopy (CEM) was used to compare the structure of RNA LPX and multi-layered RNA-NPs prepared as described in Example 1. Uncomplexed NPs were used as a control. CEM was performed essentially as described in Example 2. Figure 2C shows a CEM image of uncomplexed NPs, Figure 2D shows a CEM image of RNA LPX (whose mass ratio of liposomes to RNA is 3.75:1), and Figure 2E shows a CEM image of multi-layered RNA-NPs (whose mass ratio of liposomes to RNA is 15:1). These data support that more RNA is retained by the ML RNA-NPs. Additional data show that concentrated droplets with more ML RNA-NP complexation relative to RNA LPX support multi-layer formation of ML RNA NPs that is not observed by simply mixing equal amounts of RNA and lipid NPs by mass or charge (i.e., RNA-LPX and anionic RNA-LPX, respectively). This supports that more RNA is "retained" by the ML RNA-NPs described herein.

[0109] Experiments were also performed to determine where anionic LPX was localized upon administration to mice. Anionic LPX was localized to the spleen of the animals upon administration.

[0110] Mice were administered RNA LPX, anionic lipoplex (LPX), or multilayered RNA-NPs, and spleens were harvested one week later for evaluation of activated DCs ( * p<0.05 unpaired t-test). The RNA used in this experiment was tumor-derived mRNA derived from the K7M2 tumor osteosarcoma cell line. As shown in Figure 2F, mice treated with multi-layered RNA NPs showed the highest levels of activated DCs.

[0111] Anionic tumor mRNA-lipoplexes, tumor mRNA-lipoplexes, and multi-layer tumor mRNA-loaded NPs were compared in a therapeutic lung cancer model (K7M2) (n=5-8 / group). Each vaccine was administered intravenously weekly (x3) ( ** p<0.01, Mann-Whitney). The %CD44+CD62L+ of CD8+ splenocytes is shown in Figure 2G, and the %CD44+CD62L+ of CD4+ splenocytes is shown in Figure 2H. Figure 2J also shows that multi-layered (ML) RNA-NPs mediate substantially increased IFN-α, a natural antiviral cytokine. This indicates that ML RNA-NPs allow substantially greater natural immunity sufficient to promote efficacy even from non-antigen specific ML RNA-NPs. These data also indirectly support that ML RNA-NPs increase the number of activated plasmacytoid dendritic cells (pDCs), the most important producers of IFN-α. Taken together, this data indicates superior efficacy of multi-layered tumor-specific RNA-NPs compared to anionic LPX and RNA LPX.

[0112] Anionic tumor mRNA-lipoplexes, cationic tumor mRNA-lipoplexes, and multi-layer tumor mRNA-loaded NPs were compared in a therapeutic lung cancer model (K7M2) (n=8 / group). Each vaccine was administered intravenously weekly (x3).* p<0.05, Gehan Breslow-Wilcoxon test. Survival rates were measured by Kaplan-Meier curve analysis. As shown in Figure 2I, multi-layered tumor-specific RNA-NPs mediated superior efficacy in enhancing survival rates compared to cationic and anionic RNA lipoplexes.

[0113] The ability of multilayered RNA-NPs to activate innate immune responses in vivo was also investigated in the glioma tumor microenvironment.

[0114] RNA-NPs localize to the perivascular regions of tumors and reprogram the TME for activated myeloid cells. K-luc-bearing animals (n=5 / group) were inoculated with tumor RNA-NPs or NPs alone. Tumors were harvested 48 hours later for RNA-seq analysis. In animals administered RNA-NPs, a significant upregulation of gene signatures for BATF3, IRFs, and IFN-responsive genes was observed. In particular, the RNA-NPs of the present invention significantly upregulated the expression of BATF3 (associated with effector dendritic cell phenotype), IRF5 and IRF7 (interferon regulatory factors), and ISG15 and IFITM3 (interferon-responsive genes). These genes have been shown to be essential for sensitizing immunotherapy responses. Thus, RNA-NPs upregulate key innate immune gene signatures in the glioma tumor microenvironment associated with effector immune responses, effectively turning the tumor from “cold” to “hot,” allowing immune checkpoint inhibitors to become active in places where they were ineffective before RNA-NP treatment.

