Granulocyte-macrophage precursors engineered with chimeric antigen receptors for cancer immunotherapy

Abstract

The present disclosure provides a method for engineering granulocyte-macrophage precursors (GMPs) to express chimeric antigen receptors (CARs) and their use, including for cancer immunotherapy. In certain embodiments, the present disclosure provides a method for engineering GMPs to express chimeric antigen receptors (CARs), comprising the steps of: introducing a vector containing a CAR into the GMPs to form GMPs expressing the CAR (CAR-GMPs); expanding and culturing the CAR-GMPs in defined culture conditions for multiple passages to generate a population of CAR-GMPs; and inducing the population of CAR-GMPs to differentiate into granulocytes, macrophages, or dendritic cells in vitro, wherein the granulocytes, macrophages, or dendritic cells express the CARs.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 USC § 119 from U.S. Provisional Patent Application No. 63 / 190,387, filed May 19, 2021, the disclosure of which is incorporated herein by reference.

[0002] The present disclosure provides methods for engineering granulocyte-macrophage precursors (GMPs) to express chimeric antigen receptors (CARs) and uses thereof, including for cancer immunotherapy. [Background technology]

[0003] Granulocytes, macrophages and dendritic cells are essential components of the innate immune system in humans. They are the first line of defense against pathogens and play a central role in maintaining our body's homeostasis as well as in preventing a variety of diseases, including infections, metabolic diseases and cancer. These cells originate from a common precursor in the bone marrow, the granulocyte-macrophage precursor (GMP). Summary of the Invention [Problem to be solved by the invention]

[0004] Granulocyte-monocyte precursors (GMPs) are the common precursors of granulocytes and macrophages, two major components of the innate immune system. The inability to perform long-term expansion of GMPs and their derivatives has greatly limited the therapeutic application of these immune cells. In the studies presented herein, it was shown that homogeneous GMPs can be exponentially expanded over long periods of time in fully defined conditions. The expanded GMPs retained the key features of GMPs, including the ability to differentiate into functional granulocytes and macrophages. Transplantation of expanded GMPs effectively prevented bacterial infections in immunodeficient mice. Furthermore, expanded GMPs can be genetically engineered to produce macrophages that specifically phagocytose cancer cells. The methods and compositions described herein enable exponential expansion and genetically engineered GMPs. GMPs made by the methods and compositions of the present disclosure are useful for the development of immunotherapies to treat a wide range of diseases, particularly infectious diseases and cancer. [Means for solving the problem]

[0005] In certain embodiments, the disclosure provides a method for engineering granulocyte-macrophage precursors (GMPs) to express a chimeric antigen receptor (CAR), comprising the steps of: introducing a vector containing a CAR into the GMPs to form GMPs expressing a CAR (CAR-GMPs); expanding and culturing the CAR-GMPs for multiple passages in defined culture conditions to generate a population of CAR-GMPs; and culturing the population of CAR-GMPs in culture to differentiate into granulocytes, macrophages, or dendritic cells.The present invention provides a method comprising inducing in vitro that granulocytes, macrophages or dendritic cells express CAR. In a further embodiment, GMP is obtained from stem cells. In yet a further embodiment, the stem cells are hematopoietic stem cells. In another embodiment, the hematopoietic stem cells are isolated from the bone marrow of the subject. In yet another embodiment, the subject is a mammalian subject. In a further embodiment, the subject is a human patient. In yet a further embodiment, the CAR comprises an extracellular domain capable of binding to an antigen, a transmembrane domain, and at least one intracellular domain designed to increase the antitumor activity of granulocytes, macrophages and dendritic cells by increasing their phagocytosis and / or proinflammatory cytokine secretion. In another embodiment, the vector is a viral vector. In yet another embodiment, the viral vector can be replicating or non-replicating and can be an adenovirus vector, an adeno-associated virus (AAV) vector, a measles vector, a herpes vector, a retrovirus vector, a lentivirus vector, a rhabdovirus vector, a reovirus vector, a Seneca Valley virus vector, a poxvirus vector, a parvovirus vector or an alphavirus vector. In certain embodiments, the viral vector is a lentiviral vector. In another embodiment, the defined culture conditions include culturing CAR-GMP in a culture medium containing (i) a growth factor, (ii) a B-Raf kinase inhibitor, and (iii) a Wnt activator and / or a GSK-3 inhibitor, and the CAR-GMP remains morphologically substantially unchanged after undergoing multiple cell passages and / or clonal expansion. In a further embodiment, the culture medium is a mixture of DMEM / F12 and Neural Basal Medium (Neural Basal Medium).In yet a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal Medium in a ratio of about 5:1 to about 1:5. In another embodiment, the culture medium comprises DMEM / F12 and Neurobasal Medium in a ratio of about 1:1. In yet another embodiment, the culture medium comprises one or more supplements selected from insulin, transferrin, bovine serum albumin (BSA) fraction V, putrescine, sodium selenite, DL-α tocopherol, and / or linoleic acid. In a further embodiment, the culture medium is supplemented with insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-α tocopherol, and linoleic acid. In certain embodiments, the growth factor is stem cell factor (SCF). In another embodiment, the B-Raf kinase inhibitor is selected from the group consisting of GDC-0879, PLX4032, GSK2118436, BMS-908662, LGX818, PLX3603, RAF265, RO5185426, vemurafenib, PLX8394, SB590885, and any combination thereof. In yet another embodiment, the Wnt activator is selected from the group consisting of SKL 2001, BML-284, WAY 262611, CAS853220-52-7, QS11, and any combination thereof. In a further embodiment, the GSK-3 inhibitor is selected from the group consisting of CHIR99021, CHIR98014, SB216763, BIO, A1070722, AR-A014418, and any combination thereof. In another embodiment, the defined culture conditions include culturing CAR-GMP in a culture medium containing: (i) a growth factor; (ii) a B-Raf kinase inhibitor; (iii) an agent that inhibits mitogen-activated kinase interacting protein kinase 1 and 2 (Mnk1 / 2); (iv) an agent that inhibits the PI3K pathway; (v) optionally, one or more serum components; CAR-GMP remains substantially morphologically unchanged after undergoing multiple cell passages and / or clonal expansion. In a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal Medium. In yet a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 5:1 to about 1:5. In another embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 1:1. In yet another embodiment, the culture medium comprises one or more supplements selected from insulin, transferrin, bovine serum albumin (BSA) fraction V, putrescine, sodium selenite, DL-α tocopherol, and / or linoleic acid. In a further embodiment, the culture medium is supplemented with insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-α tocopherol, and linoleic acid. In a still further embodiment, the growth factor is stem cell factor (SCF). In another embodiment, the B-Raf kinase inhibitor is selected from the group consisting of GDC-0879, PLX4032, GSK2118436, BMS-908662, LGX818, PLX3603, RAF265, RO5185426, vemurafenib, PLX8394, SB590885, and any combination thereof. In a further embodiment, the agent that inhibits Mnk1 / 2 is selected from the group consisting of CGP-57380, cercosporamide, BAY1143269, tomivosertib, ETC-206, SLV-2436, and any combination thereof. In yet a further embodiment, the agent that inhibits the PI3K pathway is selected from the group consisting of 3-methyladenine, LY294002, alpelisib, wortmannin, quercetin, hSMG-1 inhibitor 11j, zandelisib, alpelisib hydrochloride, idelalisib, bupallisib, copanlisib, IPI549, dactolisib, pictilisib, SAR405, duvelisib, fimepinostat, GDC-0077, PI-103, YM-20 163, PF-04691502, taselisib, omipalisib, samotolisib, isorhamnetin, ZATK474, parsaclisib, rigosertib, AZD8186, GSK2636771, diciteltide, TG100-115, AS-605240, PI3K-IN-1, dactolisib tosilate, gedatolisib, TGX-221, umbralisib, AZD 6482, serabelisib, bimiralisib, apitolisib, alpha-linolenic acid, Vps34-PIK-III, PIK-93, Vps34-IN-1, CH5132799, leniolisib, voxtalisib, GSK1059615, sonolisib, PKI-402, PI4KIII beta-IN-9, HS-173, BGT226 maleate, pictilisib dimethanesulfonate, V S-5584, IC-87114, quercetin dihydrate, CNX-1351, SF2523, GDC-0326, seletalisib, acalisib, SAR-260301, ZAD-8835, GNE-317, AMG319, nemiralisib, IITZ-01, PI-103 hydrochloride, oroxine B, pilaralisib, AS-252424, cpanlisib dihydrochloride, AMG 511, disitertide TFA, PIK-90, tenalisib, esculetin, CGS15943, GNE-477, PI-3065, A66, AZD3458, ginsenoside Rk1, sophocarpine, buparisib hydrochloride, Vps34-IN-2, linperlisib, arnicolide D, KP372-1, CZC24832, PF-4989216, (R)-duparisib , PQR530, P11δ-IN-1, umbralisib hydrochloride, MTX-211, PI3K / mTOR inhibitor-2, LX2343, PF-04979064, polygalasaponin F, glaucocalyxin A, NSC781406, MSC2360844, CAY10505, IPI-3063, TG 100713, BEBT-908, PI-828, brevianamide F, ETP-46321, PIK-294, SRX3207, sophocarpine monohydrate, AS-604850, desmethylglycitein, SKI V, WYE-687, NVP-QAV-572, GNE-493, CAL-130 hydrochloride, GS-9901, BGT226, IHMT-PI3Kδ-372, PI3Kα-IN-4, Parsaclisib hydrochloride, PF-06843195, PI3K-IN-6, (S)-PI3Kα-IN-4, PI3K(gamma)-IN-8, BAY1082439, CYH33 , PI3Kγ inhibitor 2, PI3Kδ inhibitor 1, PARP / PI3K-IN-1, LAS191954, PI3K-IN-9, CHMFL-PI3KD-317, PI3K / HDAC-IN-1, MSC2360844 hemifumarate, PI3K-IN-2, PI3K / mTOR inhibitor-1, PI3Kδ-IN-1, Euscafe acid, KU-0060648, AZD 6482, WYE-687 dihydrochloride, GSK2292767, (R)-umbralisib, PIK-293, idelalisib D5, PIK-75, hirsutenone, quercetin D5, PIK-108, hSMG-1 inhibitor 11e, PI3K-IN-10, NVP-BAG956, PI3Kγ inhibitor 1, CAL-130, ON146040, PI3kδ inhibitor 1, PI3Kα / mTOR-IN-1, and any combination thereof. In another embodiment, the CAR-GMP is induced to differentiate into macrophages, which comprises culturing the CAR-GMP with a macrophage differentiation medium comprising macrophage colony-stimulating factor (MCSF), and the macrophages express CAR. In yet another embodiment, the macrophage differentiation medium comprises RPMI 1640, fetal bovine serum (FBS), and MCSF. In an alternative embodiment, the method further comprises differentiating the CAR-GMP into granulocytes, which comprises culturing the GMP with a granulocyte differentiation medium comprising granulocyte colony-stimulating factor (GCSF), and the granulocytes express CAR. In a further embodiment, the granulocyte differentiation medium comprises RPMI 1640, FBS, and GCSF.

[0006] In certain embodiments, the present disclosure also provides a CAR-expressing macrophage produced by the methods of the present disclosure.

[0007] In certain embodiments, the present disclosure further provides a CAR-expressing granulocyte produced by the methods of the present disclosure.

[0008] In another embodiment, the disclosure provides an immunotherapeutic method for treating a subject having cancer with macrophages or granulocytes expressing a CAR, comprising administering to the subject having cancer a composition comprising macrophages expressing a CAR produced by the method of the disclosure or granulocytes expressing a CAR produced by the method of the disclosure. In a further embodiment, the composition is administered intravenously or intratumorally. In yet a further embodiment, the macrophages or granulocytes are obtained from GMP derived from stem cells of the subject being treated with the immunotherapeutic method. In another embodiment, the subject is treated with the immunotherapeutic method for adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, anorectal cancer, cancer of the anal canal, appendix cancer, pediatric cerebellar astrocytoma, pediatric cerebral astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), biliary tract cancer, extrahepatic bile duct cancer, intrahepatic bile duct cancer, bladder cancer, urinary bladder cancer, ...bladder cancer, bone and joint cancer, osteosarcoma and malignant fibrous histiocytoma, brain cancer, brain tumors, brain stem glioma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic glioma, breast cancer including triple negative breast cancer, bronchial adenoma / carcinoid, carcinoid tumor, gastrointestinal tract, nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancer, Chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorder, colon cancer, colorectal cancer, cutaneous T-cell lymphoma, lymphoid neoplasms, mycosis fungoides, Seziary syndrome, endometrial cancer, esophageal cancer, extracranial germ cell tumors, extragonadal germ cell tumors, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors (GIST), germ cell tumors, ovarian germ cell tumors, Gestational trophoblastic neoplasms, Head and neck cancer, Hepatocellular (liver) cancer, Hodgkin's lymphoma, Hypopharyngeal cancer, Intraocular melanoma, Eyeball cancer, Islet cell tumor (pancreatic endocrine), Kaposi's sarcoma, Kidney cancer, Renal cancer, Laryngeal cancer, Acute lymphoblastic leukemia, Acute myeloid leukemia, Chronic lymphocytic leukemia, Chronic myeloid leukemia, Hairy cell leukemia, Lip and oral cavity cancer, Liver cancer, Lung cancer, Non-small cell lung cancer, Small cell lung cancer, AIDS-related lymphoma, Non-Hodgkin's lymphoma, Primary central nervous system lymphoma, Waldenstramm hypergammaglobulinemia, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell carcinoma, malignant mesothelioma, mesothelioma, metastatic squamous cell neck cancer, oral cancer, tongue cancer, multiple endocrine neoplasia syndrome, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative disease, chronic myeloid leukemia, acute myelocytic leukemia, multiple myeloma, chronic myeloproliferative disorder, nasopharyngeal carcinoma, neuroblastoma, oral cancer, oral ovarian cancer, ovarian epithelial cancer, ovarian tumor of low malignant potential, pancreatic cancer, islet cell pancreatic cancer, paranasal sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineoblastoma and supratentorial primitive neuroectodermal tumor, pituitary tumor, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, prostate cancer, rectal cancer, renal pelvis and ureter, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Ewing family sarcoma tumorsThe subject has a cancer selected from: uterine cancer, uterine sarcoma, skin cancer (non-melanoma), skin cancer (melanoma), papilloma, actinic keratosis and keratoacanthoma, Merkel cell skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach (gastric) cancer, supratentorial primitive neuroectodermal tumor, testicular cancer, laryngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter and other urinary organs, gestational trophoblastic tumor, urethral cancer, endometrial uterine cancer, uterine sarcoma, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor. In yet another embodiment, the immunotherapy method further comprises administering one or more anti-cancer agents to the subject with cancer. [Brief description of the drawings]

