Modified mRNAs, modified non-coding RNAs, and uses thereof

Abstract

Modified niRNAs and modified non-coding RNAs having poly(A) tails containing modified nucleotides and / or secondary structures are disclosed herein, which can be made by ligating a tailing nucleic acid to the 3' end of the RNA. Also provided are compositions comprising one or more of the modified mRNAs or modified non-coding RNAs provided herein, and methods of using the compositions for therapeutic or agricultural applications.

Description

[Background technology]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 187,752, filed May 12, 2021, entitled "MODIFIED MRNA AND USES THEREOF," and U.S. Provisional Application No. 63 / 288,522, filed December 10, 2021, entitled "MODIFIED MRNA AND USES THEREOF," the entire disclosures of each of which are incorporated herein by reference in their entirety. Reference to sequence listing submitted as a text file via EFS-WEB

[0002] This application contains a Sequence Listing, which has been submitted via EFS-Web in ASCII format and is incorporated herein by reference in its entirety. Said ASCII copy, created on May 10, 2022, is designated B119570130WO00-SEQ-JQM and is 9,854 bytes in size.

[0003] Messenger RNA (mRNA) technology is an emerging alternative to traditional small molecule therapeutic and vaccine approaches because it is powerful, programmable, and allows for the rapid production of mRNA with desired sequences. mRNA therapeutics is a rapidly developing field and has been used to express therapeutic proteins ranging from vascular regeneration factors to vaccines for COVID-19, influenza, and Zika viruses. Despite recent clinical success, mRNA therapeutics still face challenges such as instability, toxicity, short-term efficacy, and potential allergic responses. Increasing mRNA stability to improve their in vivo efficacy remains a key challenge that must be resolved to increase the feasibility of mRNA therapeutics for clinical use. Summary of the Invention

[0004] The present application provides modified mRNAs with modified nucleotides and / or structural features to improve stability in cells and thereby enhance protein production, as well as methods for making and using such modified mRNAs. Conventional mRNAs contain poly-A tails with multiple adenosine nucleotides at their 3' ends, which can be degraded by cellular exonucleases that remove the 3' nucleotides. Once exonucleases remove the poly-A tail and begin to remove nucleotides from the open reading frame, the mRNA is no longer capable of being translated into the encoded protein. mRNAs that are more resistant to 3' exonuclease activity are degraded more slowly and are therefore more stable, have an increased half-life in cells, and more protein can be produced from a given mRNA molecule. Modified nucleotides containing one or more structural modifications to the nucleobase, sugar, or phosphate linkage of the mRNA can interfere with 3' exonuclease activity, making the mRNA more stable. However, the same structural modifications that inhibit 3' exonucleases may also interfere with the ability of polyadenylation enzymes to incorporate them onto the polyA tail, making it difficult to incorporate modified nucleotides onto the polyA tail. Surprisingly, ligating an oligonucleotide containing only three modified nucleotides to the 3' end of an mRNA containing a pre-existing polyA tail significantly improved mRNA stability compared to ligating an oligonucleotide with no modified nucleotides other than a 3'-terminal blocking nucleotide to prevent oligonucleotide self-ligation (Figure 5). Similar improvements in stability were observed with ligation of oligonucleotides containing structural sequences capable of forming secondary structures, such as G-quadruplexes or aptamers. Such structural sequences are thought to prevent exonucleases from accessing the 3'-terminal nucleotide. Multiple types of modified nucleotides and structural sequences, both alone and in combination with each other, conferred improved stability to mRNAs when added to the 3' end, making the modified mRNA more resistant to RNase-mediated degradation.This resulted in increased protein production from these modified mRNAs relative to control mRNAs. These results indicate that this approach of modifying the polyA tail of mRNA to block exonuclease activity offers broad utility in producing modified mRNAs. In addition, the modified mRNAs produced by the methods provided herein can be circularized by ligating the ends of the linear mRNA to produce circular mRNAs. Because non-coding RNAs are also vulnerable to 3' exonuclease activity, the techniques described herein for improving mRNA stability may also be suitable for improving the stability of non-coding RNAs.

[0005] Thus, the present disclosure provides, in some aspects, a modified mRNA comprising: (i) a protein-encoding open reading frame (ORF); and (ii) a polyA region; wherein the polyA region is 3' to the open reading frame and comprises 10 or more nucleotides, wherein 1% to 90% of the nucleotides in the polyA region are modified nucleotides, and wherein 3 or more of the last 10 nucleotides of the polyA region are modified nucleotides.

[0006] In some embodiments, the polyA region comprises 25 or more adenosine nucleotides, wherein 1% to 90% of the nucleotides in the polyA region are modified nucleotides, and wherein 3 or more of the last 25 nucleotides in the polyA region are modified nucleotides.

[0007] In some embodiments, 4 or more of the last 25 nucleotides of the polyA region are modified nucleotides.

[0008] In some embodiments, two or more nucleotides of the last 25 nucleotide stretch of the polyA region are linked by modified internucleotide linkages.

[0009] In some embodiments, 3 or more nucleotides of the last 25 nucleotide stretch of the polyA region are modified nucleotides and are independently selected from deoxyribonucleotides, 2' modified nucleotides, and phosphorothioate linked nucleotides.

[0010] In some embodiments, the three or more modified nucleotides are a stretch of nucleotides located at the 3' end of the polyA region.

[0011] In some embodiments, a stretch of 6 or more nucleotides of the last 25 nucleotides of the polyA region comprises the same type of nucleotide or internucleoside modification.

[0012] In some embodiments, 3 or more of the last 10 nucleotides of the polyA region are modified nucleotides.

[0013] In some embodiments, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

[0014] In some embodiments, at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 of the last 25 nucleotides of the polyA region are modified nucleotides.

[0015] In some embodiments, the modified mRNA comprises a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR), wherein the ORF is between the 5'UTR and the 3'UTR, and wherein the 3'UTR is between the ORF and the polyA region.

[0016] In some embodiments, the modified mRNA is a circular mRNA, wherein a polyA region is between the 3'UTR and the 5'UTR.

[0017] In some aspects, the present disclosure provides modified mRNAs comprising: (i) protein-encoding open reading frames (ORFs); (ii) polyA region; (iii) one or more copies of a structural sequence comprising at least two nucleotides capable of forming a secondary structure; wherein the polyA region is 3' to the open reading frame and comprises 10 or more nucleotides, wherein one or more copies of the structural sequence are 3' to the polyA region, and wherein the modified mRNA comprises a secondary structure, wherein the secondary structure comprises one or more copies of the structural sequence.

[0018] In some embodiments, the polyA region is 3' to the open reading frame and comprises 25 or more nucleotides, wherein one or more copies of the structural sequence are 3' to the polyA region, and wherein the modified mRNA comprises a secondary structure, wherein the secondary structure comprises one or more copies of the structural sequence.

[0019] In some embodiments, the modified mRNA comprises a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR), wherein the ORF is between the 5'UTR and the 3'UTR, and wherein the 3'UTR is between the ORF and the polyA region.

[0020] In some embodiments, the modified mRNA is a circular mRNA, wherein one or more copies of the structural sequence are between the polyA region and the 5'UTR.

[0021] In some embodiments, the structural sequence is a G-quadruplex sequence.

[0022] In some embodiments, the G-quadruplex is an RNA G-quadruplex sequence.

[0023] In some embodiments, the G-quadruplex sequence of the RNA comprises the nucleic acid sequence of SEQ ID NO:2.

[0024] In some embodiments, the modified mRNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2.

[0025] In some embodiments, the G-quadruplex is a DNA G-quadruplex sequence.

[0026] In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence of SEQ ID NO:3.

[0027] In some embodiments, the modified mRNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3.

[0028] In some embodiments, the structural sequence is a telomeric repeat sequence.

[0029] In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4.

[0030] In some embodiments, the modified mRNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:4.

[0031] In some embodiments, the secondary structure of the mRNA is an aptamer that can bind to a target molecule.

[0032] In some embodiments, the polyA region of the modified mRNA comprises at least one modified nucleotide.

[0033] In some embodiments, at least one modified nucleotide comprises a modified nucleobase.

[0034] In some embodiments, the modified nucleobase is selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propanol] [propylamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyl Thiouracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7- Deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil,Desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyl Thioadenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-iso Pentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio -N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).

[0035] In some embodiments, at least one modified nucleotide comprises a modified sugar.

[0036] In some embodiments, the modified sugar is selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido- 2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose.

[0037] In some embodiments, at least one modified nucleotide comprises a 2' modification.

[0038] In some embodiments, the 2' modification is selected from the group consisting of: locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe). In some embodiments, at least one modified nucleotide comprises a modified phosphate.

[0039] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0040] In some embodiments, the polyA region comprises at least 3, at least 4, at least 5, or at least 6 phosphorothioates.

[0041] In some embodiments, the polyA region comprises at least six phosphorothioates.

[0042] In some embodiments, the polyA region comprises at least three guanine nucleotides and at least three phosphorothioates.

[0043] In some embodiments, the polyA region comprises at least 6 nucleotides that include a 2' modification.

[0044] In some embodiments, the polyA region comprises at least three deoxyribose sugars.

[0045] In some embodiments, the polyA region comprises at least 5, at least 10, at least 15, at least 20, or at least 23 deoxyribose sugars.

[0046] In some embodiments, the polyA region comprises at least 23 deoxyribose sugars.

[0047] In some embodiments, the 3' terminal nucleotide of the mRNA does not contain a hydroxy at the 3' position of the 3' terminal nucleotide.

[0048] In some embodiments, the 3' terminal nucleotide of the mRNA comprises an inverted nucleotide.

[0049] In some embodiments, the 3' terminal nucleotide of the mRNA comprises dideoxyadenosine, dideoxycytidine, dideoxyguanosine, dideoxythymidine, dideoxyuridine, or inverted deoxythymidine.

[0050] In some embodiments, the 3' terminal nucleotide of the mRNA comprises dideoxycytidine.

[0051] In some embodiments, the mRNA comprises a peptide binding sequence. In some embodiments, the peptide binding sequence is a polyA binding protein (PABP) binding sequence.

[0052] In some embodiments, the modified mRNA comprises a first modified nucleotide and a second modified nucleotide, wherein the first and second modified nucleosides comprise different structures.

[0053] In some embodiments, the polyA region comprises at least 25-500 nucleotides.

[0054] In some embodiments, the polyA region comprises at least 50, at least 100, at least 150, or at least 200 nucleotides.

[0055] In some embodiments, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are adenosine nucleotides.

[0056] In some embodiments, the modified mRNA is a linear mRNA, wherein the linear mRNA comprises a 5' cap.

[0057] In some embodiments, the 5' cap comprises a 7-methylguanosine.

[0058] In some embodiments, the 5' cap further comprises one or more phosphates connecting the 7-methylguanosine to adjacent nucleotides of the modified mRNA.

[0059] In some embodiments, the 5' cap comprises 3'-O-Me-m7G(5')ppp(5')G.

[0060] In some embodiments, one or more phosphates of the 5' cap are modified phosphates selected from the group consisting of: phosphorothioate, triazole ring, dihalogen methylene bisphosphonate, imidodiphosphate, and methylene bis(phosphonate).

[0061] In some embodiments, the modified mRNA comprises a 5'UTR comprising one or more modified nucleotides. In some embodiments, the modified mRNA comprises an ORF comprising one or more modified nucleotides.

[0062] In some aspects, the present disclosure provides a modified non-coding RNA comprising: (i) a non-coding RNA sequence; and (ii) a polyA region; wherein the polyA region is 3' to the non-coding RNA sequence and comprises 10 or more nucleotides, wherein 1% to 90% of the nucleotides in the polyA region are modified nucleotides, and wherein 3 or more of the last 10 nucleotides of the polyA region are modified nucleotides.

[0063] In some embodiments, the polyA region is 3' to the open reading frame and comprises 25 or more adenosine nucleotides, wherein 1% to 90% of the nucleotides in the polyA region are modified nucleotides, and wherein 3 or more of the last 25 nucleotides in the polyA region are modified nucleotides.

[0064] In some embodiments, 4 or more of the last 25 nucleotides of the polyA region are modified nucleotides.

[0065] In some embodiments, two or more nucleotides of the last 25 nucleotide stretch of the polyA region are linked by modified internucleotide linkages.

[0066] In some embodiments, 3 or more nucleotides of the last 25 nucleotide stretch of the polyA region are modified nucleotides and are independently selected from deoxyribonucleotides, 2' modified nucleotides, and phosphorothioate linked nucleotides.

[0067] In some embodiments, the three or more modified nucleotides are a stretch of nucleotides located at the 3' end of the polyA region.

[0068] In some embodiments, a stretch of 6 or more nucleotides of the last 25 nucleotides of the polyA region comprises the same type of nucleotide or internucleoside modification.

[0069] In some embodiments, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

[0070] In some embodiments, at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 of the last 25 nucleotides of the polyA region are modified nucleotides.

[0071] In some embodiments, the modified non-coding RNA is a circular non-coding RNA, wherein a polyA region is 5' to the non-coding RNA sequence.

[0072] In some embodiments, the modified non-coding RNA further comprises one or more copies of a structural sequence comprising at least two nucleotides capable of forming a secondary structure, wherein the one or more copies of the structural sequence are 3' to the polyA region, and wherein the modified non-coding RNA comprises a secondary structure, wherein the secondary structure comprises one or more copies of the structural sequence.

[0073] In some embodiments, the modified non-coding RNA is a circular mRNA, wherein one or more copies of the structural sequence are between the polyA region and the non-coding RNA sequence.

[0074] In some embodiments, the structural sequence is a G-quadruplex sequence.

[0075] In some embodiments, the G-quadruplex is an RNA G-quadruplex sequence.

[0076] In some embodiments, the G-quadruplex sequence of the RNA comprises the nucleic acid sequence of SEQ ID NO:2.

[0077] In some embodiments, the modified non-coding RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2.

[0078] In some embodiments, the G-quadruplex is a DNA G-quadruplex sequence.

[0079] In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence of SEQ ID NO:3.

[0080] In some embodiments, the modified non-coding RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3.

[0081] In some embodiments, the structural sequence is a telomeric repeat sequence.

[0082] In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4.

[0083] In some embodiments, the modified non-coding RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:4.

[0084] In some embodiments, the secondary structure of the non-coding RNA is an aptamer that can bind to a target molecule.

[0085] In some embodiments, at least one modified nucleotide comprises a modified nucleobase.

[0086] In some embodiments, the modified nucleobase is selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propanol] [propylamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyl Thiouracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7- Deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil,Desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyl Thioadenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-iso Pentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio -N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).

[0087] In some embodiments, at least one modified nucleotide comprises a modified sugar.

[0088] In some embodiments, the modified sugar is selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido- 2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose.

[0089] In some embodiments, at least one modified nucleotide comprises a 2' modification.

[0090] In some embodiments, the 2' modification is selected from the group consisting of: locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe).

[0091] In some embodiments, at least one modified nucleotide comprises a modified phosphate.

[0092] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0093] In some embodiments, the polyA region comprises at least 3, at least 4, at least 5, or at least 6 phosphorothioates.

[0094] In some embodiments, the polyA region comprises at least six phosphorothioates.

[0095] In some embodiments, the polyA region comprises at least three guanine nucleotides and at least three phosphorothioates.

[0096] In some embodiments, the polyA region comprises at least 6 nucleotides that include a 2' modification.

[0097] In some embodiments, the polyA region comprises at least three deoxyribose sugars.

[0098] In some embodiments, the polyA region comprises at least 5, at least 10, at least 15, at least 20, or at least 23 deoxyribose sugars.

[0099] In some embodiments, the polyA region comprises at least 23 deoxyribose sugars.

[0100] In some embodiments, the 3' terminal nucleotide of the non-coding RNA does not contain a hydroxy at the 3' position of the 3' terminal nucleotide.

[0101] In some embodiments, the 3' terminal nucleotide of the non-coding RNA comprises an inverted nucleotide.

[0102] In some embodiments, the 3' terminal nucleotide of the mRNA comprises dideoxyadenosine, dideoxycytidine, dideoxyguanosine, dideoxythymidine, dideoxyuridine, or inverted deoxythymidine.

[0103] In some embodiments, the 3' terminal nucleotide of the mRNA comprises dideoxycytidine.

[0104] In some embodiments, the modified non-coding RNA comprises a first modified nucleotide and a second modified nucleotide, wherein the first and second modified nucleosides comprise different structures.

[0105] In some embodiments, the polyA region comprises at least 25-500 nucleotides.

[0106] In some embodiments, the polyA region comprises at least 50, at least 100, at least 150, or at least 200 nucleotides.

[0107] In some embodiments, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are adenosine nucleotides.

[0108] In some aspects, the disclosure provides methods of producing a modified mRNA, the method comprising ligating a first RNA comprising an open reading frame encoding a protein to a tailing nucleic acid comprising one or more modified nucleotides in the presence of an RNA ligase, whereby the RNA ligase forms a covalent bond between the 3' nucleotide of the RNA and the 5' nucleotide of the tailing nucleic acid to produce the modified mRNA.

[0109] In some embodiments, the modified mRNA comprises a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR), wherein the ORF is between the 5'UTR and the 3'UTR, and wherein the 3'UTR is between the ORF and the polyA region.

[0110] In some embodiments, the method further comprises circularizing the modified mRNA in the presence of a ribozyme, wherein the modified mRNA comprises a 3' intron and a 5' intron, wherein the 3' intron is 5' of the 5' UTR, and wherein the 5' intron is 3' of the polyA region, whereby the ribozyme forms a covalent bond between the nucleotide 3' of the 3' intron and the nucleotide 5' of the 5' intron to produce a circular mRNA that does not contain a 5' intron or a 3' intron, wherein the polyA region is between the 3' UTR and the 5' UTR of the circular mRNA.

[0111] In some embodiments, the method further comprises the steps of: (i) introducing a 5′-terminal phosphate group into the first nucleotide of the modified mRNA; (ii) cleaving one or more 3'-terminal nucleotides of the modified mRNA to produce a modified mRNA having a 3'-terminal hydroxyl group; and (iii) circularizing the modified mRNA produced in step (ii) in the presence of a circularization ligase; The circularization ligase thereby forms a covalent bond between the 3' nucleotide of the modified mRNA and the 5' nucleotide of the modified mRNA to produce a circular modified mRNA, where the polyA region is between the 3' UTR and the 5' UTR.

[0112] In some aspects, the disclosure provides methods of producing modified mRNA, the methods comprising ligating an RNA comprising an open reading frame encoding a protein to a tailing nucleic acid comprising one or more copies of a structural sequence in the presence of an RNA ligase, whereby the ligase forms a covalent bond between the 3' nucleotide of the RNA and the 5' nucleotide of the tailing nucleic acid to produce the modified mRNA.

[0113] In some embodiments, the modified mRNA comprises a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR), wherein the ORF is between the 5'UTR and the 3'UTR, wherein the 3'UTR is between the ORF and a polyA region, and wherein the polyA region is between the 3'UTR and one or more copies of the structural sequence.

[0114] In some embodiments, the method further comprises circularizing the modified mRNA in the presence of a ribozyme, wherein the modified mRNA comprises a 3' intron and a 5' intron, wherein the 3' intron is 5' of the 5' UTR, and wherein the 5' intron is 3' of one or more copies of the structural sequence, whereby the ribozyme forms a covalent bond between the nucleotide 3' of the 3' intron and the nucleotide 5' of the 5' intron to produce a circular mRNA that does not contain a 5' intron or a 3' intron, and wherein one or more copies of the structural sequence are between the polyA region and the 5' UTR of the circular mRNA.

[0115] In some embodiments, the method further comprises the steps of: (i) introducing a 5′-terminal phosphate group into the first nucleotide of the modified mRNA; (ii) cleaving one or more 3'-terminal nucleotides of the modified mRNA to produce a modified mRNA having a 3'-terminal hydroxyl group; and (iii) circularizing the modified mRNA produced in step (ii) in the presence of a circularization ligase; The circularization ligase thereby forms a covalent bond between the 3' nucleotide of the modified mRNA and the 5' nucleotide of the modified mRNA to produce a circular modified mRNA, wherein one or more copies of the structural sequence are between the 3' UTR and the 5' UTR.

[0116] In some embodiments, the modified mRNA is circularized in the presence of a backbone nucleic acid, wherein the backbone nucleic acid is a nucleic acid that can hybridize to the modified mRNA, and wherein the modified mRNA forms a circular secondary structure when bound to the backbone nucleic acid.

[0117] In some embodiments, the backbone nucleic acid comprises: (a) a first hybridization sequence comprising five or more nucleotides, wherein the first hybridization sequence is complementary to at least the first five (5) nucleotides of the modified mRNA; and (b) a second hybridization sequence comprising five or more nucleotides, wherein the second hybridization sequence is complementary to at least the last five (5) nucleotides of the modified mRNA; wherein at least the first five (5) nucleotides of the modified mRNA hybridize with a first hybridization sequence and at least the last five (5) nucleotides of the modified mRNA hybridize with a second hybridization sequence.

[0118] In some embodiments, the last nucleotide of the first hybridization sequence and the first nucleotide of the second hybridization sequence are adjacent on the backbone nucleic acid and are not separated by any other nucleotides.

[0119] In some embodiments, the modified mRNA comprises: (i) a first self-hybridizing sequence 5′ of the open reading frame; (ii) a second self-hybridizing sequence 3′ to the open reading frame; (iii) a first non-hybridizing sequence 5' to the first self-hybridizing sequence; and (iv) a second non-hybridizing sequence 3' to the second self-hybridizing sequence; wherein the first and second self-hybridizing sequences are capable of hybridizing to each other; Here, the first and second self-hybridizing sequences are incapable of hybridizing to each other.

[0120] In some embodiments, hybridization of the first and second self-hybridizing sequences forms a secondary structure in which the 5'- and 3'-terminal nucleotides of the modified mRNA are separated by a distance of less than 100 Å.

[0121] In some embodiments, the 5' terminal nucleotide and the 3' terminal nucleotide are separated by a distance of less than 90 Å, less than 80 Å, less than 70 Å, less than 60 Å, less than 50 Å, less than 40 Å, less than 30 Å, less than 20 Å, or less than 10 Å.

[0122] In some embodiments, the circularizing ligase is T4 RNA ligase.

[0123] In some embodiments, the structural sequence is a G-quadruplex sequence.

[0124] In some embodiments, the G-quadruplex is an RNA G-quadruplex sequence.

[0125] In some embodiments, the G-quadruplex sequence of the RNA comprises the nucleic acid sequence of SEQ ID NO:2.

[0126] In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2.

[0127] In some embodiments, the G-quadruplex is a DNA G-quadruplex sequence.

[0128] In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence of SEQ ID NO:3.

[0129] In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3.

[0130] In some embodiments, the structural sequence is a telomeric repeat sequence.

[0131] In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4.

[0132] In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO:4.

[0133] In some embodiments, the structural sequence is an aptamer sequence comprising at least two nucleotides that can interact to form an aptamer, where the aptamer is a secondary structure that can bind to a target molecule.

[0134] In some embodiments, the tailing nucleic acid comprises at least one modified nucleotide.

[0135] In some embodiments, the 5' nucleotide of the RNA does not include a 5' terminal phosphate group; wherein the 3' nucleotide of the RNA contains a 3' terminal hydroxyl group; wherein the 5' nucleotide of the tailing nucleic acid comprises a 5' terminal phosphate group; Here, the 3' nucleotide of the tailing nucleic acid does not contain a 3' terminal hydroxyl group.

[0136] In some embodiments, the 5' nucleotide of the RNA does not comprise a 5' terminal hydroxyl group; wherein the 3' nucleotide of the RNA contains a 3' terminal phosphate group; wherein the 5' nucleotide of the tailing nucleic acid comprises a 5' terminal hydroxyl group; wherein the 3' nucleotide of the tailing nucleic acid does not contain a 3' terminal phosphate group; Here, the RNA ligase is RtcB ligase.

[0137] In some embodiments, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides of the tailing nucleic acid are modified nucleotides.

[0138] In some embodiments, at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 of the last 25 nucleotides of the tailing nucleic acid are modified nucleotides.

[0139] In some embodiments, at least one modified nucleotide comprises a modified nucleobase.

[0140] In some embodiments, the modified nucleobase is selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propanol] [propylamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyl Thiouracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7- Deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil,Desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyl Thioadenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-iso Pentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio -N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).

[0141] In some embodiments, at least one modified nucleotide comprises a modified sugar.

[0142] In some embodiments, the modified sugar is selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido- 2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose.

[0143] In some embodiments, at least one modified nucleotide comprises a 2' modification.

[0144] In some embodiments, the 2' modification is selected from the group consisting of: locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe).

[0145] In some embodiments, at least one modified nucleotide comprises a modified phosphate.

[0146] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0147] In some embodiments, the tailing nucleic acid comprises at least 3, at least 4, at least 5, or at least 6 phosphorothioates.

[0148] In some embodiments, the tailing nucleic acid comprises at least six phosphorothioates.

[0149] In some embodiments, the tailing nucleic acid comprises at least three guanine nucleotides and at least three phosphorothioates.

[0150] In some embodiments, the tailing nucleic acid comprises at least 6 nucleotides that include a 2' modification.

[0151] In some embodiments, the tailing nucleic acid comprises at least three deoxyribose sugars.

[0152] In some embodiments, the tailing nucleic acid comprises at least 5, at least 10, at least 15, at least 20, or at least 23 deoxyribose sugars.

[0153] In some embodiments, the tailing nucleic acid comprises at least 23 deoxyribose sugars.

[0154] In some embodiments, the 3' terminal nucleotide of the tailing nucleic acid comprises dideoxyadenosine, dideoxycytidine, dideoxyguanosine, dideoxythymidine, dideoxyuridine, or inverted deoxythymidine.

[0155] In some embodiments, the tailing nucleic acid comprises a first modified nucleotide and a second modified nucleotide, wherein the first and second modified nucleotides comprise different structures.

[0156] In some embodiments, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the polyA region of the modified mRNA are adenosine nucleotides.

[0157] In some embodiments, the polyA region of the modified mRNA comprises at least 25-500 nucleotides.

[0158] In some embodiments, the polyA region of the modified mRNA comprises at least 50, at least 100, at least 150, or at least 200 nucleotides.

[0159] In some embodiments, the modified mRNA is a linear mRNA, wherein the linear mRNA comprises a 5' cap.

[0160] In some embodiments, the 5' cap comprises a 7-methylguanosine.

[0161] In some embodiments, the 5' cap further comprises one or more phosphates connecting the 7-methylguanosine to adjacent nucleotides of the modified mRNA.

[0162] In some embodiments, the 5' cap comprises 3'-O-Me-m7G(5')ppp(5')G.

[0163] In some embodiments, one or more phosphates of the 5' cap are modified phosphates selected from the group consisting of: phosphorothioate, triazole ring, dihalogen methylene bisphosphonate, imidodiphosphate, and methylene bis(phosphonate).

[0164] In some embodiments, the RNA ligase is T4 RNA ligase.

[0165] In some aspects, the disclosure provides methods of producing a modified non-coding RNA, the method comprising ligating a first RNA comprising a non-coding RNA sequence to a tailing nucleic acid comprising one or more modified nucleotides in the presence of an RNA ligase, whereby the RNA ligase forms a covalent bond between the 3' nucleotide of the RNA and the 5' nucleotide of the tailing nucleic acid to produce the modified non-coding RNA.

[0166] In some embodiments, the modified non-coding RNA comprises a polyA region 3' to the non-coding RNA sequence.

[0167] In some embodiments, the method further comprises circularizing the modified non-coding RNA in the presence of a ribozyme, wherein the modified non-coding RNA comprises a 3' intron and a 5' intron, wherein the 3' intron is 5' of the non-coding RNA sequence, and wherein the 5' intron is 3' of the polyA region, and wherein the ribozyme forms a covalent bond between the nucleotide 3' of the 3' intron and the nucleotide 5' of the 5' intron to produce a circular non-coding RNA that does not contain a 5' intron or a 3' intron, and wherein the polyA region is between the 3' and 5' nucleotides of the non-coding RNA.

[0168] In some embodiments, the method further comprises the steps of: (i) introducing a 5′-terminal phosphate group onto the first nucleotide of the modified non-coding RNA; (ii) cleaving one or more 3'-terminal nucleotides of the modified non-coding RNA to produce a modified non-coding RNA having a 3'-terminal hydroxyl group; and (iii) circularizing the modified non-coding RNA produced in step (ii) in the presence of a circularization ligase; The circularizing ligase thereby forms a covalent bond between the 3' nucleotide of the modified non-coding RNA and the 5' nucleotide of the modified non-coding RNA to produce a circular modified non-coding RNA, wherein the polyA region is between the 3' and 5' nucleotides of the non-coding RNA.