[0115] Here, we show that multi-layered RNA-NP formulations targeting physiologically relevant tumor antigens are more immunogenic (Figure 2F-H, J) and significantly more efficacious (Figure 2I) compared to anionic LPX and RNA LPX. Without being bound to a particular theory, a new RNA-NP design was developed consisting of multi-layered rings of tightly wound mRNA by altering the RNA-lipid ratio and increasing the zeta potential (Figure 1C), which is believed to promote increased NP uptake of mRNA (enriched by alternating positive / negative charges) to enhance particle immunogenicity and extend in vivo localization to the periphery and tumor microenvironment (TME). Systemic administration of these multi-layered RNA-NPs localizes to lymph nodes, reticuloendothelial organs (i.e., spleen and liver) as well as the TME, where they activate DCs (based on increased expression of the activation marker CD86 on CD11c+ cells). These activated DCs prime antigen-specific T cell responses, resulting in antitumor effects (accompanied by an increase in TILs) in several tumor models.

[0116] Example 4 This example shows that personalized tumor RNA-NPs are active in a translational canine model.

[0117] The safety and activity of the multilayered RNA-NPs were evaluated in client-owned dogs (pet dogs) diagnosed with malignant glioma or osteosarcoma, which were initially biopsied for the generation of personalized tumor RNA-NP vaccines.

[0118] To generate personalized multi-layered RNA NPs, total RNA material was extracted from each patient's biopsy. A cDNA library was then prepared from the extracted total RNA, and mRNA was then amplified from the cDNA library. The mRNA was then complexed with DOTAP lipid NPs into multi-layered RNA-NPs substantially as described in Example 1. Blood was collected at baseline and then 2 and 6 hours after vaccination for evaluation of PD-L1, MHCII, CD80, and CD86 on CD11c+ cells. CD11c expression of PD-L1, MHC-II, PDL1 / CD80, and PD-L1 / CD86 is plotted over time during the dog's initial observation period. CD3+ cells were analyzed for the proportion of CD4 and CD8 over time during the dog's initial observation period, and these subsets were evaluated for expression of activation markers (i.e., CD44). From these data, it can be seen that multi-layered RNA-NPs 1) increased CD11c expression, indicative of activation of peripheral DCs; + It has been shown to induce 1) an increase in CD80 and MHCII on peripheral blood cells, and 2) an increase in activated T cells.

[0119] Interestingly, within hours of administration, tumor-specific RNA-NPs induced margination of peripheral blood mononuclear cells, which increased days and weeks after treatment, suggesting that RNA-NPs mediate lymphocyte honing of immune cell populations prior to release.

[0120] These data indicate that personalized mRNA-NPs are safe and active in a translational canine disease model.

[0121] Specific data for dogs evaluated with this method are shown. A 31 kg male Irish Setter was enrolled in the study with owner consent to receiving multi-layered RNA-NP. After tumor biopsy, tumor mRNA was successfully extracted and amplified. The immune response was plotted in response to the first vaccine. The data show an increase in activation markers over time in CD11c+ cells (DCs) (Figure 3A). The data show an increase in activated CD8+ cells (CD44+CD8+ cells) within the first hours after RNA-NP vaccination. These data confirm that multi-layered RNA-NP is immunologically active in male Irish Setters. A male Boxer diagnosed with malignant glioma was enrolled in the study with owner consent to receiving RNA-NP. After tumor biopsy, tumor mRNA was successfully extracted and amplified. The immune response is plotted in response to the first vaccine (Figure 3B). The data show an increase in activation markers over time in CD11c+ cells (DCs). As shown in Figure 3C, an increase in activated T cells (CD44+CD8+ cells) was observed within the first few hours after RNA-NP vaccination. These data support that multi-layered RNA-NPs are immunologically active in male Boxer dogs. Additional observations from treatment of dogs with spontaneous gliomas are shown in Figures 3E-3H. Figure 3E shows the percentage of lymphocytes elicited the day after vaccination, suggesting marginalization for antigen education prior to release. Figure 3F shows a surge in interferon alpha production and Figure 3G shows an increase in CD80 expression in CD11c+ cells several hours after administration of ML RNA-NPs. Figure 3H shows expression of CD8+ cells and CD44+CD8+ cells, noting a shift to a more immunologically "active" environment. This data supports the use of ML RNA-NPs to shift to an immune environment more responsive to immunotherapy.

