Compounds that bind to non-canonical G-quadruplex structures and methods for making and using same - Patents.com
Patent Information
- Application Number
- JP2023575827
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-06-09
- Filing Date
- 2022-06-09
- Publication Date
- 2025-06-18
AI Technical Summary
Current methods have failed to develop effective ligands that target the undruggable N-Myc protein, which is often overexpressed in cancers like neuroblastoma and small cell lung cancer, due to the structural complexity of G-quadruplexes in genes such as MYCN.
Development of a new class of small molecule compounds that selectively bind to non-canonical G-quadruplex structures, particularly hairpin-containing G4s in genes like MYCN, to reduce N-Myc expression.
The compounds effectively decrease MYCN and MYCNOS transcripts and N-Myc protein levels, providing a potential therapeutic approach for cancer treatment.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to the earlier filing date of U.S. Provisional Patent Application No. 63 / 208,918, filed June 9, 2021, which is incorporated by reference in its entirety herein.
[0002] Confirmation of government support This invention was made with Government support under Project No. Z01 ZIA BC011585 07 awarded by the National Institutes of Health, National Cancer Institute-Center for Cancer Research. The Government has certain rights in this invention.
[0003] Field The present disclosure relates to compounds that selectively bind to non-canonical G-quadruplex DNA structures found in certain genes, as well as methods of using the compounds to reduce or inhibit expression of such genes in cells, such as cancer cells. [Background technology]
[0004] background The MYC family of genes encodes transcription factors that broadly govern and amplify gene expression. The three Myc proteins, c-Myc, N-Myc, and l-Myc, contain a basic helix-loop-helix (bHLH) region that binds to DNA and directly regulates transcription. Among these genes, MYCN has been shown to be involved in fetal development and highly expressed in neural tissues. MYCN is often overexpressed or mutated during cancer and is considered an oncogene in cancers such as neuroblastoma and small cell lung cancer. Embedded within the MYCN locus is a second transcript, produced by antisense transcription and originally called ncym, which was shown to be embedded within a longer noncoding RNA (lncRNA) called MYCN inverse strand (MYCNOS). Expression of MYCNOS has been shown to decrease promoter occupancy of MYCN and to regulate the stability of the MYCN transcript by sequence complementarity. More recent studies have also demonstrated that variant 2 of the MYCNOS transcript, NCYM, can be translated to produce small proteins. This polypeptide, known as NCYM, is characterized by diverse regulatory activities, including regulating the stability of N-Myc protein, inhibiting GSK3β, and affecting Wnt / β-catenin signaling.
[0005] Molecules that modulate or inhibit N-Myc protein and other proteins involved in cancer are of interest as anti-cancer drugs, but as a transcription factor, N-Myc protein has classically been considered "undruggable," and attempts to develop ligands that target N-Myc itself and other undruggable proteins (particularly those that contain G-quadruplexes or "G4s" like N-Myc) have been unsuccessful. There is a need in the art for compounds, e.g., small molecules, that can bind to G4-like structures in disease-associated genes, including protein-coding and non-coding gene products, to achieve selectivity in targeting such genes. Summary of the Invention [Means for solving the problem]
[0006] Abstract Described herein is a new class of small molecule compounds that target non-canonical G4 structures, such as hairpin-containing G4s found in the MYCN gene. In certain embodiments, the compounds are useful, for example, in methods of reducing or inhibiting N-Myc expression in cells (e.g., cancer cells), as well as in methods of treating or preventing cancer in a subject, where the cancer is characterized at least in part by N-Myc overexpression.
[0007] Compounds according to formula IA [ka] (In the formula, X 1 , X 2 and X 3 each is independently N or O; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5. with the proviso that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4 -oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine, or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine. Described herein are compounds, or stereoisomers, tautomers, or pharma- ceutically acceptable salts or esters thereof.
[0008] Compounds according to formula I [ka] (In the formula, Ring A is a 5-membered heteroaryl ring other than thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, and 1,3,4-oxadiazolyl; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is - (linker) t -R b where R bis aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; Each R 4 are independently H, aliphatic, or halo; x is an integer selected from 0 to 5; n is an integer selected from 0 to 10. with the proviso that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4 -oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine, or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine. Also described herein are the compounds, or their stereoisomers, tautomers, or pharma- ceutically acceptable salts or esters.
[0009] In some embodiments, the compound, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof, has the structure according to Formula I: [ka] (In the formula, Ring A is a 5-membered heteroaryl ring; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CR a 2 ) m -R b where each R a is independently H, alkyl, or halo; m is 1, 2, 3, 4, or 5; R b is a nitrogen-containing group; R 2 is H or alkyl; Each R 3 is independently alkoxy, hydroxy, aliphatic, or halo; Each R 4 is independently H, alkyl, or halo; n is 0, 1, 2, or 3; x is 0, 1, 2, 3, 4, or 5) with the proviso that the compound does not contain the structure designated as any one of MY-1, MY-2, MY-10, MY-11, or MY-12.
[0010] In some embodiments, the compound, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof, has the structure according to Formula I: [ka] (In the formula, Ring A is a 5-membered heteroaryl ring; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CRa 2 ) m -R b or -[(CR a 2 ) m O] r -(CH 2 ) s -R b where each R a are independently H, aliphatic, or halo; t is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; s is 0 or 1; R b is an acridinyl group; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; Each R 4 are independently H, aliphatic, or halo; x is an integer selected from 0 to 5; n is an integer selected from 0 to 10. has.
[0011] Further disclosed are embodiments of pharmaceutical compositions comprising a compound according to the present disclosure and at least one pharma- ceutically acceptable excipient.
[0012] Also disclosed is a method for reducing cancer-associated protein expression in a cell, comprising contacting the cell with an effective amount of a compound according to the present disclosure or its stereoisomer, tautomer, or pharmaceutically acceptable salt or ester.Also disclosed is a use of a compound according to the present disclosure or its stereoisomer, tautomer, or pharmaceutically acceptable salt or ester for reducing N-Myc expression in a cell, comprising contacting the cell with an effective amount of the compound.In some embodiments, the use is for treating or preventing cancer in a subject.In some embodiments, the use is for manufacturing a medicament for treating or preventing cancer in a subject.
[0013] The above and other objects and features of the present disclosure will become more apparent from the following detailed description which proceeds with reference to the accompanying drawings.
[0014] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the U.S. Patent and Trademark Office upon request and payment of the necessary fee. [Brief description of the drawings]
[0015] [Figure 1] FIG. 1 is a table listing the five G-quadruplex sequences used in the binding selectivity profiling discussed herein, in which all DNA / RNA oligos are labeled with Cy5 fluorescent dye at the 5′ end and the guanines involved in G4 formation are underlined. [Diagram 2] FIG. 2 is a table listing MYCN wild-type / mutant / truncated G4 sequences. [Diagram 3] FIG. 3 shows the location of the G4 forming sequence in the MYCN gene. [Figure 4] FIG. 4 is a map showing the probability of MYCN G4 formation obtained by genome-wide G4 sequence analysis. [Diagram 5] Figures 5A and 5B show the results of quadruplex-forming G-rich sequence (or QGRS) analysis of G-quadruplex-forming sequences in MYCN / MYCNOS, where Figure 5A shows the G4-forming sequences (targets of interest) in MYCNOS discovered by G4-seq technology and Figure 5B shows the G-scores of potential G4s within this region. [Figure 6] FIG. 6 shows four hit compounds identified using small molecule microarray (SMM) screening. [Figure 7] FIG. 7 shows the fluorescence intensity assay results for 14 hit compounds from SMM (100 μM in 5% DMSO) and a negative control (compound 15), along with structures for four specific compounds, including compounds 1, 2, and 5, and compound MY-1. [Figure 8]FIG. 8 shows the surface plasmon resonance results for the compounds of FIG. [Figure 9] FIG. 9 shows the binding affinity measurements for compounds 1, 2, MY-1, and 5 by fluorescence intensity assay. [Figure 10] FIG. 10 shows the binding affinity measurements for compounds 1, 2, MY-1, and 5 by surface plasmon resonance. [Figure 11] 11A-11D show MYCN G4 structure stabilization and binding selectivity evaluation by small molecules, where FIG. 11A is the circular dichroism (CD) spectra of MYCN G4 DNA in different buffers (10 mM Tris containing 100 mM KCl or 100 mM LiCl) and in water; FIG. 11B is the CD curve recording of 5 μM MYCN G4 during melting in low KCl buffer (10 mM Tris, pH 7.0, 5 mM KCl); FIG. 11C shows MYCN G4 melting with / without compound 1 or MY-1; and FIG. 11D shows the CD melting study of dsDNA incubated with compound 1 or MY-1. [Figure 12] FIG. 12 shows the CD spectra of MYCN G4 after annealing in buffers containing 10 mM Tris, pH 7.0, and 100, 20, or 5 mM KCl. [Figure 13] Figures 13A and 13B show the binding selectivity profiles of compound 1 (Figure 13A) and MY-1 (Figure 13B) using tRNA in a 2-aminopurine fluorescence assay performed by gradually adding compound to MYCN G4 DNA in the absence / presence of 10x tRNA. [Figure 14] 14A-14E are graphs showing the binding affinity of compound 1 to six different G4 targets, where all of the DNA / RNA G4 oligomers were 5'-labeled with a fluorophore and titration curves were obtained by fluorescence intensity assay. [Figure 15] 15A-15E are graphs showing the binding affinity of compound MY-1 to six different G4 targets, where all of the DNA / RNA G4 oligomers were 5'-labeled with a fluorophore and titration curves were obtained by fluorescence intensity assay. [Figure 16] 16A-16E are quality control graphs of the G4s used in the selectivity evaluation described herein, where all G4s were tested by fluorescence intensity assay using the classical G4 binder TMPyP4 (100 μM) as a positive control. [Figure 17] FIG. 17 is an SPR curve of a competitive binding study between Compound 1 and MY-1. [Figure 18] Figures 18A and 18B show the results of a competition assay of compound 1 and MY-1, where Figure 18A is the SPR curve of sequential injections of compound 1 and MY-1, and Figure 18B shows the binding levels of compound MY-1 after injection of different concentrations of compound 1. [Figure 19] Figures 19A and 19B show the results of an SPR binding assay of TMPyP4 with and without compound MY-1 at concentrations of 50 μM (Figure 19A) and 250 μM (Figure 19B). [Figure 20] Figures 20A and 20B contain CD melting curves of G4 stabilized by individual compounds (MY-1) or compound mixtures (1 and MY-1) (Figure 20A), and melting temperatures of MYCN G4 stabilized by combinations of compounds (Figure 20B). [Figure 21] FIG. 21 is a graph depicting the stoichiometry of compound MY-1 binding to MYCN G4 as determined by Job plot analysis. [Figure 22] FIG. 22 is a graph showing the fluorescence titration of compound MY-1 using 3′-Cy5 labeled MYCN G4 DNA. [Figure 23] Figures 23A and 23B summarize the results of microscale thermophoresis (MST) studies on the binding of compound MY-1 with 3'Cy5-MYCN G4. [Figure 24-1]24A-24F show results from binding site assessment using a fluorescence quenching based method and dimethyl sulfate (DMS) footprinting, where FIG. 24A is a schematic prediction of the MYCIN G4 fold; FIG. 24B is a quenching study by adding 100 μM MY-1 to a solution of 5' / 3'-Cy5 labeled MYCN G4; FIG. 24C is a quenching study by adding 100 μM MY-1 to a solution of 2-AP MYCN G4 labeled at positions A11, A18 and A24, respectively; FIG. 24D shows a fluorescence titration using 5'-Cy5 labeled wild-type / mutant / truncated MYCN G4 DNA samples - fluorescence intensities were recorded during the titration and KD values were calculated by curve fitting; FIG. 24E shows a fluorescence titration study using minor groove binders (Hoechst FIG. 24F shows the DMS footprinting results of MYCN G4-DNA incubated with different concentrations of compound MY-1 (G tracts involved in quadruplex tetrads are underlined), with protective Gs affected by compound MY-1 marked with dots (●) (highly affected) or circles (○) (slightly affected). [Figure 24-2] Same as above. [Figure 24-3] Same as above. [Diagram 25] Figures 25A-25C show fractional inactivation determination by titration based on 2-AP modification, where DNA oligomers 2-AP labeled at positions A11 (Figure 25A), A18 (Figure 25B), or A24 (Figure 25C) were titrated with a series of concentrations of compound MY-1. [Figure 26-1] 26A-26N show the results of binding assays performed using SPR for 14 different compounds of the disclosure. [Figure 26-2] Same as above. [Figure 26-3] Same as above. [Figure 27-1] 27A-27N show the results of binding assays performed with 14 different compounds of the disclosure using DNA 2-AP labeled at position A11. [Figure 27-2] Same as above. [Figure 27-3] Same as above. [Figure 28-1] Figures 28A-28G show the effect of compound MY-8 on MYCN / MYCNOS expression in NBEB cells, where Figure 28A is an image of cell confluency after treatment with different concentrations of the compound; Figure 28B shows time-dependent cell confluency curves at different concentrations; Figure 28C is an MTS assay analysis of cell viability; Figures 28D-28F are graphs of MYCN (Figure 28D), MYCNOS001 (Figure 28E), and MYCNOS002 (Figure 28F) mRNA expression after MY-8 treatment; and Figure 28G is a western blot showing MYCN levels after MY-8 treatment. [Figure 28-2] Same as above. [Figure 29] FIG. 29 is a table summarizing representative hairpin G4 sequences in cancer-associated genes. [Diagram 30] FIG. 30 is a schematic diagram showing the binding activity of a bivalent compound (compound B33) containing a non-canonical G4 binding component and a G4 stacker component. [Diagram 31] Figures 31A and 31B are graphs of surface plasmon resonance response as a function of time (Figure 31A) and concentration (Figure 31B) showing MYCN hairpin G4 binding affinity for acridine ICR 191. [Diagram 32] Figures 32A and 32B are graphs of surface plasmon resonance response as a function of time (Figure 32A) and concentration (Figure 32B) showing MYCN hairpin G4 binding affinity for a bivalent compound according to the present disclosure (compound B33). [Diagram 33] 33A and 33B are graphs of surface plasmon resonance response as a function of time showing the dsDNA binding affinity of acridine ICR 191 (FIG. 33A) and of a bivalent compound according to the present disclosure (compound B33) (FIG. 33B). [Diagram 34] Figures 34A and 34B are graphs of fluorescence intensity as a function of DNA concentration showing the dsDNA binding affinity of acridine ICR 191 (Figure 34A) and of a bivalent compound according to the present disclosure (compound B33) (Figure 34B) using FIA. [Figure 35-1]Figures 35A-35F show the results of binding selectivity profiling using G4 microarrays and three different compounds including a bivalent compound according to the present disclosure (compound B33), thiazole orange, and amsacrine, where Figures 35A, 35C, and 35E are optical images showing the fluorescence observed for the bivalent compound, thiazole orange, and amsacrine, respectively, and the different targets; Figures 35B, 35D, and 35F are bar graphs showing the fluorescence intensity values for the binding selectivity of the bivalent compound, thiazole orange, and amsacrine, respectively, and the different targets. [Figure 35-2] Same as above. [Diagram 36] FIG. 36 is a spectrum obtained using circular dichroism spectroscopy showing the results of a thermal melting assay of MYCN G4 DNA exposed to a control (DMSO), acridine ICR, and a bivalent compound according to the present disclosure (compound B33). [Figure 37-1] Figures 37A-37G are images of results obtained from binding selectivity profile studies of a bivalent compound of the present disclosure (compound B33) and thiazole orange using high density DNA oligo microarrays, where Figure 37A is an optical image showing the fluorescence observed for these two different compounds; Figure 37B is a kernel density estimation (KDE) plot and Figure 37C is a violin plot representing the distribution of binding signals across the microarray; Figures 37D and 37E provide plots summarizing the binding behavior of the two compounds; and Figures 37F (thiazole orange) and 37G (bivalent compound) are graphs providing the Gini coefficients for the two different compounds. [Figure 37-2] Same as above. [Figure 37-3] Same as above. [Figure 38] Figures 38A and 38B provide the DMS footprints of MYCN G4 DNA with and without a bivalent compound (compound B33) (Figure 38A), as well as the proposed folded structure of the hairpin-containing G4 (Figure 38B). [Figure 39]Figures 39A and 39B are FIA graphs of the results for binding of a bivalent compound (compound B33) to MYCN G4 with an uncoiled hairpin (Figure 39A) and a truncated hairpin (Figure 39B). [Diagram 40] FIG. 40 is a graph of SPR response as a function of time for binding of a divalent compound (compound B33) to MANGO II RNA G4, where weak binding was observed. [Diagram 41] 41A and 41B show the results of binding mode evaluation of a bivalent compound (compound B33) and a hairpin G4 (BCL2) with a parallel structure. [Diagram 42] 42A and 42B show the results of binding mode evaluation of a bivalent compound (compound B33) and hairpin G4 (HIV) with a (3+1) hybrid structure. [Diagram 43] 43A and 43B show the results of binding mode evaluation of a bivalent compound (compound B33) and hairpin G4 (PIM1-first form) with a (3+1) hybrid structure. [Diagram 44] 44A and 44B show the results of binding mode evaluation of a bivalent compound (compound B33) and hairpin G4 (PIM1-second form) with a (2+2) chair structure. [Diagram 45] FIG. 45 shows a summary of MYCN HP-G4 binding activity results (as assessed using FIA and SPR) for different bivalent compounds with different linker groups (B32, B33, B34, B35, and B38). [Figure 46-1] 46A-46D are graphs of the FIA results for different divalent compounds (B32, B33, B34, B35, and B38) with different linker groups. [Figure 46-2] Same as above. [Figure 47-1] 47A-47H are graphs of SPR results for different divalent compounds (B32, B33, B34, B35, and B38) with different linker groups. [Figure 47-2] Same as above. [Figure 48]48A and 48B are graphs of the SPR results for amsacrine. [Figure 49] Figures 49A and 49B are graphs of SPR results for divalent compound (B32) (Figure 49A) and amsacrine (Figure 49B) with dsDNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0016] array The nucleic acid and amino acid sequences included in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases and three-letter code for amino acids as specified in 37 CFR §1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. The sequence listing has been submitted as an ASCII text file in the form of a file named "Sequence.txt" (28,672 bytes), created on June 3, 2022, and is incorporated herein by reference. In the accompanying sequence listing: SEQ ID NO:1 is an exemplary genomic DNA sequence encoding human MYCN. SEQ ID NOs:2-6 are exemplary nucleic acid sequences of G-quadruplex oligonucleotides for BCL2, KRAS, mTOR, NRAS, and telomeric DNA, respectively. SEQ ID NO:7 is an exemplary MYCN G4 wild-type oligonucleotide. SEQ ID NO:8 is an exemplary MYCN G4 mutant oligonucleotide. SEQ ID NO:9 is an exemplary MYCN G4 truncated oligonucleotide. SEQ ID NO:10 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCNOs-01. SEQ ID NO:11 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCNOs-01. SEQ ID NO:12 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCNOs-02. SEQ ID NO:13 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCNOs-02. SEQ ID NO:14 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCN protein isoform 1. SEQ ID NO:15 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCN protein isoform 1. SEQ ID NO: 16 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCN protein isoform 2. SEQ ID NO:17 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCN protein isoform 2. SEQ ID NO:18 is an exemplary nucleic acid sequence of a MYCN G4 quadruplex forming sequence. SEQ ID NO:19 is an exemplary nucleic acid sequence of a G4 forming sequence in MYCNOS. SEQ ID NOs:20-23 are exemplary nucleic acid sequences of possible G4s in MYCNOS. SEQ ID NOs: 24-30 are exemplary nucleic acid sequences of hairpin G4 sequences in FOXA3, KRAS, MYCL, BRD4, BCL2, LINC01018, and SOX12, respectively. SEQ ID NO:31 is an exemplary hTERT G4 oligonucleotide. SEQ ID NO:32 is an exemplary BCL2 G4 oligonucleotide. SEQ ID NO:33 is an exemplary RB1 G4 oligonucleotide. SEQ ID NO:34 is an exemplary VEGF G4 oligonucleotide. SEQ ID NO:35 is an exemplary c-MYC G4 oligonucleotide. SEQ ID NO:36 is an exemplary c-KIT G4 oligonucleotide. SEQ ID NO:37 is an exemplary dsDNA oligonucleotide. SEQ ID NO:38 is an exemplary HIF1-a G4 oligonucleotide. SEQ ID NO:39 is an exemplary ssDNA oligonucleotide. SEQ ID NO:40 is an exemplary genomic DNA sequence encoding human MYCNOS.
[0017] Detailed Description I. Definitions and Abbreviations The following explanation of terms and abbreviations is provided to better explain the present disclosure and to guide those skilled in the art in practicing the present disclosure. As used herein, "comprising" means "including," and the singular form "a" or "an" or "the" includes plural referents unless the context clearly dictates otherwise. The term "or" refers to a single element of stated alternative elements or a combination of two or more elements unless the context clearly dictates otherwise. The term "comprises" means "includes." Thus, comprising "A" or "B" refers to including A, including B, or including both A and B.
[0018] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The materials, methods and examples are only illustrative and are not intended to be limiting. Other features of the present disclosure will be apparent from the following detailed description and claims.
[0019] The disclosure of a numerical range should be understood to refer to each discrete point within the range, including the endpoints, unless otherwise noted. Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, percentages, temperatures, times, etc., when used in the specification or claims should be understood to be modified by the term "about". Thus, unless otherwise indicated, whether implicitly or explicitly, or unless the context is properly understood by those skilled in the art to have a more restrictive configuration, the numerical parameters indicated are approximations that may depend on the desired properties sought and / or the detection limits under standard test conditions / methods known to those skilled in the art. When directly and explicitly distinguishing the embodiments from the prior art discussed, the numbers of the embodiments are not approximations unless described by the word "about". It should be further understood that all base sizes or amino acid sizes and all molecular weight or molecular mass values given for nucleic acids or polypeptides are approximate and are provided for illustration purposes.
[0020] Although alternatives for various components, parameters, operating conditions, etc. are presented herein, that does not imply that the alternatives are necessarily equivalent and / or will perform equally well, nor is it meant that the alternatives are listed in order of preference unless otherwise stated.
[0021] Those of skill in the art will recognize that the definitions provided below are not intended to include impermissible substitution patterns (e.g., methyl substituted with five different groups, etc.). Such impermissible substitution patterns are readily apparent to those of skill in the art. Any functional group disclosed herein and / or defined above may be substituted or unsubstituted, unless otherwise indicated herein.
[0022] Definitions of common terms in chemistry can be found in Richard J. Lewis, Sr. (ed.), Hawley's Condensed Chemical Dictionary, published by John Wiley & Sons, Inc., 2016 (ISBN 978-1-118-13515-0). Compounds of the present disclosure may be doped with deuterium, tritium, 18 F, 14 Also included are all isotopes of atoms present in the compounds, which may include, but are not limited to, C, etc.
[0023] Those skilled in the art will understand that compounds may exhibit the phenomena of tautomerism, conformational isomerism, geometric isomerism, and / or optical isomerism. For example, certain disclosed compounds may contain one or more chiral centers and / or double bonds, and as a result may exist as stereoisomers, e.g., double bond isomers (i.e., geometric isomers), enantiomers, diastereomers, and mixtures thereof, e.g., racemic mixtures. As another example, certain disclosed compounds may exist in several tautomeric forms, including enol forms, keto forms, and mixtures thereof. While the various compound names, formulae, and compound diagrams in this specification and claims may represent only one of the possible tautomeric, conformational, optical, or geometric isomeric forms, those skilled in the art will understand that the disclosed compounds encompass any tautomeric, conformational, optical, and / or geometric isomeric forms of the compounds described herein, as well as mixtures of these various different isomeric forms. Mixtures of different isomeric forms, including mixtures of enantiomers and / or stereoisomers, can be separated to obtain each separate enantiomer and / or stereoisomer using techniques known to those of skill in the art, especially having the benefit of this disclosure. Atropisomers are also possible and are specifically included in the compounds disclosed herein when rotation is restricted, for example around an amide bond or between two directly bonded rings, such as a pyridinyl ring, a biphenyl group, etc.
[0024] In any embodiment, any or all hydrogens present in the compound or in a particular group or moiety in the compound may be replaced by deuterium or tritium. Thus, a description of an alkyl includes a deuterated alkyl, where one to the maximum number of hydrogens present may be replaced by deuterium. For example, methyl is CH 3 or one to three hydrogens are replaced by deuterium, e.g., CD x H 3-x In,CH 3 , refers to both.
[0025] As used herein, the term "substituted" refers to all subsequent modifiers in a term; for example, in the term "substituted aliphatic-aromatic," the substitution may be in the "aliphatic" portion, the "aromatic" portion, or both portions of the aliphatic-aromatic group.
[0026] "Substituted," when used to modify a specified group or moiety, means that at least one, and possibly two or more, hydrogen atoms of the specified group or moiety are independently replaced with the same or different substituents. In certain embodiments, a group, moiety, or substituent may be substituted or unsubstituted, unless specifically defined as either "unsubstituted" or "substituted." Thus, any of the functional groups specified herein may be unsubstituted or substituted, unless otherwise indicated by context or unless a particular structural formula precludes substitution. In certain embodiments, a substituent may or may not be specifically defined as substituted, but is nevertheless intended to be substituted, as appropriate. For example, an "aliphatic" or "cyclic" moiety may be unsubstituted or substituted, while an "unsubstituted aliphatic" or "unsubstituted cyclic" is not substituted. In one embodiment, a substituted group has at least one substituent up to the number of possible substituents for the particular moiety, e.g., one substituent, two substituents, three substituents, or four substituents.
[0027] Unless the attachment of a group or moiety to other parts of the structure is expressly stated or implied by context, any group or moiety defined herein may be attached to any other part of the disclosed structures, e.g., a parent or core structure, as would be understood by one of skill in the art, such as by consideration of valence rules, comparison of exemplary species, and / or consideration of functionality.
[0028] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
[0029] Acyl halide: -C(O)X, where X is a halogen, for example, Br, F, I, or Cl.
[0030] Administration: Providing or giving an agent, for example, a compound (e.g., a small compound) that selectively binds to a non-canonical G4, such as the non-canonical G4 of MYCN (encoding N-Myc), to a subject by any effective route. In some embodiments, administration can include providing or giving an agent, for example, a small molecule compound that selectively binds to G4 quadruplex DNA in the c-MYC promoter, to a subject by any effective route. Exemplary administration routes include, but are not limited to, oral, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal and intravenous), sublingual, rectal, transdermal (e.g., topical), intranasal, vaginal and inhalation routes.
[0031] Concurrent administration or co-administration refers to administration of at least two therapeutic compounds within the same general time period, and does not require administration at exactly the same time (although co-administration includes administration at exactly the same time). Thus, concurrent administration may be on the same day, or on different days, or in the same week, or in different weeks. The therapeutic compounds disclosed herein may be included in the same composition, or each of them may be included individually in a separate composition. In certain embodiments, the two compounds may be administered during a time frame during which their respective biological activity periods overlap. Thus, the term includes administration within the same time range as well as sequential administration of two or more compounds.
[0032] "Administration of" a compound and "administering" should be understood to mean providing a compound, a prodrug of a compound, or a pharmaceutical composition described herein. The compound or composition may be administered to the subject by another person (e.g., intravenously) or may be self-administered by the subject (e.g., a tablet).
[0033] Agent: Any substance, or any combination of substances, that is useful for achieving a goal or result; for example, a substance or combination of substances that is useful for reducing or decreasing tumor growth in a subject. An agent includes an effector molecule and a detectable marker. In some embodiments, an agent is a chemotherapeutic agent. Those skilled in the art will understand that a particular agent may be useful for achieving more than one result; for example, an agent may be useful both as a detectable marker and as a chemotherapeutic agent.
[0034] Aldehyde: -C(O)H.
