Polycistronic Vectors for Cell-Based Therapy

JP2024525789A5Inactive Publication Date: 2025-07-17SANA BIOTECHNOLOGY INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024502009
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-11-24
Filing Date
2022-07-18
Publication Date
2025-07-17
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Allogeneic cell therapies face challenges due to immune rejection and graft-versus-host effects, limiting their clinical application, and existing CAR-T cell therapies for diseases like cancer and neurological disorders require improved safety and efficacy.

Method used

Polycistronic vectors are developed to co-express tolerogenic factors (like CD47) and CARs, along with safety switches, to reduce immune recognition and provide controlled cell elimination, enhancing the safety and effectiveness of cell-based therapies.

Benefits of technology

The approach reduces immune rejection and enhances the therapeutic efficacy of allogeneic cell therapies by modulating immune response and providing controlled cell management, improving treatment outcomes for diseases such as cancer and neurological disorders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided are polycistronic vectors for co-expressing one or more tolerogenic factors, one or more CARs, and optionally one or more safety switches, compositions comprising the polycistronic vectors, cells comprising the polycistronic vectors, and methods of making these cells, as well as methods of using the disclosed vectors, compositions, and cells to treat diseases such as cancer, diabetes, and neurological disorders.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 222,954, filed July 16, 2021, and U.S. Provisional Patent Application No. 63 / 282,961, filed November 24, 2021. The entire contents of each of these provisional applications are incorporated herein by reference. Summary of the Invention

[0002] overview A new cell therapy approach called adoptive cell transfer (ACT) is rapidly changing the landscape of human disease treatment. ACT involves taking cells from the patient (autologous) or a healthy donor (allogeneic), matching these cells, and then transplanting the cells into the patient to fight disease. The most clinically successful ACT is chimeric antigen receptor (CAR)-T cell therapy, in which CAR-modified T cells specific for tumor-associated antigens are created and infused into the patient to recognize and kill cancer cells that carry the antigen on their surface. The CAR-T cell therapy most advanced in clinical development targets an antigen found on B cells called Cluster of Differentiation 19 (CD19) and is approved for the treatment of large B-cell lymphoma (see, for example, tisagenlecleucel, lysocabtagenemaraleucel, brexcabtageneoutelucel, and axicabtageneciloreucel).

[0003] Compared with autologous cell-based strategies, off-the-shelf allogeneic cells offer several advantages, including improved patient access, quality control, and prevention of delayed treatment, malignant cell contamination, and cell dysfunction. However, allogeneic cells can cause severe graft-versus-host effects and can be rapidly eliminated by the host immune system. Thus, immune incompatibility is a major barrier to the clinical application of ACT, and the ability of transplanted cells to escape the patient's immune system determines the success of allogeneic cell therapy. Thus, novel approaches, compositions, and methods for creating cell-based therapies are needed.

[0004] The present technology provides polycistronic vectors for co-expressing one or more immune tolerogenic factors, one or more CARs, and optionally one or more safety switches, as well as compositions and methods using the polycistronic vectors for treating diseases such as cancer, diabetes, and neurological diseases. For example, in one embodiment, the present technology provides bicistronic vectors for co-expressing immunogenic factors (e.g., CD47, HLA-E, HLA-G, PD-L1, CTLA-4, etc.) and CARs (e.g., CD19 CAR, CD22 CAR, BCMA CAR, etc.), as well as compositions and methods using the bicistronic vectors for treating diseases. In another embodiment, the present technology provides tricistronic vectors for co-expressing immunogenic factors (e.g., CD47, HLA-E, HLA-G, PD-L1, CTLA-4, etc.), CARs (e.g., CD19 CAR, CD22 CAR, BCMA CAR, etc.), and safety switches, as well as compositions and methods using the tricistronic vectors for treating diseases.

[0005] In some aspects, a polycistronic vector is provided that includes (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor, (b) a second expression cassette comprising a nucleotide sequence encoding a CAR, and (c) one or more cleavage sites separating the first and second expression cassettes, wherein the first expression cassette precedes the second expression cassette in 5' to 3' order.

[0006] In some embodiments, the tolerogenic factor is selected from the group including A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, CR1, DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, serpin b9, CCl21, and Mfge8. In some embodiments, the tolerogenic factor comprises CD47, e.g., human CD47. In some embodiments, the human CD47 comprises an amino acid sequence that is at least 80% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 1-5. In some embodiments, the nucleotide sequence encoding CD47 is at least 80% identical to the nucleotide sequence set forth in any one of SEQ ID NOs: 129-134. In some embodiments, CD47 is codon optimized. In some embodiments, the nucleotide sequence encoding CD47 is at least 80% identical to the nucleotide sequence set forth in SEQ ID NO: 135.

[0007] In some embodiments, the CAR comprises a CD19 CAR. In some embodiments, the CD19 CAR comprises a signal peptide, an extracellular binding domain specific for CD19, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain. In some embodiments, the signal peptide comprises a CD8α signal peptide, an IgK signal peptide, or a GMCSFR-α signal peptide. In some embodiments, the extracellular binding domain specific for CD19 comprises a heavy chain variable region (V) of an scFv, e.g., FMC63. H ) and the light chain variable region (V L). In some embodiments, the scFv comprises one or more complementarity determining regions (CDRs) having the amino acid sequences set forth in SEQ ID NOs: 21-23 and 26-28. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 21-23. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 26-28. In some embodiments, the hinge domain comprises a CD8α hinge domain, a CD28 hinge domain, an IgG4 hinge domain, or an IgG4 hinge-CH2-CH3 domain. In some embodiments, the transmembrane comprises a CD8α transmembrane domain or a CD28 transmembrane domain. In some embodiments, the intracellular costimulatory domain comprises a 4-1BB costimulatory domain or a CD28 costimulatory domain. In some embodiments, the intracellular signaling domain comprises a CD3 zeta (ζ) signaling domain. In some embodiments, the CD19 CAR comprises the amino acid sequence set forth in SEQ ID NO: 117 or is at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 117. In some embodiments, the nucleotide sequence encoding the CD19 CAR comprises the nucleotide sequence set forth in SEQ ID NO: 116 or is at least 80% identical to the nucleotide sequence set forth in SEQ ID NO: 116. In some embodiments, the CD19 CAR comprises the amino acid sequence set forth in SEQ ID NO: 32, 34, or 36 or is at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 32, 34, or 36. In some embodiments, the nucleotide sequence encoding the CD19 CAR comprises the nucleotide sequence set forth in SEQ ID NO: 31, 33, or 35 or is at least 80% identical to the nucleotide sequence set forth in SEQ ID NO: 31, 33, or 35.

[0008] In some embodiments, the CAR comprises a CD20 CAR. In some embodiments, the CD20 CAR comprises a signal peptide, an extracellular binding domain specific for CD20, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain. In some embodiments, the signal peptide comprises a CD8α signal peptide, an IgK signal peptide, or a GMCSFR-α signal peptide. In some embodiments, the extracellular binding domain specific for CD20 comprises a scFv, e.g., the V of Leu16. L and V H In some embodiments, the scFv comprises one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 39-41 and 43-44. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 39-41. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 43-44. In some embodiments, the hinge domain comprises a CD8α hinge domain, a CD28 hinge domain, an IgG4 hinge domain, or an IgG4 hinge-CH2-CH3 domain. In some embodiments, the transmembrane comprises a CD8α transmembrane domain or a CD28 transmembrane domain. In some embodiments, the intracellular costimulatory domain comprises a 4-1BB costimulatory domain or a CD28 costimulatory domain. In some embodiments, the intracellular signaling domain comprises a CD3 zeta (ζ) signaling domain.

[0009] In some embodiments, the CAR comprises a CD22 CAR. In some embodiments, the CD22 CAR comprises a signal peptide, an extracellular binding domain specific for CD22, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain. In some embodiments, the signal peptide comprises a CD8α signal peptide, an IgK signal peptide, or a GMCSFR-α signal peptide. In some embodiments, the extracellular binding domain specific for CD22 comprises the V of an scFv, e.g., m971. H and VL In some embodiments, the scFv comprises one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 47-49 and 51-53. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 47-49. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 51-53. In some embodiments, the extracellular binding domain specific for CD22 comprises the V of an scFv, for example m971-L7. H and V L In some embodiments, the scFv comprises one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 56-58 and 60-62. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 56-58. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 60-62. In some embodiments, the hinge domain comprises a CD8α hinge domain, a CD28 hinge domain, an IgG4 hinge domain, or an IgG4 hinge-CH2-CH3 domain. In some embodiments, the transmembrane comprises a CD8α transmembrane domain or a CD28 transmembrane domain. In some embodiments, the intracellular costimulatory domain comprises a 4-1BB costimulatory domain or a CD28 costimulatory domain. In some embodiments, the intracellular signaling domain comprises a CD3 zeta (ζ) signaling domain.

[0010] In some embodiments, the CAR comprises a BCMA CAR. In some embodiments, the BCMA CAR comprises a signal peptide, an extracellular binding domain specific for BCMA, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain. In some embodiments, the signal peptide comprises a CD8α signal peptide, an IgK signal peptide, or a GMCSFR-α signal peptide. In some embodiments, the extracellular binding domain specific for BCMA comprises a scFv, e.g., the V of C11D5.3. Land V H In some embodiments, the scFv comprises one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 65-67 and 69-71. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 65-67. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 69-71. In some embodiments, the extracellular binding domain specific for BCMA comprises the V of the scFv, for example, C12A3.2. L and V HIn some embodiments, the scFv comprises one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 74-76 and 78-80. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 74-76. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 78-80. In some embodiments, the scFv comprises a VL and VH of a CT103A scFv. In some embodiments, the scFv comprises one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 120-122 and 124-126. In some embodiments, the scFv comprises a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 120-122. In some embodiments, the scFv comprises a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 124-126. In some embodiments, the BCMA-specific extracellular binding domain comprises a fully human heavy chain variable domain (FHVH), for example, FHVH33. In some embodiments, the FHVH comprises one or more CDRs having the amino acid sequence set forth in SEQ ID NOs: 82-84. In some embodiments, the hinge domain comprises a CD8α hinge domain, a CD28 hinge domain, an IgG4 hinge domain, or an IgG4 hinge-CH2-CH3 domain. In some embodiments, the transmembrane comprises a CD8α transmembrane domain or a CD28 transmembrane domain. In some embodiments, the intracellular costimulatory domain comprises a 4-1BB costimulatory domain or a CD28 costimulatory domain. In some embodiments, the intracellular signaling domain comprises a CD3 zeta (ζ) signaling domain.

[0011] In some embodiments, the one or more cleavage sites comprises an autocleavage site, e.g., a 2A site. In some embodiments, the 2A site comprises T2A, P2A, E2A, or F2A.

[0012] In some embodiments, the one or more cleavage sites further comprise a protease site, e.g., a furin site. In some embodiments, the furin site comprises an FC1, FC2, or FC3 site. In some embodiments, the protease site is located before the 2A site in 5' to 3' order.

[0013] In some embodiments, the polycistronic vector further comprises (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, the third expression cassette being separated from the first expression cassette and / or the second expression cassette by one or more cleavage sites. In some embodiments, the safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSVtk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, RQR8, and CD47-SIRPα blockers.

[0014] In some embodiments, the polycistronic vector further comprises a promoter.In some embodiments, the promoter is a constitutive promoter, such as EF1α, CMV, SV40, PGK, UBC or CAG promoter.In some embodiments, the promoter is an inducible promoter, such as Tet-On, Tet-Off, AlcA, LexA or Cre promoter.

[0015] In some embodiments, the polycistronic vector is selected from the group consisting of, for example, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d ... The expression cassette further comprises homology arms flanking the expression cassette for insertion by homology directed repair (HDR) into a genomic locus using a site-specific nuclease selected from the group consisting of c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and CRISPR-associated transposases.

[0016] In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD19 CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD19 CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in a 5' to 3' order. In some embodiments, the polycistronic vector further includes: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first expression cassette and / or the second expression cassette by a 2A site.

[0017] In some aspects, a polycistronic vector is provided that comprises: (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor; (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; and (c) one or more cleavage sites separating the first and second expression cassettes, wherein the CD19 CAR comprises a CD8α signal peptide, an FMC63 scFv, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the tolerogenic factor comprises CD47.

[0018] In some aspects, a polycistronic vector is provided that comprises: (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor; (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; and (c) one or more cleavage sites separating the first and second expression cassettes, wherein the CD19 CAR comprises a GMCSFR-α signal peptide, an FMC63 scFv, an IgG4 hinge domain, a CD28 transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the tolerogenic factor comprises CD47.

[0019] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor; (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; and (c) one or more cleavage sites separating the first and second expression cassettes, wherein the CD19 CAR comprises a GMCSFR-α signal peptide, an FMC63 scFv, a CD28 hinge domain, a CD28 transmembrane domain, a CD28 costimulatory domain, and a CD3 zeta signaling domain. In some embodiments, the tolerogenic factor comprises CD47.

[0020] In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD20 CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD20 CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in a 5' to 3' order. In some embodiments, the polycistronic vector further includes: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first expression cassette and / or the second expression cassette by a 2A site.

[0021] In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD22 CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD22 CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in a 5' to 3' order. In some embodiments, the polycistronic vector further includes: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first and / or second expression cassettes by a 2A site.

[0022] In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; (c) a third expression cassette comprising a nucleotide sequence encoding a CD22 CAR; and (d) a 2A site separating any two adjacent expression cassettes. In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; (c) a third expression cassette comprising a nucleotide sequence encoding a CD22 CAR; and (d) a furin site and a 2A site separating any two adjacent expression cassettes, wherein the furin site is located before the 2A site in the 5' to 3' order. In some embodiments, the polycistronic vector further comprises (e) a fourth expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the fourth expression cassette is separated from the first expression cassette, the second expression cassette and / or the third expression cassette by a 2A site.

[0023] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding BCMA CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding BCMA CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in a 5' to 3' order. In some embodiments, the polycistronic vector further comprises: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first and / or second expression cassettes by a 2A site.

[0024] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor; (b) a second expression cassette comprising a nucleotide sequence encoding a BCMA CAR; and (c) one or more cleavage sites separating the first and second expression cassettes, wherein the BCMA CAR comprises a BB2121 binder, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the tolerogenic factor comprises CD47.

[0025] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor; (b) a second expression cassette comprising a nucleotide sequence encoding a BCMA CAR; and (c) one or more cleavage sites separating the first and second expression cassettes, wherein the BCMA CAR comprises a CD8α signal peptide, a CT103A scFv, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the BCMA comprises the amino acid sequence set forth in SEQ ID NO: 128. In some embodiments, the tolerogenic factor comprises CD47.

[0026] In some aspects, a polycistronic vector is provided that includes (a) a first expression cassette comprising a nucleotide sequence encoding CD47, (b) a second expression cassette comprising a nucleotide sequence encoding a safety switch, and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided that includes (a) a first expression cassette comprising a nucleotide sequence encoding CD47, (b) a second expression cassette comprising a nucleotide sequence encoding a safety switch, and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in 5' to 3' order before the 2A site.

[0027] In some aspects, a virus is provided that comprises a polycistronic vector or a fragment thereof according to various embodiments of the present technology. In some embodiments, the virus is an adenovirus, an adeno-associated virus, a retrovirus, a lentivirus, or a phage.

[0028] In some aspects, a host cell is provided comprising a polycistronic vector or a fragment thereof according to various embodiments of the present technology. In some embodiments, the host cell is an autologous cell. In some embodiments, the host cell is an allogeneic cell. In some embodiments, the host cell is an embryonic stem cell (ESC) or an induced pluripotent stem cell (iPSC). In some embodiments, the host cell is differentiated from an ESC or an iPSC. In some embodiments, the host cell is a primary cell. In some embodiments, the host cell is a T cell, a natural killer (NK) cell, or a natural killer T (NKT) cell. In some embodiments, the host cell is a beta pancreatic islet cell. In some embodiments, the host cell is a glial progenitor cell (GPC).

[0029] In some embodiments, the polycistronic vector or fragment thereof is inserted into a specific genomic locus of the host cell selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, the MIC-A locus, the MIC-B locus, and the safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 locus. In some embodiments, the insertion is, for example, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a(Cpf1), Cas12b(C2c1), Cas12c(C2c3), Cas12d(CasY), Cas12e(CasX), Cas12f(C2c10), Cas12g, Cas12h, Cas12i, Cas12k(C2c5), Cas13, Cas13a(C2c2), Cas13b, Cas This is performed by homology directed repair (HDR) using a site-specific nuclease selected from the group consisting of s13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, and CRISPR-associated transposase.

[0030] In some embodiments, the host cell is modified to have reduced expression of one or more MHC I molecules and / or one or more MHC II molecules, optionally wherein the one or more MHC I molecules are selected from the group consisting of HLA-A, HLA-B, HLA-C, and optionally wherein the one or more MHC II molecules are selected from the group consisting of HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO. In some embodiments, the host cell has reduced expression of B2M, TAP1, and / or CIITA. In some embodiments, the host cell has a knockout of B2M, TAP1, and / or CIITA. In some embodiments, the B2M, TAP1, and / or CIITA knockout is in both alleles. In some embodiments, the host cell has reduced expression of MIC-A and / or MIC-B. In some embodiments, the host cell has a knockout of MIC-A and / or MIC-B. In some embodiments, the knockout of MIC-A and / or MIC-B is performed at both alleles.