[0122] After receiving weekly RNA-NP (x3), dogs diagnosed with malignant gliomas made a steady progress. Post-vaccination MRI showed stable tumor burden with increased swelling and enhancement (in some cases), which may be more consistent with pseudoprogression from immunotherapy response in asymptomatic dogs. The survival rate of dogs diagnosed with malignant gliomas receiving only supportive care and tumor-specific RNA-NP (after tumor biopsy without resection) is shown in Figure 3D. In Figure 3D, the median survival time (shown by the dotted line) was approximately 65 days, which was reported from a meta-analysis of canine brain tumor patients receiving only symptomatic care. Previous studies have reported that canine brain astrocytomas have a median overall survival of 77 days. The personalized multi-layered RNA NPs enabled survival of over 200 days.

[0123] With the exception of a slight fever spike 6 hours after vaccination on the first day, personalized tumor RNA-NP (1x) was well tolerated with stable blood counts, differentials, renal function and liver function tests. To date, four dogs diagnosed with malignant brain tumors have been treated. It is important to emphasize that these dogs received no other therapeutic interventions for their malignancies (i.e., no surgery, radiation or chemotherapy) and all patients evaluated developed immune responses with pseudoprogression or stable / smaller tumors. One dog was necropsied after RNA-NP vaccination. In this patient, there was no toxicity considered related to the intervention agent.

[0124] These results suggest the safety and activity of tumor-specific RNA-NP in client-owned dogs with malignant brain tumors in subjects not receiving other antitumor therapeutic interventions.

[0125] Example 5 This example shows that non-antigen-specific multi-layered (ML) RNA NPs confer memory and mediate antigen-specific immunity long enough to ward off tumor rechallenge.

[0126] Experiments were performed with long-term survivors (e.g., mice that survived for about 100 days) that were challenged a total of two times by tumor inoculation, but were treated only once a week (×3) with ML RNA NPs containing GFP RNA or pp65 RNA (each non-specific to tumors), or with ML RNA NPs containing tumor-specific RNA. Treatments were performed immediately after the first tumor inoculation and about 100 days before the second tumor inoculation. Since none of the control mice (untreated mice) survived until 100 days, a new control group of mice was created by inoculating the same type of mice with K7M2 tumors. Similar to the original control mice, the new control group did not receive any treatment. The long-term survivors also did not receive any treatment after the second tumor inoculation. The timeline of events for this experiment is shown in FIG. 4A.

[0127] Notably, all three groups of mice contained long-term survivors that survived the second tumor challenge. As shown in FIG. 4B (showing only the period after the second inoculation), all three groups of mice contained long-term survivors that survived until 40 days after tumor implantation (second example of tumor inoculation). Interestingly, the percentage of long-term surviving mice previously treated with ML RNA NPs containing non-specific RNA (GFP RNA or pp65 RNA) survived until 40 days after the second tumor inoculation, which was comparable to the group treated with ML RNA NPs containing tumor-specific RNA (treated before the second tumor challenge).

[0128] These data confirm that ML RNA NPs containing RNA non-specific to the tumor of interest provide therapeutic treatment to tumors comparable to that provided by ML RNA NPs containing tumor-specific RNA, leading to an increased percentage of animal survival.

[0129] Example 6 This example shows that administration of ML RNA NPs in combination with immune checkpoint inhibitors leads to a significant increase in survival in tumor-bearing subjects.