[0035] Aliphatic: Aliphatic groups of at least 1 carbon atom to 50 carbon atoms (C), including alkanes (or alkyls), alkenes (or alkenyls), alkynes (or alkynyls), including cyclic versions thereof, further including straight and branched chain configurations, and all stereo and positional isomers. 1~50 ), for example, 1 to 25 carbon atoms (C 1~25 ), or 1 to 10 carbon atoms (C 1~10 ), or 1 to 6 carbon atoms (C 1~6 ), or 1 to 4 carbon atoms (C 1~4 ), a hydrocarbon group (e.g., a substantially hydrocarbon-based compound). The aliphatic group may be substituted with one or more groups other than hydrogen, such as an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group. Exemplary substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amido, amino, aminoalkyl, aryl, arylalkyl, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic, heteroaliphatic, heteroaryl, heterocyclic aliphatic, hydroxyl, oxo, sulfonamido, sulfhydryl, thioalkoxy, or other functional groups.
[0036] Alkenyl: at least 2 carbon atoms to 50 carbon atoms (C 2~50 ), for example, 2 to 25 carbon atoms (C2~25 ), or 2 to 10 carbon atoms (C 2~10 ), and at least one carbon-carbon double bond, which can be obtained by removing one hydrogen atom from one carbon atom of a parent alkene. An alkenyl group can be branched, straight chain, cyclic (e.g., cycloalkenyl), and cis or trans (e.g., E or Z). An alkenyl group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group.
[0037] Alkoxy: -O-aliphatic, e.g., -O-alkyl, -O-alkenyl, -O-alkynyl; exemplary embodiments include, but are not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, i-butoxy, t-butoxy, sec-butoxy, n-pentoxy, cyclopropoxy, cyclohexyloxy, and the like (any of the aliphatic components of such groups may contain no double or triple bonds or may contain one or more double and / or triple bonds). Alkoxy groups may be substituted with one or more groups other than hydrogen, e.g., aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional groups.
[0038] Alkyl: At least 1 carbon atom to 50 carbon atoms (C 1~50 ), for example, 1 to 25 carbon atoms (C 1~25 ), or 1 to 10 carbon atoms (C 1~10 ), which can be obtained by removing one hydrogen atom from one carbon atom of a parent compound (e.g., an alkane). The alkyl group can be branched, straight chain, or cyclic (e.g., cycloalkyl). The alkyl group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group. In some embodiments, a lower alkyl or (C 1~C 6 ) alkyl can be methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, pentyl, 3-pentyl, or hexyl; 3 ~C 6 ) Cycloalkyl can be cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl; 3 ~C 6 )Cycloalkyl(C 1 ~C 6 ) alkyl can be cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, 2-cyclopropylethyl, 2-cyclobutylethyl, 2-cyclopentylethyl, or 2-cyclohexylethyl; (C 1 ~C 6 ) Alkoxy can be methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentoxy, 3-pentoxy, or hexyloxy; 2 ~C 6 ) alkenyl can be vinyl, allyl, 1-propenyl, 2-propenyl, 1-butenyl, 2-butenyl, 3-butenyl, 1-pentenyl, 2-pentenyl, 3-pentenyl, 4-pentenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 4-hexenyl, or 5-hexenyl; (C 2 ~C 6 ) Alkynyl can be ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 2-pentynyl, 3-pentynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl, 3-hexynyl, 4-hexynyl, or 5-hexynyl; (C 1 ~C 6 ) alkanol can be acetyl, propanoyl or butanoyl; halo(C 1 ~C 6 ) alkyl can be iodomethyl, bromomethyl, chloromethyl, fluoromethyl, trifluoromethyl, 2-chloroethyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, or pentafluoroethyl; hydroxy(C 1 ~C 6) alkyl can be hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1-hydroxypropyl, 2-hydroxypropyl, 3-hydroxypropyl, 1-hydroxybutyl, 4-hydroxybutyl, 1-hydroxypentyl, 5-hydroxypentyl, 1-hydroxyhexyl, or 6-hydroxyhexyl; (C 1 ~C 6 ) Alkoxycarbonyl can be methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, butoxycarbonyl, pentoxycarbonyl, or hexyloxycarbonyl; 1 ~C 6 ) alkylthio can be methylthio, ethylthio, propylthio, isopropylthio, butylthio, isobutylthio, pentylthio, or hexylthio; 2 ~C 6 ) Alkanoyloxy can be acetoxy, propanoyloxy, butanoyloxy, isobutanoyloxy, pentanoyloxy, or hexanoyloxy.
[0039] Alkynyl: at least 2 carbon atoms to 50 carbon atoms (C 2~50 ), for example, 2 to 25 carbon atoms (C 2~25 ), or 2 to 10 carbon atoms (C 2~10 ) and at least one carbon-carbon triple bond, which can be obtained by removing one hydrogen atom from one carbon atom of a parent alkyne. An alkynyl group can be branched, straight chain, or cyclic (e.g., cycloalkynyl). An alkenyl group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group.
[0040] Amide: -C(O)NR e R f or -NR e C(O)R f (In the formula, R e and R fis independently selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group, and may be substituted with one or more groups other than hydrogen, e.g., an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0041] Amino: -NR e R f (In the formula, R e and R f is independently selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group, and may be substituted with one or more groups other than hydrogen, e.g., an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0042] Analog: A molecule that differs in chemical structure from a parent compound, e.g., a homolog (different in chemical structure or mass increase, such as a different length of an alkyl chain or incorporation of one or more isotopes), a molecular fragment, a structure that differs in one or more functional groups or changes in ionization. Analogs are not necessarily synthesized from a parent compound. Derivatives are molecules derived from a base structure.
[0043] Aromatic: Unless otherwise specified, a cyclic conjugated group or moiety having 5-15 ring atoms, either a single ring (e.g., phenyl) or multiple fused rings in which at least one ring is aromatic (e.g., naphthyl, indolyl, or pyrazolopyridinyl), i.e., at least one ring, and optionally multiple fused rings, have a contiguous, delocalized π-electron system. Typically, the number of out-of-plane π-electrons corresponds to Huckel's rule (4n+2). The point of attachment to the parent structure is typically through the aromatic portion of the fused ring system. For example, [ka] However, in certain instances, the context or disclosure presented may dictate that the point of attachment is through the non-aromatic portion of the fused ring system. For example, [ka] An aromatic group or moiety may contain only carbon atoms in the ring, e.g., in an aryl group or moiety, or it may contain one or more ring carbon atoms and one or more ring heteroatoms that contain lone pairs of electrons (e.g., S, O, N, P, or Si), e.g., in a heteroaryl group or moiety. An aromatic group may be substituted with one or more groups other than hydrogen, e.g., an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group.
[0044] Aryl: Contains at least 5 carbon atoms, and in some embodiments, contains at least 5 carbon atoms to 15 carbon atoms (C 5 ~C 15 ), for example, 5 to 10 carbon atoms (C 5 ~C 10 ), having a single ring or multiple fused rings, which may or may not be aromatic, provided that the point of attachment to the remainder of the compounds disclosed herein is through an atom of the aromatic carbocyclic group. The aryl group may be substituted with one or more groups other than hydrogen, such as an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group. In some embodiments, the aryl group may be substituted with one or more groups, including, but not limited to, alkyl, alkynyl, alkenyl, aryl, halide, nitro, amino, ester, ketone, aldehyde, hydroxy, carboxylic acid, or alkoxy.
[0045] Aroxy: -O-aromatic. The aroxy group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0046] Azo:-N=NR d (In the formula, R dis hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.) The azo group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group.
[0047] Cancer: A malignant tumor that has undergone characteristic anaplasia with loss of differentiation, has an increased growth rate, invades surrounding tissues, and can metastasize. For example, thyroid cancer is a malignant tumor that originates in or from thyroid tissue, and breast cancer is a malignant tumor that originates in or from breast tissue (e.g., ductal carcinoma). Residual cancer is cancer that remains in a subject after any form of treatment administered to the subject to reduce or eradicate the cancer. Metastatic cancer is a tumor at one or more internal sites other than the site of origin of the original (primary) cancer from which the metastatic cancer originates. Cancer includes, but is not limited to, solid tumors.
[0048] Carbamate: -OC(O)NR e R f (In the formula, R e and R f each is independently selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The carbamate group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0049] Carbonate:-OC(O)OR d (In the formula, R d is selected from an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group. The carbonate group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group. In an independent embodiment, R d can be hydrogen.
[0050] Carboxyl: -C(O)OH.
[0051] Carboxylate: -C(O)O - or its salt. The negative charge of this carboxylate group is M + Counterions can be used to balance the M + is an alkali ion, e.g., K + , Na + , Li + ammonium ions, e.g. + N(R e ) 4 (In the formula, R e is H, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, or aromatic); or an alkaline earth ion, e.g., [Ca 2+ ] 0.5 , [Mg 2+ ] 0.5 , or [Ba 2+ ] 0.5 It could be.
[0052] Chemotherapeutic agent: Any chemical agent that has therapeutic utility in the treatment of diseases characterized by abnormal cell growth. For example, chemotherapeutic agents are useful in the treatment of neuroblastoma. Specific examples of additional therapeutic agents that can be used include microtubule binding agents, DNA intercalating or crosslinking agents, DNA synthesis inhibitors, DNA and RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulating agents, and angiogenesis inhibitors. In one embodiment, the chemotherapeutic agent is a radioactive compound. Those of skill in the art can readily identify chemotherapeutic agents that are useful (see, e.g., Slapak and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's Principles of Internal Medicine, 14th edition; Perry et al., Chemotherapy, Ch. 17 in Abeloff, Clinical Oncology 2002, 14th edition). nded., (c) 2000 Churchill Livingstone, Inc;Baltzer, L., Berkery, R. (eds): Oncology Pocket Guide to Chemotherapy, 2nd ed. St. Louis, Mosby-Year Book, 1995;Fischer, DS, Knobf, MF, Durivage, HJ (eds): The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book, 1993;Chabner and Longo, Cancer Chemotherapy and Biotherapy: Principles and Practice (4th ed.). Philadelphia: Lippincott Willians & Wilkins, 2005;Skeel,. Handbook of Cancer Chemotherapy (6th ed.). Lippincott Williams & Wilkins, 2003). Combination chemotherapy is the administration of more than one drug to treat cancer.
[0053] Control: A sample or standard used for comparison with an experimental sample. In some embodiments, the control is a sample taken from a healthy patient or a non-tumor tissue sample taken from a patient diagnosed with cancer. In other embodiments, the control is a tumor tissue sample taken from a patient diagnosed with cancer. In some embodiments, the control is a tumor tissue sample taken from a patient diagnosed with cancer who has not been treated with a G4 stabilizer disclosed herein. In still other embodiments, the control is a historical control or a standard reference value or range (e.g., a previously tested control sample, e.g., a group of cancer patients with known prognosis or outcome, or a group of samples representing baseline or normal values, e.g., expression levels of MYCN or MYC genes in non-tumor tissue).
[0054] Cyano:-CN.
[0055] Decrease or reduce / reduce / alleviate: To decrease the quality, quantity, or intensity of something; for example, a reduction in tumor burden. In one example, the treatment reduces a tumor (e.g., tumor size, tumor number, tumor metastasis, or a combination thereof) or reduces one or more symptoms associated with a tumor, for example, compared to the response in the absence of treatment. In certain examples, the treatment reduces tumor size, tumor number, tumor metastasis, or a combination thereof after treatment, for example, a reduction of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Such reductions can be measured using the methods disclosed herein.
[0056] Determining or detecting the level of expression of a gene product: detecting the level of expression in either a qualitative or quantitative manner, for example, by detecting a nucleic acid molecule or protein, using routine methods known in the art.
[0057] Diagnosis: The process of identifying a disease by its signs, symptoms, and the results of various tests. The conclusion reached by the process is also called a "diagnosis." Common forms of testing include blood tests, medical imaging, urine tests, and biopsies.
[0058] Disulfide:-SSR d (In the formula, R d is selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The disulfide groups can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0059] Dithiocarboxylic acids: -C(S)SR d (In the formula, R dis selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The dithiocarboxylic acid group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0060] Ester: -C(O)OR d or -OC(O)R d (In the formula, R d is selected from an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group. 2 C 1~3 Alkyl groups, such as methyl esters (CO 2 Me), ethyl ester (CO 2 Et), and propyl esters (CO 2 Preferred are -OC(O)Me, -OC(O)Et and -OC(O)Pr, including their reverse esters (e.g., -OC(O)Me, -OC(O)Et and -OC(O)Pr). The ester group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group.
[0061] Ether: -aliphatic-O-aliphatic, -aliphatic-O-aromatic, -aromatic-O-aliphatic, or -aromatic-O-aromatic. The ether group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0062] Hairpin: The term "hairpin" refers to a DNA structure in which two regions of the same strand, whose sequences are normally complementary when read in opposite directions, base pair to form a double helix with an unpaired loop at the distal end of the hairpin: [ka]
[0063] Halo (or halide or halogen): fluoro, chloro, bromo, or iodo. In some embodiments, halo can also include astatine.
[0064] Haloaliphatic: an aliphatic group in which one or more hydrogen atoms, e.g., 1 to 10 hydrogen atoms, are independently replaced by a halogen atom, e.g., fluoro, bromo, chloro, or iodo. The haloaliphatic group may be substituted with one or more groups other than hydrogen, e.g., an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0065] Haloalkyl: an alkyl group in which one or more hydrogen atoms, e.g., 1 to 10 hydrogen atoms, are independently replaced by a halogen atom, e.g., fluoro, bromo, chloro, or iodo. The haloalkyl group may be substituted with one or more groups other than hydrogen, e.g., an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group. In an independent embodiment, the haloalkyl group is selected from the group consisting of CX 3 group, where each X may be independently selected from fluoro, bromo, chloro, or iodo.
[0066] Haloheteroaliphatic: a heteroaliphatic group in which one or more hydrogen atoms, e.g., 1 to 10 hydrogen atoms, are independently replaced by a halogen atom, e.g., fluoro, bromo, chloro, or iodo. A haloheteroaliphatic group may be substituted with one or more groups other than hydrogen, e.g., an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional group.
[0067] Heteroaliphatic: an aliphatic group containing at least one heteroatom to 20 heteroatoms, for example, 1 to 15 heteroatoms, or 1 to 5 heteroatoms, which may be selected from, but are not limited to, oxygen, nitrogen, sulfur, silicon, boron, selenium, phosphorus, and their oxidized forms. Alkoxy, ether, amino, disulfide, peroxy, and thioether groups are typical (but non-limiting) examples of heteroaliphatic groups. Heteroaliphatic groups may be substituted with one or more groups other than hydrogen, for example, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional groups.
[0068] Heteroaryl: An aromatic group (e.g., an aryl group) containing at least one heteroatom to six heteroatoms, e.g., one to four heteroatoms, in the ring, which may be selected from, but are not limited to, oxygen, nitrogen, sulfur, silicon, boron, selenium, phosphorus, and oxidized forms thereof. Such heteroaryl groups may have a single ring or multiple fused rings, which may or may not be aromatic and / or may or may not contain heteroatoms, provided that the point of attachment is through an atom of the aromatic heteroaryl group. Heteroaryl groups may be substituted with one or more groups other than hydrogen, e.g., aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional groups.
[0069] Heteroatom: An atom other than carbon or hydrogen, such as (but not limited to) oxygen, nitrogen, sulfur, silicon, boron, selenium, or phosphorus. In certain disclosed embodiments, such as where not permitted by valence constraints, heteroatoms do not include halogen atoms.
[0070] Heterocyclic / Heteroaliphatic: A cyclic aliphatic group having at least one carbon atom and at least one heteroatom, i.e., one or more carbon atoms are replaced with an atom having at least one lone pair of electrons, typically nitrogen, oxygen, phosphorus, silicon, or sulfur. Heterocyclic groups can be monocyclic or bicyclic.
[0071] Hydroxy: A group represented by the formula -OH.
[0072] Isolated or purified: A biological component is one that is substantially separated or purified from other biological components, i.e., other chromosomal and extrachromosomal DNA and RNA, proteins, lipids, and organelles, in the cells of the organism in which it naturally occurs. "Isolated" does not require absolute purity. For example, the desired isolated biological component may represent at least 50%, particularly at least about 75%, more particularly at least about 90%, and most particularly at least about 98% of the total contents of the preparation. The isolated biological components described herein can be isolated by many methods, such as salt fractionation, phenol extraction, precipitation with organic solvents (e.g., hexadecyltrimethylammonium bromide, or ethanol), affinity chromatography, ion exchange chromatography, hydrophobic chromatography, high performance liquid chromatography, gel filtration, isoelectric focusing, physical separation (e.g., centrifugation or agitation), and the like.
[0073] The term purified does not require absolute purity, but rather is intended as a relative term. Thus, for example, a purified peptide preparation is one in which the peptide or protein is enriched relative to the peptide or protein in its natural environment within a cell. For example, a compound preparation is purified such that the desired polysaccharide-protein conjugate represents at least 50%, more particularly at least about 90%, and most particularly at least about 98% of the total content of the preparation.
[0074] Ketone: -C(O)R d (In the formula, R d is selected from an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group. The ketone group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0075] Nitrogen-containing group: a group that contains at least one nitrogen atom. In some embodiments, the nitrogen-containing group is an amide group or an amino group. In some embodiments, the nitrogen-containing group may include a mono- or bicyclic ring or ring system that contains at least one nitrogen atom. The ring or ring system generally contains 1 to 9 carbon atoms in addition to heteroatoms and may be saturated, unsaturated, or aromatic (including pseudoaromatic). The term "pseudoaromatic" refers to a ring system that is stabilized by electron delocalization and behaves similarly to an aromatic ring. Aromatic includes pseudoaromatic ring systems, such as pyrrolyl rings.
[0076] Examples of nitrogen-containing groups include heteroaryl and / or cyclic heteroaliphatic groups, such as pyrrolyl, H-pyrrolyl, pyrrolinyl, pyrrolidinyl, oxazolyl, oxadiazolyl (including 1,2,3- and 1,2,4-oxadiazolyl), isoxazolyl, furazanyl, thiazolyl, isothiazolyl, pyrazolyl, pyrazolinyl, pyrazolidinyl, imidazolyl, imidazolinyl, triazolyl (including 1,2,3- and 1,3,4-triazolyl), tetrazolyl, thiadiazolyl (including 1,2,3- and 1,3,4-thiadiazolyl ... Examples of the nitrogen-containing groups include aryl, ... In some embodiments, the nitrogen-containing group is a broad range of substituents, preferably C1~6 Alkyl, C 1~6 Alkoxy, C 2~6 Alkenyl, C 2~6 Alkynyl, halo, hydroxy, mercapto, trifluoromethyl, amino, cyano or mono- or di(C 1~6 The amino group may be optionally substituted with alkyl.
[0077] N-Myc: N-Myc protein is encoded by the MYCN gene. MYCN has been shown to be crucial for fetal development and highly expressed in neural tissues. MYCN is often overexpressed or mutated during cancer and is considered an oncogene, especially in neuroblastoma and small cell lung cancer. MYCN sequence information is available in public databases, such as Ensembl (uswest.ensembl.org) Gene ID number: ENSG00000134323. MYCN reverse strand (MYCNOS) is located on the antisense strand of MYCN. Expression of MYCNOS has been shown to reduce the promoter occupancy of MYCN and regulate the stability of MYCN transcripts by sequence complementarity. More recent studies have shown that variant 2 of MYCNOS transcript, NCYM, can also be translated to produce small protein. This polypeptide, known as NCYM, is characterized by a variety of regulatory activities, including regulating the stability of N-Myc protein, inhibiting GSK3β, and affecting Wnt / β-catenin signaling. Sequence information for MYCNOS is listed in public databases, such as Ensembl (uswest.ensembl.org) Gene ID number: ENSG00000233718.
[0078] Organic functional group: a functional group that may be provided by any combination of aliphatic, heteroaliphatic, aromatic, haloaliphatic and / or haloheteroaliphatic groups, or may be selected from, but not limited to, aldehyde, aroxy, acyl halide, halogen, nitro, cyano, azide, carboxyl (or carboxylate), amide, ketone, carbonate, imine, azo, carbamate, hydroxyl, thiol, sulfonyl (or sulfonate), oxime, ester, thiocyanate, thioketone, thiocarboxylic acid, thioester, dithiocarboxylic acid, phosphonate, phosphate, silyl ether, sulfinyl, sulfonamide, thial, or combinations thereof. The organic functional group may be substituted with one or more groups other than hydrogen, such as, for example, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional groups.
[0079] Oxime: -CR d =NOH(where R d is hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The oxime group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0080] Peroxy: -O-OR d (In the formula, R d is hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The peroxy group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0081] Pharmaceutical composition: A composition comprising an amount (e.g., a unit dosage amount) of one or more of the disclosed compounds together with one or more non-toxic pharma- ceutically acceptable additives, including carriers, diluents and / or adjuvants, and optionally other bioactive ingredients. Such pharmaceutical compositions can be prepared by standard pharmaceutical formulation techniques, such as those disclosed in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA (19th Edition).
[0082] Pharmaceutically acceptable carriers: Useful pharma- ceutically acceptable carriers are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the disclosed immunogens.
[0083] Generally, the nature of the carrier will depend on the particular mode of administration to be employed. For example, parenteral formulations usually contain injectable fluids that contain pharma- ceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, and the like, as vehicles. Conventional non-toxic solid carriers for solid compositions (e.g., powder, pill, tablet, or capsule forms) can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sorbitan monolaurate. In certain embodiments suitable for administration to subjects, the carrier can be sterile and / or can be suspended or otherwise contained in a unit dosage form that contains one or more measured doses of the composition suitable for inducing the desired tumor response. It can also be accompanied by the drug for its use in treatment. The unit dosage form can be, for example, in a sealed vial containing the sterile contents, or a syringe for injection into a subject, or can be lyophilized for subsequent solubilization and administration, or can be a solid or modified release dosage.
[0084] Pharmaceutically acceptable salts or esters: Salts or esters prepared by conventional means, including, for example, salts of inorganic and organic acids, including, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, malic acid, acetic acid, oxalic acid, tartaric acid, citric acid, lactic acid, fumaric acid, succinic acid, maleic acid, salicylic acid, benzoic acid, phenylacetic acid, mandelic acid, and the like.
[0085] Pharmaceutically acceptable salts of the compounds of the present disclosure include those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc, and from bases such as ammonia, ethylenediamine, N-methyl-glutamine, lysine, arginine, ornithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, diethylamine, piperazine, tris(hydroxymethyl)aminomethane, and tetramethylammonium hydroxide. These salts can be prepared by standard procedures, for example, by reacting free acids with suitable organic or inorganic bases. Chemical entities described herein can alternatively be administered as their pharma-ceutically acceptable salts. "Pharmaceutically acceptable salts" also include free acids, bases, and zwitterionic forms. A description of suitable pharma-ceutically acceptable salts can be found in Handbook of Pharmaceutical Salts, Properties, Selection and Use, Wiley VCH (2002). When a compound disclosed herein contains an acidic functional group, such as a carboxy group, suitable pharma- ceutically acceptable cation pairs for the carboxy group are well known to those skilled in the art and include alkaline, alkaline earth, ammonium, quaternary ammonium cations, and the like. Such salts are known to those skilled in the art. For further examples of pharmacologically acceptable salts, see Berge et al., J. Pharm. Sci. 66:1 (1977).
[0086] Pharmaceutically acceptable esters include those derived from the compounds described herein that have been modified to contain a carboxyl group. In vivo hydrolyzable esters are those that are hydrolyzed in the human or animal body to produce the parent acid or alcohol. Thus, representative esters include those in which the non-carbonyl portion of the carboxylic acid moiety of the ester group is selected from the group consisting of straight or branched chain alkyl (e.g., methyl, n-propyl, t-butyl, or n-butyl), cycloalkyl, alkoxyalkyl (e.g., methoxymethyl), aralkyl (e.g., benzyl), aryloxyalkyl (e.g., phenoxymethyl), aryl (e.g., phenyl, halogen, C 1~4 Alkyl or C 1~4 phenyl optionally substituted by alkoxy or amino; sulfonic acid esters, such as alkyl- or aralkylsulfonyl (e.g. methanesulfonyl); or amino acid esters (e.g. L-valyl or L-isoleucyl). "Pharmaceutically acceptable esters" also include inorganic esters, such as mono-, di- or triphosphate esters. In such esters, unless otherwise specified, any alkyl moiety present advantageously contains 1 to 18 carbon atoms, particularly 1 to 6 carbon atoms, more particularly 1 to 4 carbon atoms. Any cycloalkyl moiety present in such esters advantageously contains 3 to 6 carbon atoms. Any aryl moiety present in such esters advantageously contains a phenyl group, optionally substituted as indicated in the definition of carbocycylyl above. Thus, pharma- ceutically acceptable esters include those having the C 1 ~C 22Fatty acid esters include, for example, acetyl, t-butyl, or long chain straight or branched unsaturated or omega-6 monounsaturated fatty acids, for example, palmoyl, stearoyl, etc. Alternative aryl or heteroaryl esters include benzoyl, pyridylmethyloyl, etc., any of which may be substituted as defined above in carbocyclyl. Further pharma- ceutically acceptable esters include aliphatic L-amino acid esters, for example, leucyl, isoleucyl, and especially valyl.
[0087] For therapeutic use, salts of compounds are those in which the counterion is pharma- ceutically acceptable. However, salts of acids and bases that are non-pharma-ceutically acceptable may also find use, for example, in the preparation or purification of a pharma- ceutically acceptable compound.
[0088] The above-mentioned pharmaceutically acceptable acid and base addition salts herein are intended to include the therapeutically effective non-toxic acid and base addition salt forms that the compounds can form.The pharmaceutically acceptable acid addition salts can be conveniently obtained by treating the base form with such a suitable acid.Suitable acids include, for example, inorganic acids, such as hydrohalic acids, for example hydrochloric acid or hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like; or organic acids, such as acetic acid, propanoic acid, hydroxyacetic acid, lactic acid, pyruvic acid, oxalic acid (i.e., ethanedioic acid), malonic acid, succinic acid (i.e., butanedioic acid), maleic acid, fumaric acid, malic acid (i.e., hydroxybutanedioic acid), tartaric acid, citric acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cyclamic acid, salicylic acid, p-aminosalicylic acid, pamoic acid and the like. Conversely, said salt forms can be converted by treatment with an appropriate base into the free base form.
[0089] Compounds containing acidic protons can also be converted into their non-toxic metal or amine addition salt forms by treatment with appropriate organic and inorganic bases. Suitable base salt forms include, for example, ammonium salts, alkali and alkaline earth metal salts, such as lithium, sodium, potassium, magnesium, calcium salts, etc.; salts with organic bases, such as benzathine, N-methyl-D-glucamine, hydrabamine salts; and salts with amino acids, such as arginine, lysine, etc.
[0090] The term addition salts as used herein above also comprises the solvates which the compounds described herein are able to form. Such solvates are, for example, hydrates, alcoholates and the like.
[0091] The term "quaternary amine" as used herein above defines a quaternary ammonium salt, which can be formed by reacting the basic nitrogen of the compound with a suitable quaternizing agent, such as an optionally substituted alkyl halide, aryl halide or alkylaryl halide, such as methyl iodide or benzyl iodide. Other reactants with good leaving groups, such as alkyl trifluoromethanesulfonates, alkyl methanesulfonates, and alkyl p-toluenesulfonates, can also be used. Quaternary amines have a positively charged nitrogen. Pharmaceutically acceptable counterions include chloro, bromo, iodo, trifluoroacetate, and acetate. The counterion of choice can be introduced using ion exchange resins.
[0092] Prodrugs of the disclosed compounds are also contemplated herein. Prodrugs are active or inactive compounds that are chemically modified to become active compounds by in vivo physiological action, such as hydrolysis, metabolism, etc., after administration of the prodrug to a subject. The term "prodrug" used throughout the text refers to pharmacologically acceptable derivatives, such as esters, amides, and phosphates, and thus the resulting in vivo biotransformation products of the derivatives are active drugs as defined for the compounds described herein. Prodrugs preferably have good water solubility and increased bioavailability, and are easily metabolized in vivo to become active inhibitors. Prodrugs of the compounds described herein can be prepared by modifying functional groups present in the compounds so that the modifications are cleaved by routine manipulation or in vivo to become the parent compounds. The suitability and techniques involved in making and using prodrugs are well known to those skilled in the art. For a general discussion of prodrugs containing esters, see Svensson and Tunek, Drug Metabolism Reviews 165 (1988) and Bundgaard, Design of Prodrugs, Elsevier (1985).