[0031] In some aspects, a T cell is provided that comprises a polycistronic vector or a fragment thereof, the polycistronic vector comprising a first expression cassette comprising a nucleotide sequence encoding CD47 and a second expression cassette comprising a nucleotide sequence encoding a CAR. In some aspects, a T cell is provided that comprises a polycistronic vector or a fragment thereof, the polycistronic vector comprising a first expression cassette comprising a nucleotide sequence encoding CD47 and a second expression cassette comprising a nucleotide sequence encoding a CAR, the T cell having a knockout of B2M, TAP1, and / or CIITA. In some embodiments, the B2M, TAP1, and / or CIITA knockout is in both alleles. In some embodiments, the polycistronic vector or a fragment thereof is inserted into a specific genomic locus of the T cell selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, the MIC-A locus, the MIC-B locus, and the safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 loci. In some embodiments, the CAR comprises a CD19 CAR, a CD20 CAR, a CD22 CAR, or a BCMA CAR. In some embodiments, the CAR is a CD19 CAR comprising a CD8α signal peptide, an FMC63 scFv, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the CAR is a CD19 CAR comprising a GMCSFR-α signal peptide, an FMC63 scFv, an IgG4 hinge domain, a CD28 transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.In some embodiments, the CAR is a CD19 CAR comprising a GMCSFR-α signal peptide, an FMC63 scFv, a CD28 hinge domain, a CD28 transmembrane domain, a CD28 costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the CAR is a CD19 CAR comprising an amino acid sequence set forth in SEQ ID NO: 117 or at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 117. In some embodiments, the CAR is a CD19 CAR comprising an amino acid sequence set forth in SEQ ID NO: 32, 34, or 36 or an amino acid sequence at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 32, 34, or 36. In some embodiments, the CAR is a BCMA CAR comprising a CD8α signal peptide, a CT103A scFv, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. In some embodiments, the CAR is a BCMA CAR comprising an amino acid sequence set forth in SEQ ID NO: 128 or at least 80% identical to the amino acid sequence set forth in SEQ ID NO: 128.

[0032] In some aspects, a cell is provided having a genomic locus modified by HDR, the genomic locus being selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, the MIC-A locus, the MIC-B locus, and a safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 locus. In some embodiments, the HDR is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a(Cpf1), Cas12b(C2c1), Cas12c(C2c3), Cas12d(CasY), Cas12e(CasX), Cas12f(C2c10), Cas12g, Cas12h, Cas12i, Cas12k(C2c5), Cas13, Cas13a(C2c2), Cas13b(C2c3), Cas13c(C2c4), Cas13d(CasY), Cas12e(CasX), Cas12f(C2c10), Cas12g, Cas12h, Cas12i, Cas12k(C2c5), Cas13, Cas13a(C2c2), Cas13c(C2c4), Cas13d(CasY), Cas13e(CasX), Cas13f(C2c10), Cas13c(C2c4 ... A site-specific nuclease selected from the group consisting of as13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, and CRISPR-associated transposase is used.

[0033] In some aspects, an iPSC-derived β pancreatic islet cell is provided having (1) reduced expression of MHC I and / or MHC II, and (2) a transgene comprising CD47 and a safety switch inserted at a safe harbor locus, where the safe harbor locus is selected from the group consisting of AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 loci. In some aspects, an iPSC-derived β pancreatic islet cell is provided having (1) reduced expression of MHC I and / or MHC II, and (2) a transgene comprising CD47 and HSVtk flanked by CLYBL homology arms, where the transgene is inserted at the CLYBL locus. In some embodiments, the iPSC-derived pancreatic beta islet cells have a knockout of B2M, TAP1, and / or CIITA, hi some embodiments, the B2M, TAP1, and / or CIITA knockout is in both alleles.

[0034] In some aspects, ESC-derived GPCs are provided that have (1) reduced expression of MHC I and / or MHC II, and (2) a transgene comprising CD47 and a safety switch inserted at a safe harbor locus, where the safe harbor locus is selected from the group consisting of AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 loci. In some aspects, ESC-derived GPCs are provided that have (1) reduced expression of MHC I and / or MHC II, and (2) a transgene comprising CD47 and HSVtk flanked by CLYBL homology arms, where the transgene is inserted at the CLYBL locus. In some embodiments, the ESC-derived GPCs have knockouts of B2M, TAP1, and / or CIITA. In some embodiments, the B2M, TAP1, and / or CIITA knockout is made in both alleles.

[0035] In some aspects, compositions are provided that include polycistronic vectors according to various embodiments of the present technology. In some aspects, compositions are provided that include viruses according to various embodiments of the present technology. In some aspects, pharmaceutical compositions are provided that include host cells or cells according to various embodiments of the present technology.

[0036] In some aspects, a guide RNA (gRNA) is provided for use in HDR-mediated insertion of a transgene into a genomic locus selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, the MIC-A locus, the MIC-B locus, and a safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 locus.

[0037] In some embodiments, the gRNA comprises a crRNA and optionally a tracrRNA. In some embodiments, the gRNA comprises a crRNA and a tracrRNA as two separate molecules. In some embodiments, the gRNA comprises a crRNA and a tracrRNA as a single guide RNA (sgRNA). In some embodiments, the sgRNA comprises a complementary region, a crRNA repeat region, a tetraloop, and a tracrRNA.

[0038] In some embodiments, the crRNA repeat region comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:95, SEQ ID NO:99, SEQ ID NO:103, or SEQ ID NO:108. In some embodiments, the tetraloop comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:96 or SEQ ID NO:107. In some embodiments, the tracrRNA comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:97, SEQ ID NO:101, SEQ ID NO:105, or SEQ ID NO:106.

[0039] In some embodiments, the crRNA comprises a complementary region specific to a region of the AAVS1, CLYBL, or CCR5 locus. In some embodiments, the region is a coding sequence (CDS), an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region. In some embodiments, the complementary region comprises, consists of, or consists essentially of the nucleotide sequence set forth in SEQ ID NO:110, SEQ ID NO:111, or SEQ ID NO:112.

[0040] In some embodiments, a guide RNA (gRNA) for use in HDR-mediated insertion of a transgene into a genomic locus is provided, the genomic locus being located within 4000 bp of a locus in chromosome 19 at positions 55,117,222-55,112,796, chromosome 13 at positions 99,773,011-99,858,860, or chromosome 3 at positions 46,372,892-46,376,206. In certain of these embodiments, the locus is within 4000 bp, within 3500 bp, within 3000 bp, within 2500 bp, within 2000 bp, within 1500 bp, within 1000 bp, or within 500 bp of chromosome 19 at 55,115,674, chromosome 13 at 99,822,980, or chromosome 3 at 46,373,180. In certain embodiments, the gRNA is configured to generate a cleavage site at 55,115,674 on chromosome 19, 99,822,980 on chromosome 13, or 46,373,180 on chromosome 3, or within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 55,115,674 on chromosome 19, 99,822,980 on chromosome 13, or 46,373,180 on chromosome 3.

[0041] In some embodiments, a composition is provided that comprises a gRNA according to various embodiments of the present technology. In some embodiments, the composition further comprises a site-specific nuclease or a nucleotide sequence encoding a site-specific nuclease protein as described herein.

[0042] In some embodiments, a composition comprising a gRNA according to various embodiments of the present technology is formulated for delivery into a cell. In some embodiments, the cell further comprises a site-specific nuclease or a nucleotide sequence encoding a site-specific nuclease protein as described herein.

[0043] In some embodiments, a method of HDR-mediated insertion of a transgene into a genomic locus comprises introducing into a host cell a gRNA, a site-specific nuclease or a nucleotide sequence encoding the site-specific nuclease, and a transgene flanked by homology arms, wherein the site-specific nuclease is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f ( C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and CRISPR-associated transposases. In some embodiments, the genomic locus is selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, the MIC-A locus, the MIC-B locus, and a safe harbor locus. In some embodiments, the safe harbor locus is selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 locus.

[0044] In some embodiments, the method includes introducing a gRNA according to various embodiments of the present technology. In some embodiments, the genomic locus is located within 4000 bp of a locus at 55,117,222-55,112,796 on chromosome 19, 99,773,011-99,858,860 on chromosome 13, or 46,372,892-46,376,206 on chromosome 3. In certain of these embodiments, the locus is within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of 55,115,674 on chromosome 19, 99,822,980 on chromosome 13, or 46,373,180 on chromosome 3. In certain embodiments, the gRNA is configured to generate a cleavage site at 55,115,674 on chromosome 19, 99,822,980 on chromosome 13, or 46,373,180 on chromosome 3, or within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 55,115,674 on chromosome 19, 99,822,980 on chromosome 13, or 46,373,180 on chromosome 3.

[0045] In some embodiments, the transgene comprises (a) a first expression cassette comprising a nucleotide sequence encoding a tolerogenic factor, (b) a second expression cassette comprising a nucleotide sequence encoding a chimeric antigen receptor (CAR), (c) a third expression cassette comprising a nucleotide sequence encoding a safety switch, and / or (d) one or more cleavage sites separating the first expression cassette, the second expression cassette, and / or the third expression cassette.

[0046] In some aspects, methods are provided for identifying a new genomic locus for HDR-mediated insertion of a transgene, comprising: (a) identifying the location of the genomic locus based on a known gRNA; and (b) scanning an approximately 500-4000 bp region on either side of the genomic locus for PAM sequences. In some embodiments, the genomic locus is located within 4000 bp of a locus at 55,117,222-55,112,796 on chromosome 19, 99,773,011-99,858,860 on chromosome 13, or 46,372,892-46,376,206 on chromosome 3. In some embodiments, the genomic locus is located at a position selected from the group consisting of 55,115,674 on chromosome 19, or a position within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 55,115,674 on chromosome 19; 99,822,980 on chromosome 13, or a position within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 99,822,980 on chromosome 13; and 46,373,180 on chromosome 3, or a position within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 46,373,180 on chromosome 3.

[0047] In some aspects, methods are provided for treating a disease in a subject in need thereof, comprising administering to the subject a host cell or cells, or a composition comprising a host cell or cells, according to various embodiments of the technology.

[0048] In some embodiments, the disease is a cancer, e.g., a cancer associated with expression of CD19, CD20, CD22, and / or BCMA. In some embodiments, the cancer is a hematological malignancy. In some embodiments, the hematological malignancy is selected from the group consisting of myeloid neoplasms, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), B-cell acute lymphocytic leukemia (B-ALL), T-cell acute lymphocytic leukemia (T-ALL), T-cell lymphoma, and B-cell lymphoma. In some embodiments, the hematological malignancy is a B-lymphocyte-derived malignancy.

[0049] In some embodiments, the disease comprises an autoimmune disease, such as lupus, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, psoriatic arthritis, multiple sclerosis, Crohn's disease, ulcerative colitis, Addison's disease, Graves' disease, Sjogren's syndrome, Hashimoto's thyroiditis, and celiac disease.

[0050] In some embodiments, the disease is diabetes, including, for example, type 1 diabetes, type 2 diabetes, pre-diabetes, and gestational diabetes.

[0051] In some embodiments, the disease is a neurological disease, including, for example, catalepsy, epilepsy, encephalitis, meningitis, migraine, Huntington's disease, Alzheimer's disease, Parkinson's disease, Pelizaeus-Merzbach disease, and multiple sclerosis.

[0052] In some aspects, compositions are provided comprising a first polycistronic vector and a second polycistronic vector, wherein the first polycistronic vector comprises a nucleotide sequence encoding a first tolerogenic factor and a nucleotide sequence encoding a first CAR, separated by one or more cleavage sites, and the second polycistronic vector comprises a nucleotide sequence encoding a second tolerogenic factor and a nucleotide sequence encoding a second CAR, separated by one or more cleavage sites. In some embodiments, the first tolerogenic factor and the second tolerogenic factor are independently selected from the group consisting of A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, CR1, DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, serpin b9, CCl21, and Mfge8. In some embodiments, the first tolerogenic factor and the second tolerogenic factor comprise CD47. In some embodiments, CD47 comprises an amino acid sequence that is at least 80% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 1-5. In some embodiments, the first CAR and the second CAR are different and are independently selected from the group consisting of CD19 CAR, CD20 CAR, CD22 CAR, and BCMA CAR. In some embodiments, the first CAR and / or the second CAR comprises an amino acid sequence set forth in any one of SEQ ID NOs: 32, 34, 36, 117, 128, and 136, or is at least 80% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 32, 34, 36, 117, 128, and 136. In some embodiments, the first CAR is a CD19 CAR and the second CAR is a CD22 CAR.

[0053] In some aspects, compositions are provided that include a first virus comprising a first polycistronic vector and a second virus comprising a second polycistronic vector, the first polycistronic vector comprising a nucleotide sequence encoding a first tolerogenic factor and a nucleotide sequence encoding a first CAR, separated by one or more cleavage sites, and the second polycistronic vector comprising a nucleotide sequence encoding a second tolerogenic factor and a nucleotide sequence encoding a second CAR, separated by one or more cleavage sites. In some embodiments, the first virus and / or the second virus is an adenovirus, an adeno-associated virus, a retrovirus, a lentivirus, or a phage. In some embodiments, the first tolerogenic factor and the second tolerogenic factor are independently selected from the group consisting of A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, CR1, DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, serpin b9, CCl21, and Mfge8. In some embodiments, the first tolerogenic factor and the second tolerogenic factor comprise CD47. In some embodiments, CD47 comprises an amino acid sequence that is at least 80% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 1-5. In some embodiments, the first CAR and the second CAR are different and are independently selected from the group consisting of CD19 CAR, CD20 CAR, CD22 CAR, and BCMA CAR. In some embodiments, the first CAR and / or the second CAR comprises an amino acid sequence set forth in any one of SEQ ID NOs: 32, 34, 36, 117, 128, and 136, or is at least 80% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 32, 34, 36, 117, 128, and 136. In some embodiments, the first CAR is a CD19 CAR and the second CAR is a CD22 CAR.

[0054] In some aspects, methods of generating a heterogeneous population of host cells are provided, comprising introducing a composition according to various embodiments of the present technology into the population of host cells. In some aspects, heterogeneous populations of host cells generated by the methods described are provided. In some aspects, pharmaceutical compositions comprising the population of host cells described are provided. In some aspects, methods of treating a disease in a subject in need thereof are provided, comprising administering to the subject a population of host cells described or a pharmaceutical composition comprising the population of host cells.

[0055] In some aspects, there is provided a host cell having reduced expression of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and / or MIC-B, and increased expression of one or more tolerogenic factors selected from the group consisting of HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor, wherein the one or more tolerogenic factors are carried in a polycistronic vector or fragment thereof according to any one of claims 1 to 118.

[0056] In some embodiments, the reduced expression of MHC class I molecules is due to reduced expression of B2M. In some embodiments, the reduced expression of MHC class II molecules is due to reduced expression of CIITA. In some embodiments, the reduced expression of MHC class I molecules and / or MHC class II molecules is due to reduced expression of MIC-A and / or MIC-B. In some embodiments, the host cell has a knockout of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and / or MIC-B. In some embodiments, the host cell has a knockout of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and MIC-B. In some embodiments, the host cell has a knockout of MHC class I molecules, MHC class II molecules, MIC-A, and MIC-B. In some embodiments, the knockout is Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a(Cpf1), Cas12b(C2c1), Cas12c(C2c3), Cas12d(CasY), Cas12e(CasX), Cas12f(C2c10), Cas12g, Cas12h, Cas12i, Cas12k(C2c5), Cas13, Cas13a(C2c2), Cas This is achieved by use of a site-specific nuclease selected from the group consisting of s13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, and CRISPR-associated transposase.

[0057] In some embodiments, the one or more tolerogenic factors comprise HLA-E. In some embodiments, the one or more tolerogenic factors are one or more tolerogenic factors comprising CD24. In some embodiments, the one or more tolerogenic factors comprise CD47. In some embodiments, the one or more tolerogenic factors comprise PD-L1. In some embodiments, the one or more tolerogenic factors comprise CD24, CD47, and PD-L1. In some embodiments, the one or more tolerogenic factors comprise CD46. In some embodiments, the one or more tolerogenic factors comprise CD55. In some embodiments, the one or more tolerogenic factors comprise CD59. In some embodiments, the one or more tolerogenic factors comprise C1 inhibitor. In some embodiments, the one or more tolerogenic factors comprise CD46, CD55, CD59, and C1 inhibitor. In some embodiments, the one or more tolerogenic factors include HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor.

[0058] In some embodiments, the host cell is a pluripotent stem cell (PSC). In some embodiments, the PSC is an ESC or an iPSC. In some embodiments, the host cell is differentiated from an ESC or an iPSC. In some embodiments, the host cell is a primary cell. In some embodiments, the host cell is a T cell, a NK cell, a NKT cell, a beta pancreatic islet cell, or a GPC.

[0059] In some embodiments, the polycistronic vector further comprises a nucleotide sequence encoding an additional exogenous component, which in some embodiments is a safety switch selected from the group consisting of herpes simplex virus thymidine kinase (HSVtk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), and rapamycin-activated caspase 9 (rapaCasp9).

[0060] In some aspects, there is provided a T cell having reduced expression of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and / or MIC-B, and increased expression of one or more tolerogenic factors selected from the group consisting of HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor, wherein the one or more tolerogenic factors are carried in a polycistronic vector or a fragment thereof according to any one of claims 1 to 118.

[0061] In some aspects, there is provided a NK cell having reduced expression of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and / or MIC-B, and increased expression of one or more tolerogenic factors selected from the group consisting of HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor, wherein the one or more tolerogenic factors are carried in a polycistronic vector or a fragment thereof according to any one of claims 1 to 118.