[0130] To test the effect of ML RNA NPs in combination with ICI, tumor-bearing C57Bl / 6 mice were treated with ML RNA NPs alone (RNA NPs) or in combination with anti-PDL1 monoclonal antibody (PDL1 mAb). Control groups included untreated mice, mice treated with nanoparticles not loaded with any RNA (NPs only), or PDL1 mAb only. For tumor implantation, approximately 200,000 MOC-1 cells, which are murine oral cavity squamous cell carcinoma (OSCC) cells, were implanted subcutaneously in C57Bl / 6 mice. For the groups receiving nanoparticles (ML RNA NPs only or combined with PDL1 mAb or NPs only), NPs were injected intravenously within 24 hours of tumor implantation, followed by two more injections once a week. For groups of mice receiving ICI (ML RNA NP+PDL1 mAb or PDL1 mAb alone), PD-L1 mAb (400 μg) was injected intraperitoneally, followed by 200 μg injections twice weekly until the third dose of NP. Surviving mice in each group were monitored over the course of the study, which was approximately 100 days, and the percentage of surviving mice in each group was plotted as a function of time after tumor implantation. The results are shown in Figure 5. As shown in this figure, the percentage of surviving mice treated with ML RNA NP in combination with ICI was much higher than mice that received either treatment alone.

[0131] Example 7 This example shows that the ML RNA-NPs of the present disclosure mediate anti-tumor immune responses against immunologically "cold" tumors, i.e., tumors that did not respond to ICIs. As shown in Figures 6A-6C, administration of the ML RNA-NPs of the present disclosure together with an immune checkpoint inhibitor (here, an anti-PD-L1 antibody) resulted in a reduction in tumor volume in a melanoma model compared to administration of the RNA-NPs alone and the checkpoint inhibitor alone. Administration of ML RNA-NPs also resulted in enhanced subject survival in a sarcoma model and a metastatic lung model. This data establishes that ML RNA-NPs reprogram immunologically "cold" tumors and demonstrates the efficacy of ML RNA-NPs across a range of cancers and tumor types.

[0132] Example 8 This example describes a study to elucidate the effect of systemic administration of the nanoparticle compositions of the present disclosure on CAR T cell priming.

[0133] CD70 and GD2 are surface antigens expressed in osteosarcoma (OSA). The CD70-CAR T platform shows promising antitumor activity against CD70-expressing solid tumors. Jin et al., Nat Commun., 10(1):4016 (2019). In in vitro experiments, tumor-specific killing against CD70-KR158 and CD70-K7M2 OSA tumor cells was observed. In addition, GD2-CAR T cell constructs were generated that target GD2-expressing OSA cell lines (K7M2 and MOS-J). In follow-up experiments, CAR T cells were shown to mediate substantial regression of established solid tumors when combined with RNA-NPs encoding a surface target (i.e., CD70), which correlated well with CAR T recruitment to tissues (Figure 8A).

[0134] To determine the effect of NP-activated APCs on CAR-specific T cells (administered 1 week after transplantation), K7M2-bearing mice (inoculated iv with pulmonary OSA metastases) were vaccinated with purified tumor mRNA (derived from CD70 expressing K7M2) encapsulated in FITC-labeled NPs as previously described (Sayour et al. Oncoimmunology 2016:e1256527;doi:10.1080 / 2162402X.2016.1256527). RNA-NPs (vs. NPs alone or control RNA-NPs) composed of 375 μg of lipid-NPs described herein with 25 μg of tumor mRNA (derived from K7M2) were administered iv every week (×3) starting 24 hours after CAR T cell administration. CAR transgene expression was assessed from peripheral blood. One week after the last vaccine, relevant FITC+DCs (CD11c+CD86+MHC+cells) were sorted (FACSort; BD Aria II) from spleens, tumor draining lymph nodes (tDLNs) and OSA tumors. RNA-NP-transfected DCs were then cultured with CAR T cells and T cells were assessed for proliferation, phenotype (effector vs. central memory), function and cytotoxicity. T cell proliferation was assessed via CFSE dilution by flow cytometry. Effector / central memory cell phenotype was determined by differential staining of CD44 and CD62L. These T cells were restimulated for a total of two cycles before supernatants were harvested for detection of Th1 cytokines (i.e., IL-2, TNF-α and IFN-γ) by bead array (BD). To determine antigen specificity, T cells were incubated in the presence of K7M2 (expressing a surface target, transfected with GFP or luciferase) or control tumors (B16F10-GFP, a non-surface target expressing K7M2) and assessed for cytotoxic killing. The amount of GFP or luciferase in each co-culture, as a surrogate for viable tumor cells, was quantitatively measured by flow cytometry and bioluminescence.Representative results of this type of assay are shown in Figure 13A, which shows transduction of spleen and liver cells with RNA-NPs, and Figure 13B, which corresponds to a study using tumor cells, RNA-NPs, and CAR T cells.