[0093] The term "prodrug" is also intended to include any covalently bonded carrier that releases the active parent drug of the present invention in vivo when the prodrug is administered to a subject. Since prodrugs often have improved properties, such as solubility and bioavailability, compared to active drug pharmaceuticals, the compounds disclosed herein can be delivered in prodrug form. Thus, prodrugs of the compounds disclosed herein, methods of delivering the prodrugs, and compositions containing such prodrugs are also contemplated. Prodrugs of the disclosed compounds are typically prepared by modifying one or more functional groups present in the compound such that the modifications are cleaved in routine manipulation or in vivo to yield the parent compound. Prodrugs include compounds with phosphonate and / or amino groups functionalized with any group that is cleaved in vivo to yield the corresponding amino and / or phosphonate groups, respectively. Examples of prodrugs include, but are not limited to, compounds with acetylated amino groups and / or phosphonate ester or phosphonamide groups. In certain examples, the prodrug is a phosphonic acid lower alkyl ester, for example, a phosphonic acid isopropyl ester.
[0094] Protected derivatives of the disclosed compounds are also contemplated. A variety of suitable protecting groups for use with the disclosed compounds are disclosed in Greene and Wuts, Protective Groups in Organic Synthesis; 3rd Ed.; John Wiley & Sons, New York, 1999.
[0095] Generally, the protecting group is removed under conditions that will not affect the remaining portion of the molecule. These methods are well known in the art and include acid hydrolysis, hydrogenolysis, and the like. One preferred method involves the removal of esters, for example, cleavage of phosphonate esters using Lewis acidic conditions, such as those in the case of TMS-Br mediated ester cleavage to give free phosphonates. A second preferred method involves the removal of protecting groups, for example, removal of benzyl groups by hydrogenolysis utilizing palladium on carbon in a suitable solvent system, for example, alcohol, acetic acid, and the like, or mixtures thereof. t-Butoxy-based groups, including t-butoxycarbonyl protecting groups, can be removed utilizing inorganic or organic acids, for example, HCl or trifluoroacetic acid, in a suitable solvent system, for example, water, dioxane, and / or methylene chloride. Another exemplary protecting group suitable for protecting amino and hydroxy functions is trityl. Other conventional protecting groups are known, and those skilled in the art can select a suitable protecting group with reference to Greene and Wuts, Protective Groups in Organic Synthesis; 3rd Ed.; John Wiley & Sons, New York, 1999. When the amine is deprotected, the resulting salt can be easily neutralized to give the free amine. Similarly, when an acid moiety, such as a phosphonic acid moiety, is exposed, the compound can be isolated as the acid compound or as a salt thereof.
[0096] Phosphate: -OP(O)(OR d ) 2 (In the formula, each R d are independently hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group; or one or more R d The group is absent, and therefore the phosphate group has at least one negative charge, and the negative charge is + Counterions can be used to balance each M + are independently an alkali ion, e.g., K + , Na + , Li+ ammonium ions, e.g. + N(R e ) 4 (In this formula, R e is H, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, or aromatic); or an alkaline earth ion, e.g., [Ca 2+ ] 0.5 , [Mg 2+ ] 0.5 , or [Ba 2+ ] 0.5 (R of phosphate can be d A group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0097] Phosphonate: -P(O)(OR d ) 2 (In the formula, each R d are independently hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group; or one or more R d The group is absent, and therefore the phosphate group has at least one negative charge, and the negative charge is + Counterions can be used to balance each M + are independently an alkali ion, e.g., K + , Na + , Li + ammonium ions, e.g. + N(R e ) 4 (In this formula, R e is H, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, or aromatic); or an alkaline earth ion, e.g., [Ca 2+ ] 0.5 , [Mg 2+ ] 0.5 , or [Ba 2+ ] 0.5 The R of the phosphonate group can be dA group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0098] Silyl ether: -OSiR e R f (In the formula, R e and R f each is independently selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The silyl ether group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0099] Small molecule: As used herein, the term "small molecule" refers to a molecule having a molecular weight of 1000 daltons or less (e.g., 900 daltons or less, 800 daltons or less, 700 daltons or less, 600 daltons or less, 500 daltons or less, 400 daltons or less, 300 daltons or less, 200 daltons or less, or 100 daltons or less). In some examples, a small molecule has a molecular weight of 100-1000 daltons, 200-900 daltons, 200-700 daltons, or 200-500 daltons.
[0100] Subject: includes both human and non-human subjects, including birds and non-human mammals, such as non-human primates, companion animals (e.g., dogs and cats), livestock (e.g., pigs, sheep, cows), and non-domestic animals, such as big cats. The term subject applies regardless of the stage of the life cycle of the organism. Thus, the term subject applies to organisms in utero or in ovo, depending on the organism (i.e., whether the organism is a mammal or an avian, such as poultry or wild birds).
[0101] Sulfinyl: -S(O)R d (In the formula, R dis selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The sulfinyl group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0102] Sulfonyl: -SO 2 R d (In the formula, R d is selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The sulfonyl group may be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0103] Sulfonamides: -SO 2 NR e R or -N(R e )SO 2 R f (In the formula, R e and R f is independently selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The sulfonamide group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0104] Sulfonate: -SO 3 - The negative charge of this sulfonate group is M + Counterions can be used to balance the M + is an alkali ion, e.g., K + , Na + , Li + ammonium ions, e.g. + N(R e ) 4 (In the formula, R e is H, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, or aromatic); or an alkaline earth ion, e.g., [Ca 2+ ] 0.5, [Mg 2+ ] 0.5 , or [Ba 2+ ] 0.5 It could be.
[0105] Therapeutically effective amount: An amount of an agent that, alone or together with one or more additional agents, induces a desired response, such as treating a tumor in a subject. Ideally, a therapeutically effective amount provides a therapeutic benefit without causing substantial cytotoxic effects in the subject.
[0106] In one example, the desired response is to reduce the size, volume, or number of tumors (e.g., metastases) in a subject. For example, the agent(s) or agents can reduce the size, volume, or number of tumors by a desired amount, e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 50%, at least 75%, at least 90%, or at least 95%, compared to the response in the absence of the agent.
[0107] Some preparations disclosed herein are administered in a therapeutically effective amount. The therapeutically effective amount of the disclosed compounds administered to a human or veterinary subject will vary depending on several factors related to the subject, such as the subject's overall health. The therapeutically effective amount can be determined by varying the dosage and measuring the resulting therapeutic response, such as tumor regression. The therapeutically effective amount can also be determined by various in vitro, in vivo or in situ immunoassays. The disclosed agents can be administered in a single dose or in several doses as needed to obtain the desired response. However, the therapeutically effective amount can depend on the source utilized, the subject being treated, the severity and type of the condition being treated, and the method of administration.
[0108] CHIAL:-C(S)H.
[0109] Thiocarboxylic acids: -C(O)SH, or -C(S)OH.
[0110] Thiocyanate: -S-CN or -N=C=S.
[0111] Thioester: -C(O)SR d OR - C(S)OR d (In the formula, R d is selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group.) The thioester group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0112] Thioether: -S-aliphatic or -S-aromatic, e.g., -S-alkyl, -S-alkenyl, -S-alkynyl, -S-aryl, or -S-heteroaryl; or -aliphatic-S-aliphatic, -aliphatic-S-aromatic, -aromatic-S-aliphatic, or -aromatic-S-aromatic. The thioether group may be substituted with one or more groups other than hydrogen, e.g., aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organic functional groups.
[0113] Thioketone: -C(S)R d (In the formula, R d is selected from hydrogen, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organofunctional group. The thioketone group can be substituted with one or more groups other than hydrogen, for example, an aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or organofunctional group.
[0114] Treating or suppressing a disease: A therapeutic intervention that alleviates the signs or symptoms of a disease or pathological conditions associated with a disease (e.g., a tumor). Treatment may also induce remission or cure of a condition such as a tumor. In certain instances, treatment includes preventing a tumor, for example by suppressing the complete development of a tumor, for example, preventing the development of metastases or the development of a primary tumor. Prevention does not require the complete absence of a tumor.
[0115] Relief of signs or symptoms of disease or disease-related pathology refers to any observable beneficial effect of treatment.Relief of signs or symptoms associated with tumor can be demonstrated, for example, by delaying the onset of clinical symptoms of disease in susceptible subjects (e.g., subjects with tumors that have not yet metastasized), by reducing the severity of some or all clinical symptoms of disease, by slower progression of disease (e.g., by extending the life span of tumor-bearing subjects), by reducing the number of recurrences of disease, by improving the overall health or physical and mental well-being of subjects, or by other parameters well known in the art that are specific to specific tumors.A "prophylactic" treatment is a treatment administered to subjects who do not show signs of disease or who only show early signs, with the aim of reducing the risk of developing a pathology.
[0116] Tumor: abnormal growth of cells, which may be benign or malignant. Cancer is a malignant tumor, characterized by abnormal or unregulated cell growth. Other features often associated with malignant lesions include metastasis, interference with the normal function of neighboring cells, release of abnormal levels of cytokines or other secretory products, and suppression or exacerbation of inflammatory or immunological responses, infiltration of surrounding or distant tissues or organs, such as lymph nodes. "Metastatic disease" refers to cancer cells that leave the primary tumor site and travel to other parts of the body, for example, via the bloodstream or lymphatic system. Thus, metastatic cancer is cancer at one or more internal sites other than the original site of origin of the original (primary) cancer from which the metastatic cancer originates. The amount of tumor in an individual is the "tumor burden," which can be measured as the number, volume, or weight of tumors. Tumors that do not metastasize are called "benign."
[0117] The amount of tumor in an individual is the "tumor burden", which can be measured as the number, volume or weight of tumors. Tumors that do not metastasize are called "benign". Tumors that invade surrounding tissues and / or can metastasize are called "malignant". Examples of hematological tumors include leukemias, including acute leukemias (e.g., 11q23-positive acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myelocytic leukemia, and myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemias), chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia, chronic myelocytic leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (low-grade and high-grade types), multiple myeloma, Waldenstrom's hypergammaglobulinemia, heavy chain disease, myelodysplastic syndromes, hairy cell leukemia and myelodysplasia.
[0118] Solid tumors, such as sarcomas and carcinomas, include, but are not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, lymphoid malignancies, pancreatic cancer, breast cancer (including basal, ductal, and lobular breast cancer), lung cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, salivary gland carcinoma, medullary thyroid carcinoma, papillary These include thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, choriocarcinoma, Wilms' tumor, cervical carcinoma, testicular tumor, seminoma, bladder carcinoma, and CNS tumors (e.g., glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma).
[0119] An "established" or "pre-existing" tumor is a pre-existing tumor that may be identifiable by a diagnostic test. In some embodiments, an established tumor can be palpated. In some embodiments, an "established tumor" is a tumor that is at least 500 mm in size. 3 , e.g., at least 600 mm 3 , at least 700mm 3 , or at least 800 mm 3In other embodiments, the tumor is at least 1 cm long. For solid tumors, established tumors generally have a robust blood supply and induce Tregs and myeloid-derived suppressor cells (MDSCs). In some examples, the tumor is a neuroblastoma or small cell lung cancer.
[0120] II. Introduction Targeting G-quadruplexes (G4s) with small molecules is an attractive strategy for modulating the expression of undruggable proteins, such as N-Myc and other G4-containing proteins, but selective binders to G4s are difficult to identify due to the structural similarity of many G4s. Most canonical G4 structures are relatively simple: they contain a guanine tetrad, stabilized by a central potassium ion and a small 1-7 nucleotide loop. However, recent examples of more complex G4s (or "non-canonical" G4s) have also been shown to contain additional structural elements, such as hairpins and other types of structures (see, for example, Onel et al., JACS 2016, 138:2563;2570; Ngoc Nguyen et al., Nucleic Acids Res. 2020, 48:10567-10575; and Tan et al., Nucleic Acids Res. 2020, 48:11162-11171, which disclose such non-canonical structures and are incorporated herein by reference). Among the reported G4s in MYCN, one example of a non-canonical G4 with such a structure is found in the first intron of MYCN. Genome-wide search studies have also experimentally confirmed the presence of G4 in the MYCN gene, but it does not appear in the promoter region of MYCN like many other regulatory G4s.
[0121] Described herein are new small molecule compounds that target non-canonical G4 structures, such as hairpin-containing G4. In some embodiments, the compounds target non-canonical G4 in MYC gene family, such as MYCN. Also disclosed are pharmaceutical compositions that include the compounds, and methods for making and using the compounds.
[0122] Also disclosed are methods of using such compounds for therapeutic treatment, e.g., in methods of treating diseases and / or disorders such as cancer. In some embodiments, treatment with the disclosed compounds results in a decrease in both MYCN and MYCNOS transcripts and N-Myc protein levels.
[0123] III.Compound Disclosed herein are compounds for use in novel methods for treating diseases and / or disorders, such as cancer. In certain embodiments, the compounds are small molecule compounds (including stereoisomers, tautomers, or pharma- ceutically acceptable salts or esters thereof) that can target and bind to non-canonical G4s. In certain embodiments, the compounds are small molecules that selectively bind directly to structurally complex non-canonical G4s, such as hairpin-containing G4s. In certain embodiments, hairpin-containing G4s are present in DNA. In an independent embodiment, the compounds do not bind to RNAs (or mRNAs) that do not contain G4 structures. Some compounds, such as the bivalent compounds disclosed herein, can bind to G4s present in RNAs (e.g., mRNAs), but do not bind to simple RNAs (or mRNAs), such as simple RNAs (or mRNAs) that contain stem-loop structures, bulge structures, or hairpin structures without G4s. Exemplary genes that can be targeted using the compounds disclosed herein include, but are not limited to, MYC family (e.g., MYCN, MYCNOS, MYCL, MYC, etc.), FOXA3, KRAS, BRD4, and any cancer gene and / or its non-coding RNA (e.g., long non-coding RNA (lncRNA)), such as BCL2, SOX2, and / or LINC01018. In some embodiments, the compounds can bind to the G4 present in helicases (e.g., DHX15). In some embodiments, the compounds selectively bind near the junction of the G4 hairpin found in such genes.
[0124] In some embodiments, the compound, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof, has a structure according to Formula I: [ka] With respect to Formula I, the following variable descriptions may apply: Ring A is a 5-membered heteroaryl ring, which in certain independent embodiments is not thiophenyl, thiazolyl, furanyl, triazolyl, or thiadiazolyl; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo (e.g., Cl, F, Br, or I), and in independent embodiments, R 3 is not fluoro; Each R 4 is independently H, aliphatic, or halo; x is an integer selected from 0 to 5, e.g., 0, 1, 2, 3, 4, or 5; and n is an integer selected from 0 to 10, for example, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
[0125] In some embodiments of Formula I, the following variable descriptions may apply: Ring A is oxadiazolyl, and in certain independent embodiments is not 1,3,4-oxadiazolyl; Ring B is selected from diazinyl (e.g., pyridazinyl, pyrimidinyl, or pyrazinyl); R 1is - (linker) t -R b where R b is aryl, heteroaryl, cyclic heteroaliphatic, acyclic heteroaliphatic, cyclic aliphatic, acyclic aliphatic, t is 0 or 1, and the linker is -(CR a 2 ) q -or- [(CR a 2 ) q Y] r -(CR a 2 ) s -, where each R a is independently H, aliphatic, or halo, Y is hydrogen, sulfur, or NR', where R' is H or aliphatic, q is an integer selected from 1-10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, r is an integer selected from 1-10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and s is an integer selected from 0, 1, or 2; R 2 is H or lower alkyl; Each R 3 is independently alkoxy or hydroxy; Each R 4 is independently H, alkyl, or halo; x is an integer selected from 1 to 5; and n is an integer selected from 0 to 3, for example, 0, 1, 2 or 3.
[0126] In still further embodiments of Formula I, the following variable descriptions may apply: Ring A is 1,2,4-oxadiazolyl (e.g., [ka] ) is; Ring B is pyridazinyl (e.g., [ka] ) is; R 1 is - (linker) t -R b where R b is phenyl, piperazinyl, pyridinyl, azepinyl, cyclopentyl, amino (e.g., NH 2 , N(alkyl) 2 , and NH(alkyl)), piperidinyl, pyrrolidinyl, oxadiazolyl, triazinyl, amide (e.g., -C(O)NH 2 ), morpholinyl, acridinyl (e.g., 9-aminoacridine, acridine Cl, and acridine NH 2 , acridine ICR 191); t is 0 or 1; and the linker is -(CH 2 ) q -, -CH(Me)-, -(CH 2 ) q -CH(Me)-, -[(CH 2 ) q O] r -(CH 2 ) s - or -(CH 2 ) q NH-, where q is an integer selected from 1 to 4, e.g., 1, 2, 3 or 4, and r is an integer selected from 1 to 4, e.g., 1, 2, 3 or 4; s is 0, 1 or 2; R 2 is H or Me; Each R 3 is independently -OMe or hydroxy; and n is 0.
[0127] In some embodiments, the compound has a structure according to formula I, where ring A is a 5-membered heteroaryl ring; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; and R 1 is -(CR a 2 ) m -R b or -[(CR a 2 ) m O]r -(CH 2 ) s- R b where each R a are independently H, alkyl, or halo; m is 1, 2, 3, 4, or 5; r is 1 or 2; s is 2; R b is a cycloalkyl group, an aryl group, or a nitrogen-containing group (e.g., an N-containing cyclic group, such as a heteroaryl group containing nitrogen, or a cyclic heteroaliphatic group containing a nitrogen atom; an amido group; or an amino group); R 2 is H or aliphatic; each R 3 is independently alkoxy or hydroxy; x is 0, 1, 2, 3, 4, or 5; each R 4 is independently H, alkyl, or halo; and n is 0, 1, 2, or 3. In an independent embodiment of such compounds having a structure according to Formula I, the compounds do not include the following compounds, but may include any pharma- ceutically acceptable salts or esters thereof: 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine; N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine; N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine; or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine.
[0128] In some embodiments, the compound has the structure according to formula IA. [ka] where: [ka] Each bond represented by X may be a single or double bond as necessary to satisfy valence requirements; 1 , X 2 , and X 3 Each of R is independently N, O, S, or C(R c ), where R c is H, alkyl, or halo, with the proviso that X 1 , X 2 , and X 3 At least one of C(R c ) other than;R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, t is 0 or 1; R 2 is H or aliphatic; each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo (e.g., Cl, F, Br, or I), and in independent embodiments, R 3 is not fluoro; each R 4is independently H, aliphatic, or halo; x is an integer selected from 0-5, e.g., 0, 1, 2, 3, 4, or 5; and n is an integer selected from 0-10, e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In certain independent embodiments, the compound does not contain a thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, or 1,3,4-oxadiazolyl ring. In certain embodiments, the compound contains a 1,2,4-oxadiazolyl ring.
[0129] In any of the above or below embodiments, Ring A is [ka] where: [ka] Each bond represented by X may be a single or double bond as necessary to satisfy valence requirements; 1 , X 2 , and X 3 Each of R is independently N, O, S, or C(R c ), where R c is H, alkyl, or halo, with the proviso that X 1 , X 2 , and X 3 At least one of C(R c In some embodiments of Formula I and / or Formula IA, R c is H or alkyl, e.g., C 1 ~C 3 In certain embodiments of formula I and / or formula IA, R c is H. In some embodiments of Formula I and / or Formula IA, X 1 , X 2 , and X 3 At least one of X is N. In certain embodiments of formula I and / or formula IA, 1, X 2 , and X 3 At least one of is N, and X 1 , X 2 , and X 3 is O or S. In some embodiments, the five-membered ring of formula I and / or formula IA is [ka] In certain examples, the five-membered ring of formula I and / or formula IA is selected from: [ka] It is.
[0130] In any of the above or following embodiments, ring B of formula I is [ka] where Y 1 , Y 2 , Y 3 , and Y 4 Each of R is independently N or C(R c ), where R c is H, alkyl, or halo, with the proviso that Y 1 , Y 2 , Y 3 , and Y 4 At least one of Y is N. In some embodiments of Formula I, Y 1 , Y 2 , Y 3 , and Y 4 Two of them are N and two are Y 1 , Y 2 , Y 3 , and Y 4 The others are C(R c ) Each R C may be independently H, -alkyl, or halo. In certain instances, R c is H. In some embodiments of formula I, ring B is [ka] In certain embodiments of formula I, ring B is: [ka] It is.
[0131] The disclosed compounds typically include some R 3 group (represented in Formula I as "x"), where x is 0, 1, 2, 3, 4, or 5, and each R 3 is independently alkoxy, hydroxy, haloalkyl, aliphatic, or halo. 3 is not fluoro. In some embodiments, x is 1, 2, or 3. In certain embodiments, x is 1. In some embodiments, at least one R 3 The group is in the para position relative to ring A. In any of the above or following embodiments, R 3 is C 1 ~C 3 In some embodiments, R 3 In certain embodiments, x is 1 and R 3 is in para to ring A.
[0132] In any of the above or following embodiments, wherein n is an integer other than 0, each R 4 are independently H, alkyl (e.g., C 1 ~C 3 alkyl), or halo. In some embodiments, R 4 is H or methyl. In certain embodiments, R 4 is H. In some embodiments, n is 0 or 1. In certain embodiments, n is 0 and -N(R 1 )(R 2 ) is directly attached to ring B.
[0133] In some embodiments, the compound has a structure according to Formula II: [ka] With respect to formula II, R 1 , R 2 and R 3 Each of R is as defined according to any of the above embodiments. 2 is H or C 1 ~C 3 In certain embodiments, R 2 is H.
[0134] In some embodiments, the compound has a structure according to Formula III: [ka] has.
[0135] In certain embodiments of any one of formulas I, IA, II or III, R 1 is -(CR a 2 ) m -R b or -[(CR a 2 ) m O] r -(CH 2 ) 2 -R b where each R a is independently H, alkyl, or halo; m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; R b is a nitrogen-containing group. In some embodiments, each R a are independently H or C 1 ~C 3 In certain embodiments, each R a is H and R 1 is -(CH 2 ) m -R b In certain embodiments, each Ra is H and R 1 is -[(CR a 2 ) m O] r -(CH 2 ) 2 -R b where r is 1, 2 or 3. In some embodiments, m is 1, 2 or 3, particularly 2 or 3. In any of the above or following embodiments, m+n can be 1, 2, 3, 4 or 5. In some embodiments, m+n is 2, 3 or 4, particularly 2 or 3. In certain embodiments, n is 0 and m is 2 or 3.
[0136] In certain embodiments of any one of formulas I, IA, II or III, R b is a nitrogen-containing group. In some embodiments, R b is an N-containing cyclic group, -N(R c ) 2 , or -C(O)N(R c ) 2 where each R c is H, alkyl, or halo. The N-containing cyclic group can be saturated or unsaturated (including aromatic) and can contain 5 to 15 atoms, e.g., 5 to 14 atoms, or 5 to 10 atoms, or 5 to 8 atoms. In some embodiments, the N-containing cyclic group further comprises one or more substituents, e.g., a substituent selected from halo, heteroaliphatic, or aliphatic. In certain embodiments, the N-containing cyclic group is -(CR a 2 ) m - or -[(CR a 2 ) m O] r -(CH 2 ) 2- is bonded to - through a nitrogen atom in the heterocycle. Exemplary N-containing cyclic groups contain one or two nitrogen atoms and may contain another heteroatom, such as an S or O atom. Suitable N-containing cyclic groups include, but are not limited to, acridinyl groups (or other G4 stacking compounds, such as BRACO-19), hexahydroazepinyl groups, piperazinyl groups, morpholino groups, and piperidinyl groups. In some embodiments, R b is -N(R c ) 2 or -C(O)N(R c ) 2 where R c is H or alkyl, e.g., H or C 1 ~C 3 alkyl; or an acridinyl group, such as acridine ICR 191, 9-aminoacridine, acridine Cl, or acridine NH 2 In embodiments that include such an acridinyl group, the compound may be a "bivalent" compound that includes two G4-responsive groups, including a non-canonical G4 binding component and a G4 stacker component. The non-canonical G4 binding component is selected from the group consisting of ring A, ring B and / or ring R. 3 The portion of the compound that contains a possessed phenyl ring includes a G4 stacker component that contains an acridinyl group. [ka]
[0137] In some embodiments of the divalent compound, the divalent compound has a structure according to Formula IV: [ka] (In the formula, R b is a G4 stacker group, e.g., an aromatic group (e.g., an acridinyl group); a 2 ) m - or -[(CR a 2 ) m O] r -(CH2 ) s - where R a , m, r and s are as described herein, e.g., as provided for Formula I and / or Formula II. has.
[0138] In some embodiments of the divalent compound, the divalent compound has a structure according to Formula V: [ka] (In the formula, R b is an acridinyl group; the linker group is -(CH 2 ) m -or- [(CH a 2 ) m O] r -(CH 2 ) s -wherein each of m, r and s is as described herein, e.g., as provided for Formula I and / or Formula II. has.
[0139] In certain embodiments of any one of formulas I, IA, II or III, R 1 is selected from: [ka]
[0140] In certain embodiments of any one of formulas I, IA, IV or V, R 1 is selected from: [ka]
[0141] In certain embodiments of formula II, R 2 is H or C 1 ~C 3 is alkyl, R 1is as defined according to any of the above embodiments. In certain embodiments, R 2 is H.
[0142] In certain embodiments of formula III, R 2 is H and R 3 is methoxy and R 1 is as defined according to any of the above embodiments.
[0143] Certain compounds according to Formula I are shown in Table 1: [Table 1-1] [Table 1-2]
[0144] In some embodiments, the compound is MY-5, MY-6, MY-7, MY-8, MY-13, MY-14, B32, B33, B34, B35, or B38. In certain examples, the compound is MY-8 or B33.
[0145] In an independent embodiment, the compound is: 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine; N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine; N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine is also 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine does not include, is not these, or is other than these.
[0146] IV. Preparation method Disclosed herein are embodiments of methods for making compounds according to the present disclosure, e.g., compounds of formula I, IA, II, III, IV, or V. An exemplary method for making the compounds is provided in Scheme 2 below, in which R is any of the R 1 is used to represent [ka]
[0147] A representative method for making the compound embodiments disclosed herein is provided in Scheme 3 below. [ka] With respect to Scheme 3, the following exemplary procedures can be used (the amounts of reagents, reaction times, and temperatures described in the Examples section herein can be used in some embodiments):
[0148] 6-Hydroxypyridazine-3-carboxylic acid, EDC·HCl, Oxyma Pure, and DMF are combined. The reaction is stirred at room temperature for 10 minutes, followed by the addition of 4-methoxybenzamide oxime. The reaction mixture is then heated to 120° C. and stirred. After 3 hours, the reaction mixture is filtered and washed with DMF. The filtrate is collected and dried to give the target product P1. POCl is then added to the reaction mixture. 3 The solution of P1 in is heated to 100° C. and stirred for 4 h. The reaction crude is poured onto ice-cold water and neutralized with 10% NaOH solution. The mixture is then extracted with EtOAc and washed with brine. The combined organic layers are washed with MgSO 4 The mixture is dried over 1000 ml of ethyl acetate, filtered, and concentrated in vacuo. The resulting residue is purified by ISCO flash column chromatography. P2 and 3-(4-methylpiperazin-1-yl)propan-1-amine and NH in EtOH are then purified. 4 The mixture of Cl is heated to 80° C. and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to give MY-5;
[0149] P2 and N,N'-dimethylethylenediamine in EtOH with NH 4 The mixture of Cl is heated to 80° C. and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to give MY-6;
[0150] P2 and 3-aminopropanamide hydrochloride in EtOH and K 2 CO 3 The mixture is heated to 80° C. and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to give MY-7;
[0151] P2 and 3-(1-azepanyl)-1-propanamine in EtOH with NH 4The mixture of MY-8 and TFA is heated to 80° C. and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to give MY-8. MY-8 is then stirred in TFA for 30 minutes to give the corresponding TFA salt;
[0152] P2 and 2-morpholinoethan-1-amine in EtOH with NH 4 The mixture of MY-13 and MY-22 is heated to 80° C. and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to give MY-13; and
[0153] P2 and 2-(4-methylpiperazin-1-yl)ethan-1-amine in EtOH with NH 4 The mixture of Cl is heated to 80° C. and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to provide MY-14.