[0009] [Figure 1]Figure 1A-E shows that αCD19 CAR-macrophages generated from engineered SCF / 2i GMPs effectively phagocytose human B-ALL cells. (A) SCF / 2i GMPs were electroporated with GFP mRNA or transduced with GFP lentivirus (pSin-GFP). 48 h after transfection, GFP expression was analyzed by fluorescence microscopy (upper panel) and flow cytometry (lower panel). Flow cytometry data are shown as mean ± SD from five independent experiments. (B) SCF / 2i GMPs derived from CAG-Cas9-GFP mice were electroporated with control or GFP sgRNA and GFP expression was analyzed by flow cytometry 48 h after electroporation. Data are shown as mean ± SD from three independent experiments. (C) Schematic diagram showing the structures of CarP-RFP, CarPFc-19-RFP and CarPzFc-19-RFP. (D) SCF / 2i GMPs were transduced with CarP-RFP or CarPzFc19-RFP lentivirus, and RFP-positive GMPs were selected and further expanded in SCF / 2i. 1x105 macrophages derived from RFP-positive GMPs were co-cultured with 1x106 GFP-positive human B-ALL cells pre-treated with or without anti-CD47 antibody. Cells were washed with PBS 1 h after co-culture, and phase contrast and fluorescence images were acquired. (E) Cells in (D) were trypsinized, and GFP and RFP expression were analyzed by flow cytometry. The percentage of phagocytic macrophages was quantified. Data are shown as mean ± SD from three independent experiments. [Diagram 2]Figure 2A-C shows the expansion, differentiation and genetic manipulation of GMPs. (A) Phagocytosis analysis of GMP-derived macrophages by incubation with GFP-labeled E. coli for 1 h. Representative phase contrast and fluorescence images showing GFP-labeled bacteria engulfed by macrophages, and representative plots of flow cytometry analysis of GMP-derived macrophages incubated with (red) or without (blue) GFP-labeled bacteria. Flow cytometry data are shown as mean ± SD from three independent experiments. (B) Differentiated cells were plated in 96-well plates at a density of 2 × 104 cells / well and stimulated with or without 500 ng / ml LPS for 6 h, after which cytokine secretion in the supernatant was measured by ELISA. Data are shown as mean ± SD from three independent experiments. (C) GMPs expanded in modified SCF / 2i were transduced with CarP-RFP or human CarPzFc19-RFP lentivirus. RFP-positive GMPs were selected and further expanded in modified SCF / 2i. Macrophages derived from RFP-positive GMPs were plated in 24-well plates at a density of 1×105 cells / well and cultured overnight in DMEM / 10% FBS, after which 1×106 GFP-positive human B-ALL cells pretreated with or without anti-CD47 antibody were added to each well. After 1 h of co-culture, cells were washed with PBS, trypsinized, and GFP and RFP expression were analyzed by flow cytometry. The percentage of phagocytic macrophages was quantified. Data are presented as mean ± SD from three independent experiments. [Diagram 3]Figure 3A-D, in relation to Figure 1, shows the phagocytosis of human B-ALL cells by genetically engineered SCF / 2i GMP-derived macrophages. (A) SCF / 2i mouse GMPs were transduced with CarP-RFP or CarPFc19-RFP lentivirus, and RFP-positive cells were selected and expanded in SCF / 2i. Macrophages derived from RFP-positive mouse GMPs were plated in 24-well plates at a density of 1 × 105 cells / well and cultured overnight in DMEM / 10% FBS, after which 1 × 106 GFP-positive human B-ALL cells were added to each well. After 1 h of co-culture, cells were washed with PBS, trypsinized, and GFP and RFP expression were analyzed by flow cytometry. The percentage of phagocytic macrophages was quantified. Data are shown as the mean ± SD from three independent experiments. (B) Time-lapse images showing the process of phagocytosis of CarPzFc19-RFP-expressing macrophages at different time points. Time is indicated in minutes. Arrows indicate GFP-positive B-ALL cells before and after phagocytosis. Images were extracted from the video. (C) SCF / 2i mouse GMPs were transduced with αHER2 CarPzFc19-RFP lentivirus. RFP-positive GMPs were selected and expanded in SCF / 2i. Macrophages derived from RFP-positive GMPs were plated in 24-well plates at a density of 1 × 105 cells / well and cultured overnight in DMEM / 10% FBS, after which 1 × 106 GFP-positive SK-BR-3 cells were added to each well. After 1 h of co-culture, phase-contrast and fluorescence images were acquired. (D) SCF / 2i GMPs were transduced with αCD19 CarPzFc19-RFP or αHER2 CarPzFc19-RFP lentivirus, and RFP-positive GMPs were selected and further expanded in SCF / 2i. 1x105 macrophages expressing αCD19 CarPzFc19-RFP or αHER2 CarPzFc19-RFP were co-cultured with GFP-positive human B-ALL or SKBR-3 cells. After 1 h of co-culture, cells were washed with PBS, trypsinized, and GFP and RFP expression were analyzed by flow cytometry. The percentage of phagocytic macrophages was quantified.Data are presented as the mean ± SD from three independent experiments. [Figure 4] Figure 4A-B, in relation to Figure 2C, shows that αCD19 CAR-macrophages derived from engineered GMPs efficiently phagocytose human B-ALL cells. (A) GMPs were expanded in modified SCF / 2i and transduced with human CarPzFc19-RFP (h CarPzFc19-RFP) lentivirus. Macrophages derived from hCarPzFc19-RFP-expressing GMPs were co-cultured with GFP-labeled human B-ALL cells. After 1 h of co-culture, phase contrast and fluorescence images were acquired. (B) Sequential fluorescence images of hCarPzFc19-RFP-expressing macrophages co-cultured with GFP-labeled human B-ALL cells pre-incubated with anti-CD47 antibody. [Diagram 5] Figure 5A-D shows that transplantation of αCD19 CAR-GMP attenuates leukemia cells in mice. (A) GFP-labeled human B-cell acute lymphoblastic leukemia (B-ALL) cells were injected into NSG mice to create a B-ALL mouse model. 21 days after B-ALL injection, aCD19 CAR-GMP or PBS was injected and FACS analysis was performed once a week to determine the percentage of GFP-positive B-ALL cells in the peripheral blood. (B) Representative FACS analysis results. (c) Viability for control (PBS) and treatment (aCD19 CAR-GMP). (D) Percentage of GFP-positive B-ALL cells in blood in control and treated mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of cells, reference to "the granulocyte-macrophage precursor" includes reference to one or more granulocyte-macrophage precursors and equivalents thereof known to those skilled in the art, and so forth.

[0011] Additionally, the use of "or" means "and / or" unless specifically stated otherwise. Similarly, "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and are not to be construed as limiting.

[0012] It is further understood that where the description of various embodiments uses the term "comprising," those of ordinary skill in the art will understand that in some specific instances an embodiment may alternatively be described using the words "consisting essentially of" or "consisting of."

[0013] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although many methods and reagents are similar or equivalent to those described herein, exemplary methods and materials are disclosed herein.

[0014] All publications mentioned herein are fully incorporated by reference for the purpose of describing and disclosing methodologies that may be used in conjunction with the descriptions herein. Furthermore, with respect to any term presented in one or more publications that is similar or identical to a term expressly defined in this disclosure, the definition of the term expressly provided in this disclosure shall prevail in all respects.

[0015] It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc. described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0016] Outside of the working examples, or where otherwise indicated, all numbers expressing amounts of ingredients or reaction conditions used herein should be understood to be modified in all instances by the term "about". The term "about" means ±1% when used to describe this disclosure in conjunction with percentages. In other examples, the term "about" as used herein refers to measurable values, such as amounts, durations, etc., and encompasses variations of ±20%, ±10%, ±5%, ±1%, ±0.5% or ±0.1% from the specified value.

[0017] As used herein, the term "administering" refers to the placement of an agent disclosed herein (e.g., an engineered GMP, or macrophages or granulocytes derived therefrom) into a subject by a method or route that results in at least partial localization of the agent at a desired site.

[0018] "Autologous" cells, as used herein, refer to cells derived from the same individual to whom the cells are subsequently readministered.

[0019] The term "antibody fragment" as used herein generally refers to a protein fragment comprising only a portion of an intact antibody that includes the antigen-binding site of the intact antibody and thus retains the ability to bind antigen. Examples of antibody fragments encompassed by this definition include: (i) a Fab fragment having the VL, CL, VH and CH1 domains; (ii) a Fab' fragment, which is a Fab fragment having one or more cysteine ​​residues at the C-terminus of the CH1 domain; (iii) an FDA fragment having the VH and CH1 domains; (iv) an Fd' fragment having the VH and CH1 domains and one or more cysteine ​​residues at the C-terminus of the CH1 domain; (v) an Fv fragment having the VL and VH domains of a single arm of an antibody; (vi) a dAb fragment consisting of a VH domain (Ward et al., Nature 341, 544-546 (1989)); (vii) isolated CDR regions; (viii) an F(ab')2 fragment, which is a bivalent fragment comprising two Fab' fragments linked by a disulfide bridge at the hinge region; (ix) single chain antibody molecules (e.g., single chain Fv; scFv) (Bird et al., Science 242:423-426 (1988); and Huston et al., PNAS (USA) 85:5879-5883 (1988); (x) "bispecific antibodies" having two antigen-binding sites comprising a heavy chain variable domain (VH) connected to a light chain variable domain (VL) in the same polypeptide chain (see, e.g., EP 404,097; WO 93 / 11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); (xi) "linear antibodies" comprising a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen-binding regions (Zapata et al., Protein Eng. 8(10):1057-1062 (1995); and U.S. Pat. No. 5,641,870).

[0020] "B-Raf" kinase inhibitor refers to a substance, e.g., a compound or molecule, that blocks or reduces the activity of a protein called B-Raf kinase or reduces the amount of B-Raf kinase. B-Raf is a kinase enzyme that helps control cell growth and signal transduction. It can be found in mutated (altered) form in some types of cancer, including melanoma and colorectal cancer. Some B-Raf kinase inhibitors are used to treat cancer. Examples of B-Raf kinase inhibitors include, but are not limited to, GDC-0879, PLX4032, GSK2118436, BMS-908662, LGX818, PLX3603, RAF265, RO5185426, vemurafenib, PLX8394 and SB590885. In certain embodiments, the methods disclosed herein include the use of the B-Raf kinase inhibitor GDC-0879.

[0021] A "beneficial result" may include, but is in no way limited to, lessening or alleviating the severity of a disease state, preventing a disease state from worsening, curing a disease state, preventing a disease state from developing, reducing the likelihood that a patient will develop a disease state, and increasing a patient's life span or life expectancy. As non-limiting examples, a "beneficial result" or "desired result" may be the alleviation of one or more symptoms, a reduction in the extent of a defect, a stabilized (i.e., not worsening) state of cancer progression, a delay or slowing of metastasis or invasiveness, and the amelioration or alleviation of symptoms associated with cancer.

[0022] For the purposes of this disclosure, the term "cancer" is used to encompass cell proliferative disorders, neoplasms, precancerous cell disorders, and cancers, unless specifically indicated otherwise. Thus, "cancer" refers to any cell undergoing abnormal cell proliferation that may result in metastasis or tumor growth. Exemplary cancers include adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, anorectal cancer, cancer of the anal canal, appendix cancer, pediatric cerebellar astrocytoma, pediatric cerebral astrocytoma, basal cell carcinoma, skin cancer (non-melanoma), biliary tract cancer, extrahepatic bile duct cancer, intrahepatic bile duct cancer, bladder cancer, urinary bladder cancer, ...bladder cancer, bone and joint cancer, osteosarcoma and malignant fibrous histiocytoma, brain cancer, brain tumors, brain stem glioma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic glioma, breast cancer including triple negative breast cancer, bronchial adenoma / carcinoid, carcinoid tumor, gastrointestinal tract, nervous system cancer, nervous system lymphoma, central nervous system cancer, central nervous system lymphoma, cervical cancer, childhood cancer, Chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorder, colon cancer, colorectal cancer, cutaneous T-cell lymphoma, lymphoid neoplasms, mycosis fungoides, Seziary syndrome, endometrial cancer, esophageal cancer, extracranial germ cell tumors, extragonadal germ cell tumors, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors (GIST), germ cell tumors, ovarian germ cell tumors, Gestational trophoblastic neoplasms, Head and neck cancer, Hepatocellular (liver) cancer, Hodgkin's lymphoma, Hypopharyngeal cancer, Intraocular melanoma, Eyeball cancer, Islet cell tumor (pancreatic endocrine), Kaposi's sarcoma, Kidney cancer, Renal cancer, Laryngeal cancer, Acute lymphoblastic leukemia, Acute myeloid leukemia, Chronic lymphocytic leukemia, Chronic myeloid leukemia, Hairy cell leukemia, Lip and oral cavity cancer, Liver cancer, Lung cancer, Non-small cell lung cancer, Small cell lung cancer, AIDS-related lymphoma, Non-Hodgkin's lymphoma, Primary central nervous system lymphoma, Waldenstramm hypergammaglobulinemia, medulloblastoma, melanoma, intraocular (eye) melanoma, Merkel cell carcinoma, malignant mesothelioma, mesothelioma, metastatic squamous cell neck cancer, oral cancer, tongue cancer, multiple endocrine neoplasia syndrome, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative disease, chronic myeloid leukemia, acute myelocytic leukemia, multiple myeloma, chronic myeloproliferative disorder, nasopharyngeal carcinoma, neuroblastoma, oral cancer, oralCavity Cancer, Oropharyngeal Cancer, Ovarian Cancer, Ovarian Epithelial Cancer, Ovarian Tumor of Low Malignant Potential, Pancreatic Cancer, Islet Cell Pancreatic Cancer, Paranasal Sinus and Nasal Cancer, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pineoblastoma and Supratentorial Primitive Neuroectodermal Tumor, Pituitary Tumor, Plasma Cell Neoplasm / Multiple Myeloma, Pleuropulmonary Blastoma, Prostate Cancer, Rectal Cancer, Renal Pelvis and Ureter, Transitional Cell Carcinoma, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Ewing Family Sarcoma Tumor, Soft Tissue Sarcoma, Uterine Cancer, Uterine Sarcoma, Skin Cancer (Non-Melanoma) These include, but are not limited to, skin cancer (melanoma), papilloma, actinic keratosis and keratoacanthoma, Merkel cell skin cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach (gastric) cancer, supratentorial primitive neuroectodermal tumor, testicular cancer, laryngeal cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter and other urinary organs, gestational trophoblastic neoplasm, urethral cancer, endometrial uterine cancer, uterine sarcoma, uterine cancer, vaginal cancer, vulvar cancer, and Wilms' tumor.