[0062] In some aspects, there is provided a pancreatic islet cell having reduced expression of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and / or MIC-B, and increased expression of one or more tolerogenic factors selected from the group consisting of HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor, wherein the one or more tolerogenic factors are carried in a polycistronic vector or a fragment thereof according to any one of claims 1 to 118.

[0063] In some embodiments, the reduced expression of MHC class I molecules is due to reduced expression of B2M. In some embodiments, the reduced expression of MHC class II molecules is due to reduced expression of CIITA. In some embodiments, the reduced expression of MHC class I molecules and / or MHC class II molecules is due to reduced expression of MIC-A and / or MIC-B. In some embodiments, the cell has a knockout of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and / or MIC-B. In some embodiments, the cell has a knockout of one or more MHC class I molecules, one or more MHC class II molecules, MIC-A, and MIC-B. In some embodiments, the cell has a knockout of MHC class I molecules, MHC class II molecules, MIC-A, and MIC-B. In some embodiments, the knockout is Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a(Cpf1), Cas12b(C2c1), Cas12c(C2c3), Cas12d(CasY), Cas12e(CasX), Cas12f(C2c10), Cas12g, Cas12h, Cas12i, Cas12k(C2c5), Cas13, Cas13a(C2c2), Cas This is achieved by use of a site-specific nuclease selected from the group consisting of s13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, and CRISPR-associated transposase.

[0064] In some embodiments, the one or more tolerogenic factors comprise HLA-E. In some embodiments, the one or more tolerogenic factors are one or more tolerogenic factors comprising CD24. In some embodiments, the one or more tolerogenic factors comprise CD47. In some embodiments, the one or more tolerogenic factors comprise PD-L1. In some embodiments, the one or more tolerogenic factors comprise CD24, CD47, and PD-L1. In some embodiments, the one or more tolerogenic factors comprise CD46. In some embodiments, the one or more tolerogenic factors comprise CD55. In some embodiments, the one or more tolerogenic factors comprise CD59. In some embodiments, the one or more tolerogenic factors comprise C1 inhibitor. In some embodiments, the one or more tolerogenic factors comprise CD46, CD55, CD59, and C1 inhibitor. In some embodiments, the one or more tolerogenic factors include HLA-E, CD24, CD47, PD-L1, CD46, CD55, CD59, and C1 inhibitor.

[0065] In some embodiments, the host cells are differentiated from ESCs or iPSCs. In some embodiments, the host cells are primary cells.

[0066] In some embodiments, the polycistronic vector further comprises a nucleotide sequence encoding an additional exogenous component, which in some embodiments is a safety switch selected from the group consisting of herpes simplex virus thymidine kinase (HSVtk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), and rapamycin-activated caspase 9 (rapaCasp9). [Brief description of the drawings]

[0067] [Figure 1A]Schematic diagram showing the design and alternative designs of bicistronic vectors according to certain embodiments of the present technology. The general design of CD47-CD19 CAR bicistronic vector is shown, where the vector has an EF1α promoter, a coding sequence for CD47, a cleavage site, and a coding sequence for CD19 CAR. The cleavage site can optionally have a 2A site plus a furin site (top) or only a 2A site (bottom). FC = furin cleavage site. [Figure 1B] 1 is a schematic diagram showing bicistronic vector designs and alternative designs according to certain embodiments of the present technology, showing a co-transduction design using two lentiviral vectors encoding CD19 CAR and CD47, respectively, to transduce cells. [Figure 1C] 1 is a schematic diagram showing the design of a bicistronic vector according to certain embodiments of the present technology and an alternative design, which shows an alternative design of a CD19 CAR-CD47 vector in which the 5' to 3' order of CD47 and CD19 CAR is reversed, i.e., CD19 CAR is located in the first expression cassette and CD47 is located in the second expression cassette of the bicistronic vector. [Diagram 2] Figure 1 shows flow cytometry plots showing expression levels of CD47 (vertical scale) and CD19 CAR (horizontal scale) in primary T cells transfected with the vector construct(s) shown in the figure. LV = lentiviral virus, *co = codon optimized, Koz = Kozak consensus sequence. [Diagram 3] FIG. 1 shows the expression levels of CD47 in cells transduced with the different vector constructs indicated. [Figure 4] FIG. 1 shows the expression levels of CD19 CAR in cells transduced with the different vector constructs indicated in the figure. [Diagram 5] Shown is total CD47 molecular weight in HIP CAR-T cells (with HLA-I / II knockout (KO) with B2M and CIITA deletion) transduced with the different vector constructs indicated in the figure. [Figure 6] Shown are the results of an in vitro xCELLigence assay of natural killing (NK) and macrophage killing in HIP CAR-T cells transduced with CD47-CD19 CAR. KO = knockout, copt = codon optimized. [Figure 7] A is a schematic diagram showing the design of a bicistronic vector for co-expression of CD47 and a safety switch. The bicistronic vector includes a construct comprising a CAG promoter, a coding sequence for CD47, and a coding sequence for a safety switch (e.g., cytosine deaminase (CyD), herpes simplex virus thymidine kinase (HSVtk)), followed by an HA tag. The coding sequence for CD47 and the coding sequence for the safety switch are separated by a 2A site. In the 5' to 3' order, the coding sequence for the safety switch can be placed in front of the coding sequence for CD47 (top) or vice versa (bottom). The construct can be flanked by left and right homology arms (LHA, RHA) complementary to the regions flanking the CLYBL safe harbor locus for site-specific insertion by homology directed repair (HDR). B shows the design of a bicistronic vector for co-expression of CD47 and CyD according to certain embodiments of the present technology. The bicistronic vector comprises a construct with a CAG promoter, a coding sequence for CyD followed by an HA tag, a 2A site, and a coding sequence for CD47. The construct is flanked by the LHA and RHA of CLYBL for site-specific insertion into the safe harbor locus of CLYBL. C shows another bicistronic vector design for co-expression of CD47 and HSVtk according to certain embodiments of the technology. The bicistronic vector comprises a construct with a CAG promoter, a coding sequence for CD47, a 2A site, and a coding sequence for HSVtk followed by an HA tag. The construct is flanked by the LHA and RHA of CLYBL for site-specific insertion into the safe harbor locus of CLYBL. [Figure 8]The expression levels of CD47 in wild-type (WT) iPSCs and iPSCs transduced with CyD-CD47 (clone 2-G11 is shown as a representative example) and after differentiation are shown. [Figure 9] CyD killing curves as measured by cell number for clones 2-G09 and 2-G11 in the presence of different concentrations (μM) of 5-fluorocytosine (5-FC). Open triangles represent iPSCs and closed triangles represent differentiated cells. [Figure 10] Shown are CD47 expression levels in CD47-HSVtk clones 1-B10, 1-C02, 2-F09, and 1-H04 over a two week period. [Figure 11] The fold overexpression levels of CD47 in CD47-HSVtk clones 1-B10, 1-C02, 2-F09, and 1-H04 are shown relative to WT, using CyD-CD47 clone 2-G09 as a control. [Figure 12] Figure 1 shows the killing curves of HSVtk as measured by % viable cells for CD47-HSVtk clones 1-B10, 1-C02, 2-F09, 1-G10, and 1-H04 in the presence of different concentrations (μM) of ganciclovir (GCV). The calculated IC50 and R-squared (R2) values ​​for each clone are also shown. [Figure 13] The designs of the CD47-CD19 CAR bicistronic vector (top) and the CD47-CD22 CAR bicistronic vector (bottom) are shown. [Figure 14] Physical and functional assays of CD47-CD19 CAR, CD47-CD22 CAR (PLAS2199), and CD22 CAR-CD47 (PLAS2218) lentiviruses are shown. Left panel = genomic quantification assay (GQA), middle panel = functional titer assay, right panel = particle-to-infectivity assay. [Figure 15] Shown is the workflow of the dual transduction approach using CD47-CD19 CAR and CD47-CD22 CAR / CD22 CAR-CD47 lentivirus. [Figure 16]An exemplary gating strategy for flow cytometry analysis of transduced T cells to examine expression levels of CD47, CD19 CAR, and CD22 CAR is shown. [Figure 17] Flow cytometry plots showing expression levels of CD19 CAR (vertical scale) and CD22 CAR (horizontal scale) in CD4+ (upper panel) and CD8+ (lower panel) T cells transduced with the lentivirus(es) indicated in the figure. [Figure 18] The efficiency of single and double transduction approaches as indicated by the percentage of CAR-expressing cells across different donors and virus lots is shown. Each top panel shows the percentage of the total generated cell population, and each bottom panel shows the percentage of total transduced cells. The color of each symbol represents an independent donor, CD19 CAR virus, or CD22 CAR virus, respectively. [Figure 19] Median fluorescence intensity (MFI) of CD47, CD19 CAR and CD22 CAR expression levels in donor cells transduced with the lentivirus(es) indicated in the figure is shown. [Figure 20] FIG. 1 shows CD47 expression levels as quantified by QiFi (Agilent) analysis and vector copy number (VCN) in donor cells transduced with the lentivirus(es) indicated in the figure. [Figure 21] A shows the assay workflow testing the VCN of single and double transduction approaches with the lentivirus(es) indicated in the figure, and B shows the VCN of double and single transduced cells. [Figure 22]Shown are the results of cytotoxicity (IncuCyte®, top panels) and cytokine (Meso Scale Discovery, bottom panels) assays of red fluorescent protein (RFP)-labeled control NALM, NALM CD19 knockout (KO), and NALM CD22 KO cells treated with T cells single transduced with CD47-CD19 CAR (CD19 CAR-T cells), CD47-CD22 CAR (CD22 CAR-T cells), or CD47-CD19 CAR / CD47-CD22 CAR-T cells (CD19×CD22 CAR-T cells) as indicated. Cytotoxicity was measured by total integrated intensity of RFP versus time. [Figure 23] Figure 1 shows the cytotoxicity measured by luciferase assay of T cells transduced with (1) mock, (2) CD47-CD19 CAR lentivirus only, (2) CD22 CAR-CD47 lentivirus only, (3) CD47-CD22 CAR lentivirus only, (4) a mixture of CD47-CD19 CAR lentivirus and CD22 CAR-CD47 lentivirus (CD47-CD19 CAR×CD22 CAR-CD47), and (5) a mixture of CD47-CD19 CAR lentivirus and CD47-CD22 CAR lentivirus (CD47-CD19 CAR×CD47-CD22 CAR) against NALM and RAJI tumor cells at different effector (E) to target (T) (E:T) ratios as indicated. E:T ratio was defined as the ratio of the number of T cells to the number of NALM or RAJI cells. [Figure 24] Figure 1 shows the workflow for generating, selecting and testing single or double transduced CAR-T cells. CAR selection 1 uses anti-idiotype-biotin and anti-biotin microbeads for CD19 CAR and double transduced T cells, and soluble CD22-biotin for CD22 CAR. CAR selection 2 uses soluble CD22-biotin for CD22 CAR in the double transduced population. [Diagram 25]Flow cytometry plots showing expression levels of CD19 CAR (vertical scale) and CD22 CAR (horizontal scale) in CD4+ (left panels) and CD8+ (right panels) T cells transduced with the lentivirus(es) indicated before (top panels) and after (bottom panels) sorting. [Figure 26] Cytotoxicity curves of RFP-labeled NALM cells treated with mock, CD19 CAR-T, CD22 CAR-T, or CD19xCD22 CAR-T cells as indicated are shown. Cytotoxicity was measured by total integrated intensity of RFP versus time. E:T ratios are shown in the lower left corner of each graph and are based on the ratio of CAR-expressing T cell numbers to NALM cell numbers. [Figure 27] Cytotoxicity curves of RFP-labeled CD19 knockout NALM cells treated with mock, CD19 CAR-T, CD22 CAR-T, or CD19xCD22 CAR-T cells as indicated are shown. Cytotoxicity was measured by total integrated intensity of RFP versus time. E:T ratios are shown in the lower left corner of each graph and are based on the ratio of CAR-expressing T cell numbers to NALM cell numbers. [Figure 28] Cytotoxicity curves of RFP-labeled CD22 knockout NALM cells treated with mock, CD19 CAR-T, CD22 CAR-T, or CD19xCD22 CAR-T cells as indicated are shown. Cytotoxicity was measured by total integrated intensity of RFP versus time. E:T ratios are shown in the lower left corner of each graph and are based on the ratio of CAR-expressing T cell numbers to NALM cell numbers. [Figure 29] Cytokine levels (vertical scale) are shown in control, CD19 knockout, and CD22 knockout NALM cells treated with mock, CD19 CAR-T cells, CD22 CAR-T cells, or CD19xCD22 CAR-T cells at different E:T ratios (horizontal scale) as indicated. [Diagram 30]1 shows the study design to test the tumor growth suppression ability of CD22 CAR-T cells and dual-transduced CD19×CD22 CAR-T cells in a CD19 knockout NALM tumor-implanted mouse model. [Diagram 31] 1 shows effective inhibition of tumor growth by CD22 CAR-T cells and CD19 CAR×CD22 CAR-T cells in the CD19 knockout NALM mouse model as measured by tumor cell bioluminescence. [Diagram 32] Shows effective inhibition of tumor growth by CD22 CAR-T cells and CD19 CAR×CD22 CAR-T cells in the CD19 knockout NALM mouse model as measured by whole-mouse imaging. [Diagram 33] Shows effective inhibition of tumor growth by CD22 CAR-T cells and CD19 CAR×CD22 CAR-T cells in the RAJI mouse model, as measured by tumor cell bioluminescence. [Diagram 34] Shows effective inhibition of tumor growth by CD22 CAR-T cells and CD19 CAR×CD22 CAR-T cells in the RAJI mouse model as measured by whole-mouse imaging. [Diagram 35] A study design is shown to compare the tumor growth suppression ability of dual-transduced or dual-transduced and selected CD19×CD22 CAR-T cells with the combination of CD19 and CD22 CAR-T cells in a NALM tumor-implanted mouse model. [Diagram 36] Showing more effective inhibition of tumor growth by dual-transduced or dual-transduced and sorted CD19×CD22 CAR-T cells compared to a mixture of single-transduced CAR-T cells in the NALM mouse model as measured by tumor cell bioluminescence. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0068] Detailed Description The present disclosure provides polycistronic vectors for co-expressing one or more tolerogenic factors (e.g., CD47, HLA-E, HLA-G, PD-L1, CTLA-4, etc.), one or more CARs (e.g., CD19 CAR, CD22 CAR, BCMA CAR, etc.), and optionally one or more safety switches in host cells for various cell-based therapies. As described herein, overexpression of tolerogenic factors, often in conjunction with other genetic modifications (e.g., B2M and CIITA knockout), for example in allogeneic cells, can improve the low immunogenicity of the resulting cells, thereby enhancing the efficacy of the cell-based therapy, as the cells will not be subject to immune rejection when transplanted into a recipient. In contrast, the inclusion of a safety switch in a polycistronic vector allows for controlled killing of the cells in the event of cytotoxicity or other adverse effects on the recipient, thereby enhancing the safety of cell-based therapies, including those that use tolerogenic factors.

[0069] While the present disclosure can be implemented in various forms, the following description of some embodiments is provided with the understanding that the disclosure should be considered as an example of the present invention and is not intended to limit the present invention to the specific embodiments shown. Each heading is provided for convenience only and should not be construed as limiting the present invention in any manner. An embodiment shown under any heading can be combined with an embodiment shown under any other heading.

[0070] The use of numerical values ​​in the various quantitative values ​​specified in this application, unless otherwise specified, is described as an approximation, as if the word "about" were to precede both the minimum and maximum values ​​in the range described. It should be understood that, although not always explicitly stated, all numerical designations are preceded by the word "about". It will be understood that such range formats are used for convenience and brevity, and should be interpreted flexibly to include not only the numerical values ​​explicitly stated as limits of a range, but also to include all individual numerical values ​​and subranges encompassed within the range, as if each numerical value and subrange were explicitly stated. For example, a ratio range of about 1 to about 200 should be understood to include not only the explicitly stated limits of about 1 and about 200, but also individual ratios such as about 2, about 3, and about 4, as well as subranges such as about 10 to about 50, about 20 to about 100, etc. It is also to be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents thereof are well known in the art.

[0071] To the extent that any material incorporated by reference herein conflicts with the present disclosure, the present disclosure controls.

[0072] definition As used herein, when referring to a measurable value, such as an amount or concentration, the term "about" is meant to encompass a variation of 20%, 10%, 5%, 1%, 0.5% or even 0.1% of the specified amount.

[0073] The term "antibody" is used to refer to naturally occurring antibodies as well as genetically engineered or otherwise modified forms of immunoglobulins or portions thereof, including chimeric, human, humanized, or synthetic antibodies. Antibodies may be monoclonal or polyclonal. In those embodiments in which the antibody is an immunogenically active portion of an immunoglobulin molecule, the antibody may include, but is not limited to, single chain variable fragment antibodies (scFv), disulfide-linked Fv, single domain antibodies (sdAb), VHH antibodies, antigen-binding fragments (Fab), Fab', F(ab')2 fragments, or diabodies. scFv antibodies are antibodies that combine the heavy chain (V) of an immunoglobulin with the heavy chain (V H ) and light chain (V L Disulfide-linked Fv antibodies are derived from antibodies by linking the variable regions of V and VD with a short linker peptide. Similarly, disulfide-linked Fv antibodies are made up of V and VD domains linked together using interdomain disulfide bonds. H and V L In contrast, sdAbs consist only of the variable regions of either the heavy or light chains and are usually the smallest antigen-binding fragments of antibodies. VHH antibodies are antigen-binding fragments of only the heavy chains. Diabodies consist of VHH antibodies that are non-covalently linked by small peptide linkers or covalently linked to each other. H and V L The antibodies disclosed herein, including those comprising an immunogenically active portion of an immunoglobulin molecule, retain the ability to bind to a particular antigen.