[0154] The divalent compounds disclosed herein can be made according to the methods provided by Scheme 4 below, in which R is any of the R 1 is used to represent [ka]
[0155] A representative method for making the divalent compound embodiments disclosed herein is provided in Scheme 5 below. [ka] With respect to Scheme 5, the following procedure may be used (the amounts of reagents, reaction times, and temperatures described in the Examples section herein may be used in some embodiments), where R is any particular R 1 The substituents refer to the linker-G4 stacker motif as described below:
[0156] A solution of 7 in DMSO is combined with DIPEA followed by 2. The reaction is heated and maintained at 110° C. for 18 h. The crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to give B33 as a yellow solid;
[0157] A solution of 7 in DMSO is combined with DIPEA followed by 2. The reaction is heated and maintained at 110° C. for 18 h. The crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to give B33 as a yellow solid;
[0158] A solution of 7 in DMSO is combined with DIPEA followed by 3. The reaction is heated and maintained at 110° C. for 18 h. The crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to give B34 as a yellow solid;
[0159] A solution of 7 in DMSO is combined with DIPEA followed by 4. The reaction is heated and maintained at 110° C. for 18 h. The crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to give B35 as a yellow solid; and
[0160] A solution of 7 in DMSO is combined with DIPEA followed by 5. The reaction is heated and maintained at 110° C. for 18 h. The crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to give B38 as a yellow solid.
[0161] Further details regarding methods for making representative compounds are provided in the Examples section herein.
[0162] V. How to use Disclosed herein are embodiments of methods for regulating the level of a gene and / or gene expression in a cell, wherein the gene comprises at least one region that comprises a non-canonical G4, such as a region that comprises a hairpin G4. In some embodiments, the cell may be a cell present in a subject or a sample (e.g., a biological sample that contains a cell, such as a cancerous or non-cancerous cell). Regulating the level of a gene and / or gene expression may include reducing the expression of a gene (e.g., MYCN or MYC), for example, reducing the accumulation of a gene product, such as an RNA (e.g., mRNA or lncRNA), an associated protein, or a combination thereof. In some embodiments of the method, the gene may be selected from the MYC family (e.g., MYCN, MYCNOS, MYCL, MYC, etc.), FOXA3, KRAS, BRD4, and any associated cancer genes.
[0163] In some embodiments, the method may include treating the cancer (or tumor) by administering to a subject having the cancer (or tumor) a therapeutically effective amount of a compound according to the present disclosure (or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof). In other embodiments, the method may include contacting a cell with an effective amount of a compound according to the present disclosure (or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof). The cell may be contacted in vitro, ex vivo, or in vivo. In some examples, the compound according to the present disclosure enters the cell upon contact. In some embodiments, the method may further include detecting a decrease in gene, protein, and / or lncRNA expression after exposing the subject or sample to the compound.
[0164] In certain embodiments, a method for decreasing protein expression of N-Myc in a cell is disclosed. The method may include contacting the cell with an effective amount of the disclosed compound, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof. The cell may be contacted in vitro, ex vivo, or in vivo. The compound selectively binds to a G4 nucleic acid region in the MYCN gene, which in certain embodiments is a G4 nucleic acid region that includes a non-canonical G4 structure. In certain embodiments, the compound binds to such a non-canonical G4 in the DNA of the gene, but does not bind to the RNA (e.g., mRNA) of the gene that does not similarly contain a G4. In some embodiments, the compound selectively binds to or near the G4 hairpin. The cell may be a cell characterized at least in part by overexpression of the MYCN gene. In some embodiments, expression of the MYCN gene in the cell is reduced by at least 25%, e.g., at least 50%, at least 75%, at least 80%, at least 85%, or even at least 90%, compared to expression in the absence of the compound. The compounds may also reduce cell growth and / or proliferation, hi some embodiments, the growth and / or proliferation is reduced by at least 25%, e.g., at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, or even at least 95%, compared to growth and / or proliferation in the absence of the compound.
[0165] In certain embodiments, a method for decreasing the protein expression of c-Myc in a cell is disclosed. The method may include contacting the cell with an effective amount of the disclosed compound, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof. The cell may be contacted in vitro, ex vivo, or in vivo. The compound selectively binds to a G4 nucleic acid region in the MYC gene, which in certain embodiments is a G4 nucleic acid region that includes a non-canonical G4 structure. In certain embodiments, the compound binds to such a non-canonical G4 in the DNA of the gene, but does not bind to the RNA (e.g., mRNA) of the gene that does not similarly contain a G4. The cell may be a cell characterized at least in part by overexpression of the MYC gene. In some embodiments, expression of the MYC gene in the cell is reduced by at least 25%, e.g., at least 50%, at least 75%, at least 80%, at least 85%, or even at least 90%, compared to expression in the absence of the compound. The compound may also reduce cell growth and / or proliferation. In some embodiments, growth and / or proliferation is reduced by at least 25%, such as at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, or even at least 95%, compared to growth and / or proliferation in the absence of the compound.
[0166] In any of the above or following embodiments, the cell may be a tumor and / or cancer cell in a subject, and the method may further comprise treating or preventing cancer in a subject by administering to a subject in need thereof a therapeutically effective amount of a compound or a pharma-ceutically acceptable salt or ester thereof to reduce protein (e.g., N-Myc, c-Myc, etc.) expression in the tumor and / or cancer cell, thereby treating or preventing cancer in the subject. Subjects that can benefit from the disclosed methods include human and veterinary subjects. In some embodiments, the cancer cell is a neural cancer cell or a lung cancer cell. In certain embodiments, the cancer is a neuroblastoma or a small cell lung cancer. In some embodiments, treating cancer in a subject reduces the growth and / or proliferation of the cancer cell or of a tumor comprising the cancer cell.
[0167] Cancer treatment is generally started after cancer diagnosis or after the onset of precursor conditions (e.g., dysplasia or benign tumor development).Treatment can be started early in cancer, for example, before the subject manifests symptoms of the condition, for example, during stage I diagnosis, or when dysplasia is diagnosed.However, treatment can be started at any stage of disease, for example, but not limited to, during stage I, stage II, stage III and stage IV cancer.In some cases, treatment is administered to those subjects with benign tumors that can transform into malignant lesions or even metastatic tumors.
[0168] Treatment initiated after the onset of a condition such as malignant cancer may result in a reduction in the severity of one or more symptoms of the condition, or may result in the complete elimination of symptoms, or may result in a reduction in metastasis, tumor volume, and / or tumor number. In some cases, the tumor becomes undetectable after treatment. In one embodiment of the present disclosure, the formation of tumors, such as metastases, is delayed, prevented, or reduced. In another embodiment, the size of the primary tumor is reduced. In a further embodiment, the symptoms of the tumor are reduced. In yet another embodiment, the tumor volume is reduced.
[0169] Prior to initiating the disclosed treatment, the subject can be screened, for example, to determine whether the subject has a tumor and / or cancer. The presence of a tumor can be determined by methods known in the art, typically including cytological and morphological evaluation. The tumor can be an established tumor. The cells can be in vivo or ex vivo, including cells obtained from a biopsy. The presence of a tumor indicates that the tumor can be treated using the methods provided herein. In some embodiments, a subject with an N-Myc-positive or c-Myc-positive tumor is selected for treatment, for example, by detecting N-Myc or c-Myc expression and / or activity in a biological sample obtained from the subject.
[0170] For example, upregulated expression of the MYCN gene (e.g., as detected by an increase in MYCN mRNA, N-Myc protein, or gene expression upregulated by N-Myc compared to a control) can be detected and in some cases quantified. The expression of the MYCN gene in a biological sample is compared to a control (e.g., a normal non-tumor sample). An increase in the expression of the MYCN gene in a biological sample (e.g., an increase in MYCN mRNA, N-Myc protein, or gene expression upregulated by N-Myc) compared to a control indicates the presence of an N-Myc positive tumor, and the increase can be used to select a subject for treatment with one or more of the compounds or compositions disclosed herein. For example, an increase in the test sample of at least 50%, at least 75%, at least 80%, at least 90%, at least 100%, at least 200%, or even more than 500% compared to a control indicates that the subject (e.g., a human subject) is likely to respond favorably to treatment with one or more of the agents disclosed herein. A suitable method for detecting and / or monitoring an N-Myc positive tumor (e.g., an N-Myc positive neuroblastoma) in a subject can be selected by the attending physician. In one embodiment, a sample is taken from a subject and the presence of cells expressing N-Myc is assessed in vitro.
[0171] In yet further embodiments, upregulated expression of the MYC gene (e.g., as detected by an increase in MYC mRNA, c-Myc protein, or gene expression upregulated by c-Myc compared to a control) can be detected and in some cases quantified. Expression of the MYC gene in a biological sample is compared to a control (e.g., a normal non-tumor sample). An increase in MYC gene expression in a biological sample (e.g., an increase in MYC mRNA, c-Myc protein, or gene expression upregulated by c-Myc) compared to a control indicates the presence of a c-Myc positive tumor, and can be used to select a subject for treatment with one or more of the compounds or compositions disclosed herein. For example, an increase in the test sample of at least 50%, at least 75%, at least 80%, at least 90%, at least 100%, at least 200%, or even more than 500% compared to a control indicates that the subject (e.g., a human subject) is likely to respond favorably to treatment with one or more of the agents disclosed herein. A suitable method for detecting and / or monitoring a c-Myc positive tumor (e.g., a c-Myc positive neuroblastoma) in a subject can be selected by the attending physician. In one embodiment, a sample is taken from the subject and the presence of cells expressing c-Myc is assessed in vitro.
[0172] A therapeutically effective amount of a disclosed compound according to any one of Formulas I, IA, II, III, IV, or V, as well as any representative compound species disclosed herein (e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY-11, MY-12, MY-13, MY-14, B32, B33, B34, B35, or B38) (or a pharmaceutical composition containing same) can be administered to a subject to treat a tumor and / or cancer in the subject. Subjects who have, are suspected of having, or are at risk of developing a tumor or tumors, such as neuroblastoma or small cell lung cancer, can be selected for treatment.
[0173] The administration of a compound according to any one of Formulas I, IA, II, III, IV, or V of the present disclosure, as well as any representative compound species disclosed herein (e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY-11, MY-12, MY-13, MY-14, B32, B33, B34, B35, or B38) (or a pharmaceutical composition containing same) can be for either prophylactic or therapeutic purposes. When provided prophylactically, the compound is provided prior to any symptoms of initial development of tumors and / or cancer or recurrence of previously treated tumors and / or cancer. Prophylactic administration of the compound serves to prevent or ameliorate any subsequent disease process. When provided therapeutically, the compound is provided at (or shortly after) the onset of symptoms of disease or infection.
[0174] In some examples, a disclosed compound according to any one of formulas I, IA, II, III, IV, or V, as well as any representative compound species disclosed herein (e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY-11, MY-12, MY-13, MY-14, B32, B33, B34, B35, or B38) (or a pharmaceutical composition containing same) can be administered to a subject to slow or inhibit the growth or metastasis of a tumor and / or cancer. In these applications, a therapeutically effective amount of the compound (or a pharmaceutical composition thereof) can be administered to a subject in an amount and under conditions sufficient to slow or inhibit the growth or metastasis of a tumor or inhibit a sign or symptom of a tumor by binding to a non-canonical G4, such as a non-canonical G4 present in the DNA of the MYCN gene, and reducing N-Myc expression. Examples of suitable subjects include those diagnosed with or suspected of having cancer (eg, a tumor-bearing subject), such as a subject with neuroblastoma or small cell lung cancer.
[0175] In some examples, a disclosed compound according to any one of formulas I, IA, II, III, IV, or V, as well as any representative compound species disclosed herein (e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY-11, MY-12, MY-13, MY-14, B32, B33, B34, B35, or B38) (or a pharmaceutical composition containing same) can be administered to a subject to slow or inhibit the growth or metastasis of a tumor and / or cancer. In these applications, a therapeutically effective amount of the compound (or a pharmaceutical composition thereof) can be administered to a subject in an amount and under conditions sufficient to slow or inhibit the growth or metastasis of a tumor or inhibit a sign or symptom of a tumor by binding to a non-canonical G4, such as a non-canonical G4 present in the DNA of the MYC gene, and reducing c-Myc expression. Examples of suitable subjects include those diagnosed with or suspected of having cancer (e.g., a subject with a tumor). In some examples, the subject has a cancer that expresses MYCN and / or c-MYC.Non-limiting exemplary cancers include sarcoma, carcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovium, mesothelioma, Ewing's tumor, Kaposi's sarcoma, leiomyosarcoma, rhabdomyosarcoma, colon cancer, lymphoid malignancies, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, uterine cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, adrenal gland carcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, These include hepatoma, cholangiocarcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder cancer, melanoma, and CNS tumors such as gliomas (e.g., brain stem glioma and mixed glioma), glioblastoma (also known as glioblastoma multiforme), astrocytoma, CNS lymphoma, germinoma, medulloblastoma, schwannoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, head and neck cancer, neuroblastoma, retinoblastoma, and brain metastases.Cancer also includes blood (or hematopoietic) cancer, such as leukemia, such as lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (low-grade or high-grade), multiple myeloma, Waldenstrom's hypergammaglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia or myelodysplasia. In non-limiting examples, the cancer is neuroblastoma, rhabdomyosarcoma, prostate cancer, or small cell lung cancer.
[0176] The therapeutically effective amount will depend on the severity of the disease and the overall health of the subject.The therapeutically effective amount is the amount that causes either the subjective relief of one or more symptoms, or the objectively identifiable improvement as recognized by the clinician or other qualified observer.In one embodiment, the therapeutically effective amount is the amount necessary to suppress tumor growth, or the amount effective to reduce the signs or symptoms of tumor.The therapeutically effective amount of the administered drug may vary depending on the desired effect and the subject to be treated.In some examples, the therapeutic amount is the amount that eliminates or reduces the tumor burden of the patient, or prevents or reduces the proliferation of metastatic cells.
[0177] The actual dosage of the compound may vary depending on factors such as the disease indication and specific status of the subject (e.g., the subject's age, size, fitness, degree of symptoms, susceptibility factors, etc.), the time and route of administration, other drugs or treatments administered concomitantly, and the specific pharmacology of the compound to elicit the desired activity or biological response in the subject. Dosage regimens can be adjusted to obtain optimal prophylactic or therapeutic responses. A therapeutically effective amount is also an amount in which any toxic or adverse side effects of the compound and / or other bioactive agent are outweighed in clinical terms by the therapeutically beneficial effects. A non-limiting range for the therapeutically effective amount of the compound and / or other bioactive agent in the methods and formulations of the present disclosure is about 0.01 mg / kg body weight to about 20 mg / kg body weight, for example, about 0.05 mg / kg to about 5 mg / kg body weight, or about 0.2 mg / kg to about 2 mg / kg body weight.
[0178] The attending clinician can vary the dosage to maintain the desired concentration at the target site (e.g., lung or systemic circulation).Based on the mode of delivery, for example, intravenous or subcutaneous or intramuscular delivery versus transdermal, rectal, oral, pulmonary, intraosseous or intranasal delivery, higher or lower concentrations can be selected.Dosage can also be adjusted based on the release rate of the administered formulation, for example, the release rate of intrapulmonary spray versus intrapulmonary powder, the release rate of injected microparticle formulation or sustained release oral formulation versus transdermal delivery formulation, etc.
[0179] Any administration method, including local and systemic administration, can be used for the disclosed therapeutic agent. For example, local, oral, intravascular, such as intravenous, intramuscular, intraperitoneal, intranasal, intradermal, intrathecal and subcutaneous administration can be used. The specific administration mode and dosing regimen will be selected by the attending clinician, taking into account the details of the case (e.g., the subject, the disease, the pathology suffered, and whether the treatment is preventive). When more than one agent or composition is to be administered, one or more administration routes can be used. In some embodiments, administration is oral, intravascular, such as intravenous, intramuscular, intraperitoneal, intranasal, or intrathecal administration.
[0180] For the purpose of prevention and treatment, the compound can be administered to a subject by oral route or in a single bolus delivery, by continuous delivery over a long period of time (e.g., continuous intravenous delivery), or in a repeated administration protocol (e.g., hourly, daily, or weekly repeated administration protocol). The therapeutically effective dosage of the compound can be provided as repeated doses in a long-term prevention or treatment regimen that will produce clinically significant results to alleviate one or more symptoms or detectable conditions related to the target disease or condition as shown herein. In this regard, the determination of effective dosage is typically based on animal model studies followed by human clinical trials, and is guided by an administration protocol that significantly reduces the incidence or severity of the target disease symptoms or condition in the subject. Suitable models in this regard include, for example, mice, rats, birds, dogs, sheep, pigs, felines, non-human primates, and other accepted animal model subjects known in the art. Alternatively, effective dosage can be determined using in vitro models. Using such models, only routine calculations and adjustments are required to determine appropriate concentrations and dosages for administering a therapeutically effective amount of the compound (e.g., an amount that is effective to alleviate one or more symptoms of the targeted disease.) In alternative embodiments, an effective amount or dosage of a compound can simply inhibit or enhance one or more selected biological activities that are correlated with a disease or condition as set forth herein, for either therapeutic or diagnostic purposes.
[0181] In some embodiments, local administration of the disclosed compounds can be used, for example, by applying the disclosed compounds to the area of tissue from which a tumor has been removed or to an area suspected of being prone to developing a tumor. In some embodiments, sustained release within (or near) a tumor of a pharmaceutical preparation comprising a therapeutically effective amount of a disclosed compound can be beneficial.
[0182] The disclosed compounds can be formulated in unit dosage forms suitable for individual administration of precise dosages. In addition, the disclosed compounds can be administered in a single dose or multiple dose schedule. A multiple dose schedule can be one in which the main course of treatment is by more than one separate administration, for example, 1-10 administrations, followed by other administrations given at subsequent time intervals as needed to maintain or enhance the action of the composition. Treatment can include one or multiple daily administrations of the compound over a period ranging from several days to several months or even years. Thus, dosage regimens will be determined, at least in part, based on the particular needs of the subject to be treated and will be dependent on the judgment of the administering practitioner.
[0183] In certain examples, the subject is administered a therapeutic composition comprising one or more of the disclosed compounds in a multiple daily dosing schedule, such as for at least 2 consecutive days, 10 consecutive days, etc., over a period of, e.g., weeks, months, or years. In one example, the subject is administered the composition for a period of at least 30 days, e.g., at least 2 months, at least 4 months, at least 6 months, at least 12 months, at least 24 months, or at least 36 months.
[0184] In some embodiments, the disclosed methods include administering surgery, radiation therapy, and / or chemotherapy to the subject in combination with administration of the disclosed compounds or compositions containing same. Methods and therapeutic dosages of such agents and treatments are known to those of skill in the art and can be determined by the skilled clinician. Preparation and dosing schedules for additional agents can be used by those of skill in the art according to manufacturer's instructions or as determined by experimentation. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service, (1992) Ed., MC Perry, Williams & Wilkins, Baltimore, Md.
[0185] Non-limiting examples of additional therapeutic agents that can be used in combination therapy include microtubule binding agents, DNA intercalating or crosslinking agents, DNA synthesis inhibitors, DNA and RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulators, angiogenesis inhibitors, and proteosome inhibitors (e.g., bortezomib or carfilzomib). These agents (administered in therapeutically effective amounts) and treatments can be used alone or in combination. For example, any suitable anti-cancer or anti-angiogenesis agent can be administered in combination with the compounds disclosed herein. Methods and therapeutic dosages for such agents are known to those skilled in the art and can be determined by skilled clinicians.
[0186] Additional chemotherapeutic agents include alkylating agents, such as nitrogen mustards (e.g., chlorambucil, chlormethine, cyclophosphamide, ifosfamide, and melphalan), nitrosoureas (e.g., carmustine, fotemustine, lomustine, and streptozocin), platinum compounds (e.g., carboplatin, cisplatin, oxaliplatin, and BBR3464), busulfan, dacarbazine, mechlorethamine, procabazine, temozolomide, thiotepa, and uramustine; antimetabolites, such as folates (e.g., methotrexate, pemetrexed, and raltitrexed), purines (e.g., cladribine, clofarabine, fludarabine, mercaptopurine, and thioguanine), pyrimidines (e.g., capecitabine), cytarabine, fluorouracil, and gemcitabine; plant alkaloids, such as , podophyllum (e.g., etoposide, and teniposide), taxanes (e.g., docetaxel and paclitaxel), vincas (e.g., vinblastine, vincristine, vindesine, and vinorelbine); cytotoxic / antitumor antibodies, e.g., anthracycline family members (e.g., daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, and valrubicin), bleomycin, topoisomerase inhibitors such as topotecan and irinotecan; monoclonal antibodies such as alemtuzumab, bevacizumab, cetuximab, gemtuzumab, rituximab, panitumumab, pertuzumab, and trastuzumab; photosensitizers such as aminolevulinic acid, methyl aminolevulinate, porfimer sodium, and verteporfin;and other agents, such as, but not limited to, alitretinoin, altretamine, amsacrine, anagrelide, arsenic trioxide, asparaginase, axitinib, bexarotene, bevacizumab, bortezomib, celecoxib, denileukin diftitox, erlotinib, estramustine, gefitinib, hydroxycarbamide, imatinib, lapatinib, pazopanib, pentostatin, masoprocol, mitotane, pegaspargase, tamoxifen, sorafenib, sunitinib, vemurafenib, vandetanib, and tretinoin. The selection and therapeutic dosage of such agents are known to those skilled in the art and can be determined by a skilled clinician.;
[0187] Combination therapy may produce synergistic effects and may be found to be synergistic, that is, the effect achieved when active ingredients are used together is greater than the sum of the effects resulting from using the compounds separately.Synergistic effects may be achieved when active ingredients are (1) formulated together and administered or delivered simultaneously in a combined unit dosage formulation; (2) delivered alternately or in parallel as separate formulations; or (3) by some other regimen.Synergistic effects when delivered alternately may be achieved when compounds are administered or delivered sequentially, for example, by different injections in separate syringes.Generally, during alternation, the effective dosage of each active ingredient is administered sequentially, i.e., sequentially, whereas in combination therapy, the effective dosage of two or more active ingredients is administered together.
[0188] In any embodiment of the method of the present disclosure, the compound used in the method can be any of the compounds according to the present disclosure, as well as 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine; N1-(6-(3-(4-meth The compound may be any compound, including N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine; and 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine.
[0189] VI. Pharmaceutical Compositions Another aspect of the present disclosure includes pharmaceutical compositions prepared for administration to cells, such as ex vivo, in vivo, or in vitro cells, comprising a therapeutically effective amount of one or more of the compounds disclosed herein. The therapeutically effective amount of the disclosed compounds will depend on the route of administration, the species of the subject, and the physical characteristics of the subject being treated. Specific factors that can be considered include disease severity and stage, body weight, diet, and concomitant drugs. The relevance of these factors to determine the therapeutically effective amount of the disclosed compounds will be understood by those skilled in the art.
[0190] In addition to the selected molecule, the pharmaceutical composition for administration to a subject may contain at least one additional pharma- ceutically acceptable additive, such as a carrier, a thickener, a diluent, a buffer, a preservative, a surfactant, and the like. The pharmaceutical composition may also contain one or more additional active ingredients, such as an antimicrobial agent, an anti-inflammatory agent, an anesthetic agent, and the like. The pharma- ceutically acceptable carriers useful in these formulations are conventional. Remington's Pharmaceutical Sciences, by EW Martin, Mack Publishing Co., Easton, PA, 19th Edition (1995), describes compositions and formulations suitable for pharmaceutical delivery of the compounds disclosed herein.
[0191] Generally, the nature of the carrier will depend on the particular mode of administration to be used.For example, parenteral formulations usually contain injectable fluids that contain pharma- ceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, etc., as vehicles.Conventional non-toxic solid carriers for solid compositions (e.g., powder, pill, tablet or capsule forms) can include, for example, pharmaceutical grade mannitol, lactose, starch, or magnesium stearate.In addition to biologically neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sorbitan monolaurate.
[0192] The pharmaceutical compositions disclosed herein include those formed from pharma- ceutically acceptable salts and / or solvates of the disclosed compounds. Pharmaceutically acceptable salts include those derived from pharma- ceutically acceptable inorganic or organic bases and acids. Certain disclosed compounds possess at least one basic group capable of forming acid-base salts with acids. Examples of basic groups include, but are not limited to, amino and imino groups. Examples of inorganic acids capable of forming salts with such basic groups include, but are not limited to, mineral acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, or phosphoric acid. Basic groups may also be formed from organic carboxylic acids, sulfonic acids, sulfo acids, or phosphoric acids. acid) or N-substituted sulfamic acids, such as acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2-acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid, and also amino acids, such as α -amino acids, and also with methanesulfonic acid, ethanesulfonic acid, 2-hydroxymethanesulfonic acid, ethane-1,2-disulfonic acid, benzenedisulfonic acid, 4-methylbenzenesulfonic acid, naphthalene-2-sulfonic acid, 2- or 3-phosphoglycerate, glucose-6-phosphate or N-cyclohexylsulfamic acid (with the formation of cyclamic acid), or with other acidic organic compounds, such as ascorbic acid. In particular, suitable salts include those derived from alkali metals, such as potassium and sodium, alkaline earth metals, such as calcium and magnesium, among numerous other acids well known in the pharmaceutical art.
[0193] Certain compounds contain at least one acidic group that can form acid-base salts with inorganic or organic bases. Examples of salts formed from inorganic bases include salts of the disclosed compounds with alkali metals such as potassium and sodium, alkaline earth metals including calcium and magnesium, and the like. Similarly, salts of acidic compounds with organic bases, such as amines (as used herein, the term amines should be understood to include their conjugate acids unless the context clearly indicates that the free amine is intended), are contemplated, including salts formed with basic amino acids, aliphatic amines, heterocyclic amines, aromatic amines, pyridines, guanidines, and amidines. Among aliphatic amines, acyclic aliphatic amines and cyclic and acyclic di- and trialkylamines are particularly suitable for use in the disclosed compounds. In addition, quaternary ammonium counterions can also be used.
[0194] Specific examples of suitable amine bases (and their corresponding ammonium ions) for use in the present compounds include, but are not limited to, pyridine, N,N-dimethylaminopyridine, diazabicyclononane, diazabicycloundecene, N-methyl-N-ethylamine, diethylamine, triethylamine, diisopropylethylamine, mono-, bis- or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, tris(hydroxymethyl)methylamine, N,N-dimethyl-N-(2-hydroxyethyl)amine, tri-(2-hydroxyethyl)amine and N-methyl-D-glucamine.For additional examples of "pharmacologically acceptable salts", see Berge et al., J. Pharm. Sci. 66:1 (1977).
[0195] The compounds disclosed herein can be crystallized and can be provided in single crystal form or as a combination of different crystal polymorphs.Accordingly, the compounds can be provided in one or more physical forms, for example, different crystal forms, crystalline, liquid crystal or non-crystalline (amorphous) forms.Such different physical forms of the compounds can be prepared, for example, by using different solvents or different solvent mixtures for recrystallization.Alternatively or additionally, different polymorphs can be prepared, for example, by performing recrystallization at different temperatures and / or by changing the cooling rate during recrystallization.The presence of polymorphs can be determined by X-ray crystallography, or in some cases by other spectroscopic techniques, for example, solid-state NMR spectroscopy, IR spectroscopy, or differential scanning calorimetry.
[0196] The pharmaceutical composition can be administered to a subject by various mucosal administration methods, including oral, rectal, intranasal, pulmonary or transdermal delivery, or by topical delivery to other surfaces.Optionally, the composition can be administered by non-mucosal routes, including intramuscular, subcutaneous, intravenous, intraarterial, intraarticular, intraperitoneal, intrathecal, intracerebroventricular or parenteral routes.In another alternative embodiment, the compound can be administered ex vivo, by direct exposure to cells, tissues or organs originating from the subject.