[0023] "Chimeric antigen receptor" or "CAR" or "CARs" as used herein refers to an engineered receptor that grafts antigen specificity onto a cell (e.g., a GMP cell). CARs are also known as artificial T cell receptors, chimeric T cell receptors, or chimeric immune receptors. In various embodiments, a CAR is a recombinant polypeptide that includes an antigen-specific domain (ASD), a hinge region (HR), a transmembrane domain (TMD), a costimulatory domain (CSD), and an intracellular signaling domain (ISD).

[0024] "CAR binding domain" refers to the portion of a CAR that specifically binds to an antigen on a target cell. In some embodiments, the binding domain of a CAR comprises any of the known binding domains used in CAR constructs (see, e.g., PCT / US2017 / 064379), including antibodies or functional equivalents or fragments or derivatives thereof. The targeting region can comprise a full-length heavy chain, a Fab fragment, a single-chain Fv (scFv) fragment, a bivalent single-chain antibody, or a bispecific antibody, each of which is specific for a target antigen.

[0025] "Condition" and "disease state" as used herein may include cancer, tumor or infectious disease. In exemplary embodiments, the condition includes, but is in no way limited to, any form of malignant neoplastic cell proliferative disorder or disease.

[0026] "Costimulatory domain" as used herein refers to a portion of a CAR that contains a polypeptide domain that enhances cell proliferation, survival and / or development. The costimulatory domain is an optional domain or CAR. The CAR of the present invention may contain no costimulatory domain or may contain one or more costimulatory domains. Each costimulatory domain typically includes a member of the TNFR superfamily, CD28, CD137 (4-1BB), CD134 (OX40), Dap10, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, or a combination thereof. Other costimulatory domains (e.g., from other proteins) will be apparent to those skilled in the art.

[0027] "Diseases targeted by genetically modified GMPs" as used herein encompasses the targeting of any cell involved in any disease in any manner by the genetically modified GMP cells of the present disclosure (or granulocytes or macrophages derived therefrom), regardless of whether the genetically modified cells target diseased cells or healthy cells to produce a therapeutically beneficial result. The genetically modified cells express a CAR, which can target any of the antigens expressed on the surface of the target cells. Examples of antigens that can be targeted include, but are not limited to, antigens expressed on carcinomas, sarcomas, lymphomas, leukemias, germ cell tumors, and blastomas; antigens expressed on various immune cells; and antigens expressed on cells associated with various hematological, autoimmune, and / or inflammatory diseases. Other antigens that can be targeted will be apparent to those skilled in the art and can be targeted by the CARs of the present disclosure.

[0028] The term "effective amount" or "therapeutically effective amount" as used herein refers to an amount of a composition comprising a GMP (macrophage or granulocyte derived therefrom) engineered to express a CAR to reduce at least one or more symptoms of a disease or disorder, and relates to an amount of the composition sufficient to provide a desired effect. The phrase "therapeutically effective amount" as used herein means an amount of the composition sufficient to treat a disorder at a reasonable benefit / risk ratio applicable to any medical treatment.

[0029] A therapeutically or prophylactically significant reduction in symptoms is, for example, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150% or more reduction in a measured parameter compared to a control or untreated subject, or the state of the subject before administration of the cellular composition described herein. Measured or measurable parameters include clinically detectable markers of disease, such as elevated or suppressed levels of biological markers. The exact amount required will vary depending on factors such as the type of disease being treated, the sex, age and weight of the subject.

[0030] "Effector function" refers to a specialized function of a differentiated cell. An effector function of a granulocyte or macrophage can be, for example, cytolytic activity or secretion of cytokines.

[0031] The term "expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses and adeno-associated viruses, etc.) that incorporate the recombinant polynucleotide, all of which are known in the art.

[0032] "Granulocyte colony-stimulating factor" or "GCSF" (also known as colony-stimulating factor 3 (CSF3)) is a glycoprotein that stimulates bone marrow to produce granulocytes and stem cells. Gene sequences, protein sequences and orthologs across various species are known in the art (see, for example, NCBI Reference Sequence: NP_000750.1, which is incorporated herein by reference).

[0033] "Growth factor" refers to a substance, e.g., a compound or molecule, that is effective in promoting the growth of cells, e.g., stem cells, and is not a component of the basal medium unless added to the culture medium as a supplement. Growth factors include, but are not limited to, stem cell factor (SCF), basic fibroblast growth factor (bFGF), acidic fibroblast growth factor (aFGF), epidermal growth factor (EGF), insulin-like growth factor-I (IGF-I), insulin-like growth factor-II (IGF-II), platelet-derived growth factor-AB (PDGF), and vascular endothelial growth factor (VEGF), activin-A, Wnt and bone morphogenetic proteins (BMPs), insulin, cytokines, chemokines, morphogens, neutralizing antibodies, other proteins, and small molecules. Exogenous growth factors may also be added to the medium according to the present disclosure to help maintain the culture of GMP in a substantially undifferentiated state. Such factors or their effective concentrations may be identified as described elsewhere herein or using techniques known to those skilled in the art of culturing cells. In certain embodiments, the GMPs are cultured in a culture medium that includes SCFs.

[0034] "Hinge region" as used herein refers to a hydrophilic region between the CAR binding domain and the transmembrane domain of the CAR. Hinge regions include, but are not limited to, the Fc fragment of an antibody or a fragment or derivative thereof, the hinge region of an antibody or a fragment or derivative thereof, the CH2 region of an antibody, the CH3 region of an antibody, an artificial spacer sequence, or a combination thereof. Examples of hinge regions include, but are not limited to, the CD8a hinge, and an artificial spacer made of a polypeptide that can be as small as, for example, Gly3, or the CH1 and CH3 domains of IgG (e.g., human IgG4). Other hinge regions will be apparent to those skilled in the art and can be used in conjunction with alternative embodiments of the invention.

[0035] "Intracellular signaling domain" or "cytoplasmic domain" as used herein refers to the portion of CAR that contains the domain that transmits effector function signals and instructs the cell to carry out its specialized function. Examples of domains that transmit effector function signals include, but are not limited to, the z chain of the T cell receptor complex or any of its homologs (e.g., h chain, FceR1g and b chains, MB1 (Iga) chain, B29 (Igb) chain, etc.), human CD3 zeta chain, CD3 polypeptides (D, d and e), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.) and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. Other intracellular signaling domains will be apparent to those skilled in the art.

[0036] The term "isolated" as used herein refers to a molecule, biological agent, cell or cellular material that is substantially free of other materials with which it is normally associated. In one aspect, the term "isolated" refers to a nucleic acid, e.g., a DNA or RNA, or a protein or polypeptide (e.g., an antibody or derivative thereof), or a cell or cellular organelle, that is separated from other DNA or RNA, or proteins or polypeptides, or cells or cellular organelles, respectively, that are present in the natural source. The term "isolated" also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In addition, "isolated nucleic acid" is meant to include nucleic acid fragments that are not naturally occurring as fragments and are not found in the natural state. The term "isolated" is also used herein to refer to a polypeptide that is isolated from other cellular proteins, and is meant to encompass both purified and recombinant polypeptides. The term "isolated" is also used herein to refer to cells or tissues that are isolated from other cells or tissues, and is meant to encompass both cultured and engineered cells or tissues.

[0037] "Linker" or "linker domain" as used herein refers to an oligopeptide or polypeptide region, about 1-100 amino acids in length, that links together any of the domains / regions of the CAR of the present disclosure. Linkers may be composed of flexible residues, such as glycine and serine, so that adjacent protein domains are free to move relative to one another. Longer linkers may be used when it is desirable to ensure that two adjacent domains do not sterically hinder one another. Linkers may be cleavable or non-cleavable. Examples of cleavable linkers include 2A linkers (e.g., T2A), 2A-like linkers or functional equivalents thereof and combinations thereof. In some embodiments, linkers include picornavirus 2A-like linkers, CHYSEL sequences of porcine teschovirus (P2A), Thosea asigna virus (T2A) or combinations, variants and functional equivalents thereof. Other linkers will be apparent to one of skill in the art.

[0038] The term "lentiviral vector" refers to a vector derived from at least a portion of a lentiviral genome, including, inter alia, the self-inactivating lentiviral vectors provided in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that may be used in the clinic include, but are not limited to, Oxford BioMedica's LENTIVECTOR® gene delivery technology, Lentigen's LENTIMAX™ vector system, and the like. Non-clinical lentiviral vectors are also available and known to those skilled in the art.

[0039] As used herein, "long-term culture" or "long-term expansion" refers to the growth of cells under controlled conditions such that the cells expand in number and / or maintain substantial viability and substantially similar morphology. In some embodiments, the term refers to a period of culture (e.g., over a period of about 2 months or longer) while maintaining a desired morphology and cell number, or may relate to a number of culture passages (e.g., medium changes) of at least 10 culture passages. In other embodiments, the term refers to an increase in number over a period of time (e.g., at least a million-fold increase over a period of about 2 months). In some embodiments, the long-term culture is cultured for a period of more than 4 months, more than 6 months, or more than 1 year. In other embodiments, the long-term culture is passaged for more than 15 passages, more than 18 passages, or more than 20 passages.

[0040] "Macrophage colony-stimulating factor" or "MCSF" (also known as colony-stimulating factor 1 (CSF 1)) is involved in the proliferation, differentiation and survival of monocytes, macrophages and myeloid precursor cells. Gene sequences, protein sequences and orthologs across various species are known in the art (see, for example, NCBI Reference Sequence: NP_000748.4, incorporated herein by reference).

[0041] "Polynucleotide" as used herein includes, but is not limited to, DNA, RNA, cDNA (complementary DNA), mRNA (messenger RNA), rRNA (ribosomal RNA), shRNA (small hairpin RNA), snRNA (small nuclear RNA), snoRNA (short nucleolar RNA), miRNA (microRNA), genomic DNA, synthetic DNA, synthetic RNA and / or tRNA.

[0042] A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) having a certain percentage (e.g., 80%, 85%, 90% or 95%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same when comparing the two sequences. Alignment and percent homology or sequence identity can be determined using software programs known in the art, such as those described in Current Protocols in Molecular Biology (Ausubel et al., eds., 1987), Supplement 30, section 7.7.18, table 7.7.1. Preferably, default parameters are used for alignment. A typical alignment program is BLAST, using default parameters. In particular, exemplary programs are BLASTN and BLASTP using the following default parameters: Genetic code=standard; Filter=none; Strand=both; Cutoff=60; Expectation=10; Matrix=BLOSUM62; Representation=50 sequences; Sorting method=HIGH SCORE; Database=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the following internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST.

[0043] When the present disclosure relates to a polypeptide, a protein, a polynucleotide, an antibody or a fragment thereof, it is inferred that their equivalents or biological equivalents are intended to be within the scope of the present disclosure, unless otherwise intended, without express citation. As used herein, the term "biological equivalent thereof" is intended to be synonymous with "equivalent thereof" when referring to a reference protein, an antibody or a fragment thereof, a polypeptide or a nucleic acid, and is intended to have minimal homology while still maintaining the desired structure or functionality. Unless specifically recited herein, any of the above is intended to include its equivalent. For example, equivalents are intended to have at least about 70% homology or identity, or at least 80% homology or identity, and alternatively at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least 98% percent homology or identity, and exhibit substantially equivalent biological activity to the reference protein, polypeptide, antibody or a fragment thereof or nucleic acid. Alternatively, when referring to a polynucleotide, the equivalent is a polynucleotide that hybridizes under stringent conditions to a reference polynucleotide or its complement. Alternatively, when referring to a polypeptide or protein, the equivalent is a polypeptide or protein expressed from a polynucleotide that hybridizes under stringent conditions to a polynucleotide encoding the reference polypeptide or protein, or its complement.

[0044] The term "retroviral vector" refers to a vector derived from at least a portion of a retroviral genome. Examples of retroviral vectors include MSCVneo, MSCV-pac (or MSCV-puro), MSCV-hygro, available from Addgene or Clontech. Another example of a retroviral vector is MSCV-Bgl2-AvrII-Bam-EcoR1-Xho-BstB1-Mlu-Sal-ClaI.I03 (SEQ ID NO: 872).

[0045] The term "Sleeping Beauty transposon" or "Sleeping Beauty transposon vector" refers to a vector derived from at least a portion of the Sleeping Beauty transposon genome.

[0046] "Stem cell factor" or "SCF" (also known as KIT-ligand, KL or steel factor) is a cytokine that binds to the c-KIT receptor (CD117). SCF can exist as both a transmembrane and a soluble protein. This cytokine plays an important role in hematopoiesis (formation of blood cells), spermatogenesis and melanogenesis. Gene sequences, protein sequences and orthologs across various species are known in the art (see, for example, NCBI reference sequence NP_000890.1, which is incorporated herein by reference).

[0047] As used herein, a "substantially homogenous population" refers to a population of cells in which at least 80%, preferably at least 90%, 95%, or even 98% or more of the cells are of the indicated type.

[0048] "Transmembrane domain" as used herein refers to the region of CAR that crosses the plasma membrane. The transmembrane domain of CAR is the transmembrane region of a transmembrane protein (e.g., a type I transmembrane protein), an artificial hydrophobic sequence, or a combination thereof. Other transmembrane domains will be apparent to those skilled in the art. In some embodiments, the transmembrane domain is selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD1 la, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRFl), CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1 ld, ITGAE, CD103, ITGAL, CDl la, LFA-1, ITGAM, CDl lb, ITGAX, CDl lc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRT The transmembrane domain may be derived from or cloned from a protein selected from the transmembrane domains of AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​PAG / Cbp, NKp44, NKp30, NKp46, NKG2D and / or NKG2C.

[0049] As used herein, the terms "treat", "treatment", "treating" or "amelioration" refer to therapeutic treatments that aim to reverse, reduce, ameliorate, inhibit, slow down or stop the progression or severity of a condition associated with a disease or disorder. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder, such as cancer. A treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, a treatment is "effective" if the progression of a disease is reduced or halted. That is, "treatment" includes not only the improvement of symptoms or markers, but also the halting or at least slowing down of the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, relief of one or more symptoms, whether detectable or undetectable, reduction in the extent of the disease, a stabilized (i.e., non-worsening) state of the disease, delay or slowing of disease progression, remission or alleviation, and relief (whether partial or total) of the condition. The term "treatment" of a disease also includes providing relief from the symptoms or side effects of the disease (including palliative treatment). In some embodiments, treating cancer includes reducing tumor volume, reducing the number of cancer cells, inhibiting cancer metastasis, increasing life expectancy, reducing cancer cell proliferation, reducing cancer cell survival, or ameliorating various physiological symptoms associated with a cancerous condition.