[0074] As used herein, the term "antigen" refers to a molecule that can induce an immune response. Antigens include, but are not limited to, cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide complexes, peptide and non-peptide mimetics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts, and multicellular organisms such as parasites, and allergens. In a broad sense, the term antigen includes any type of molecule that is recognized as foreign by the host immune system.

[0075] The terms "autoimmune disease," "autoimmune disorder," "inflammatory disease," or "inflammatory disorder" refer to any disease or disorder in which a subject develops an immune response against its own tissues and / or cells. Autoimmune disorders can affect almost every organ system in a subject (e.g., a human), including, but not limited to, diseases of the nervous system, gastrointestinal system, and endocrine system, as well as skin and other connective tissues, eyes, blood, and blood vessels. Examples of autoimmune diseases include, but are not limited to, Hashimoto's thyroiditis, systemic lupus erythematosus, Sjogren's syndrome, Graves' disease, scleroderma, rheumatoid arthritis, multiple sclerosis, myasthenia gravis, and diabetes.

[0076] "Binding domain", also referred to as "binding region", refers to an antibody or a portion thereof that has the ability to specifically and non-covalently associate, integrate or bind to a target. Binding domains include any natural, synthetic, semi-synthetic or recombinantly produced binding partner to a biological molecule, molecular complex or other target of interest. Exemplary binding domains include receptor ectodomains, ligands, scFvs, disulfide-linked Fvs, sdAbs, VHH antibodies, Fab fragments, Fab' fragments, F(ab')2 fragments, diabodies, or other synthetic polypeptides selected for their specific ability to bind to a biological molecule, molecular complex or other target of interest.

[0077] The term "chimeric antigen receptor (CAR)", also known as chimeric T cell receptor or artificial T cell receptor, refers to an artificially engineered receptor that combines both antigen binding and T cell activation functions. CARs can include an extracellular portion that includes a binding domain, such as a binding domain obtained or derived from an antibody (e.g., scFv). The extracellular portion may be linked to one or more intracellular signaling or effector domains via a transmembrane domain. CARs can optionally include an intracellular co-stimulatory domain(s). (See, e.g., Sadelain et al., Cancer Discov., 3(4):388-398 (2013); see also Harris & Kranz, Trends Pharmacol. Sci., 37(3):220-230 (2016); Stone et al., Cancer Immunol. Immunother., 63(11):1163-1176 (2014)). A CAR can be introduced and expressed on the surface of a T cell, enabling the T cell to target and kill a target cell (e.g., a cancer cell) that expresses the antigen to which the CAR is designed to bind.

[0078] The term "codon-optimized" or "codon optimization" when referring to a nucleotide sequence is based on the discovery that the frequency of occurrence of synonymous codons (i.e., codons that code for the same amino acid) in coding nucleotide sequences is biased in different species. Due to such codon degeneracy, the same polypeptide may be encoded by a variety of nucleotide sequences. Codon optimization refers to the process of replacing certain codons in a coding nucleotide sequence with synonymous codons based on host cell preferences without altering the resulting polypeptide sequence. Various codon optimization methods are known in the art, including, for example, the methods disclosed in at least U.S. Patent Nos. 5,786,464 and 6,114,148.

[0079] The term "complementarity determining region (CDR)" is synonymous with "hypervariable region" or "HVR" and is known in the art to generally refer to sequences of amino acids in an antibody variable region that confer antigen specificity and / or binding affinity and are separated from each other in the primary structure by framework sequences. In some cases, framework amino acids may also contribute to binding. Generally, there are three CDRs in each variable region. Variable domain sequences can be aligned according to numbering schemes (e.g., Kabat, EU, international ImMunoGeneTics information system® (IMGT®) and Aho), which allows equivalent residue positions to be annotated, and different molecules can be compared using the Antibody Numbering and Antigen Receptor Classification (ANARCI) software tool (2016, Bioinformatics 15:298-300).

[0080] The term "construct" refers to any polynucleotide, including recombinant nucleic acid molecules. A construct may be present in a vector (e.g., bacterial vector, viral vector) or integrated into a genome. A "vector" is a nucleic acid molecule that can introduce a specific nucleic acid sequence into a cell or another nucleic acid sequence, or as a means of transporting another nucleic acid molecule. A vector can be, for example, a plasmid, a cosmid, a virus, an RNA vector, or a linear or circular DNA or RNA molecule that can include chromosomal, non-chromosomal, semisynthetic, or synthetic nucleic acid molecules. Exemplary vectors include vectors capable of autonomous replication (episomal vectors), vectors capable of delivering a polynucleotide to a cell genome (e.g., viral vectors), or vectors capable of expressing a nucleic acid molecule to which the vector is linked (expression vectors).

[0081] The term "epitope" includes any molecule, structure, amino acid sequence, or protein determinant that is recognized and specifically bound by a cognate binding molecule, such as an antibody or T-cell receptor, or other binding molecule, domain, or protein.

[0082] The term "expression" refers to the process by which a polypeptide is produced based on a coding sequence of a nucleic acid molecule such as a gene. This process can include transcription, post-transcriptional regulation, post-transcriptional modification, translation, post-translational regulation, post-translational modification, or any combination thereof. An expressed nucleic acid molecule is usually operably linked to an expression control sequence (e.g., a promoter).

[0083] As used herein, the term "host cell" refers to a cell or microorganism that is subject to genetic modification by the introduction of a construct or vector carrying a nucleotide sequence for expressing a protein or polypeptide of interest. In certain embodiments, when the protein to be expressed comprises a CAR, the host cell is typically a T cell.

[0084] The terms "hypoimmunogenic", "hypoimmunogenic", "hypoimmunogenic", "hypoimmunogenic" or "hypoimmune" are used interchangeably to describe cells that are less susceptible to immune rejection by a subject into which they are transplanted. For example, such hypoimmunogenic cells may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99% or more less susceptible to immune rejection by a subject into which they are transplanted compared to unaltered or unmodified wild-type cells. In some examples described herein, genome editing techniques are utilized to modulate the expression of MHC I and MHC II genes, thus creating hypoimmunogenic cells. In other examples described herein, tolerogenic factors are introduced into cells that, when expressed, can modulate or affect the ability of the cells to be recognized by the host immune system, thereby conferring hypoimmunogenicity. The low immunogenicity of a cell can be determined by evaluating the ability of the cell to induce adaptive and innate immune responses. Such immune responses can be measured, for example, by measuring the effect of the low immunogenic cells on T cell proliferation, T cell activation, T cell killing, NK cell proliferation, NK cell activation, and macrophage activity using assays recognized by those skilled in the art. The low immunogenic cells will be reduced in killing by T cells and / or NK cells or reduced in phagocytosis by macrophages when administered to a subject, compared to unmodified or wild-type cells. In some cases, the low immunogenic cells induce a reduced or decreased immune response in a recipient subject, compared to the corresponding unmodified wild-type cells. In some cases, the low immunogenic cells are non-immunogenic or cannot induce an immune response in a recipient subject.Detailed descriptions of hypoimmunogenic cells, methods for making them, and methods for using them can be found in WO2016183041 filed May 9, 2015, WO2018132783 filed January 14, 2018, WO2018176390 filed March 20, 2018, WO2020018615 filed July 17, 2019, WO2020018620 filed July 31, 2020, WO2020018636 filed July 17, 2019, WO2020018640 filed July 31, 2020, WO2020018650 filed July 17, 2020, WO2020018661 filed July 17, 2020, WO2020018670 filed July 17, 2020, WO2020018681 filed July 17, 2020, WO2020018691 filed July 17, 2020, WO2020018692 filed July 17, 2020, WO2020018694 filed July 17, 2020, WO2020018696 filed July 17, 2020, WO2020018698 filed July 17, 2020, WO2020018699 filed July 17, 2020, WO2020018697 filed July 17, 2020, WO2020018699 filed July 17, 2020, WO2020018698 filed July No. 6,393,133, filed on Jul. 31, 2020, WO2021022223, filed on Aug. 24, 2020, WO2021222285, filed on Apr. 27, 2021, and WO2021222285, filed on Apr. 27, 2021, the disclosures of which, including the examples, sequence listings, and figures, are hereby incorporated by reference in their entireties.

[0085] An "intracellular signaling domain" or "effector domain" is an intracellular portion or domain of a CAR or receptor that can directly or indirectly promote a biological or physiological response within a cell upon receiving an appropriate signal. In certain embodiments, the effector domain is derived from a protein or a portion thereof or a protein complex that receives a signal upon binding to a target or cognate molecule, or when the protein or portion thereof or protein complex directly binds to a target or cognate molecule and induces a signal from the effector domain.

[0086] The term "nucleic acid" or "polynucleotide" refers to a polymeric compound containing covalently linked nucleotides containing naturally occurring subunits (e.g., purine or pyrimidine bases). Purine bases include adenine and guanine, while pyrimidine bases include uracil, thymine, and cytosine. Nucleic acid molecules include polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), where DNA includes cDNA, genomic DNA, and synthetic DNA, any of which may be single-stranded or double-stranded. A nucleic acid molecule that encodes an amino acid sequence includes all nucleotide sequences that encode the same amino acid sequence.

[0087] The term "operably linked" refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other.

[0088] The term "patient" refers to an animal, e.g., a human, to which treatment, including prophylactic treatment, with the cells described herein is given. With respect to the treatment of an infection, condition or disease state specific to a particular animal, e.g., a human patient, the term patient refers to that particular animal. The term "patient" also encompasses any vertebrate, including, but not limited to, mammals, reptiles, amphibians and fish. However, the patient is advantageously a mammal, e.g., a human, or other mammal, e.g., a domestic mammal, e.g., a dog, cat, horse, etc., or a production mammal, e.g., a cow, sheep, pig, etc.

[0089] "Safe harbor" or "safe harbor locus" refers to a locus that allows for the safe expression of a transgene or exogenous gene. The transgene or exogenous gene can be inserted into any suitable region of the safe harbor locus that allows for the safe expression of the gene, including, for example, an intron, exon, or coding sequence region (CDS) within the safe harbor locus.

[0090] The term "safety switch" as used herein refers to a system for controlling the expression of a gene or protein of interest that, when downregulated or upregulated, causes elimination or death of the cell, for example, through recognition by the host's immune system. The safety switch can be designed to be triggered by an exogenous molecule upon an adverse clinical event. The safety switch can be manipulated by controlling expression at the DNA, RNA, and protein levels. The safety switch includes a protein or molecule that allows for control of cellular activity in response to an adverse event. In some embodiments, the safety switch is a "kill switch" that is expressed in an inactive state, and activation of the switch by an exogenously applied selective agent is lethal to the cell expressing the safety switch. In some embodiments, the safety switch gene acts in cis with the gene of interest in the construct. Activation of the safety switch causes the cell to kill itself alone, or itself and neighboring cells, by apoptosis or necrosis.

[0091] The term "subject" refers to a mammalian subject, preferably a human. A "subject in need thereof" may refer to a subject who has been diagnosed with a disease or is at risk of developing a disease. The terms "subject" and "patient" are used interchangeably herein.

[0092] As used herein, a "therapeutically effective amount" is an amount that produces a desired effect in treating a disease in a subject. In certain embodiments, a therapeutically effective amount is an amount that produces a maximum therapeutic effect. In other embodiments, a therapeutically effective amount produces a therapeutic effect that is less than the maximum therapeutic effect. For example, a therapeutically effective amount can be an amount that produces a therapeutic effect while avoiding one or more side effects associated with a dose that produces a maximum therapeutic effect. The therapeutically effective amount of a particular composition will vary based on a variety of factors, including, but not limited to, the characteristics of the therapeutic composition (e.g., activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological state of the subject (e.g., age, weight, sex, type and stage of disease, medical history, general physical condition, response to a given dosage, and other current medications), the nature of the pharmacologic carrier, excipients, and preservatives in the composition, and the route of administration. Those skilled in the clinical and pharmacological arts will be able to determine a therapeutically effective amount by routine experimentation, i.e., by monitoring the subject's response to administration of the host cell or a pharmaceutical composition containing the host cell, and adjusting the dosage accordingly. For further guidance, see, e.g., Remington: The Science and Practice of Pharmacy, 22, the entire disclosure of which is incorporated herein by reference. nd Edition, Pharmaceutical Press, London, 2012 and Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12 th Edition, McGraw-Hill, New York, NY, 2011.

[0093] As used herein, "tolerogenic factors" include hypoimmunogenic factors, complement inhibitors, and other factors that modulate or affect the ability of cells to be recognized by the immune system of the host or recipient subject upon administration, transplantation, or engraftment.

[0094] A "transmembrane domain" is a portion of a transmembrane protein that may insert into or span a cell membrane.

[0095] The terms "treat", "therapeutic" and "treatment" as used herein with respect to cancer refer to partially or completely alleviating cancer, preventing cancer, reducing the likelihood of cancer development or recurrence, delaying the progression or development of cancer, eliminating, reducing or delaying the onset of one or more symptoms associated with cancer, or increasing progression-free or overall survival of cancer. For example, "therapeutic" may refer to preventing or slowing the growth of an existing cancer, preventing or slowing the formation or metastasis of cancer, and / or slowing the onset of a particular symptom of cancer. In some embodiments, the terms "treat", "therapeutic" or "treatment" refer to a subject having a reduction in the number or size of cancer cells compared to a subject to which the treatment is not administered. In some embodiments, the terms "treat", "therapeutic" or "treatment" refer to a reduction in one or more symptoms of cancer in a subject receiving a treatment as disclosed and described herein compared to a subject not receiving such treatment.

[0096] The term "variable region" or "variable domain" refers to the portion of an antibody heavy or light chain that is involved in antigen binding. H ) and light chain (V L The variable domains of each of the ribozymes generally contain four generally conserved framework regions (FRs) and three complementarity determining regions (CDRs), each of which separates the CDRs and is located between the framework regions.

[0097] A "vector" refers to a DNA construct that includes a nucleic acid molecule operably linked to a suitable control sequence capable of expressing the nucleic acid molecule in a suitable host. Such control sequences may include a promoter for transcription, an optional operator sequence for controlling such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and sequences that control the termination of transcription and translation. A vector may be a plasmid, a phage particle, a virus, or simply a potential genomic insert. Once transformed into a suitable host, a vector may replicate and function independently of the host genome, or in some cases, may be integrated into the genome itself.

[0098] Polycistronic vectors and compositions thereof In some aspects, the technology provides a polycistronic vector comprising two or more expression cassettes for co-expressing two or more proteins of interest in a host cell. In some embodiments, the polycistronic vector comprises two expression cassettes, i.e., bicistronic. In some embodiments, the polycistronic vector comprises three expression cassettes, i.e., tricistronic. In some embodiments, the polycistronic vector comprises four expression cassettes, i.e., quadcistronic. In some embodiments, the polycistronic vector comprises more than four expression cassettes. In any of these embodiments, each of the expression cassettes comprises a nucleotide sequence encoding a protein of interest. In certain embodiments, the two or more genes to be expressed are under the control of a single promoter and are separated from each other by one or more cleavage sites, allowing each protein of interest to be co-expressed from a single transcript. In other embodiments, the two or more genes may be under the control of separate promoters.

[0099] Tolerogenic factors In certain embodiments, the polycistronic vector can include one or more expression cassettes, each of which includes a nucleotide sequence encoding a tolerogenic factor. Each tolerogenic factor expressed by the one or more expression cassettes can be the same or different. In some embodiments, the tolerogenic factor is selected from the group consisting of A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, complement receptor (CR1), DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, serpin b9, CCl21, Mfge8, and truncations, variants, and fusions of any of the above. In embodiments where the polycistronic vector comprises two or more expression cassettes encoding two or more tolerogenic factors, the two or more tolerogenic factors can be independently selected from the group consisting of A20 / TNFAIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, complement receptor (CR1), DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, serpin b9, CCl21, Mfge8, truncations, variants, and fusions of any of the above, or any combination thereof.

[0100] In some embodiments, the tolerogenic factor is CD47. CD47 is a leukocyte surface antigen that plays a role in cell adhesion and regulation of integrins. CD47 is expressed on the surface of cells (e.g., T cells) and signals circulating macrophages not to phagocytose the cells. Thus, overexpression of CD47 can reduce the immunogenicity of cells when transplanted and improve immune protection in allogeneic recipients. CD47 is a transmembrane protein that in humans is encoded by the CD47 gene. CD47 is a member of the immunoglobulin (Ig) superfamily. The molecular weight of CD47 is approximately 50 kDa. CD47 is glycosylated and ubiquitously expressed on virtually all cells in the human body. CD47 has a single IgV-like domain at its N-terminus, a highly hydrophobic stretch with five transmembrane segments, and an alternatively spliced ​​cytoplasmic tail at its C-terminus. In addition, CD47 has two extracellular and two intracellular domains located between adjacent transmembrane segments. A signal peptide, when present on CD47 isoforms, is located N-terminal to the IgV-like domain.