[0197] To formulate pharmaceutical compositions, compounds can be combined with various pharmaceutically acceptable additives and bases or vehicles for dispersing compounds.Desired additives include, but are not limited to, pH adjusting agents, such as arginine, sodium hydroxide, glycine, hydrochloric acid, citric acid, etc.In addition, local anesthetics (e.g., benzyl alcohol), isotonicity agents (e.g., sodium chloride, mannitol, sorbitol), adsorption inhibitors (e.g., Tween® 80 or Miglyol 812), dissolution enhancers (e.g., cyclodextrins and their derivatives), stabilizers (e.g., serum albumin), and reducing agents (e.g., glutathione) can be included. Adjuvants such as aluminum hydroxide (e.g., Amphogel, Wyeth Laboratories, Madison, NJ), Freund's adjuvant, MPL™ (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, IN) and IL-12 (Genetics Institute, Cambridge, MA), among many other suitable adjuvants known in the art, can be included in the composition. When the composition is a liquid, the isotonicity of the formulation, measured with reference to the isotonicity of 0.9% (w / v) saline solution considered as a single state, is usually adjusted to a value that will not induce substantial irreversible tissue damage at the site of administration. Generally, the isotonicity of the solution is adjusted to a value of about 0.3 to about 3.0, e.g., about 0.5 to about 2.0, or about 0.8 to about 1.7.
[0198] The compound can be dispersed in a base or vehicle that can contain a hydrophilic compound capable of dispersing the compound and any desired additives. The base can be selected from a wide range of suitable compounds, including but not limited to polycarboxylic acids or their salts, copolymers of carboxylic anhydrides (e.g., maleic anhydride) and other monomers (e.g., methyl (meth)acrylate, acrylic acid, etc.), hydrophilic vinyl polymers, such as polyvinyl acetate, polyvinyl alcohol, polyvinylpyrrolidone, cellulose derivatives, such as hydroxymethylcellulose, hydroxypropylcellulose, etc., and natural polymers, such as chitosan, collagen, sodium alginate, gelatin, hyaluronic acid, and non-toxic metal salts thereof. In many cases, biodegradable polymers, such as polylactic acid, poly(lactic acid-glycolic acid) copolymers, polyhydroxybutyric acid, poly(hydroxybutyric acid-glycolic acid) copolymers, and mixtures thereof, are selected as the base or vehicle. Alternatively or in addition, synthetic fatty acid esters, such as polyglycerin fatty acid esters, sucrose fatty acid esters, etc., can be utilized as vehicles. Hydrophilic polymers and other vehicles can be used alone or in combination, and enhanced structural integrity can be imparted to the vehicles by partial crystallization, ionic bonding, crosslinking, etc. The vehicles can be provided in a variety of forms, including fluid or viscous solutions, gels, pastes, powders, microspheres and films for direct application to mucosal surfaces.
[0199] The compound can be combined with a base or vehicle according to various methods, and the release of the compound can be by dispersion, vehicle collapse, or concomitant water channel formation. In some circumstances, the compound is dispersed in a microcapsule (microsphere) or nanocapsule (nanosphere) (see, for example, Michael et al., J. Pharmacy Pharmacol. 43:1-5, 1991) prepared from a suitable polymer, such as 2-isobutyl cyanoacrylate, and dispersed in a biocompatible dispersion medium, thereby resulting in sustained delivery and bioactivity over an extended period of time.
[0200] Alternatively, the compositions of the present disclosure may contain, as necessary to approximate physiological conditions, substances such as pH adjusting and buffering agents, toxicity adjusting agents, wetting agents, etc., such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate, as pharmaceutically acceptable vehicles. For solid compositions, conventional non-toxic pharmaceutically acceptable vehicles may be used, including, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate, and the like.
[0201] The pharmaceutical composition for administering the compound can also be formulated as a solution, microemulsion, or other ordered structure suitable for high concentration of active agent.The vehicle can be a solvent or dispersion medium, for example, containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof.The proper fluidity of the solution can be maintained, for example, by using a coating agent, such as lecithin, by maintaining a desired particle size in the case of dispersible preparations, and by using surfactants.In many cases, it will be desirable to include an isotonic agent, for example, sugar, polyalcohol, for example, mannitol and sorbitol, or sodium chloride in the composition.Prolonged absorption of the compound can be achieved by including an agent that delays absorption, for example, monostearate salts and gelatin in the composition.
[0202] In certain embodiments, the compound can be administered in a sustained release formulation, for example, in a composition that includes a slow-release polymer. These compositions can be prepared with vehicles that will prevent rapid release, for example, modified release vehicles, for example, polymers, microencapsulated delivery systems, or bioadhesive gels. Long-term delivery in various compositions of the present disclosure can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate hydrogel and gelatin. When a modified release formulation is desired, the modified release binder suitable for use according to the present disclosure includes any biocompatible modified release material that can be inserted into the active agent and can incorporate the compound and / or other bioactive agent. Numerous such materials are known in the art. Useful modified release binders are materials that are slowly metabolized under physiological conditions after delivery (for example, at mucosal surfaces or in the presence of body fluids). Suitable binders include, but are not limited to, biocompatible polymers and copolymers that are well known in the art for use in sustained release formulations. Such biocompatible compounds are non-toxic and inert to surrounding tissues and do not induce significant adverse side effects, such as nasal irritation, immune responses, inflammation, etc. They are metabolized into metabolic products that are also biocompatible and easily eliminated from the body.
[0203] Exemplary polymeric materials for use in the present disclosure include, but are not limited to, polymeric matrices derived from copolymeric and homopolymeric polyesters with hydrolyzable ester linkages.Some of these are known in the art to be biodegradable and produce non-toxic or low-toxicity degradation products.Exemplary polymers include polyglycolic acid and polylactic acid, poly(DL-lactic acid-co-glycolic acid), poly(D-lactic acid-co-glycolic acid), and poly(L-lactic acid-co-glycolic acid). Other useful biodegradable or bioerodable polymers include, but are not limited to, polymers such as poly(epsilon-caprolactone), poly(epsilon-aprolactone-co-lactic acid), poly(epsilon.-caprolactone-co-glycolic acid), poly(beta-hydroxybutyric acid), poly(alkyl-2-cyanoacrilate), hydrogels, e.g., poly(hydroxyethyl methacrylate), polyamides, poly(amino acids) (e.g., L-leucine, glutamic acid, L-aspartic acid, etc.), poly(ester ureas), poly(2-hydroxyethyl DL-aspartamide), polyacetal polymers, polyorthoesters, polycarbonates, polymaleamides, polysaccharides, and copolymers thereof. Many methods for preparing such formulations are well known to those skilled in the art (see, for example, Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978).Other useful formulations include controlled release microcapsules (U.S. Pat. Nos. 4,652,441 and 4,917,893), lactic acid-glycolic acid copolymers useful for making microcapsules and other formulations (U.S. Pat. Nos. 4,677,191 and 4,728,721), and sustained release compositions for water-soluble peptides (U.S. Pat. No. 4,675,189).
[0204] The pharmaceutical compositions of the present disclosure are typically sterile and stable under the conditions of manufacture, storage and use. Sterile solutions can be prepared by incorporating the required amount of compound with one or a combination of ingredients listed in this specification as required in a suitable solvent, followed by filtration sterilization. In general, dispersions are prepared by incorporating the compound and / or other bioactive agents into a sterile vehicle containing a basic dispersion medium and other required ingredients from those listed in this specification. In the case of sterile powders, preparation methods include vacuum drying and freeze-drying, which produce powders of the compound with any additional desired ingredients from their previously sterile-filtered solutions. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
[0205] The disclosure also includes kits, packages and multicontainer units containing pharmaceutical compositions, active ingredients and / or means for administering them described herein for use in the prevention and treatment of diseases and other conditions in mammalian subjects. Kits for diagnostic use are also provided. In one embodiment, these kits include a container containing one or more of the compounds described herein, or a formulation containing them. In one example, this component is formulated in preparation of the medicament for delivery to the subject. The compounds are optionally contained in bulk dosage containers or contained in unit or multi-unit dosage forms. Optional administration means can be provided, such as a pulmonary or nasal spray applicator. The packaging material optionally includes a label or instructions indicating the purpose of treatment and / or the method in which the packaged pharmaceutical agent can be used.
[0206] In any embodiment of the composition of the present disclosure, the embodiment of the compound used in the composition is according to the present disclosure, as well as 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine; N1-(6-(3-(4 N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine; and 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine.
[0207] VII. Representative Embodiments Compounds according to formula IA [ka] (In the formula, X 1 , X 2 and X 3 each is independently N or O; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5. with the proviso that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4 -oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine, or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine. Disclosed herein are compounds, or stereoisomers, tautomers, or pharma- ceutically acceptable salts or esters thereof.
[0208] Compounds according to formula I [ka] (In the formula, Ring A is a 5-membered heteroaryl ring other than thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, and 1,3,4-oxadiazolyl; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; Each R 4 are independently H, aliphatic, or halo; x is an integer selected from 0 to 5; n is an integer selected from 0 to 10. with the proviso that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)-N Also disclosed herein is a compound that is not 2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof.
[0209] Compounds according to formula I: [ka] (In the formula, Ring A is a 5-membered heteroaryl ring; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CR a 2 ) m -R b where each R a is independently H, alkyl, or halo; m is 1, 2, 3, 4, or 5; R b is a nitrogen-containing group; R2 is H or alkyl; Each R 3 is independently alkoxy, hydroxy, aliphatic, or halo; Each R 4 is independently H, alkyl, or halo; n is 0, 1, 2, or 3; x is 0, 1, 2, 3, 4, or 5) with the proviso that it does not contain a structure designated as any one of MY-1, MY-2, MY-10, MY-11, or MY-12. Also disclosed herein are the compounds, their stereoisomers, tautomers, or pharma- ceutically acceptable salts or esters.
[0210] Compounds according to formula I [ka] (In the formula, Ring A is a 5-membered heteroaryl ring; Ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CR a 2 ) m -R b or -[(CR a 2 ) m O] r -(CH 2 ) s -R b where each R a are independently H, aliphatic, or halo; t is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; s is 0 or 1; R b is an acridinyl group; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; Each R 4are independently H, aliphatic, or halo; x is an integer selected from 0 to 5; n is an integer selected from 0 to 10; Or stereoisomers, tautomers, or pharma- ceutically acceptable salts or esters thereof are also disclosed herein.
[0211] In any or all of these representative embodiments, Ring A is [ka] where: [ka] each bond represented by is a single or double bond, as necessary to satisfy valence requirements; X 1 , X 2 , and X 3 Each of R is independently N, O, S, or C(R c ), where R c is H, alkyl, or halo, with the proviso that X 1 , X 2 , and X 3 At least one of C(R c ) other than.
[0212] In any or all of these representative embodiments, Ring A is [ka] It is.
[0213] In any or all of these representative embodiments, Ring A is [ka] It is.
[0214] In any or all of these exemplary embodiments, Ring B is [ka] where: Y 1 , Y 2 , Y 3 , and Y 4 Each of R is independently N or C(R c ), where R c is H, alkyl, or halo, with the proviso that Y 1 , Y 2 , Y 3 , and Y 4 At least two of are N.
[0215] In any or all of these exemplary embodiments, Ring B is [ka] It is.
[0216] In any or all of these exemplary embodiments, Ring B is [ka] It is.
[0217] In any or all of these representative embodiments, (i) x is 1, 2, or 3; or (ii) one R 3 is in the para position relative to ring A; or (iii) both (i) and (ii).
[0218] In any or all of these exemplary embodiments, n is 0.
[0219] In any or all of these exemplary embodiments, each R 3 is independently 1 ~C3 It is alkoxy or hydroxy.
[0220] In any or all of these exemplary embodiments, x is 1 and R 3 is methoxy.
[0221] In any or all of these exemplary embodiments, the compound has a structure according to Formula II: [ka] has.
[0222] In any or all of these exemplary embodiments, R 2 is H.
[0223] In any or all of these exemplary embodiments, the compound has a structure according to Formula III: [ka] has.
[0224] In any or all of these exemplary embodiments, R 1 is -(CH 2 ) m -R b It is.
[0225] In any or all of these exemplary embodiments, m is 2 or 3.
[0226] In any or all of these exemplary embodiments, R b is an N-containing cyclic group -N(R c ) 2 , or -C(O)N(R c ) 2 where each R c is H or alkyl.
[0227] In any or all of these exemplary embodiments, R 1 teeth, [ka] It is.
[0228] In any or all of these exemplary embodiments, the compound is [ka] It is.
[0229] In any or all of these exemplary embodiments, the compound has a structure according to Formula IV: [ka] (Wherein, the linker is -(CR a 2 ) m -or- [(CR a 2 ) m O] r -(CR a 2 ) s -, where each R a is independently H, aliphatic, or halo; m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; and s is 0 or 1. has.
[0230] In any or all of these exemplary embodiments, the compound has a structure according to Formula V: [ka] (Wherein, the linker is -(CH 2 ) m -or- [(CH 2 ) m O] r -(CH 2 )s where m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; and s is 0 or 1. has.
[0231] In any or all of these exemplary embodiments, R 1 teeth, [ka] [ka] It is.
[0232] In any or all of these exemplary embodiments, the compound is [ka] It is.
[0233] Also disclosed herein are pharmaceutical compositions comprising a compound according to any or all of the above representative embodiments and at least one pharma- ceutically acceptable excipient.
[0234] In any or all of these exemplary embodiments, the pharmaceutical composition comprises a unit dosage form of a therapeutic amount of the compound.
[0235] In any or all of these exemplary embodiments, the pharmaceutical composition further comprises an anti-cancer agent.
[0236] A method for reducing cancer associated protein expression in a cell, comprising treating the cell with a compound according to formula IA. [ka] (In the formula, X 1 , X 2 and X 3each is independently N or O; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5. with the proviso that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4 -oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine, or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine. with an effective amount of the compound, or a stereoisomer, tautomer, or a pharma- ceutically acceptable salt or ester thereof. Also disclosed herein is a method comprising:
[0237] Also disclosed is a method of reducing cancer-associated protein expression in a cell, comprising contacting the cell with an effective amount of a compound according to any or all of the above-listed representative embodiments for Formulas I, II, III, IV and V, or a stereoisomer, tautomer, or pharma-ceutically acceptable salt or ester thereof.
[0238] In an exemplary embodiment of any or all of these methods, (i) Ring A is [ka] where: [ka] Each bond represented by X may be a single or double bond as necessary to satisfy valence requirements. 1 , X 2 , and X 3 Each of R is independently N, O, S, or C(R c ), where R c is H or alkyl, with the proviso that X 1 , X 2 , and X 3 At least one of C(R c ) other than; or (ii) Ring B is [ka] where Y 1 , Y 2 , Y 3 , and Y 4 Each of R is independently N or C(R c ), where R c is H or alkyl, with the proviso that Y 1 , Y 2 , Y 3 , and Y 4 at least two of are N; or (iii) Both (i) and (ii).
[0239] In an exemplary embodiment of any or all of these methods, (i) Ring A is [ka] is; or (ii) Ring B is [ka] is; or (iii) Both (i) and (ii).
[0240] In an exemplary embodiment of any or all of these methods, (i)R 2 is H; or (ii)R 3 is C 1 ~C 3 alkoxy or hydroxy; or (iii) x is 1, 2, or 3; or (iv) One R 3 is in the para position relative to ring A; (v) n is 0; or (vi) any combination of (i), (ii), (iii), (iv), and (v).
[0241] In an exemplary embodiment of any or all of these methods, the compound has a structure according to any one of Formulas II, III, IV or V: [ka] wherein for Formulas VI and V, the linker is -(CR a 2 ) m -or- [(CR a 2 ) m O]r -(CR a 2 ) s -, where each R a is independently H, aliphatic, or halo; m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; and s is 0 or 1. has.
[0242] In an exemplary embodiment of any or all of these methods, the compound is [ka] It is.
[0243] In an exemplary embodiment of any or all of these methods, the compound is [ka] [ka] It is.
[0244] In an exemplary embodiment of any or all of these methods, the compound is [ka] It is.
[0245] In an exemplary embodiment of any or all of these methods, the cell is in vitro.
[0246] In an exemplary embodiment of any or all of these methods, the cell is in vivo.
[0247] In an exemplary embodiment of any or all of these methods, decreasing cancer-associated protein expression in a cell decreases the growth and / or proliferation of the cell.
[0248] In an exemplary embodiment of any or all of these methods, the cell is a cell with overexpression of the MYCN gene.
[0249] In an exemplary embodiment of any or all of these methods, the compound selectively binds to a non-canonical G4-quadruplex nucleic acid region in the MYCN gene.
[0250] In an exemplary embodiment of any or all of these methods, the non-canonical G4-quadruplex nucleic acid region comprises a hairpin structure.
[0251] In representative embodiments of any or all of these methods, the cell is a cancer cell in a subject, and the method further includes the step of treating or preventing cancer in a subject, comprising the step of administering to a subject in need thereof a therapeutically effective amount of a compound, or a pharma- ceutically acceptable salt or ester thereof, to reduce N-Myc expression in the cancer cell, thereby treating or preventing cancer in the subject.
[0252] In an exemplary embodiment of any or all of these methods, the cancer cells are neural cancer cells or lung cancer cells.
[0253] In an exemplary embodiment of any or all of these methods, the cancer is neuroblastoma, rhabdomyosarcoma, prostate cancer, or small cell lung cancer.
[0254] In an exemplary embodiment of any or all of these methods, the step of treating the cancer comprises reducing tumor volume, reducing the number or size of metastases, or alleviating a symptom of the cancer.
[0255] In an exemplary embodiment of any or all of these methods, the method further comprises the step of administering to the subject a therapeutically effective amount of an additional anti-cancer agent.
[0256] 16. Use of a compound according to formula IA or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof to reduce N-Myc expression in a cell, comprising treating the cell with a compound according to formula IA or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof. [ka] (In the formula, X 1 , X 2 and X 3 each is independently N or O; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5. with the proviso that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4 -oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine, or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine. Uses are also disclosed that include contacting with an effective amount of the compound.
[0257] Further disclosed is the use of a compound according to any or all of the representative embodiments described herein for Formulas I, II, III, IV and V, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof, for reducing N-Myc expression in a cell, comprising contacting the cell with an effective amount of a compound according to any or all of the representative embodiments described herein for Formulas I, II, III, IV and V.
[0258] 2. Use of a compound according to formula IA or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof for treating or preventing cancer in a subject, wherein the compound has the structure according to formula IA: [ka] (In the formula, X 1 , X 2 and X 3 each is independently N or O; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5. with the proviso that the compound is 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2, not 4-oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine, Uses are also disclosed.
[0259] Also disclosed is the use of a compound according to any or all of the representative embodiments described herein for Formulas I, II, III, IV, and V, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof, for treating or preventing cancer in a subject, wherein the compound has a structure according to any or all of the representative embodiments described herein for Formulas I, II, III, IV, and V.
[0260] 2. Use of a compound according to formula IA, or a stereoisomer, tautomer, or pharma- ceutically acceptable salt or ester thereof, in the manufacture of a medicament for treating or preventing cancer in a subject, wherein the compound has the structure according to formula IA. [ka] (In the formula, X 1 , X 2 and X 3 each is independently N or O; R 1 is - (linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5. with the proviso that the compound is 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidine]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2, not 4-oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazin-3-amine or 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazin-3-amine, Uses are also disclosed.
[0261] Further disclosed is the use of a compound according to any or all of the representative embodiments described herein for Formulas I, II, III, IV and V, or a stereoisomer, tautomer, or a pharma- ceutically acceptable salt or ester thereof, in the manufacture of a medicament for treating or preventing cancer in a subject, wherein the compound has a structure according to any or all of the representative embodiments described herein for Formulas I, II, III, IV and V. EXAMPLES
[0262] VIII. Examples The following examples are provided to illustrate particular features of certain embodiments and should not limit the scope of the claims to those exemplified features.
[0263] material and method Labeled or unlabeled MYCN G4 oligonucleotide (5'-AGG GGG TGG GAG GGG GCA TGC AGA TGC AGG GGG T-3', SEQ ID NO: 7) was purchased from Integrated DNA Technology. Other sequences of DNA / RNA samples used in binding specificity studies are summarized in Figures 1-2:
[0264] Hit compounds for binding validation were purchased from ChemDiv and Chembridge. Analogs of compound MY-1 were synthesized in-house or purchased. RNA extraction kit RNeasy Plus Mini Kit (#74134) was purchased from Qiagen, CA. cDNA synthesis kit High-Capacity RNA-to-cDNA™ Kit (#4387406) was purchased from Life Technologies (Invitrogen), New York. Fast SYBR™ Green Master Mix was purchased from Life Technologies (Invitrogen), NY. Anti-N-Myc (B8.4.B): sc-53993 antibody (1:4000 dilution; Santa Cruz Biotechnology (SCB), USA), anti-GAPDH (0411): sc-47724 antibody (1:2000 dilution; SCB, USA), and goat anti-mouse IgG-HRP: sc-2005 antibody (1:1000 dilution; SCB, USA) were used for immunoblotting.
[0265] General Chemistry Methods. All chemical reagents were obtained from commercial suppliers and used without further purification. In these examples, compounds for SAR studies were purchased from ChemDiv (MY-1, MY-2, MY-3, MY-4, MY-9, MY-10, MY-11, MY-12) or synthesized in the laboratory (MY-5, MY-6, MY-7, MY-8, MY-13, MY-14). Solvents were removed using a Buchi rotary evaporator under reduced pressure. Flash column chromatography was performed using a Teledyne ISCO CombiFlash® Rf automated chromatography system. 1 H and 13 C NMR spectra were recorded on a Bruker spectrometer at 500 MHz or 125 MHz, respectively, and are reported relative to the deuterated solvent signal. 1 H NMR spectral data are reported as follows: chemical shift (δ ppm), multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, quin = quintet, m = multiplet), coupling constants (Hz), and integrals. 13 C NMR spectroscopic data are reported in terms of chemical shifts.
[0266] High-resolution mass spectrometry data were acquired on an Agilent 6520 Accurate-Mass Q-TOF LC / MS System (Agilent Technologies, Inc.) equipped with dual electrospray sources and operated in positive ion mode. Separation was performed on a Zorbax 300SB-C18 Poroshell column (2.1 mm × 150 mm; particle size 5 μm). Analytes were eluted using a water / acetonitrile gradient containing 0.1% formic acid. Data were acquired at high resolution (1,700 m / z) at 4 GHz. To maintain mass accuracy during the run time, internal mass calibration samples were continuously injected during the LC / MS run. Data acquisition and analysis were performed using MassHunter Workstation Data Software, LCMS Data Acquisition (version B.06.01) and Qualitative Analysis (version B.07.00).
[0267] Small Molecule Microarray Screening. Small molecule microarrays (SMMs) were fabricated on 2D epoxy glass slides (Schott). Briefly, approximately 15,000 compounds (10 mM in DMSO) from the ChemDiv and Chembridge libraries, as well as control dyes (Alexa Fluor 647 and 488, 10 μM in DMSO) were prepared in a 384-well plate (Arrayjet Jetstar™). Each of the compounds was printed in duplicate blocks by an Arrayjet robotic microarray printer. After printing, the slides were incubated overnight in an arrayer for immobilization, followed by vacuum drying for 24 hours. To quench unreacted epoxy groups, the slides were incubated in 1 M aqueous ethanolamine (pH 8.5) for 2 hours, then incubated in DMF and ddH 2 Rinse thoroughly with O, then with N 2 Drying was carried out.
[0268] To begin screening against the target of interest, 5'Cy5-labeled MYCN G4 DNA samples were first prepared at 10 μM concentration in annealing buffer (10 mM Tris, pH 7.0, 100 mM KCl). The DNA samples were incubated at 95°C for 5 min in a heating block and then slowly cooled to room temperature over a period of more than 1 h. The folded DNA was then diluted into screening buffer (10 mM Tris, pH 7.0, 100 mM KCl, 0.005% Tween 20) to correspond to a final concentration of 50 nM. The SMM slides were placed in a 4-well slide holder and incubated with 3 mL of 10x tRNA (500 nM in screening buffer) for 2 h. The slides were then carefully washed with screening buffer and incubated with 3 mL of MYCN G4 DNA solution (containing 10x tRNA) for an additional 2 h. After incubation, the slides were transferred to a 50 mL conical tube and diluted with PBST and ddH 2The slides were gently washed in each buffer solution with 0.0 x 3 times. The slides were then dried by centrifugation at 1,700g for 2 min. Finally, the slides with SMM were imaged by a fluorescent scanner (InnoScan 1100 AL) at 647 nm with a resolution of 5 μm. The fluorescence intensity of each spot was quantified by Innopsys Mapix software, and hits were identified based on previously reported criteria (Connelly et al., ACS Chemical Biology 2017, 12:435-443; Connelly et al., Nature Communications 2019, 10:1501). To identify hits, another slide incubated only with the screening buffer was also tested and imaged as a negative control using the same method.
[0269] Fluorescence Intensity Assay. In this disclosure, Fluorescence Intensity Assay (FIA) was used for both validation of hit binding at single dose and binding affinity determination. To validate hit compounds from SMM screening, 100 μM solutions of each compound were prepared in triplicate in 96-well plates (Costar, black-walled clear bottom), thereby obtaining a 5% DMSO concentration. 5'Cy5-labeled MYCN G4 DNA was annealed as described above and then added to the well plates, thereby obtaining a final concentration of 100 nM. The plates were incubated with shaking for 30 minutes, followed by centrifugation at 500 rpm for 2 minutes. Fluorescence intensity was then measured at Ex 649 nm / Em 670 nm by a Synergy Mx microplate reader (BioTek). TMPyP4 / DMSO was used as positive and negative controls, respectively. In certain instances, compounds were considered as binders if a change was observed that was >10% change in fluorescence intensity compared to the negative control (DMSO solution). For binding affinity measurements, small molecule solutions were prepared as serial dilutions in DMSO. Final test plates were then prepared by adding 5 μL of small molecule solution and 10 μL of annealed DNA sample to 85 μL of buffer solution, thereby giving final small molecule concentrations of 0-250 μM (5% final DMSO concentration). Fluorescence intensities were normalized and binding affinities were calculated by curve fitting using the one-site total model in GraphPad Prism 8.3.1 software. Fluorescence titrations using 3'-labeled oligonucleotides were performed in the same manner.
[0270] Fluorescence displacement assay. Fluorescence displacement assay was performed by using two classical minor groove binders (Hoechst 33258 and netropsin). Hoechst 33258 as fluorophore was prepared at 5 μM concentration in buffer (10 mM Tris, pH 7.0, 100 mM KCl) and then titrated with different concentrations of unlabeled MYCN G4 oligonucleotide. For displacement, either compound MY-1 or netropsin was added to the solution, thereby obtaining a final concentration of 5 μM or 50 μM. Fluorescence signal was obtained at an excitation wavelength of 352 nm and an emission wavelength of 500 nm.
[0271] Surface Plasmon Resonance (SPR) Analysis. SPR binding assays were performed using a BIAcore 3000 (GE Healthcare) instrument. A CM5 SPR biochip was loaded into the system and primed with running buffer (10 mM Tris, pH 7.0, 100 mM KCl, 0.005% Tween 20, 5% DMSO) at a flow rate of 5 μL / min. Both flow cells (Fc) 1 and 2 were then activated with EDC / NHS (0.4M / 0.1M) aqueous solution for 15 min, followed by injection of streptavidin (SA) solution (0.2 mg / mL in 10 mM sodium acetate buffer, pH 4.5) for 30 min. After the immobilized amount of SA reached 8,000-10,000RU, the surface was inactivated by flowing 1M ethanolamine aqueous solution (pH 8.5) for 10 min and regenerated with 10 mM NaOH for 2 min to remove unbound SA. Meanwhile, biotinylated MYCN G4 DNA was prepared at 5 μM in annealing buffer, heated to 95 °C for 5 min, and cooled slowly. After annealing, a total of 150 μL of the solution was injected into Fc 2 of the SPR system for 30 min to immobilize the DNA on the chip surface. Once the baseline was stabilized, the small molecule solution was tested.
[0272] A faster flow rate (25 μL / min) was used for both Fc 1 (reference) and Fc 2 (DNA) to detect binding affinity as well as binding signal. Each of the compound solutions was prepared at 20× design concentration in DMSO and then diluted in non-DMSO running buffer, thereby obtaining a final concentration of 5% DMSO. A total of 50 μL of compound solution was then injected into the Fc 1-2 flow channel for 120 s for association, followed by 200 s of buffer flow for dissociation. An injection of 50 μL of regeneration buffer (1 M KCl) could be performed between the two samples if necessary. The final binding curve was obtained by subtracting the reference. Binding affinity (K DTo determine the K, a series of diluted compound solutions were injected and the K was calculated using the Langmuir 1:1 binding model by BIAevaluation 4.0 software (GE Healthcare). D was calculated.