[0050] "Wnt activators" refer to compounds or molecules that induce the Wnt signaling pathway. The Wnt signaling pathway is a group of signaling pathways that begin with a protein that sends a signal into the cell through a cell surface receptor. Three Wnt signaling pathways have been characterized: the canonical Wnt pathway, the non-canonical planar cell polarity pathway, and the non-canonical Wnt / calcium pathway. All three pathways are activated by binding of a Wnt protein ligand to the Frizzled family receptor, which sends a biological signal to Disheveled proteins inside the cell. Wnts comprise a diverse family of secreted lipid-modified signaling glycoproteins that are 350-400 amino acids long. The type of lipid modification that occurs on these proteins is palmitoylation of cysteines in a conserved pattern of 23-24 cysteine ​​residues. Palmitoylation is necessary because it initiates the targeting of Wnt proteins to the plasma membrane for secretion and allows Wnt proteins to bind to their receptors due to the covalent attachment of fatty acids. Wnt proteins also undergo glycosylation, which attaches carbohydrates to ensure proper secretion. In Wnt signaling, these proteins act as ligands that activate different Wnt pathways through paracrine and autocrine pathways. These proteins are highly conserved across species. They can be found in mouse, human, Xenopus, zebrafish, Drosophila and many others. Examples of Wnt activators include, but are not limited to, SKL 2001, BML-284, WAY 262611, CAS 853220-52-7 and QS11. In certain embodiments, the methods disclosed herein include the use of compounds of the present disclosure that have Wnt activator activity.

[0051] Granulocytes and macrophages are the two major cell types of the innate immune system. They are the first line of defense against pathogens and play a central role in maintaining the homeostasis of our body as well as in preventing various diseases, including infections and metabolic diseases and cancer. Granulocytes and macrophages engulf and digest invading microorganisms in a process called phagocytosis. In addition to phagocytosis, macrophages also play an important role as antigen presenters, initiating specific defense mechanisms (adaptive immunity) by recruiting other immune cells such as lymphocytes. Recently, macrophages have also become attractive therapeutic targets for fighting cancer. Despite their great therapeutic potential, there are no effective methods to expand and genetically modify granulocytes and macrophages, greatly limiting their clinical application.

[0052] A more promising approach is to expand and genetically modify granulocyte-monocyte precursor (GMP) cells, which are the common precursors in the bone marrow from which granulocytes and macrophages originate. As used herein, GMPs can be derived or obtained from mammalian species (e.g., bovine, canine, equine, feline, human, murine, primate, rat, etc.). Ex vivo expanded GMPs may allow the ability to generate sufficient macrophages for therapeutic applications. Expanded GMPs can also be induced to differentiate into neutrophils, the most abundant type of granulocyte, which can then be infused into the blood circulation to fight infections in patients with neutropenia or neutrophil dysfunction. More importantly, GMPs can be easily modified to generate genetically engineered macrophages with enhanced antitumor or antibacterial activity. Macrophages engulf and digest any foreign particles, including the genetic material used to engineer them, but GMPs have no phagocytic activity, making them a much more preferred target. However, despite decades of intensive research, long-term ex vivo expansion of GMPs, as well as other stem / progenitor cells of the hematopoietic system, has remained elusive.

[0053] Cells of the hematopoietic system are organized in a hierarchy with hematopoietic stem cells (HSCs) at the top, various mature blood cells at the bottom, and hematopoietic stem and progenitor cells (HSPCs) at the middle, e.g., GMPs in between. Motivated by the great therapeutic potential of HSPCs, numerous groups have attempted to develop culture conditions for their ex vivo expansion over the past two decades. So far, all conditions have a fundamental limitation: they cannot continuously exponentially expand homogenous populations of any type of HSPCs.

[0054] A unique challenge has been the difficulty in distinguishing and separating one type of HSPC from another type of HSPC, especially from its immediate precursors and downstream progeny. In fact, conventional immunophenotyping cannot distinguish one HSPC type from its immediate precursors and downstream progeny. At the clonal level, prospectively purified HSCs are still highly heterogeneous, containing cells with diverse gene expression patterns and distinct cellular functions. This is expected, since HSPCs span a continuum of cells with somewhat similar cell surface marker expression but heterogeneous functions. It is technically very challenging to identify growth factors / cytokines and small molecules that can promote the expansion of a single stem / progenitor cell type within this heterogeneous cell population.

[0055] Granulocytes, macrophages and dendritic cells originate from a common precursor in the bone marrow, the granulocyte-macrophage precursor (GMP). Despite the immense therapeutic potential of innate immune cells, their application in the clinic has been greatly limited due to the current inability to effectively expand and genetically modify these cells or their precursor GMPs. Provided herein is a method for long-term expansion of GMPs. Ex vivo expanded GMPs can efficiently differentiate into mature and functional granulocytes, macrophages and dendritic cells both in vitro and in vivo. These ex vivo expanded GMPs can also be genetically modified. The methods disclosed herein for the production of GMPs and the GMPs produced therefrom have great utility due to the following: (1) long-term expansion of GMPs provides an unlimited homogenous cell population for both basic research and clinical applications; (2) long-term expansion of GMPs allows for the study of the regulation of immune responses by modifying GMP genes and their expression; and (3) ex vivo expanded GMPs can be used for clinical applications including transplantation. For example, ex vivo expanded GMPs can be easily used to treat neutropenia. Furthermore, the present disclosure also provides genetic modifications of GMPs (e.g., knockout SIRPα and / or PI3Kγ genes; overexpression of angiotensin-converting enzyme) that can be further induced to differentiate into macrophages and dendritic cells. In the studies presented herein, these engineered macrophages and dendritic cells show enhanced anti-tumor effects and can be used clinically to treat cancer as monotherapy or in combination with other immunological agents, such as anti-PD-1 / PD-L1 antibodies and chimeric antigen receptor T (CAR-T) cells. GMPs were also engineered to produce CAR-macrophages. These CAR-macrophages can be used to treat cancer and other diseases.

[0056] Macrophages display diverse phenotypes that were originally classified as M1- or M2-polarized. M1-polarized macrophages display the ability to present antigens and produce IL-12, IL-23, interferon gamma (IFNγ) and reactive oxygen species (ROS). M1 macrophages are more effective in antitumor and skew T-cell responses toward T helper type 1 (Th1) or cell-mediated immune responses. In contrast, M2 macrophages produce IL-10 and TGF-β, are involved in tissue remodeling, have immunosuppressive properties, and promote Th2 or antibody-mediated immune responses. Tumor-associated macrophages (TAMs) constitute a major component of the tumor microenvironment. These cells are the predominant M2 phenotype macrophages that promote tumor immunosuppression. Recent studies support their contribution to the suppression of T-cell function, which is not abrogated by the use of immune checkpoint blockade. Macrophages have therefore become attractive therapeutic targets to combat cancer. Despite the great therapeutic potential of macrophages, their application in the clinic has been largely limited due to the current lack of effective methods to expand and genetically modify macrophages or their precursor GMPs. Long-term expansion of GMPs would allow for genetic modification to make these cells more therapeutically applicable.

[0057] In certain embodiments, the present disclosure provides a method for long-term expansion of a homogenous cell population of granulocyte / macrophage precursor cells (GMPs) that remain morphologically unchanged after undergoing multiple cell passages and clonal expansion. In further embodiments, the methods disclosed herein include culturing GMPs in a culture medium containing a combination of factors and agents, including, but not limited to, growth factors (e.g., SCF), B-Raf kinase inhibitors (e.g., GDC-0879), agents that inhibit Mnk1 / 2, agents that inhibit the PI3K pathway, and, optionally, one or more serum components. In yet another embodiment, long-term cultures of GMPs are genetically engineered to express a chimeric antigen receptor (CAR).

[0058] Stem cells are cells that can differentiate into other cell types, including cells with specific specialized functions (e.g., tissue-specific cells, parenchymal cells and their precursors). Progenitor cells (i.e., "multipotent") are cells that can give rise to different terminally differentiated cell types and can give rise to various progenitor cells. Cells that give rise to some or many, but not all, of an organism's cell types are often referred to as "pluripotent" stem cells, which can differentiate into any cell type in the body of a mature organism, but cannot dedifferentiate into the cells from which they were derived without reprogramming. As will be understood, "pluripotent" stem / progenitor cells (e.g., granulocyte / macrophage precursor cells (GMPs)) have a narrower differentiation potential than pluripotent stem cells. Prior to induction into GMPs, the stem cells disclosed herein can be genetically modified by the use of a number of genetic engineering techniques, such as gene therapy, gene editing systems, homologous recombination, and the like. Such modified stem cells may provide enhanced therapy (see, e.g., Nowakowski et al., Acta Neurobiol Exp(Wars) 73(1):1-18 (2013)). In certain embodiments, stem or progenitor cells may be engineered to express a chimeric antigen receptor (CAR) or to contain a polynucleotide encoding a chimeric antigen receptor (CAR).

[0059] In further embodiments, the GMP disclosed herein is derived from stem cells.Stem cells can include embryonic stem cells, induced pluripotent stem cells, non-embryonic (adult) stem cells and umbilical cord blood stem cells.The stem cell types that can be cultured using the medium disclosed herein include stem cells from any mammalian species, including human, mouse, rat, monkey and ape (see, for example, Nature 448:313-318, July 2007; and Takahashi et al., Cell 131(5):861-872, which are incorporated herein by reference).

[0060] In certain embodiments, the GMP of the present disclosure is derived from induced pluripotent cells (iPS or iPSC). iPSC is a type of pluripotent stem cell obtained from non-pluripotent cells by selective gene expression (of endogenous genes) or by transfection with heterologous genes. Induced pluripotent stem cells have been described by Shinya Yamanaka's team at Kyoto University, Japan. Yamanaka et al. used retroviruses to identify genes that are specifically active in embryonic stem cells and transfect mouse fibroblasts by selection of those genes. Finally, four key pluripotency genes were isolated that are important for the production of pluripotent stem cells: Oct-3 / 4, SOX2, c-Myc and Klf4. More recent studies have shown that fewer of these factors, combined with certain culture conditions and additional factors, can induce pluripotent stem cells. The cells are expressed in the presence of Fbx15 + The cells were isolated by antibiotic selection. The same group, along with two other independent research groups from Harvard, MIT and the University of California, Los Angeles, published studies demonstrating successful reprogramming of mouse fibroblasts into iPS cells and even the production of viable chimeras.

[0061] In an alternative embodiment, the GMP disclosed herein is derived from embryonic stem cells (ESCs). ESCs are stem cells derived from the undifferentiated inner cell mass of human embryos. Embryonic stem cells are pluripotent, meaning that they can develop (i.e., differentiate) into all derivatives of the three primary germ layers: ectoderm, endoderm, and mesoderm. Pluripotency distinguishes embryonic stem cells from adult stem cells found in adults; embryonic stem cells can generate all cell types in the body, whereas adult stem cells are multipotent and can only produce a limited number of cell types. Furthermore, under defined conditions, embryonic stem cells are capable of propagating themselves indefinitely. This allows embryonic stem cells to be used as a useful tool for both research and regenerative medicine, since they can produce an unlimited number of embryonic stem cells for continued research or clinical use.

[0062] In another alternative embodiment, the GMP disclosed herein is derived from umbilical cord blood stem cells. Umbilical cord blood is the blood left in the placenta and umbilical cord after the birth of a baby. Umbilical cord blood is composed of all the elements found in whole blood. Umbilical cord blood contains red blood cells, white blood cells, plasma, platelets, and is also rich in hematopoietic stem cells. Hematopoietic stem cells can be isolated from umbilical cord blood using any number of isolation methods taught in the art, including those taught in Chularojmontri et al., J Med Assoc Thai 92(3):S88-94 (2009). Additionally, commercial kits from several vendors, including STEMCELL Technologies, Thermo Fisher Scientific, Zen-Bio, and others, are available to isolate CD34 stem cells. + Cells (ie, hematopoietic stem cells) are available for isolation from human umbilical cord blood.

[0063] In yet another alternative embodiment, the GMP disclosed herein is derived from non-embryonic stem cells. Non-embryonic stem cells can regenerate themselves and differentiate to give rise to some or all of the major specialized cell types of a tissue or organ. The primary role of non-embryonic stem cells in living organisms is to maintain and repair the tissues in which they are found. Scientists also use the term somatic stem cells instead of non-embryonic stem cells, where somatic refers to the cells of the body (not germ cells, sperm, or eggs). Non-embryonic stem cells have been identified in many organs and tissues, including the brain, bone marrow, peripheral blood, blood vessels, skeletal muscle, skin, teeth, heart, intestine, liver, ovarian epithelium, and testes. They are believed to reside in specific regions (called "stem cell niches") of each tissue. In living animals, non-embryonic stem cells can divide over long periods of time as needed, giving rise to mature cell types with the characteristic shapes and specialized structures and functions of specific tissues.

[0064] In certain embodiments, the GMPs disclosed herein are derived from hematopoietic stem cells (HSCs). HSCs can be easily isolated from umbilical cord blood and bone marrow. Such isolation protocols are known in the art and typically include CD34 as a cell selection marker for the isolation of HSCs. + (See, e.g., Lagasse et al., Nat Med. 6:1229-1234 (2000)).

[0065] In the methods disclosed herein, GMPs can be grown and expanded in a culture medium containing a combination of factors and agents, including but not limited to growth factors (e.g., SCF), B-Raf kinase inhibitors (e.g., GDC-0879), agents that inhibit Mnk1 / 2, agents that inhibit the PI3K pathway, and, optionally, one or more serum components. The culture medium can be a modified basal medium supplemented with various other biological agents. Basal medium refers to a solution of amino acids, vitamins, salts, and nutrients that are effective to support the growth of cells in culture, but these compounds do not usually support cell growth unless supplemented with additional compounds. Nutrients include carbon sources (e.g., sugars, e.g., glucose) that can be metabolized by cells, as well as other compounds necessary for cell survival. These are compounds that the cells themselves cannot synthesize due to the absence of one or more of the genes encoding the proteins necessary to synthesize the compound (e.g., essential amino acids), or for compounds that the cells can synthesize, the genes encoding the necessary biosynthetic proteins are not expressed at sufficient levels due to their particular developmental state. Although several base media, such as Dulbecco's Modified Eagle Medium (DMEM), RPMI 1640, Knockout-DMEM (KO-DMEM) and DMEM / F12, are known in the art of mammalian cell culture, any base medium that can be supplemented with agents that support the growth of stem cells in a substantially undifferentiated state can be used. It has further been found herein that a culture medium comprising one of the above-exemplified base media (e.g., DMEM / F12) and neurobasal medium (or alternatively other base media, e.g., IMDM and / or StemSpan™ SFEMII) in a certain ratio unexpectedly provided improved growth of GMPs. In particular, a ratio of about 5:1 to about 1:5 of one of the above-exemplified base media (e.g., DMEM / F12) to neurobasal medium can be used to culture GMPs. In a further embodiment, the culture medium for growing GMPs comprises about 1:1 of DMEM / F12 to neurobasal medium.