[0101] CD47 is involved in a variety of cellular processes, including apoptosis, proliferation, adhesion, and migration. CD47 interacts with multiple extracellular ligands, including TSP-1, integrins, other CD47 proteins, and SIRPα. CD47 / SIRPα interactions regulate a variety of cell-cell interactions in many biological systems, such as the immune system, regulating lymphocyte homeostasis, dendritic cell (DC) maturation and activation, proper localization of specific DC subsets in secondary lymphoid organs, and cell transmigration. CD47 on cells, including donor cells in the context of transplantation or cell therapy applications, can function as a "marker of self" and regulate phagocytosis by binding to SIRPα on the surface of circulating immune cells to deliver an inhibitory "don't kill me" signal. CD47-SIRPα binding results in phosphorylation of immunoreceptor tyrosine-based inhibitory motifs (ITIMs) on SIRPα, which triggers recruitment of SHP1 and SHP2 Src homology phosphatases. These phosphatases then inhibit the accumulation of myosin II at the phagocytic synapse, preventing phagocytosis (Fujioka et al., Mol. Cell. Biol., 16:6887-6899 (1996)). Phagocytosis of target cells by macrophages is ultimately regulated by a balance between activating signals (e.g., FcγR, CRT, LRP-1) and inhibitory signals (e.g., SIRPα-CD47). Increased expression of CD47 can help cells escape immune surveillance and subsequent destruction and killing by innate immune cells. Thus, CD47 can be utilized as a tolerogenic factor to induce immune tolerance, for example, in cases where there is pathological or undesired activation of an otherwise normal immune response. This can occur, for example, when a patient develops an immune response against donor antigens after receiving an allogeneic transplant or allogeneic cell therapy, or when the body responds inappropriately to self-antigens involved in autoimmune diseases.

[0102] The human CD47 gene has six naturally occurring transcripts, five of which encode protein isoforms of CD47 (Ensembl, Gene:CD47, ENSG00000196776). The six transcripts are named CD47-201, CD47-202, CD47-203, CD47-204, CD47-205, and CD47-206. The coding DNA sequences (CDS) of the six transcripts are set forth in SEQ ID NOs: 129-134, respectively. The amino acid sequences of the five protein isoforms are set forth in SEQ ID NOs: 1-5, respectively (see Table 1).

[0103] The transcript CD47-201 (SEQ ID NO: 129) encodes the isoform CD47-201 (SEQ ID NO: 1) which has 305 amino acids. Isoform CD47-201 has a C-terminal truncation of 18 amino acids from isoform CD47-202. All splice junctions of the CD47-201 transcript are supported by at least one non-suspect mRNA.

[0104] The transcript CD47-202 (SEQ ID NO: 130) encodes the isoform CD47-202 (SEQ ID NO: 2) with 323 amino acids. CD47-202 is the longest transcript of the human CD47 gene. It is designated as the representative transcript in the Ensembl database. In identifying representative transcripts, Ensembl keeps in mind the identification of transcripts that have the highest coverage of conserved exons, the highest expression rate, the longest coding sequence in a balanced manner, and are represented in other major resources such as NCBI and UniProt. All splice junctions of the CD47-202 transcript are supported by at least one non-suspect mRNA. Amino acids 1-18 are the signal peptide.

[0105] The transcript CD47-203 (SEQ ID NO: 131) encodes the 86 amino acid isoform CD47-203 (SEQ ID NO: 3). The only support for the transcript model comes from a single expressed sequence tag (EST).

[0106] The transcript CD47-204 (SEQ ID NO: 132) does not encode a protein. All splice junctions of this transcript are supported by at least one non-suspect mRNA.

[0107] Transcript CD47-205 (SEQ ID NO: 133) encodes the 109 amino acid isoform CD47-205 (SEQ ID NO: 4). Isoform 205 contains the three transmembrane domains and a truncated intracellular domain from isoform CD47-202. The best supporting mRNAs for this transcript model are either flagged as suspect or support is from multiple ESTs.

[0108] The transcript CD47-206 (SEQ ID NO: 134) encodes the isoform CD47-206 (SEQ ID NO: 5) which has 183 amino acids. Isoform 206 contains a truncated extracellular domain and five transmembrane domains from isoform CD47-202.

[0109] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding CD47. In some embodiments, CD47 is human CD47, and in some of these embodiments, the human CD47 comprises or consists of the amino acid sequence set forth in any one of SEQ ID NOs: 1-5, or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in any one of SEQ ID NOs: 1-5. In some embodiments, the human CD47 comprises or consists of the amino acid sequence set forth in SEQ ID NO: 2, or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding CD47 corresponds to the mRNA sequence of human CD47. In some embodiments, the nucleotide sequence encoding CD47 is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in any one of SEQ ID NOs: 129-134. In some embodiments, the nucleotide sequence encoding CD47 is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO: 130.

[0110] In some embodiments, the nucleotide sequence encoding CD47 is codon-optimized for expression in a mammalian cell, e.g., a human cell. In some embodiments, the codon-optimized nucleotide sequence encoding CD47 is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO: 135.

[0111] [Table 1] TIFF2024525789000003.tif189165TIFF2024525789000004.tif243165TIFF2024525789000005.tif229165TIFF2024525789000006.tif222165

[0112] CAR In certain embodiments, the polycistronic vector can include one or more expression cassettes, each of which includes a nucleotide sequence encoding a CAR. A CAR (also known as a chimeric immune receptor, chimeric T cell receptor, or artificial T cell receptor) is a receptor protein that has been engineered to confer new capabilities to a host cell (e.g., T cell) to target a specific protein. The receptor is chimeric because it combines both antigen binding and T cell activation functions in a single receptor. The polycistronic vectors of the present technology can be used to express one or more CARs in a host cell (e.g., T cell) for use in cell-based therapy against a variety of target antigens. The CARs expressed by one or more expression cassettes can be the same or different. In any of these embodiments, the CAR can include an extracellular binding domain (also called a "binder") that specifically binds to the target antigen, a transmembrane domain, and an intracellular signaling domain. In certain embodiments, the CAR further includes one or more additional factors, including one or more signal peptides, one or more extracellular hinge domains, and / or one or more intracellular costimulatory domains. The domains may be directly adjacent to each other, or there may be one or more amino acids linking the domains. The nucleotide sequence encoding the CAR may be derived from a mammalian sequence (e.g., a murine sequence, a primate sequence, a human sequence, or a combination thereof). In the case where the nucleotide sequence encoding the CAR is non-human, the sequence of the CAR may be humanized. The nucleotide sequence encoding the CAR may also be codon-optimized for expression in a mammalian cell (e.g., a human cell). In any of these embodiments, the nucleotide sequence encoding the CAR may be at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the nucleotide sequences disclosed herein. The sequence variations may result from codon optimization, humanization, restriction enzyme-based cloning scars, and / or additional amino acid residues linking the functional domains, and the like.

[0113] In certain embodiments, the CAR may comprise a signal peptide at the N-terminus. Non-limiting examples of signal peptides include CD8α signal peptide, IgK signal peptide, and granulocyte-macrophage colony-stimulating factor receptor subunit alpha (GMCSFR-α, also known as colony-stimulating factor 2 receptor subunit alpha (CSF2RA)) signal peptide, and variants thereof, the amino acid sequences of which are provided in Table 2 below.

[0114] [Table 2]

[0115] In certain embodiments, the CAR can comprise an extracellular binding domain, also referred to as a binder. In certain embodiments, the extracellular binding domain can comprise one or more antibodies specific for one target antigen or multiple target antigens. The antibodies can be antibody fragments (e.g., scFvs) or single domain antibody fragments (e.g., VHHs). In certain embodiments, scFvs are composed of heavy chain variable regions (VHHs) of antibodies connected by a linker. H ) and the light chain variable region (V L ). V H and V L can be expressed in any order (i.e., V H -Linker-V L or V L -Linker-V H Non-limiting examples of linkers include the Whitlow linker, (G4S) n(n can be a positive integer, e.g., 1, 2, 3, 4, 5, 6, etc.), and variants thereof. In certain embodiments, the antigen can be an antigen that is expressed only or preferentially in tumor cells, or an antigen characteristic of an autoimmune or inflammatory disease. Exemplary target antigens include, but are not limited to, B cell maturation factor (BCMA), CA9, CD5, CD19, CD20, CD22, CD23, CD30, CD33, CD38, CD44, CD70, CD133, CD174, CD274, CD276, CEACAM5, CSPG4, EGFR, EGFRvIII, EPCAM, EPHA2, ERBB2, FAP, FOLH1, FOLR1, GD2, GPC3, GPNMB, IL1RAP, IL3BA, IL13RA2, kappa, KDR, L1CAM, lambda, MET, MS4A1, MSLN, MUC1, NCAM1, PDCD1, PSCA, ROR1, SDC1, SLAMF7, TEM1, TNFRSF8, TNFRSF17, ULBP1 Examples of such proteins include ULBP2, G protein-coupled receptor family C group 5 member D (GPRC5D) (associated with leukemia); CS1 / SLAMF7, CD38, CD138, GPRC5D, TACI, and BCMA (associated with myeloma); GD2, HER2, EGFR, EGFRvIII, B7H3, PSMA, PSCA, CAIX, CD171, CEA, CSPG4, EPHA2, FAP, FRα, IL-13Rα, mesothelin, MUC1, MUC16, and ROR1 (associated with solid tumors). In any of these embodiments, the extracellular binding domain of the CAR may be codon-optimized for expression in the host cell or may have a variant sequence to increase function of the extracellular binding domain.

[0116] In certain embodiments, the CAR may comprise a hinge domain, also referred to as a spacer. The terms "hinge" and "spacer" may be used interchangeably in this disclosure. Non-limiting examples of hinge domains include CD8α hinge domain, CD28 hinge domain, IgG4 hinge domain, IgG4 hinge-CH2-CH3 domain, and variants thereof, the amino acid sequences of which are provided in Table 3 below.

[0117] [Table 3]

[0118] In certain embodiments, the CAR comprises a transmembrane domain. In certain embodiments, the transmembrane domain comprises the transmembrane region of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, or functional variants thereof, and may include the human version of each of these sequences. In other embodiments, the transmembrane domain comprises the transmembrane region of CD8α, CD8β, 4-1BB / CD137, CD28, CD34, CD4, FcεRIγ, CD16, OX40 / CD134, CD3ζ, CD3ε, CD3γ, CD3δ, TCRα, TCRβ, TCRζ, CD32, CD64, CD64, CD45, CD5, CD9, CD22, CD37, CD80, CD86, CD40, CD40L / CD154, VEGFR2, FAS, and FGFR2B, or functional variants thereof, and may include human versions of each of these sequences. Table 4 provides the amino acid sequences of several exemplary transmembrane domains.

[0119] [Table 4]

[0120] In certain embodiments, the CAR can have an intracellular costimulatory domain and / or an intracellular signaling domain. In certain embodiments, the intracellular costimulatory domain and / or the intracellular signaling domain can be selected from the group consisting of B7-1 / CD80, B7-2 / CD86, B7-H1 / PD-L1, B7-H2, B7-H3, B7-H4, B7-H6, B7-H7, BTLA / CD272, CD28, CTLA-4, Gi24 / VISTA / B7-H5, ICOS / CD278, PD-1, PD-L2 / B7-DC, PDCD6, 4-1BB / TNFSF9 / CD137, 4-1BB ligand / TNFSF9, BAFF / BLyS / TNFSF13B, BAFF, BLyS ... R / TNFRSF13C, CD27 / TNFRSF7, CD27 ligand / TNFSF7, CD30 / TNFRSF8, CD30 ligand / TNFSF8, CD40 / TNFRSF5, CD40 / TNFSF5, CD40 ligand / TNFSF5, DR3 / TNFRSF25, GITR / TNFRSF18, GITR ligand / TNFSF18, HVEM / TNFRSF14, LIGHT / TNFSF14, lymphotoxin-α / TNFβ, OX40 / TNFRSF4, OX40 ligand / TNFSF4, RELT / TNFRSF19L, TACI / TNFRSF13B, TL1A / TNFSF15, TNFα, TNF RII / TNFRSF1B, 2B4 / CD244 / SLAMF4, BLAME / SLAMF8, CD2, CD2F-10 / SLAMF9, CD48 / SLAMF2, CD58 / LFA-3, CD84 / SL AMF5, CD229 / SLAMF3, CRACC / SLAMF7, NTB-A / SLAMF6, SLAM / CD150, CD2, CD7, CD53, CD82 / Kai-1, CD90 / Thy1, CD9 6, CD160, CD200, CD300a / LMIR1, HLA class I, HLA-DR, Ikaros, integrin α4 / CD49d, integrin α4β1, integrin α4β7 / LPAM-1, LAG-3, TCL1A, TCL1B, CRTAM, DAP12, Dectin-1 / CLEC7A, DPPIV / CD26, EphB6, TIM-1 / KIM-1 / HAVCR, TIM-4, TSLP, TSLPR, lymphocyte function associated antigen-1 (LFA-1), NKG2C, CD3zeta, immunoreceptor tyrosine-based activation motif (ITAM), CD27, CD28, 4-1BB, CD134 / OX40, CD30, CD40, PD-1, ICOS, lymphocyte function associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligand that specifically binds to CD83, and functional variants thereof, and may include human versions of each of these sequences. In some embodiments, the intracellular costimulatory domain and / or intracellular signaling domain comprises one or more signaling domains selected from a CD3zeta domain, an ITAM, a CD28 domain, a 4-1BB domain, or functional variants thereof. Table 5 provides the amino acid sequences of several exemplary intracellular costimulatory and / or signaling domains. In certain embodiments, such as in the case of tisagenlecleucel described below, the CD3ζ signaling domain of SEQ ID NO: 18 may have a mutation at amino acid position 14, e.g., a glutamine (Q) to lysine (K) mutation (see SEQ ID NO: 115).

[0121] [Table 5]

[0122] In certain embodiments in which the polycistronic vector encodes two or more CARs, the two or more CARs may contain the same functional domain or one or more different functional domains, as described. For example, the two or more CARs may contain different signal peptides, extracellular binding domains, hinge domains, transmembrane domains, costimulatory domains, and / or intracellular signaling domains to minimize the risk of recombination due to sequence similarity. Or alternatively, the two or more CARs may contain the same functional domains. In cases in which the same domain(s) and / or backbone are used, it is optional to introduce codon diversity at the nucleotide sequence level to minimize the risk of recombination.

[0123] CD19 CAR In some embodiments, the CAR is a CD19 CAR, and in these embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding a CD19 CAR. In some embodiments, the CD19 CAR can comprise, in tandem, a signal peptide, an extracellular binding domain that specifically binds CD19, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain.

[0124] In some embodiments, the signal peptide of the CD19 CAR comprises a CD8α signal peptide. In some embodiments, the CD8α signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:6 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the signal peptide comprises an IgK signal peptide. In some embodiments, the IgK signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:7 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the signal peptide comprises a GMCSFR-α or CSF2RA signal peptide. In some embodiments, the GMCSFR-α or CSF2RA signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:8 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:8.

[0125] In some embodiments, the extracellular binding domain of the CD19 CAR is specific for CD19, e.g., human CD19. The extracellular binding domain of the CD19 CAR can be codon-optimized for expression in a host cell or can have a variant sequence to increase the function of the extracellular binding domain. In some embodiments, the extracellular binding domain comprises an immunogenically active portion of an immunoglobulin molecule (e.g., scFv).

[0126] In some embodiments, the extracellular binding domain of the CD19 CAR is a heavy chain variable region (V) of the FMC63 monoclonal antibody (FMC63) connected by a linker. H ) and the light chain variable region (V L) FMC63 and derived scFvs are described in Nicholson et al., Mol. Immun. 34(16-17):1157-1165 (1997) and PCT Publication No. WO2018213337, each of which is incorporated herein by reference in its entirety. In some embodiments, the amino acid sequence of the entire FMC63-derived scFv (also referred to as FMC63 scFv) and its different portions is shown in Table 6 below. In some embodiments, the CD19-specific scFv comprises or consists of an amino acid sequence set forth in SEQ ID NO: 19, 20, or 25, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO: 19, 20, or 25. In some embodiments, the CD19-specific scFv may comprise one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 21-23 and 26-28. In some embodiments, the CD19-specific scFv may comprise a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 21-23. In some embodiments, the CD19-specific scFv may comprise a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 26-28. In any of these embodiments, the CD19-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that contain a sequence at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the CD19 CAR comprises or consists of one or more CDRs described herein.

[0127] In some embodiments, the V of the scFv H and V LThe linker linking the moieties is a Whitlow linker having the amino acid sequence set forth in SEQ ID NO: 24. In some embodiments, the Whitlow linker is a different linker, e.g., (G4S) n (n can be a positive integer, e.g., 1, 2, 3, 4, 5, or 6). In some embodiments, the linker is a 3xG4S linker having the amino acid sequence set forth in SEQ ID NO:30, resulting in a different FMC63-derived scFv having the amino acid sequence set forth in SEQ ID NO:29. In certain of these embodiments, the CD19-specific scFv comprises or consists of the amino acid sequence set forth in SEQ ID NO:29, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:29.