[0169] In some embodiments, the tailing nucleic acid further comprises one or more copies of a structural sequence.

[0170] In some embodiments, the modified non-coding RNA comprises a polyA tract, located between the non-coding RNA sequence and one or more copies of the structural sequence.

[0171] In some embodiments, the method further comprises circularizing the modified non-coding RNA in the presence of a ribozyme, wherein the modified non-coding RNA comprises a 3' intron and a 5' intron, wherein the 3' intron is 5' to the non-coding RNA sequence, and wherein the 5' intron is 3' to one or more copies of the structural sequence, whereby the ribozyme forms a covalent bond between the nucleotide 3' to the 3' intron and the nucleotide 5' to the 5' intron to produce a circular non-coding RNA that does not contain a 5' intron or 5' intron, and wherein one or more copies of the structural sequence are between the polyA region and the non-coding RNA sequence of the circular non-coding RNA.

[0172] In some embodiments, the method further comprises the steps of: (i) introducing a 5′-terminal phosphate group onto the first nucleotide of the modified non-coding RNA; (ii) cleaving one or more 3'-terminal nucleotides of the modified non-coding RNA to produce a modified non-coding RNA having a 3'-terminal hydroxyl group; and (iii) circularizing the modified non-coding RNA produced in step (ii) in the presence of a circularization ligase; The circularizing ligase thereby forms a covalent bond between the 3' nucleotide of the modified non-coding RNA and the 5' nucleotide of the modified non-coding RNA to produce a circular modified non-coding RNA, wherein one or more copies of the structural sequence are between the polyA region and the non-coding RNA sequence.

[0173] In some embodiments, the modified non-coding RNA is circularized in the presence of a backbone nucleic acid, wherein the backbone nucleic acid is a nucleic acid that can hybridize to the modified non-coding RNA, and wherein the modified non-coding RNA forms a circular secondary structure when bound to the backbone nucleic acid.

[0174] In some embodiments, the backbone nucleic acid comprises: (a) a first hybridization sequence comprising five or more nucleotides, wherein the first hybridization sequence is complementary to at least the first five (5) nucleotides of the modified non-coding RNA; and (b) a second hybridization sequence comprising five or more nucleotides, wherein the second hybridization sequence is complementary to at least the last five (5) nucleotides of the modified non-coding RNA; wherein at least the first five (5) nucleotides of the modified non-coding RNA hybridize with a first hybridization sequence and at least the last five (5) nucleotides of the modified non-coding RNA hybridize with a second hybridization sequence.

[0175] In some embodiments, the last nucleotide of the first hybridization sequence and the first nucleotide of the second hybridization sequence are adjacent on the backbone nucleic acid and are not separated by any other nucleotides.

[0176] In some embodiments, the modified non-coding RNA comprises: (i) a first self-hybridizing sequence 5′ of the open reading frame; (ii) a second self-hybridizing sequence 3′ to the open reading frame; (iii) a first non-hybridizing sequence 5' to the first self-hybridizing sequence; and (iv) a second non-hybridizing sequence 3' to the second self-hybridizing sequence; wherein the first and second self-hybridizing sequences are capable of hybridizing to each other; Here, the first and second self-hybridizing sequences are incapable of hybridizing to each other.

[0177] In some embodiments, hybridization of the first and second self-hybridizing sequences forms a secondary structure in which the 5'- and 3'-terminal nucleotides of the modified non-coding RNA are separated by a distance of less than 100 Å.

[0178] In some embodiments, the 5' terminal nucleotide and the 3' terminal nucleotide are separated by a distance of less than 90 Å, less than 80 Å, less than 70 Å, less than 60 Å, less than 50 Å, less than 40 Å, less than 30 Å, less than 20 Å, or less than 10 Å.

[0179] In some embodiments, the circularizing ligase is T4 RNA ligase.

[0180] In some embodiments, the structural sequence is a G-quadruplex sequence.

[0181] In some embodiments, the G-quadruplex is an RNA G-quadruplex sequence.

[0182] In some embodiments, the G-quadruplex sequence of the RNA comprises the nucleic acid sequence of SEQ ID NO:2.

[0183] In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2.

[0184] In some embodiments, the G-quadruplex is a DNA G-quadruplex sequence.

[0185] In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence of SEQ ID NO:3.

[0186] In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3.

[0187] In some embodiments, the structural sequence is a telomeric repeat sequence.

[0188] In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4.

[0189] In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO:4.

[0190] In some embodiments, the structural sequence is an aptamer sequence comprising at least two nucleotides that can interact to form an aptamer, where the aptamer is a secondary structure that can bind to a target molecule.

[0191] In some embodiments, the 5' nucleotide of the RNA does not include a 5' terminal phosphate group; wherein the 3' nucleotide of the RNA contains a 3' terminal hydroxyl group; wherein the 5' nucleotide of the tailing nucleic acid comprises a 5' terminal phosphate group; Here, the 3' nucleotide of the tailing nucleic acid does not contain a 3' terminal hydroxyl group.

[0192] In some embodiments, the 5' nucleotide of the RNA does not comprise a 5' terminal hydroxyl group; wherein the 3' nucleotide of the RNA contains a 3' terminal phosphate group; wherein the 5' nucleotide of the tailing nucleic acid comprises a 5' terminal hydroxyl group; wherein the 3' nucleotide of the tailing nucleic acid does not contain a 3' terminal phosphate group; Here, the RNA ligase is RtcB ligase.

[0193] In some embodiments, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides of the tailing nucleic acid are modified nucleotides.

[0194] In some embodiments, at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 of the last 25 nucleotides of the tailing nucleic acid are modified nucleotides.

[0195] In some embodiments, at least one modified nucleotide comprises a modified nucleobase.

[0196] In some embodiments, the modified nucleobase is selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propanol] [propylamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyl Thiouracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7- Deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil,Desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyl Thioadenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-iso Pentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio -N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A).

[0197] In some embodiments, at least one modified nucleotide comprises a modified sugar.

[0198] In some embodiments, the modified sugar is selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido- 2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose.

[0199] In some embodiments, at least one modified nucleotide comprises a 2' modification.

[0200] In some embodiments, the 2' modification is selected from the group consisting of: locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe).

[0201] In some embodiments, at least one modified nucleotide comprises a modified phosphate.

[0202] In some embodiments, the modified phosphate is selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0203] In some embodiments, the tailing nucleic acid comprises at least 3, at least 4, at least 5, or at least 6 phosphorothioates.

[0204] In some embodiments, the tailing nucleic acid comprises at least six phosphorothioates.

[0205] In some embodiments, the tailing nucleic acid comprises at least three guanine nucleotides and at least three phosphorothioates.

[0206] In some embodiments, the tailing nucleic acid comprises at least 6 nucleotides that include a 2' modification.

[0207] In some embodiments, the tailing nucleic acid comprises at least three deoxyribose sugars.

[0208] In some embodiments, the tailing nucleic acid comprises at least 5, at least 10, at least 15, at least 20, or at least 23 deoxyribose sugars.

[0209] In some embodiments, the tailing nucleic acid comprises at least 23 deoxyribose sugars.

[0210] In some embodiments, the 3' terminal nucleotide of the tailing nucleic acid comprises dideoxyadenosine, dideoxycytidine, dideoxyguanosine, dideoxythymidine, dideoxyuridine, or inverted deoxythymidine.

[0211] In some embodiments, the tailing nucleic acid comprises a first modified nucleotide and a second modified nucleotide, wherein the first and second modified nucleotides comprise different structures.

[0212] In some embodiments, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the polyA region of the modified non-coding RNA are adenosine nucleotides.

[0213] In some embodiments, the polyA region of the modified non-coding RNA comprises at least 25-500 nucleotides.

[0214] In some embodiments, the polyA region of the modified non-coding RNA comprises at least 50, at least 100, at least 150, or at least 200 nucleotides.

[0215] In some embodiments, the RNA ligase is T4 RNA ligase.

[0216] In some aspects, the present disclosure provides modified mRNA produced by any one of the methods provided herein.

[0217] In some embodiments, the mRNA encodes an antigen or therapeutic protein.

[0218] In some embodiments, the antigen is a viral antigen, a bacterial antigen, a protozoan antigen, or a fungal antigen.

[0219] In some embodiments, the therapeutic protein is an enzyme, a transcription factor, a cell surface receptor, a growth factor, or a clotting factor.

[0220] In some embodiments, the open reading frame is codon-optimized for expression in a cell.

[0221] In some embodiments, the modified mRNA is codon-optimized for expression in mammalian cells.

[0222] In some embodiments, the modified mRNA is codon-optimized for expression in human cells.

[0223] In some aspects, the present disclosure provides a modified non-coding RNA produced by any one of the methods provided herein.

[0224] In some embodiments, the modified non-coding RNA is a guide RNA (gRNA), a prime-editing guide RNA (pegRNA), or a long non-coding RNA (lncRNA).

[0225] In some aspects, the present disclosure provides lipid nanoparticles comprising any one of the modified mRNAs or modified non-coding RNAs provided herein.

[0226] In some aspects, the present disclosure provides a cell comprising any one of the modified mRNAs or modified non-coding RNAs provided herein.

[0227] In some embodiments, the cell is a mammalian cell.

[0228] In some embodiments, the cells are human cells.

[0229] In some aspects, the present disclosure provides compositions comprising any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, or cells provided herein.

[0230] In some aspects, the present disclosure provides pharmaceutical compositions comprising any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, or cells provided herein and a pharmaceutically acceptable excipient.

[0231] In some aspects, the present disclosure provides methods that include introducing into a cell any of the modified mRNA, modified non-coding RNA, or lipid nanoparticles provided herein.

[0232] In some aspects, the present disclosure provides methods that include introducing into a subject any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, cells, or compositions provided herein.

[0233] In some aspects, the present disclosure provides methods of vaccinating a subject, the methods comprising introducing into the subject any of the modified mRNA, lipid nanoparticles, cells, or compositions provided herein, wherein the open reading frame of the mRNA encodes an antigen.

[0234] In some aspects, the present disclosure provides methods of replenishing an enzyme in a subject, the methods comprising introducing into a subject any of the modified mRNA, lipid nanoparticles, cells, or compositions provided herein, wherein the open reading frame of the mRNA encodes the enzyme.

[0235] In some aspects, the present disclosure provides methods of modifying a subject's genome, the methods comprising introducing into the subject any of the modified non-coding RNAs or compositions provided herein.

[0236] In some embodiments, the subject is a mammal.

[0237] In some embodiments, the subject is a human.

[0238] In some aspects, the present disclosure provides any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, cells, or compositions provided herein for use as a medicament.

[0239] In some aspects, the present disclosure provides kits comprising the RNA and tailing nucleic acid of any of the methods provided herein.

[0240] In some embodiments, the kit further comprises an RNA ligase.

[0241] In some aspects, the present disclosure provides kits comprising any of the pharmaceutical compositions provided herein and a delivery device.

[0242] In some aspects, the present disclosure provides methods for purifying modified mRNA or modified non-coding RNA, comprising: contacting a mixture containing the modified mRNA or modified non-coding RNA with a purification medium, wherein the modified mRNA or modified non-coding RNA interacts with the purification medium to form a modified RNA-purification medium conjugate; separating the modified RNA-purification medium conjugate from the mixture; and eluting the modified mRNA or modified non-coding RNA from the modified RNA-purification medium conjugate with a solvent.

[0243] In some embodiments, the purification medium comprises paramagnetic beads. [Brief explanation of the drawings]

[0244] [Figure 1]Figure 1 shows the structures of naturally occurring modified nucleosides, including m6Am, m1A, pseudouridine, m6A, m7G, ac4C, Nm, and m5C, which can be used in the modified mRNAs or methods of making modified mRNAs provided herein.

[0245] [Figure 2] Figure 2A shows the designs of modified linear mRNA (Design A) and modified circular mRNA (Design B). Solid circles represent modified nucleotides on the open reading frame that improve protein production. Hollow circles represent modified nucleotides on the poly(A) region that improve RNA stability. Figure 2B shows the arrangement of elements on a typical mRNA, which, in 5' to 3' order, contains the 5' UTR, open reading frame, 3' UTR, and poly(A) tail.

[0246] [Figure 3] Figure 3 shows data on the relative efficiency of protein production from modified mRNA relative to unmodified mRNA. Modified mRNA encoding green fluorescent protein (GFP) was synthesized and polyadenylated to add a poly(A) tail. The polyadenylation reaction incorporated a limiting amount (5% or 25%) of modified adenosine triphosphate, as indicated. Unmodified mRNA encoding mCherry was synthesized and polyadenylated using classical nucleotides. A mixture of modified and unmodified mRNA was transfected into cells, and the GFP / mCherry ratio was measured 1–3 days posttransfection.

[0247] [Figure 4]Figure 4A shows an overview of the experimental scheme used to modify specific poly(A) tails while leaving the coding sequence unmodified. Cellular exonucleases deadenylate the poly(A) tail, but random incorporation of modified nucleoside triphosphates (NTPs) by poly(A) polymerase can slow degradation of the 3' end of mRNA (SEQ ID NO: 1). Figure 4B shows an overview of the experimental scheme used to install chemically defined structures at the 3' end of mRNA. Chemically synthesized oligonucleotides with defined compositions were ligated to the 3' end of mRNA encoding GFP, which contained a template-encoded poly(A) sequence. Ligation of the chemically synthesized oligonucleotides allowed for the production of unnatural internucleotide linkages and the incorporation of defined numbers of modified nucleotides into each mRNA end.

[0248] [Figure 5] Figure 5 shows a bar graph of the abundance of GFP encoded by modified mRNA, normalized to the abundance of mCherry encoded by unmodified mRNA, 24, 48, and 72 hours after transfection of both mRNAs into HeLa cells. Mean + / - SD. P values ​​were calculated by unpaired t-test using Graphpad Prism 7.01 without assuming a consistent SD. *P<0.01, **P<0.001, ***P<0.0001, ****P<0.00001.

[0249] [Figure 6]Figure 6A shows a representative RNase H assay demonstrating RNase H activity on mRNA ligated to several RNA or DNA nucleotides. As described in the Methods section, ligations were performed on in vitro transcribed mRNA, which was then purified by AMPure bead cleanup. All samples were characterized for integrity by separate gels. All samples shown on the gel were treated using the RNase H assay protocol described in the Methods section. The ladder shown is 400 ng of Century-Plus RNA marker. Figure 6B shows an E. coli RNase R digestion assay performed on selected RNA / DNA oligos used as substrates in the ligations. While chain-terminating nucleotides do not prevent RNase R digestion, mRNAs containing 23 deoxyadenosine nucleotides and a terminal dideoxycytidine exhibited robust stability against RNase R degradation. The ladder contains a ssDNA primer with the lengths listed on the left.

[0250] [Figure 7A] Figure 7A shows a schematic diagram of messenger-oligonucleotide-conjugated RNA (mocRNA) synthesis, along with an overview of the chemical modifications and structures of the synthetic oligos used in ligation. Chemically synthesized oligos with defined compositions were ligated to the 3' end of a humanized monster green fluorescent protein (GFP) mRNA (GFP-60A) containing a 60-nt poly(A) sequence encoded by the template to produce translatable mocRNA. [Figure 7B]Figure 7B shows a schematic diagram of the RNase H assay used to quantify the efficiency of the mocRNA ligation reaction. The oligonucleotides used for ligation were 30 nt. The DNA probe targets the 3' UTR of the mRNA, with the 5' end of the probe 106 nt upstream of the poly(A) tail. This generates a 5' mRNA fragment (824 nt) and a 3' mRNA fragment (166 nt, including the 60-nt poly(A) tail, for unligated mRNA; ~200 nt for ligated mRNA). The 3' cleavage product exhibits a band shift on a denaturing gel upon ligation. M, marker Century-Plus RNA marker.

[0251] [Figure 8A] Figure 8A shows bar graphs of mCherry fluorescence signals and GFP fluorescence signals normalized to mock ligation controls at 24, 48, and 72 hours after transfection. Gray dashed line, y=1. Mean ± sd. n Field of View (FOV) is indicated below each bar. Each condition had at least three biological replicates, of which four FOVs were imaged. P values ​​were calculated by ordinary two-way ANOVA (Dunnett's multiple comparison test, comparing means between time points) for multiple comparisons with sample 29rA_ddC. ***P<0.001, ****P<0.0001. [Figure 8B] Figure 8B shows representative separate and overlay images of mCherry fluorescence, GFP fluorescence, and Hoechst nuclear staining in HeLa cells 48 hours after transfection of the indicated RNA constructs using the same confocal imaging setup. Scale bar 25 μm. [Figure 8C] FIG. 8C shows the correlation between the mean bulk GFP / mCherry RNA ratio (RT-qPCR, mean ± sem, see also Table 7) and the bulk GFP / mCherry fluorescence ratio (mean ± sd) 48 hours after transfection. [Figure 8D]Figure 8D shows a representative image of STARmap amplicons representing GFP and mCherry RNA in situ in HeLa cells, fixed 48 hours after transfection with the indicated mRNA vectors and acquired using the same confocal imaging settings. Nuclei are indicated by DAPI staining. Colocalized GFP and mCherry amplicons (shown in the inset; right column) are likely lipid transfection vesicles (white arrows) and therefore excluded from downstream STARmap quantification of RNA species.

[0252] [Figure 9A-B] Figure 9A shows the kinetic characterization of firefly luciferase-degron compared with untagged luciferase. mRNA encoding each protein was transfected into HeLa cells, which were treated with cycloheximide (CHX) at time = 0. The resulting relative luminescence units (RLU) were measured in the cells at 2-hour intervals after CHX treatment to estimate the protein decay half-life. Figure 9B shows the firefly luciferase-degron RLU normalized to the mock ligation signal (8 hours after transfection). The corresponding normalized firefly RLU values ​​at each time point were tested for significance compared to mock ligation using a standard one-way ANOVA test. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001. [Figure 9C]Figure 9C shows representative STARmap images (channel overlay) taken at 24, 48, and 72 hours from mocRNA-transfected HeLa cells. Images were taken as single slices from Z-stacks obtained from each field. White arrows in the mock-ligated 24-hour sample indicate representative transfection vesicles (areas of large, overlapping GFP / mCherry signals). Gray spots indicate GFP or mCherry mRNA. Nuclei are indicated by DAPI staining. Image contrast was adjusted equally between images in ImageJ. [Figure 9D] Figure 9D shows the time course of STARmap mRNA counting and quantification in mocRNA-transfected HeLa cells. GFP and mCherry mRNA species were counted, excluding large aggregates (i.e., transfection vesicles). Three biological replicates were performed for each experimental condition. Four fields of view (FOVs) were taken from each sample. Violin plot elements: line, lower / upper adjacent values; bar, interquartile range; white dot, median. Single cell counts are listed above the corresponding distribution. Statistical tests were performed at each respective time point compared to 29rA_ddC using Welch's t-test. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0253] [Figure 10A-B] Figure 10A shows a schematic of a general chemical strategy for increasing mRNA exo- and endonuclease resistance through the incorporation of modified nucleotide triphosphates (NTPs). X, modified nucleoside. Figure 10B shows the chemical structure of adenosine-5'-O(1-thiotriphosphate) (S-ATP), which was used in E-PAP and IVT spike-in reactions. The sulfur modification of the alpha phosphate, when incorporated into RNA, is identical to a phosphorothioate (PS) linkage (shown in Figure 7B). [Figure 10C]Figure 10C shows a schematic illustrating different strategies for incorporation of phosphorothioate (PS) linkages onto mRNA. RNA polymerase (i.e., cotranscriptional) and poly(A) polymerase incorporation of adenosine-5'-O-(1-thiotriphosphate) (S-ATP) were used to place nuclease-resistant PS linkages onto mRNA. Inset: Denaturing gel showing the effect of each modification strategy on mRNA length distribution. Gray A: chemically modified adenosine; black A: unmodified adenosine. M, marker Century-Plus RNA marker. [Figure 10D] Figure 10D shows a bar graph of GFP protein abundance from modified GFP mRNA generated by various strategies. Normalized to the mean of mCherry and untreated mRNA controls at each time point (24, 48, and 72 hours) after transfection into HeLa cells. Mean ± sd; n. The number of fields of view (FOVs) is indicated below each bar. Each condition consisted of at least three biological replicates, each imaged from four fields of view. Dashed line: y = 1. Unless otherwise specified in the figure, p values ​​were calculated by a standard two-way ANOVA (Dunnett's multiple comparison test, comparing means across time points) for multiple comparisons with untreated mRNA. **P<0.01, ****p<0.0001.

[0254] [Figure 11]Figure 11A shows a bar graph of GFP protein abundance normalized to mCherry and "untreated" controls in neurons 24 and 48 hours after transfection. Mean ± sd, n (FOV) = 18. Each condition consisted of at least three biological replicates, of which six FOVs / stacks were imaged from each. Gray dashed line: y = 1. P values ​​were calculated for each separate time point compared to the untreated sample by ordinary two-way ANOVA (Dunnett's multiple comparisons test). ****P < 0.0001. Figure 11B shows representative images of GFP and mCherry fluorescence in neurons 24 hours after transfection, imaged with the same confocal microscopy settings. Nuclei are indicated by Hoechst staining. Scale bar 25 μm.

[0255] [Figure 12] Figure 12 shows a representative RNase H assay, showing a mocRNA vector prepared by ligation of IVT GFP-60A mRNA and a synthetic oligo. The DNA probe targets the 3' UTR of the mRNA, with the 5' end of the probe 106 nt upstream of the poly(A) tail. This generates a 5' mRNA fragment (824 nt) and a 3' mRNA fragment (166 nt encompassing a 60 nt poly(A), lanes 1 and 2). The 3' cleavage product exhibits a band shift on a denaturing gel upon ligation. M, Century-Plus RNA marker. Ligated and unligated tails are labeled accordingly.

[0256] [Figure 13A]Figure 13A shows violin plots of single-cell quantification of the GFP and mCherry fluorescence ratio (ln[1+ratio]) in HeLa cells 24, 48, and 72 hours after transfection with the indicated mRNA vectors. Violin plot elements: line, lower / upper adjacent values; bar, interquartile range; white dot, median; n is indicated in parentheses. P values ​​are calculated by Welch's t-test (unpaired, two-tailed) compared with sample 29rA_ddC as a control. **P<0.01, ***P<0.001, ****P<0.0001. [Figure 13B] Figure 13B shows a representative image stack maximum intensity projection of STARmap characterization of GFP and mCherry RNA in HeLa cells 48 hours after lipofectamine-mediated transfection. GFP and mCherry mRNA species trapped in lipofectamine-mediated vesicles appeared overlapping, forming large merged foci. mRNA species released from the vesicles appeared as individual dots in the cytosol, each representing a single mRNA molecule. Scale bar 20 μm. [Figure 13C] Figure 13C shows single-cell analysis of GFP / mCherry mRNA copy numbers (amplicons) quantified by STARmap. Violin plot elements: line, lower / upper adjacent values; bar, interquartile range; white dot, median. Number of cells in parentheses. Gray dashed line, median for sample 29rA_ddC. P values ​​were calculated by Welch's t-test (unpaired, two-tailed) compared with sample 29rA_ddC as a control. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. [Figure 13D] FIG. 13D shows the correlation between median single-cell GFP / mCherry RNA ratios and single-cell GFP / mCherry fluorescence ratios 48 hours after transfection.

[0257] [Figure 14A]Figure 14A shows GFP-60A mocRNA ligated to length-adjusted PS+G4 oligos (26rA_G4_C9orf72_RNA_6xSrG, 26rA_G4_C9orf72_DNA_6xSG, and 26rA_G4_telo_DNA_6xSG). Fluorescence time course measurements were performed after transfection of GFP mocRNA into HeLa cells along with an mCherry mRNA internal control. The resulting GFP / mCherry fluorescence values ​​for each sample were further normalized to the mean value for 6xSr(AG) at each time point. Statistical tests were performed using a conventional two-way ANOVA (Dunnett's multiple comparison test, comparing means between time points), and comparisons were made against 6xSr(AG). ****P<0.0001. [Figure 14B-C] Figure 14B shows the in vitro translation of the firefly-PEST mocRNA construct. Rabbit reticulocyte lysate was used as an in vitro translation system for the firefly-PEST mocRNA construct along with an unmodified internal Renilla luciferase control. Firefly RLU / Renilla RLU were measured from each reaction to compare the possible modes of translation enhancement provided by the different mocRNAs. Statistical testing was performed using one-way ANOVA (nonparametric, Kruskal-Wallis, Dunn's multiple comparison test), and comparisons were made to the "mock ligation" sample. *P<0.05. Figure 14C shows the kinetic characterization of the mocRNA construct encoding the firefly degron. Renilla (internal control) RLU normalized to mock ligation values ​​8 hours after transfection. Corresponding mocRNA values ​​at each time point were tested for significance compared to mock ligation using one-way ANOVA (Kruskal-Wallis test, Dunn's multiple comparison test). Internal control signals appeared consistent across different samples.

[0258] [Figure 15]Figure 15 shows GFP mRNA subjected to poly(A) tailing with E. coli poly(A) polymerase (E-PAP) and spiked with various amounts of chemically modified ATP derivatives. The tail-modified GFP mRNA was transfected into HeLa cells along with an unmodified mCherry transfection control (E-PAP tailing, 100% ATP). Bars represent GFP / mCherry fluorescence normalized by the average of the 100% ATP E-PAP-tailed GFP mRNA samples at each corresponding time point. Percentages indicate the relative molar ratios between modified and unmodified ATP used in each reaction. Chemically modified GFP mRNA was cotransfected with unmodified mCherry mRNA, and the resulting GFP / mCherry fluorescence ratio was measured 24, 48, and 72 hours after transfection in HeLa cell cultures. ATP: adenosine 5'-triphosphate; m6ATP: N6-methyladenosine 5'-triphosphate; 2'-O-meATP: 2'O-methyladenosine-5'-triphosphate; S-ATP: adenosine-5'-O-(1-thiotriphosphate); dATP: 2'-deoxyadenosine 5'-triphosphate; amino-dATP: 2'-amino-2'-deoxyadenosine-5'-triphosphate. Mean ± sd, n = 4. Gray dashed line: y = 1. P values ​​were calculated by ordinary two-way ANOVA (Dunnett's multiple comparison test, comparing means between time points), and comparisons were made relative to E-PAP tailing (100% ATP). ****P < 0.0001.

[0259] [Figure 16A] Figure 16A shows quantification of HeLa cell numbers from the confocal microscopy images of Figure 8. Hoechst-stained nuclei were segmented in CellProfiler, and the number of cells in each field of view (FOV) was calculated for each mocRNA condition and time point. Cell numbers were normalized to the average cell number for the mock ligation condition at every time point. Comparisons were made using a regular two-way ANOVA (Dunnett's multiple comparison test, comparing means between time points) against the "no ligation" sample. *P<0.05, **P<0.01. [Figure 16B] Figure 16B shows RT-qPCR quantification of innate immune responses in transfected HeLa cells. RT-qPCR of IFNB1 mRNA in samples transfected with each GFP-60A ligation construct was normalized to human ACTB mRNA and then normalized again to mock-ligated samples. Values ​​were further log10 transformed prior to significance testing and graphing. Each condition consisted of at least three biological replicates, with three technical replicates per biological sample. The mean of the three technical replicates (for each biological condition) is shown as an individual point, with each data point corresponding to a specific biological replicate (mean + sem of biological replicates). Unmodified GFP mRNA refers to IVT hMGFP mRNA (E-PAP poly(A) tailing) without N1-methylpseudouridine substitution (i.e., containing 100% uridine). Log10 normalized samples were analyzed for significance using Welch's t-test (unpaired, two-tailed parametric). Samples were referenced to 29rA_ddCmocRNA for pairwise comparisons. The number of biological replicates (n) used for each condition is indicated in parentheses above the corresponding sample. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001. [Figure 16C]Figure 16C shows the percentage of dead rat cortical neurons determined from mocRNA transfection. Primary rat cortical neuron cultures were transfected with 250 ng of GFP-60A mocRNA along with 250 ng of mCherry mRNA internal control. Cells were then imaged 24 or 48 hours after transfection using Hoechst to stain live and dead nuclei and NucRed Dead (647) to stain dead nuclei. The relative number of dead nuclei to the total was calculated to provide the percentage of dead cells in each transfection condition. Poly(I:C) at 50 ng was used as a positive control for toxicity. Comparisons were made with the transfection-only sample using a standard two-way ANOVA (Dunnett's multiple comparison test, comparing means between time points). **P<0.01.