[0066] As indicated above, the culture medium disclosed herein for growing GMPs may be supplemented with one or more additional agents, including, but not limited to, insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-alpha tocopherol, and linolenic acid. In certain embodiments, the culture medium disclosed herein for growing GMPs is supplemented with insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-alpha tocopherol, and linolenic acid.

[0067] As will be appreciated, it is desirable to replace the spent culture medium with fresh culture medium continuously or at regular intervals, typically every 1-3 days. One advantage of using fresh medium is the ability to adjust conditions so that the cells expand more uniformly and more quickly than when cultured on feeder cells according to conventional techniques or in conditioned medium.

[0068] A population of GMPs that has been expanded 4-fold, 10-fold, 20-fold, 50-fold, 100-fold, 1000-fold, or more, may be obtained when compared to the previous starting cell population. Under appropriate conditions, the cells in the expanded population are 50%, 70% or more undifferentiated compared to the GMP used to initiate the culture. The degree of expansion per passage may be calculated by dividing the approximate number of cells recovered at the end of the culture by the approximate number of cells originally seeded in the culture. If the geometry of the growth environment is limiting, or for other reasons, the cells may be passaged as needed into a similar growth environment for further expansion. The total expansion is the product of all the expansions in each of the passages. Of course, it is not necessary to retain all the cells expanded at each passage. For example, if the cells expand 2-fold in each culture, but only about 50% of the cells are retained at each passage, approximately the same number of cells will be carried forward. However, after four cultures, the cells are said to have undergone a 16-fold expansion. Cells may be stored by cryogenic freezing techniques known in the art.

[0069] As described in more detail herein, GMPs can be grown and expanded in culture medium containing a combination of factors and agents, including, but not limited to, growth factors (e.g., SCF), B-Raf kinase inhibitors (e.g., GDC-0879), agents that inhibit Mnk1 / 2, agents that inhibit the PI3K pathway, and, optionally, one or more serum components.

[0070] The present disclosure provides a method for genetically modifying the GMP disclosed herein using genetic engineering techniques.In particular, it has been shown herein that the GMP disclosed herein is susceptible to genetic engineering techniques, thereby enabling the use of the GMP in basic scientific research and clinical therapeutic applications.Therefore, the expanded and genetically modified GMP can be easily transferred to broad clinical applications.Therefore, the present disclosure further provides a method for genetically modifying the GMP disclosed herein.Such a method can include genetically modifying the GMP by using a gene editing system, homologous recombination or site-directed mutagenesis.Specific examples of gene editing systems include zinc finger nucleases, TALEN and CRISPR.

[0071] In certain embodiments, the CRISPR system is a type II CRISPR system and the Cas enzyme is Cas9, which catalyzes DNA cleavage. Enzymatic action by Cas9 from Streptococcus pyogenes or any closely related Cas9 hybridizes to a 20-nucleotide guide sequence and generates a double-stranded break at a target site sequence that has a protospacer-adjacent motif (PAM) sequence (examples include NGG / NRG or PAM, which can be determined as described herein) following the 20-nucleotide target sequence. Cas9-mediated CRISPR activity for site-specific DNA recognition and cleavage is defined by the guide sequence, the tracr sequence that hybridizes in part to the guide sequence, and the PAM sequence. Further aspects of the CRISPR system are described in Karginov and Hannon, The CRISPR system: small RNA-guided defense in bacteria and archaea, Mole Cell 2010-01-15;37(1):7.

[0072] The type II CRISPR locus from Streptococcus pyogenes SF370 contains a cluster of four genes Cas9, Cas1, Cas2 and Csn1, as well as two non-coding RNA elements: tracrRNA, and a characteristic array of repeat sequences (direct repeats) spaced by short stretches of non-repetitive sequences (spacers, each about 30 bp). In this system, targeted DNA double-strand breaks (DSBs) are generated in four sequential steps. First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the direct repeats of the pre-crRNA, which are then processed into mature crRNAs containing individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target sequence, including the protospacer and the corresponding PAM, via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA. Finally, Cas9 mediates cleavage of the target sequence of the PAM to create a DSB within the protospacer. In certain embodiments, an RNA polymerase Ill-based U6 promoter is used to drive the expression of tracrRNA.

[0073] Typically, with respect to endogenous CRISPR systems, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs of the target sequence). Without wishing to be bound by theory, the tracr sequence may comprise or consist of all or a portion of the wild-type tracr sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of the wild-type tracr sequence, or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of the wild-type tracr sequence), and may also form part of a CRISPR complex, for example, by hybridization along at least a portion of the tracr sequence to all or a portion of the tracr mate sequence operably linked to the guide sequence. In some embodiments, one or more vectors that drive the expression of one or more elements of the CRISPR system are introduced into a host cell (e.g., a GMP or stem cell) such that the expression of the elements of the CRISPR system directs the formation of a CRISPR complex at one or more target sites. For example, the Cas enzyme, the guide sequence linked to the tracr mate sequence, and the tracr sequence may each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements can be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system that are not included in the first vector.The CRISPR system elements combined in a single vector can be arranged in any suitable orientation, for example, one element can be located 5' to the second element (the "upstream" of the second element) or 3' to the second element (the "downstream" of the second element).The coding sequence of one element can be located on the same strand or opposite strand of the coding sequence of the second element, and can be oriented in the same direction or opposite direction.In some embodiments, a single promoter drives the expression of the transcript encoding the CRISPR enzyme, as well as one or more of the guide sequence, the tracr mate sequence (optionally operably linked to the guide sequence), and the tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, the guide sequence, the tracr mate sequence, and the tracr sequence are operably linked to and expressed from the same promoter.

[0074] In some embodiments, the CRISPR expression vector comprises one or more insertion sites, such as restriction endonuclease recognition sequences (also referred to as "cloning sites"). In some embodiments, one or more insertion sites (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more insertion sites, or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more insertion sites) are located upstream and / or downstream of one or more sequence elements of one or more vectors. In some embodiments, the vector comprises an insertion site upstream of the tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that after insertion of the guide sequence into the insertion site and upon expression, the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence in eukaryotic cells (e.g., GMP or stem cells). In some embodiments, the vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences to allow insertion of a guide sequence at each site. In such a configuration, the two or more guide sequences can comprise two or more copies of a single guide sequence, two or more different guide sequences, or a combination thereof.When multiple different guide sequences are used, a single expression construct can be used to target CRISPR activity to multiple different corresponding target sequences in cells.For example, a single vector can comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more guide sequences, or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more guide sequences.In some embodiments, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of such guide sequence-containing vectors, or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of such guide sequence-containing vectors can be provided and can be delivered to cells as needed.

[0075] In some embodiments, the vector comprises a regulatory element operably linked to an enzyme coding sequence that encodes a CRISPR enzyme, e.g., a Cas protein. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. In some embodiments, unmodified CRISPR enzyme, for example Cas9, has DNA cleavage activity.In some embodiments, CRISPR enzyme directs the cleavage of one or both strands at the position of target sequence, for example, within target sequence and / or within the complement of target sequence.In some embodiments, CRISPR enzyme directs the cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500 or more base pairs from the first or last nucleotide of target sequence.In some embodiments, the vector encodes a mutated CRISPR enzyme with respect to the corresponding wild type enzyme, such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of target polynucleotide containing target sequence. For example, an aspartate to alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (that cleaves a single strand). Other examples of mutations that turn Cas9a into a nickase include, without limitation, H840A, N854A, and N863A. As a further example, two or more catalytic domains of Cas9 (RuvC I, RuvC II, and RuvC III or HNH domains) can be mutated to produce a mutated Cas9 that is substantially devoid of all DNA cleavage activity.In some embodiments, the D10A mutation is combined with one or more of the H840A, N854A or N863A mutations to produce a Cas9 that is substantially devoid of all DNA cleavage activity. In some embodiments, a CRISPR enzyme is considered to be substantially devoid of all DNA cleavage activity if the DNA cleavage activity of the mutated enzyme is less than about 25%, 10%, 5%, 1%, 0.1%, 0.01% or less compared to its non-mutated form. If the enzyme is not SpCas9, the mutation can be made at any or all of the residues corresponding to positions 10, 762, 840, 854, 863 and / or 986 of SpCas9 (which can be determined, for example, by standard sequence comparison tools). In particular, any or all of the following mutations are preferred in SpCas9: D10A, E762A, H840A, N854A, N863A, and / or D986A, but conservative substitutions for any of the replaced amino acids are also envisioned. The same at corresponding positions in other Cas9s (or conservative substitutions of these mutations) are also shown.

[0076] The orthologues shown are also described herein.Cas enzyme can be identified as Cas9, because it can refer to a general class of enzymes that share homology with the largest nucleases with multiple nuclease domains of type II CRISPR system.Most preferably, Cas9 enzyme is derived from or derived from spCas9 or saCas9.Derived means that derived enzyme is mainly based on wild-type enzyme, in the sense that it has a high degree of sequence homology with wild-type enzyme, but is mutated (modified) in some ways as described herein.

[0077] It is understood that the terms Cas and CRISPR enzyme are generally used interchangeably herein unless otherwise specified.As mentioned above, many of the residue numberings used herein refer to the Cas9 enzyme from the type II CRISPR locus of Streptococcus pyogenes.However, it is understood that the present disclosure includes many additional Cas9s from other species of microorganisms, such as SpCas9, SaCa9, St1Cas9, etc.

[0078] Genetic editing systems (e.g., zinc finger nucleases, CRISPR and TALEN) can be used to engineer modifications into GMPs or stem cells, for example, to replace or disrupt (knock out) existing genes found in GMPs or stem cells. As shown in the examples presented herein, the GMPs of the present disclosure are particularly susceptible to knockout mutations. Furthermore, it is expected that additional knockouts, such as SIRPα gene knockouts and / or PI3Kγ gene knockouts, can be easily created from the GMPs of the present disclosure. Alternatively, the same editing systems (e.g., CRISPR and TALEN) can be used to modify a locus to contain sequence information not found at that locus (knock-in mutations). Such modifications can be used to create GMPs with "gained functions". Such modified GMPs are particularly useful for mimicking disease conditions, for example, by expressing a biological molecule associated with a disease or disorder.

[0079] In another embodiment, GMP cells are engineered using vectors.For example, the CAR of the present disclosure can be introduced into cells using a number of techniques, including but not limited to using lentivirus vectors, retrovirus vectors, adeno-associated virus vectors, baculovirus vectors, Sleeping Beauty transposon, piggyback transposon, or by mRNA transfection, or by using a combination of the above methods.CAR can be expressed under the control of endogenous promoters (e.g., TCRα or TCRβ promoters).In some embodiments, CAR is expressed using exogenous promoters (e.g., CMV promoters).

[0080] In some embodiments, introducing the nucleic acid molecule encoding a CAR comprises transducing a vector comprising the nucleic acid molecule encoding a CAR or transfecting the nucleic acid molecule encoding a CAR into a GMP cultured as described herein.

[0081] In some embodiments, the method includes a) providing a population of GMPs to be cultured to expand and maintain the culture of GMPs; b) introducing a vector containing a nucleic acid encoding a CAR construct into the GMPs; and c) culturing the transformed / transfected GMPs. In some embodiments, the method further provides for differentiation of the GMPs into blood cells of myeloid and lymphoid lineages, such as differentiation of monocytes, macrophages, granulocytes, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes, platelets, T cells, B cells, and natural killer cells. In certain embodiments, the method disclosed herein further includes differentiating the GMPs of the present disclosure into macrophages by culturing the GMPs with a macrophage differentiation medium containing MCSF. In yet further embodiments, the macrophage differentiation medium contains RPMI 1640, 10% FBS, and 20 ng / mL MCSF. In an alternative embodiment, the method disclosed herein further includes differentiating the GMPs of the present disclosure into granulocytes by culturing the GMPs with a granulocyte differentiation medium containing GCSF. In yet a further embodiment, the granulocyte differentiation medium comprises RPMI 1640, 10% FBS and 20 ng / mL GCSF.

[0082] In certain embodiments, the present disclosure provides a method of engineering granulocyte-macrophage precursors (GMPs) to express a chimeric antigen receptor (CAR), comprising the steps of: introducing a vector containing a CAR into the GMPs to form GMPs expressing the CAR (CAR-GMPs); expanding and culturing the CAR-GMPs for multiple passages in defined culture conditions to generate a population of CAR-GMPs; and inducing the population of CAR-GMPs to differentiate in vitro into granulocytes, macrophages, or dendritic cells, wherein the granulocytes, macrophages, or dendritic cells express the CAR. In a further embodiment, the GMPs are obtained from stem cells. In yet a further embodiment, the stem cells are hematopoietic stem cells. In another embodiment, the hematopoietic stem cells are isolated from the bone marrow of a subject. In yet another embodiment, the subject is a mammalian subject. In a further embodiment, the subject is a human patient. In yet another embodiment, CAR comprises an extracellular domain capable of binding to antigen, a transmembrane domain, and at least one intracellular domain designed to increase the antitumor activity of granulocytes, macrophages and dendritic cells by increasing their phagocytosis and / or proinflammatory cytokine secretion.In another embodiment, the vector is a viral vector.In yet another embodiment, the viral vector can be replicative or non-replicative, and can be an adenovirus vector, an adeno-associated virus (AAV) vector, a measles vector, a herpes vector, a retrovirus vector, a lentivirus vector, a rhabdovirus vector, a reovirus vector, a Seneca Valley virus vector, a poxvirus vector, a parvovirus vector or an alphavirus vector.In a certain embodiment, the viral vector is a lentivirus vector. In another embodiment, the defined culture conditions comprise culturing CAR-GMP in a culture medium comprising (i) a growth factor, (ii) a B-Raf kinase inhibitor, and (iii) a Wnt activator and / or a GSK-3 inhibitor, wherein the CAR-GMP remains substantially morphologically unchanged after undergoing multiple cell passaging and / or clonal expansion.In a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium. In yet a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 5:1 to about 1:5. In another embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 1:1. In yet another embodiment, the culture medium comprises one or more supplements selected from insulin, transferrin, bovine serum albumin (BSA) fraction V, putrescine, sodium selenite, DL-α tocopherol, and / or linoleic acid. In a further embodiment, the culture medium is supplemented with insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-α tocopherol, and linoleic acid. In certain embodiments, the growth factor is stem cell factor (SCF). In another embodiment, the B-Raf kinase inhibitor is selected from the group consisting of GDC-0879, PLX4032, GSK2118436, BMS-908662, LGX818, PLX3603, RAF265, RO5185426, vemurafenib, PLX8394, SB590885, and any combination thereof.In yet another embodiment, the Wnt activator is selected from the group consisting of SKL 2001, BML-284, WAY 262611, CAS 853220-52-7, QS11, and any combination thereof.In a further embodiment, the GSK-3 inhibitor is selected from the group consisting of CHIR99021, CHIR98014, SB216763, BIO, A1070722, AR-A014418, and any combination thereof. In another embodiment, the defined culture conditions include culturing CAR-GMP in a culture medium comprising: (i) a growth factor; (ii) a B-Raf kinase inhibitor; (iii) an agent that inhibits mitogen-activated kinase-interacting protein kinases 1 and 2 (Mnk1 / 2); (iv) an agent that inhibits the PI3K pathway; and (v) optionally, one or more serum components; and the CAR-GMP remains substantially morphologically unchanged after undergoing multiple cell passages and / or clonal expansion. In a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal Medium.In yet a further embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 5:1 to about 1:5. In another embodiment, the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 1:1. In yet another embodiment, the culture medium comprises one or more supplements selected from insulin, transferrin, bovine serum albumin (BSA) fraction V, putrescine, sodium selenite, DL-α tocopherol, and / or linoleic acid. In a further embodiment, the culture medium is supplemented with insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-α tocopherol, and linoleic acid. In a still further embodiment, the growth factor is stem cell factor (SCF). In another embodiment, the B-Raf kinase inhibitor is selected from the group consisting of GDC-0879, PLX4032, GSK2118436, BMS-908662, LGX818, PLX3603, RAF265, RO5185426, vemurafenib, PLX8394, SB590885, and any combination thereof.