[0128] [Table 6] TIFF2024525789000012.tif98165

[0129] In some embodiments, the extracellular binding domain of the CD19 CAR is derived from an antibody specific for CD19, such as SJ25C1 (Bejcek et al., Cancer Res. 55:2346-2351 (1995)), HD37 (Pezutto et al., J. Immunol. 138(9):2793-2799 (1987)), 4G7 (Meeker et al., Hybridoma 3:305-320 (1984)), B43 (Bejcek (1995)), BLY3 (Bejcek (1995)), B4 (Freedman et al., 70:418-427 (1987)), B4 HB12b (Kansas & Tedder, J. Immunol. 147:4094-4102 (1991); Yazawa et al., Proc. Natl. Acad. Sci. USA 102:15178-15183 (2005); Herbst et al., J. Pharmacol. Exp. Ther. 335:213-222 (2010)), BU12 (Callard et al., J. Immunology, 148(10):2983-2987 (1992)), and CLB-CD19 (De Rie Cell. Immunol. 118:368-381 (1989)). In any of these embodiments, the extracellular binding domain of the CD19 CAR is the V domain of any of the antibodies. H , V L , and / or one or more CDRs.

[0130] In some embodiments, the hinge domain of the CD19 CAR comprises a CD8α hinge domain, e.g., a human CD8α hinge domain. In some embodiments, the CD8α hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the hinge domain comprises a CD28 hinge domain, e.g., a human CD28 hinge domain. In some embodiments, the CD28 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the hinge domain comprises an IgG4 hinge domain, e.g., a human IgG4 hinge domain. In some embodiments, the IgG4 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In some embodiments, the hinge domain comprises an IgG4 hinge-Ch2-Ch3 domain, for example a human IgG4 hinge-Ch2-Ch3 domain.In some embodiments, the IgG4 Hinge-Ch2-Ch3 Domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 13 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 13.

[0131] In some embodiments, the transmembrane domain of the CD19 CAR comprises a CD8α transmembrane domain, e.g., a human CD8α transmembrane domain. In some embodiments, the CD8α transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 14 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain, e.g., a human CD28 transmembrane domain. In some embodiments, the CD28 transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 15.

[0132] In some embodiments, the intracellular costimulatory domain of the CD19 CAR comprises a 4-1BB costimulatory domain. 4-1BB, also known as CD137, delivers a strong costimulatory signal to T cells, promoting the differentiation and enhancing the long-term survival of T lymphocytes. In some embodiments, the 4-1BB costimulatory domain is human. In some embodiments, the 4-1BB costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 16 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the intracellular costimulatory domain comprises a CD28 costimulatory domain. CD28 is another costimulatory molecule on T cells. In some embodiments, the CD28 costimulatory domain is human. In some embodiments, the CD28 costimulatory domain comprises, or consists of, the amino acid sequence set forth in SEQ ID NO: 17 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 17. In some embodiments, the intracellular costimulatory domain of the CD19 CAR comprises a 4-1BB costimulatory domain and a CD28 costimulatory domain as described.

[0133] In some embodiments, the intracellular signaling domain of the CD19 CAR comprises a CD3 zeta (ζ) signaling domain. CD3ζ associates with the T cell receptor (TCR) to generate a signal and contains an immunoreceptor tyrosine-based activation motif (ITAM). The CD3ζ signaling domain refers to amino acid residues from the cytoplasmic domain of the ζ chain sufficient to functionally transmit the initial signal required for T cell activation. In some embodiments, the CD3ζ signaling domain is human. In some embodiments, the CD3ζ signaling domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115.

[0134] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD19 CAR, including a CD19 CAR comprising, for example, a CD19-specific scFv having a sequence as set forth in SEQ ID NO: 19 or SEQ ID NO: 29, a CD8α hinge domain of SEQ ID NO: 9, a CD8α transmembrane domain of SEQ ID NO: 14, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence). In any of these embodiments, the CD19 CAR can further comprise a signal peptide as described (e.g., a CD8α signal peptide).

[0135] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD19 CAR, including a CD19 CAR comprising, for example, a CD19-specific scFv having a sequence as set forth in SEQ ID NO: 19 or SEQ ID NO: 29, an IgG4 hinge domain of SEQ ID NO: 11 or SEQ ID NO: 12, a CD28 transmembrane domain of SEQ ID NO: 15, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence). In any of these embodiments, the CD19 CAR can further comprise a signal peptide as described (e.g., a CD8α signal peptide).

[0136] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD19 CAR, including a CD19 CAR comprising, for example, a CD19-specific scFv having a sequence as set forth in SEQ ID NO: 19 or SEQ ID NO: 29, a CD28 hinge domain of SEQ ID NO: 10, a CD28 transmembrane domain of SEQ ID NO: 15, a CD28 costimulatory domain of SEQ ID NO: 17, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence). In any of these embodiments, the CD19 CAR can further comprise a signal peptide as described (e.g., a CD8α signal peptide).

[0137] In some embodiments, the polycistronic vector comprises an expression cassette that contains a nucleotide sequence encoding a CD19 CAR set forth in SEQ ID NO: 116 or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO: 116 (see Table 7). The encoded CD19 CAR has a corresponding amino acid sequence set forth in SEQ ID NO: 117 or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 117 and includes the following components: CD8α signal peptide, FMC63 scFv (V L -Whitlow Linker-V H ), CD8α hinge domain, CD8α transmembrane domain, 4-1BB costimulatory domain, and CD3ζ signaling domain.

[0138] In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding a commercially available embodiment of a CD19 CAR. Non-limiting examples of commercially available embodiments of CD19 CARs expressed and / or encoded by T cells include tisagenlecleucel, lysocabbutagenmalaleucel, axicabbutagensiloreucel, and brexcabbutagenoutrousel.

[0139] In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding tisagenleucel or a portion thereof. The tisagenleucel comprises the following components: CD8α signal peptide, FMC63 scFv (V L -3×G4S Linker-V H), a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. The nucleotide and amino acid sequences of the CD19 CAR in tisagenlecleucel are provided in Table 7, with annotation of the sequences provided in Table 8.

[0140] In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding lysocabtagene malareucel or a portion thereof. Lysocabtagene malareucel contains the following components: GMCSFR-α or CSF2RA signal peptide, FMC63 scFv (V L -Whitlow Linker-V H ), an IgG4 hinge domain, a CD28 transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain. The nucleotide and amino acid sequences of the CD19 CAR in lysocabtagenemaraleucel are provided in Table 7, with annotation of the sequences provided in Table 9.

[0141] In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding axicabtagene siloleucel or a portion thereof. Axicabtagene siloleucel contains the following components: GMCSFR-α or CSF2RA signal peptide, FMC63 scFv (V L -Whitlow Linker-V H ), CD28 hinge domain, CD28 transmembrane domain, CD28 costimulatory domain, and CD3 zeta signaling domain. The nucleotide and amino acid sequences of the CD19 CAR in axicabtagenecilol-eucel are provided in Table 7, with annotation of the sequences provided in Table 10.

[0142] In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding brexcavtagene outrousel or a portion thereof, which comprises a CD19 CAR having the following components: GMCSFR-α signal peptide, FMC63 scFv, CD28 hinge domain, CD28 transmembrane domain, CD28 costimulatory domain, and CD3 zeta signaling domain.

[0143] In some embodiments, the polycistronic vector comprises an expression cassette that contains a nucleotide sequence encoding a CD19 CAR set forth in SEQ ID NO: 31, 33, or 35, or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO: 31, 33, or 35. The encoded CD19 CAR has a corresponding amino acid sequence set forth in SEQ ID NO: 32, 34, or 36, respectively, or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 32, 34, or 36, respectively.

[0144] [Table 7] TIFF2024525789000014.tif187165TIFF2024525789000015.tif168165TIFF20245257890 00016.tif168165TIFF2024525789000017.tif184165TIFF2024525789000018.tif160165

[0145] [Table 8]

[0146] [Table 9]

[0147] [Table 10]

[0148] In some embodiments, the polycistronic vector comprises an expression cassette that encodes a CD19 CAR as set forth in SEQ ID NO: 31, 33, or 35, or comprises a nucleotide sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence as set forth in SEQ ID NO: 31, 33, or 35. In certain embodiments, the nucleotide sequence can be codon-optimized for expression in a mammalian cell, such as a human cell. The encoded CD19 CAR has a corresponding amino acid sequence as set forth in SEQ ID NO: 32, 34, or 36, respectively, or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence as set forth in SEQ ID NO: 32, 34, or 36, respectively.

[0149] CD20 CAR In some embodiments, the CAR is a CD20 CAR, and in these embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding the CD20 CAR. CD20 is an antigen found on the surface of B cells as early as the pro-B stage and at increasing levels gradually until B cell maturation, and is also found on the cells of most B cell neoplasms. CD20 positive cells are also sometimes found in cases of Hodgkin's disease, myeloma, and thymoma. In some embodiments, the CD20 CAR may comprise a signal peptide, an extracellular binding domain that specifically binds to CD20, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain in tandem.

[0150] In some embodiments, the signal peptide of the CD20 CAR comprises a CD8α signal peptide. In some embodiments, the CD8α signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:6 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the signal peptide comprises an IgK signal peptide. In some embodiments, the IgK signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:7 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the signal peptide comprises a GMCSFR-α or CSF2RA signal peptide. In some embodiments, the GMCSFR-α or CSF2RA signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:8 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:8.

[0151] In some embodiments, the extracellular binding domain of the CD20 CAR is specific for CD20, e.g., human CD20. The extracellular binding domain of the CD20 CAR can be codon-optimized for expression in a host cell or can have a variant sequence to increase the function of the extracellular binding domain. In some embodiments, the extracellular binding domain comprises an immunogenically active portion of an immunoglobulin molecule (e.g., scFv).

[0152] In some embodiments, the extracellular binding domain of the CD20 CAR is derived from an antibody specific for CD20, including, for example, Leu16, IF5, 1.5.3, rituximab, obinutuzumab, ibritumomab, ofatumumab, tositumumab, odronextamab, veltuzumab, ublituximab, and ocrelizumab. In some embodiments, the CD20 CAR is derived from a CAR specific for CD20, including, for example, MB-106 (Fred Hutchinson Cancer Research Center, see Shadman et al., Blood 134(Suppl.1):3235(2019)), UCART20 (Cellectis, www.cellbiomedgroup.com), or C-CAR066 (Cellular Biomedicine Group, see Liang et al., J. Clin. Oncol. 39(15)suppl:2508(2021)). In any of these embodiments, the extracellular binding domain of the CD20 CAR is the V of any antibody. H , V L , and / or one or more CDRs.

[0153] In some embodiments, the extracellular binding domain of the CD20 CAR comprises a heavy chain variable region (V H ) and the light chain variable region (V L ) from the Leu16 monoclonal antibody. See Wu et al., Protein Engineering. 14(12):1025-1033 (2001). In some embodiments, the linker is n(n can be a positive integer, e.g., 1, 2, 3, 4, 5, or 6) linker, e.g., a 3×G4S linker. In other embodiments, the linker is a Whitlow linker as described herein. In some embodiments, various portions of the entire Leu16-derived scFv (also referred to as Leu16 scFv) and the amino acid sequences of the various portions thereof are provided in Table 11 below. In some embodiments, the CD20-specific scFv comprises or consists of an amino acid sequence set forth in SEQ ID NO: 37, 38, or 42, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO: 37, 38, or 42. In some embodiments, the CD20-specific scFv can comprise one or more CDRs having an amino acid sequence set forth in SEQ ID NO: 39-41, 43, and 44. In some embodiments, the CD20-specific scFv may comprise a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 39-41. In some embodiments, the CD20-specific scFv may comprise a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 43-44. In any of these embodiments, the CD20-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that contain a sequence at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the CD20 CAR comprises or consists of one or more CDRs described herein.

[0154] [Table 11]

[0155] In some embodiments, the hinge domain of the CD20 CAR comprises a CD8α hinge domain, e.g., a human CD8α hinge domain. In some embodiments, the CD8α hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the hinge domain comprises a CD28 hinge domain, e.g., a human CD28 hinge domain. In some embodiments, the CD28 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the hinge domain comprises an IgG4 hinge domain, e.g., a human IgG4 hinge domain. In some embodiments, the IgG4 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In some embodiments, the hinge domain comprises an IgG4 hinge-Ch2-Ch3 domain, for example a human IgG4 hinge-Ch2-Ch3 domain.In some embodiments, the IgG4 Hinge-Ch2-Ch3 Domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 13 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 13.

[0156] In some embodiments, the transmembrane domain of the CD20 CAR comprises a CD8α transmembrane domain, e.g., a human CD8α transmembrane domain. In some embodiments, the CD8α transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 14 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain, e.g., a human CD28 transmembrane domain. In some embodiments, the CD28 transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 15.

[0157] In some embodiments, the intracellular costimulatory domain of the CD20 CAR comprises a 4-1BB costimulatory domain, e.g., a human 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 16 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the intracellular costimulatory domain comprises a CD28 costimulatory domain, e.g., a human CD28 costimulatory domain. In some embodiments, the CD28 costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO:17 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:17.

[0158] In some embodiments, the intracellular signaling domain of the CD20 CAR comprises a CD3 zeta (ζ) signaling domain, e.g., a human CD3ζ signaling domain. In some embodiments, the CD3ζ signaling domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115.

[0159] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD20 CAR, including a CD20 CAR comprising, for example, a CD20-specific scFv having the sequence set forth in SEQ ID NO: 37, a CD8α hinge domain of SEQ ID NO: 9, a CD8α transmembrane domain of SEQ ID NO: 14, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0160] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD20 CAR, including a CD20 CAR comprising, for example, a CD20-specific scFv having the sequence set forth in SEQ ID NO:37, a CD28 hinge domain of SEQ ID NO:10, a CD8α transmembrane domain of SEQ ID NO:14, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0161] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD20 CAR, including a CD20 CAR comprising, for example, a CD20-specific scFv having the sequence set forth in SEQ ID NO:37, an IgG4 hinge domain of SEQ ID NO:11 or SEQ ID NO:12, a CD8α transmembrane domain of SEQ ID NO:14, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0162] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD20 CAR, including a CD20 CAR comprising, for example, a CD20-specific scFv having the sequence set forth in SEQ ID NO: 37, a CD8α hinge domain of SEQ ID NO: 9, a CD28 transmembrane domain of SEQ ID NO: 15, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0163] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD20 CAR, including a CD20 CAR comprising, for example, a CD20-specific scFv having the sequence set forth in SEQ ID NO: 37, a CD28 hinge domain of SEQ ID NO: 10, a CD28 transmembrane domain of SEQ ID NO: 15, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0164] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD20 CAR, including a CD20 CAR comprising, for example, a CD20-specific scFv having the sequence set forth in SEQ ID NO:37, an IgG4 hinge domain of SEQ ID NO:11 or SEQ ID NO:12, a CD28 transmembrane domain of SEQ ID NO:15, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0165] CD22 CAR In some embodiments, the CAR is a CD22 CAR, and in these embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding the CD22 CAR. CD22 is a transmembrane protein found mostly on the surface of mature B cells that functions as an inhibitory receptor for B cell receptor (BCR) signaling. CD22 is expressed in 60-70% of B cell lymphomas and leukemias (e.g., B-chronic lymphocytic leukemia, hairy cell leukemia, acute lymphocytic leukemia (ALL), and Burkitt's lymphoma) and is not present on the cell surface or on stem cells in early stages of B cell development. In some embodiments, the CD22 CAR may comprise in tandem a signal peptide, an extracellular binding domain that specifically binds CD22, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain.

[0166] In some embodiments, the signal peptide of the CD22 CAR comprises a CD8α signal peptide. In some embodiments, the CD8α signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:6 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the signal peptide comprises an IgK signal peptide. In some embodiments, the IgK signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:7 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the signal peptide comprises a GMCSFR-α or CSF2RA signal peptide. In some embodiments, the GMCSFR-α or CSF2RA signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:8 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:8.

[0167] In some embodiments, the extracellular binding domain of the CD22 CAR is specific for CD22, e.g., human CD22. The extracellular binding domain of the CD22 CAR may be codon-optimized for expression in a host cell or may have a variant sequence to increase the function of the extracellular binding domain. In some embodiments, the extracellular binding domain comprises an immunogenically active portion of an immunoglobulin molecule (e.g., scFv).

[0168] In some embodiments, the extracellular binding domain of the CD22 CAR is derived from an antibody specific for CD22, including, for example, SM03, inotuzumab, epratuzumab, moxetumomab, and pinatuzumab. In any of these embodiments, the extracellular binding domain of the CD22 CAR is derived from the V domain of any of the antibodies. H , V L , and / or one or more CDRs.

[0169] In some embodiments, the extracellular binding domain of the CD22 CAR is a heavy chain variable region (V) of the m971 monoclonal antibody (m971) connected by a linker. H ) and the light chain variable region (V L In some embodiments, the linker comprises an scFv derived from m971, comprising (G4S) n(n may be a positive integer, e.g., 1, 2, 3, 4, 5, or 6) linker, e.g., a 3×G4S linker. In other embodiments, a Whitlow linker may be used instead. In some embodiments, the amino acid sequence of the entire m971-derived scFv (also referred to as m971 scFv) and various portions thereof are provided in Table 12 below. In some embodiments, the CD22-specific scFv comprises or consists of an amino acid sequence set forth in SEQ ID NO: 45, 46, or 50, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO: 45, 46, or 50. In some embodiments, the CD22-specific scFv may comprise one or more CDRs having an amino acid sequence set forth in SEQ ID NOs: 47-49 and 51-53. In some embodiments, the CD22-specific scFv may comprise a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 47-49. In some embodiments, the CD22-specific scFv may comprise a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 51-53. In any of these embodiments, the CD22-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that contain a sequence at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the CD22 CAR comprises or consists of one or more CDRs as described herein.