[0260] [Figure 17] Figure 17 shows the 72-hour firefly RLU / Renilla RLU normalized to the average of the "mock ligation" sample values. n = 9 for each condition, except for 29rA_ddC, where n = 18. This corresponds to 3 biological replicates × 3 technical replicates (per biological replicate), or 6 biological replicates × 3 technical replicates for 29rA_ddC. A mocRNA construct was prepared using mRNA encoding firefly luciferase. Firefly luciferase mRNA (250 ng) and unligated Renilla luciferase mRNA (250 ng) were cotransfected into HeLa cells using Lipofectamine MessengerMax (LMRNA001) according to the manufacturer's protocol. HeLa cells were replated after 6 h of incubation, and luminescence was measured 72 h after transfection using the Promega Dual-Glo luciferase assay system (E2920).

[0261] [Figure 18A-B]Figure 18A shows the experimental procedure for in vivo bioluminescence imaging. Untreated or 6xSr(AG)_invdT-conjugated firefly luciferase mRNA (2 μg) was intramuscularly injected into either the left or right thigh using in vivo-jetRNA (Polyplus: 101000013) according to the manufacturer's protocol. Luciferin (150 mg / kg, VivoGlo™) was intraperitoneally injected 6 hours after mRNA injection. In vivo bioluminescence imaging was performed 15 minutes later. "μg" refers to μg. Figure 18B shows that in vivo bioluminescence was measured with a 3-minute exposure time. The side of injection of untreated and 6xSr(AG)_invdT-conjugated firefly luciferase mRNA is indicated at the bottom of the image. [Figure 18C] Figure 18C shows the statistical results of in vivo bioluminescence produced by intact or 6xSr(AG)_invdT-conjugated firefly luciferase mRNA. *p<0.05, paired T-test. DETAILED DESCRIPTION OF THE INVENTION

[0262] The present application provides modified mRNAs with modified nucleotides and / or structural features on or downstream of the mRNA's poly(A) tail to improve stability in cells and thereby enhance protein production. Methods for producing modified mRNAs are also provided, including ligating a tailing nucleic acid to the 3' end of an mRNA to introduce a defined number of modified nucleic acids or structural sequences 3' to the modified mRNA produced by ligation. Additionally, the present disclosure provides pharmaceutical compositions containing one or more of the modified mRNAs provided herein, as well as kits containing reagents for producing the modified mRNAs described herein. Conventional mRNAs contain a poly(A) tail with multiple adenosine nucleotides at the 3' end, which can be degraded by cellular exonucleases that remove the 3' nucleotides. Once exonucleases remove the poly(A) tail and begin removing nucleotides from the open reading frame, the mRNA is no longer capable of being translated into the encoded protein. Because one of the primary determinants of mRNA stability in cells is the time required to degrade the polyA tail, mRNAs that are more resistant to 3' exonuclease activity are degraded at a slower rate. The modified mRNAs of the present disclosure have a longer half-life and are therefore more stable in cells. The more stable an mRNA is in a cell, the longer it will take to be degraded. Therefore, more protein can be translated from a given RNA molecule with a longer half-life. Modified nucleotides containing one or more structural modifications at the nucleobase, sugar, and / or phosphate linkages of an mRNA can interfere with 3' exonuclease activity, making the mRNA more stable. However, the same structural modifications that inhibit 3' exonucleases can also interfere with the ability of polyadenylation enzymes to incorporate them onto the polyA tail, preventing the addition of modified nucleotides to the polyA tail via conventional polyadenylation methods. Surprisingly, ligating an oligonucleotide containing only three modified nucleotides to the 3' end of an mRNA containing a pre-existing polyA tail resulted in a significant improvement in mRNA stability.Ligation of oligonucleotides containing structural sequences capable of forming secondary structures, such as G-quadruplexes or aptamers, that prevent exonucleases from accessing the 3'-terminal nucleotide also significantly improved mRNA stability relative to RNA without such secondary structures. Several classes of modified nucleotides and structural sequences, both alone and in combination with each other, increased mRNA stability when added to the 3' end, suggesting that modifying the polyA tail of mRNA to prevent exonuclease activity offers broad utility in the production of modified mRNA. Modified mRNAs with increased stability in cells and therefore the ability to produce more encoded protein from a given RNA molecule are useful for use in vaccines and other RNA-based therapies, such as the delivery of mRNAs encoding essential enzymes, clotting factors, transcription factors, or cell surface receptors. definition

[0263] As used herein, "messenger RNA" ("mRNA") refers to a nucleic acid that contains a protein-encoding open reading frame and a poly(A) region. mRNA may also contain a 5' untranslated region (5' UTR) located 5' (upstream) of the open reading frame and a 3' untranslated region located 3' (downstream) of the open reading frame.

[0264] As used herein, a "protein-encoding open reading frame" refers to a nucleic acid sequence containing a coding sequence that, when translated, leads to the production of a protein. The nucleic acid sequence may also be an RNA sequence. In this case, translation of the RNA sequence produces a polypeptide having the amino acid sequence of the protein. The nucleic acid sequence may also be a DNA sequence. In this case, a protein is produced when an RNA polymerase uses the DNA sequence to transcribe an RNA molecule containing an RNA sequence that is complementary to the DNA sequence, and translation of the RNA sequence produces a polypeptide having the amino acid sequence of the protein. An open reading frame typically begins with a start codon, e.g., AUG in the RNA sequence (ATG in the DNA sequence), and ends with a stop codon, e.g., UAG, UAA, or UGA in the RNA sequence (TAG, TAA, or TGA in the DNA sequence), where the number of bases between the start codon G and the stop codon T or U is a multiple of three (e.g., 3, 6, or 9).

[0265] RNA molecules that can be translated are called messenger RNA or mRNA. DNA or RNA sequences encode genes through codons. A codon refers to a group of three nucleotides in a nucleic acid sequence, such as DNA or RNA. An anticodon refers to a group of three nucleotides in a nucleic acid, such as a transfer RNA (tRNA), that is complementary to a codon. As a result, a codon in a first nucleic acid associates with an anticodon in a second nucleic acid through hydrogen bonds between the bases of the codon and the anticodon. For example, a codon 5'-AUG-3' in an mRNA has a corresponding anticodon 3'-UAC-5' in a tRNA. During translation, a tRNA with an anticodon complementary to the codon to be translated associates with the codon in the mRNA to generally deliver the amino acid corresponding to the codon to be translated or facilitate the termination of translation and release of the translated polypeptide from the ribosome.

[0266] Translation is the process by which an RNA coding sequence is used to direct the production of a polypeptide. The first step in translation is initiation, in which a ribosome associates with an mRNA, and a first transfer RNA (tRNA) carrying a first amino acid associates with the first or start codon. The next stage of translation, elongation, involves three steps. First, a second tRNA carrying a second amino acid and having an anticodon complementary to the codon following the start codon or the second codon associates with the mRNA. Second, the carbon atom of the non-side chain carboxylic acid moiety at the end of the first amino acid reacts with the nitrogen of the non-side chain amino moiety at the end of the second amino acid, forming a peptide bond between the two amino acids. The second amino acid is then bound to the second tRNA, and the first amino acid is bound to the second amino acid, not the first tRNA. Third, the first tRNA dissociates from the mRNA, and the ribosome moves along the mRNA. As a result, the position where the first tRNA associated with the ribosome is now occupied by the second tRNA, and the position previously occupied by the second tRNA is now available for additional tRNAs carrying additional amino acids to associate with the mRNA. These three steps—1) association of the tRNA carrying an amino acid, 2) peptide bond formation that adds the additional amino acid to the growing polypeptide, and 3) advancement of the ribosome along the mRNA—continue until the ribosome reaches a stop codon, which terminates translation. Generally, the tRNA that associates with the stop codon does not carry an amino acid. Therefore, association of a tRNA that does not carry an amino acid during the elongation step results in cleavage of the bond between the polypeptide and the tRNA carrying the last amino acid on the polypeptide, resulting in the polypeptide being released from the ribosome. Alternatively, if a tRNA does not associate with the stop codon, the ribosome may dissociate from the mRNA and release the polypeptide.

[0267] As used herein, "nucleic acid" or "polynucleotide" refers to an organic molecule comprising two or more covalently linked nucleotides. As used herein, "nucleotide" refers to an organic molecule comprising: 1) a nucleoside comprising a sugar covalently linked to a nitrogenous base (nucleobase); and 2) a phosphate group covalently linked to the sugar of the nucleoside. The nucleotides in a polynucleotide are typically joined by phosphodiester bonds, in which the 3' carbon of the sugar of a first nucleotide is linked to the 5' carbon of the sugar of a second nucleotide by a bridging phosphate group. Typically, the bridging phosphate contains two non-bridging oxygen atoms bonded only to the phosphorus atom of the phosphate and two bridging oxygen atoms, each connecting the phosphorus atom to either the 3' carbon of the first nucleotide or the 5' carbon of the second nucleotide. In a nucleic acid sequence describing the order of nucleotides on a nucleic acid, a first nucleotide is said to be 5' (upstream) of a second nucleotide if the 3' carbon of the first nucleotide is connected to the 5' carbon of the second nucleotide. Similarly, a second nucleotide is said to be 3' (downstream) of a first nucleotide if the 5' carbon of the second nucleotide is connected to the 3' carbon of the first nucleotide. Nucleic acid sequences are typically read in 5'->3' order, starting with the 5' nucleotide and ending with the 3' nucleotide.

[0268] As used herein, a "modified nucleotide" refers to a nucleotide having a structure that is not the classical structure of an adenosine nucleotide, a cytidine nucleotide, a guanine nucleotide, or a uracil nucleotide. The classical structure of a molecule refers to the structure generally known in the art to be the structure referred to by the name of the molecule. As used herein, a "modified nucleotide" can also refer to a nucleotide containing a non-classical nucleobase or sugar (ribose or deoxyribose). A "modified nucleotide" can also refer to a nucleotide that is covalently linked to a second nucleotide by an internucleoside linkage that is not a classical internucleoside linkage (i.e., not a phosphodiester internucleoside linkage, e.g., a phosphorothioate internucleoside linkage). The classical structure of an adenosine ribonucleotide, containing an adenine base, a ribose sugar, and one or more phosphate groups, is shown below in the form of adenosine monophosphate: [ka] (AMP).

[0269] The classical structure of AMP also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and in which the oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are attached to adjacent nucleotides in the nucleic acid sequence.

[0270] The classical structure of a cytosine nucleotide, containing a cytosine base, a ribose sugar, and one or more phosphate groups, is shown below in the form of cytidine monophosphate: [ka] (CMP). The classical structure of a CMP also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and in which the oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are attached to adjacent nucleotides in the nucleic acid sequence.

[0271] The classical structure of a guanine nucleotide, containing a guanine base, a ribose sugar, and one or more phosphate groups, is shown below in the form of guanosine monophosphate: [ka] (GMP). The classical structure of GMP also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and in which the oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are attached to adjacent nucleotides in the nucleic acid sequence.

[0272] The classical structure of a uracil nucleotide, containing a uracil base, a ribose sugar, and one or more phosphate groups, is shown below in the form of uridine monophosphate: [ka] (UMP). The classical structure of a UMP also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, and in which the oxygen atom of the phosphate and / or the 3' oxygen atom of the sugar are attached to adjacent nucleotides in a nucleic acid sequence.

[0273] The structure of modified nucleotide may differ from that of classical nucleotide due to one or more modifications in the sugar, nitrogenous base, or phosphate of the nucleotide.In some embodiments, modified nucleotide includes modified nucleosides that are not of the classical structure of adenine nucleoside, cytosine nucleoside, guanine nucleoside, or uracil nucleoside.As used herein.

[0274] An example of the classical structure of adenosine, the adenine nucleoside, is reproduced below: [ka] (Adenosine). The classical structure of adenosine also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, the 5' carbon is attached to the 5' phosphate on a nucleic acid sequence, and the 3' oxygen atom is attached to the 5' phosphate group of an adjacent nucleotide on a nucleic acid sequence.

[0275] An example of the classical structure of cytidine, the cytosine nucleoside, is reproduced below: [ka] (Cytidine). The classical structure of cytidine also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, the 5' carbon is attached to the 5' phosphate on the nucleic acid sequence, and the 3' oxygen atom is attached to the 5' phosphate group of the adjacent nucleotide on the nucleic acid sequence.

[0276] An example of the classical structure of guanosine, guanine nucleoside, is reproduced below: [ka] (Guanosine). The classical structure of guanosine also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, the 5' carbon is attached to the 5' phosphate on a nucleic acid sequence, and the 3' oxygen atom is attached to the 5' phosphate group of an adjacent nucleotide on a nucleic acid sequence.

[0277] An example of the classical structure of uridine, uracil nucleoside, is reproduced below: [ka] (Uridine). The classical structure of uridine also refers to a structure in which one or more hydroxyl groups of the phosphate and / or one or more hydroxyl groups of the sugar are deprotonated, the 5' carbon is bound to the 5' phosphate on a nucleic acid sequence, and the 3' oxygen atom is bound to the 5' phosphate group of an adjacent nucleotide on a nucleic acid sequence.

[0278] As used herein, a "structural sequence" refers to a nucleic acid sequence that includes at least two nucleotides that can interact with each other to form a secondary structure on the nucleic acid that includes the structural sequence.

[0279] As used herein, "aptamer" refers to a nucleic acid that contains a secondary structure that is capable of binding to a target molecule.

[0280] As used herein, "ligase" refers to an enzyme capable of forming a covalent bond between two nucleotides, and the process of "ligation" refers to the formation of a covalent bond between two nucleotides.

[0281] As used herein, a "tailing nucleic acid" refers to a nucleic acid that is ligated to the 3' end of another nucleic acid. Modified mRNA

[0282] In some aspects, the present disclosure provides modified mRNAs comprising i) one or more modified nucleotides; and / or ii) one or more copies (repeat units) of a structural sequence, wherein the modified nucleotides and / or structural sequence are part of or 3' to the polyA region of the mRNA. The polyA region, also referred to as the poly(A) region or poly(A) tail of an mRNA, is a region of an mRNA 3' (downstream) of the open reading frame that contains a stretch of adenosine nucleotides, typically 50 to 300, and may include multiple non-adenosine nucleotides downstream of the stretch of adenosine nucleotides. In cells, after transcription of a DNA sequence to produce precursor messenger RNA (pre-mRNA), the polyA tail is added by a polyadenylation enzyme, such as polyA polymerase (PAP), resulting in a long stretch of adenosine nucleotides at the 3' end of the RNA. The polyA region plays several important roles in the production of the protein encoded by the mRNA. First, the poly(A) region provides an attachment site for poly(A)-binding protein (PABP), which associates with mRNA in the nucleus and promotes its export to the cytoplasm (see, e.g., Tudek et al. Philos Trans R Soc Lond B Biol Sci. 2018. 373(1762): 20180169). In addition, the presence of a poly(A) tail on an mRNA facilitates translation initiation (see, e.g., Gallie. Genes & Dev. 1991. 5:2108-2116 and Munroe et al. Mol Cell Biol. 1990. 10(7): 3441-3455). Finally, the poly(A) tail stabilizes the mRNA by protecting the open reading frame from the activity of exonucleases, such as polynucleotide phosphorylase (PNPase), which remove 3' nucleotides from the mRNA. As exonucleases remove nucleotides, the mRNA becomes progressively shorter. Once all of the nucleotides downstream of the open reading frame have been removed, the nucleotide removed by the exonuclease will be a nucleotide of the open reading frame.Removal of nucleotides from the open reading frame prevents translation of the encoded protein. In addition, association of exonucleases with mRNA near the open reading frame can inhibit translation by conformationally preventing ribosomes and tRNA from associating with the mRNA. Removal of the poly(A) tail is often cited as the rate-limiting step in RNA degradation, and the lifespan of an mRNA in a cell is determined by the time required to remove its poly(A) tail (see, e.g., Dreyfus et al., Cell. 2002. 111(5): 611-613). The composition of the poly(A) tail of an mRNA varies, but contains approximately 75 adenosine nucleotides in yeast cells and 250 adenosine nucleotides in mammalian cells.

[0283] In some embodiments of the modified mRNA provided herein, the modified mRNA comprises one or more modified nucleotides in the polyA region or 3' (downstream) of the polyA region of the mRNA. In some embodiments, the polyA region comprises one or more nucleotides that are not classical adenosine nucleotides. In some embodiments, the polyA region comprises one or more nucleotides that are not adenosine nucleotides. In some embodiments, the polyA region comprises one or more nucleotides 3' (downstream) of a nucleic acid sequence that comprises multiple stretches of adenosine nucleotides. In some embodiments, the polyA region comprises at least 25 stretches of adenosine nucleotides, which may be classical or modified adenosine nucleotides. In some embodiments, the polyA region comprises 25 to 500 stretches of adenosine nucleotides, which may be classical or modified adenosine nucleotides. In some embodiments, the polyA region comprises 25 to 300 stretches of adenosine nucleotides. In some embodiments, the polyA region comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or at least 200 consecutive adenosine nucleotides.

[0284] In some embodiments, one or more of the modified nucleotides of the modified mRNA comprises a modified phosphate group. The modified phosphate group is a phosphate group that differs from the classical structure of phosphate. An example of the classical structure of phosphate is shown below: [ka] Wherein, R5 and R3 are the atom or molecule that classical phosphate is bound to.For example, in the phosphate of nucleic acid sequence, R5 can refer to the upstream nucleotide of nucleic acid, and R3 can refer to the downstream nucleotide of nucleic acid.The classical structure of phosphate also refers to the structure in which one or more hydroxyl groups of phosphate are deprotonated, or the oxygen atom of phosphate is bound to the adjacent nucleotide of nucleic acid sequence. Non-limiting examples of modified phosphate groups that can be substituted for classical phosphate on nucleic acids include: phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0285] In some embodiments of the modified mRNAs comprising modified nucleotides provided herein, at least one modified nucleotide comprises a modified nucleobase. In some embodiments, at least one modified nucleotide comprises a modified sugar. In some embodiments, at least one modified nucleotide comprises a modified phosphate. In some embodiments, at least one modified nucleotide comprises a modified nucleobase selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyl ... Cytosine, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5 -hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7 -deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil,Cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil, desthiobiotin-16-aminoallyl-uracil, desthio Biotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinyl In some embodiments, the at least one modified nucleotide comprises a modified sugar selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'-deoxyribose, 2'-deoxyribose, 2'-amino- ...2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In certain embodiments, at least one modified nucleobase is 2'-O-(unsubstituted C, 1-6 Alkoxy)-(unsubstituted C 1-6 alkyl) nucleobase (e.g., 2'-O-(unsubstituted C 1-6 Alkoxy)-(unsubstituted C 1-6 In certain embodiments, at least one modified nucleobase is a 2'-O-methoxyethyl nucleobase (e.g., a 2'-O-methoxyethyl RNA nucleobase). In some embodiments, at least one modified nucleotide comprises a 2' modification. In some embodiments, the 2' modification is selected from the group consisting of: a locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and the 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe).

[0286] In some embodiments, at least one modified nucleotide comprises a modified phosphate selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0287] In some embodiments, the modified mRNA contains more than one type of modified nucleotide. In some embodiments, the modified mRNA contains at least a first modified nucleotide and a second modified nucleotide having a structure different from that of the first modified nucleotide. The nucleotides may differ in structure due to differences in the nucleobase, sugar, and / or phosphate group. In some embodiments, the modified mRNA contains at least a first modified phosphate and a second modified phosphate having a structure different from that of the first modified phosphate. In some embodiments, the modified mRNA contains a first modified nucleoside and a second modified nucleoside.

[0288] Aspects of the present disclosure relate to modified mRNAs comprising a polyA region having 25 or more adenine nucleotides. In certain embodiments, the polyA region is 3' of the open reading frame and comprises 10 or more, 15 or more, 20 or more, 30 or more, 40 or more, or 50 or more adenosine nucleotides. In certain embodiments, the polyA region is 3' of the open reading frame and comprises between 10 and 15, between 15 and 20, between 20 and 25, between 25 and 35, between 35 and 50, between 50 and 70, or between 70 and 100 adenosine nucleotides, inclusive. An adenine nucleotide is a nucleotide comprising an adenine nucleoside and a phosphate group. An adenine nucleoside comprises a sugar and an adenine base. In some embodiments, the polyA region comprises 25 or more classical adenosine nucleotides. Classical adenosine nucleotides comprise an adenine base, a ribose sugar, and a phosphate group. As arranged in the structure of adenosine monophosphate (AMP) below: [ka] In some embodiments, one or more of the hydroxyl groups of the phosphate and / or the 3' hydroxyl group of the ribose are deprotonated and contain an oxygen ion in place of the -OH group. [ka] When present on the nucleic acid sequence of an mRNA, a classical adenosine comprises the following structure and is connected to the adjacent nucleotide in the following manner: [ka] In the formula, R5 is the adjacent nucleotide located 5' (upstream) of the adenosine nucleotide on the mRNA, and R3 is the adjacent nucleotide located 3' (downstream) of the adenosine nucleotide on the mRNA. In some embodiments, the classical adenosine nucleotide is the 3'-terminal nucleotide (last nucleotide) of the linear mRNA, R3 is hydrogen, and the 3'-terminal nucleotide comprises a 3'-terminal hydroxyl (-OH) group. In some embodiments, the classical adenosine nucleotide is the 3'-terminal nucleotide (last nucleotide) of the linear mRNA, and R3 is electron.

[0289] In some embodiments of the modified mRNAs provided herein, the mRNA comprises a 5' untranslated region (5'UTR) and a 3' untranslated region (3'UTR). The 5' and 3'UTRs are sequences on the mRNA that do not encode amino acids of the protein encoded by the mRNA and are therefore not part of the open reading frame. The 5'UTR is 5' (upstream) of the open reading frame. The 3'UTR is 3' (downstream) of the open reading frame. In some embodiments, the 3'UTR comprises one or more nucleotides 3' of the open reading frame and 5' (upstream) of the polyA region of the mRNA.

[0290] In some embodiments of the mRNA provided herein, the mRNA comprises, in 5' to 3' order: 1) 5'UTR; 2) open reading frame; 3) 3'UTR; and 4) polyA region (Figure 2B). In some embodiments, the last nucleotide of the 5'UTR is 5' (upstream) of the first nucleotide of the open reading frame. In some embodiments, the first nucleotide of the open reading frame is 3' (downstream) of the last nucleotide of the 5'UTR, and the last nucleotide of the open reading frame is 5' (upstream) of the first base of the 3'UTR. In some embodiments, the open reading frame is between the last nucleotide of the 5'UTR and the first nucleotide of the 3'UTR. In some embodiments, the first nucleotide of the 3'UTR is 3' (downstream) of the last nucleotide of the open reading frame, and the last nucleotide of the 3'UTR is 5' (upstream) of the first base of the polyA region. In some embodiments, the 3'UTR is between the last nucleotide of the open reading frame and the first nucleotide of the polyA region. In some embodiments, the first nucleotide of the polyA region is 3' (downstream) of the last nucleotide of the 3'UTR.

[0291] In some embodiments, the mRNA is a linear mRNA. A linear mRNA is an mRNA having a 5'-terminal nucleotide and a 3'-terminal nucleotide. The 5'-terminal nucleotide of a linear mRNA is covalently linked to only one adjacent nucleotide of the mRNA, and the adjacent nucleotide occurs 3' of the 5'-terminal nucleotide on the nucleic acid sequence of the mRNA. The 3'-terminal nucleotide of a linear mRNA is covalently linked to only one adjacent nucleotide of the mRNA, and the adjacent nucleotide occurs 5' of the 3'-terminal nucleotide on the nucleic acid sequence of the mRNA. In a nucleic acid sequence that includes all nucleotides of a linear mRNA in 5' to 3' order, the 5'-terminal nucleotide is the first nucleotide on the sequence, and the 3'-terminal nucleotide is the last nucleotide on the sequence.

[0292] In some embodiments of the linear mRNA provided herein, the mRNA comprises a 5' cap. Most mRNAs produced in eukaryotic cells include a 5' cap that is added during processing of pre-mRNA into mature mRNA. The 5' cap plays multiple roles in the processes of mRNA production, export, and translation. First, assembly of the spliceosome, which mediates the removal of introns from pre-mRNA, requires binding of the nuclear cap-binding complex (CBC) to the 5' cap. Furthermore, interactions between the CBC and nuclear pores mediate export of mRNA into the cytoplasm starting from the 5' end. Finally, the CBC attached to the 5' cap mediates the recruitment of multiple factors, such as CBP80, CTIF, eIF3g, eIF4III, Met-tRNAi, and ribosomal subunits, which are required for translation initiation (see, e.g., Ramanathan et al. Nucleic Acids Res. 2016. 44(16): 7511-7526). In some embodiments, the 5' cap comprises 7-methylguanosine. In some embodiments, 7-methylguanosine has the structure: [ka] Includes:

[0293] In some embodiments, the 5' cap comprises one or more phosphates connecting the 7-methylguanosine to adjacent nucleotides of the modified mRNA. In some embodiments, the one or more phosphates of the 5' cap are modified phosphates selected from the group consisting of phosphorothioates, triazole rings, dihalogen methylene bisphosphonates, imidodiphosphates, and methylene bis(phosphonates). In some embodiments, the 7-methylguanosine is connected to adjacent nucleotides of the mRNA by a 5' to 5' triphosphate bridge. In some embodiments, the 5' cap has the structure: [ka] wherein R is the 5' carbon of the first transcribed nucleotide of the mRNA. In some embodiments, the 5' cap comprises 3'-O-Me-m7G(5')ppp(5')G.

[0294] In some embodiments, the mRNA is a circular mRNA. A circular mRNA is an mRNA that does not have a 5'-terminal nucleotide or a 3'-terminal nucleotide. Every nucleotide on a circular mRNA is covalently linked to both 1) the 5'-adjacent nucleotide; and 2) the 3'-adjacent nucleotide. In a circular mRNA having a nucleic acid sequence that includes every nucleotide of a circular mRNA in 5'-to-3' order, the last nucleotide of the nucleic acid sequence is covalently linked to the first nucleotide of the nucleic acid sequence. In some embodiments of a circular mRNA having a 5'UTR, a 3'UTR, and a polyA region, the polyA region is located 3' (downstream) of the 3'UTR and 5' (upstream) of the 5'UTR.

[0295] In some embodiments of the modified mRNA provided herein, the modified mRNA comprises one or more copies of a structural sequence 3' of the polyA region of the mRNA. In some embodiments, the nucleotides of the secondary structure interact through hydrogen bonds. In some embodiments, the secondary structure is a G-quadruplex. A G-quadruplex or G-quadruplex is a secondary structure formed by a guanine-rich nucleic acid sequence. A guanine-rich nucleic acid sequence contains multiple guanine nucleotides. Typically, at least 50% of the nucleotides in a guanine-rich nucleic acid sequence are guanine nucleotides. A G-quadruplex comprises at least one plane containing four guanines (G-tetrads), each of which is bound to two other guanines by Hoogsteen hydrogen bonds. Hoogsteen hydrogen bonds refer to hydrogen bonds between nitrogenous bases of nucleotides or nucleosides other than those formed by classical base pairing (A:T, A:U, and G:C). The guanines of the G-tetrads surround empty spaces, which may contain cations such as potassium ions to stabilize the G-tetrads. A G-quadruplex contains at least two G-tetrads arranged in a parallel orientation.

[0296] In some embodiments of the modified mRNA comprising one or more structural sequences, the structural sequence is a G-quadruplex sequence. A nucleic acid comprising a G-quadruplex sequence can form a G-quadruplex comprising one or more nucleotides of the G-quadruplex sequence. In some embodiments, the G-quadruplex sequence comprises one or more spacer nucleotides that are not guanine nucleotides. In some embodiments, the G-quadruplex sequence is an RNA G-quadruplex sequence. In some embodiments, the RNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 2). In some embodiments, the modified mRNA comprises at least three copies of the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the G-quadruplex sequence is a DNA G-quadruplex sequence. In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 3). In some embodiments, the modified mRNA comprises at least three copies of the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the structural sequence comprises a telomeric repeat sequence. In some embodiments, the telomeric repeat sequence comprises a nucleic acid sequence presented as one of SEQ ID NOs: 4 or 5. In some embodiments, the telomeric repeat sequence comprises a nucleic acid sequence presented as SEQ ID NO: 4. In some embodiments, the modified mRNA comprises at least three copies of the nucleotide sequence of SEQ ID NO:4.

[0297] In some embodiments, the structural sequence is an aptamer sequence, comprising at least two nucleotides that can interact to form an aptamer.Non-limiting examples of target molecules that can be bound by aptamers include cytokines, cell surface receptors, and transcription factors.In some embodiments, the secondary structure formed by one or more copies of the structural sequence is an aptamer that can bind to target molecules.Exemplary aptamers are known in the art, and include multiple RNA structures that can bind to cell surface receptors, such as CD4, CTLA-4, TGF-β receptors, and receptor tyrosine kinases.See, for example, Germer et al. Int J Biochem Mol Biol., 2013.4(1):27-40.