[0083] In further embodiments, the agent that inhibits Mnk1 / 2 is selected from the group consisting of CGP-57380, cercosporamide, BAY 1143269, tomivosertib, ETC-206, SLV-2436, and any combination thereof. In still further embodiments, the agent that inhibits the PI3K pathway is selected from the group consisting of 3-methyladenine, LY294002, alpelisib, wortmannin, quercetin, hSMG-1 inhibitor 11j, zandelisib, alpelisib hydrochloride, idelalisib, bupallisib, copanlisib, IPI549, dactolisib, pictilisib, SAR405, duvelisib, fimepinostat, GDC-0077, PI-103, YM-20163, PF-04691502, taselisib, omipalisib, samotricisib, isorhamnetin, ZATK474, parsaclisib, rigosertib, AZD8186, GSK2636771, diciteltide, TG100-115, AS-605240, PI3K-IN-1, dactolisib tosylate, gedatricisib, TGX-221, umbralisib, AZD 6482, Seravelisib, Bimiralisib, Apitolisib, Alpha-linolenic acid, Vps34-PIK-III, PIK-93, Vps34-IN-1, CH5132799, Leniolisib, Voxtalisib, GSK1059615, Sonolisib, PKI-402, PI4KIII beta-IN-9, HS-173, BGT226 maleate, Pictilisib dimethanesulfonate folate, VS-5584, IC-87114, quercetin dihydrate, CNX-1351, SF2523, GDC-0326, seletalisib, acalisib, SAR-260301, ZAD-8835, GNE-317, AMG319, nemiralisib, IITZ-01, PI-103 hydrochloride, oroxine B, piralalisib, AS-252424, cupanelisib dihydrochloride, AMG 511, diciteltide TFA, PIK-90, tenalisib, esculetin, CGS15943, GNE-477, PI-3065, A66, AZD3458, ginsenoside Rk1, sophocarpine, bupallisib hydrochloride, Vps34-IN-2, limpellisib, alnikolide D, KP372-1, CZC24832, PF-4989216, (R)-duvelisib, PQR530, P11δ-IN-1, umbralisib hydrochloride, MTX-211, PI3K / mTOR inhibitor-2, LX2343, PF-04979064, polygalasaponin F, glaucocalicin A, NSC781406, MSC2360844, CAY10505, IPI-3063, TG 100713, BEBT-908, PI-828, Brevianamid F, ETP-46321, PIK-294, SRX3207, Sophocarpine monohydrate, AS-604850, Desmethylglycitein, SKI V, WYE-687, NVP-QAV-572, GNE-493, CAL-130 hydrochloride, GS-9901, BGT226, IHMT-PI3Kδ-372, PI3Kα-IN-4, Parsaclisib hydrochloride, PF-06843195, PI3K-IN-6, (S)-PI3Kα-IN-4, PI3K(gamma)-IN-8, BAY1082439, CYH33 , PI3Kγ inhibitor 2, PI3Kδ inhibitor 1, PARP / PI3K-IN-1, LAS191954, PI3K-IN-9, CHMFL-PI3KD-317, PI3K / HDAC-IN-1, MSC2360844 hemifumarate, PI3K-IN-2, PI3K / mTOR inhibitor-1, PI3Kδ-IN-1, Euscafe acid, KU-0060648, AZD 6482, WYE-687 dihydrochloride, GSK2292767, (R)-umbralisib, PIK-293, idelalisib D5, PIK-75, hirsutenone, quercetin D5, PIK-108, hSMG-1 inhibitor 11e, PI3K-IN-10, NVP-BAG956, PI3Kγ inhibitor 1, CAL-130, ON146040, PI3kδ inhibitor 1, PI3Kα / mTOR-IN-1, and any combination thereof. In another embodiment, the CAR-GMP is induced to differentiate into macrophages, which comprises culturing the CAR-GMP with a macrophage differentiation medium comprising macrophage colony-stimulating factor (MCSF), and the macrophages express CAR. In yet another embodiment, the macrophage differentiation medium comprises RPMI 1640, fetal bovine serum (FBS), and MCSF. In an alternative embodiment, the method further comprises differentiating the CAR-GMP into granulocytes, which comprises culturing the GMP with a granulocyte differentiation medium comprising granulocyte colony-stimulating factor (GCSF), and the granulocytes express CAR. In a further embodiment, the granulocyte differentiation medium comprises RPMI 1640, FBS, and GCSF.

[0084] In the studies presented herein, it was found that ex vivo expanded GMPs can be engineered to produce CAR-macrophages that target cancer cells with high efficiency and specificity. Thus, the present disclosure provides a method for genetically engineering granulocyte-macrophage precursors (GMPs) to express chimeric antigen receptors (CARs) for use in cancer immunotherapy. Chimeric antigen receptors include an extracellular domain capable of binding to an antigen, a transmembrane domain, and at least one intracellular domain. The intracellular domain is designed to increase the antitumor activity of granulocytes, macrophages, and dendritic cells by increasing their phagocytosis and / or proinflammatory cytokine secretion. CAR-GMPs can be expanded and induced to differentiate into granulocytes, macrophages, or dendritic cells in vitro or in vivo. CAR-GMPs or their derivatives, granulocytes, macrophages, and dendritic cells, are adoptively transferred into patients, where they act as potent immune effectors by infiltrating tumors and killing target cells.

[0085] CAR-GMP can further be administered in combination with one or more anti-cancer drugs to treat a subject with cancer. Examples of anti-cancer drugs that may be used with the CAR-GMP disclosed herein include alkylating agents such as thiotepa and CYTOXAN® cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylylenethiophosphoramide, and tiimethylolomelamine; acetogenins (e.g., bullatasin and bullatasinone); camptothecins (including the synthetic analog topotecan); bryostatin; callystatin; CC-1065 (including its adzelesin, calstatin); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatins; duocarmycins (including the synthetic analogs KW-2189 and CB1-TM1); erytherobin; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards, e.g., chlorambucil, chlornaphazine, colofosphamide, mide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosurea, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine and ranimnustine; vinca alkaloids; epipodophyllotoxins;Antibiotics, such as enediyne antibiotics (e.g., calicheamicins, especially calicheamicin gamma II and calicheamicin omega II; L-asparaginase; anthracenedione-substituted ureas; methylhydrazine derivatives; dynemicins, including dynemicin A; bisphosphonates, such as clodronate; esperamicin; and neocarzinostatin chromophore and related enediyne antibiotic chromophores), aclacinomycins, sin), actinomycin, autramycin, azaserine, bleomycin, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (morpholino) doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, such as mitomycin C, mycophenolic acid, nogalamycin, olivomycin, peplomycin, potfiromycin, puromycin, quelamycin n), rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine;Pyrimidine analogues such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calsterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone; antiadrenal agents such as aminoglutethimide, mitotane, trilostane; folic acid replenishers such as frolinic acid acid;aceglatone;aldophosphamide glycosides;aminolevulinic acid;eniluracil;amsacrine;bestrabucil;bisantrene;edatraxate;defofamine;demecolcine;diaziquone;elfornithine;elliptinium acetate;epothilone;etoglucide;gallium nitrate;hydroxyurea;lentinan;lonidainine;maytansinoids, e.g. maytansine and ansamitocin;mitoguazone;mitoxantrone;mopidanmol;nitiaerine;pentostatin;phenamet;pirarubicin;losoxantione;podophyllinic acid acid);2-ethylhydrazide;procarbazine;PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.);razoxane;rhizoxin;schizophyllan;spirogermanium;tenuazonic acid;triazicon;2,2 2"-trichlorotiiethylamine;trichothecenes (especially T-2 toxin, verracurin A, roridin A, and anguidine);urethane;vindesine;dacarbazine;mannomustine;mitobronitol;mitolactol;pipobroman;gacytosine;arabinosides ("Ara-C");cyclophosphamide;thiotepa;Taxoids such as TAXOL® paclitaxel (Bristol-Myers Squibb Oncology, Princeton, NJ), ABRAXANE® Cremophor-free, albumin engineered nanoparticle formulation of paclitaxel (American Pharmaceutical Partners, Schaumberg, Ill.) and TAXOTERE® (docetaxel) (Rhone-Poulenc Rorer, Antony, France); chloranbucil; GEMZAR® (gemcitabine); 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes, such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitors RFS 2000;difluoromethylornithine (DFMO);retinoids, e.g., retinoic acid;capecitabine;leucovorin (LV);irenotecan;adrenal corticotropic drugs;corticosteroids;progestins;estrogens;androgens;gonadotropin-releasing hormone analogs;and pharmacologic acceptable salts, acids, or derivatives of any of the above.Anti-hormonal agents that act to regulate or inhibit the action of hormones on tumors, such as anti-estrogens and selective estrogen receptor modulators (SERMs), including tamoxifen (including NOLVADEX® tamoxifen), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and FARESTON-toremifene;Aromatase inhibitors, which inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as 4(5)-imidazole, aminoglutethimide, MEGASE® megestrol acetate, AROMASL® exemestane, formestanie, fadrozole, RIVISOR® vorozole, FEMARA® letrozole, and ARTMIDES® anastrozole; and antiandrogens, such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; and troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those used to treat abherant cells. Also included are anti-cancer agents that inhibit the expression of genes in signal transduction pathways involved in proliferation, such as PKC-alpha, Ralf, and H-Ras; ribozymes, such as VEGF-A expression inhibitors (e.g., ANGIOZYME® ribozyme) and HER2 expression inhibitors; vaccines, such as gene therapy vaccines, such as ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; PROLEUKIN® rJL-2; LURTOTECAN® topoisomerase 1 inhibitors; ABARELLX® rmRH; antibodies, such as trastuzumab, as well as pharma- ceutically acceptable salts, acids, or derivatives of any of the above.;

[0086] There are several advantages of this GMP-based cancer immunotherapy over other types of cellular immunotherapy, such as CAR-T therapy. Long-term expansion of GMPs provides an opportunity to produce ready-made CAR-macrophages for immunotherapy. A major hurdle in the clinical application of ready-made CAR-macrophages is human leukocyte antigen (HLA) compatibility. The ability to long-term expand and genetically engineer GMPs allows for the establishment of master cell banks of GMPs collected from healthy donors and / or umbilical cord blood to generate ready-made CAR-macrophages for immunotherapy. Alternatively, HLA-universal GMPs can be generated using the genetic modification techniques described above. Long-term expansion of GMPs allows for sophisticated multiple genetic engineering on GMPs to make these cells more therapeutically applicable. For example, signal regulatory protein-α (SIRPα) and phosphatidylinositol 3-kinase-γ (PI3Kγ) genes can be knocked out to further enhance the antitumor activity of GMP-derived CAR-macrophages. SIRPα knockout in macrophages is expected to enhance their antitumor activity by disrupting CD47-SIRPα interaction between tumor cells and macrophages. PI3Kγ is abundantly expressed in macrophages and directly controls macrophage switching between immune stimulatory (M1 macrophages) and suppressive (M2 macrophages). Activation of PI3Kγ in macrophages induces a transcriptional program that promotes immune suppression during inflammation and tumor growth, whereas inactivation of macrophage PI3Kγ promotes an immune stimulatory transcriptional program. PI3Kγ- / - macrophages are expected to have enhanced antitumor activity by polarizing toward an immune stimulatory M1 phenotype.

[0087] Adoptive transfer of engineered GMPs has the potential to reverse the immunosuppressive tumor microenvironment (TME). Tumor-associated macrophages (TAMs) constitute a major component of the TME. Experimental and clinical studies have found that the majority of TAMs are immunosuppressive M2 macrophages that prevent tumor cells from being attacked by natural killer (NK) and T cells. These observations suggest the need to target TAMs in combination with other immunotherapies to achieve maximal antitumor effects. One strategy is to supplement the immunosuppressive M2 macrophages with immunostimulatory M1 macrophages that have antitumor activity. This is achieved by depleting TAMs and subsequently upregulating PI3Kγ. - / - This can be achieved by adoptive transfer of GMPs or immunostimulatory M1 macrophages generated from GMPs that overexpress IL-12. IL-12-expressing monocytes and macrophages have been shown to shift the TME from immunosuppressive to immunostimulatory.

[0088] GMPs can be engineered to produce macrophages that have the potential to initiate more complete and robust immune responses than CAR-T cells. Macrophages exhibit their antitumor activity through secretion of inflammatory cytokines, phagocytosis of cancer cells, and more importantly, processing of cancer antigens and their presentation to NK and T cells. Macrophages are professional antigen-presenting cells (APCs). Endogenous NK and T cells activated by macrophages are likely to initiate immune responses with high selectivity and efficiency. Thus, harnessing the power of GMPs / macrophages via genetic engineering represents a promising approach for developing next-generation cancer immunotherapy.