[0273] Circular dichroism (CD) characterization and thermal melting assay. The folded G-quadruplex structure was characterized by circular dichroism using a J-1500 circular dichroism spectrometer (Jasco). Unlabeled MYCN oligonucleotide (5'-AGG GGG TGG GAG GGG GCA TGC AGA TGC AGG GGG T-3', SEQ ID NO: 7) was prepared at 5 μM concentration in annealing buffer (10 mM Tris, pH 7.0, 100 mM KCl). As a contrast, Li + Containing buffer (10 mM Tris, pH 7.0, 100 mM LiCl) and H 2 A DNA sample diluted with O was also used as a negative control. The annealing procedure was the same as described above. CD spectra were recorded from 320 nm to 200 nm at 25 °C in steps of 1 nm. Each spectrum was obtained by averaging the signals of three replicate samples.
[0274] For thermal melting assays, MYCN oligonucleotides were prepared at 5 μM concentration in low KCl buffer (10 mM Tris, pH 7.0, 5 mM KCl). To test the stabilizing effect, G4 samples were incubated with and without 20 μM of compound (final solution containing 5% DMSO). A total of 300 μL of solution was then added to a cuvette and heated from 20° C. to 95° C. at 1° C. intervals in a CD spectrometer. To calculate the melting temperature (Tm), the peak of the CD spectrum at 263 nm was tracked and the ellipsometry plotted against temperature and fitted using a nonlinear sigmoidal dose-response model with variable slope in GraphPad Prism 8 software. The shift in melting temperature (ΔT m ) to T m (compound)-T m Calculations were performed using (DMSO).
[0275] 2-Aminopurine (2-AP) Fluorescence Titration. Fluorescence titration based on 2-aminopurine labeling was performed using a previously reported protocol. Briefly, MYCN G4 oligonucleotides with 2-AP substitutions at either A11 or A18 positions were annealed by heating the samples to 95 °C for 5 min and slow cooling to RT. Oligonucleotides with folded structures were diluted to 10 μM in Tris buffer (10 mM Tris, pH 7.0, 100 mM KCl, 0.005% Tween 20) and prepared as designed in triplicate in black 96-well plates (Costar). Small molecules were diluted in DMSO to obtain a series of solutions with concentrations ranging from 0.1 to 5 mM, then diluted 20-fold and added to the plate (5% DMSO final concentration). The final concentration of 2-AP DNA in the well plate was 1 μM. Small molecule solutions without DNA were also prepared in the same plate to obtain background fluorescence. After 30 min incubation at RT, plates were briefly centrifuged and scanned at Ex 310 nm / Em 365 nm in a Synergy Mx microplate reader (BioTek). Fluorescence signals were calculated by averaging the intensities in triplicate wells after reference subtraction. Finally, binding signals were normalized and K was calculated by curve fitting using a nonlinear sigmoidal dose-response model with variable slope in GraphPad Prism 8.3.1 software. D value was determined.
[0276] Job plot analysis. To determine the stoichiometry of binding, a continuous change method was used by varying the fraction of compound in solution (Renny et al., Angewandte Chemie 2013, 52:11998-12013). Briefly, 5 μM annealed A11 2-AP labeled MYCN G4 DNA sample and 5 μM stock solution of compound (containing 5% DMSO) were prepared, respectively. Then, two series of solutions were prepared in 96-well black-walled well plates for the experiment: one changed the fraction of small molecule by mixing DNA sample with compound stock while keeping the total concentration constant (5 μM), and the other changed the concentration of DNA sample by diluting with buffer, thereby obtaining the trace of the sample as a reference. After scanning, the difference in fluorescence intensity between the two series of solutions was calculated to generate a Job plot. Then, linear regression analysis was performed using GraphPad Prism 8.3.1 software.
[0277] Microscale Thermophoresis (MST). MST experiments were performed by a Monolith NT.115 system (NanoTemper Technologies). 3'-Cy5 MYCN G4 DNA solutions were prepared in 10 mM Tris (pH 7.5), 100 mM KCl, 0.005% T20, annealed (as described above), and diluted to 100 nM (2x). DMSO solutions of small molecules were prepared by stepwise 1:1 dilution in buffer, thereby obtaining 2x the design concentration (10% DMSO). DNA samples were then mixed 1:1 (v / v) with the corresponding small molecule solutions, thereby obtaining 50 nM DNA and 5% DMSO. Finally, MST signals were detected in triplicate capillaries, and dissociation constants were determined by curve fitting using a single-site model (MO.Affinity Analysis v2.3).
[0278] DMS footprinting. Footprinting of 5'Cy5-labeled DNA was performed as described in the literature (Zhang et al., JACS 2014, 136:1381-1390; Li et al., PNAS 2015, 112:14581-14586). MYCN G4 DNA samples were prepared at 5 μM concentration in the appropriate buffer (10 mM Tris, pH 7.0, 5 mM KCl, 0.005% T20) and then annealed using the method described above. The DNA solution was then diluted to 50 nM in the corresponding buffer (final volume of 2 mL in each tube) and compound stock solutions (in DMSO) were added, thereby obtaining solutions with the designed concentrations (resulting in 5% DMSO). After 30 min of incubation, the folded DNA samples were treated with 0.5% DMS for 10 min at RT and 200 μL of stop buffer (2.5 M NH 4 The reaction was stopped by adding 0.01 M β-mercaptoethanol, 0.1 M OAc, 0.1 M β-mercaptoethanol, 1 mg / mL calf thymus DNA). After phenol / chloroform / isoamyl alcohol extraction and ethanol precipitation, the DNA was dissolved in 50 μL of nuclease-free water. The same volume of 10% piperidine was added to each tube, and the mixed solution was heated at 90°C for 30 min, followed by quick cooling on ice. The DNA was again subjected to phenol / chloroform / isoamyl alcohol extraction and ethanol precipitation. The precipitated DNA was dissolved in 10 μL of nuclease-free water, denatured at 95°C for 5 min, and resolved on a 17% denaturing polyacrylamide gel. After gel electrophoresis, Cy5-labeled DNA fragments were visualized by a Typhoon Imager (Amersham) and digitized using Image J software.
[0279] Cell lines and cell culture. The neuroblastoma cell line NBEB (Single Copy MYCN) cells were used to evaluate the efficacy of MYCN / MYCNOs G-quadruplex binding molecules. NBEB were from stock at the National Institutes of Health, National Cancer Institute, Division of Pediatric Oncology, Bethesda, MD, and were STS-validated. Cells were cultured at 4°C for 24 h at 5% CO 2The cells were cultured in RPMI-1640 supplemented with 10% FBS (Atlanta Biologicals, Atlanta), 2 mM glutamine (Life Technologies, New York), and antibiotics (penicillin 100 μg / mL, streptomycin 100 μg / mL; Life Technologies, New York) at 37°C in an incubator.
[0280] To investigate the effect of G4-binding compounds on NBEB cells, live cell imaging was performed using an Incucyte interface (described below). For NBEB (5K / well), cells were seeded in triplicate in 96-well plates and treated with various concentrations (0–45 μM) of compound MY-8 and cultured until control wells reached confluence. For RT-qPCR and Western blotting, NBEB (300K) cells were treated with MY-8 for 48 h in 6-well dishes. To investigate the time-dependent decrease in MYCNOs expression, cells were treated with 22.5 μM and 45 μM MY-8 and analyzed at various time points (0, 4, 24, 48, 72, and 96 h). To verify cell viability, trypan blue exclusion test was performed 48 and 96 h after treatment and the percentage of live to dead cells was calculated using a hemocytometer.
[0281] Cell viability. After live cell image analysis, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium inner salt assay was performed to examine cell viability. (MTS: inner salt assay; Promega, America). The absorbance was measured at a wavelength of 490 nm using a microplate reader (BIO-RAD, America). To calculate the percentage of viable cells, MY-8-treated cells were divided by the control samples from each group.
[0282] Incucyte Live-cell Imaging System. Live-cell imaging was performed using the Incucyte Zoom Live-cell Imaging System from Essen Bioscience (Ann Arbor, MI, USA). Incucyte measured cell confluency based on predefined processing definitions for NBEB NB cells. The Incucyte Zoom Live-cell Imaging System scanned three phase-contrast images per well every 6 h for the duration of treatment (0–120 h).
[0283] Quantitative RT-PCR. Total RNA was extracted from NBEB cells according to the manufacturer's instructions (RNeasy Plus Mini Extraction kit (#74134) (Qiagen, CA). RNA (1 μg) was reverse transcribed into cDNA using the cDNA synthesis High-Capacity RNA-to-cDNA™ Kit. Quantitative PCR was performed using Fast SYBR™ Green Master Mix according to the manufacturer's protocol. Beta-actin was used as a housekeeping gene. 2(-ΔC t Relative expression was calculated using the qPCR primer sequences in the Supplementary Material.
[0284] Protein assay. After 48 h of MY-8 treatment in 6-well plates, single copy MYCN cells were directly lysed in the plate with radioimmunoprecipitation assay buffer (Beyotime, China), pelleted, and chilled at -80°C. Due to poor cell adhesion, NBEB cells were collected in 1.5 mL microcentrifuge tubes, washed twice with phosphate buffer solution (Sigma-Aldrich, USA), pelleted, and chilled at -80°C. Total protein concentration was determined using the Bradford assay using Bradford reagent (Beyotime, China). Each protein sample (10 μg) was loaded onto a 12% gel (Bio-Rad, USA), electrophoresed at 90 V for 90 min, and transferred to a nitrocellulose membrane (Immobilon-P, Millipore, Bedford, MA, USA) using the Bio Rad Trans-Blot Turbo Transfer System (Bio-Rad, USA). Nitrocellulose membranes were incubated in 5% milk in Tris-buffered saline supplemented with 0.5% Tween 20 for 1 h at room temperature and incubated with anti-N-Myc: sc-53993 (1:4000) and anti-GAPDH: sc-47724 (1:2000) antibodies overnight at 4°C. After incubation, the membranes were washed with Tris-buffered saline supplemented with 0.5% Tween 20 and probed with goat anti-mouse (1:1000) antibody conjugated to peroxidase and incubated for 1 h at room temperature. Chemiluminescent signals were detected using Clarity™ Western ECL Substrate (Bio-Rad, USA) or Supersignal™ West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific, USA) with a ChemiDoc gel imaging system (Bio-Rad, USA).
[0285] Bioinformatics studies. Two files (file names "Na_K_PDS_minus_hits_intersect.bed.gz" and "Na_K_PDS_plus_hits_intersect.bed.gz") for experimental G4 data were downloaded from Gene Expression Omnibus (GSE63874) (1). Genomic sequences in bed files were extracted from the GRCh37 (hg19) reference genome using getfasta from bedtools (bedtools 2.30.0) (2). For the "Na_K_PDS_plus_hits_intersect.bed" position, the complementary strand sequence was extracted due to the G4 sequence present on the minus strand of the genome assembly. The regular expression formula from the extracted unique OQ: ((G 3~6 (N 1~33 ) 3 G 3~6 ) was used to identify G4-forming sequences.
[0286] The probability of hairpin-forming loops in G4 sequences was then calculated. UNAFold 4.0 was used to calculate hairpin formation from sequences flanking two G tracts of 3 nt in length in G4s. UNAFold was run using the "hybrid-ss-min --NA DNA" setting to output the probability of each nt position forming a single strand according to DNA energy laws at 37°C (3). Sequences in which more than 50% of their nucleotides are base-paired were identified as hairpin-forming sequences. Hairpin-forming G4s were then identified and traced back to the OQs from which they were extracted. The coordinates of the G4 hairpin-containing OQs were then calculated using the UCSC The Lift Genome Annotations tool (liftOver) (4) was used to convert to GRCh38 (hg38) coordinates.
[0287] The resulting hg38 coordinates were annotated with GENCODE, hg38 version 36 global gene annotation GFF3 file (5). Promoters were also added to the annotation by defining them as the region 1000 nt upstream of the TSS site of the GENCODE gene. Introns were also added to the GENCODE annotation using the Genome Tools package (genometools 1.6.1) “gt gff3-addintrons” command (6). Overlap of genomic features and GQ-hairpin containing OQs was identified using the bedtools intersect command. Python 3.8 was used for computational operations that were not performed by the mentioned software packages.
[0288] qPCR Experiments. Primer sequences for qPCR experiments are listed as follows: MYCNOs-01(ENST00000641263.1-1,313,bps) Sense 5'-AGGCTCAGTCTCCCTCACTA 3', SEQ ID NO: 10 Antisense 5'TTCTGGAGGCTGAGAAGTCC3', SEQ ID NO: 11 MYCNOs-02(ENST00000419083.5-770bps) Sense 5'CTCACGAGCACGCAGACAAC 3', SEQ ID NO: 12 Antisense 5'TCCCAGCTTTGCAGCCTTCT 3', SEQ ID NO: 13 MYCN protein isoform 1 (ENST00000281043.4-464AA) Sense 5'GATCTGCAAGAACCCAGACC 3', SEQ ID NO: 14 Antisense 5'CACAGCTCGTTCTCAAGCAG 3', SEQ ID NO: 15 MYCN protein isoform 2 (ENST00000638417.1-253AA) Sense 5'TCCTGGGAACTGTGTTGGA 3', SEQ ID NO: 16 Antisense 5'CACAGTGACCACGTCGATTT 3', SEQ ID NO: 17
[0289] Compound synthesis - Monovalent compounds [ka]
[0290] To a reaction flask were added 6-hydroxypyridazine-3-carboxylic acid (392 mg, 2.80 mmol), EDC·HCl (589 mg, 3.08 mmol), Oxyma Pure (438 mg, 3.08 mmol) and DMF (8 mL). The reaction was stirred at room temperature for 10 min followed by the addition of 4-methoxybenzamide oxime (605 mg, 3.64 mmol). The reaction mixture was then heated to 120 °C and stirred. After 3 h, the reaction mixture was filtered and washed with DMF (3 mL × 3). The filtrate was collected and dried to give the target product P1 (344 mg, 46%). 1 H NMR (500 MHz, DMSO-d 6 ): δ 13.85 (s, 1H), 8.08 (d, J = 9.9 Hz, 1H), 8.04-8.01 (m, 2H), 7.17-7.14 (m, 1H), 7.12 (d, J = 9.9 Hz, 1H), 3.85 (s, 3H); 13 C NMR (125 MHz, DMSO-d 6 ): δ 171.2, 167.9, 162.0, 160.3, 132.4, 131.9, 130.4, 128.9, 118.0, 114.8, 55,5;HRMS:(ESI+)C 13 H 11 N 4 O 3 [M+H] + Calculated m / z: 271.0826, measured value: 271.0833.
[0291] POCl 3 A solution of P1 (970 mg, 3.59 mmol) in (6 mL) was heated to 100 °C and stirred for 4 h. The reaction crude was poured onto ice-cold water and neutralized with 10% NaOH solution. The mixture was then extracted with EtOAc (10 mL x 3) and washed with brine. The combined organic layers were washed with MgSO 4The resulting residue was purified by ISCO flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded P2 (246 mg, 72%) as a pale pink solid. 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.57 (d, J = 8.9 Hz, 1H), 8.26 (d, J = 8.9 Hz, 1H), 8.09-8.06 (m, 2H), 7.19-7.16 (m, 2H), 3.87 (s, 3H); 13 C NMR (125 MHz, DMSO-d 6 ) δ 172.0, 168.3, 162.1, 158.4, 147.1, 130.4, 130.2, 129.0, 117.8, 114,9, 55.5;HRMS:(ESI+)C 13 H 10 35 ClN 4 O 2 [M+H] + Calculated m / z: 289.0487, measured value: 289.0493.
[0292] P2 (20 mg, 0.07 mmol) and 3-(4-methylpiperazin-1-yl)propan-1-amine (22 mg, 0.14 mmol) in EtOH (3 mL) with NH 4 A mixture of Cl (4 mg, 0.07 mmol) was heated to 80 °C and stirred overnight. The reaction mixture was concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded MY-5 (13 mg, 45%) as a white solid. 1 H NMR (500 MHz, DMSO-d 6) δ 8.04-8.01 (m, 2H), 7.98 (d, J = 9.3 Hz, 1H), 7.83 (s, 1H), 7.16-7.13 (m, 2H), 6.98 (d, J = 9.3 Hz, 1H), 3.85 (s, 3H), 3.50-3.43 (m, 2H), 2.56-2.25 (m, 10H), 2.19 (s, 3H), 1.77 (quintet, J = 7.0 Hz, 2H); 13 C NMR (125 MHz, DMSO-d 6 ) δ 173.4, 167.7, 161.8, 159.4, 138.3, 128.8, 127.4, 118.4, 114.7, 55.5, 55.3, 54.6, 52.4, 45.5, 25.7;HRMS:(ESI+)C 21 H 28 N 7 O 2 [M+H] + Calculated m / z: 410.2299, measured: 410.2305.
[0293] P2 (30 mg, 0.10 mmol) and N,N'-dimethylethylenediamine (18 mg, 0.20 mmol) in EtOH (3 mL) with NH 4 A mixture of Cl (5 mg, 0.10 mmol) was heated to 80° C. and stirred overnight. The reaction mixture was concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded MY-6 (15 mg, 44%) as a white solid. 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.17-8.14 (m, 1H), 8.05-8.03 (m, 2H), 7.35-7.32 (m, 1H), 7.17-7.14 (m, 2H), 4.08 (t, J = 6.4 Hz, 2H), 3.86 (s, 3H), 3.24-3.20 (m, 5H), 2.59-2.58 (m, 3H); 13 C NMR (125 MHz, DMSO-d 6) δ 173.3, 167.8, 161.9, 159.6, 138.2, 128.8, 127.8, 118.3, 114.7, 111.8, 55.5, 46.1, 46.0, 36.5, 33.0;HRMS:(ESI+)C 17 H 21 N 6 O 2 [M+H] + Calculated m / z: 341.1721, measured: 341.1725.
[0294] P2 (20 mg, 0.07 mmol) and 3-aminopropanamide hydrochloride (17 mg, 0.14 mmol) in EtOH (3 mL) 2 CO 3 (37 mg, 0.28 mmol) was heated to 80° C. and stirred overnight. The reaction mixture was concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded MY-7 (12 mg, 50%) as a white solid. 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.04-8.01 (m, 2H), 7.99 (d, J = 9.6 Hz, 1H), 7.84 (t, J = 5.9 Hz, 1H), 7.39 (s, 1H), 7.16-7.13 (m, 2H), 7.01 (d, J = 9.6 Hz, 1H), 6.88 (s, 1H), 3.85 (s, 3H), 3.68-3.66 (m, 2H), 2.45 (t, J = 6.7 Hz, 2H); 13 C NMR (125 MHz, DMSO-d 6 ) δ 173.4, 172.5, 167.7, 161.8, 159.2, 138.4, 128.8, 127.4, 118.4, 114.7, 55.4, 37.3, 34.3;HRMS:(ESI+)C 16 H 17 N 6 O 3 [M+H] +Calculated m / z: 341.1357, measured: 341.1359.
[0295] Dissolve 2 (32.91 mg, 0.11 mmol) and 3-(1-azepanyl)-1-propanamine (36 mg, 0.23 mmol) in EtOH (3 mL) and NH 4 A mixture of Cl (6 mg, 0.11 mmol) was heated to 80° C. and stirred overnight. The reaction mixture was concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded MY-8 (31 mg, 66%) as a white solid. 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.04-7.99 (m, 4H), 7.16-7.14 (m, 2H), 7.04 (d, J = 9.5 Hz, 1H), 3.85 (s, 3H), 3.55-3.54 (m, 2H), 3.15-3.07 (m, 6H), 2.08-2.00 (m, 2H), 1.83-1.77 (m, 4H), 1.67-1.57 (m, 4H); 13 C NMR (125 MHz, DMSO-d 6 ) δ 173.3, 167.8, 161.8, 159.5, 138.6, 128.8, 127.5, 118.4, 114.7, 55.5, 54.4, 53.8, 38.3, 26.0, 23.7, 23.3;HRMS:(ESI+)C 22 H 29 N 6 O 2 [M+H] + Calculated m / z: 409.2347, Found: 409.2354. MY-8 (5 mg) was then stirred in TFA (1 mL) for 30 min to give the corresponding TFA salt.
[0296] Dissolve 2 (30 mg, 0.10 mmol) and 2-morpholinoethane-1-amine (14 mg, 0.20 mmol) in EtOH (3 mL) and NH 4A mixture of Cl (5 mg, 0.10 mmol) was heated to 80° C. and stirred overnight. The reaction mixture was concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded MY-13 (22.5 mg, 59%) as a white solid. 1 H NMR (500 MHz, DMSO-d 6 ) δ 8.05-8.02 (m, 2H), 7.99 (d, J = 9.3 Hz, 1H), 7.70 (t, J = 5.5 Hz, 1H), 7.17-7.14 (m, 2H), 7.04 (d, J = 9.4 Hz, 1H), 3.85 (s, 3H), 3.61-3.58 (m, 6H), 2.56 (t, J = 6.6 Hz, 2H), 2.46-2.44 (m, 4H); 13 C NMR (125 MHz, DMSO-d 6 ) δ 173.4, 167.7, 161.8, 138.4, 128.8, 127.4, 118.4, 114.7, 66.2, 56.9, 55.4, 53.4, 38.0;HRMS:(ESI+)C 19 H 23 N 6 O 3 [M+H] + Calculated m / z: 383.1826, measured: 383.1831.
[0297] Dissolve 2 (20 mg, 0.07 mmol) and 2-(4-methylpiperazin-1-yl)ethan-1-amine (20 mg, 0.14 mmol) in EtOH (3 mL) and NH 4 A mixture of Cl (4 mg, 0.07 mmol) was heated to 80 °C and stirred overnight. The reaction mixture was concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography (CH 2 Cl 2 Purification by elution with 0-25% MeOH in water afforded MY-14 (16 mg, 58%) as a white solid. 1 H NMR (500 MHz, DMSO-d 6) δ 8.04-8.02 (m, 2H), 7.99 (d, J = 9.5 Hz, 1H), 7.68 (t, J = 5.3 Hz, 1H), 7.16-7.14 (m, 2H), 7.03 (d, J = 9.5 Hz, 1H), 3.85 (s, 3H), 3.62-3.56 (m, 2H), 2.56 (t, J = 6.7 Hz, 2H), 2.46-2.26 (m, 8H), 2.17 (s, 3H); 13 C NMR (125 MHz, DMSO-d 6 ) δ 173.4, 167.7, 161.8, 138.4, 128.8, 127.4, 118.4, 114.7, 56.4, 55.4, 54.6, 52.6, 38.3;HRMS:(ESI+)C 20 H 26 N 7 O 2 [M+H] + Calculated m / z: 396.2142, measured: 396.2141.