[0298] In some embodiments, the modified mRNA comprises 1 to 20 copies of the structural sequence. In some embodiments, the modified mRNA comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 copies of the structural sequence. In some embodiments, the modified mRNA comprises about 4 copies of the structural sequence. In some embodiments, the modified mRNA comprises multiple different structural sequences. In some embodiments, the modified mRNA comprises at least a first structural sequence and a second structural sequence comprising a nucleic acid sequence different from the first structural sequence. In some embodiments, the modified mRNA comprises at least one G-quadruplex sequence and at least one telomeric repeat sequence.

[0299] In some embodiments of modified mRNAs comprising one or more copies of the structural sequences provided herein, the polyA region of the modified mRNA comprises at least one modified nucleotide. In some embodiments, at least one modified nucleotide comprises a modified nucleobase. In some embodiments, at least one modified nucleotide comprises a modified sugar. In some embodiments, at least one modified nucleotide comprises a modified phosphate. In some embodiments, at least one modified nucleotide comprises a modified nucleobase selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, and 2-thiocytosine. , 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine , 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil,Biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallylura Cytosine, Dabsyl-5-3-aminoallyluracil, Desthiobiotin-16-aminoallyl-uracil, Desthiobiotin-6-aminoallylcytosine, Isoguanine, N1-Ethylpseudouracil, N1-Methoxymethylpseudouracil, N1-Methyladenine, N1-Methylpseudouracil, N1-Propylpseudouracil, N2-Methylguanine, N4-Biotin-OBEA-cytosine, N4-Methylcytosine, N6-Methyladenine, O6-Methylguanine, Pseudoisocytosine, Pseudouracil, Thienocytosine Synthon, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, at least one modified nucleotide isThe modified sugars include those selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3' -dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked ribose, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In some embodiments, at least one modified nucleotide comprises a 2' modification. In some embodiments, the 2' modification is selected from the group consisting of locked nucleic acid (LNA) modifications (i.e., nucleotides containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe).

[0300] In some embodiments, at least one modified nucleotide comprises a modified phosphate selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, the polyA region of the mRNA comprises at least three, at least four, or at least five phosphorothioates and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three phosphorothioates and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three guanine nucleotides and at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least 20 deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three copies of a G-quadruplex sequence and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six consecutive phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six phosphorothioates and three guanine nucleosides and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three copies of the G-quadruplex sequence and at least six phosphorothioates, and does not contain a 3' terminal hydroxyl.In some embodiments, the polyA region of the mRNA contains at least three copies of the telomeric repeat sequence and at least six phosphorothioates, and does not contain a 3'-terminal hydroxyl. In some embodiments, the 3'-terminal nucleotide that does not contain a 3'-terminal hydroxyl is dideoxycytidine or inverted deoxythymidine.

[0301] In some embodiments, the modified mRNA comprises more than one type of modified nucleotide. In some embodiments, the modified mRNA comprises at least a first modified nucleoside and a second modified nucleoside having a structure different from the first modified nucleoside. In some embodiments, the modified mRNA comprises at least a first modified phosphate and a second modified phosphate having a structure different from the first modified phosphate. In some embodiments, the modified mRNA comprises a modified nucleoside and a modified nucleoside.

[0302] In some embodiments of the modified mRNA comprising a secondary structure provided herein, the mRNA comprises a 5'UTR and a 3'UTR. In some embodiments, the 5'UTR is located 5' (upstream) of the open reading frame. In some embodiments, the mRNA comprises, in 5' to 3' order: 1) the 5'UTR; 2) the open reading frame; 3) the 3'UTR; 4) a polyA region; and 5) one or more copies of a structural sequence. In some embodiments, the 3'UTR is located 3' (downstream) of the open reading frame. In some embodiments, the polyA region is located 3' (downstream) of the 3'UTR. In some embodiments, one or more copies of the structural sequence and the secondary structure formed by the structural sequence are located 3' (downstream) of the polyA region. In some embodiments, the mRNA is a linear mRNA. In some embodiments, the linear mRNA comprises a 5' cap. In some embodiments, the 5' cap comprises 7-methylguanosine. In some embodiments, the 5' cap comprises one or more phosphates connecting the 7-methylguanosine to adjacent nucleotides of the modified mRNA. In some embodiments, the 7-methylguanosine is connected to adjacent nucleotides of the mRNA by a 5'-to-5' triphosphate bridge. In some embodiments, one or more phosphates of the 5' cap are modified phosphates selected from the group consisting of phosphorothioates, triazole rings, dihalogen methylene bisphosphonates, imidodiphosphates, and methylene bis(phosphonates). In some embodiments, the 5' cap comprises 3'-O-Me-m7G(5')ppp(5')G. In some embodiments, the polyA region of the mRNA comprises at least three, at least four, or at least five phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three guanine nucleotides and at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three deoxyribose sugars and does not comprise a 3'-terminal hydroxyl.In some embodiments, the polyA region of the mRNA comprises at least 20 deoxyribose sugars and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three copies of a G-quadruplex sequence and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six phosphorothioates and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six consecutive nucleotides containing a 2'-modification and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six consecutive phosphorothioates and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six phosphorothioates and three guanine nucleosides and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and does not have a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least three copies of the telomeric repeat sequence and at least six phosphorothioates, and does not contain a 3'-terminal hydroxyl. In some embodiments, the 3'-terminal nucleotide that does not contain a 3'-terminal hydroxyl is dideoxycytidine or inverted deoxythymidine.

[0303] In some embodiments of the modified mRNA comprising a secondary structure provided herein, the modified mRNA comprises, in 5' to 3' order: 1) 5'UTR; 2) open reading frame; 3) 3'UTR; 4) polyA region; and 5) one or more copies of the structural sequence. In some embodiments, the modified mRNA is a circular mRNA. In some embodiments of the circular mRNA, one or more copies of the structural sequence are located between the polyA region and the 5'UTR. In some embodiments, the secondary structure is located between the polyA region and the 5'UTR.

[0304] In some embodiments of the modified mRNAs provided herein, 1% to 90% of the nucleotides in the polyA region are modified nucleotides, hi some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

[0305] In some embodiments of the modified mRNAs provided herein, three or more of the last 25 nucleotides of the polyA region are modified nucleotides, hi some embodiments, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, or 25 of the last 25 nucleotides of the polyA region are modified nucleotides.

[0306] In some embodiments of the modified mRNAs provided herein, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are adenosine nucleotides. One or more adenosine nucleotides in the polyA region can be a classical adenosine nucleotide or a modified adenosine nucleotide that contains a structure different from that of a classical adenosine nucleotide. Non-limiting examples of modified adenosine nucleotides include: N6-isopentenyladenosine (i6A), 2-methyl-thio-N6-isopentenyladenosine (ms2i6A), 2-methylthio-N6-methyladenosine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyladenosine (g6A), N6-threonylcarbamoyladenosine (t6A), 2-methylthio-N6-threonylcarbamoyladenosine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenosine (m6t6A), N6-hydroxynorvalylcarbamoylade ...hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenos N6,N6-dimethyladenosine (m62A), N6,2'-O-dimethyladenosine (m6Am), N6,N6,O-2'-trimethyladenosine (m62Am), 1-methylthio-N6-hydroxynorvalylcarbamoyladenosine (ms2hn6A), 2'-O-ribosyladenosine (phosphate) (Ar(p)), N6,N6-dimethyladenosine (m62A), N6,2'-O-dimethyladenosine (m6Am), N6,N6,O-2'-trimethyladenosine (m62Am), 1 , 2'-O-dimethyladenosine (m1Am), N6-acetyladenosine (ac6A), 2'-thioadenosine (2'SA), 5'-thioadenosine (5'SA), 2'-O-(2-azidoethyl)-adenosine, 2'-azidoadenosine, deoxyadenosine (dA), dideoxyadenosine (ddA), and aminodeoxyadenosine (aminodA).

[0307] In some embodiments of the modified mRNAs provided herein, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are classical adenosine nucleotides. In some embodiments, the polyA region further comprises one or more nucleotides that are not adenosine nucleotides (e.g., classical or non-classical adenosine nucleotides). In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 80%, or at least 90% of the nucleotides in the polyA region are nucleotides that are not adenosine nucleotides.

[0308] In some embodiments of the modified mRNAs provided herein, the polyA region comprises at least 25-500 nucleotides. In some embodiments, the polyA region comprises at least 25, at least 30, at least 50, at least 100, at least 150, or at least 200 nucleotides. In some embodiments, the polyA region comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 nucleotides. In some embodiments, the polyA region comprises about 200 to about 300 nucleotides. In some embodiments, the polyA region comprises about 250 nucleotides.

[0309] In some embodiments, the polyA region contains at least 3, at least 4, or at least 5 phosphorothioates and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 3 phosphorothioates and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 3 guanine nucleotides and at least 3 phosphorothioates and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 3 deoxyribose sugars and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 20 deoxyribose sugars and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 3 copies of a G-quadruplex sequence and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 6 nucleotides containing 2'-modifications and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA contains at least 6 phosphorothioates and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six consecutive nucleotides containing a 2' modification and does not have a 3' terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six consecutive phosphorothioates and does not have a 3' terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least six phosphorothioates and three guanine nucleosides and does not have a 3' terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and does not have a 3' terminal hydroxyl. In some embodiments, the polyA region of the mRNA comprises at least three copies of a telomeric repeat sequence and at least six phosphorothioates and does not have a 3' terminal hydroxyl. In some embodiments, the 3' terminal nucleotide without a 3' terminal hydroxyl is dideoxycytidine or inverted deoxythymidine. Modified non-coding RNA

[0310] Those skilled in the art will readily recognize that any of the techniques disclosed herein for improving mRNA stability in cells (e.g., by improving the resistance of mRNA to 3' exonuclease activity) may also be suitable for improving the stability of non-protein-encoding RNA ("non-coding" RNA) in cells. Thus, in some aspects, the present disclosure provides modified non-coding RNAs comprising: i) one or more modified nucleotides; and / or ii) one or more copies (repeat units) of a structural sequence, where the modified nucleotides and / or structural sequence are part of or 3' to the RNA. The non-coding RNAs described herein do not comprise an open reading frame (ORF). The non-coding RNA may or may not comprise a 3' polyA region. A non-coding RNA that does not comprise a 3' polyA region can be modified to include one (e.g., by ligating the non-coding RNA to an oligonucleotide containing a polyA region, using methods disclosed herein or otherwise known in the art). The non-coding RNA may comprise a region of complementarity with a portion of a cellular mRNA transcript or genomic sequence. Non-coding RNA can be the non-coding RNA that is suitable for genome editing.Examples of non-coding RNA include but are not limited to small interfering RNA (siRNA), short hairpin RNA (shRNA), long non-coding RNA (lncRNA), clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 genome editing guide RNA (gRNA), non-CRISPR / Cas9 gRNA (for example, adenosine deaminase acting on RNA (ADAR) recruiting gRNA) or prime editing guide RNA (pegRNA).See, e.g., Chen, et al., Acta Pharm Sin B. 2021; 11(2): 340-354; Chen, et al., Adv Drug Deliv Rev. 2021; 168: 246-258; Hendel, et al., Nat Biotechnol. 2015; 33: 985-989; Qu, et al., Nat Biotechnol. 2019; 37(9): 1059-1069; Yi, et al., Nat Biotechnol. 2022. Epub ahead of print; and Nelson, et al., Nat Biotechnol. 2022; 40(3): 402-410. Any of the techniques described herein for producing modified mRNA can also be used to produce modified non-coding RNA, unless specifically stated otherwise.

[0311] In some embodiments, the modified non-coding RNA provided herein comprises a non-coding RNA comprising a 3' polyA region. In some embodiments, the modified non-coding RNA provided herein comprises a non-coding RNA that typically does not comprise a 3' polyA region (e.g., gRNA). In some embodiments, the modified non-coding RNA provided herein comprises a non-coding RNA ligated at its 3' end to the 5' end of an oligonucleotide comprising a polyA region, thereby producing a modified non-coding RNA comprising a polyA region as described herein. The non-coding RNA can be ligated to an oligonucleotide comprising a polyA region by any method disclosed herein or otherwise known in the art.

[0312] In some embodiments of the modified non-coding RNA provided herein, the modified non-coding RNA comprises one or more modified nucleotides in a polyA region present on the non-coding RNA or 3' (downstream) of a polyA region. In some embodiments, the polyA region comprises one or more nucleotides that are not classical adenosine nucleotides. In some embodiments, the polyA region comprises one or more nucleotides that are not adenosine nucleotides. In some embodiments, the polyA region comprises one or more nucleotides 3' (downstream) of a nucleic acid sequence that comprises multiple stretches of adenosine nucleotides. In some embodiments, the polyA region comprises at least 25 stretches of adenosine nucleotides, which may be classical or modified adenosine nucleotides. In some embodiments, the polyA region comprises 25 to 500 stretches of adenosine nucleotides, which may be classical or modified adenosine nucleotides. In some embodiments, the polyA region comprises 25 to 300 stretches of adenosine nucleotides. In some embodiments, the polyA region comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or at least 200 consecutive adenosine nucleotides.

[0313] In some embodiments, one or more of the modified nucleotides of the modified non-coding RNA comprises a modified phosphate group. The modified phosphate group is a phosphate group that differs from the classical structure of phosphate. An example of the classical structure of phosphate is shown below: [ka] Wherein, R5 and R3 are the atom or molecule that classical phosphate is bound to.For example, in the phosphate of nucleic acid sequence, R5 can refer to the upstream nucleotide of nucleic acid, and R3 can refer to the downstream nucleotide of nucleic acid.The classical structure of phosphate also refers to the structure in which one or more hydroxyl groups of phosphate are deprotonated, or the oxygen atom of phosphate is bound to the adjacent nucleotide of nucleic acid sequence. Non-limiting examples of modified phosphate groups that can be substituted for classical phosphate on nucleic acids include: phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0314] In some embodiments of the modified non-coding RNAs comprising modified nucleotides provided herein, at least one modified nucleotide comprises a modified nucleobase. In some embodiments, at least one modified nucleotide comprises a modified sugar. In some embodiments, at least one modified nucleotide comprises a modified phosphate. In some embodiments, at least one modified nucleotide comprises a modified nucleobase selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyl ... Cytosine, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5 -hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7 -deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil,Cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil, desthiobiotin-16-aminoallyl-uracil, desthio Biotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinyl In some embodiments, the at least one modified nucleotide comprises a modified sugar selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'-deoxyribose, 2'-deoxyribose, 2'-amino- ...2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In certain embodiments, at least one modified nucleobase is 2'-O-(unsubstituted C, 1-6 Alkoxy)-(unsubstituted C 1-6 alkyl) nucleobase (e.g., 2'-O-(unsubstituted C 1-6 Alkoxy)-(unsubstituted C 1-6 In certain embodiments, at least one modified nucleobase is a 2'-O-methoxyethyl nucleobase (e.g., a 2'-O-methoxyethyl RNA nucleobase). In some embodiments, at least one modified nucleotide comprises a 2' modification. In some embodiments, the 2' modification is selected from the group consisting of: a locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and the 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe).

[0315] In some embodiments, at least one modified nucleotide comprises a modified phosphate selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphanate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0316] In some embodiments, the modified non-coding RNA comprises more than one type of modified nucleotide. In some embodiments, the modified non-coding RNA comprises at least a first modified nucleotide and a second modified nucleotide having a structure different from that of the first modified nucleotide. The nucleotides may differ in structure due to differences in the nucleobase, sugar, and / or phosphate group. In some embodiments, the modified non-coding RNA comprises at least a first modified phosphate and a second modified phosphate having a structure different from that of the first modified phosphate. In some embodiments, the modified non-coding RNA comprises a first modified nucleoside and a second modified nucleoside.

[0317] Aspects of the present disclosure relate to modified non-coding RNAs comprising a polyA region having 25 or more adenine nucleotides. In certain embodiments, the polyA region is at the 3' end of the non-coding RNA and comprises 10 or more, 15 or more, 20 or more, 30 or more, 40 or more, or 50 or more adenosine nucleotides. In certain embodiments, the polyA region is at the 3' end of the non-coding RNA and comprises between 10 and 15, between 15 and 20, between 20 and 25, between 25 and 35, between 35 and 50, between 50 and 70, or between 70 and 100 adenosine nucleotides, inclusive. An adenine nucleotide is a nucleotide comprising an adenine nucleoside and a phosphate group. An adenine nucleoside comprises a sugar and an adenine base. In some embodiments, the polyA region comprises 25 or more classical adenosine nucleotides. A classical adenosine nucleotide comprises an adenine base, a ribose sugar, and a phosphate group. As arranged in the structure of adenosine monophosphate (AMP) below: [ka] In some embodiments, one or more of the hydroxyl groups of the phosphate and / or the 3' hydroxyl group of the ribose are deprotonated and contain an oxygen ion in place of the -OH group. [ka] When present on the nucleic acid sequence of a non-coding RNA, a classical adenosine comprises the following structure and is connected to the adjacent nucleotide in the following manner: [ka] wherein R5 is the adjacent nucleotide 5' (upstream) of the adenosine nucleotide on the non-coding RNA, and R3 is the adjacent nucleotide 3' (downstream) of the adenosine nucleotide on the non-coding RNA. In some embodiments, the classical adenosine nucleotide is the 3'-terminal nucleotide (last nucleotide) of the linear non-coding RNA, R3 is hydrogen, and the 3'-terminal nucleotide contains a 3'-terminal hydroxyl (-OH) group. In some embodiments, the classical adenosine nucleotide is the 3'-terminal nucleotide (last nucleotide) of the linear non-coding RNA, and R3 is electron.

[0318] In some embodiments of the non-coding RNA provided herein, the non-coding RNA comprises, in 5' to 3' order: 1) the non-coding RNA; and 2) a polyA region present on or ligated to the 3' end of non-coding RNA 1. In some embodiments, the first nucleotide of the polyA region ligated to the non-coding RNA is 3' (downstream) of the last nucleotide of the non-coding RNA.

[0319] In some embodiments, the non-coding RNA is a linear non-coding RNA. The linear non-coding RNA is a non-coding RNA having a 5'-terminal nucleotide and a 3'-terminal nucleotide. The 5'-terminal nucleotide of the linear non-coding RNA is covalently linked to only one adjacent nucleotide of the non-coding RNA, and the adjacent nucleotide occurs 3' from the 5'-terminal nucleotide on the nucleic acid sequence of the non-coding RNA. The 3'-terminal nucleotide of the linear non-coding RNA is covalently linked to only one adjacent nucleotide of the non-coding RNA, and the adjacent nucleotide occurs 5' from the 3'-terminal nucleotide on the nucleic acid sequence of the non-coding RNA. In a nucleic acid sequence comprising all nucleotides of the linear non-coding RNA in 5' to 3' order, the 5'-terminal nucleotide is the first nucleotide on the sequence, and the 3'-terminal nucleotide is the last nucleotide on the sequence.

[0320] In some embodiments of the linear non-coding RNA provided herein, the non-coding RNA comprises a 5' cap. In some embodiments, the 5' cap comprises one or more phosphates connecting a 7-methylguanosine to adjacent nucleotides of the modified non-coding RNA. In some embodiments, the one or more phosphates of the 5' cap are modified phosphates selected from the group consisting of phosphorothioates, triazole rings, dihalogen methylene bisphosphonates, imidodiphosphates, and methylene bis(phosphonates). In some embodiments, the 7-methylguanosine is connected to adjacent nucleotides of the non-coding RNA by a 5' to 5' triphosphate bridge. In some embodiments, the 5' cap has the structure: [ka] wherein R is the 5' carbon of the first transcribed nucleotide of the non-coding RNA. In some embodiments, the 5' cap comprises 3'-O-Me-m7G(5')ppp(5')G.

[0321] In some embodiments, the linear non-coding RNA does not comprise a 5' cap.

[0322] In some embodiments, the non-coding RNA is a circular non-coding RNA. A circular non-coding RNA is a non-coding RNA that does not have a 5'-terminal nucleotide or a 3'-terminal nucleotide. Every nucleotide on the circular non-coding RNA is covalently linked to both 1) the 5'-adjacent nucleotide; and 2) the 3'-adjacent nucleotide. In a circular non-coding RNA having a nucleic acid sequence that includes every nucleotide of the circular non-coding RNA in 5' to 3' order, the last nucleotide of the nucleic acid sequence is covalently linked to the first nucleotide of the nucleic acid sequence. In some embodiments of the circular non-coding RNA, the last nucleotide of the polyA region on or ligated to the 3' end of the non-coding RNA is 5' to the first nucleotide of the non-coding RNA.

[0323] In some embodiments of the modified non-coding RNA provided herein, the modified non-coding RNA comprises one or more copies of a structural sequence 3' of the polyA region on or ligated to the non-coding RNA. In some embodiments, the nucleotides of the secondary structure interact through hydrogen bonds. In some embodiments, the secondary structure is a G-quadruplex. A G-quadruplex or G-quadruplex is a secondary structure formed by a guanine-rich nucleic acid sequence.

[0324] In some embodiments of the modified non-coding RNA comprising one or more structural sequences, the structural sequence is a G-quadruplex sequence. The nucleic acid comprising the G-quadruplex sequence can form a G-quadruplex comprising one or more nucleotides of the G-quadruplex sequence. In some embodiments, the G-quadruplex sequence comprises one or more spacer nucleotides that are not guanine nucleotides. In some embodiments, the G-quadruplex sequence is an RNA G-quadruplex sequence. In some embodiments, the RNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 2). In some embodiments, the modified non-coding RNA comprises at least three copies of the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the G-quadruplex sequence is a DNA G-quadruplex sequence. In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 3). In some embodiments, the modified non-coding RNA comprises at least three copies of the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the structural sequence comprises a telomeric repeat sequence. In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence set forth as one of SEQ ID NOs: 4 or 5. In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence submitted as SEQ ID NO: 4. In some embodiments, the modified non-coding RNA comprises at least three copies of the nucleotide sequence of SEQ ID NO: 4.

[0325] In some embodiments, the structural sequence is an aptamer sequence, comprising at least two nucleotides that can interact to form an aptamer.Non-limiting examples of target molecules that can be bound by aptamers include cytokines, cell surface receptors, and transcription factors.In some embodiments, the secondary structure formed by one or more copies of the structural sequence is an aptamer that can bind to target molecules.Exemplary aptamers are known in the art, and include multiple RNA structures that can bind to cell surface receptors, such as CD4, CTLA-4, TGF-β receptors, and receptor tyrosine kinases.See, for example, Germer et al. Int J Biochem Mol Biol., 2013.4(1):27-40.

[0326] In some embodiments, the modified non-coding RNA comprises 1 to 20 copies of a structural sequence. In some embodiments, the modified non-coding RNA comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 copies of a structural sequence. In some embodiments, the modified non-coding RNA comprises about 4 copies of a structural sequence. In some embodiments, the modified non-coding RNA comprises a plurality of different structural sequences. In some embodiments, the modified non-coding RNA comprises at least a first structural sequence and a second structural sequence comprising a nucleic acid sequence different from the first structural sequence. In some embodiments, the modified non-coding RNA comprises at least one G-quadruplex sequence and at least one telomeric repeat sequence.

[0327] In some embodiments of a modified non-coding RNA comprising one or more copies of a structural sequence provided herein, the polyA region of the modified non-coding RNA comprises at least one modified nucleotide. In some embodiments, at least one modified nucleotide comprises a modified nucleobase. In some embodiments, at least one modified nucleotide comprises a modified sugar. In some embodiments, at least one modified nucleotide comprises a modified phosphate. In some embodiments, at least one modified nucleotide comprises a modified nucleobase selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, and 2-thiocytosine. , 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine , 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil,Biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallylura Cytosine, Dabsyl-5-3-aminoallyluracil, Desthiobiotin-16-aminoallyl-uracil, Desthiobiotin-6-aminoallylcytosine, Isoguanine, N1-Ethylpseudouracil, N1-Methoxymethylpseudouracil, N1-Methyladenine, N1-Methylpseudouracil, N1-Propylpseudouracil, N2-Methylguanine, N4-Biotin-OBEA-cytosine, N4-Methylcytosine, N6-Methyladenine, O6-Methylguanine, Pseudoisocytosine, Pseudouracil, Thienocytosine Synthon, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamidouracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, at least one modified nucleotide isThe modified sugars include those selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxyribose, 3'-azido-2',3' -dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In some embodiments, at least one modified nucleotide comprises a 2'-modification. In some embodiments, the 2'-modification is selected from the group consisting of locked nucleic acid (LNA) modifications (i.e., nucleotides containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe). In some embodiments, at least one modified nucleotide comprises a modified phosphate selected from the group consisting of phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, the polyA region of the non-coding RNA comprises at least 3, at least 4, or at least 5 phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least 3 phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments,The polyA region of a non-coding RNA comprises at least three guanine nucleotides and at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least three deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least 20 deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least three copies of a G-quadruplex sequence and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least six nucleotides comprising a 2'-modification and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least six phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least six consecutive nucleotides comprising a 2'-modification and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least six consecutive phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six phosphorothioates and three guanine nucleosides and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and does not contain a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of a telomeric repeat sequence and at least six phosphorothioates and does not contain a 3'-terminal hydroxyl. In some embodiments, the 3'-terminal nucleotide that does not contain a 3'-terminal hydroxyl is dideoxycytidine or inverted deoxythymidine.

[0328] In some embodiments, the modified non-coding RNA comprises more than one type of modified nucleotide. In some embodiments, the modified non-coding RNA comprises at least a first modified nucleoside and a second modified nucleoside having a structure different from the first modified nucleoside. In some embodiments, the modified non-coding RNA comprises at least a first modified phosphate and a second modified phosphate having a structure different from the first modified phosphate. In some embodiments, the modified non-coding RNA comprises a modified nucleoside and a modified nucleoside.

[0329] In some embodiments of the modified non-coding RNA comprising a secondary structure provided herein, the modified non-coding RNA comprises, in 5' to 3' order: 1) a 5' non-coding RNA; 2) a polyA region on or ligated to the 3' end of the non-coding RNA; and 3) one or more copies of a structural sequence. In some embodiments, the one or more copies of the structural sequence and the secondary structure formed by the structural sequence are 3' (downstream) of the polyA region. In some embodiments, the non-coding RNA is a linear non-coding RNA. In some embodiments, the linear non-coding RNA comprises a 5' cap. In some embodiments, the 5' cap comprises a 7-methylguanosine. In some embodiments, the 5' cap comprises one or more phosphates connecting the 7-methylguanosine to adjacent nucleotides of the modified non-coding RNA. In some embodiments, the 7-methylguanosine is connected to adjacent nucleotides of the non-coding RNA by a 5' to 5' triphosphate bridge. In some embodiments, one or more phosphates of the 5' cap are modified phosphates selected from the group consisting of phosphorothioate, triazole ring, dihalogen methylene bisphosphonate, imidodiphosphate, and methylene bis(phosphonate). In some embodiments, the 5' cap comprises 3'-O-Me-m7G(5')ppp(5')G. In some embodiments, the linear non-coding RNA does not comprise a 5' cap. In some embodiments, the polyA region of the non-coding RNA comprises at least three, at least four, or at least five phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three guanine nucleotides and at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least 20 deoxyribose sugars and does not comprise a 3' terminal hydroxyl.In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of a G-quadruplex sequence and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six nucleotides comprising a 2'-modification and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six consecutive nucleotides comprising a 2'-modification and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six consecutive phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six phosphorothioates and three guanine nucleosides and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of the telomeric repeat sequence and at least six phosphorothioates, and does not contain a 3'-terminal hydroxyl. In some embodiments, the 3'-terminal nucleotide that does not contain a 3'-terminal hydroxyl is dideoxycytidine or inverted deoxythymidine.

[0330] In some embodiments of the modified non-coding RNA comprising a secondary structure provided herein, the modified non-coding RNA comprises, in 5' to 3' order: 1) the non-coding RNA; 2) a polyA region on or ligated to the non-coding RNA; and 3) one or more copies of a structural sequence. In some embodiments, the modified non-coding RNA is a circular non-coding RNA. In some embodiments of the circular non-coding RNA, one or more copies of the structural sequence are between the polyA region on or ligated to the non-coding RNA and the 5' nucleotide of the non-coding RNA.