[0135] Recruitment of DCs to tumors is typically associated with a regulatory phenotype characterized by increased IDO, FoxP3+ Tregs, and secretion of immunomodulatory cytokines. To determine the intratumoral efficacy of DCs, CAR T cells with or without tumor mRNA-NPs (vs. NPs alone or control RNA-NPs) are administered once a week (x3) to K7M2-bearing IFN-γ reporter mice with or without DC-depleting mAb (Bioxcell). Activated and regulatory T cells are examined over time in the intratumoral microenvironment at consecutive time points (6 hours, 1 day, 7 days, and 21 days). Effector T cells may be characterized as previously described (Sayour et al. Nano Lett, 18(10):6195-206 (2018)) and Tregs are phenotyped by expression of FoxP3, CD25, and CD4. DCs from non-depleted animals are FACSort and phenotyped for expression of multiple cytokines, chemokines (i.e., IL-2, TNF-alpha, IFN-I / II, MIP-1-alpha / beta), activation markers (i.e., CD80, CD86, CD40), cytolytic markers (i.e., TRAIL, granzyme b), and regulatory markers (i.e., IL-10, TGF-β, IDO). Tumor cell-induced immune phenotypic changes are also assessed (i.e., MHC-I, PD-L1, SIRPα).

[0136] Example 9 This example describes studies to investigate the mechanistic basis for CAR T cell trafficking and persistence in the OSA tumor microenvironment (TME).

[0137] RNA-NPs upregulate LFA-1 and CCR2 on T cells in an interferon-I-dependent manner. These findings correlate with the massive mobilization of lymphocytes and monocytes from peripheral blood in large animals receiving RNA vaccines. Because high-grade OSA expresses increased levels of CCL2 compared to low-grade OSA, this approach may drive CAR T cell therapy into the OSA TME, resulting in enhanced antitumor activity and persistence.

[0138] Subsequent studies will serve to investigate the chemokine receptor, S1P1, and VLA-4 / LFA-1 expression profiles of CAR T cells before and after RNA-NP vaccination. This methodology will allow for the evaluation of the effect of RNA-NPs on CAR T cell trafficking molecules, including sphingosine-1-phosphate receptor 1 (S1P1), required for T cell egress from lymphoid organs, and integrins (i.e., VLA-4, LFA-1), required for T cell passage into the TME. K7M2-bearing IFN-γ reporter mice will be administered CAR T cells alone or in combination with RNA-NPs. One week after the last vaccination, recipient mice will be humanely euthanized (by CO2) and spleens, tdLNs, bone marrow, and tumors will be harvested. Organs are digested and CAR T cells from spleen, lymph nodes, bone marrow, and tumor are identified at consecutive time points (days 7, 14, and 21) by surface expression of target antigens and by differential staining for effector and central memory T cells (i.e., CD62L and CD44 markers). Th1-associated chemokine receptors (i.e., CCR2, CCR5, CCR7, and CXCR3), S1P1 expression, VLA-4, and LFA-1 expression (ebioscience) from CD4 and CD8 CAR T cells are assessed by multiparameter flow cytometry and IHC.

[0139] Subsequent studies will serve to investigate the effect of RNA-NP on CAR T cell in vitro and in vivo migration and persistence in the OSA TME. In vitro: K7M2 tumor-bearing naïve, LFA-1, CCL2, or CCR2 KO animals (B6 transgenic, Jackson) are administered CAR T cells with or without RNA-NP (vs. NP alone or control RNA-NP) weekly (x3). One week after the last vaccine, T cells are FACSorted through a BD Aria II Cell Sorter. These T cells can be assessed for migration ability in a transwell assay (Thermo-Fisher). Briefly, T cells are placed on the top layer of a cell culture insert with a permeable membrane between layers of K7M2-GFP tumor cells. Migration is assessed by the number of cells migrating between the layers. T cells are administered weekly (x3) with tumor cells (4x10 6 4 × 10 per mL for coculture with IL-2 (1 microgram / mL) (× 48 h) 6 IFN-γ is determined by ELISA after plating in T cell medium at a concentration of 0.1 mg / mL. The amount of GFP in each co-culture is quantitatively measured by flow cytometric analysis and bioluminescence as a surrogate for viable tumor cells. In vivo: K7M2-bearing IFN-γ reporter mice or IFN-γ reporter mice receiving LFA-1 or CCL2 blocking mAbs (Bioxcell) are administered CAR T cells with or without RNA-NP (vs. NP alone or control RNA-NP) weekly (×3). In vivo passage into the TME is assessed from the percentage and absolute number of CAR T cells in OSA tumors (relative to spleen, lymph nodes, bone marrow) at consecutive time points (days 5, 10, 15, 20 from the first vaccine). Antigen-specific T cell cytotoxicity assays are performed as described above.