[0298] Compound synthesis - Bivalent compounds The divalent compounds disclosed herein were made according to Scheme 5 below. [ka]
[0299] R for divalent compounds 1 The group (designated "R" in Scheme 5 above) was made as shown in Scheme 6 below and then combined with compound 7 in Scheme 5 also using the conditions below. [ka]
[0300] N 1 -(6-chloro-2-methoxyacridin-9-yl)ethane-1,2-diamine (1): 6,9-Dichloro-2-methoxycridine (99.2 mg, 0.357 mmol, 1 equiv), phenol (33.6 mg, 0.357 mmol, 1 equiv) and 1,2-diaminoethane (214 mg, 3.57 mmol, 10 equiv) were combined in a sealed vial and heated at 110 °C for 8 h in the dark. Once complete by LCMS, the reaction was allowed to cool to room temperature, poured onto Celite and concentrated. The reaction mixture was purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as a modifier)) to give 66.3 mg (62%) of 1 as a yellow solid: 1 H NMR (500 MHz, CD 3 OD) δ 8.47 (dd, J = 9.5, 2.6 Hz, 1H), 7.86 (q, J = 2.9, 2.4 Hz, 2H), 7.81 (dd, J = 9.3, 2.0 Hz, 1H), 7.74 - 7.67 (m, 1H), 7.54 (dt, J = 9.3, 2.1 Hz, 1H), 4.52 (t, J = 6.2 Hz, 2H), 4.03 (d, J = 2.0 Hz, 3H), 3.58 (t, J = 6.1 Hz, 2H); 13 C NMR (126 MHz, CD 3 OD) δ 158.72, 158.55, 142.20, 141.78, 136.27, 129.37, 129.19, 125.48, 121.60, 118.79, 116.08, 111.61, 103.92, 56.75, 47.44, 39.78;LRMS:C 16 H 16 ClN 3 O + m / z calculated for [M+H]+: 301.09, LC / MS (ESI): R t 1.18 min, m / z measured value 302.20 [M+H] + . [ka]
[0301] N 1-(6-chloro-2-methoxyacridin-9-yl)propane-1,3-diamine (2): 6,9-Dichloro-2-methoxyacridine (200 mg, 0.719 mmol, 1 equiv), phenol (67.7 mg, 0.719 mmol, 1 equiv) and 1,3-diaminopropane (533 mg, 7.19 mmol, 10 equiv) were combined in a sealed vial and heated at 110 °C for 8 h in the dark. Once complete by LCMS, the reaction was allowed to cool to room temperature, poured onto Celite and concentrated. The reaction mixture was purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as a modifier)) to give 125 mg (57%) of 2 as a yellow solid: 1 H NMR (500 MHz, CD 3 OD) δ 8.47 (dd, J = 9.5, 3.0 Hz, 1H), 7.82 (dd, J = 9.8, 2.4 Hz, 2H), 7.77 (dd, J = 9.1, 3.1 Hz, 1H), 7.66 (dd, J = 9.2, 2.6 Hz, 1H), 7.50 (dt, J = 9.4, 2.2 Hz, 1H), 4.27 (t, J = 7.0 Hz, 2H), 4.00 (d, J = 4.2 Hz, 2H), 3.13 (t, J = 7.6 Hz, 2H), 2.38 - 2.31 (m, 2H); 13 C NMR (125 MHz, CD 3 OD) δ 158.47, 158.33, 142.05, 141.73, 136.08, 129.34, 128.99, 125.29, 121.59, 118.67, 115.88, 111.59, 103.86, 56.71, 47.30, 38.11, 28.66;LRMS:C 17 H 18 ClN 3 O + m / z calculated for [M+H]+: 315.11, LC / MS (ESI): R t 1.17 min, m / z measured value 316.20 [M+H] + . [ka]
[0302] N 1 -(6-chloro-2-methoxyacridin-9-yl)butane-1,4-diamine (3): 6,9-Dichloro-2-methoxyacridine (250 mg, 0.899 mmol, 1 equiv), phenol (84.6 mg, 0.889 mmol, 1 equiv) and 1,4-diaminobutane (792 mg, 8.99 mmol, 10 equiv) were combined in a sealed vial and heated at 110 °C for 8 h in the dark. Once complete by LCMS, the reaction was allowed to cool to room temperature, poured onto Celite and concentrated. The reaction mixture was purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as a modifier)) to give 424 mg (85%) of 3 as an orange-yellow solid: 1 H NMR (500 MHz, CD3OD) δ 8.20 (dd, J = 9.4, 2.5 Hz, 1H), 7.80 (t, J = 2.0 Hz, 1H), 7.78 - 7.75 (m, 1H), 7.46 (d, J = 2.7 Hz, 1H), 7.39 (dt, J = 9.3, 2.2 Hz, 1H), 7.25 (dt, J = 9.3, 2.1 Hz, 1H), 3.95 (s, 3H), 3.83 (t, J = 7.1 Hz, 2H), 2.83 (dd, J = 8.9, 6.0 Hz, 2H), 1.83 (p, J = 8.4, 7.6 Hz, 2H), 1.70 - 1.62 (m, 2H);LRMS:C 18 H 20 ClN 3 O + m / z calculated for [M+H]+ 329.13, LC / MS (ESI): R t 1.56 min, m / z measured value 330.25 [M+H] + . [ka]
[0303] N-(2-(2-aminoethoxy)ethyl)-6-chloro-2-methoxyacridin-9-amine (4): 6,9-Dichloro-2-methoxyacridine (250 mg, 0.899 mmol, 1 equiv), phenol (84.6 mg, 0.889 mmol, 1 equiv) and 2,2'-oxybis(ethan-1-amine) (936 mg, 8.99 mmol, 10 equiv) were combined in a sealed vial and heated at 110 °C for 8 h in the dark. Once complete by LCMS, the reaction was allowed to cool to room temperature, poured onto Celite and concentrated. The reaction mixture was purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as a modifier)) to give 441 mg (86%) of 4 as a yellow solid: 1 H NMR (500 MHz, CD 3 OD) δ 8.15 (d, J = 9.4 Hz, 1H), 7.80 (s, 1H), 7.78 (d, J = 9.3 Hz, 1H), 7.38 (s, 2H), 7.33 (d, J = 9.0 Hz, 1H), 7.21 (d, J = 9.3 Hz, 1H), 3.91 (s, 3H), 3.85 (t, J = 5.1 Hz, 2H), 3.63 (m, 2H), 3.43 (m, 2H), 2.70 (m, 2H); 13 C NMR (126 MHz, CD 3 OD) δ 155.89, 151.58, 147.51, 145.60, 134.99, 129.02, 125.70, 125.37, 124.81, 123.31, 117.87, 115.40, 99.69, 71.75, 70.15, 54.76, 49.38, 40.63;LRMS:C 18 H 20 ClN 3 O 2 + m / z calculated for [M+H]+: 345.12, LC / MS (ESI): R t 1.74 min, m / z measured value 346.25 [M+H] + . [ka]
[0304] N-(2-(2-(2-aminoethoxy)ethoxy)ethyl)-6-chloro-2-methoxyacridin-9-amine (5): 6,9-Dichloro-2-methoxyacridine (250 mg, 0.899 mmol, 1 equiv), phenol (84.6 mg, 0.889 mmol, 1 equiv) and 2,2'-(ethane-1,2-diylbis(oxy))bis(ethan-1-amine) (1.33 g, 8.99 mmol, 10 equiv) were combined in a sealed vial and heated at 110 °C for 8 h in the dark. Once complete by LCMS, the reaction was allowed to cool to room temperature, poured onto Celite and concentrated. The reaction mixture was purified by reverse phase flash chromatography (0–100% acetonitrile / (10 mM NH as modifier) for 1 h). 4 Purification by elution with water containing OH) afforded 200 mg (57%) of 5 as a yellow solid: 1 H NMR (500 MHz, DMSO-D6) δ 8.37 (d, J = 9.2 Hz, 1H), 7.86 (s, 1H), 7.63 (d, J = 2.7 Hz, 1H), 7.41 (d, J = 9.3 Hz, 1H), 7.34 (d, J = 10.5 Hz, 1H), 6.78 - 6.55 (m, 1H), 3.93 (s, 3H), 3.86 (d, J = 7.9 Hz, 2H), 3.68 (t, J = 5.6 Hz, 2H), 3.49 (dd, J = 5.7, 3.9 Hz, 2H), 3.40 (dd, J = 5.9, 3.9Hz, 2H), 3.25 (t, J = 5.8 Hz, 2H), 2.56 (t, J = 5.8 Hz, 2H); 13 C NMR (126 MHz, DMSO-D6) δ 155.15, 150.62, 147.98, 146.23, 133.44, 130.81, 127.23, 126.34, 126.18, 117.69, 115.38, 100.54, 73.06, 69.79, 69.50, 55.59, 41.28. [ka]
[0305] 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-ol (6): To a solution of 6-hydroxypyridazine-3-carboxylic acid (1.50 g, 11 mmol, 1 equiv.) in DMF (48 mL) was added triethylamine (3.0 mL, 21 mmol, 2 equiv.), HOBt (1.60 g, 11 mmol, 1 equiv.) and EDC·HCl (2.40 g, 11 mmol, 1 equiv.). The solution was allowed to stir at room temperature for 30 min before adding N'-hydroxy-4-methoxybenzimidamide (1.80 g, 11 mmol, 1 equiv.). The reaction was maintained at room temperature for 1 h and then heated and maintained at 150° C. for 1 h or until judged complete by TLC. The solution was allowed to cool to room temperature, at which stage the product precipitated out of solution. Water (approximately 300 mL) was added and the solid was triturated at room temperature for 30 min. The product was isolated by vacuum filtration and dried in vacuo to give 1.84 g of 6 (64%) as a white solid: 1 H NMR (500 MHz, DMSO-D6) δ 13.85 (s, 1H, D 2 exchanged by 13 C NMR (125 MHz, DMSO-D6) δ 171.2, 167.9, 162.0, 160.3, 132.3, 131.8, 130.4, 128.9, 117.9, 114.8, 55.4. NMR data are consistent with literature values. [1] [ka]
[0306] 5-(6-chloropyridazin-3-yl)-3-(4-methoxyphenyl)-1,2,4-oxadiazole (7): 1 (500 mg, 1.85 mmol, 1 equiv.) and POCl 3 The vial of (3.14 mL, 0.59 M) was sealed and heated to 100 °C for 4 h. Upon completion by TLC, the reaction mixture was allowed to cool to room temperature and concentrated in vacuo. The crude mixture was purified by flash column chromatography (0-100% EtOAc / Hexanes) to give 388 mg (72%) of 7 as a tan solid: 1 H NMR (500 MHz, DMSO-D6) δ 1 H NMR (500 MHz, DMSO-D6) δ 8.56 (d, J = 8.9 Hz, 1H), 8.26 (d, J = 9.0 Hz, 1H), 8.07 (d, J = 8.8 Hz, 2H), 7.17 (d, J = 8.8 Hz, 2H), 3.86 (s, 3H); 13 C NMR (125 MHz, DMSO-D6) δ 172.0, 168.3, 162.1, 158.4, 147.0, 130.3, 130.2, 129.0, 117.8, 114.8, 55.5. [ka]
[0307] N1-(6-chloro-2-methoxyacridin-9-yl)-N2-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)ethane-1,2-diamine (B32): To a solution of 7 (21.3 mg, 0.07 mmol, 1 equiv) in DMSO (1 mL) was added DIPEA (64.3 μL, 0.370 mmol, 5 equiv), followed by 2 (44.4 mg, 0.148 mmol, 2 equiv). The reaction was heated and maintained at 110 °C for 18 h. The crude reaction mixture was allowed to cool to room temperature and purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as modifier)) to give 3.26 mg (7%) of B32 as a yellow solid: 1H NMR (500 MHz, DMSO-D6) δ 8.68 (d, J = 9.3 Hz, 1H), 8.04 (d, J = 8.9 Hz, 2H), 7.96 (d, J = 9.3 Hz, 1H), 7.87 (d, J = 2.1 Hz, 1H), 7.86 - 7.73 (m, 2H), 7.67 (dd, J = 9.2, 2.5 Hz, 1H), 7.50 (dd, J = 9.2, 2.2 Hz, 1H), 7.16 (d, J = 8.9 Hz, 2H), 6.91 (d, J = 9.4 Hz, 1H), 4.42 (d, J = 5.9 Hz, 2H), 4.00 (s, 3H), 3.86 (s, 3H), 3.75 (m, 2H). [ka]
[0308] N 1 -(6-chloro-2-methoxyacridin-9-yl)-N 3 -(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)propane-1,3-diamine (B33): To a solution of 7 (30 mg, 0.1 mmol, 1 equiv) in DMSO (1 mL) was added DIPEA (91 μL, 0.52 mmol, 5 equiv), followed by 2 (65 mg, 21 μmol, 2 equiv). The reaction was heated and maintained at 110 °C for 18 h. The crude reaction mixture was allowed to cool to room temperature and purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as modifier)) to give 17 mg (29%) of B33 as a yellow solid: 1 H NMR (500 MHz, CD 3OD) δ 8.49 (d, J = 9.2 Hz, 1H), 8.11 (dd, J = 8.9, 2.1 Hz, 2H), 7.88 (d, J = 9.4 Hz, 1H), 7.78 (d, J = 2.6 Hz, 1H), 7.73 (d, J = 2.2 Hz, 1H), 7.70 (d, J = 9.4 Hz, 1H), 7.58 (dd, J = 9.3, 2.5 Hz, 1H), 7.44 (dd, J = 9.3, 2.3 Hz, 1H), 7.10 (d, J = 8.8 Hz, 2H), 6.81 (d, J = 9.4 Hz, 1H), 4.26 (t, J = 6.2 Hz, 2H), 4.02 (s, 3H), 3.90 (s, 3H), 3.75 (t, J = 6.4 Hz, 2H), 2.31 (t, J = 6.4 Hz, 2H);LRMS:C 30 H 26 ClN 7 O 3 + m / z calculated for [M+H]+: 567.18, LC / MS (ESI): R t 4.14 min, m / z measured value 568.35 [M+H] + . [ka]
[0309] N 1 -(6-chloro-2-methoxyacridin-9-yl)-N 4 -(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)butane-1,4-diamine (B34): To a solution of 7 (30 mg, 0.1 mmol, 1 equiv) in DMSO (1.0 mL) was added DIPEA (91 μL, 0.52 mmol) followed by 3 (51 mg, 0.16 mmol, 1.5 equiv). The reaction was heated and maintained at 110 °C for 18 h. The crude reaction mixture was allowed to cool to room temperature and purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as modifier)) to give 19 mg (31%) of B34 as a yellow solid: 1 H NMR (500 MHz, CD 3 OD) δ 8.36 (d, J = 9.3 Hz, 1H), 8.09 (d, J = 8.9 Hz, 2H), 7.92 (d, J = 9.4 Hz, 1H), 7.79 (d, J = 2.2 Hz, 1H), 7.75 (d, J = 9.3 Hz, 1H), 7.64 (d, J = 2.7 Hz, 1H), 7.47 (dd, J = 9.3, 2.5 Hz, 1H), 7.35 (dd, J = 9.3, 2.2 Hz, 1H), 7.09 (d, J = 8.9 Hz, 2H), 6.78 (d, J = 9.4 Hz, 1H), 4.08 (t, J = 7.0 Hz, 2H), 3.96 (s, 3H), 3.89 (s, 3H), 3.55 (t, J = 6.9 Hz, 2H), 2.03 - 1.97 (m, 2H), 1.83 (t, J = 7.3 Hz, 2H);LRMS:C31H28ClN7O3 + m / z calculated for [M+H]+: 581.19, LC / MS (ESI): R t 4.10 min, m / z measured value 582.40 [M+H] + . [ka]
[0310] 6-Chloro-2-methoxy-N-(2-(2-((6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)amino)ethoxy)ethyl)acridin-9-amine (B35): To a solution of 7 (42 mg, 0.15 mmol, 1 equiv) in DMSO (2 mL) was added DIPEA (130 μL, 0.73 mmol, 5 equiv), followed by 4 (75 mg, 0.22 mmol, 1.5 equiv). The reaction was heated and maintained at 110 °C for 18 h. The crude reaction mixture was allowed to cool to room temperature and purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as modifier)) to give 48 mg (55%) of B35 as a yellow solid: 1 H NMR (500 MHz, DMSO) δ 8.58 (d, J = 9.3 Hz, 1H), 8.03 (d, J = 8.8 Hz, 2H), 7.89 (d, J = 2.6 Hz, 1H), 7.81 - 7.71 (m, 3H), 7.64 (dd, J = 9.3, 2.5 Hz, 1H), 7.45 (dd, J = 9.2, 2.1 Hz, 1H), 7.17 (d, J = 9.0 Hz, 2H), 6.73 (d, J = 9.4 Hz, 1H), 4.26 (m, 2H), 4.01 (t, J = 5.1 Hz, 2H), 3.93 (s, 3H), 3.87 (s, 3H), 3.75 (t, J = 5.3 Hz, 2H), 3.63 (m, 2H);LRMS:C31H28ClN7O4 + m / z calculated for [M+H]+: 597.18, LC / MS (ESI): R t 3.89 min, m / z measured value 598.35 [M+H] + . [ka]
[0311] 6-Chloro-2-methoxy-N-(2-(2-((6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)amino)ethoxy)ethoxy)ethyl)acridin-9-amine (B38): To a solution of 7 (100 mg, 0.35 mmol, 1 equiv) in DMSO (2 mL) was added DIPEA (302 μL, 1.73 mmol, 5 equiv), followed by 5 (168 mg, 0.43 mmol, 1.5 equiv). The reaction was heated and maintained at 110 °C for 18 h. The crude reaction mixture was allowed to cool to room temperature and purified by reverse phase flash chromatography (0-100% acetonitrile / (water containing 0.1% TFA as modifier)) to give 50 mg (23%) of B38 as a yellow solid: 1 H NMR (500 MHz, DMSO) δ 8.60 (d, J = 9.3 Hz, 1H), 8.01 (d, J = 8.8 Hz, 2H), 7.92 (d, J = 2.6 Hz, 1H), 7.88 (d, J = 9.4 Hz, 1H), 7.81 - 7.75 (m, 2H), 7.68 (dd, J = 9.3, 2.5 Hz, 1H), 7.51 (dd, J = 9.3, 2.2 Hz, 1H), 7.15 (d, J = 8.9 Hz, 2H), 6.90 (d, J = 9.4 Hz, 1H), 4.24 (q, J = 5.6 Hz, 2H), 3.94 (m, 5H), 3.86 (s, 3H), 3.64 (m, 2H), 3.59 - 3.53 (m, 4H), 3.51 (m, 2H);LRMS:C33H32ClN7O5 + m / z calculated for [M+H]+ 641.21, LC / MS (ESI): R t 3.87 min, m / z measured value 642.50 [M+H] + .
[0312] Example 1 Analysis of G-quadruplex in the MYCN gene As shown in FIG. 3, the MYCN G4 discussed herein is located on the negative strand and near the transcription start site (TSS) of MYCNOS. However, unlike simple G4s, MYCN G4s contain hairpins adjacent to tetrads (Benabou et al., Biochim. et Biophys. Acta 2014, 1840(41-52). This class of hybrid G4 structures has been recently characterized by both genomic data mining and experimental approaches (Onel et al., JACS 2016, 138:2563-2570; Ngoc Nguyen et al., Nucleic Acids Res. 2020, 48:10567-10575; Lim et al., Nucleic Acids Res. 2015, 43:5630-5646) and represents an interesting target for small molecules due to their unique structure (Kang et al., JACS 2016, 138:13673-13692). Although the MYCN G4 has been structurally characterized in vitro, questions about the presence of G4 in biological contexts are often raised. To confirm that the MYCN gene contains a sequence that folds into a G4, we analyzed genome-wide G4-seq data reported by the Balasubramanian group (Chambers et al., Nature Biotechnology 2015; 33:877-881). This approach consists of two rounds of sequencing, before and after stabilizing the G4. A higher mismatch rate between experiments means that the corresponding regions are more likely to form a G4 structure. Among these data, the G4 sequence of interest in this study is K + It was found to have a much higher mismatch rate in both the stabilized and PDS stabilized datasets, thereby supporting the presence of G4 in the MYCN gene (Figure 4). Furthermore, we calculated the G-score within this sequence using QGRS mapper (Kikin et al., Nucleic Acids Res. 2006, 34:W676-682) and found that the target of interest exhibited a promising G-score of 33 (Figures 5A-5B).
[0313] Example 2 Small molecule microarray screening and hit identification To identify small molecule binders of MYCN G4, a small molecule microarray (SMM) screening approach was used. In this study, glass slides modified with epoxy groups were prepared according to a similar protocol previously reported (Abulwerdi et al., Methods 2016, 103:188-195). Compounds were printed and covalently immobilized on the glass surface by a robotic arrayer (Arrayjet™). The slides were then incubated in parallel with 50 nM MYCN G4 DNA 5'-labeled with Cy5, and buffer. After washing and drying, the slides were imaged by a microarray scanner. For each compound, a composite Z-score was calculated to identify hits (Connelly et al., ACS Chemical Biology 2017, 12:435-443). Compounds that did not have promiscuous binding to other nucleic acids in other SMM screens were prioritized. In total, 14 hits were identified (Table 2). [Table 2-1] [Table 2-2]
[0314] To validate the 14 hit compounds as bona fide binders, single concentration binding assays were performed by fluorescence intensity assay (FIA) and surface plasmon resonance (SPR). Compounds were evaluated at 100 μM concentration in each assay. In this example, positive binding was defined by the criterion of >10% deactivation in the FIA study, while SNR>3 was used as the cutoff in the SPR experiment. Compounds 1, 2, MY-1, 5, 10, 11, 12, and 14 were hits in the FIA study, and compounds 1-3, MY-1, 5, 9, and 13 were hits in the SPR study. From these assays, four compounds (1, 2, MY-1, and 5) were identified that showed positive responses in both binding assays (Figures 6-8). The equilibrium dissociation binding constants (K D ) values were measured by FIA and SPR (Figures 9 and 10). MYCN G4 DNA samples were titrated with gradient concentrations of the compounds, and compound MY-1 was found to show the best binding among the four candidates (K by FIA). D = 3.5 ± 1.6 μM, and K by SPR D =3.6±2.4 μM). Compound 1 shared a similar structure to 2 but had better binding affinity (20.8±2.2 μM by FIA and 11.7±2.6 μM by SPR).
[0315] The effect of MY-1 on the thermal stability of MYCN G4 was assessed by circular dichroism (CD). First, G4 formation was confirmed by CD spectroscopy. Samples of MYCN G4 DNA were incubated in three different buffer conditions (10 mM Tris containing 100 mM KCl, 10 mM Tris containing 100 mM LiCl, and 10 mM HSO). 2 As shown in FIG. 11A, MYCN G4 DNA exhibited a positive peak at 263 nm and a negative peak at 240 nm, characteristic of a correctly folded parallel G-quadruplex structure, in KCl buffer. On the other hand, in LiCl buffer and H2O, the MYCN G4 DNA exhibited a positive peak at 263 nm and a negative peak at 240 nm, characteristic of a correctly folded parallel G-quadruplex structure, in KCl buffer. 2 The spectrum of the DNA sample in O showed a much weaker peak at 263 nm, and the peak at 240 nm was negligible.
[0316] Next, melting assays were performed by CD instrumentation using MYCN G4 DNA incubated without / with validated small molecule binders. The 263 nm peak in the CD spectrum gradually decreased during heating (Figure (Figure11B),11), and the T m MYCN G4 was first thawed in 10 mM Tris buffer (pH 7.0) containing 100 mM KCl, and T m was determined to be 78.0±1.9°C, consistent with previously reported values (Benabou et al., Biochim. et Biophys. Acta 2014; 1840:41-52). To assess the effect of the molecule on thermal unfolding, we performed an assay using decreasing KCl concentrations (Kumari et al., Nature Chemical Biology 2007, 3:218-221) after confirming that G4 folding was not affected by less KCl (Figure 12). In 5 mM KCl buffer, the melting curve of MYCN G4 was better fitted, with a T m The temperature was 54.6±0.4℃. m was not affected by the addition of 5% DMSO to the buffer. 20 μM of 1 or MY-1 was added to the MYCN G4 solution and incubated for 15 min before unfolding. As a result, both compounds induced a significant shift in the melting curve and T m by 4.7±0.7°C (for 1) and 3.7±0.5°C (for MY-1), respectively (Figure 11C). Neither compound had a measurable effect on dsDNA melting (Figure 11D), indicating that these hit compounds were not B-DNA binders.
[0317] The binding selectivity of compound 1 and MY-1 was also evaluated. In a separate experiment, a fluorescence-based assay was performed by gradually adding the compounds to a G4 solution in the presence / absence of excess tRNA. Similar to dsDNA, excess tRNA did not affect the binding affinity of 1 or MY-1, further suggesting a specific interaction mode (Figures 13A and 13B). In addition, another five 5'Cy5-labeled G4s from cancer-related genes (Figure 1) were also introduced for selectivity profiling. The two hit compounds were titrated, and compound 1 showed some degree of binding to all G4s with binding affinities ranging from 25.2 to 127.9 μM, but weaker than that of MYCN G4 (Figures 14A-14E). However, MY-1 did not show any significant deactivation behavior and showed no significant K for any G4 except MYCN. D We were unable to measure the levels of MY-1 in the MYCN G4-dependent IL-1 domain (Figures 15A-15E, 16A-16E). This result indicated that MY-1 binds to MYCN G4 via its unique structure.
[0318] Example 3 Identification of compound MY-1 as a non-canonical G4 binder Analysis of the SPR sensorgrams revealed significantly different binding levels (R max) was observed, suggesting that the binding modes of the two compounds may be different. Based on this unexpected observation, and without being bound to a single theory, it is now believed that the two compounds may bind to different sites on MYCN G4. To investigate, we performed competition assays with SPR by stepwise injection of the compounds in a specified order or by injecting mixtures (Brooks et al., Drug Discovery Today 2014, 19:1040-1044; Spurny et al., PNAS 112:E2543-2552). When 100 μM of 1 was injected, followed by 100 μM of MY-1, the observed binding levels of MY-1 did not change significantly compared to those of the individual injections (Figure 17). Even at a higher concentration of 1 (500 μM), the MY-1 binding levels were maintained (Figures 18A and 18B). This suggests that 1 does not compete with MY-1. Next, TMPyP4 (Seenisamy, JACS 2004, 126:8702-8709), a classical stacking G4 binder, was also tested together with MY-1. Addition of MY-1 (both 100 μM and 250 μM) to the TMPyP4 solution resulted in an increase in the SPR binding signal (Figures 19A and 19B). This suggests that MY-1 binds to G4s in a distinctly different manner. In addition, CD melting assays were also performed using either MY-1 or a mixture of the two hits (1 and MY-1). A mixture of solutions containing 20 μM 1 and 20 μM MY-1 enhanced the T of MYCN G4. m MYCN G4 increased ΔT by 9.7±0.7°C, which was significantly higher than that of 20 μM MY-1 alone (Figures 20A and 20B), suggesting a non-overlapping mode of interaction. m was not significantly increased, probably due to saturation of binding sites.
[0319] To evaluate the binding stoichiometry of MY-1 and MYCN G4, a job plot analysis was performed. Briefly, the change in fluorescence intensity by varying the fraction of the components during the fluorescence titration was plotted and fitted, resulting in a maximum at 0.47, indicating a 1:1 binding stoichiometry (Figure 21). The binding of MY-1 to MYCN G4 was studied by microscale thermophoresis (MST). A 3'-Cy5 labeled DNA sample was used since no deactivation was observed (Figure 22). The microscale thermophoresis (MST) curve was well fitted to a 1:1 binding model, and the binding affinity was calculated to be 8.1 ± 1.7 μM, which was consistent with the results of FIA and SPR experiments (Figures 23A and 23B). As a result, MY-1 was identified as a non-canonical G4 binder, unlike the majority of other reported G4 stackers and distinct from 1.
[0320] Example 4 Binding site identification using FIA and DMS-footprinting To further understand the binding details of compound MY-1 with MYCN G4, a series of FIA studies were designed and performed. Given that the hit compound bound to G4 at a 1:1 stoichiometry, we hypothesized that the unique binding behavior was related to the hairpin structure. We first investigated the binding region by introducing environmentally sensitive 2-aminopurine (2-AP) fluorophores into distinct positions (A11, A18, and A24) of G4 (Figure 24A). After incubating 100 μM MY-1 with the labeled DNA samples, the fluorescence intensity was measured and compared to the DMSO control. The fluorescence of the A11 2-AP DNA sample was nearly 100% quenched, whereas the quenching percentages for A18 and A24 2-AP DNA were 80% and 70%, respectively (Figure 24B, Figures 25A-25C). Based on previous observations of the different inactivation behavior of 5'-Cy5-labeled oligos and 3'-Cy5-labeled oligos (15% and 0% inactivation, FIG. 24C), we hypothesized that MY-1 binds to a region near the hairpin. We then explored the necessity of the hairpin in this binding event by designing two DNA constructs containing a mutated long loop (unable to form base pairing) and a truncated sequence (no hairpin) (see FIG. 2). Upon gradual addition of MY-1 to the two DNAs, the binding affinity was significantly reduced to >100 μM micromolar (approximately 30-fold weaker than that of wild-type MYCN G4). Meanwhile, compound 1 was also tested against these G4s, and the affinity was comparable to that of the wild-type (WT) constructs (FIG. 24D). These results indicated that the hairpin structure in MYCN G4 is important for maintaining the binding with MY-1 but not with 1.
[0321] In addition, to explore whether compounds bind to the minor groove of the hairpin, MY-1 was tested together with two other classical minor groove binders (Hoechst 33258 and netropsin) by fluorescence displacement assay (Alniss, J. Medicinal Chemistry 2019, 62:385-402). Since Hoechst 33258 has been reported as a fluorophore and has been widely used as a DNA staining reagent, it was first incubated with different concentrations of unlabeled MYCN G4 DNA and titrated. Utilizing an excitation wavelength of 352 nm and an emission wavelength of 500 nm, the fluorescence intensity increased with increasing DNA concentration as expected (Figure 24E). Next, either MY-1 or netropsin was added to the solution as a competitor during the DNA titration. Netropsin, as a well-known minor groove binder, showed significant displacement of Hoechst 33258 as measured by a corresponding decrease in fluorescence intensity. However, for MY-1, a partial fluorescence decrease was observed at 50 μM, but no measurable change was observed at 5 μM. Thus, although the hairpin now appears to facilitate MY-1 binding, it does not appear to be a classical minor groove binder.
[0322] To better understand the binding mode of compounds to MYCN G4, a dimethyl sulfate (DMS) footprinting assay was developed. This assay exploits the ability of DMS to methylate the free N7 in guanine (G), which can be subsequently cleaved using piperidine (43, 44). Meanwhile, the Hoogsteen-bound G in the quadruplex structure remains protected from modification. Furthermore, changes in modification upon incubation with small molecules can be observed near the binding site. 5'Cy5-labeled MYCN G4 was annealed in the presence of 5 mM KCl, and then compounds were added to the MYCN G4 at the observed K DThe MY-1-containing compound was added at a concentration according to the concentration of G10-G12. As shown in Figure 24F, the bands corresponding to G10-G12 were dark due to protection, indicating that G was incorporated into the tetrad of the quadruplex. However, G13-G16 remained unprotected and therefore showed a brighter band due to hairpin formation by Watson-Crick base pairing. In the presence of compound MY-1, a concentration-dependent protection of various Gs was observed, indicating that the compound stabilizes the G4 structure. Upon addition of My-1, G8, G9, G16, and G17 were significantly protected, while G13-G15 were slightly protected. This result, consistent with the results above, suggested that MY-1 was bound to the junction between the quadruplex and the hairpin (Figure 24B).
[0323] Example 5 Structure-activity relationship (SAR) study of compound MY-1 To achieve better binding to the MYCN G4 target, structure-activity relationship (SAR) studies were performed by using a series of analogs of MY-1 (see Table 3). A targeted library containing MY-1 and 13 derivatives (MY-2 to MY-14) was purchased or synthesized. Each compound was evaluated by SPR and 2-AP titration as described above. Preliminary studies now suggest that the pyrrolidine group in MY-1 plays a role not only by maintaining binding to the G4 but also aids in solubility. Meanwhile, it is now believed that the heterocyclic core of MY-1 (shown in Table 3) also aids in MYCN G4 recognition. Therefore, most analogs contained modified side chain R groups. [Table 3-1] [Table 3-2]
[0324] Systematic binding assays of 14 analogs with MYCN G4 were performed by SPR and 2-AP(A11) fluorescence titration (Figures 26A-26N, 27A-27N). In summary, the observed binding affinities ranged from 1.4 to 23.5 μM (SPR) and 0.2 to 7.0 μM (2-AP titration). Most of the analogs showed good binding behavior to MYCN G4, except for MY-4 and MY-9, both of which had solubility in suitable buffers. SPR experiments identified four analogs (MY-2, 5, 8, and 10) as stronger binders than the parent compound, among which MY-5 and MY-8 showed the strongest binding affinity of 1.4 ± 0.2 μM and 1.5 ± 0.3 μM, respectively. Compound MY-2 showed a high response in the SPR sensorgrams, suggesting that it is an aggregator. For the 2-AP fluorescence titration assay (using the A11 substitution construct), the observed K D The values were in good agreement with the SPR experiments, although the values were overall slightly lower. Among the analogs tested, four compounds (MY-2, MY-8, MY-10, and MY-14) were found to be submicromolar binders to the MYCN G4 target. Again, analog MY-2 showed the highest binding affinity at 0.2±0.03 μM, but was not selected for further testing due to possible aggregation / poor solubility. Considering all the SAR data, MY-8 was selected for the cell-based assay. The results are shown in Table 3 above.