[0331] In some embodiments of the modified non-coding RNAs provided herein, 1% to 90% of the nucleotides in the polyA region are modified nucleotides, hi some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

[0332] In some embodiments of the modified non-coding RNAs provided herein, three or more of the last 25 nucleotides of the polyA region are modified nucleotides, in some embodiments, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, or 25 of the last 25 nucleotides of the polyA region are modified nucleotides.

[0333] In some embodiments of the modified non-coding RNA provided herein, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are adenosine nucleotides. One or more adenosine nucleotides in the polyA region can be a classical adenosine nucleotide or a modified adenosine nucleotide that contains a structure different from that of a classical adenosine nucleotide. Non-limiting examples of modified adenosine nucleotides include: N6-isopentenyladenosine (i6A), 2-methyl-thio-N6-isopentenyladenosine (ms2i6A), 2-methylthio-N6-methyladenosine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenosine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyladenosine (g6A), N6-threonylcarbamoyladenosine (t6A), 2-methylthio-N6-threonylcarbamoyladenosine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenosine (m6t6A), N6-hydroxynorvalylcarbamoylade ...hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (t6A), 2-methylthio-N6-threonylcarbamoyladenosine (ms2t6A), N6-hydroxynorvalylcarbamoyladenosine (m6t6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxynorvalylcarbamoyladenosine (g6A), N6-hydroxy N6,N6-dimethyladenosine (m62A), N6,2'-O-dimethyladenosine (m6Am), N6,N6,O-2'-trimethyladenosine (m62Am), 1-methylthio-N6-hydroxynorvalylcarbamoyladenosine (ms2hn6A), 2'-O-ribosyladenosine (phosphate) (Ar(p)), N6,N6-dimethyladenosine (m62A), N6,2'-O-dimethyladenosine (m6Am), N6,N6,O-2'-trimethyladenosine (m62Am), 1 , 2'-O-dimethyladenosine (m1Am), N6-acetyladenosine (ac6A), 2'-thioadenosine (2'SA), 5'-thioadenosine (5'SA), 2'-O-(2-azidoethyl)-adenosine, 2'-azidoadenosine, deoxyadenosine (dA), dideoxyadenosine (ddA), and aminodeoxyadenosine (aminodA).

[0334] In some embodiments of the modified non-coding RNAs provided herein, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are classical adenosine nucleotides. In some embodiments, the polyA region further comprises one or more nucleotides that are not adenosine nucleotides (e.g., classical or non-classical adenosine nucleotides). In some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 80%, or at least 90% of the nucleotides in the polyA region are nucleotides that are not adenosine nucleotides.

[0335] In some embodiments of the modified non-coding RNAs provided herein, the polyA region comprises at least 25-500 nucleotides. In some embodiments, the polyA region comprises at least 25, at least 30, at least 50, at least 100, at least 150, or at least 200 nucleotides. In some embodiments, the polyA region comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 nucleotides. In some embodiments, the polyA region comprises about 200 to about 300 nucleotides. In some embodiments, the polyA region comprises about 250 nucleotides.

[0336] In some embodiments, the polyA region comprises at least 3, at least 4, or at least 5 phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least three guanine nucleotides and at least three phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least three deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least 20 deoxyribose sugars and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least three copies of a G-quadruplex sequence and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least 6 nucleotides containing 2'-modifications and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of a non-coding RNA comprises at least 6 phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six consecutive nucleotides containing a 2' modification and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six consecutive phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least six phosphorothioates and three guanine nucleosides and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the polyA region of the non-coding RNA comprises at least three copies of a telomeric repeat sequence and at least six phosphorothioates and does not comprise a 3'-terminal hydroxyl. In some embodiments, the 3'-terminal nucleotide without a 3'-terminal hydroxyl is dideoxycytidine or inverted deoxythymidine. Methods for Producing Modified mRNA and Modified Non-coding RNA

[0337] In some aspects, the present disclosure provides a method for producing modified mRNA, comprising ligating RNA, e.g., RNA containing an open reading frame encoding a protein or a non-coding RNA, to a tailing nucleic acid containing one or more modified nucleotides in the presence of a ligase, whereby the ligase forms a covalent bond between the 3' nucleotide of the RNA and the 5' nucleotide of the tailing nucleic acid to produce a modified RNA (e.g., a modified mRNA or a modified non-coding RNA). When the ligase forms a covalent bond between two linear nucleic acids, a new nucleic acid is produced, which contains the nucleic acid sequence of both nucleic acids. Ligation of the 3'-terminal nucleotide of a first nucleic acid to the 5'-terminal nucleotide of a second nucleic acid produces a third nucleic acid, which contains the sequences of the first and second nucleic acids, with the second nucleic acid sequence being 3' (downstream) of the first nucleic acid sequence. Ligation by RNA ligase occurs in several steps. First, the amino (-NH2) group of an amino acid (e.g., lysine) of the ligase binds to the phosphate group of adenosine triphosphate (ATP), resulting in the binding of the adenosine monophosphate (AMP) group to the RNA ligase. Second, the 5'-terminal phosphate of the second nucleic acid replaces the phosphate of the AMP bound to the RNA ligase. Finally, the oxygen of the 3'-terminal hydroxyl group of the first nucleic acid binds to the phosphorus atom of the 5'-terminal phosphate of the second nucleic acid. This final step forms a phosphodiester bond between the terminal nucleotides of the nucleic acids, thereby forming a single nucleic acid with a continuing sugar-phosphate backbone. In some embodiments, the ligase is an RNA ligase. In some embodiments, the RNA ligase is T4 RNA ligase.

[0338] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the RNA to which the tailing nucleic acid is ligated is synthesized by in vitro transcription (IVT). IVT is a process in which RNA, such as precursor mRNA (pre-mRNA), mRNA, or non-coding RNA, is produced by transcription of a DNA template by RNA polymerase. Typically, the DNA template contains a promoter, such as a bacteriophage promoter, upstream of the DNA sequence to be transcribed. RNA polymerase binds to the promoter and begins transcription of the DNA sequence, producing an RNA transcript having the nucleic acid sequence present in the template, except that thymidine (T) nucleotides in the DNA sequence are replaced by uracil (U) nucleotides in the RNA sequence. The RNA transcript produced by IVT can be modified prior to ligation of the tailing nucleic acid, for example, by adding a 5' cap, cleaving one or more nucleotides from the RNA, or polyadenylation to extend the polyA region. In some embodiments, the DNA template contains a polyA region, such that IVT produces an mRNA or non-coding RNA having a polyA region. See, for example, Becker et al. Methods Mol Biol., 2011. 703: 29-41.

[0339] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the 3' nucleotide of the RNA contains a 3'-terminal hydroxyl group, and the 5' nucleotide of the tailing nucleic acid contains a 5'-terminal phosphate group. The combination of a 3'-terminal hydroxyl group on the RNA and a 5'-terminal phosphate group on the tailing nucleic acid allows for efficient ligation of the two nucleic acids. In some embodiments, the RNA does not contain a 5'-terminal phosphate group. The RNA may lack a 5'-terminal phosphate group due to the addition of a 5'-cap or another chemical modification. The 5'-terminal phosphate can also be removed from the RNA by a phosphatase enzyme to produce an RNA lacking a 5'-terminal phosphate. The lack of a 5'-terminal phosphate group on the RNA prevents RNA ligase from ligating multiple copies of the mRNA or non-coding RNA together. In some embodiments, the tailing nucleic acid does not contain a 3'-terminal hydroxyl group. If the last nucleotide of the tailing nucleic acid contains a modified nucleotide that does not contain a 3' hydroxyl group, such as dideoxyadenosine, dideoxycytidine, dideoxyguanosine, dideoxythymidine, or inverted deoxythymidine, the RNA may lack a 3' hydroxyl group. The lack of a 3' hydroxyl group on the tailing nucleic acid prevents RNA ligase from ligating multiple tailing nucleic acids together. In some embodiments, the 5' nucleotide of the RNA does not contain a 5' phosphate group; the 3' nucleotide of the RNA contains a 3' hydroxyl group; the 5' nucleotide of the tailing nucleic acid contains a 5' phosphate group; and the 3' nucleotide of the tailing nucleic acid does not contain a 3' hydroxyl group. In some embodiments, the tailing nucleic acid contains at least three, at least four, or at least five phosphorothioates and does not contain a 3' hydroxyl group. In some embodiments, the tailing nucleic acid contains at least three phosphorothioates and does not contain a 3' hydroxyl group. In some embodiments, the tailing nucleic acid comprises at least three guanine nucleotides and at least three phosphorothioates and does not have a 3' terminal hydroxyl.In some embodiments, the tailing nucleic acid comprises at least three deoxyribose sugars and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least 20 deoxyribose sugars and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least three copies of a G-quadruplex sequence and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least six nucleotides comprising a 2'-modification and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least six phosphorothioates and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least six consecutive nucleotides comprising a 2'-modification and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least six consecutive phosphorothioates and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least six phosphorothioates and three guanine nucleosides and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and no 3'-terminal hydroxyl. In some embodiments, the tailing nucleic acid comprises at least three copies of the telomeric repeat sequence and at least six phosphorothioates, and does not contain a 3'-terminal hydroxyl. In some embodiments, the 3'-terminal nucleotide that does not contain a 3'-terminal hydroxyl is dideoxycytidine or inverted deoxythymidine. In some embodiments, the ligase used to ligate the tailing nucleic acid to RNA is an RNA ligase. In some embodiments, the RNA ligase is T4 RNA ligase. In some embodiments, the T4 RNA ligase is T4 RNA ligase 1. In some embodiments, the T4 RNA ligase is T4 RNA ligase 2.

[0340] In some embodiments of the methods of producing modified mRNA or modified non-coding RNA provided herein, the 5' nucleotide of the RNA does not comprise a 5'-terminal hydroxyl group, the 3' nucleotide of the RNA comprises a 3'-terminal phosphate group, the 5' nucleotide of the tailing nucleic acid comprises a 5'-terminal hydroxyl group, the 3' nucleotide of the tailing nucleic acid does not comprise a 3'-terminal phosphate group, and the RNA ligase is RtcB ligase, which ligates a first nucleotide comprising a 3'-terminal phosphate group to a second nucleotide comprising a 5'-terminal hydroxyl group.

[0341] Some embodiments of the methods for making modified mRNA or modified non-coding RNA provided herein further include producing a circular mRNA or circular non-coding RNA. After a linear modified mRNA or modified non-coding RNA is produced by ligating an RNA and a tailing nucleic acid, circularizing the modified mRNA or modified non-coding RNA involves several additional steps. First, a 5'-terminal phosphate is introduced to the first nucleotide of the modified mRNA or modified non-coding RNA, a process known as phosphorylation. In some embodiments, the 5'-terminal phosphate is introduced by a kinase. A "kinase" refers to an enzyme that introduces a phosphate group to a molecule, forming a covalent bond between the phosphate group and the molecule, in a process known as "phosphorylation." Second, the modified mRNA or modified non-coding RNA is engineered to produce a modified mRNA or modified non-coding RNA with a 3'-terminal hydroxyl group. In some embodiments, modified mRNAs or modified non-coding RNAs are engineered by cleaving one or more of the last nucleotides of the modified RNA to produce modified mRNAs or modified non-coding RNAs with a 3'-terminal hydroxyl group. In some embodiments, the modified mRNAs or modified non-coding RNAs are cleaved by a restriction enzyme, ribozyme, or endoribonuclease. In some embodiments, cleavage of the last one or more nucleotides of the modified mRNAs or modified non-coding RNAs occurs before phosphorylation of the first nucleotide of the modified RNA. In some embodiments, cleavage occurs after phosphorylation. Modified mRNAs or modified non-coding RNAs containing a terminal phosphate group on one end and a terminal hydroxyl group on the other end can be circularized by ligation of both terminal nucleotides. An RNA ligase that ligates the terminal nucleotides of a linear nucleic acid to produce a circular nucleic acid can be referred to as a "circularization ligase." In some embodiments, the circularization ligase is an RNA ligase. In some embodiments, the circularization ligase is a SplintR ligase. In some embodiments, the circularizing ligase is T4 RNA ligase.In some embodiments, the circularization ligase is T4 RNA ligase 1. In some embodiments, the circularization ligase is T4 RNA ligase 2. In some embodiments, the modified mRNA or modified non-coding RNA comprises a 5'-terminal hydroxyl group and a 3'-terminal phosphate group, and the circularization ligase is RtcB ligase, which can ligate nucleotides having a 3'-terminal phosphate and a 5'-terminal hydroxyl group. For ligation to occur, the 5'- and 3'-terminal nucleotides of the modified mRNA or modified non-coding RNA must be close enough for the RNA ligase to form a bond between both nucleotides. Methods for positioning both nucleotides of a linear nucleic acid close enough for ligation to occur and circularizing RNA are generally known in the art (see, for example, Petkovic et al., Nucleic Acids Res., 2015. 43(4): 2454-2465). In some embodiments, the modified mRNA or modified non-coding RNA is incubated with a backbone nucleic acid that can hybridize (hydrogen bond) to the modified RNA, such that the modified mRNA or modified non-coding RNA forms a circular secondary structure when hybridized (bound) to the backbone nucleic acid.

[0342] When RNA forms a circular secondary structure, the 5' and 3' terminal nucleotides are in close physical proximity. This is required for RNA ligase to form a covalent bond between them. In some embodiments of the method for circularizing mRNA or non-coding RNA, one or more of the last nucleotides of the RNA are bound to a first hybridization sequence on the backbone nucleic acid, and one or more of the first nucleotides of the mRNA or non-coding RNA are bound to a second hybridization sequence on the backbone nucleic acid 3' (downstream) of the first hybridization sequence. In some embodiments, the first hybridization sequence comprises five or more nucleotides, and the first hybridization sequence is complementary to at least the first five (5) nucleotides of the modified mRNA or modified non-coding RNA. In some embodiments, the first hybridization sequence comprises 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, or 50 or more nucleotides, and at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or up to 100% of the nucleotides of the first hybridization sequence are complementary to the last N nucleotides of the modified mRNA or modified non-coding RNA, where N is the length of the first hybridization sequence. In some embodiments, the second hybridization sequence comprises 5 or more nucleotides, and the second hybridization sequence is complementary to at least the last five (5) nucleotides of the modified mRNA or modified non-coding RNA. In some embodiments, the second hybridization sequence comprises 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, or 50 or more nucleotides, and at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or up to 100% of the nucleotides of the second hybridization sequence are complementary to the last N nucleotides of the modified mRNA or modified non-coding RNA, where N is the length of the second hybridization sequence.In some embodiments, at least the first five (5) nucleotides of the modified mRNA or modified non-coding RNA hybridize with a first hybridization sequence. In some embodiments, at least the last five (5) nucleotides of the modified mRNA or modified non-coding RNA hybridize with a second hybridization sequence. In some embodiments, at least the first five (5) nucleotides of the modified mRNA or modified non-coding RNA hybridize with a first hybridization sequence, and at least the last five (5) nucleotides of the modified mRNA or modified non-coding RNA hybridize with a second hybridization sequence. In some embodiments, the last nucleotide of the first hybridization sequence and the first nucleotide of the second hybridization sequence are adjacent on the backbone nucleic acid and are not separated by any other nucleotides.

[0343] In some embodiments of the methods for producing circular RNA provided herein, no backbone nucleic acid is used to promote the formation of a circular secondary structure by the modified mRNA or modified non-coding RNA. Instead, the modified mRNA or modified non-coding RNA comprises a first hybridization sequence at the 5' end that is complementary to a second hybridization sequence at the 3' end. In some embodiments, each hybridization sequence comprises at least five (5) nucleotides. In some embodiments, each hybridization sequence comprises at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotides.

[0344] In some embodiments of the methods for producing circular RNA provided herein, the modified mRNA or modified non-coding RNA is not circularized using a backbone nucleic acid and a circularization ligase, but rather is circularized by a nucleic acid ribozyme that catalyzes a reaction such as the formation of a covalent bond between two nucleotides. In some embodiments, prior to circularization, the modified mRNA or modified non-coding RNA includes a 3' intron located 5' (upstream) of the 5' UTR of the mRNA or the first nucleotide of the non-coding mRNA, and a 5' intron located 3' (downstream) of the polyA region and / or one or more structural sequences of the mRNA or non-coding RNA. Ribozymes and other enzymes that catalyze splicing of pre-mRNA to remove introns can catalyze the formation of a covalent bond between the nucleotide 5' of the 5' intron and the nucleotide 3' of the 3' intron, resulting in the formation of a circular mRNA or non-coding RNA. See, for example, Wesselhoeft et al., Nat Commun. 2018.9:2629.

[0345] In some embodiments of the method for producing circular RNA provided herein, modified mRNA or modified non-coding RNA is not circularized by using a backbone nucleic acid, but rather by using a complementary sequence that promotes the formation of a secondary structure with mRNA of non-coding RNA, closely positioning the 5' and 3' terminal nucleotides of mRNA or non-coding RNA. In some embodiments, prior to circularization, the modified mRNA comprises: (i) a first self-hybridization sequence located 5' of the open reading frame or 5' of the non-coding RNA; (ii) a second self-hybridization sequence located 3' of the open reading frame or 3' of the non-coding RNA; (iii) a first non-hybridization sequence located 5' of the first self-hybridization sequence; and (iv) a second non-hybridization sequence located 3' of the second self-hybridization sequence. The first and second self-hybridization sequences can hybridize with each other, but the first and second self-hybridization sequences cannot hybridize with each other. In some embodiments, the hybridization of the first and second self-hybridizing sequences forms a secondary structure, in which the 5'-terminal nucleotide and the 3'-terminal nucleotide of the modified mRNA or modified non-coding RNA are spaced apart by a distance of less than 100 Å. In some embodiments, the 5'-terminal nucleotide and the 3'-terminal nucleotide are spaced apart by a distance of less than 90 Å, less than 80 Å, less than 70 Å, less than 60 Å, less than 50 Å, less than 40 Å, less than 30 Å, less than 20 Å, or less than 10 Å. See, for example, Carmona, Ellese Marie. 2019. Circular RNA: Design Criteria for Optimal Therapeutic Utility. Ph.D. dissertation, Harvard University, Graduate School of Letters and Science; Petkovic et al. Nucleic Acids Res., 2015. 43(4):2454-2465; and WO2020 / 237227.

[0346] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the modified mRNA or modified non-coding RNA produced by the method comprises one or more copies of a structural sequence 3' of the polyA region of the mRNA or non-coding RNA. In some embodiments, the tailing nucleic acid comprises one or more copies of the structural sequence. In some embodiments, the nucleotides of the structural sequence interact by hydrogen bonds. In some embodiments, the secondary structure is a G-quadruplex. In some embodiments, the structural sequence is a G-quadruplex sequence. In some embodiments, the G-quadruplex sequence comprises one or more spacer nucleotides that are not guanine nucleotides. In some embodiments, the G-quadruplex sequence is an RNA G-quadruplex sequence. In some embodiments, the RNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 2). In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the G-quadruplex sequence is a DNA G-quadruplex sequence. In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 3). In some embodiments, the tailing nucleic acid comprises at least three copies of the G-quadruplex sequence of SEQ ID NO: 3. In some embodiments, the structural sequence comprises a telomere repeat sequence. In some embodiments, the telomere repeat sequence comprises the nucleic acid sequence presented as one of SEQ ID NOs: 4 or 5 (TAGGGT or TACCCT, respectively). In some embodiments, the telomere repeat sequence comprises the nucleic acid sequence presented as SEQ ID NO: 4. In some embodiments, the tailing nucleic acid comprises at least three copies of the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the structural sequence is an aptamer sequence comprising at least two nucleotides that can interact to form an aptamer. In some embodiments, the secondary structure formed by one or more copies of the structural sequence is an aptamer that can bind to a target molecule. The formation of an aptamer by an mRNA or non-coding RNA allows the mRNA or non-coding RNA to localize to a given region of a cell that contains a target molecule, such as a receptor.

[0347] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, the modified mRNA or modified non-coding RNA comprises 1 to 20 copies of a structural sequence. In some embodiments, the modified mRNA or modified non-coding RNA comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 copies of a structural sequence. In some embodiments, the modified mRNA or modified non-coding RNA comprises about 4 copies of a structural sequence. In some embodiments, the modified mRNA or modified non-coding RNA comprises multiple different structural sequences. In some embodiments, the modified mRNA or modified non-coding RNA comprises at least a first structural sequence and a second structural sequence comprising a nucleic acid sequence different from the first structural sequence.

[0348] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, the polyA region of the modified mRNA or modified non-coding RNA comprises at least one modified nucleotide. In some embodiments, the tailing nucleic acid comprises at least one modified nucleotide. In some embodiments, at least one modified nucleotide comprises a modified nucleobase. In some embodiments, at least one modified nucleotide comprises a modified sugar. In some embodiments, at least one modified nucleotide comprises a modified phosphate. In some embodiments, the at least one modified nucleotide comprises a modified nucleobase selected from the group consisting of xanthine, allylaminouracil, allylaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5- Carboxymethyl ester uracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine, 5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine,8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil , cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil, desthiobiotin-16-aminoallyl-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine Adenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine, 2,6-diamino(damino)guanine, 5-carboxamido-uracil, 5-ethynyluracil, N6-isopentenyladenine (i6A), 2-methyl-thio-N6-isopentenyladenine (ms2i6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2- Methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyladenine (g6A), N6-threonylcarbamoyladenine (t6A), 2-methylthio-N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A),and N6-acetyladenine (ac6A). In some embodiments, at least one modified nucleotide comprises a modified sugar selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'-deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxy ribose, 3'-azido-2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In some embodiments, at least one modified nucleotide comprises a 2' modification. In some embodiments, the 2' modification is selected from the group consisting of: locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe). In some embodiments, at least one modified nucleotide comprises a modified phosphate selected from the group consisting of: phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate, guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate. In some embodiments, the polyA region of the mRNA or non-coding RNA comprises at least 3, at least 4, or at least 5 phosphorothioates and does not comprise a 3' terminal hydroxyl.The polyA region of an mRNA or non-coding RNA comprises at least three phosphorothioates and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least three guanine nucleotides and at least three phosphorothioates and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least three deoxyribose sugars and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least 20 deoxyribose sugars and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least three copies of a G-quadruplex sequence and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least six nucleotides containing 2'-modifications and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least six phosphorothioates and no 3'-terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least six consecutive nucleotides containing a 2' modification and does not comprise a 3' terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least six consecutive phosphorothioates and does not comprise a 3' terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least six phosphorothioates and three guanine nucleosides and does not comprise a 3' terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least three copies of a G-quadruplex sequence and at least six phosphorothioates and does not comprise a 3' terminal hydroxyl. In some embodiments, the polyA region of an mRNA or non-coding RNA comprises at least three copies of a telomeric repeat sequence and at least six phosphorothioates and does not comprise a 3' terminal hydroxyl. In some embodiments, the 3' terminal nucleotide without a 3' terminal hydroxyl is dideoxycytidine or inverted deoxythymidine.

[0349] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, the modified mRNA or modified non-coding RNA comprises more than one type of modified nucleotide. In some embodiments, the modified mRNA or modified non-coding RNA comprises at least a first modified nucleoside and a second modified nucleoside having a structure different from the first modified nucleoside. In some embodiments, the modified mRNA or modified non-coding RNA comprises at least a first modified phosphate and a second modified phosphate having a structure different from the first modified phosphate. In some embodiments, the modified mRNA or modified non-coding RNA comprises a modified nucleoside and a modified nucleoside.

[0350] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, 1% to 90% of the nucleotides in the polyA region are modified nucleotides, hi some embodiments, at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

[0351] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, three or more of the last 25 nucleotides of the polyA region are modified nucleotides, in some embodiments, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, or 25 of the last 25 nucleotides of the polyA region are modified nucleotides.

[0352] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are adenosine nucleotides. One or more adenosine nucleotides in the polyA region can be a classical adenosine nucleotide or a modified adenosine nucleotide that contains a structure different from that of a classical adenosine nucleotide.

[0353] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides in the polyA region are classical adenosine nucleotides.

[0354] In some embodiments of the modified mRNA or modified non-coding RNA produced by the methods provided herein, the polyA region comprises at least 25-500 nucleotides. In some embodiments, the polyA region comprises at least 25, at least 30, at least 50, at least 100, at least 150, or at least 200 nucleotides. In some embodiments, the polyA region comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 nucleotides. In some embodiments, the polyA region comprises from about 200 to about 300 nucleotides. In some embodiments, the polyA region comprises about 250 nucleotides.

[0355] In some embodiments of the methods for producing modified mRNA provided herein, the RNA comprises an open reading frame and a polyA region prior to ligation of the tailing nucleic acid. In some embodiments of the methods for producing modified non-coding RNA provided herein, the RNA comprises a non-coding RNA prior to ligation of the tailing nucleic acid, and may or may not comprise a polyA region prior to ligation of the tailing nucleic acid. In some embodiments, the polyA region of the RNA comprises at least 25-500 nucleotides prior to ligation of the tailing nucleic acid. In some embodiments, the polyA region comprises at least 25, at least 30, at least 50, at least 100, at least 150, or at least 200 nucleotides. In some embodiments, the polyA region comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 nucleotides. In some embodiments, the polyA region comprises from about 200 to about 300 nucleotides. In some embodiments, the polyA region comprises about 250 nucleotides.

[0356] In some embodiments, prior to ligation of the tailing nucleic acid, the tailing nucleic acid comprises at least 10-500 nucleotides. In some embodiments, the tailing nucleic acid comprises at least 10, at least 15, at least 20, at least 25, at least 30, at least 50, at least 100, at least 150, or at least 200 nucleotides. In some embodiments, the tailing nucleic acid comprises at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or at least 200 nucleotides. In some embodiments, the polyA region comprises from about 10 to about 50 nucleotides.

[0357] In some embodiments of the methods for producing modified mRNA provided herein, prior to ligation of the tailing nucleic acid, the RNA comprises, in 5' to 3' order, a 5'UTR, an open reading frame, a 3'UTR, and a polyA region. In some embodiments, the open reading frame is between the 5'UTR and the 3'UTR. In some embodiments, the 3'UTR is between the open reading frame and the polyA region.

[0358] In some embodiments of the methods of producing a modified non-coding RNA provided herein, prior to ligation of the tailing nucleic acid, the RNA comprises, in 5' to 3' order, the non-coding RNA and optionally a polyA region. In some embodiments, the first nucleotide of the polyA region is 3' to the last nucleotide of the non-coding RNA. In some embodiments, prior to ligation of the tailing nucleic acid, the non-coding RNA does not comprise a polyA tail. Thus, in some embodiments, the tailing nucleic acid comprises a polyA region as described herein that is added to the 3' end of the non-coding RNA by ligating the tailing nucleic acid to the 3' end of the non-coding RNA, thereby producing a modified non-coding RNA that comprises a polyA region.

[0359] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the RNA does not include a 5' cap prior to ligation of the tailing nucleic acid. In some embodiments, the 5' cap includes a 7-methylguanosine. In some embodiments, the 5' cap includes one or more phosphates connecting the 7-methylguanosine to adjacent nucleotides of the RNA. In some embodiments, the 5' cap is added after ligation of the tailing nucleic acid. In some embodiments, the RNA does not include a 5' cap prior to ligation of the tailing nucleic acid (e.g., the RNA is an mRNA or non-coding RNA that does not include a 5' cap).