[0140] Example 10 This example describes a study to examine the immunological activity of CAR T cells with and without systemic vaccination in a large animal OSA model.

[0141] Two dogs with OSA (which naturally expressed CD70) were treated with RNA-NPs to generate CAR-transformed canine T cells. Notably, one OSA patient remains alive. In dogs with OSA, within hours of administration, tumor-specific RNA-NPs induced margination of peripheral blood mononuclear cells, and this margination increased days and weeks after treatment (Figure 9A-C), suggesting that RNA-NPs mediate lymphocyte honing of immune cell populations prior to release. RNA-NPs also induced increases in 1) serum IFN-α, which spiked at 2 hours, 2) CD86, PD-L1, and MHCII on CD11c+ peripheral blood cells (indicating activation of peripheral DCs), and 3) the percentage of activated CD8+ T cells.

[0142] Subsequent studies will examine combination therapy of RNA-NPs and CAR T cells in a canine model of OSA. Routine standard treatment for dogs with metastatic OSA involves palliation (no biopsy) and is uniformly fatal. Dogs with suspected metastatic OSA (based on imaging) will be enrolled. Dogs will then undergo a screening CT-guided biopsy for confirmation of disease by histopathology, and screening for GD2 or CD70 expression. If the patient meets eligibility, we will manufacture GD2 or CD70 CAR T cells and inject these (1×10 7 CAR T cells / kg) will be administered in conjunction with tumor-specific RNA-NP. Validation of personalized tumor mRNA will be determined based on RNA quality, concentration, and integrity by gel electrophoresis, nanodrop spectrophotometry, and bioanalysis. Enrolled dogs will receive CAR T cells alone or CAR T cells and RNA-NP (1 hour apart) two weeks after biopsy and peripheral blood mononuclear cell (PBMC) collection. Peripheral laboratory findings and serum cytokines (i.e., IFI-I, IL-6, TNF-α) from dogs will be monitored at the time of diagnosis, immediately prior to each biweekly RNA-NP vaccination (x3), and during monthly post-treatment follow-ups.

[0143] Subsequent studies will examine peripheral DC and CAR T cell activation phenotypes in dogs diagnosed with OSA.

[0144] Identifying biological correlates of immunotherapy response has been a key challenge impeding the development of new immunotherapies. DC and CAR T cell phenotypes required for immune response or tolerance can be examined as follows: Briefly, 10-50 mL of dog peripheral blood is collected in vacutainer tubes at the time of diagnosis and immediately prior to each vaccination. PBMCs are separated by density gradient centrifugation over Ficoll. DCs from PBMCs are evaluated weekly for determination of activation markers (i.e., CD80, CD86, and MHCII on CD11c+ cells). CAR transgene expression is assessed. T cell lymphocytes are analyzed for surface expression of CD3, CD4, CD8, CCR2, CD69, LFA-1, and PD-1, and intracellular staining is performed for FoxP3 and IFN-γ. Analysis is monitored using multicolor flow cytometry. To assess efficacy, tumor growth is determined based on CT imaging (weeks 2 and 4 after RNA-NP and every 3 months thereafter). Immune evasion mechanisms were investigated in tumors obtained via autopsy (i.e., expression of checkpoint ligands, IDO, downregulation of MHC class I) and within the OSA TME (i.e., MDSCs, Tregs, and TAMs). Evasion mechanisms in tumors and within the TME were performed by multiparameter flow cytometry (LSR, BD Bioscience).