[0089] The present disclosure relates to a method of treating or preventing a disease associated with expression of a disease associated antigen in a subject, comprising administering to the subject an effective amount of a GMP (or macrophage, granulocyte, etc. derived therefrom) comprising a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding domain that binds to a disease associated antigen associated with the disease, the disease associated antigen being selected from the group consisting of CD5, CD19; CD123; CD22; CD30; CD171; CS-1 (also known as CD2 subset 1, CRACC, SLAMF7, CD319, and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRviii); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(l-4)bDGlcp(ll)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; glycosylated CD43 epitope expressed on acute leukemia or lymphoma but not on hematopoietic precursors, glycosylated CD43 epitope expressed on non-hematopoietic cancers, carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD 213A2); mesothelin; interleukin-11 receptor alpha (IL-llRa); prostate stem cell antigen (PSCA); protease serine 21 (Testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific fetal antigen-4 (SSEA-4); CD20; folate receptor alpha; receptor tyrosine-protein kinase ERBB2 (Her2 / neu); mucin 1, cell surface associated (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase;Prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor); carbonic anhydrase IX (CAlX); proteasome (prosome, macropain) subunit, beta, 9 (LMP2); glycoprotein 100 (gpl00); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDCla1p(l-4)bDGlcp(l-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o -acetyl-GD2 ganglioside (OAcGD2);folate receptor beta;tumor endothelial marker 1 (TEM1 / CD248);tumor endothelial marker 7-related (TEM7R);claudin 6 (CLDN6);thyroid-stimulating hormone receptor (TSHR);G protein-coupled receptor class C group 5, member D (GPRC5D);X chromosome open reading frame 61 (CXORF61);CD97;CD179a;anaplastic lymphoma kinase (ALK);polysialic acid;placenta-specific 1 (PLAC1);hexasaccharide portion of globoH glycoceramide (GloboH);mammary differentiation antigen (NY-BR-1);uroplakin 2 (UPK2);hepatitis A virus cell receptor 1 (HAVCR1);adrenergic receptor beta 3 (ADRB3);pannexin 3 (PANX3);G protein-coupled receptor 20 (GPR20);lymphocyte antigen 6 complex, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ES0-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation-variant gene 6, located on chromosome 12p (ETV6-AML);sperm protein 17 (SPA17); X antigen family, member lA (XAGEl); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; surviving; telomerase; prostate cancer tumor antigen-1 (PCT A-1 or galectin 8), melanoma antigen 1 recognized by T cells (MelanA or MARTI); rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; inhibitor of apoptosis in melanoma (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin Bl; v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 lB 1 (CYPlB 1); CCCTC-binding factor (zinc finger protein)-like (BORIS, i.e., Brother of the Regulator of Imprinted Sites Sites), squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TESl); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchoring protein 4 (AKAP-4); synovial sarcoma, X-breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RUl); renal ubiquitous 2 (RU2); legumain; human papilloma virus E6 (HPV E6); human papilloma virus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mut hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIRl);Fc fragment of IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); glypican-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLLl), MPL, biotin, c-MYC epitope tag, CD34, LAMP1 TROP2, GFR alpha 4, CDH17, CDH6, NYBR1, CDH19, CD200R, Slea (CA19.9;Sialyl Lewis antigen) fucosyl-GM1, PTK7, gpNMB, CDH1-CD324, DLL3, CD276 / B7H3, IL11Ra, IL13Ra2, CD179b-IGLl1, ALK TCR gamma-delta, NKG2D, CD32(FCGR2A), CSPG4-HMW-MAA, Tim1- / HVCR1, CSF2RA(GM-CSFR-alpha), TGF beta R2, VEGFR2 / KDR, Lewis Ag, TCR-beta 1 chain, TCR-beta 2 chain, TCR-gamma chain, TCR-delta chain, FITC, luteinizing hormone receptor (LHR), follicle-stimulating hormone receptor (FSHR), chorionic gonadotropin hormone receptor (CGHR), CCR4, SLAMF6, SLAMF4, HIV1 envelope glycoprotein, HTLV1-Tax, CMV pp65, EBV-EBNA3c, influenza A hemagglutinin (HA), GAD, PDL1, guanylyl cyclase C (GCC), KSHV-K8.1 protein, KSHV-gH protein, autoantibody to desmoglein 3 (Dsg3), autoantibody to desmoglein 1 (Dsg1), HLA, HLA-A, HLA-A2, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, HLA-G, IGE, CD99, RAS G12V, tissue factor 1 (TF1), AFP, GPRC5D, claudin 18.2 (CLD18A2 or CLDN18A.2), P-glycoprotein, STEAP1, LIV1, NECTIN-4, CRIPTO, GPA33, BST1 / CD157, small conductance chloride channel, and an antigen recognized by the TNT antibody, thereby treating the subject or preventing disease in the subject;

[0090] In another aspect, a method of treating a subject is provided, comprising administering an effective amount of a GMP (or macrophage, granulocyte, etc. derived therefrom) comprising a chimeric antigen receptor (CAR) to reduce or ameliorate a hyperproliferative disorder or condition (e.g., cancer) in the subject, such as a solid tumor, a soft tissue tumor, a blood cancer, or a metastatic lesion. As used herein, the term "cancer" is meant to include all types of cancerous growth or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or invasive stage. Exemplary solid tumors include malignancies of various organ systems, such as adenocarcinomas, sarcomas, and carcinomas, such as those affecting the breast, liver, lung, brain, lymphatic system, gastrointestinal tract (e.g., colon), genitourinary tract (e.g., kidney, urothelial cells), prostate, and pharynx. Adenocarcinomas include cancers, such as most colon cancers, rectal cancer, renal cell carcinoma, liver cancer, non-small cell carcinoma of the lung, cancer of the small intestine, and cancer of the esophagus. In one embodiment, the cancer is melanoma, e.g., advanced melanoma. Metastatic lesions of the above-mentioned cancers may also be treated or prevented using the methods and compositions of the present disclosure. Examples of other cancers that may be treated or prevented include pancreatic cancer, bone cancer, skin cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, head and neck cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's disease, non-Hodgkin's lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, acute myeloid leukemia, chronic bone marrow leukemia, chronic osteoporosis ... Chronic or acute leukemias including myelocytic leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, tumors of the spinal axis, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, and combinations of such cancers.

[0091] In another aspect, a method of treating a subject is provided, comprising administering an effective amount of a GMP (or macrophage, granulocyte, etc. derived therefrom) comprising a chimeric antigen receptor (CAR) to reduce or ameliorate a hyperproliferative disorder or condition (e.g., cancer) in the subject, such as a solid tumor, a soft tissue tumor, a blood cancer, or a metastatic lesion. As used herein, the term "cancer" is meant to include all types of cancerous growth or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or invasive stage. Exemplary solid tumors include malignancies of various organ systems, such as adenocarcinomas, sarcomas, and carcinomas, such as those affecting the breast, liver, lung, brain, lymphatic system, gastrointestinal tract (e.g., colon), genitourinary tract (e.g., kidney, urothelial cells), prostate, and pharynx. Adenocarcinomas include cancers, such as most colon cancers, rectal cancer, renal cell carcinoma, liver cancer, non-small cell carcinoma of the lung, cancer of the small intestine, and cancer of the esophagus. In one embodiment, the cancer is melanoma, e.g., advanced melanoma. Metastatic lesions of the above-mentioned cancers may also be treated or prevented using the methods and compositions of the present disclosure. Examples of other cancers that may be treated or prevented include pancreatic cancer, bone cancer, skin cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, head and neck cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's disease, non-Hodgkin's lymphoma, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, acute myeloid leukemia, chronic bone marrow leukemia, chronic osteoporosis ... Chronic or acute leukemias including myelocytic leukemia, acute lymphoblastic leukemia, chronic lymphocytic leukemia, solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, tumors of the spinal axis, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, and combinations of such cancers.

[0092] The following examples are intended to illustrate, but not limit, the disclosure. They are typical of those that might be used, although other procedures known to those skilled in the art can alternatively be used. EXAMPLES

[0093] Mice: C57BL / 6J (JAX stock no. 000664), B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo / J (mTmG, JAX stock no. 007676), B6.129S-Cybbtm1Din / J (gp91phox-, JAX stock no. 002365), NOD.Cg-Prkdcscid Il2rgtm1Wjl (NSG, JAX stock no. 05557) and B6J.129(Cg)-Gt(ROSA)26Sortm1.1(CAG-cas9 * ,-EGFP) Fezh / J (CAG-Cas9-EGFP, JAX stock number 026179) mice were purchased from Jackson Laboratory. All mice (male and female) were used between 6 and 12 weeks of age. All animal experiments were performed in accordance with protocols approved by the University of Southern California Animal Care and Use Committee. Animals (no more than 5 mice per cage) were provided with food and water and maintained on a constant 12-h light / dark cycle. NSG mice were bred under pathogen-free conditions.

[0094] CGD mouse model. gp91phox- mice (CGD mice) were irradiated with a lethal dose (950 cGy) and 5 × 10 6 tdTomato-positive GMPs and 2.5 x 10 4 gp91phox-whole bone marrow cells (helper cells) or 2.5 × 10 4 Mice were transplanted via tail vein injection with either 2 × 10 helper cells or 1 × 10 helper cells alone. Two days after transplantation, mice were 8100 S. aureus strain 502A (ATCC number 27217; ATCC) or 200 B. cepacia bacilli (ATCC number 25609; ATCC) were injected intraperitoneally. The number of bacteria in the inoculum was confirmed by serial dilution and plating. PBS or 5 × 10 6 tdTomato-positive GMPs were injected via the tail vein immediately after bacterial inoculation, and injections were repeated every 3 days thereafter. Mice were examined once daily and euthanized if moribund or 7 days after intraperitoneal challenge. The presence of intraperitoneal abscesses was assessed by visual inspection. In some experiments, blood cultures were obtained from tail vein blood samples and bacteremia was quantified by plate culture.

[0095] Media and Reagents. DMEM / F-12 (12400024) and Neurobasal (21103049) media were purchased from Thermo Fisher Scientific. Human insulin (91077C-250MG), human Holo-transferrin (T0665-100MG), putrescine (P5780-5G), sodium selenite (S9133-1MG), linoleic acid (L1012-100MG), DL-alpha tocopherol (vitamin E, T3251-5G) and bovine serum albumin (A8806-5G) were purchased from Sigma. Recombinant mouse SCF (250-03), recombinant human M-CSF (300-25) and recombinant human G-CSF (300-23) were purchased from PeproTech. GDC-0879 (S1104) and SKL2001 (S8302) were purchased from Selleck.

[0096] To prepare B7 medium, 500 ml of DMEM / F-12 and 500 mL of Neurobasal medium were mixed and supplemented with 4 mg human insulin, 20 mg human Holo-Transferin, 16 mg putrescine, 12.5 μg sodium selenite, 1 mg linoleic acid, 1 mg vitamin E, and 2.5 g bovine serum albumin. Insulin does not dissolve readily; insulin is dissolved overnight at 4° C. in 0.01 M sterile HCl to produce a 10 mg / mL stock solution. Store at −20° C. in 1 mL aliquots. The suspension was mixed thoroughly before aliquoting.

[0097] Induction, expansion and differentiation of mouse GMP. Cells were cultured at 37 °C in a 5% CO2 water jacketed incubator (Thermo Scientific). Bone marrow cells isolated from C57BL / 6J, mTmG or CAG-Cas9-EGFP mice were cultured at 2 × 10 6 The cells were plated in 6-well plates at a density of 10 cells / well and cultured in 2 mL of B7 medium supplemented with 50 ng / mL SCF, 1 μM GDC-0879, and 10 μM SKL2001 (SCF / 2i). After 3-4 days, the cells were dissociated into a single cell suspension by pipetting up and down and then cultured at a density of 2 × 10 6 The cells were replated in 6-well plates at a density of 1000 cells / well and cultured in 2 mL of B7 medium supplemented with SCF / 2i. After two passages in SCF / 2i, the majority of the cells were GMPs. GMPs were routinely passaged every 3 days. To induce differentiation, GMPs were plated in 10 cm tissue culture dishes and cultured in RPMI-1640 medium containing 10% FBS and supplemented with either 20 ng / mL M-CSF (for macrophage differentiation) or 20 ng / mL G-CSF (for granulocyte differentiation). GMP-derived macrophages were harvested on day 7 (medium was changed once on day 4) and GMP-derived granulocytes were harvested on day 3 and used for further experiments.

[0098] To generate bone marrow-derived macrophages, 2 × 10 6Bone marrow cells were plated in 10 cm tissue culture dishes and cultured in RPMI-1640 medium containing 10% FBS and 20 ng / ml M-CSF. Medium was changed on day 4 and cells were harvested on day 7.

[0099] Peritoneal macrophages were generated by injecting 1 mL of 2% Bio-Gel P-100 (Bio-Rad, 1504174) into the mouse peritoneal cavity immediately after implantation of tdTomato-positive GMPs, followed by peritoneal lavage with sterile PBS 4 days later. Cells collected from the peritoneal cavity were used for fluorescent imaging and flow cytometry analysis.

[0100] Derivation and expansion of GMP cells. Cord blood samples were obtained from StemCyte (Baldwin Park, CA), whole bone marrow was purchased from Stemcell Technologies (catalog number 70502.2), and mobilized peripheral blood was purchased from StemExpress (catalog number MLE4GCSF5). Mononuclear cells were isolated using Ficoll-Paque™ PLUS kit (GE Healthcare Life Sciences, 17-1440-03). Briefly, blood was diluted with PBS at a ratio of 1:3 and added into a SepMate™-50 tube (Stemcell Technologies, 85460) pre-filled with 15ml Ficoll-Paque™ PLUS. After centrifugation at 1200g for 20 minutes at room temperature, the top layer was collected and centrifuged at 300×g for 10 minutes at 4° C. Residual red blood cells were removed by using ACK lysis buffer. Cells were used immediately or frozen and stored in liquid nitrogen.

[0101] For the expansion of GMP, Lin-(CD3, CD14, CD19 and CD56)CD34 + CD38 + CD45RA + GMPs were sorted from mononuclear cells isolated from umbilical cord blood, whole bone marrow or mobilized peripheral blood. Sorted GMPs were cultured at 4×10 4Cells were plated in 96-well plates at a density of 100 cells / well and cultured in B6 medium supplemented with SCF (50 ng / mL. AF-300-07, PeproTech), GDC-0879 (1 μM).