[0360] In some aspects of the methods for producing modified mRNA or modified non-coding RNA provided herein, which comprise ligating a tailing nucleic acid to an mRNA or non-coding RNA, the tailing nucleic acid comprises one or more modified nucleotides. In some embodiments, the tailing nucleic acid comprises at least one modified nucleotide comprising a modified nucleoside. In some embodiments, the at least one modified nucleotide comprises a modified nucleoside comprising a modified nucleobase and / or a modified sugar. In some embodiments, the at least one modified nucleotide comprises a modified nucleoside comprising a modified nucleobase and a modified sugar. In some embodiments, the at least one modified nucleotide comprises a modified nucleobase. In some embodiments, the at least one modified nucleotide comprises a modified sugar. In some embodiments, the at least one modified nucleotide comprises a modified phosphate. In some embodiments, the at least one modified nucleotide comprises a modified nucleobase selected from the group consisting of xanthine, aliaminouracil, aliaminothymidine, hypoxanthine, digoxigenylated adenine, digoxigenylated cytosine, digoxigenylated guanine, digoxigenylated uracil, 6-chloropurine riboside, N6-methyladenine, methylpseudouracil, 2-thiocytosine, 2-thiouracil, 5-methyluracil, 4-thiothymidine, 4-thiouracil, 5,6-dihydro-5-methyluracil, 5,6-dihydrouracil, 5-[(3-indolyl)propanol]- propionamido-N-allyl]uracil, 5-aminoallylcytosine, 5-aminoallyluracil, 5-bromouracil, 5-bromocytosine, 5-carboxycytosine, 5-carboxymethylesteruracil, 5-carboxyuracil, 5-fluorouracil, 5-formylcytosine, 5-formyluracil, 5-hydroxycytosine, 5-hydroxymethylcytosine, 5-hydroxymethyluracil, 5-hydroxyuracil, 5-iodocytosine, 5-iodouracil, 5-methoxycytosine, 5-methoxyuracil, 5-methylcytosine, 5-methyluracil, 5-propargylaminocytosine,5-propargylaminouracil, 5-propynylcytosine, 5-propynyluracil, 6-azacytosine, 6-azauracil, 6-chloropurine, 6-thioguanine, 7-deazaadenine, 7-deazaguanine, 7-deaza-7-propargylaminoadenine, 7-deaza-7-propargylaminoguanine, 8-azaadenine, 8-azidoadenine, 8-chloroadenine, 8-oxoadenine, 8-oxoguanine, araadenine, aracytosine, araguanine, arauracil, biotin-16-7-deaza-7-propargylaminoguanine, Biotin-16-aminoallylcytosine, biotin-16-aminoallyluracil, cyanine 3-5-propargylaminocytosine, cyanine 3-6-propargylaminouracil, cyanine 3-aminoallylcytosine, cyanine 3-aminoallyluracil, cyanine 5-6-propargylaminocytosine, cyanine 5-6-propargylaminouracil, cyanine 5-aminoallylcytosine, cyanine 5-aminoallyluracil, cyanine 7-aminoallyluracil, dabsyl-5-3-aminoallyluracil, desthiobiotin-16-aminoallyl 1-uracil, desthiobiotin-6-aminoallylcytosine, isoguanine, N1-ethylpseudouracil, N1-methoxymethylpseudouracil, N1-methyladenine, N1-methylpseudouracil, N1-propylpseudouracil, N2-methylguanine, N4-biotin-OBEA-cytosine, N4-methylcytosine, N6-methyladenine, O6-methylguanine, pseudoisocytosine, pseudouracil, thienocytosine, thienoguanine, thienouracil, xanthosine, 3-deazaadenine, 2,6-diaminoadenine , 2,6-diamino (damino) guanine, 5-carboxamido-uracil, 5-ethynyluracil, N6-isopentenyl adenine (i6A), 2-methyl-thio-N6-isopentenyl adenine (ms2i6A), 2-methylthio-N6-methyl adenine (ms2m6A), N6-(cis-hydroxyisopentenyl) adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl) adenine (ms2io6A), N6-glycinylcarbamoyl adenine (g6A), N6-threonylcarbamoyl adenine (t6A),2-methylthio-N6-threonylcarbamoyladenine (ms2t6A), N6-methyl-N6-threonylcarbamoyladenine (m6t6A), N6-hydroxynorvalylcarbamoyladenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyladenine (ms2hn6A), N6,N6-dimethyladenine (m62A), and N6-acetyladenine (ac6A). In some embodiments, at least one modified nucleotide comprises a modified sugar selected from the group consisting of 2'-thioribose, 2',3'-dideoxyribose, 2'-amino-2'-deoxyribose, 2'deoxyribose, 2'-azido-2'-deoxyribose, 2'-fluoro-2'-deoxyribose, 2'-O-methylribose, 2'-O-methyldeoxyribose, 3'-amino-2',3'-dideoxy ribose, 3'-azido-2',3'-dideoxyribose, 3'-deoxyribose, 3'-O-(2-nitrobenzyl)-2'-deoxyribose, 3'-O-methylribose, 5'-aminoribose, 5'-thioribose, 5-nitro-1-indolyl-2'-deoxyribose, 5'-biotin-ribose, 2'-O,4'-C-methylene-linked, 2'-O,4'-C-amino-linked ribose, and 2'-O,4'-C-thio-linked ribose. In some embodiments, at least one modified nucleotide comprises a 2' modification. In some embodiments, the 2' modification is selected from the group consisting of: locked nucleic acid (LNA) modification (i.e., a nucleotide containing an additional carbon atom attached to the 2' oxygen and 4' carbon of ribose), 2'-fluoro (2'-F), 2'-O-methoxyethyl (2'-MOE), and 2'-O-methylated (2'-OMe). In some embodiments, at least one modified nucleotide comprises a modified phosphate selected from the group consisting of: phosphorothioate (PS), phosphorodithioate, thiophosphate, 5'-O-methylphosphonate, 3'-O-methylphosphonate, 5'-hydroxyphosphonate, hydroxyphosphate, phosphoroselenoate, selenophosphate, phosphoramidate, carbophosphonate, methylphosphonate, phenylphosphonate, ethylphosphonate, H-phosphonate,Guanidinium ring, triazole ring, boranophosphate (BP), methylphosphonate, and guanidinopropyl phosphoramidate.

[0361] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the tailing nucleic acid comprises more than one type of modified nucleotide. In some embodiments, the tailing nucleic acid comprises at least a first modified nucleoside and a second modified nucleoside having a structure different from the first modified nucleoside. In some embodiments, the tailing nucleic acid comprises at least a first modified phosphate and a second modified phosphate having a structure different from the first modified phosphate. In some embodiments, the tailing nucleic acid comprises a modified nucleoside and a modified nucleoside.

[0362] In some embodiments, 1% to 90% of the nucleotides of the tailing nucleic acid are modified nucleotides. In some embodiments, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides of the tailing nucleic acid are modified nucleotides. In some embodiments, three or more of the last 25 nucleotides of the tailing nucleic acid are modified nucleotides. In some embodiments, at least 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 of the last 25 nucleotides of the tailing nucleic acid are modified nucleotides.

[0363] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the tailing nucleic acid comprises one or more structural sequences. In some embodiments, the tailing nucleic acid comprises one or more copies of a G-quadruplex sequence. In some embodiments, the G-quadruplex sequence is an RNA G-quadruplex sequence. In some embodiments, the RNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 2). In some embodiments, the G-quadruplex sequence is a DNA G-quadruplex sequence. In some embodiments, the DNA G-quadruplex sequence comprises the nucleic acid sequence GGGGCC (SEQ ID NO: 3). In some embodiments, the tailing nucleic acid comprises one or more copies of a telomeric repeat sequence. In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence set forth in one of SEQ ID NOs: 4 or 5 (TAGGGT or TACCCT, respectively). In some embodiments, the telomeric repeat sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 4. In some embodiments, the structural sequence is an aptamer sequence comprising at least two nucleotides that can interact to form an aptamer. In some embodiments, the secondary structure formed by one or more copies of the structural sequence is an aptamer capable of binding to a target molecule.

[0364] In some embodiments of the methods for producing modified mRNA or modified non-coding RNA provided herein, the tailing nucleic acid comprises 1 to 20 copies of the structural sequence. In some embodiments, the tailing nucleic acid comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 copies of the structural sequence. In some embodiments, the tailing nucleic acid comprises about 4 copies of the structural sequence. In some embodiments, the tailing nucleic acid comprises a plurality of different structural sequences. In some embodiments, the tailing nucleic acid comprises at least a first structural sequence and a second structural sequence comprising a nucleic acid sequence different from the first structural sequence. Each of the different first and second structural sequences can be either a structural sequence provided herein or a different sequence. In further embodiments, the methods for producing modified mRNA or modified non-coding RNA also relate to methods for isolating (e.g., purifying, concentrating) the modified mRNA or modified non-coding RNA provided herein. In some embodiments, a method for isolating (e.g., purifying, concentrating) a modified mRNA or modified non-coding RNA comprises contacting a mixture (e.g., a ligation mixture) containing the modified mRNA or modified non-coding RNA with a purification medium, wherein the modified mRNA or modified non-coding RNA interacts with the purification medium to form a modified RNA-purification medium conjugate. In some embodiments, the purification medium that has formed the modified RNA-purification medium conjugate is separated from the mixture by means of one or more physical or chemical properties, for example, but not limited to, size (mass) or charge. In some embodiments, the modified mRNA or modified non-coding RNA is eluted from the purification medium (i.e., separated from the purification medium) by treating the modified RNA-purification medium conjugate with a solvent. In some embodiments, the solvent is an aqueous solvent (e.g., water). In certain embodiments, the solvent is a mixture of two or more (e.g., three) solvents.In certain embodiments, the solvent is a mixture of water and an organic solvent (e.g., acetonitrile, methanol, ethanol, tetrahydrofuran). In certain embodiments, the solvent further comprises a mobile phase modifier. In certain embodiments, the mobile phase modifier is an acid (e.g., trifluoroacetic acid, acetic acid, formic acid, phosphoric acid), a base (ammonia, ammonium hydroxide, ammonium bicarbonate), or a salt (phosphate, acetate, citrate, ammonium formate, or borate). In some embodiments, the purification medium is a solid purification medium. In some embodiments, the purification medium comprises beads. In some embodiments, the purification medium comprises a resin. In some embodiments, the purification medium comprises paramagnetic beads. Examples of purification media suitable for purifying RNA are well known to those of skill in the art and include, for example, various commercially available purification media (see, e.g., #A63987 from Beckman Coulter Life Sciences). In certain embodiments, the steps described in this paragraph are performed at a temperature between 0 and 20°C, between 20 and 25°C, between 25 and 36°C, or between 36 and 38°C, inclusive. In certain embodiments, the steps described in this paragraph are carried out at a pressure between 0.9 and 1.1 atm, inclusive. Compositions Comprising Modified mRNA or Modified Non-coding RNA and Methods of Use

[0365] In some aspects, the present disclosure provides a composition comprising any one of the modified mRNAs or modified non-coding RNAs provided herein. In some embodiments, the modified mRNA or modified non-coding RNA is produced by any of the methods provided herein, including ligating a tailing nucleic acid to the RNA. Compositions comprising the modified mRNA are useful for delivering the modified mRNA to cells to vaccinate a subject against a foreign antigen or to express a therapeutic protein for treating a condition or disorder. Compositions comprising the modified non-coding RNA are useful for regulating the expression of genes in a cell or subject or editing the genome of a cell or subject, and can be used to treat a condition or disorder. Compositions comprising the modified mRNA or modified non-coding RNA are also useful for exerting a desired effect in a subject in the absence of disease, for example, for agricultural use. For example, mRNAs encoding biological pesticides or growth enhancers, or non-coding RNAs for genome editing, can be used to regulate growth in a manner that increases plant resistance to pests or increases crop yield, respectively. Any of the modified mRNAs or modified non-coding RNAs or compositions thereof described herein can be used to improve the delivery and / or stability of mRNAs or modified non-coding RNAs to plants or plant cells, and can be used to enhance techniques for plant genome engineering that are well established in the art. See, e.g., Stoddard, et al. PLoS One. 2016; 11(5): e0154634.

[0366] In some embodiments, the open reading frame of an mRNA is codon-optimized for expression in a target cell. As used herein, "codon-optimized" refers to the preferential use of codons that are more efficiently translated in a cell. Multiple codons can encode the same amino acid, and the translation rate and efficiency of each codon are determined by several factors, such as the intracellular concentration of aminoacyl-tRNAs containing complementary anticodons. Codon optimization of a nucleic acid sequence can involve replacing one or more codons with a codon that encodes the same amino acid as the replaced codon but is translated more efficiently. For example, the amino acid threonine (Thr) can be encoded by ACA, ACC, ACG, or ACT (ACU in RNA), but in mammalian host cells, ACC is the most commonly used codon; in other species, a different Thr codon may be preferred for codon optimization. An mRNA with a codon-optimized open reading frame is therefore expected to be translated more efficiently and produce more polypeptides in a given amount of time than an mRNA with an open reading frame that is not codon-optimized. In some embodiments, the open reading frame is codon-optimized for expression in human cells.

[0367] In some embodiments of the modified mRNA provided herein, the open reading frame encodes an antigen or therapeutic protein. As used herein, a "therapeutic protein" refers to a protein that, when expressed in a subject, such as a human subject, having or at risk of developing a disease or disorder, prevents, reduces, or alleviates one or more signs or symptoms of the disease. The therapeutic protein can be an essential enzyme or transcription factor encoded by a gene that is mutated in the subject. For example, IPEX syndrome in humans is caused by a mutation in the FOXP3 gene, which disrupts the development of FOXP3+ regulatory T cells and leads to increased susceptibility to autoimmune and inflammatory disorders. Expression of an essential enzyme or transcription factor from an mRNA can thus compensate for the mutation in the gene encoding the enzyme or transcription factor in the subject. As used herein, an "antigen" refers to a molecule (e.g., a protein) that, when expressed in a subject, elicits the production of antibodies that bind to the antigen in the subject. In some embodiments, the antigen is a protein derived from a virus (a viral antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a bacterium (a bacterial antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a protozoan (protozoan antigen) or a fragment thereof. In some embodiments, the antigen is a protein derived from a fungus (fungal antigen) or a fragment thereof. A fragment of a full-length protein refers to a protein having an amino acid sequence that is present in but shorter than the amino acid sequence of the full-length protein.

[0368] In some aspects, the present disclosure provides lipid nanoparticles containing any of the modified mRNAs or modified non-coding RNAs provided herein. Lipid nanoparticles refer to compositions containing one or more lipids that form enclosed structures or lipid aggregates having an inner surface and an outer surface. Lipids used in formulating lipid nanoparticles for delivering mRNAs or non-coding RNAs are generally known in the art and include ionizable amino lipids, non-cationic lipids, sterols, and polyethylene glycol (PEG)-modified lipids. See, for example, Buschmann et al. Vaccines. 2021. 9(1): 65. In some embodiments, the modified mRNA or non-coding RNA is surrounded by the lipids of the lipid nanoparticle and present inside the lipid nanoparticle. In some embodiments, the mRNA or non-coding RNA is dispersed within the lipids of the lipid nanoparticle. In some embodiments, the lipid nanoparticles contain ionizable amino lipids, non-cationic lipids, sterols, and / or polyethylene glycol (PEG)-modified lipids.

[0369] In some aspects, the present disclosure provides a cell comprising any of the modified mRNAs or modified non-coding RNAs provided herein. In some embodiments, the cell is a human cell comprising any of the modified mRNAs or modified non-coding RNAs provided herein. A "cell" is the basic structural and functional unit of all known free-living organisms. It is the smallest unit of life classified as a living organism. Some organisms, such as most bacteria, are unicellular (consisting of a single cell). Other organisms, such as plants, fungi, and animals, including cows, horses, chickens, turkeys, sheep, pigs, dogs, cats, and humans, are multicellular. In some embodiments, the half-life of the modified mRNA or modified non-coding RNA in the cell is between 15 and 900 minutes. In some embodiments, the half-life of the modified mRNA or modified non-coding RNA in the cell is between 30 and 600 minutes. In some embodiments, the half-life of the modified mRNA or modified non-coding RNA in the cell is between 60 and 300 minutes. In some embodiments, the half-life of the modified mRNA or modified non-coding RNA is at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or at least 60 minutes. In some embodiments, the half-life of the modified mRNA or modified non-coding RNA in a cell is at least 30, at least 60, at least 90, at least 120, at least 150, at least 180, at least 210, at least 240, at least 270, at least 300, at least 330, at least 360, at least 390, at least 420, at least 450, at least 480, at least 510, at least 540, at least 570, at least 600, at least 630, at least 660, at least 690, at least 720, at least 750, at least 780, at least 810, at least 840, or at least 870 minutes.

[0370] In some aspects, the present disclosure provides a composition comprising any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, or cells provided herein. In some embodiments, the composition is a pharmaceutical composition comprising any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, or cells provided herein and a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients, carriers, buffers, stabilizers, isotonicity agents, preservatives, or antioxidants, or other materials, are well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, for example, intravenous, intramuscular, intradermal, sublingual, buccal, ocular, intranasal, subcutaneous, intrathecal, intratumoral, oral, vaginal, or rectal.

[0371] In some aspects, the present disclosure provides methods of administering to a subject any of the modified mRNA, modified non-coding RNA, lipid nanoparticles, cells, compositions, or pharmaceutical compositions provided herein. In some embodiments, any of the modified mRNAs or modified non-coding RNAs described herein may be used in conjunction with various reagents or materials (e.g., one or more lipid nanoparticles, cells, compositions, or pharmaceutical compositions), or certain production, purification, formulation, and delivery processes and techniques known in the art, such as, but not limited to, those exemplified in U.S. Patent Nos. 9950065, 10576146, 11045418, 8754062, 10808242, 9957499, 10155785, 11059841, 10876104, 10975369, 9580711, 9670152, 9850202, 9896413, 10399937, 10052284, 10959953, and 10961184, each of which is incorporated herein by reference.

[0372] In some embodiments, the subject is a human. In some embodiments, administration is intravenous, intramuscular, intradermal, sublingual, buccal, ocular, intranasal, subcutaneous, intrathecal, intratumoral, oral, vaginal, or rectal.

[0373] In some embodiments, the compositions should be stored below 50°C, below 40°C, below 30°C, below 20°C, below 10°C, below 0°C, below -10°C, below -20°C, below -30°C, below -40°C, below -50°C, below -60°C, below -70°C, or below -80°C, so that the nucleic acids are relatively stable over time.

[0374] In some embodiments, modified mRNA or modified non-coding RNA is introduced into a subject's cells by in vivo electroporation. In vivo electroporation is a process of introducing nucleic acids or other molecules into a subject's cells using electric pulses, which promote the passage of nucleic acids or other molecules through cell membranes and / or cell walls. See, for example, Somiari et al. Molecular Therapy., 2000. 2(3): 178-187. The nucleic acid or molecule to be delivered is administered to a subject, for example, by injection, and an electric pulse is applied to the injection site, whereby the electricity promotes the entry of the nucleic acid into cells at the administration site. In some embodiments, the nucleic acid is administered with other elements, such as buffers and / or excipients, that increase the efficiency of electroporation.

[0375] In some aspects, the present disclosure provides a kit comprising any of the RNAs provided herein and any of the tailing nucleic acids. The RNA and tailing nucleic acid can be combined in the presence of an RNA ligase to produce a modified mRNA or modified non-coding RNA, such as one of the modified mRNAs or modified non-coding RNAs provided herein. In some embodiments, the kit comprises a ligase. In some embodiments, the kit comprises an RNA ligase. In some embodiments, the kit comprises a T4 RNA ligase. In some embodiments, the kit comprises a T4 RNA ligase 1. In some embodiments, the kit comprises a T4 RNA ligase 2. In some embodiments, the kit comprises an RtcB RNA ligase. In some embodiments, the kit further comprises a buffer for performing ligation. In some embodiments, the kit further comprises a nucleotide triphosphate, such as ATP, to provide the energy required by the ligase. In some embodiments, the kit should be stored below 50°C, below 40°C, below 30°C, below 20°C, below 10°C, below 0°C, below -10°C, below -20°C, below -30°C, below -40°C, below -50°C, below -60°C, below -70°C, or below -80°C, so that the nucleic acids are relatively stable over time.

[0376] In some aspects, the present disclosure provides a kit comprising any of the pharmaceutical compositions provided herein and a delivery device. A delivery device refers to a machine or instrument suitable for administering a composition to a subject, such as a syringe or needle. In some embodiments, the kit should be stored at temperatures below 50°C, below 40°C, below 30°C, below 20°C, below 10°C, below 0°C, below -10°C, below -20°C, below -30°C, below -40°C, below -50°C, below -60°C, below -70°C, or below -80°C, so that the nucleic acid of the pharmaceutical composition is relatively stable over time. [Example]

[0377] In order that the present disclosure may be more fully understood, the following examples are presented. The examples are provided to illustrate the modified mRNAs, pharmaceutical compositions, kits, and methods provided herein and should not be construed in any way as limiting the scope thereof. Example 1: Production of modified mRNA.

[0378] Modified mRNA is produced by in vitro transcription (IVT) of a DNA template encoding the 5' untranslated region (UTR), the open reading frame encoding the desired protein, and the 3' UTR. The DNA template may also contain a nucleic acid sequence containing repeated thymidine bases (poly(T) sequences) downstream of the template encoding the 3' UTR. When transcribing RNA from a poly(T) DNA sequence, RNA polymerase stutters, adding multiple adenosine bases to the transcribed RNA without necessarily proceeding along the DNA template. This results in the addition of a long RNA sequence containing only adenosine bases, known as a poly(A) tail, to the 3' end of the RNA (Figure 1).

[0379] Alternatively, RNA transcripts without poly(A) tails can be produced by in vitro transcription of DNA templates that do not contain poly(T) sequences, and poly(A) tails can be added to these transcripts separately in a tailing reaction. RNA molecules are incubated with adenosine triphosphate (ATP) or modified ATP in the presence of an enzyme that can add nucleotides to the 3' end of RNA molecules, such as poly(A) polymerase (PAP). Incubating RNA and polyadenylation enzymes with a mixture of ATP and one or more modified ATPs results in the addition of a poly(A) tail. The modified mRNAs produced by either of these methods described above are linear mRNAs, and they have 5' and 3' terminal nucleotides.

[0380] Modified mRNAs can be circular mRNAs, which are single-stranded mRNA molecules without 5' or 3' ends (Figure 2A). Circular mRNAs are produced by incubating the linear mRNA to be circularized with another single-stranded nucleic acid, such as a DNA oligonucleotide, containing: i) a nucleotide sequence complementary to the sequence at the 3' end of the mRNA (3' DNA complement), and ii) a nucleotide sequence complementary to the sequence at the 5' end of the mRNA (5' DNA complement). Here, the 3' DNA complement is immediately downstream (3') of the 5' DNA complement on the DNA oligonucleotide. The mRNA hybridizes with the complementary oligonucleotide, so that the 3' terminal nucleotide of the mRNA is 5' to the 5' terminal nucleotide of the mRNA. A ligase, such as SplintR ligase, forms a phosphodiester bond between the two terminal bases of the mRNA, resulting in the formation of a circular mRNA molecule without terminal nucleotides. Example 2: The effect of modified bases on the efficiency of protein production from mRNA.

[0381] RNA encoding either GFP or mCherry and lacking a poly(A) tail was produced by in vitro transcription. The RNA was polyadenylated as described in Example 1 using different nucleotide compositions to produce mRNAs with different poly(A) tails. RNA encoding GFP was polyadenylated with: a) ATP, b) a mixture of 95% ATP and 5% modified ATP, c) a mixture of 75% ATP and 25% modified ATP, or d) no ATP (no tailing) as a negative control. The modified ATPs tested were m 6ATP, 2'OMeATP, thioATP, dATP, and aminodATP were included. RNA encoding mCherry was polyadenylated with ATP to produce a control mRNA with a classical poly(A) tail. A mixture of GFP-encoding mRNA and control mCherry-encoding mRNA was transfected into HeLa cells. One, two, and three days after transfection, the amount of GFP and mCherry protein produced in each cell population was quantified by fluorescence microscopy, and the GFP / mCherry ratio was calculated. Each of the GFP-encoding mRNAs containing ATP modified on the poly(A) tail resulted in a higher GFP / mCherry ratio relative to the GFP-encoding mRNA produced by polyadenylation with ATP alone (Figure 3). In general, the use of 25% modified ATP in the polyadenylation reaction resulted in a more significant increase in the GFP / mCherry ratio than the use of only 5% modified ATP, indicating that the more frequent inclusion of modified adenosines on the poly(A) tail further improves the efficiency of protein production from modified mRNA. Example 3: Biochemical and functional characterization of modified mRNA.

[0382] Modified mRNA is characterized according to several biochemical parameters, including mRNA purity and the ratio of bases in a given region, such as the poly(A) tail, that are modified bases. NMR spectroscopy is used to assess the identity of the mRNA in a composition. Gel electrophoresis is used to assess the purity of a composition containing mRNA. A pure composition containing a single mRNA species will produce a single band on the gel, while an impure composition containing multiple mRNA molecules of different sizes will produce multiple bands or a smear on the gel. Liquid column mass spectrometry (LC / MS) is used to assess the incorporation of modified nucleotides. Modified nucleotides generally have a larger molecular weight than classical nucleotides, and therefore, the incorporation of more modified nucleotides into mRNA will result in a greater shift, usually an increase, in the mass of the mRNA molecule.

[0383] Cell-based screening is used to assess the effect of modified bases on protein translation. Modified mRNA is transfected into a separate population of human cells in parallel with unmodified mRNA containing classical bases. After transfection, the rate of protein production is assessed by one of several methods known in the art, including flow cytometry and ELISA. The stability of modified or unmodified mRNA in transfected cells is assessed by lysing the transfected cells at the desired time point after transfection, isolating the nucleic acid, preparing cDNA from the mRNA in the lysate by reverse transcription, and quantifying the amount of cDNA corresponding to the transfected mRNA using quantitative PCR. Induction of innate immune responses by transfected mRNA is quantified using one of several methods known in the art, such as ELISA for phosphorylated signaling domains of Toll-like receptors or adaptor proteins, or qRT-PCR-based quantification of genes activated by detection of exogenous RNA, such as OAS1.

[0384] In a therapeutic approach, the modified mRNA is administered to a human or animal subject, such that the ribosomes of the subject's cells produce the protein(s) encoded by the mRNA. The mRNA can encode a bioluminescent protein, such as luciferase, such that the efficiency of protein production in the subject can be measured using a luciferase imaging system. The mRNA can encode an antigen, such that production of the antigen in the subject's cells results in the subject producing antibodies and / or T cells specific to the antigen. The immune response generated by the subject against the antigen is assessed by methods known in the art, including ELISA to quantify antigen-specific antibodies, neutralization assays to quantify neutralizing antibodies, and flow cytometry to quantify multiple types of immune cells, including T cells or antigen-specific T cells. Example 4: Producing modified mRNA by ligation. Introduction

[0385] Messenger RNA (mRNA) therapeutics and vaccines are quickly becoming established as a new class of drugs, as evidenced by the recent clinical trials and approval of mRNA vaccines for SARS-CoV-2. 1,2 Due to their programmability, rapid in vivo protein production, relatively low-cost manufacturing, and potential scalability to target multiple proteins simultaneously, mRNA vectors appear to be a promising alternative to traditional protein-based drugs. 3-5 Although mRNA has been shown to robustly generate transgenic proteins in vivo, the relatively short half-life of mRNA may limit the clinical application of this therapeutic platform. 3,6 This problem has previously been circumvented by multiple injections of RNA (e.g., "booster" doses) during animal studies, as is the case in some vaccine studies. 7-9 However, this strategy could potentially limit therapeutic drug application and widespread distribution.

[0386] Chemical modification is an effective strategy to boost the translation potential and reduce toxicity of mRNA for in vivo applications. Incorporation of modified UTP derivatives (e.g., pseudouridine and N1-methylpseudouridine) has been widely used to reduce innate immune toxicity induced by RNA transfection. 10-12 Circular mRNAs have been reported to have an enhanced half-life compared to their linear counterparts, likely due to their lack of degradable 5' and 3' RNA ends. 13-15 However, circular mRNAs suffer from lower overall expression levels due to their reliance on IRES elements that do not robustly tolerate the incorporation of modified nucleotides. 15 In addition, exonuclease-resistant nucleotides have been incorporated into the mRNA body and mRNA poly(A) tail, resulting in variable increases in RNA half-life. 16,17 Although random incorporation of modified nucleoside triphosphates (NTPs) into the mRNA body by RNA polymerase shows promise, this strategy dramatically reduces the chemical space of NTPs that can be tested because many modified NTPs are not well tolerated by the ribosomal machinery, thus reducing overall translation efficiency. 18-20 An alternative strategy is to selectively incorporate modified NTPs during enzymatic poly(A) tailing. 16,17 Although promising, this strategy relies on poly(A) polymerase enzymes, and these face limitations due to the small chemical repertoire tolerated by the enzyme and its inability to incorporate modified nucleotides in a site-specific manner.

[0387] An alternative strategy for generating mRNA vectors with improved protein production capabilities through 3'-end ligation of synthetic modified RNA oligonucleotides is presented herein. The classical mRNA degradation pathway in eukaryotes is typically thought to begin with 3'-deadenylation, followed by recruitment of a decapping complex and exposure of the mRNA to cellular 5' and 3' exonucleases. 21mRNAs with exonuclease-resistant poly(A) tails were tested for their ability to withstand deadenylation and produce more protein in cells relative to mRNAs with unmodified poly(A) tails. result Preliminary modified ATP incorporation during poly(A) tailing

[0388] Several chemically modified ATP derivatives were screened for their poly(A) stabilizing activity. Specifically, modified ATP was spiked into a poly(A) tailing reaction using a GFP mRNA template using a similar tailing protocol as previously described (Figure 4A). 17 HeLa cells were cotransfected with mRNA encoding GFP with a modified poly(A) tail and mRNA encoding mCherry with an unmodified poly(A) tail. Each transfection contained only one type of modified GFP-encoding mRNA and a control mCherry-encoding mRNA. By measuring the relative GFP / mCherry fluorescence ratio over a 3-day time course, we observed a modest difference in mRNA translation half-life as a result of modified NTP incorporation onto the poly(A) tail.