[0170] In some embodiments, the extracellular binding domain of the CD22 CAR comprises an scFv derived from m971-L7, which is an affinity matured variant of m971 with significantly improved CD22 binding affinity compared to the parent antibody m971 (improved from about 2 nM to less than 50 pM). In some embodiments, the scFv derived from m971-L7 is (G4S) n (n may be a positive integer, e.g., 1, 2, 3, 4, 5, or 6) V of m971-L7 connected by a linker, e.g., a 3×G4S linker H and V LIn other embodiments, a Whitlow linker may be used instead. In some embodiments, the amino acid sequence of the entire m971-L7 derived scFv (also referred to as m971-L7 scFv) and various portions thereof are provided in Table 12 below. In some embodiments, the CD22-specific scFv comprises or consists of an amino acid sequence set forth in SEQ ID NO:54, 55, or 59, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO:54, 55, or 59. In some embodiments, the CD22-specific scFv may comprise one or more CDRs having an amino acid sequence set forth in SEQ ID NO:56-58 and 60-62. In some embodiments, the CD22-specific scFv may comprise a heavy chain having one or more CDRs having an amino acid sequence set forth in SEQ ID NO:56-58. In some embodiments, the CD22-specific scFv may comprise a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 60-62. In any of these embodiments, the CD22-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that contain a sequence at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the CD22 CAR comprises or consists of one or more CDRs described herein.

[0171] [Table 12] TIFF2024525789000024.tif222165

[0172] In some embodiments, the extracellular binding domain of the CD22 CAR comprises the antitoxin HA22 or BL22. The antitoxins BL22 and HA22 are therapeutics that contain a scFv specific for CD22 fused to a bacterial toxin and thus bind to the surface of cancer cells expressing CD22 and can kill the cancer cells. BL22 contains a dsFv of an anti-CD22 antibody (RFB4) fused to a 38 kDa truncated form of Pseudomonas aeruginosa exotoxin A (Bang et al., Clin. Cancer Res., 11:1545-50 (2005)). HA22 (CAT8015, moxetumomab passotox) is a mutated, higher affinity version of BL22 (Ho et al., J. Biol. Chem., 280(1):607-17 (2005)). Suitable sequences of the HA22 and BL22 antigen-binding domains specific for CD22 are disclosed, for example, in U.S. Pat. Nos. 7,541,034, 7,355,012, and 7,982,011, which are incorporated herein by reference in their entireties.

[0173] In some embodiments, the hinge domain of the CD22 CAR comprises a CD8α hinge domain, e.g., a human CD8α hinge domain. In some embodiments, the CD8α hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the hinge domain comprises a CD28 hinge domain, e.g., a human CD28 hinge domain. In some embodiments, the CD28 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the hinge domain comprises an IgG4 hinge domain, e.g., a human IgG4 hinge domain. In some embodiments, the IgG4 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In some embodiments, the hinge domain comprises an IgG4 hinge-Ch2-Ch3 domain, for example a human IgG4 hinge-Ch2-Ch3 domain.In some embodiments, the IgG4 Hinge-Ch2-Ch3 Domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 13 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 13.

[0174] In some embodiments, the transmembrane domain of the CD22 CAR comprises a CD8α transmembrane domain, e.g., a human CD8α transmembrane domain. In some embodiments, the CD8α transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 14 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain, e.g., a human CD28 transmembrane domain. In some embodiments, the CD28 transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 15.

[0175] In some embodiments, the intracellular costimulatory domain of the CD22 CAR comprises a 4-1BB costimulatory domain, e.g., a human 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 16 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the intracellular costimulatory domain comprises a CD28 costimulatory domain, e.g., a human CD28 costimulatory domain. In some embodiments, the CD28 costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO:17 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:17.

[0176] In some embodiments, the intracellular signaling domain of the CD22 CAR comprises a CD3 zeta (ζ) signaling domain, e.g., a human CD3ζ signaling domain. In some embodiments, the CD3ζ signaling domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115.

[0177] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD22 CAR, including a CD22 CAR comprising, for example, a CD22-specific scFv having the sequence set forth in SEQ ID NO: 45 or SEQ ID NO: 54, a CD8α hinge domain of SEQ ID NO: 9, a CD8α transmembrane domain of SEQ ID NO: 14, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0178] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD22 CAR, including a CD22 CAR comprising, for example, a CD22-specific scFv having the sequence set forth in SEQ ID NO:45 or SEQ ID NO:54, a CD28 hinge domain of SEQ ID NO:10, a CD8α transmembrane domain of SEQ ID NO:14, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0179] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD22 CAR, including a CD22 CAR comprising, for example, a CD22-specific scFv having the sequence set forth in SEQ ID NO:45 or SEQ ID NO:54, an IgG4 hinge domain of SEQ ID NO:11 or SEQ ID NO:12, a CD8α transmembrane domain of SEQ ID NO:14, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0180] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD22 CAR, including a CD22 CAR comprising, for example, a CD22-specific scFv having the sequence set forth in SEQ ID NO:45 or SEQ ID NO:54, a CD8α hinge domain of SEQ ID NO:9, a CD28 transmembrane domain of SEQ ID NO:15, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0181] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD22 CAR, including a CD22 CAR comprising, for example, a CD22-specific scFv having the sequence set forth in SEQ ID NO:45 or SEQ ID NO:54, a CD28 hinge domain of SEQ ID NO:10, a CD28 transmembrane domain of SEQ ID NO:15, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0182] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a CD22 CAR, including a CD22 CAR comprising, for example, a CD22-specific scFv having the sequence set forth in SEQ ID NO:45 or SEQ ID NO:54, an IgG4 hinge domain of SEQ ID NO:11 or SEQ ID NO:12, a CD28 transmembrane domain of SEQ ID NO:15, a 4-1BB costimulatory domain of SEQ ID NO:16, a CD3ζ signaling domain of SEQ ID NO:18 or SEQ ID NO:115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence).

[0183] In some embodiments, the polycistronic vector comprises a nucleotide sequence encoding a CD22 CAR having an amino acid sequence set forth in SEQ ID NO: 136, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 136, in combination with the following components: GMCSFR-α signal peptide, m971 scFV (V H -G4S Linker-V L ), together with the CD8α hinge domain, the CD8α transmembrane domain, the 4-1BB costimulatory domain, and the CD3ζ signaling domain (see Table 12).

[0184] BCMA CAR In some embodiments, the CAR is a BCMA CAR, and in these embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding the BCMA CAR. BCMA is a tumor necrosis family receptor (TNFR) member expressed on cells of the B-cell lineage, with highest expression on terminally differentiated B cells or mature B lymphocytes. BCMA is involved in mediating the survival of plasma cells for the maintenance of long-term humoral immunity. BCMA expression has recently been linked to a number of cancers, including multiple myeloma, Hodgkin's and non-Hodgkin's lymphoma, various leukemias, and glioblastoma. In some embodiments, the BCMA CAR may comprise, in tandem, a signal peptide, an extracellular binding domain that specifically binds BCMA, a hinge domain, a transmembrane domain, an intracellular costimulatory domain, and / or an intracellular signaling domain.

[0185] In some embodiments, the signal peptide of the BCMA CAR comprises a CD8α signal peptide. In some embodiments, the CD8α signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:6 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the signal peptide comprises an IgK signal peptide. In some embodiments, the IgK signal peptide comprises or consists of an amino acid sequence set forth in SEQ ID NO:7 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:7. In some embodiments, the signal peptide comprises a GMCSFR-α or CSF2RA signal peptide. In some embodiments, the GMCSFR-α or CSF2RA signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:8 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:8.

[0186] In some embodiments, the extracellular binding domain of the BCMA CAR is specific for BCMA, e.g., human BCMA. The extracellular binding domain of the BCMA CAR may be codon-optimized for expression in a host cell or may have a variant sequence to increase the function of the extracellular binding domain.

[0187] In some embodiments, the extracellular binding domain comprises an immunogenically active portion of an immunoglobulin molecule (e.g., an scFv). In some embodiments, the extracellular binding domain of the BCMA CAR is derived from an antibody specific for BCMA, including, for example, belantamab, erlanatamab, teclistamab, LCAR-B38M, and siltacabtagene. In any of these embodiments, the extracellular binding domain of the BCMA CAR comprises the VFv of any of the antibodies. H , V L , and / or one or more CDRs.

[0188] In some embodiments, the extracellular binding domain of the BCMA CAR comprises an scFv derived from C11D5.3 (a murine monoclonal antibody described in Carpenter et al., Clin. Cancer Res. 19(8):2048-2060 (2013)). See also PCT Publication No. WO2010104949. The C11D5.3-derived scFv comprises the heavy chain variable region (V) of C11D5.3 connected by a Whitlow linker. H ) and the light chain variable region (V L), the amino acid sequences of which are provided in Table 13 below. In some embodiments, the BCMA-specific extracellular binding domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 63, 64, or 68, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO: 63, 64, or 68. In some embodiments, the BCMA-specific extracellular binding domain may comprise one or more CDRs having an amino acid sequence set forth in SEQ ID NO: 65-67 and 69-71. In some embodiments, the BCMA-specific extracellular binding domain may comprise a light chain having one or more CDRs having an amino acid sequence set forth in SEQ ID NO: 65-67. In some embodiments, the BCMA-specific extracellular binding domain may comprise a heavy chain having one or more CDRs having an amino acid sequence set forth in SEQ ID NO: 69-71. In any of these embodiments, the BCMA-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that comprise a sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the BCMA CAR comprises or consists of one or more CDRs described herein.

[0189] In some embodiments, the extracellular binding domain of the BCMA CAR comprises an scFv derived from another murine monoclonal antibody C12A3.2, described in Carpenter et al., Clin. Cancer Res. 19(8):2048-2060 (2013) and PCT Application Publication No. WO2010104949, the amino acid sequence of which is also provided in Table 13 below. In some embodiments, the BCMA-specific extracellular binding domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 72, 73, or 77, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO: 72, 73, or 77. In some embodiments, the BCMA-specific extracellular binding domain may comprise one or more CDRs having an amino acid sequence set forth in SEQ ID NOs: 74-76 and 78-80. In some embodiments, the BCMA-specific extracellular binding domain may comprise a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 74-76. In some embodiments, the BCMA-specific extracellular binding domain may comprise a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 78-80. In any of these embodiments, the BCMA-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that contain a sequence at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the BCMA CAR comprises or consists of one or more CDRs as described herein.

[0190] In some embodiments, the extracellular binding domain of the BCMA CAR comprises a murine monoclonal antibody with high specificity for human BCMA, designated BB2121 in Friedman et al., Hum. Gene Ther. 29(5):585-601 (2018). See also PCT Publication No. WO2012163805.

[0191] In some embodiments, the extracellular binding domain of the BCMA CAR comprises two single variable fragments of heavy chains (VHH) capable of binding to two epitopes of BCMA, as described in Zhao et al., J. Hematol. Oncol. 11(1):141 (2018), also referred to as LCAR-B38M. See also PCT Publication No. WO2018028647.

[0192] In some embodiments, the extracellular binding domain of the BCMA CAR comprises a fully human heavy chain variable domain (FHVH), also referred to as FHVH33, as described in Lam et al., Nat. Commun. 11(1):283 (2020). See also PCT Publication No. WO2019006072. The amino acid sequences of FHVH33 and its CDRs are provided in Table 13 below. In some embodiments, the BCMA-specific extracellular binding domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 81 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 81. In some embodiments, the BCMA-specific extracellular binding domain may comprise one or more CDRs having an amino acid sequence set forth in SEQ ID NOs: 82-84. In any of these embodiments, the BCMA-specific extracellular binding domain may comprise one or more CDRs that contain one or more amino acid substitutions or that comprise a sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the BCMA CAR comprises or consists of one or more CDRs described herein.

[0193] In some embodiments, the extracellular binding domain of the BCMA CAR is an scFv derived from CT103A (or CAR0085) as described in US Patent No. 11,026,975B2, and the amino acid sequence is provided in Table 13 below. In some embodiments, the BCMA-specific extracellular binding domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 118, 119, or 123, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to an amino acid sequence set forth in SEQ ID NO: 118, 119, or 123. In some embodiments, the BCMA-specific extracellular binding domain may comprise one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 120-122 and 124-126. In some embodiments, the BCMA-specific extracellular binding domain may comprise a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 120-122. In some embodiments, the BCMA-specific extracellular binding domain may comprise a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 124-126. In any of these embodiments, the BCMA-specific scFv may comprise one or more CDRs that contain one or more amino acid substitutions or that contain a sequence at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to any of the identified sequences. In some embodiments, the extracellular binding domain of the BCMA CAR comprises or consists of one or more CDRs as described herein.

[0194] CARs and binding factors directed to BCMA are also described in U.S. Application Publication Nos. 2020 / 0246381A1 and 2020 / 0339699A1, the entire contents of each of which are incorporated herein by reference.

[0195]

Table 13

[0196] In some embodiments, the hinge domain of the BCMA CAR comprises a CD8α hinge domain, e.g., a human CD8α hinge domain. In some embodiments, the CD8α hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 9 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the hinge domain comprises a CD28 hinge domain, e.g., a human CD28 hinge domain. In some embodiments, the CD28 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 10, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the hinge domain comprises an IgG4 hinge domain, e.g., a human IgG4 hinge domain. In some embodiments, the IgG4 hinge domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 11 or SEQ ID NO: 12. In some embodiments, the hinge domain comprises an IgG4 hinge-Ch2-Ch3 domain, for example a human IgG4 hinge-Ch2-Ch3 domain.In some embodiments, the IgG4 Hinge-Ch2-Ch3 Domain comprises or consists of the amino acid sequence set forth in SEQ ID NO: 13 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 13.

[0197] In some embodiments, the transmembrane domain of the BCMA CAR comprises a CD8α transmembrane domain, e.g., a human CD8α transmembrane domain. In some embodiments, the CD8α transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 14 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain, e.g., a human CD28 transmembrane domain. In some embodiments, the CD28 transmembrane domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 15.

[0198] In some embodiments, the intracellular costimulatory domain of the BCMA CAR comprises a 4-1BB costimulatory domain, e.g., a human 4-1BB costimulatory domain. In some embodiments, the 4-1BB costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 16 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the intracellular costimulatory domain comprises a CD28 costimulatory domain, e.g., a human CD28 costimulatory domain. In some embodiments, the CD28 costimulatory domain comprises or consists of an amino acid sequence set forth in SEQ ID NO:17 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO:17.

[0199] In some embodiments, the intracellular signaling domain of the BCMA CAR comprises a CD3 zeta (ζ) signaling domain, e.g., a human CD3ζ signaling domain. In some embodiments, the CD3ζ signaling domain comprises or consists of an amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115, or an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the amino acid sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 115.

[0200] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a BCMA CAR, including a BCMA CAR comprising any of the BCMA-specific extracellular binding domains described, a CD8α hinge domain of SEQ ID NO: 9, a CD8α transmembrane domain of SEQ ID NO: 14, a 4-1BB costimulatory domain of SEQ ID NO: 16, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e., having a sequence that is at least 80% identical, e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence). In any of these embodiments, the BCMA CAR can further comprise a signal peptide as described (e.g., a CD8α signal peptide).

[0201] In some embodiments, the polycistronic vector comprises an expression cassette comprising a nucleotide sequence encoding a BCMA CAR, including a BCMA CAR comprising any of the BCMA-specific extracellular binding domains described, a CD8α hinge domain of SEQ ID NO: 9, a CD8α transmembrane domain of SEQ ID NO: 14, a CD28 costimulatory domain of SEQ ID NO: 17, a CD3ζ signaling domain of SEQ ID NO: 18 or SEQ ID NO: 115, and / or variants thereof (i.e. having a sequence that is at least 80% identical, e.g. at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a disclosed sequence). In any of these embodiments, the BCMA CAR can further comprise a signal peptide as described.

[0202] In some embodiments, the polycistronic vector comprises an expression cassette that contains a nucleotide sequence encoding a BCMA CAR set forth in SEQ ID NO: 127 or is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the nucleotide sequence set forth in SEQ ID NO: 127 (see Table 14). The encoded BCMA CAR has a corresponding amino acid sequence set forth in SEQ ID NO: 128 or is at least 80% identical (e.g., 、 at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) and includes the following components: CD8α signal peptide, CT103A scFv (V L -Whitlow Linker-V H ), CD8α hinge domain, CD8α transmembrane domain, 4-1BB costimulatory domain, and CD3ζ signaling domain.

[0203] In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding a commercially available embodiment of a BCMA CAR, including, for example, idecabutagen bicelucel (ide-cel, also known as bb2121). In some embodiments, the polycistronic vector comprises an expression cassette containing a nucleotide sequence encoding idecabutagen bicelucel or a portion thereof. Idecabutagen bicelucel comprises a BCMA CAR having the following components: a BB2121 binding factor, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB costimulatory domain, and a CD3ζ signaling domain.