[0102] Five days after the initial plating, GMP was added to 1 × 10 5 They were routinely passaged every 3 days by replating in 48-well plates at a density of 100 cells / well and cultured in modified SCF / 2i. Replacement of GDC-0879 with SB590885 (0.5 μM. S2220, Selleck) could slightly increase the GMP growth rate. To prepare B6 medium, mix 500 mL of DMEM / F-12 and 500 ml of Neurobasal medium and supplement with 4 mg insulin, 20 mg Holo-transferrin, 12.5 μg sodium selenite, 1 mg linoleic acid, 1 mg vitamin E and 2.5 g serum albumin.

[0103] Induction of human leukemia cells. Clinical specimens were obtained from patients with adult B-cell acute lymphoblastic leukemia (B-ALL). Human B-ALL cells were induced by human CD45 + And CD19 + Human B-ALL cells were isolated from bone marrow aspirates of B-ALL patients by sorting for GFP lentivirus. Human B-ALL cells were transduced with GFP lentivirus. The cells were transplanted into NSG mice and GFP + Leukemia cells were selected from mouse spleens 6 weeks after transplantation.

[0104] Chimeric antigen receptors (CarPs) for macrophage phagocytosis. The CarP constructs used in mouse GMP were constructed by fusing human CD19 scFv or HER2 scFv to the human CD8 hinge and transmembrane domain, resulting in P2A-RFP (CarP-RFP), mouse Fcer1g (NM_010185.4, aa19-86)-mouse CD19 (NM_009844.2, aa491-535)-P2A-RFP (CarP Fc19-RFP) or mouse CD3ζ (NM_001113391.2, aa52-164)-mouse Fcer1g (aa45-86)-mouse CD19-P2A-RFP (CarP zFc19 -RFP). The intracellular domains of the αCD19 CarP constructs used in GMP were human CD3ζ (NM_198053.2, aa52-164)-human Fcer1g (NM_004106.1, aa45-86)-human CD19 (NM_001178098.1, aa498-544). All CarP receptors contain an N-terminal CD8a signal peptide (MALPVTALLLPLALLLHAARP (SEQ ID NO:1)) for membrane targeting. All receptors were codon-optimized, synthesized by Integrated DNA Technologies, and cloned into a modified pSin-EF2 lentiviral backbone by restriction enzyme digestion and T4 ligation.

[0105] Electroporation, lentivirus production and GMP transduction. GFP mRNA (TriLink, L7601-100) and single guide RNA (Synthego, sequence: CCGUCCAGCUCGACCAGGAU (SEQ ID NO:2)) were electroporated into GMP using the Neon transfection system (ThermoFisher, MPK5000). Briefly, GMPs derived from WT or CAG-Cas9-EGFP mice were expanded in SCF / 2i. For transfection, GMPs were harvested, washed twice with PBS and diluted to 1 × 10 in buffer R. 7 GMPs were resuspended at a concentration of 10 μg / mL. 5 μg GFP mRNA or sgRNA was added to 10 μl of WT or CAG-Cas9-EGFP GMP suspension and electroporated with one 20 ms pulse of 1600 V. After electroporation, GMPs were plated and cultured in SCF / 2i. After 48 hours, GFP expression was examined using fluorescence microscopy and flow cytometry.

[0106] Lentiviruses were produced by co-transfection of pSin plasmids and vectors (pSPAX and pVSVG) encoding packaging proteins using lipofectamine LTX with plus transfection reagent (ThermoFisher, 15338100) in Lenti-X 293T cells (Takara, 632180) plated in 10 cm dishes at approximately 80% confluence. Viral supernatants were collected 2 days after transfection, 0.45 μM filtered, and concentrated in a Lenti-X concentrator (Takara, 631232). Concentrated viruses were used immediately for transduction or frozen for long-term storage. For GMP transduction, lentiviruses were added to GMP cultures and centrifuged at 800 g for 1.5 h at 32° C. Cells were resuspended in fresh medium and cultured for 48 h. RFP-positive cells were sorted by FACS.

[0107] Quantification and statistical analysis. Statistical analysis (except for RNA-seq experiments) was performed using the PRISM program (GraphPad). Two groups were compared using unpaired t-tests. To assess the statistical significance of differences between more than two treatments, a two-way ANOVA was utilized.

[0108] Engineering SCF / 2i GMPs to selectively target cancer cells. Macrophages are an attractive therapeutic target for treating cancer. Macrophages exhibit their anti-cancer effects through phagocytosis of cancer cells and subsequent presentation of cancer antigens to T cells. Because macrophages are difficult cells to transfect, we assessed whether genetic engineering could be performed on SCF / 2i GMPs and whether macrophages derived from these engineered GMPs could be used to selectively target cancer cells. First, it was demonstrated that highly efficient genetic modification could be achieved in SCF / 2i GMPs. Next, as a proof-of-principle study, GMPs were engineered to specifically target human B-cell lymphomas. Chimeric antigen receptor (CAR) T-cell therapy has been approved by the US Food and Drug Administration (FDA) to treat B-cell lymphomas. More recently, studies have demonstrated that macrophage-mediated phagocytosis of cancer cells can be enhanced via engineering macrophages to express a CAR for phagocytosis (CarP). We generated a CarP that contains an extracellular single-chain antibody variable fragment (scFv) (αCD19 scFv) that recognizes the human B cell antigen CD19, the human CD8 transmembrane domain, and the mouse CD19 cytoplasmic domain fused to the mouse common γ subunit of the Fc receptor (FcRγ). Fc19 The transgene was linked to red fluorescent protein (RFP) (CarP Fc19 -RFP), which facilitated monitoring of transgene expression. A control CarP (CarP-RFP) was constructed that contains an extracellular αCD19 scFv antibody fragment, a CD8 transmembrane domain, and a cytoplasmic RFP, but does not have the cytoplasmic signaling domain (see FIG. 1C).

[0109] CarP by lentiviral infection Fc19 After transfection of CarP-RFP and CarP-RFP into SCF / 2i GMPs, RFP-positive GMPs were selected and expanded in SCF / 2i. To assess phagocytosis, macrophages were transfected with CarP Fc19CarP-RFP and CarP-RFP GMPs were generated and co-cultured with GFP-labeled human B-cell acute lymphoblastic leukemia (B-ALL) cells. As expected, very rare (0.21 ± 0.08%) phagocytosis was observed in the CarP-RFP group, because CarP-RFP lacks the cytoplasmic domain responsible for activating phagocytic signals. In contrast, CarP Fc19 -RFP macrophages engulfed GFP-positive human B-ALL cells within 1 h of coculture (see Fig. S2A ).

[0110] CarP Fc19 Since the phagocytosis efficiency of macrophages expressing CarP-RFP was still relatively low, we tested whether the efficiency could be improved by combining signaling motifs that could promote phagocytosis. Since the CD3ζ intracellular domain contains the same immunoreceptor tyrosine-based activation motif (ITAM) as FcRγ and has been shown to be able to enhance phagocytosis (Isakov, 1997), we investigated whether the efficiency could be improved by combining signaling motifs that could promote phagocytosis. Fc19 The cytoplasmic domain of -RFP was modified by adding the mouse CD3ζ cytoplasmic domain (CarP zFc19 -RFP) (see FIG. 1C). When co-cultured with human B-ALL cells, CarP zFc19 The -RFP-expressing macrophages immediately began to engulf the leukemia cells. Some macrophages phagocytosed multiple leukemia cells (see Figure 1D and Figure 3B). Flow cytometry analysis revealed that the CarP zFc19 It was shown that 41.57 ± 9.26% of -RFP-expressing macrophages engulfed leukemia cells within 1 hour of co-culture (see Figure 1E).

[0111] We next assessed the specificity of CarP macrophages in targeting cancer cells. zFc19The αCD19 scFv cassette of -RFP was replaced with human epidermal growth factor receptor 2 (HER2) scFv to generate αHER2 CarP. αHER2 CarP macrophages generated from αHER2 CarP GMP were cocultured with GFP-labeled SK-BR-3 cells, a human breast cancer cell line that overexpresses HER2. 30.8 ± 6.3% of αHER2 CarP macrophages engulfed SK-BR-3-GFP cells within 1 h of coculture, whereas phagocytosis was very rare when αHER2 CarP macrophages were cocultured with GFP-labeled human B-ALL cells that do not express HER2 (see Figure 3C-D). In contrast, CarP zFc19 -RFP macrophages efficiently engulfed CD19-expressing human B-ALL cells but not CD19-negative SK-BR-3 cells (see FIG. 3D). These results suggest that CarP macrophages target cancer cells in a highly specific manner.

[0112] CD47 blockade synergistically enhances phagocytosis of CarP macrophages. Previous studies have suggested that macrophage phagocytosis efficiency can be increased by blocking CD47, a "don't eat me" signal to macrophages. zFc19 We tested whether anti-CD47 and anti-CD47 antibodies could act synergistically to enhance macrophage phagocytosis. Within 1 h of co-culture, 41.6 ± 9.3% of CarPs were engulfed compared with 41.6 ± 9.3% without pre-incubation. zFc19 86.2±13.8% of CarP-RFP-expressing macrophages engulfed human B-ALL cells preincubated with 20 μg / ml anti-CD47 antibody for 30 min. For macrophages expressing CarP-RFP, the phagocytosis efficiency increased from 0.21±0.08% to 18.57±2.85% when human B-ALL cells were preincubated with anti-CD47 antibody. More notably, almost all human B-ALL cells preincubated with anti-CD47 antibody engulfed CarP-RFP after 24 h of coculture. zFc19These data demonstrate that CarP and anti-CD47 antibodies act synergistically to improve macrophage phagocytosis of cancer cells.

[0113] Engineering ex vivo expanded GMPs to selectively target cancer cells. To determine whether ex vivo expanded GMPs could be engineered to selectively phagocytose human B-ALL cells, we used CarP zFc19 CarP-RFP expressing GMPs were generated and expanded in modified SCF / 2i. zFc19 Macrophages generated from CarP-RFP GMPs were co-cultured with GFP-labeled human B-ALL cells. Flow cytometry analysis revealed that 0.87 ± 0.2% of macrophages expressed CarP compared with 0.87 ± 0.2% of macrophages expressed CarP-RFP. zFc19 It was shown that 28.6 ± 4.5% of -RFP-expressing macrophages engulfed leukemia cells within 1 hour of co-culture (see Figures 2C and 4A). zFc19 The phagocytosis efficiency for CarP-RFP macrophages was further increased to 69.5±5.6% and 32.8±5.5%, respectively, when human B-ALL cells were preincubated with anti-CD47 antibody (see FIG. 2C). More notably, CarP zFc19 -RFP macrophages engulfed and digested nearly all human B-ALL cells preincubated with anti-CD47 antibodies after 36 h of coculture (see FIG. 4B).

[0114] It is understood that various modifications can be made without departing from the spirit and scope of the disclosure. Accordingly, other embodiments are within the scope of the following claims.

Claims

1. 1. A method for genetically engineering granulocyte-macrophage precursor (GMP) cells to express a chimeric antigen receptor (CAR), comprising: introducing a vector containing the CAR into a GMP to form a GMP expressing the CAR (CAR-GMP); expanding and culturing the CAR-GMP for multiple passages in defined culture conditions to generate a population of CAR-GMP; and inducing said population of CAR-GMP to differentiate in vitro into granulocytes, macrophages or dendritic cells, wherein said granulocytes, macrophages or dendritic cells express CAR. A method comprising:

2. The method of claim 1 , wherein the GMP is obtained from stem cells, the stem cells being hematopoietic stem cells.

3. 2. The method of claim 1, wherein the CAR comprises an extracellular domain capable of binding to an antigen, a transmembrane domain, and at least one intracellular domain designed to increase the anti-tumor activity of granulocytes, macrophages and dendritic cells by increasing their phagocytosis and / or pro-inflammatory cytokine secretion.

4. 2. The method of claim 1, wherein the vector is a viral vector, which may be replicating or non-replicating and may be an adenovirus vector, an adeno-associated virus (AAV) vector, a measles vector, a herpes vector, a retrovirus vector, a lentivirus vector, a rhabdovirus vector, a reovirus vector, a Seneca Valley Virus vector, a poxvirus vector, a parvovirus vector or an alphavirus vector, or wherein the viral vector is a lentivirus vector.

5. The defined culture conditions include: (i) a growth factor, (ii) a B-Raf kinase inhibitor, and (iii) Wnt activator and / or GSK-3 inhibitor wherein the CAR-GMP remains morphologically substantially unchanged after undergoing multiple cell passaging and / or clonal expansion.

6. 6. The method of claim 5, wherein the culture medium comprises DMEM / F12 and Neurobasal medium, wherein the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 5:1 to about 1:5, or wherein the culture medium comprises DMEM / F12 and Neurobasal medium in a ratio of about 1:

1.

7. the culture medium comprises one or more supplements selected from insulin, transferrin, bovine serum albumin (BSA) fraction V, putrescine, sodium selenite, DL-alpha tocopherol, and linolenic acid and / or linoleic acid, or 6. The method of claim 5, wherein the culture medium is supplemented with insulin, transferrin, BSA fraction V, putrescine, sodium selenite, DL-alpha tocopherol, and linolenic acid and / or linoleic acid.

8. The method of claim 5 , wherein the growth factor is stem cell factor (SCF).

9. 6. The method of claim 5, wherein the B-Raf kinase inhibitor is selected from the group consisting of GDC-0879, PLX4032, GSK2118436, BMS-908662, LGX818, PLX3603, RAF265, RO5185426, vemurafenib, PLX8394, SB590885, and any combination thereof.

10. 6. The method of claim 5, wherein the Wnt activator is selected from the group consisting of SKL 2001, BML-284, WAY 262611, CAS 853220-52-7, QS11, and any combination thereof.

11. 6. The method of claim 5, wherein the GSK-3 inhibitor is selected from the group consisting of CHIR99021, CHIR98014, SB216763, BIO, A1070722, AR-A014418, and any combination thereof.

12. The method of any one of claims 1 to 11, wherein the CAR-GMP is induced to differentiate into a macrophage, which comprises culturing the CAR-GMP with a macrophage differentiation medium containing macrophage colony-stimulating factor (MCSF), and the macrophages express CAR.

13. A macrophage expressing a CAR, prepared by the method of claim 12.

14. The method of any one of claims 1 to 11, further comprising a step of differentiating the CAR-GMP into granulocytes, which comprises culturing the GMP with a granulocyte differentiation medium containing granulocyte colony stimulating factor (GCSF), wherein the granulocytes express CAR.

15. A CAR-expressing granulocyte prepared by the method of claim 14.

16. 1. An immunotherapeutic method for treating a subject having cancer with macrophages or granulocytes expressing a chimeric antigen receptor (CAR), comprising: Administering a composition comprising the macrophages of claim 13 or the granulocytes of claim 15 to said subject with cancer. A method comprising:

Images