[0389] Monitoring fluorescence in HeLa cells over a 3-day period revealed increased fluorescent protein production as a result of poly(A) tailing reactions with modified ATP spike-in, particularly for dATP (2'-deoxyadenosine) and alpha-thiol ATP (adenosine-5'-O-(1-thiotriphosphate)) (Figure 1). E. coli poly(A) polymerase likely incorporated modified ATP sporadically and at substoichiometric levels. It is also possible that E. coli poly(A) polymerase completely excluded some modified nucleotides, producing unmodified poly(A) tails despite the presence of modified ATP in the polyadenylation reaction. Ligation of chemically modified oligonucleotides improves translational longevity

[0390] Alternative modification strategies were pursued to test different designs of site-specific chemical modifications and incorporate alternative internucleotide linkages. In this study, synthetic oligonucleotides were ligated to the 3' ends of mRNAs containing pre-existing poly(A) tails (Figure 4B). A population of GFP-encoding mRNAs with uniform length was generated using in vitro transcription from a DNA template containing the GFP coding sequence and a sequence encoding a poly(A) tail. The efficiency of 3' oligonucleotide ligation was determined using an RNase H reaction targeting the 3' UTR. This resulted in clear separation of the ligated and unligated mRNA 3' ends on a gel (Figure 6A). Ligation using T4 RNA ligase I (Promega) was observed to work with nearly 100% efficiency, as evidenced by the RNase H reaction (Figure 6A).

[0391] To compare the effectiveness of different chemical modifications, all oligonucleotides were designed to be 29 nucleotides in length. Each oligonucleotide contained a 5' phosphate to facilitate ligation to the 3' end of the mRNA and a 3' blocking group (dideoxyC [ddC] or inverted dT [InvdT]) lacking a 3' hydroxyl group to prevent self-ligation of the oligonucleotide. This ensured that ligation would attach only one copy of the oligonucleotide to the mRNA. Furthermore, at least 6–8 nucleotides at the 5' end of the oligonucleotide were unmodified rA nucleotides to provide an unstructured handle for the T4 RNA ligase I reaction. The modified RNA and DNA oligonucleotide sequences can be found in Table 1. The oligonucleotides were ligated to the 3' end of the GFP-encoding mRNA described in the preceding paragraph, which contained a poly(A) tail encoded by a ∼60-nucleotide template, for ease of characterization using the previously described RNase H protocol. [Table 1-1] [Table 1-2] [Table 1-3]

[0392] Ligated modified GFP-encoding mRNA was transfected into HeLa cells along with unligated mCherry mRNA (E-PAP poly(A)-tailed), which served as an internal transfection control. Cell samples were imaged to quantify the relative GFP / mCherry fluorescence intensity ratio at 24, 48, and 72 hours posttransfection to estimate the effect of specific 3'-end modifications on translational lifespan.

[0393] Ligation of a control oligonucleotide (29xrA_ddC) containing 29 unmodified rA linkages and a 3' ddC resulted in a modest increase in GFP fluorescence in HeLa cell cultures (between 50% and 55%, Table 2) compared with unligated and mock-ligated controls. This was likely due to the 28-nucleotide extension of the poly(A) tail and possibly, in part, the presence of the chain-terminating ddC nucleotide. In addition, ligation products of oligonucleotides containing three consecutive phosphorothioate (PS) linkages (3xSrA_ddC, 3xSrA_InvdT, and 3xSrG_InvdT) showed 140% to 210% increased GFP production compared with that of the 29-nt poly(rA) control oligo at each time point (Figure 5). This observation is consistent with the nuclease-resistant activity of phosphorothioate linkages, as generally used in antisense oligonucleotide therapy. 22 . [Table 2-1] [Table 2-2] [Table 2-3]

[0394] Detailed P values ​​are listed in the format of Sample 1 vs. Sample 2: 72-hour comparison. Mock ligation vs. 29rA_ddC: 4e-7; 29rA_ddC vs. 3XSrA_ddC: 2e-6; 29rA_ddC vs. 3XSrA_InvdT: 0.005; 29rA_ddC vs. 3XSrG_InvdT: 1e-5; 29rA_ddC vs. 6XSr(AG): <1e-15; 29rA_ddC vs. G4_telo_DNA_WT: 9e-6; 29rA_ddC vs. G4_C9orf72_RNA_6xSrG: 0.003; 29rA_ddC vs. G4_C9orf72_DNA_6xSrG: 8e-5; 29rA_ddC vs. G4_telo_DNA_6xSG: 0.002.

[0395] Surprisingly, the 3xthio-rG_invdT ligation demonstrated slightly greater GFP fluorescence than 3xthio-rA_invdT at all time points (170%-200% vs. 140%-180% normalized GFP / mCherry), but this difference was relatively small (Table 2; Figure 5). This result may be related to the specificity of mRNA deadenylase for adenine compared to guanosine. 23,24 However, these short, unstructured sequence differences played a relatively minor role in modulating mRNA translational lifetime. Furthermore, 3xSrA_ddC and 3xSrA_InvdT demonstrated normalized GFP / mCherry production of 170%–210% and 140%–180%, respectively (considering all time points; Table 2). This suggests that altering the identity of the small, chain-terminating nucleotides used in ligation (3'dideoxy-C & 3'inverted dT) can result in a modest improvement in mRNA stability.

[0396] Given the success of RNase-resistant phosphorothioate linkages, we replaced RNA nucleotides on oligonucleotides with RNase-resistant DNA nucleotides to determine their effect on protein translation yield. Unexpectedly, an oligonucleotide containing 23 deoxyadenosines (23xdA_ddC) did not substantially improve translation half-life (Figure 5), despite the oligonucleotide's resistance to in vitro RNase R digestion (Figure 6B). However, a DNA quadruplex (telomere-derived) ssDNA sequence exhibited a stabilizing effect that was consistently greater than that of the 23 unstructured deoxyadenosines and "GtoC" ssDNA oligo control ligations (Figure 5). We hypothesized that mRNAs possessing unstructured 3' ssDNA ends may be sensitive to cellular ssDNA exonucleases, or alternatively, may induce RNase H activity if they possess homology to mRNAs. 25-27 .

[0397] Finally, we explored ligation with oligonucleotides bearing increasing numbers of phosphorothioate modifications and their combination with quadruplex (G4) secondary structures to determine whether these modifications could act synergistically to stabilize the modified mRNA. Six consecutive phosphorothioate linkages (6xSr(AG)) on an unstructured ssRNA oligo provided the most consistent level of stabilization, with a standard deviation of 0.26–0.6 across all time points (Table 2; Figure 5). The ssDNA and ssRNA G4 oligos containing six consecutive phosphorothioate linkages (G4_C9orf72_RNA_6xSrG, G4_C9orf72_DNA_6xSrG, and G4_telo_DNA_6xSG) also resulted in improved translation compared to the control oligos, although the performance of these constructs was more variable across different replicates, demonstrating SD ranges of 0.7–1; 0.8–1.1; and 1.0–1.3, respectively (Table 2; Figure 5).

[0398] A HeLa cell time course experiment demonstrated that mRNAs incorporating phosphorothioate linkages had increased GFP / mCherry signals over time (Figure 5). These chemical modifications may act directly by increasing translation efficiency per mRNA or indirectly by reducing the rate of RNA degradation relative to an internal control mRNA encoding mCherry, thereby increasing the observed GFP / mCherry signal. Consideration

[0399] Previous studies of cytoplasmic mRNA decay have identified poly(A) tail shortening as the rate-limiting step in major mRNA degradation pathways (e.g., deadenylation-dependent decay). Following this model, we investigated poly(A) tail shortening as the rate-limiting step in mRNA vector deactivation.

[0400] Ligation of oligonucleotides containing nuclease-resistant chemical linkers to the 3' end of mRNA is sufficient to increase mRNA translation activity over the course of several days (24-72 hours), resulting in up to 170%-220% more protein expression in cell culture in the case of the 6xSr(AG) construct. This strategy may expand the chemical space of modified nucleotide derivatives in mRNA vectors for diverse purposes.

[0401] These results suggest that poly(A) truncation is a major determinant of the translational efficacy of therapeutic mRNAs, consistent with previous models of cytoplasmic mRNA degradation. These results inform the replacement of mRNA tails with nuclease-resistant poly(A)-binding protein (PABP)-binding aptamers / oligonucleotides for improved mRNA stabilization. The strategies detailed in this application also address other types of modifications, such as the hydrolysis-resistant 7-methylguanosine 5' cap. 28,29 , modified 5'UTR region 30This ligation strategy is also compatible with endonuclease / hydrolysis resistant modified nucleotides on the mRNA body. This ligation strategy allows the attachment of mRNA therapeutics to easily synthesized chemically modified aptamers, e.g., peptide nucleic acids. 31 , locked nucleic acid 32 or generally suitable for combination with other chemical groups. method Plasmid cloning, characterization, and purification

[0402] Plasmids encoding hMGFP and mCherry (WX28 and WX26, respectively) were obtained on the pCS2 vector, which contained (in 5'-3' order): the SP6 promoter sequence, the 5' UTR, the fluorescent protein coding sequence (CDS), the 3' UTR, and a NotI restriction site.

[0403] PCR was performed on the plasmid using primers encoding poly(A) on the forward primer and poly(T) on the reverse primer using the Q5® Site-Directed Mutagenesis Kit (NEB), followed by KLD enzyme treatment and then transformation into NEB Stabl cells for isolation using the ZymoPURE Plasmid Miniprep Kit and Sanger sequencing by Genewiz. mRNA synthesis and characterization

[0404] GFP mRNA was synthesized from the WX28xEsp3i plasmid, which contains the SP6 promoter followed by the hMGFP CDS and template-encoded poly(A) tail. The plasmid was linearized via a single Esp3i site located immediately 3' of the poly(A) region. The linearized plasmid was then purified using the DNA Clean & Concentrator-25 kit from Zymo Research.

[0405] 5'-capped modified mRNA was prepared using the SP6 enzyme and reaction buffer from the mMESSAGE mMACHINE™ SP6 Transcription Kit. The 2x NTP / cap solution provided by the kit was replaced with a 2x NTP / cap preparation containing: 10 mM ATP, 10 mM CTP, 2 mM GTP, 8 mM 3'-O-Me-m 7 G(5')ppp(5')G RNA cap analog, and 10 mM N1-methylpseudouridine-5'-triphosphate. Superase-In RNase inhibitor was added to a final concentration of 1:20 (v / v). After IVT reaction assembly and incubation at 37°C for 2-4 hours, the reaction was treated with 1-2 μl of TURBO DNAse for 1 hour at 37°C prior to reaction purification using the MEGAclear™ Transcription Cleanup Kit.

[0406] Superase-In RNase inhibitor was added to purified mRNA samples at a final concentration of 1:50 (v / v), and samples were stored at -80°C for long-term storage. Purified mRNA was measured by Nanodrop prior to ligation to estimate concentration, while mRNA was measured using the Qubit RNA HS assay for normalization immediately prior to transfection for cell-based studies.

[0407] For preparation of unmodified poly(A) polymerase-tailed mRNA, dsDNA templates were generated by linearization of WX28 and WX26 plasmids with NotI-HF, and the digested products were column-purified using Zymo DNA Clean & Concentrator-25. In vitro transcription was performed using the protocol described above, except that after TURBO DNAse digestion, an extra step of poly(A) tailing using the E-PAP Poly(A) Tailing Kit was included. mRNA purification and storage were as described above (e.g., using the MEGAclear Transcription Cleanup Kit). Modified E. coli poly(A) polymerase tailing

[0408] In modified E-PAP tailing experiments, the substrate was untailed GFP mRNA generated from an IVT with a linearized WX28 template. The protocol utilized the enzymes and buffers from the E-PAP poly(A) tailing kit. A "10 mM total" ATP stock solution was prepared for each modified ATP spike-in, resulting in a specific percentage of ATP being replaced by a modified ATP derivative (XATP). For example, a 25% dATP sample would require the assembly of a 2.5 mM dATP, 7.5 mM ATP stock solution. The tailing reaction was assembled as follows: 1.5μg untailed GFP mRNA 5μl 5x E-PAP buffer 2.5 μl 10 mM XATP:ATP stock solution (different for each sample) 2.5 μl 25 mM MnCl2 1 μl Superase-In RNase inhibitor 1μl E-PAP enzyme Bring to a total volume of 25 μl with nuclease-free water

[0409] The reaction was incubated at 37°C for 1 hour and then quenched by adding 0.5 μl of 500 mM EDTA. The tailed mRNA was then column purified using the Monarch RNA Cleanup Kit (50 μg). Superase-In RNase inhibitor was added to the purified mRNA at a final dilution of 1:50 (v / v), and the mRNA was stored at -80°C prior to transfection.

[0410] The following modified ATP derivatives (XATP) were used in polyadenylation experiments: adenosine 5'-triphosphate (ATP); N 6 -methyladenosine-5'-triphosphate (m 6A); 2'-O-methyladenosine-5'-triphosphate; adenosine-5'-O-(1-thiotriphosphate); deoxyadenosine triphosphate (dATP); 2'-amino-2'-deoxyadenosine-5'-triphosphate. 3'-end ligation of modified oligonucleotides

[0411] The ligation reaction was carried out using T4 RNA ligase I. The reaction was assembled as follows: 2μg capped mRNA 200 pmol chemically modified oligo 2 μl Superase-In RNase inhibitor 20 μl 50% PEG-8000 5 μl 100% DMSO 5μl 10x T4 RNA ligase buffer 5μl T4RNA ligase (Promega) up to a total volume of 50 μl (with nuclease-free water)

[0412] The reaction was incubated at 37°C for 30 minutes, then inactivated by adding 1 μl of 500 mM EDTA, pH 8.0. The reaction was diluted by adding 1 volume of nuclease-free water (e.g., 50 μl) and then 0.5 volumes of AMPure XP (e.g., 25 μl) containing 1 μl of Superase-In. The reaction was purified according to the manufacturer's protocol, and the mRNA was eluted from the AMPure beads with nuclease-free water containing Superase-In at a 1:50 (v / v) ratio.

[0413] For ligations that were incomplete according to the RNase H gel-based assay, ligations were performed using modified conditions in which DMSO was omitted from the reaction. When necessary, this generally resulted in more efficient ligations. RNase H assay

[0414] A potassium chloride (KCl) stock solution was prepared and used to anneal ssDNA oligos to mRNA prior to the RNase H assay. The KCl stock solution contained: 50 mM KCl, 2.5 mM EDTA, and 1:200 (v / v) Superase-In RNase inhibitor. The final volume was brought up to 1:1 with nuclease-free water. The ssDNA probe was ordered from IDT and had the sequence GCATCACAAATTTCACAAATAAAGCATTTTTTTCAC (SEQ ID NO: 18).

[0415] The following reaction was prepared to anneal the mRNA to the ssDNA probe described above: 200ng mRNA sample (purified) 2 pmol ssDNA probe 2 μl stock solution: 50 mM KCl, 2.5 mM EDTA, 1:200 Superase-In Bring to a volume of 10 μl using nuclease-free water

[0416] Reactions were denatured at 70°C for 5 minutes and then cooled to room temperature (25°C) at a rate of 0.2°C / sec in a benchtop thermocycler. After probe annealing, 1 μl of thermostable RNase H and 1 μl of 10× buffer were added to each reaction, which was then incubated at 50°C for 30 minutes. After reaction incubation, the samples were digested by adding 1 μl of proteinase K and incubated at room temperature for 5 minutes. The samples were then mixed with 1 volume of gel loading buffer II supplemented with EDTA to a final concentration of 50 mM.

[0417] Samples in 1× loading buffer were denatured at 70° C. for 3-5 minutes prior to loading and resolution on a 6% Novex™ TBE-urea gel. RNase R digestion of oligonucleotides

[0418] 200 ng of oligos were incubated in a total reaction volume of 10 μl containing 1× RNase R reaction buffer and 10 units of RNase R. Reactions were incubated at 37°C for 1 hour, then digested with 1 μl proteinase K and denatured in 1× gel loading buffer II. They were run on a 15% Novex TBE-urea gel. Mammalian cell culture and mRNA transfection

[0419] HeLa cells (CCL-2, ATCC) were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS in a 37°C incubator with 5% CO and passaged at a ratio of 1:8 every 3 days. Cell cultures were routinely confirmed to be free of mycoplasma contamination by Hoechst staining and microscopic imaging.

[0420] The day before mRNA transfection, cells were seeded at 75% confluence into individual wells of a 12-well plate. The following day, 500 ng of mCherry (internal control) mRNA and 500 ng of GFP mRNA with a synthetic tail (concentrations determined by Qubit) were transfected into each well using 3 μL of Lipofectamine MessengerMAX transfection reagent. Additional controls containing mCherry mRNA alone, transfection reagent alone, or untransfected cells were included. After 6 h of incubation, the Lipofectamine / mRNA transfection mixture was removed, and cells were rinsed once with DPBS, trypsinized, and replated into three glass-bottom 24-well plates (poly-D-lysine coated) at a 6:4:3 ratio for fluorescent protein quantification at 24, 48, and 72 h posttransfection, respectively. Confocal imaging and quantification of fluorescent proteins

[0421] Prior to fluorescent protein imaging, the culture medium was removed and the cells were rinsed once with DPBS before being incubated in nuclear staining medium (FluoroBrite DMEM with 1:2000 dilution of Hoechst 33342) for 10 min at 37°C.

[0422] Confocal images of nuclei (Hoechst), GFP, and mCherry were taken with a Leica Stellaris 8 with a 10x air objective at a pixel size of 900 nm x 900 nm. Four representative fields, one from each quadrant, were taken for each well. The same imaging settings were used for all samples to be compared. The excitation / detection wavelengths were as follows, in the format "excitation wavelength / ~[detection wavelength range]": Hoechst: diode 405 nm / ~[430-480] nm; GFP: WLL 489 nm / ~[500-576] nm; mCherry: WLL 587 nm / ~[602-676] nm. mRNA quantification in transfected cell cultures using STARmap

[0423] STARmap, an imaging-based method for detecting individual mRNA molecules as barcoded DNA colonies, quantifies mCherry and GFP mRNA 33 The STARmap procedure for cell culture described by Wang et al. was followed. 33 .

[0424] Briefly, after fluorescent protein imaging, cells were fixed with 1.6% PFA / 1x PBS for 10 min at room temperature before further fixation and permeabilization with pre-chilled methanol at -20°C (up to 1 week) before the next step. Then, methanol was removed, and cells were rehydrated with PBSTR / glycine / tRNA (PBS with 0.1% Tween-20, 0.5% Superase In, 100 mM glycine, and 1% yeast tRNA) for 15 min at room temperature, followed by one wash with PBSTR. Samples were then hybridized overnight at 40°C with SNAIL probes targeting mCherry and GFP mRNA sequences in hybridization buffer (2x SSC, 10% formamide, 1% Tween-20, 20 mM RVC, 0.5% Superase In, 1% yeast tRNA, and 100 nM of each probe). The cells were then washed twice at 37°C with PBSTR (20 min each wash) and once at 37°C with high-salt wash buffer (PBSTR with 4x SSC) before one rinse with PBSTR at room temperature. The ligation reaction was carried out for 2 h at room temperature to circularize the padlock probe adjacent to the primer. After two washes with PBSTR, rolling circle amplification was initiated from the primer using Phi29 for 2 h at 30°C. Amino-dUTP was spiked in. After two more washes with PBSTR, the DNA amplicon was modified to be polymerizable with 20 mM MA-NHS in PBST buffer for 2 h at room temperature. The sample was then converted to a hydrogel-cell hybrid before proteinase K digestion of the fluorescent protein overnight at room temperature. The sample was washed three times with PBST before washing with fluorescent detector oligonucleotides and staining in imaging buffer (2x SSC, 10% formamide) for 1 h at 37°C. Finally, the samples were washed three times with washing and imaging buffer at room temperature and stained with DAPI before imaging in washing and imaging buffer.

[0425] Confocal imaging stacks were taken with a Leica Stellaris 8 with a 40x oil immersion objective at a pixel size of 283nm*283nm. 14um stacks were imaged for 15 steps at 1um / step. Four representative fields, one from each quadrant, were taken for each well. [Table 3]

[0426] Fluorescence detection probe sequence mCherry amplicon detection probe: / 5Alexa647N / CATACACTAAAGATAACAT (SEQ ID NO: 31) hMGFP amplicon detection probe: / 5Alex546N / TCGTAGACTAAGATAACAT (SEQ ID NO: 32) reference

[0427] 1. Polack, FP et al. Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine. N. Engl. J. Med. 383, 2603-2615 (2020).

[0428] 2. Lombardi, A. et al. Mini Review Immunological Consequences of Immunization With COVID-19 mRNA Vaccines: Preliminary Results. Front. Immunol. 12, 657711 (2021).

[0429] 3. Sahin, U., Kariko, K. & Tureci, O. mRNA-based therapeutics - developing a new class of drugs. Nat. Rev. Drug Discov. 13, 759-780 (2014).

[0430] 4. Dammes, N. & Peer, D. Paving the Road for RNA Therapeutics. Trends Pharmacol. Sci. 41, 755-775 (2020).

[0431] 5. Weng, Y. et al. The challenge and prospect of mRNA therapeutics landscape. Biotechnol. Adv. 40, 107534 (2020).

[0432] 6. Chen, C.-Y. A., Ezzeddine, N. & Shyu, A.-B. Messenger RNA half-life measurements in mammalian cells. Methods Enzymol. 448, 335-357 (2008).

[0433] 7. Petsch, B. et al. Protective efficacy of in vitro synthesized, specific mRNA vaccines against influenza A virus infection. Nat. Biotechnol. 30, 1210-1216 (2012).

[0434] 8. Richner, J. M. et al. Vaccine Mediated Protection Against Zika Virus-Induced Congenital Disease. Cell 170, 273-283. e12 (2017).

[0435] 9. Tai, W. et al. A novel receptor-binding domain (RBD)-based mRNA vaccine against SARS-CoV-2. Cell Res. 30, 932-935 (2020).

[0436] 10. Kariko, K. et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. 16, 1833-1840 (2008).

[0437] 11. Kariko, K., Buckstein, M., Ni, H. & Weissman, D. Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity 23, 165-175 (2005).

[0438] 12. Andries, O. et al. N(1)-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. J. Control. Release 217, 337-344 (2015).

[0439] 13. Wesselhoeft, R. A., Kowalski, P. S. & Anderson, D. G. Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat. Commun. 9, 2629 (2018).

[0440] 14. Wesselhoeft, R. A. et al. RNA Circularization Diminishes Immunogenicity and Can Extend Translation Duration In Vivo. Mol. Cell 74, 508-520. e4 (2019).

[0441] 15. Carmona, E. M. Circular RNA: Design Criteria for Optimal Therapeutical Utility. (Harvard University, 2019).

[0442] 16. Anhauser, L., Huwel, S., Zobel, T. & Rentmeister, A. Multiple covalent fluorescence labeling of eukaryotic mRNA at the poly(A) tail enhances translation and can be performed in living cells. Nucleic Acids Res. 47, e42 (2019).

[0443] 17. Strzelecka, D. et al. Phosphodiester modifications in mRNA poly(A) tail prevent deadenylation without compromising protein expression. RNA 26, 1815-1837 (2020).

[0444] 18. Li, B., Luo, X. & Dong, Y. Effects of Chemically Modified Messenger RNA on Protein Expression. Bioconjug. Chem. 27, 849-853 (2016).

[0445] 19. Aurup, H., Siebert, A., Benseler, F., Williams, D. & Eckstein, F. Translation of 2'-modified mRNA in vitro and in vivo. Nucleic Acids Res. 22, 4963-4968 (1994).

[0446] 20. Choi, J. et al. 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation. Nat. Struct. Mol. Biol. 25, 208-216 (2018).

[0447] 21. Labno, A., Tomecki, R. & Dziembowski, A. Cytoplasmic RNA decay pathways - Enzymes and mechanisms. Biochim. Biophys. Acta 1863, 3125-3147 (2016).

[0448] 22. Eckstein, F. Phosphorothioates, essential components of therapeutic oligonucleotides. Nucleic Acid Ther. 24, 374-387 (2014).

[0449] 23. Stowell, J. A. W. et al. Reconstitution of Targeted Deadenylation by the Ccr4-Not Complex and the YTH Domain Protein Mmi1. Cell Rep. 17, 1978-1989 (2016).

[0450] 24. Chen, J., Chiang, Y.-C. & Denis, C. L. CCR4, a 3'-5' poly(A) RNA and ssDNA exonuclease, is the catalytic component of the cytoplasmic deadenylase. EMBO J. 21, 1414-1426 (2002).

[0451] 25. Cerritelli, S. M. & Crouch, R. J. Ribonuclease H: the enzymes in eukaryotes. FEBS J. 276, 1494-1505 (2009).

[0452] 26. Yang, Y.-G., Lindahl, T. & Barnes, D. E. Trex1 exonuclease degrades ssDNA to prevent chronic checkpoint activation and autoimmune disease. Cell 131, 873-886 (2007).

[0453] 27. Takahashi, A. et al. Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells. Nat. Commun. 9, 1249 (2018).

[0454] 28. Rydzik, A. M. et al. mRNA cap analogues substituted in the tetraphosphate chain with CX2: identification of O-to-CCl2 as the first bridging modification that confers resistance to decapping without impairing translation. Nucleic Acids Res. 45, 8661-8675 (2017).

[0455] 29. Strenkowska, M. et al. Towards mRNA with superior translational activity: synthesis and properties of ARCA tetraphosphates with single phosphorothioate modifications. New J. Chem. 34, 993-1007 (2010).

[0456] 30. Kawaguchi, D. et al. Phosphorothioate Modification of mRNA Accelerates the Rate of Translation Initiation to Provide More Efficient Protein Synthesis. Angew. Chem. Int. Ed Engl. 59, 17403-17407 (2020).

[0457] 31. Wu, J.-C. et al. Recent advances in peptide nucleic acid for cancer bionanotechnology. Acta Pharmacol. Sin. 38, 798-805 (2017).

[0458] 32. Doessing, H. & Vester, B. Locked and unlocked nucleosides in functional nucleic acids. Molecules 16, 4511-4526 (2011).

[0459] 33. Wang, X. et al. Three-dimensional intact-tissue sequencing of single-cell transcriptional states. Science 361, (2018).

[0460] 34. Zangi, Lior, et al. "Modified mRNA directs the fate of heart progenitor cells and induces vascular regeneration after myocardial infarction." Nature Biotechnology. 31.10 (2013): 898.

[0461] 35. Bahl, Kapil, et al. "Preclinical and clinical demonstration of immunogenicity by mRNA vaccines against H10N8 and H7N9 influenza viruses." Molecular Therapy. 25.6 (2017): 1316-1327.

[0462] 36. Richner, Justin M., et al. "Modified mRNA vaccines protect against Zika virus infection." Cell. 168.6 (2017): 1114-1125. Example 5: Chemically modified mocRNA for highly efficient protein expression in mammalian cells.

[0463] As evidenced by the recent clinical trials and approval of messenger RNA (mRNA) vaccines for SARS-CoV-2 1,2 mRNA is an emerging and promising alternative to traditional protein-based drugs, primarily due to its programmability, rapid production of proteins in vivo, relatively low-cost manufacturing, and potential scalability for the simultaneous production of multiple proteins. 3-5 However, mRNA has been shown to robustly generate therapeutic proteins in vivo. 3,6-8 However, their relatively short life span may limit their clinical use where high amounts of protein production are required. 3,9 Depending on the intended function of the therapeutic protein, the dosage and duration of treatment for mRNA drugs can vary by orders of magnitude. For vaccines, expression of antigens in the nanogram to microgram range can be sufficient to elicit an immune response. 3 However, for growth factors, hormones, or antibodies, therapeutic doses can range from micrograms to milligrams, or even gram quantities of protein. 3 Simply scaling up mRNA quantities to achieve high protein production can lead to dose-dependent toxicity due to innate immune stimulation inherent in mRNA transfection. 3 This combination of factors drives the need to engineer mRNA vectors to boost transgenic protein production without increasing dosage, particularly by improving mRNA longevity and / or translation efficiency.