[0325] Example 6 Effect on MYCN-MYCNOS expression after MY-8 treatment To evaluate the effect of MY-8 on MYCN gene expression, NBEB cells were cultured and treated with different concentrations of MY-8. The effect of MY-8 on cell viability was evaluated using an Incucyte live cell imaging system. Significant inhibition of NBEB cell growth was observed based on 4-day measurements of cell confluency after a single treatment with MY-8 (Figures 28A and 28B). CC1 at 20.5 μM was significantly inhibited with increasing compound concentrations up to 45 μM. 50was confirmed by MTS assay (Figure 28C). Next, the mRNA levels of genes, including MYCN and two MYCNOS transcripts (MYCNOS001 and MYCNOS002), were measured using qRT-PCR at different time points (24, 36 and 48 hours) after MY-8 treatment (Figures 28D-28F). At higher MY-8 concentrations, a clear decrease in mRNA levels was observed for all three transcripts, indicating that treatment with MY-8 reduced the expression levels of both MYCN and MYCNOS. Interestingly, MYCNOS002 levels were reduced as early as 24 hours, earlier than the other two transcripts. The levels of N-Myc protein were also measured using Western blotting (Figure 28G). Here, the results were consistent with the qPCR experiments, and the levels of N-Myc protein were reduced by treatment with MY-8 in a dose-dependent manner.
[0326] As shown by the data herein, biophysical analysis using multiple orthogonal techniques described herein confirms that compounds, such as compounds MY-1 and MY-8, bind to the MYCN G4 in an atypical manner by interacting with a unique fold formed by a G-tetrad and a hairpin. Also, in some instances, biological evaluation of MY-8 demonstrated that it reduces the levels of MYCN as well as MYCNOS, thus downregulating the levels of both gene products at the RNA and protein levels.
[0327] The data and information disclosed herein confirm that targeting the higher-order structure within DNA G4 provides a new way to develop selective inhibitors that regulate the expression of undruggable cancer genes.Indeed, the more complex RNA G4 has become a successful framework for highly selective small molecule binding.Although these examples are mainly evolved fluorescent RNA aptamers, they elegantly demonstrate that the complex structure containing G4 can provide a unique pocket for highly selective small molecule recognition.
[0328] In a broader sense, small molecule recognition of G4 elements in the presence of lncRNA promoters can be one way to regulate lncRNA expression. Although lncRNAs represent important drivers in multiple cancer types, there are few examples of small molecules that can regulate their expression or function. The data provided herein show that the unique folds formed by these complex structures can also be useful functional targets for small molecules to aid in targeting disease-related genes, including protein-coding as well as non-coding gene products.
[0329] Example 7 Given the possibility of hairpin-containing hybrid G4s as targets, we further explored the presence of other G4s with similar structures in the human genome. Using data from genome-wide G4-seq, we identified approximately 2 million unique loops (>7 nt) between G-tracts of G4s embedded in 407,491 regions of observed quadruplexes (OQs). Through hairpin folding tests using UNAfold (46) (hybrid-ss-min package at 37°C), 33,912 OQs were found to contain hairpin structures (approximately 8.3% of all OQs), consistent with previous computational predictions. Among the hairpin-G4 regions, 58% were associated with protein-coding genes, whereas 13% were associated with non-coding RNAs. Some of the hairpin-containing G4s were located in genes of cancer-related proteins (such as FOXA3, KRAS, MYCL, and BRD4), (see Figure 29 for each hairpin-G4). This example shows that higher complexity G4s containing embedded hairpins are highly prevalent throughout the genome and are often associated with cancer genes or lncRNAs.
[0330] Example 8 In this example, an SPR binding assay was performed to analyze the binding activity of representative bivalent compounds of the present disclosure. The compounds in this example included a non-standard binder component and a G4 stacker component. A BIAcore 3000 (GE Healthcare) instrument was used. A CM5 SPR biochip was used and primed with running buffer (10 mM Tris, pH 7.0, 100 mM KCl, 0.005% Tween 20, 5% DMSO). The flow rate was set at 5 μL / min to immobilize the compounds on the chip surface. The carboxylated dextran on the chip surface was then activated by EDC / NHS (0.4M / 0.1M) aqueous solution for 15 minutes, followed by injection of streptavidin (SA) solution (0.2 mg / mL in 10 mM sodium acetate buffer, pH 4.5) for 30 minutes. After the immobilization amount of SA, the surface was deactivated by injecting 1M ethanolamine (EA) aqueous solution (pH 8.5) for 10 min and regenerated with 10 mM NaOH for 2 min to remove physical adsorption. Furthermore, biotinylated MYCN G4 DNA was prepared at 5 μM in annealing buffer, heated to 95°C for 5 min, and then slowly cooled to room temperature within 1 h. After annealing, a total of 150 μL of solution was injected into Fc 2 of the SPR system for 30 min to immobilize the DNA on the chip surface. Compound solutions were then tested once the baseline was stabilized.
[0331] A faster flow rate (25 μL / min) was used for both Fc 1 (blank) and Fc 2 (target) to detect binding affinity as well as binding signal. Each of the compound solutions was prepared at 20× design concentration in DMSO and then diluted into non-DMSO running buffer, thereby obtaining a final concentration of 5% DMSO. A total of 50 μL of compound solution was then injected into the Fc 1-2 flow channel for 120 s for association, followed by 200 s of buffer flow for dissociation. An injection of 50 μL of regeneration buffer (1 M KCl) could be performed between the two samples if necessary. Final binding curves were obtained by referencing the blank channel (Fc 1). Binding affinity (K DTo determine the K, a series of diluted compound solutions were injected and the K was calculated using the Langmuir 1:1 binding model by BIAevaluation 4.0 software (GE Healthcare). D was calculated.
[0332] Results for the specific embodiment performed for this example are shown in Figures 30, 31A, 31B, 32A and 32B. A schematic showing the binding of the bivalent compounds of this example as currently understood is provided by Figure 30. Acridine ICR 191 has a K of 821 ± 184 nM. D (Other acridinyl compounds evaluated were 9-aminoacridine, acridine Cl, and acridine NH 2 ) (Figures 31A and 31B). Binding of compound B33 to MYCN G4 was quantified by SPR titration. Compound B33 showed a large improvement in binding affinity (K) compared to either the reported MY-8 (1.5 ± 0.3 μM by SPR) or acridine ICR 191. D =70±13 nM) (Figures 32A and 32B). In addition, the binding curve of compound B33 showed different kinetics from that of acridine ICR 191 (fast on / off). Furthermore, the newly developed compound did not show any binding to dsDNA in SPR even with 5 μM compound injection. Meanwhile, acridine ICR showed a dose-dependent binding signal to dsDNA due to groove binding and intercalation (Figures 33A and 33B). These results indicated that compound B33 has a superior binding preference for G4 structure over B-DNA structure, which would lead to better specificity in complex solutions.
[0333] Example 9 In this study, FIA was used to verify the binding of certain bivalent oligos with MYCN G4 oligos. To measure the binding affinity, solutions of each compound were prepared in triplicate in 96-well plates (Costar, black-walled clear bottom), thereby obtaining a final concentration of 100 nM (5% final DMSO in working solution). Unlabeled MYCN G4 DNA was folded based on the annealing method described above and then added to the well plate, thereby obtaining different concentrations by serial dilution. The plate was incubated at room temperature for 30 min, followed by centrifugation at 500 rpm for 2 min. The fluorescence intensity was then quantitatively recorded by a Synergy Mx microplate reader (BioTek) at Ex 340 nm / Em 500 nm. The fluorescence intensity was then normalized and the binding affinity was calculated by curve fitting using the one-site total model in GraphPad Prism 8.3.1 software.
[0334] FIA studies were also performed by taking advantage of the fluorescence properties of molecules derived from acridine. Acridine ICR and compound B33 were excited at 340 nm and showed a fluorescence emission peak at about 500 nm. By gradually adding folded DNA G4 to a 100 nM small molecule solution, dose-dependent response curves were obtained and fitted. As a result, acridine ICR 191 and compound B33 showed 1040 ± 150 nM and 66 ± 7 nM, respectively (Figures 34A and 34B). This result confirmed the strong binding of compound B33 to MYCN hairpin-G4.
[0335] Example 10 In this example, small-scale DNA G4 microarrays containing 12 different G4 oligos and non-G4 oligos (dsDNA and ssDNA) were fabricated and tested (Table 4). First, SA-coated glass surfaces were prepared. Amino-functionalized glass slides were first modified with a solution of N,N'-disuccinimidyl carbonate (DSC, 1.0 M) and N,N-diisopropylethylamine (DIPEA, 1.0 M) in DMF overnight at room temperature. Successive washes with EtOH, Milli-Q water (5 min each), and N 2After drying with gas, the slides were incubated with 1 mg / mL SA solution for 12 h (overnight) in a refrigerator at 4°C, and then the surface was blocked with EA buffer for 30 min. The slides were then rinsed with PBS buffer and Milli-Q water, and dried by centrifugation (1,700 g, 2 min). [Table 4-1] [Table 4-2]
[0336] In parallel, biotin-labeled DNA / RNA oligos were prepared in annealing buffer, resulting in a 5 μM stock solution, and subsequently annealed (according to the method described above). All oligo solutions were then transferred to a 384-well plate. Microarray printing was then performed at 60% humidity by a robotic arrayer (Nanoprint, Arrayit, USA). After the microarrays were created, the slides were placed in a slide box with one wet Kimwipe tissue and incubated at 4 °C for 2 h.
[0337] For incubation with fluorescent compounds (compound B33, thiazole orange ("TO"), and amsacrine), slides were thoroughly rinsed with PBST, PBS, and water to remove unbound oligos. Slides were then dried by centrifugation (1,700g, 2 min) and quickly assembled with a microarray gasket (Agilent, USA) before loading with compound solutions. After 1 h of incubation, slides were washed and dried using the method described above. Finally, microarray slides were imaged using the green channel with a fluorescent scanner (Mapix) and the fluorescence intensity was quantified.
[0338] At 2.5 μM, compound B33 exhibited a relatively higher signal-to-noise ratio (SNR) and lower background compared to other incubation concentrations (data not shown). As a result, only MYCN spots emitted light in compound B33-treated microarrays, indicating promising binding selectivity for the corresponding targets (Figures 35A-35F). Meanwhile, another two reported hairpins (hTERT and BCL2) containing G4 DNA did not show fluorescence, suggesting that molecular recognition was highly dependent on the hairpin in MYCN G4. In addition, no binding to dsDNA / ssDNA was observed, which was consistent with the G4-binding behavior of compound B33. Meanwhile, TO, as a general G4 binder, showed binding to most oligos except dsDNA / ssDNA, suggesting a broad-range G4-binding ability. Amsacrine, which shared the acridine core with compound B33 but had a shorter tail (a benzyl-type sulfonamide), showed binding to several G4s in microarrays, particularly the NRAS RNA G4 and three hairpin-G4s (MYCN, hTERT, and BCL2). These results demonstrated the promising binding selectivity of compound B33 to the MYCN hairpin-G4 over other G4 structures.
[0339] Example 11 In this example, the folding of the G-quadruplex structure was characterized by circular dichroism using a J-1500 circular dichroism spectrometer (Jasco). To optimize the buffer conditions, unlabeled MYCN oligonucleotides were prepared at 5 μM concentration in different annealing buffer conditions. The annealing procedure was the same as that described above. CD spectra were recorded from 320 to 200 nm at 25 °C with a step of 1 nm. Each spectrum was obtained by averaging the signals of three repeated scans.
[0340] For the CD melting assay, MYCN oligonucleotides were prepared at 5 μM concentration in KCl buffer (10 mM sodium phosphate, pH 7.0, 5 mM KCl). To test the stabilizing effect of compounds, MYCN G4 DNA samples were mixed with / without compounds (final solution containing 5% DMSO) at the designed concentrations. A total of 300 μL of the solution was then added to a cuvette and heated from 20° C. to 80° C. in 1° C. intervals in the CD spectrometer. The melting temperature (T m To calculate the σ, the CD spectral peak at 263 nm was tracked and the ellipsometry plotted versus temperature and fitted using a nonlinear sigmoidal dose-response model with variable slope in GraphPad Prism 8 software.
[0341] Thermal melting assays using CD were performed to investigate the effect of compounds on MYCN G4 stability. m = 4.6 °C), compound B33 has a much higher ΔT m (6.4° C.), which could be attributed to the synergistic effect of the two fragments in compound B33 ( FIG. 36 ). This result was consistent with our hypothesis that the bivalent interactions could not only improve the binding affinity but also increase the thermal stability of MYCN hairpin-G4 due to the introduction of more contact points between the small molecule and the oligo.
[0342] To further characterize the binding selectivity of compound B33, a high-density large-scale DNA microarray containing about 19,000 different G4 sequences was fabricated and used. In this microarray, 340 reported G4s (G-rich sequences) as well as 280 non-G4s (C-rich sequences) were designed as positive and negative controls. In addition, more than 17,000 standard G4 oligos with short loops (1-7 nt) were also designed and synthesized by varying the loop sequences to meet the diversity of G4 structures. After folding the surface-grafted DNA oligos in high-concentration KCl buffer, TO and compound B33 solutions (500 nM) were incubated with the microarray, respectively. The slide was then thoroughly washed, dried, and imaged using the green channel by a fluorescent scanner. As a result, the TO-treated microarray presented a wide range of fluorescence, and the fluorescent signals were evenly distributed (except for some negative control spots), indicating that almost all G4s were folded (Figure 37A). However, the compound B33 slide showed only a few bright spots, while other spots remained dark as background, suggesting that compound B33 had a strong preferential binding behavior. The binding of TO and compound B33 was further investigated to quantify the fluorescence intensity of each spot. The kernel density estimation (KDE) plot and violin plot showed the distribution of binding signals across the entire microarray. As shown in Figure 37B, the two bands corresponding to the two small molecules were well separated. The compound B33 spectrum was spread over a much wider range than that of TO. In the violin plot (Figure 37C), the average SNR value of the TO group was 12, which was much higher than that of the compound B33 group. In addition, the TO group had smaller error bars, which confirmed the binding signals were uniformly distributed in the microarray. The violin plot of the compound B33 group presented a needle-like shape at the top and a body at the bottom, indicating that there was a strongly biased binding event (Figure 37C). Focusing on 620 G4 and non-G4 controls, TO showed binding to both G4 and non-G4, although the average SNR of the former was significantly higher than that of the latter (Figure 37D).In contrast, compound B33 showed some binding to G4, but no binding was observed in the non-G4 group. This result indicated that compound B33 had a preference for G4 over non-G4 structures, which was consistent with the global analysis of the microarray. Comparing the SNR values between the TO and compound B33 groups, the scatter plot was off the 45 degree line (Figure 37E), which again indicated that the binding behavior of compound B33 was quite different from that of the non-selective binder (TO). Furthermore, the selectivity of the two compounds was quantitatively profiled by using the Gini coefficient. The Gini coefficient, which was initially used as an economic concept, has been applied to profiling the selectivity / promiscuity of kinase inhibitors as well as RNA binders. A higher Gini value means a higher selectivity of the compound (Gini coefficient >0.75 is considered to be excellent selectivity). Gini coefficient based on SNR in microarrays. As a result, TO and compound B33 showed Gini coefficient values of 0.236 and 0.628 (Figures 37F and 37G, respectively). The high Gini values quantitatively confirmed that compound B33 had relatively promising selectivity among G4.
[0343] Example 12 In this example, DMS-footprinting was performed by using 5'-Cy5-labeled MYCN hairpin-G4 DNA. 5 μM of oligos were annealed in optimized buffer conditions (10 mM Tris, pH 7.0, 10 mM LiCl and 10 mM NaCl) by heating to 95°C followed by slow cooling. The folded DNA was then incubated with different concentrations (0, 10, 25, 50, 100 nM) of compound B33 for 30 min. The solution was then subjected to 1% DMS treatment at room temperature for 10 min and 2.5 M NH 4The reaction was stopped with OAc and 0.1M β-mercaptoethanol. The treated DNA was purified with phenol / chloroform / isoamyl alcohol and precipitated with ethanol. The DMS-modified DNA was then cleaved using 10% piperidine at 90°C for 30 min. The solution was dried using a SpeedVac vacuum concentrator, washed twice with 100 μL water, and dissolved in nuclease-free water. The treated DNA samples were resolved on a 17% denaturing polyacrylamide gel and visualized by Typhoon Imager (Amersham) followed by processing with ImageJ software.
[0344] Buffer optimization was performed to observe small molecule-induced G4 formation. 10 mM LiCl + 10 mM NaCl was selected as the salt condition in Tris-HCl buffer by CD spectrum study. 5'-Cy5-labeled MYCN G4 was annealed and incubated with different concentrations of compound B33, followed by DMS-footprinting assay (Figure 38A). In the absence of compound, the bands of G13-15 were more intense corresponding to the hairpin region, while some bands of G were dark due to quadruplex formation (Figure 38B). With the addition of compound B33, the oligo was induced to form G4 structure due to protection for G2-9, G10-12 and G17-21. In addition, G13-15 was observed to be partially protected, indicating that this hairpin region was also in contact with the molecule during quadruplex formation. This result is consistent with binding studies using unwound and truncated MYCN G4 (Figures 39A and 39B, respectively), further supporting the involvement of the hairpin in binding. However, in another study, a duplex-containing RNA G4 (MANGO II) showed weak binding to compound B33 by SPR (Figure 40) because the duplex and quadruplex structures were separated rather than forming a junction (PDB:6C63). Without being bound by a single theory, it is now believed that this result may indicate that molecular recognition is aided by the presence of a tertiary structure formed by the hairpin-quadruplex.
[0345] In addition to the DMS-footprinting study, the bivalent binding mode of compound B33 to MYCN hairpin-G4 was also investigated by comparing HP-G4 with different folding forms. Four reported HP-G4s with parallel structure (BCL2), (3+1) hybrid structure (HIV and PIM1-1 form) and (2+2) chair structure (PIM1-2 form) were examined by FIA binding studies using compound B33 (Figures 41A, 41B, 42A, 42B, 43A, 43B, 44A and 44B). As a result, BCL2 HP-G4 has a K of 258±39 nM, almost 4-fold weaker than MYCN HP-G4. D For the (3+1) hybrid G4, HIV and PIM1-form 1 HP-G4 showed 151±26 nM and 279±32 nM binding to the small molecule. For the antiparallel structure, PIM1-form 2 HP-G4 showed even weaker binding affinity to compound B33 (1.1±0.4 μM), completely losing the synergistic effect of the two fragments. This observation could be attributed to the conformational difference between the planar G-tetrad and the parallel MYCN G4 separating grooves. These results indicated that the binding event of the developed molecule (compound B33) with HP-G4 is highly related to the conformation of the hairpin-quadruplex junction, which may determine the shape of the binding site.
[0346] (Example 13) In this example, different linker groups of bivalent compounds were evaluated. Linkers with different lengths and / or functional groups were evaluated. The results are summarized in Figure 45. The K for each compound as measured using FIA and SPR. D The results of specific K values are provided in Figures 46A-46D and 47A-47H, respectively. In this example, B35 had the lowest K value, showing a >10-fold improvement over B32 (311 ± 52 nM by FIA and 303 ± 32 nM by SPR). D (38±5 nM by FIA and 14±6 nM by SPR). This dissociation constant is comparable to that of a reported antibody (scFV:K DThe binding of the linker was comparable to that of B33 (approximately 30 nM). When the linker was further extended (e.g., using PEG2 groups, such as in compound B38), weaker binding was observed (69±21 nM by FIA, 87±39 nM by SPR), none of which was stronger than that of B33. In addition, amsacrine with a short linker showed even weaker binding (2.9±0.5 μM) to MYCN HP-G4 (see Figures 48A and 48B). Compound B32 and amsacrine also bound to dsDNA at low micromolar levels (see Figures 49A and 49B). In a particular example, the PEG linker in compound B35 not only properly confirmed and facilitated the fitting of the two fragments into the binding site, but also contributed to water solubility, which could facilitate cell assay evaluation.
[0347] IX. Additional Sequences An exemplary genomic DNA sequence encoding human MYCN (SEQ ID NO:1) [ka] [ka] [ka] [ka]
[0348] An exemplary genomic DNA sequence encoding human MYCNOS (SEQ ID NO:40): [ka] [ka] [ka] [ka]
[0349] In view of the many possible embodiments to which the principles of this disclosure may be applied, it is to be recognized that the described embodiments are merely preferred examples and should not be considered as limiting the scope of the disclosure. Rather, the scope is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
1. A compound according to formula IA 【Chemical Formula 79】 (wherein X 1 , X 2 and X 3 each independently is N or O; R 1 is -(linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, said linker is an aliphatic or heteroaliphatic group, t is 0 or 1; R 2 is H or aliphatic; Each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5) provided that it is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazine-3-amine, N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazine-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazine-3-amine, nor 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazine-3-amine a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
2. a compound according to formula I [Chemical formula 80] (wherein, ring A is a 5-membered heteroaryl ring other than thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, and 1,3,4-oxadiazolyl; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(linker) t -R b and here, R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2is H or aliphatic; Each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; Each R 4 is independently H, aliphatic, or halo; x is an integer selected from 0 to 5; n is an integer selected from 0 to 10) wherein, provided that 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazine-3-amine, N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazine-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazine-3-amine, nor 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazine-3-amine a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
3. A compound according to formula I 【Chemical Formula 81】 (wherein ring A is a 5-membered heteroaryl ring; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CR a 2 ) m -R b where each R a is independently H, alkyl, or halo, m is 1, 2, 3, 4, or 5, and R b is a nitrogen-containing group; R 2 is H or alkyl; each R 3 is independently alkoxy, hydroxy, aliphatic, or halo; each R 4 is independently H, alkyl, or halo; n is 0, 1, 2, or 3; x is 0, 1, 2, 3, 4, or 5) and provided that it does not include a structure represented as any one of MY-1, MY-2, MY-10, MY-11, or MY-12 or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
4. A compound according to formula I 【Chemical Formula 82】 【Chemical Formula 82】 (wherein ring A is a 5-membered heteroaryl ring; ring B is a 6-membered heteroaryl ring containing at least 2 nitrogen atoms; R 1 is -(CR a 2 ) m -R b or -[(CR a 2 ) m O] r -(CH 2 ) s -R b where each R a is independently H, aliphatic, or halo, t is 1, 2, 3, 4, or 5, r is 1, 2, 3, 4, or 5, s is 0 or 1, and R b is an acridinyl group; R 2 is H or aliphatic; each R 3 is independently heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; each R 4 is independently H, aliphatic, or halo; x is an integer selected from 0 to 5; n is an integer selected from 0 to 10), or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
5. Ring A is 【Chemical Formula 83】 wherein each bond represented by 【Chemical Formula 84】 is a single or double bond as necessary to satisfy valence requirements; X 1 、X 2 、and X 3 each is independently N, O, S, or C(R c ), where R c is H, alkyl, or halo, provided that at least one of X 1 、X 2 、and X 3 is other than C(R c ), The compound according to any one of claims 2 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
6. Ring A is 【Chemical Formula 85】 The compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
7. Ring A is 【Chemical Formula 86】 The compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
8. Ring B is [Chemical Formula 87] where Y 1 , Y 2 , Y 3 , and Y 4 each independently is N or C(R c ), where R c is H, alkyl, or halo, provided that at least two of Y 1 , Y 2 , Y 3 , and Y 4 are N. The compound according to any one of claims 2 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
9. Ring B is [Chemical Formula 88] The compound according to any one of claims 2 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
10. Ring B is [Chemical Formula 89] The compound according to any one of claims 2 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
11. (i) x is 1, 2, or 3; or (ii) one R 3 is in the para position with respect to ring A; or (iii) both (i) and (ii). The compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
12. The compound according to any one of claims 2 to 4, wherein n is 0, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
13. Each R 3 is independently C 1 to C 3 alkoxy or hydroxy, the compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
14. wherein x is 1 and R 3 is methoxy, the compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
15. The structure according to formula II 【Chemical Formula 90】 The compound according to claim 1, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, having
16. R 2 is H, the compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
17. The structure according to formula III 【Chemical Formula 91】 The compound according to any one of claims 1 to 3, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, having
18. R 1 is -(CH 2 ) m -R bThe compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
19. The compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, wherein m is 2 or 3.
20. R b is an N-containing cyclic group -N(R c ), or -C(O)N(R 2 ), wherein each R c is H or alkyl, and the compound according to any one of claims 1 to 3, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof. 2 is H or alkyl, and the compound according to any one of claims 1 to 3, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof. c is H or alkyl, and the compound according to any one of claims 1 to 3, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
21. R 1 is 【Chemical formula 92】 and the compound according to any one of claims 1 to 3, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
22. 【Chemical formula 93】 and the compound according to any one of claims 1 to 3, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof.
23. The structure according to formula IV 【Chemical formula 94】 (wherein the linker is -(CR a 2 ), or -[(CR m ), or -[(CR a 2 ), or -[(CR m O]] r -(CR a 2 ), and wherein each R s is ais independently H, aliphatic, or halo; m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; s is 0 or 1) The compound according to claim 1 or 2, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, having
24. Structure according to formula V 【Chemical Formula 95】 (wherein the linker is -(CH 2 ) m - or -[(CH 2 ) m O] r -(CH 2 ) s -, where m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; s is 0 or 1) The compound according to any one of claims 1, 2, or 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, having
25. R 1 is 【Chemical Formula 96】 The compound according to any one of claims 1, 2, or 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, being
26. 【Chemical Formula 97-1】 【Chemical Formula 97-2】 The compound according to any one of claims 1, 2, or 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, being
27. A pharmaceutical composition comprising the compound according to any one of claims 1 to 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, and at least one pharmaceutically acceptable additive.
28. A pharmaceutical composition according to claim 27, comprising a therapeutically effective unit dosage form of said compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, and optionally an anti-cancer agent.
29. A composition for use in a method of reducing N-Myc expression in a cell, said composition comprising a compound of formula IA or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, said method comprising exposing said cell to a compound of formula IA 【Chemical Formula 108】 (wherein, X 1 , X 2 and X 3 each independently is N or O; R 1 is -(linker) t -R b wherein R b is aromatic, heteroaliphatic, or aliphatic, said linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; Each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5) provided that it is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazine-3-amine, N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazine-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazine-3-amine, nor 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazine-3-amine A composition comprising contacting with a compound.
30. A composition comprising the compound according to any one of claims 2, 3 or 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, wherein the composition is for use in a method of reducing N-Myc expression in a cell, the method comprising contacting the cell with the compound according to any one of claims 2, 3 or 4; (ii) for treating or preventing cancer in a subject, the compound having the structure according to any one of claims 2, 3 or 4.
31. A composition for treating or preventing cancer in a subject, the composition comprising a compound of formula IA or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, the compound having the structure of formula IA 【Chemical 109】 (wherein X 1 , X 2 and X 3 each independently is N or O; R 1 is -(linker) t -R b where R b is aromatic, heteroaliphatic, or aliphatic, the linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5) and provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazine-3-amine, N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazine-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazine-3-amine, nor 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazine-3-amine, a composition.
32. Use of a compound of formula IA or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof in the manufacture of a medicament for treating or preventing cancer in a subject, wherein said compound has the structure according to formula IA 【Chemical 110】 (wherein X 1 、X 2 and X 3 each independently is N or O; R 1 is -(linker) t -R b wherein R b is aromatic, heteroaliphatic, or aliphatic, said linker is an aliphatic or heteroaliphatic group, and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5) having, provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazine-3-amine, N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazine-3-amine, N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-yl)-N2,N2-dimethylethane-1,2-diamine, N-(3-(azepan-1-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazine-3-amine, 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperidin-1-yl)propyl)pyridazine-3-amine, nor 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(2-morpholinoethyl)pyridazine-3-amine, use.
33. Use of a compound according to any one of claims 2, 3 or 4, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, in the manufacture of a medicament for treating or preventing cancer in a subject, wherein the compound has the structure according to any one of claims 2, 3 or 4.
34. The use according to claim 32, wherein the cancer is neuroblastoma, rhabdomyosarcoma, prostate cancer, or small cell lung cancer.