[0145] All references cited in this specification, including publications, patent applications, and patents, are hereby incorporated by reference to the same extent as if each reference was individually and specifically indicated to be incorporated by reference and was set forth in its entirety herein.

[0146] Use of the terms "a" and "an" and "the" and similar referents in the context of describing this disclosure (particularly in the context of the claims which follow) should be construed to encompass both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (i.e., meaning "including, but not limited to"), unless otherwise indicated. When aspects of the invention are described as "comprising" a feature, it is contemplated that the embodiment also "consists of" or "consists essentially of" the feature.

[0147] The recitation of ranges of values ​​herein, unless otherwise indicated herein, is merely intended to serve as a shorthand method of referring individually to each separate value and each endpoint falling within the range, and each separate value and endpoint is incorporated herein to the same extent as if each separate value and endpoint were individually recited herein. Except in the operating examples, or unless otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about," as that term would be interpreted by one of ordinary skill in the relevant art.

[0148] All methods described herein may be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. Any and all examples provided herein, or the use of exemplary language (e.g., "etc.") are intended merely to facilitate easier understanding of the disclosure and do not impose limitations on the scope of the disclosure unless otherwise asserted. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the disclosure.

[0149] Preferred embodiments of the present disclosure are described herein, including the best mode known to the inventors for carrying out the disclosure. Variations of these preferred embodiments may become apparent to those skilled in the art upon reading the foregoing specification. The inventors anticipate that those skilled in the art will adopt such variations as necessary, and the inventors intend for the present disclosure to be carried out in variations other than those specifically described herein. Accordingly, this disclosure includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the present disclosure unless otherwise indicated herein or clearly contradicted by context.

Claims

1. 1. A first composition for use in preconditioning a subject for chimeric antigen receptor (CAR) T-cell therapy, the first composition comprising nanoparticles comprising a positively charged surface and (i) a core, and (ii) an interior comprising at least two nucleic acid layers, each nucleic acid layer disposed between a cationic lipid bilayer, the first composition being for administration to the subject at least one day prior to administering CAR T-cell therapy to the subject.

2. 2. The composition for use of claim 1, wherein said composition is for administration to said subject 2-14 days prior to administering said CAR T cell therapy to said subject.

3. 2. The composition for use of claim 1, wherein said composition is for administration to said subject about 5 to about 8 days prior to administering said CAR T cell therapy to said subject.

4. 2. The composition for use of claim 1, wherein the subject has not been administered lymphodepleting therapy within 21 days prior to administration of the CAR T cell therapy.

5. The composition for use according to claim 1 , wherein the subject is afflicted with a solid tumor.

6. The composition for use according to claim 1, wherein the subject is suffering from an immune checkpoint inhibitor (ICI)-resistant malignant tumor.

7. The composition for use according to claim 1 , wherein the subject is suffering from a refractory malignant tumor.

8. The composition for use according to claim 1 , wherein the subject is suffering from a malignant brain tumor.

9. The composition for use according to claim 8, wherein the malignant brain tumor is a glioblastoma, a medulloblastoma, a diffuse intrinsic pontine glioma, or a peripheral tumor with metastatic infiltration into the central nervous system.

10. The composition for use according to claim 5, wherein the subject is suffering from recurrent or metastatic osteosarcoma.

11. The composition for use according to claim 1 , wherein the nanoparticle comprises at least three layers of nucleic acid, each of which is disposed between cationic lipid bilayers.

12. The composition for use according to claim 1 , wherein the outermost layer of the nanoparticle comprises a cationic lipid bilayer.

13. The composition for use according to claim 1 , wherein the surface comprises a plurality of hydrophilic moieties of the cationic lipids of the cationic lipid bilayer.

14. The composition for use according to claim 1 , wherein the core comprises a cationic lipid bilayer.

15. The composition for use according to claim 1 , wherein the core comprises less than about 0.5% by weight of nucleic acid.

16. The composition for use according to claim 1 , wherein the nanoparticles comprise a zeta potential of about 40 mV to about 60 mV.

17. The composition for use according to claim 16, wherein the nanoparticles comprise a zeta potential of about 45 mV to about 55 mV.