[0464] Chemical modification is an effective method to improve the performance of mRNA vectors. Exogenous mRNA prepared by in vitro transcription (IVT) consisting of "unmodified" adenosine (A), guanosine (G), cytidine (C), and uridine (U) strongly induces innate immune toxicity, which suppresses protein expression. 10-12The incorporation of modified U derivatives, such as pseudouridine and N1-methylpseudouridine, has been widely used to increase translation, specifically by reducing innate immune toxicity through blocking Toll-like receptor recognition. 10-14 However, this strategy currently limits the chemical space of mRNA modifications available for incorporation because many modified nucleoside triphosphates (NTPs) are not tolerated by RNA polymerase or the ribosomal machinery. Moreover, certain chemical modifications on the protein-coding region of mRNA can potentially cause impaired translation. 14-16 An alternative strategy to increase mRNA stability without modifying the coding region is to selectively incorporate modified NTPs during enzymatic elongation of the mRNA poly(A) tail, which is particularly vulnerable to cellular exonucleases. 17,18 Although promising, this strategy relies on poly(A) polymerases, which again face limited chemical repertoires, variable efficiencies of enzymatic incorporation, and the generation of a variable distribution of poly(A) tail lengths. 18 .

[0465] To overcome the aforementioned limitations, we developed a ligation-based strategy to efficiently construct messenger-oligonucleotide-conjugated RNA (mocRNA) for mRNA-based expression systems with enhanced protein production. In this approach, synthetic oligonucleotides (oligos) are ligated to the 3' end of template-encoded mRNA containing a poly(A) tail (Figures 7A and 7B). This allows for precise and modular encoding of chemical modifications onto RNA vectors, which is not possible using RNA polymerase-mediated integration. Poly(A) tail shortening has been identified as a critical step in cellular mRNA decay, and poly(A) tails are essential for cap-dependent translation. 19,20 Therefore, as a proof of concept for the mocRNA system, various nuclease-resistant motifs were used. 21was designed and tested in a synthetic oligonucleotide to protect the poly(A) tail, which demonstrated superior protein expression compared to alternative variants of mRNA vectors. Results and Discussion Highly efficient synthesis of mocRNA by ligation

[0466] To enable conjugation between in vitro transcribed (IVT) mRNA and synthetic oligos, we designed each oligo with the following elements (Figure 7A, Table 4): (1) a 5' phosphate and at least six unstructured RNA nucleotides at the 5' end of the oligo for ligation to the 3' end of IVT mRNA by T4 RNA ligase I; (2) a 3' blocking group (2'-3 dideoxycytidine [ddC] or inverted 2'-deoxythymidine [InvdT]) to prevent oligo self-ligation; and (3) comparable lengths of poly(A) tracts to enable reliable comparison of translational enhancement. The 3' blocking group of the oligo allows for a large molar excess of oligos in the reaction, ensuring near 100% conversion of IVT mRNA to mocRNA product (Figures 7A and 7B, Table 4). [Table 4-1] [Table 4-2]

[0467] To demonstrate the mocRNA expression system, a plasmid template containing humanized monster green fluorescent protein (GFP) followed by a template-encoded poly(A) tail was cloned (plasmid: pCS2_GFP-60A). This ensures translatable mRNA with uniform poly(A) length. An mRNA encoding GFP with 100% replacement of uridine with a 5' anti-reverse cap analog (ARCA) and N1-methylpseudouridine (GFP-60A) was synthesized using IVT with SP6 polymerase. The IVT mRNA was further modified into mocRNA by 3' oligo ligation using T4 RNA ligase I. Conjugation efficiency was determined by sequence-specific RNA cleavage using RNase H and a DNA oligo targeting the 3' untranslated region (UTR), followed by gel electrophoresis to resolve the 3' ends of the conjugated and unconjugated mRNAs. RNase H assays showed near 100% conjugation efficiency for all mocRNA constructs using the previously described GFP-60A mRNA (Fig. 7B, 12A), suggesting the general applicability of this conjugation strategy. Nuclease-resistant mocRNA increases protein production and RNA stability in human cells

[0468] Because the endogenous deadenylation machinery is a 3' to 5' exonuclease complex and deadenylation is the rate-limiting step in classical RNA decay in cells, we hypothesized that introducing a nuclease-resistant element at the 3' end after the poly(A) tail would be an effective way to increase RNA translational capacity by keeping the poly(A) tail intact. To this end, mocRNA constructs were synthesized using synthetic oligos (3xSrA_ddC, 3xSrA_InvdT, and 3xSrG_InvdT, and 6xSr(AG), Table 4) and containing 3'-end deadenylase-resistant modifications, such as phosphorothioate PS linkages. 18 and A to G substitution 22The mocRNA construct encoding GFP was transfected into HeLa cells together with E-PAP poly(A)-tailed mCherry mRNA, which served as an internal transfection control. The GFP / mCherry fluorescence intensity ratio was quantified by confocal microscopy at 24, 48, and 72 hours after transfection. Fluorescence quantification showed that the control mocRNA construct, containing a 29-nt-long poly(A) tract followed by a 3' ddC (29rA_ddC), increased GFP fluorescence by 69% compared to the mock ligation control (GFP-60A mRNA treated with ligase without the modified oligo). This increase was likely due to the elongation of the poly(A) tail and possibly the presence of chain-terminating nucleotides. Of all oligos containing terminal PS linkages, an unstructured single-stranded (ss) RNA oligo with six consecutive phosphorothioates (6xSr(AG), sequence shown in Table 4) consistently provided the highest expression of GFP (290%–377% at 24–72 h normalized to “mock ligation”) compared to other modified oligos tested (Figures 8A–8B; Table 6). [Table 6]

[0469] The success of PS-modified mocRNAs led us to hypothesize that RNase-resistant DNA junctions at the 3' end might similarly enhance protein translation. A telomere-derived DNA quadruplex (G4_telo_DNA_WT) sequence significantly enhanced protein translation (150%-170% at 24-72 h) compared with unstructured "GtoC" DNA oligo control ligations (Figures 8A and 8B; Table 6). These results suggest that mocRNAs containing unstructured ssDNA at their 3' ends are more resistant to cellular nucleases, such as ssDNA-specific nucleases. 23,24 and CCR4 (a component of the deadenylation complex) which contains some ssDNAse activity. 25An alternative possibility is that unstructured ssDNAs may induce mRNA degradation by RNase H if they are partially complementary to the mRNA sequence. 26 Taken together, these results indicate that mocRNAs containing a structured DNA quadruplex at their 3' ends can most effectively increase protein expression, whereas unstructured ssDNA tails can enhance expression to a somewhat lesser extent.

[0470] We further explored whether combining PS modifications with G4 secondary structures could synergistically stabilize mocRNAs. ssDNA and ssRNA G4 oligos containing six consecutive PS linkages (G4_C9orf72_RNA_6xSrG, G4_C9orf72_DNA_6xSrG, and G4_telo_DNA_6xSrG) conferred enhanced translation levels similar to those of mocRNAs containing unstructured 6xSr(AG) oligos (Figures 8A and 8B; Table 6).

[0471] The improved translation of mocRNA could be due to either a reduced RNA degradation rate or a direct increase in translation efficiency per mRNA without affecting mRNA degradation kinetics. To examine the mechanism of translation improvement, RT-qPCR quantification was performed on HeLa cells transfected with various mocRNA ligation constructs 48 hours after transfection (Table 7). The relative GFP / mCherry RNA ratio was found to correlate well with the bulk GFP / mCherry protein fluorescence ratio observed for each construct (Figure 8C, Pearson r = 0.84, P = 2e-4; Figures 13B and 13C), suggesting that the modified oligos improve protein translation primarily by stabilizing mRNA abundance in cells. [Table 7]

[0472] The stochastic nature of lipid-mediated transfection and endosome disruption can result in large variations in the number of transfected mRNAs between individual cells. 27 To characterize whether the observed translational enhancement of mocRNA represents a general increase in translation across the entire cell population or whether it results from a small set of highly expressing cells, the GFP / mCherry protein fluorescence and RNA copy number ratios were quantified at the single-cell level. Single-cell fluorescence analysis of the GFP / mCherry fluorescence ratio (Figure 13A) reproduced the trends observed in bulk measurements (Figure 8A). mRNA abundance in transfected cells was analyzed using the in situ transcriptome method STARmap 28 The subcellular resolution can be used to identify the copy number of target mRNA sequences in fixed cells or tissue samples (Figures 8D and 13B). In STARmap images, fluorescent spots correspond to free "cytosolic" GFP-mocRNA or mCherry mRNA, respectively. Large intracellular granules likely correspond to lipid transfection vesicles containing many copies of GFP-mocRNA and mCherry mRNA (Figure 8D). While RT-qPCR provides a bulk measurement of mRNA (cytosolic and transfection reagent-contained), STARmap allows spatial separation of these two signals by filtering out the signal from large aggregates, allowing direct quantification of individual cytosolic mRNAs. Importantly, quantification of the cytosolic RNA fraction at the single-cell level indicates that the stabilizing effect of mocRNA also occurs throughout the cell population (Figures 13C and 13D). Protein and RNA kinetics indicate increased stability of mocRNA in cells

[0473] It seemed plausible that the translation observed from the initial screening of PS+G4 oligos could potentially be confounded by the extension of poly(A) tails of different lengths (26 As in 6xSr(AG) and 6 As in G4_C9orf72_RNA_6xSrG, G4_C9orf72_DNA_6xSrG, and G4_teloJDNA_6xSrG). To address this point directly, a comparison was made between 6xSr(AG) and redesigned longer PS+G4 oligos containing similar numbers of As: 26rA_G4_C9orf72_RNA_6xSrG, 26rA_G4_C9orf72_DNA_6xSrG, and 26rA_G4_telo_DNA_6xSrG. The HeLa expression time course indicated that 6xSr(AG) outperformed the 26A-containing C9orf72 oligo in enhancing expression. However, 26rA_G4_telo_DNA_6xSrG demonstrated modest translation enhancement compared to 6xSr(AG) (17-24% over the 24-72 h period, Figure 14A). These data suggest that specific telomere structures may add a relatively low level of additional stabilization beyond that provided by PS junctions. Given the similar levels of expression between 6xSr(AG) and 26rA_G4_telo_DNA_6xSrG mocRNA, these two oligos were examined by downstream kinetic analysis of protein expression.

[0474] To characterize the kinetics of mocRNA translation at various time points, we generated a mocRNA encoding firefly luciferase tagged with a degron (PEST) derived from mouse ornithine decarboxylase. 29) reduced the luciferase half-life in HeLa cells from 20.4 h to an estimated 0.92 h (Figure 9A). Luciferase-PEST mocRNAs containing either of the two best-performing oligos, 6xSr(AG) and 26rA_G4_telo_DNA_6xSrG, were generated, and luminescence was recorded as a function of time after mRNA transfection into HeLa cells. Eight hours after transfection, the 6xSr(AG) and 26rA_G4_telo_DNA_6xSrG mocRNAs (encoding luciferase degrons) demonstrated slightly greater levels of translation than mock ligation (44% and 39% greater signals, respectively). However, by 48 and 72 h, both mocRNAs substantially outperformed mock ligation. 6xSr(AG) demonstrated 10- and 15-fold more signal, respectively, and 26rA_G4_telo_DNA_6xSrG demonstrated 15- and 25-fold more signal (Figure 9B). This translation improvement was not due to differences in transfection efficiency between the samples, as no comparable significant differences were observed in the translation of the cotransfected Renilla luciferase mRNA internal control (Figure 14C). The observed kinetics of mocRNA translation is consistent with the fact that, in contrast to mock ligation, 6xSr(AG) and 26rA_G4_telo_DNA_6xSrG possess intact poly(A) tails at these time points (enabling translation). Furthermore, in vitro translation experiments performed on mocRNA showed no substantial differences in translation efficiency between mocRNA and the control (Figure 14B). This indicates that increased protein expression from mocRNA is primarily attributable to improved mRNA lifetime rather than improved translation initiation efficiency.

[0475] The kinetics of mocRNA decay was further verified in cells by performing in situ mRNA visualization using STARmap at 24, 48, and 72 hours after transfection into HeLa cells (Figure 9C). GFP-60A mocRNA containing 29rA_ddC, 6xSr(AG), or 26rA_G4_telo_DNA_6xSrG was transfected into HeLa cells, and relative mRNA abundance was quantified over time. The 6xSr(AG) mocRNA sample exhibited 1.7-2.5-fold higher GFP / mCherry mRNA count ratios (averaged from single cells) than 29rA_ddC at each time point. In addition, 26rA_G4_telo_DNA_6xSrG had 1.7-3.1-fold higher GFP / mCherry mRNA count ratios compared to the 29rA_ddC control at each time point (Figure 9D). mocRNA outperforms alternative strategies for mRNA modification

[0476] Previous work has reported that PS linkages incorporated into poly(A) tails by E. coli poly(A) polymerase (E-PAP) can improve mRNA stability. 18Therefore, we also explored a strategy for E-PAP modification of the poly(A) tail. A panel of chemically modified ATP derivatives (XATP) was screened by introducing XATP spike-in into the poly(A) tailing reaction for capped GFP mRNA containing N1-methylpseudouridine instead of uridine (Figure 15). HeLa cells were cotransfected with various tail-modified GFP mRNAs along with an internal transfection control, tail-unmodified mCherry mRNA (100% ATP, E-PAP tailing), and the GFP / mCherry fluorescence ratio was monitored over a 3-day time course. Initial screening in HeLa cell experiments revealed that poly(A) modification with XATP spike-in increased normalized GFP production compared to unmodified poly(A) constructs, particularly for dATP (2'-deoxyadenosine triphosphate, 25-62% increase in normalized GFP / mCherry) and S-ATP (adenosine-5'-O-(1-thiotriphosphate), 42-91% increase) (Figure 15). S-ATP spike-in provided the most significant improvement in GFP expression (consistent with previously reported work). 18 ), and was therefore used to compare different mRNA modification strategies ( Figure 10A ).

[0477] We compared 6xSr(AG) versus GFP-60A mRNA functionalized with S-ATP by IVT or E-PAP incorporation (Figures 10A-10C) in terms of RNA length uniformity and protein production. While the mocRNA and IVT-modified constructs showed uniform length distributions, E-PAP-tailed mRNAs had a broader distribution of tail lengths, with shorter lengths occurring with increasing percentages of S-ATP spike-in (Figure 10C). Using mCherry mRNA (100% E-PAP-tailed with A) as an internal transfection control, the GFP / mCherry fluorescence ratio was quantified in HeLa cells at 24, 48, and 72 hours after transfection. After normalization to the untreated GFP-60A control, 6xSr(AG) mocRNA resulted in the highest increase in GFP expression at various times posttransfection (24 h: 214 ± 45%; 48 h: 289 ± 68%; 72 h: 286 ± 32%; mean ± sd) (Figure 10D). Of all E-PAP-tailed mRNA constructs, the 25% S-ATP spike-in had the highest increase in GFP expression compared to the untreated GFP-60A control (24 h, 93 ± 21% increase). IVT-mediated incorporation of S-ATP proved beneficial with a small percentage of modified ATP (24 h, 5% S-ATP: 160 ± 7%). Decreased translation of the reporter (54 ± 5%) was observed with 25% S-ATP compared to untreated GFP-60A mRNA. Overall, this systematic comparison between different mRNA tail modification methods demonstrated the superior performance of mocRNA compared to E-PAP and IVT-modified mRNAs (Figure 10D). MocRNA constructs enhance protein expression in primary rat cortical neuron cultures

[0478] Neurons are major therapeutic targets in a variety of brain and nervous system-related diseases 30,31Although chemical / lipid-mediated transfection of DNA plasmids demonstrates limited expression efficiency in postmitotic cells such as neurons, mRNA transfection is an alternative for introducing transgenic protein expression in neurons with higher efficiency. 32 To explore whether mocRNA could increase protein production in primary cell cultures, the modified constructs were tested in primary cultures of rat cortical neurons.

[0479] GFP mocRNA prepared with 6xSr(AG) oligos and an unligated control were co-transfected with mCherry mRNA (E-PAP tailed with 100% rA, transfection control) for comparison at 24 and 48 h posttransfection (Figure 11A). Compared to the unligated GFP sample, GFP expression in the 6xSr(AG) mocRNA sample was an order of magnitude higher at both time points (24 h: 1015 ± 190%; 48 h: 1061 ± 210%) (Figures 11A-11B, Table 8). These results demonstrated that mocRNA can provide robust enhancement of protein expression in neuronal cell cultures compared to conventional mRNA vectors. [Table 8] MocRNAs possess similar toxicity profiles to therapeutic mRNAs

[0480] Unmodified IVT mRNA induces strong immune responses upon transfection, and these suppress the protein production 10-12 100% replacement of uridine with N1-methylpseudouridine is used in therapeutic mRNA (and mocRNA) preparations to minimize immunotoxicity. 12We further evaluated whether the chain-terminating nucleotides, PS linkages, or DNA-RNA covalent bonds introduced by synthetic oligos onto the mocRNA would induce additional cytotoxicity. First, cell numbers were quantified from the imaging data presented in Figure 8 to check for substantial reductions in cell proliferation and viability. No significant reduction in HeLa cell number was observed between any of the mocRNA conditions and the unligated mRNA control (Figure 16A). Additionally, innate immune stimulation in HeLa cells was measured by RT-qPCR measurement of IFNB1 mRNA for samples 48 hours post-transfection, as shown in Figure 8. IFNB1 upregulation is a consequence of RIG-I and MDA5 activation, which are innate immune sensors that recognize exogenous RNA species. 33-35 Unmodified GFP mRNA (100% uridine) and poly(I:C) transfection (a potent RIG-I agonist) 36 The positive control of rA_ddC induced statistically significant upregulation of IFNB1 mRNA when compared to the 29rA_ddC mocRNA control (Welch's t-test). However, no significant differences were observed between either mocRNA, unligated mRNA, and the transfection-only control (Figure 16B). These results indicate that, at least with the constructs explored in this study, mocRNA does not inherently enhance innate immune responses over intact mRNA.

[0481] Finally, mocRNA-mediated toxicity was analyzed in neurons using live-dead cell staining (Hoechst staining and NucRed Dead 647) on transfected rat cortical neuron cultures. The percentage of dead neurons was calculated in each culture condition to test for differences in cytotoxicity between mocRNA and conventional mRNA transfection. No significant differences in neuronal toxicity caused by 6xSr(AG) ligation were observed compared to transfection controls (Figure 16C). Together, these results suggest that the modifications identified in this study did not substantially modulate the toxicity profile of mRNA in the cell cultures tested. Summary and Conclusion

[0482] Existing methods for synthesizing chemically modified poly(A) tails using poly(A) polymerase often result in a wide distribution of tail lengths, which can make batch-to-batch uniformity difficult, and do not allow for precise control of the modification site. In contrast, mocRNA synthesis demonstrates near-100% yield and can fully preserve mRNA uniformity, making it compatible with existing pipelines for the development of mRNA therapeutics. More importantly, the mocRNA expression system can introduce chemical modifications that cannot be incorporated by RNA polymerase, enabling precise control of the modification site to maximize the effect of RNA modification. As a first demonstration, mocRNAs with clustered nuclease-resistant motifs at the 3' end improved protein expression by protecting the poly(A) tail of the mRNA vector. Fluorescence protein measurements demonstrated that mocRNAs containing 3'-terminal PS linkages increased protein production by a factor of 2–4 in a human HeLa cell line (Figure 8A) and by 10-fold in primary rat cortical neuron cultures (Figure 11A). Combined bulk RT-qPCR and single-cell resolved in situ STARmap measurements indicate that mocRNAs containing 3'-end PS modifications and specific telomeric sequences improve protein expression primarily by stabilizing the RNA (Figures 8A, 14A). 37 These mocRNA constructs have higher translational potential than existing variants of mRNA vectors that rely on random incorporation of modified NTPs during IVT and polyadenylation. 14,15,18 (Figure 10D).

[0483] In summary, a modular, programmable, and efficient strategy for synthesizing mocRNA has been developed, allowing for diverse and precise chemical modifications of RNA vectors to improve protein translation capacity and RNA stability. mocRNA can potentially be used in conjunction with other types of modification strategies, such as poly(A)-binding protein (PABP)-linked oligos (see, e.g., Barragan-Iglesias, et al. Nat Commun, 9(1): 10). 38, hydrolysis-resistant 7-methylguanosine cap 39,40 , modified 5'UTR region 41 , and other types of modified nucleotides on the mRNA body 42 The mocRNA design can serve as a generalizable platform for integrating organic synthesis with enzymatic synthesis to diversify chemical moieties and boost the functional effectiveness of RNA-based protein expression systems. method Plasmid cloning, characterization, and purification

[0484] Plasmids encoding hMGFP and mCherry (pCS...

Claims

1. Modified RNA, including: (i) a protein-encoding open reading frame (ORF) or a non-coding RNA sequence; and (ii) a polyA region; wherein the polyA region is 3' to the ORF or non-coding RNA sequence and comprises 10 or more nucleotides, wherein 3 or more of the last 10 nucleotides of the polyA region are modified nucleotides, and wherein at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

2. 2. The modified RNA of claim 1, wherein the polyA region is 3' to the open reading frame and comprises 25 or more adenosine nucleotides, wherein 2% to 90% of the nucleotides in the polyA region are modified nucleotides, wherein 3 or more of the last 25 nucleotides of the polyA region are modified nucleotides, and optionally 4 or more of the last 25 nucleotides of the polyA region are modified nucleotides.

3. 2. The modified RNA of claim 1, wherein two or more nucleotides of the last 25 nucleotide stretch of the polyA region are linked by modified internucleotide linkages.

4. 2. The modified RNA of claim 1, wherein 3 or more nucleotides of the last 25 nucleotide stretch of the polyA region are modified nucleotides, independently selected from deoxyribonucleotides, 2' modified nucleotides, and phosphorothioate linked nucleotides.

5. The modified RNA of claim 1 , wherein the three or more modified nucleotides are a stretch of nucleotides located at the 3' end of the polyA region.

6. 2. The modified RNA of claim 1, wherein a stretch of 6 or more nucleotides of the last 25 nucleotides of the polyA region contains the same type of nucleotide or internucleoside modification.

7. The modified RNA of claim 1 , wherein the modified RNA is a modified mRNA comprising an ORF.

8. The modified RNA of claim 1 , wherein the modified RNA is a modified non-coding RNA comprising a non-coding RNA sequence.

9. The modified RNA of claim 1, wherein the modified RNA further comprises (iii) one or more copies of a structural sequence comprising at least two nucleotides capable of forming a secondary structure, wherein the one or more copies of the structural sequence are 3' to the polyA region, wherein the modified RNA comprises a secondary structure, and wherein the secondary structure comprises one or more copies of the structural sequence.

10. The modified RNA of claim 9, wherein the modified RNA is a circular mRNA, wherein one or more copies of the structural sequence are between the polyA region and the 5'UTR.

11. The modified RNA of claim 9 or 10, wherein the structural sequence is selected from the following: (a) a G-quadruplex sequence of an RNA, optionally wherein the G-quadruplex sequence of the RNA comprises a nucleic acid sequence of SEQ ID NO:2, optionally wherein the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2; (b) a DNA G-quadruplex sequence, optionally, the DNA G-quadruplex sequence comprises a nucleic acid sequence of SEQ ID NO:3, and optionally, the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3; and (c) a telomeric repeat sequence, optionally wherein the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4, and optionally wherein the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:

4.

12. The modified RNA of claim 9 or 10, wherein the secondary structure of the RNA is an aptamer capable of binding to a target molecule.

13. Modified RNA, including: (i) a protein-encoding open reading frame (ORF) or a non-coding RNA sequence; (ii) a polyA region; (iii) one or more copies of a structural sequence comprising at least two nucleotides capable of forming a secondary structure; wherein the polyA region is 3' to the open reading frame and comprises 10 or more nucleotides, wherein one or more copies of the structural sequence are 3' to the polyA region, and wherein the modified RNA comprises a secondary structure, wherein the secondary structure comprises one or more copies of the structural sequence.

14. The modified RNA of claim 13, wherein the modified RNA is a circular mRNA, wherein one or more copies of the structural sequence are between the polyA region and the 5'UTR.

15. The modified RNA of claim 13 or 14, wherein the structural sequence is selected from the following: (a) a G-quadruplex sequence of an RNA, optionally wherein the G-quadruplex sequence of the RNA comprises a nucleic acid sequence of SEQ ID NO:2, optionally wherein the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2; (b) a DNA G-quadruplex sequence, optionally, the DNA G-quadruplex sequence comprises a nucleic acid sequence of SEQ ID NO:3, and optionally, the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3; and (c) a telomeric repeat sequence, optionally wherein the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4, and optionally wherein the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:

4.

16. The modified RNA of claim 13 or 14, wherein the secondary structure of the RNA is an aptamer capable of binding to a target molecule.

17. 14. The modified RNA of claim 13, wherein the polyA region is 3' to the ORF or non-coding RNA sequence and comprises 10 or more nucleotides, wherein 3 or more of the last 10 nucleotides of the polyA region are modified nucleotides, and wherein at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the nucleotides in the polyA region are modified nucleotides.

18. 14. The modified RNA of claim 13, wherein the polyA region is 3' to the open reading frame and comprises 25 or more adenosine nucleotides, wherein 2% to 90% of the nucleotides in the polyA region are modified nucleotides, wherein 3 or more of the last 25 nucleotides of the polyA region are modified nucleotides, and optionally 4 or more of the last 25 nucleotides of the polyA region are modified nucleotides.

19. 14. The modified RNA of claim 13, wherein two or more nucleotides of the last 25 nucleotide stretch of the polyA region are linked by modified internucleotide linkages.

20. 14. The modified RNA of claim 13, wherein 3 or more nucleotides of the last 25 nucleotide stretch of the polyA region are modified nucleotides, independently selected from deoxyribonucleotides, 2' modified nucleotides, and phosphorothioate linked nucleotides.

21. 14. The modified RNA of claim 13, wherein the three or more modified nucleotides are a stretch of nucleotides located at the 3' end of the polyA region.

22. 14. The modified RNA of claim 13, wherein a stretch of 6 or more nucleotides of the last 25 nucleotides of the polyA region contains the same type of nucleotide or internucleoside modification.

23. The modified RNA of claim 13, wherein the modified RNA is a modified mRNA comprising an ORF.

24. The modified RNA of claim 13, wherein the modified RNA is a modified non-coding RNA comprising a non-coding RNA sequence.

25. 14. A method of producing a modified RNA according to claim 1 or 13, the method comprising ligating a first RNA comprising an open reading frame encoding a protein or a non-coding RNA sequence to a tailing nucleic acid comprising one or more modified nucleotides in the presence of an RNA ligase, whereby the RNA ligase forms a covalent bond between the 3' nucleotide of the RNA and the 5' nucleotide of the tailing nucleic acid to produce the modified RNA; Optionally, the method further comprises circularizing the modified RNA in the presence of a ribozyme, wherein the modified RNA comprises a 3' intron and a 5' intron, wherein the 3' intron is 5' of the 5' UTR, and wherein the 5' intron is 3' of the polyA region, whereby the ribozyme forms a covalent bond between a nucleotide 3' of the 3' intron and a nucleotide 5' of the 5' intron to produce a circular RNA that does not contain a 5' intron or a 3' intron, and wherein the polyA region is between the 3' UTR and the 5' UTR of the circular RNA; Optionally, the method comprises ligating an RNA comprising an open reading frame encoding a protein to a tailing nucleic acid comprising one or more copies of the structural sequence in the presence of an RNA ligase, whereby the ligase forms a covalent bond between the 3' nucleotide of the RNA and the 5' nucleotide of the tailing nucleic acid to produce a modified RNA.

26. 26. The method of claim 25 further comprising the steps of: (i) introducing a 5' terminal phosphate group onto the first nucleotide of the modified RNA; (ii) cleaving one or more 3' terminal nucleotides of the modified RNA to produce a modified RNA having a 3' terminal hydroxyl group; and (iii) circularizing the modified RNA produced in step (ii) in the presence of a circularization ligase; The circularization ligase thereby forms a covalent bond between the 3' nucleotide of the modified RNA and the 5' nucleotide of the modified RNA to produce a circular modified RNA, where the polyA region is between the 3'UTR and the 5'UTR.

27. 26. The method of claim 25, wherein the structural sequence is selected from the following: (a) a G-quadruplex sequence of an RNA, optionally wherein the G-quadruplex sequence of the RNA comprises a nucleic acid sequence of SEQ ID NO:2, optionally wherein the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:2; (b) a DNA G-quadruplex sequence, optionally, the DNA G-quadruplex sequence comprises a nucleic acid sequence of SEQ ID NO:3, and optionally, the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:3; and (c) a telomeric repeat sequence, optionally wherein the telomeric repeat sequence comprises the nucleic acid sequence of SEQ ID NO:4, and optionally wherein the modified RNA comprises at least three copies of the nucleic acid sequence of SEQ ID NO:4.

Images