18. The composition for use according to claim 1 , wherein the cationic lipid is DOTAP or DOTMA.

19. The composition for use according to claim 1 , wherein the nucleic acid is mRNA.

20. 20. The composition for use according to claim 19, wherein the mRNA is a tumor mRNA.

21. 21. The composition for use of claim 20, wherein the mRNA is in vitro transcribed mRNA and the in vitro transcription template is cDNA made from RNA extracted from a tumor cell.

22. 20. The composition for use of claim 19, wherein the mRNA does not encode a tumor antigen targeted by the CAR T cells.

23. 20. The composition for use of claim 19, wherein the mRNA is not a tumor mRNA.

24. The composition for use according to claim 1 , wherein the nanoparticles are free of neutral lipids.

25. 2. The composition for use of claim 1, further comprising administering, after administering CAR T cell therapy, a second composition comprising nanoparticles comprising a positively charged surface and an interior comprising: (i) a core, and (ii) at least two nucleic acid layers, each nucleic acid layer disposed between a cationic lipid bilayer.

26. 26. The composition for use according to claim 25, wherein the nucleic acid of the second composition is a tumor mRNA.

27. 27. The composition for use of claim 26, wherein the mRNA is in vitro transcribed mRNA and the in vitro transcription template is cDNA made from RNA extracted from a tumor cell.

28. 1. A combination of compositions for use in treating a solid tumor in a subject, said combination comprising a first composition and a second composition, said first composition comprising nanoparticles comprising a positively charged surface and an interior comprising (i) a core, and (ii) at least two nucleic acid layers, each nucleic acid layer disposed between a cationic lipid bilayer, said nucleic acid encoding said surface antigen, and said second composition comprising T cells expressing a chimeric antigen receptor (CAR) that targets said surface antigen, wherein said combination is administered to a subject comprising a surface antigen-negative solid tumor.

29. 29. The combination of claim 28, wherein the first composition is administered at least one day before the second composition.

30. The combination of claim 28, wherein the first composition is administered at least once 2 to 14 days prior to administering the second composition to the subject.

31. 30. The combination of claim 28, wherein the subject has not been administered lymphodepleting therapy within 21 days prior to administration of the CAR T cell therapy.

32. 29. The combination of claim 28, wherein the solid tumor is located in the lung, liver, bone, spleen, or lymph node.

33. The combination of claim 32, wherein the subject is suffering from recurrent or metastatic osteosarcoma.

34. 29. The combination of claim 28, wherein the nanoparticle comprises at least three layers of nucleic acid, each of which is disposed between cationic lipid bilayers.

35. 29. The combination of claim 28, wherein the outermost layer of the nanoparticle comprises a cationic lipid bilayer.

36. 30. The combination of claim 28, wherein the surface comprises a plurality of hydrophilic moieties of the cationic lipids of the cationic lipid bilayer.

37. 29. The combination of claim 28, wherein the core comprises a cationic lipid bilayer.

38. 29. The combination of claim 28, wherein the core comprises less than about 0.5% by weight of nucleic acid.

39. 29. The combination of claim 28, wherein the nanoparticles comprise a zeta potential of about 40 mV to about 60 mV.

40. 40. The combination of claim 39, wherein the nanoparticles comprise a zeta potential of about 45 mV to about 55 mV.

41. 29. The combination of claim 28, wherein the cationic lipid is DOTAP or DOTMA.

42. The combination according to claim 28, wherein the nucleic acid is mRNA.

43. The combination of claim 28 , wherein the nanoparticles do not contain neutral lipids.

44. 29. The combination of claim 28, comprising administering the first composition after administering the second composition.

45. 29. The combination of claim 28, further comprising a third composition comprising nanoparticles comprising a positively charged surface and (i) a core, and (ii) an interior comprising at least two nucleic acid layers, each nucleic acid layer disposed between cationic lipid bilayers, and the nucleic acid does not encode the surface antigen.

46. The combination of claim 45, wherein the nucleic acid of the third composition is a tumor mRNA.

47. The combination of claim 45, wherein the nucleic acid of the third composition is not tumor RNA.

48. The combination according to claim 28, wherein the surface antigen is CD70.

Images