[0204] [Table 14] TIFF2024525789000030.tif91165

[0205] Safety switch In certain embodiments, the polycistronic vector can include one or more expression cassettes, each of which includes a nucleotide sequence encoding a safety switch. The use of a safety switch in the polycistronic vector of the present technology can induce the death or apoptosis of a host cell that contains the polycistronic vector, for example, when the cell grows and divides in an undesirable manner or causes excessive toxicity to the host. Thus, the use of a safety switch can conditionally eliminate abnormal cells in vivo, which can be an important step for the application of cell therapy in medical institutions. Safety switches and their uses are described, for example, in Duzgunes, Origins of Suicide Gene Therapy (2019), Duzgunes (eds), Suicide Gene Therapy. Methods in Molecular Biology, vol. 1895 (Humana Press, New York, NY) (for HSVtk, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, and horseradish peroxidase), Zhou and Brenner, Exp Hematol 44(11):1013-1019 (2016) (for iCaspase9), Wang et al., Blood 18(5):1255-1263 (2001) (for huEGFR), U.S. Patent Application Publication No. 20180002397 (for HER1), and Philip et al. al., Blood 124(8):1277-1287 (2014) (for RQR8).

[0206] In some embodiments, the safety switch can trigger cell death in a controlled manner, for example, in the presence of a drug or prodrug, or upon activation by a selective exogenous compound. In some embodiments, expression of the safety switch is regulated by a promoter of the polycistronic vector, in the case of genomic location-independent transcriptional regulation, or by an endogenous promoter, in the case of site-specific integration of the construct into a target locus.

[0207] In some embodiments, the safety switch comprises a "suicide gene" or "suicide switch." A suicide gene can cause the death of cells if they are allowed to grow and divide in an undesirable manner. A suicide gene can encode a protein that causes cell death only when activated by a particular compound, e.g., an enzyme that selectively converts a non-toxic compound into a highly toxic metabolite.

[0208] In some embodiments, the safety switch of the polycistronic vector is selected from the group consisting of herpes simplex virus thymidine kinase (HSVtk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.

[0209] In some embodiments, the safety switch of the polycistronic vector may be a transgene that encodes a product that, when activated by a drug or prodrug, exhibits cell killing capabilities, for example, by converting a non-toxic prodrug to a toxic metabolite within the cell. In these embodiments, cell killing is activated by contacting a cell containing the vector with the drug or prodrug. In some cases, the safety switch is HSVtk, which converts ganciclovir (GCV) to GCV triphosphate, thereby preventing DNA synthesis and killing dividing cells. In some cases, the safety switch is CyD or a variant thereof, which converts the antifungal drug 5-fluorocytosine (5-FC) to the cytotoxic 5-fluorouracil (5-FU) by catalyzing the hydrolytic deamination of cytosine to uracil. 5-FU is further converted by cellular enzymes to potent antimetabolites (5-FdUMP, 5-FdUTP, 5-FUTP). These compounds inhibit thymidylate synthase and the production of RNA and DNA, resulting in cell death. In some cases, the safety switch is NTR or a variant thereof and can act on the prodrug CB1954 by reducing the nitro group to a reactive N-hydroxylamine intermediate that is toxic in proliferating and non-proliferating cells. In some cases, the safety switch is PNP or a variant thereof and can convert the prodrugs 6-methylpurine deoxyriboside or fludarabine to metabolites that are toxic to both proliferating and non-proliferating cells. In some cases, the safety switch is horseradish peroxidase or a variant thereof and can catalyze the conversion of indole-3-acetic acid (IAA) to a potent cytotoxin that can kill cells.

[0210] In some embodiments, the safety switch of the polycistronic vector can be iCasp9. Caspase 9 is a component of the intrinsic mitochondrial apoptosis pathway that is activated by the release of cytochrome C from damaged mitochondria under physiological conditions. Activated caspase 9 then activates caspase 3, which triggers terminal effector molecules leading to apoptosis. iCasp9 can be generated by fusing truncated caspase 9 (without its physiological dimerization domain or caspase activation domain) to FKBP12-F36V, an FK506 binding protein (FKBP), via a peptide linker. iCasp9 has low dimer-independent basal activity and can be stably expressed in host cells (e.g., human T cells) without compromising the phenotype, function, or antigen specificity of the host cells. However, in the presence of chemical inducers of dimerization (CIDs), such as rimiduside (AP1903), AP20187, and rapamycin, iCasp9 can undergo inducible dimerization and activate downstream caspase molecules, resulting in apoptosis of cells expressing iCasp9 (see, e.g., PCT Publication No. 2011 / 146862; Stasi et al., N. Engl. J. Med. 365;18 (2011); Tey et al., Biol. Blood Marrow Transplant 13:913-924 (2007)). In particular, the rapamycin-inducible caspase 9 variant is referred to as rapaCasp9 (see, e.g., Stavrou et al., Mol. Ther. 26(5):1266-1276 (2018)). Thus, by using iCasp9 as a safety switch in the polycistronic vectors of the invention, controlled killing of host cells can be achieved.

[0211] In some embodiments, the safety switch of the polycistronic vector may be a membrane-expressed protein, allowing for cell depletion following administration of a specific antibody against that protein. Safety switches in this category may include, for example, CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, or RQR8. These proteins may have surface epitopes that can be targeted by specific antibodies.

[0212] In some embodiments, the safety switch comprises a CCR4 that can be recognized by an anti-CCR4 antibody. Non-limiting examples of suitable anti-CCR4 antibodies include mogamulizumab and its biosimilars.

[0213] In some embodiments, the safety switch comprises CD16 or CD30 that can be recognized by an anti-CD16 or anti-CD30 antibody. Non-limiting examples of such anti-CD16 or anti-CD30 antibodies include AFM13 and its biosimilars.

[0214] In some embodiments, the safety switch comprises CD19 that can be recognized by an anti-CD19 antibody, non-limiting examples of which include MOR208 and its biosimilars.

[0215] In some embodiments, the safety switch comprises CD20, which can be recognized by an anti-CD20 antibody. Non-limiting examples of such anti-CD20 antibodies include obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-RLIb and biosimilars thereof. Thus, cells expressing the safety switch are CD20 positive and can be targeted for killing by administration of the described anti-CD20 antibodies.

[0216] In some embodiments, the safety switch comprises an EGFR that can be recognized by an anti-EGFR antibody. Non-limiting examples of such anti-EGFR antibodies include tomzotuximab, RO5083945 (GA201), cetuximab, and biosimilars thereof.

[0217] In some embodiments, the safety switch comprises GD2 that can be recognized by an anti-GD2 antibody. Non-limiting examples of such anti-GD2 antibodies include Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-RLIc, and biosimilars thereof.

[0218] In some embodiments, the safety switch comprises a HER1 that can be recognized by an anti-HER1 antibody, non-limiting examples of which include cetuximab and its biosimilars.

[0219] In some embodiments, the safety switch comprises a HER2 that can be recognized by an anti-HER2 antibody. Non-limiting examples of such anti-HER2 antibodies include margetuximab, trastuzumab, TraGEX, and biosimilars thereof.

[0220] In some embodiments, the safety switch comprises MUC1 that can be recognized by an anti-MUC1 antibody, non-limiting examples of which include gatipotuzumab and its biosimilars.

[0221] In some embodiments, the safety switch comprises PSMA that can be recognized by an anti-PSMA antibody, non-limiting examples of which include KM2812 and its biosimilars.

[0222] In some embodiments, the safety switch comprises RQR8, which can be recognized by an anti-RQR8 antibody. Non-limiting examples of such anti-RQR8 antibodies include cetuximab and its biosimilars.

[0223] In some embodiments, the safety switch comprises HSVtk and a membrane expressed protein, such as CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.

[0224] In some embodiments, the safety switch comprises a therapeutic agent that recognizes one or more tolerogenic factors expressed on the surface of the modified cell. In some embodiments, the safety switch comprises a therapeutic agent that inhibits or blocks the interaction between CD47 and signal regulatory protein alpha (SIRPα), e.g., a CD47-SIRPα blocking agent. SIRPα is a transmembrane receptor protein on circulating immune cells. When CD47 expressed by a foreign cell binds to SIRPα, CD47 delivers a "don't eat me" inhibitory signal to the recipient's immune system, thus avoiding rejection by the recipient's immune system. Thus, disrupting the CD47-SIRPα interaction removes the immune defense masking, resulting in the elimination of the foreign cell by the recipient's immune system. In some embodiments, the CD47-SIRPα blocking agent is an agent that neutralizes, blocks, antagonizes, or interferes with cell surface expression of CD47, SIRPα, or both. In some embodiments, the CD47-SIRPα blocking agent inhibits or blocks the interaction of CD47, SIRPα, or both. In some embodiments, the CD47-SIRPα blocking agent (e.g., a CD47-SIRPα blocking agent, inhibitor, reducer, antagonist, neutralizer, or disruptor) comprises an agent selected from the group including an antibody or fragment thereof that binds CD47, a bispecific antibody that binds CD47, an immunocytokine fusion protein that binds CD47, a CD47-containing fusion protein, an antibody or fragment thereof that binds SIRPα, a bispecific antibody that binds SIRPα, an immunocytokine fusion protein that binds SIRPα, a SIRPα-containing fusion protein, or any combination thereof.

[0225] In some embodiments, the CD47-SIRPα blocking agent comprises a CD47 binding domain. In some embodiments, the CD47 binding domain comprises SIRPα or a fragment thereof. In some embodiments, the CD47-SIRPα blocking agent comprises an immunoglobulin G (IgG) Fc domain. In some embodiments, the IgG Fc domain comprises an IgG1 Fc domain. In some embodiments, the IgG1 Fc domain comprises a fragment of a human antibody. In some embodiments, the CD47-SIRPα blocking agent is selected from the group consisting of TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPα blocking agent is TTI-621. In some embodiments, the CD47-SIRPα blocking agent is TTI-622. In some embodiments, the CD47-SIRPα blocking agent is ALX148. In some embodiments, the IgG Fc domain comprises an IgG4 Fc domain. In some embodiments, the CD47-SIRPα blocking agent is an antibody. In some embodiments, the antibody is selected from the group consisting of MIAP410, B6H12, and magrolimab. In some embodiments, the antibody is MIAP410. In some embodiments, the antibody is B6H12. In some embodiments, the antibody is magrolimab. In some embodiments, the antibody is selected from the group consisting of AO-176, IBI188 (retaplimab), STI-6643, and ZL-1201. In some embodiments, the antibody is AO-176 (Arch). In some embodiments, the antibody is IBI188 (retaplimab) (Innovent). In some embodiments, the antibody is STI-6643 (Sorrento). In some embodiments, the antibody is ZL-1201 (Zai).

[0226] In some embodiments, useful antibodies or fragments thereof that bind to CD47 include magrolimab ((Hu5F9-G4)) (Forty Seven, Inc.; Gilead Sciences, Inc.), urabulelimab, CC-90002 (Celgene; Bristol-Myers Squibb), IBI-188 (Innovent Biologics), IBI-322 (Innovent Biologics), TG-1801 (TG Therapeutics; also known as NI-1701, Novimmune SA), ALX148 (ALX Oncology), TJ011133 (also known as TJC4, I-Mab Biopharma), FA3M3, ZL-1201 (Zai Lab Co., Ltd), AK117 (Akesbio Australia Pty, Ltd.), AO-176 (Arch Oncology), SRF231 (Surface Oncology), GenSci-059 (GeneScience), C47B157 (Janssen Research and Development), C47B161 (Janssen Research and Development), C47B167 (Janssen Research and Development), C47B222 (Janssen Research and Development), C47B227 (Janssen Research and Development), Vx-1004 (Corvus Pharmaceuticals), HMBD004 (Hummingbird Bioscience Pte Ltd), SHR-1603 (Hengrui), AMMS4-G4 (Beijing Institute of Biotechnology), RTX-CD47 (University of Groningen), and IMC-002 (Samsung Biologics; ImmuneOncia Therapeutics).In some embodiments, the antibody or fragment thereof does not compete for CD47 binding with an antibody selected from the group including magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof competes for CD47 binding with an antibody selected from magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof that binds to CD47 is selected from the group including a single chain Fv fragment (scFv) against CD47, a Fab against CD47, a VHH nanobody against CD47, a DARPin against CD47, and variants thereof. In some embodiments, the scFv against CD47, Fab against CD47, and variants thereof are based on the antigen binding domain of any of the antibodies selected from the group including magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002.Further information regarding CD47-SIRPα blocking agents can be found in PCT Publication No. WO2022076928, which is incorporated by reference in its entirety.

[0227] In certain embodiments, the polycistronic vector can include one or more expression cassettes, each comprising a nucleotide sequence encoding a transgene of interest for use in cell therapy, e.g., cancer therapy. In any of these embodiments, the polycistronic vector can be designed to allow for the co-expression of one or more tolerogenic factors, one or more CARs, one or more safety switches, and / or one or more other transgenes of interest for cell therapy, where the expression cassettes are separated by one or more cleavage sites as described.

[0228] Specific Exemplary Embodiments In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD19 CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD19 CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in the 5' to 3' order. In some embodiments, the polycistronic vector further includes: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first and / or second expression cassettes by a 2A site, or a 2A site and a furin site.

[0229] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD20 CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD20 CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in the 5' to 3' order. In some embodiments, the polycistronic vector further comprises: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first and / or second expression cassettes by a 2A site, or a 2A site and a furin site.

[0230] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD22 CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding CD22 CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in the 5' to 3' order. In some embodiments, the polycistronic vector further comprises: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first and / or second expression cassettes by a 2A site, or a 2A site and a furin site.

[0231] In some aspects, a polycistronic vector is provided that comprises: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; (c) a third expression cassette comprising a nucleotide sequence encoding a CD22 CAR; and (d) a 2A site, or a 2A and a furin site, separating any two adjacent expression cassettes. In some embodiments, the polycistronic vector further comprises (e) a fourth expression cassette comprising a nucleotide sequence encoding a safety switch, the fourth expression cassette being separated from the first expression cassette, the second expression cassette, and / or the third expression cassette by a 2A site, or a 2A and a furin site.

[0232] In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding BCMA CAR; and (c) a 2A site separating the first and second expression cassettes. In some aspects, a polycistronic vector is provided comprising: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding BCMA CAR; and (c) a furin site and a 2A site separating the first and second expression cassettes, wherein the furin site is located in front of the 2A site in a 5' to 3' order. In some embodiments, the polycistronic vector further comprises: (d) a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first and / or second expression cassettes by a 2A site, or a 2A site and a furin site.

[0233] In some aspects, a polycistronic vector is provided that includes: (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding a safety switch; and (c) a 2A site, or a 2A and a furin site, separating the first and second expression cassettes.

[0234] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47 and a second expression cassette comprising a nucleotide sequence encoding CD19 CAR, separated by one or more of the cleavage sites described (e.g., 2A site, 2A site and furin site). The 5' to 3' order of the first and second expression cassettes may be reversed, i.e., the CD47 gene may be located either before or after the CD19 CAR gene. However, as shown in the examples, placing the CD47 gene before the CD19 CAR gene in the 5' to 3' order may increase expression of CD47 and improve immune protection of host cells from killing by innate immune cells. In certain of these embodiments, the polycistronic vector may further comprise a third expression cassette comprising a nucleotide sequence encoding a safety switch, separated from the first and / or second expression cassette by one or more of the cleavage sites described (e.g., 2A site, 2A site and furin site). The location of the safety switch can vary, for example, in 5' to 3' order before the CD47 and CD19 CAR cassettes, between the CD47 and CD19 CAR cassettes, or after the CD47 and CD219 CAR cassettes.

[0235] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47 and a second expression cassette comprising a nucleotide sequence encoding CD20 CAR, separated by one or more cleavage sites as described (e.g., a 2A site, a 2A site and a furin site). In certain of these embodiments, the polycistronic vector can further comprise a third expression cassette comprising a nucleotide sequence encoding a safety switch, separated from the first and / or second expression cassette by one or more cleavage sites as described (e.g., a 2A site, a 2A site and a furin site). The location of the safety switch can vary, for example, in 5' to 3' order before the CD47 and CD20 CAR cassettes, between the CD47 and CD20 CAR cassettes, or after the CD47 and CD20 CAR cassettes.

[0236] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47 and a second expression cassette comprising a nucleotide sequence encoding CD22 CAR, separated by one or more cleavage sites as described (e.g., a 2A site, a 2A site and a furin site). In certain of these embodiments, the polycistronic vector can further comprise a third expression cassette comprising a nucleotide sequence encoding a safety switch, separated from the first and / or second expression cassette by one or more cleavage sites as described (e.g., a 2A site, a 2A site and a furin site). The location of the safety switch can vary, for example, in 5' to 3' order before the CD47 and CD22 CAR cassettes, between the CD47 and CD22 CAR cassettes, or after the CD47 and CD22 CAR cassettes.

[0237] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47, a second expression cassette comprising a nucleotide sequence encoding a CD22 CAR, and a third expression cassette comprising a nucleotide sequence encoding a CD19 CAR, all separated from each other by one or more cleavage sites as described (e.g., 2A site, 2A and furin site). Such a polycistronic vector allows for the co-expression of two CARs (i.e., CD22 CAR and CD19 CAR) in a host cell. For example, to minimize the risk of recombination due to sequence similarity, the CD22 CAR and the CD19 CAR may comprise one or more different non-antigen binding domains, e.g., each CAR may comprise a different hinge domain, transmembrane domain, costimulatory domain, and / or intracellular signaling domain. As one non-limiting example, one CAR may comprise one transmembrane domain (e.g., CD28 transmembrane domain) and the other CAR may comprise a different transmembrane domain (e.g., CD8α transmembrane domain). As another non-limiting example, one CAR may contain one costimulatory domain (e.g., a 4-1BB costimulatory domain) and the other CAR may contain a different costimulatory domain (e.g., a CD28 costimulatory domain). Alternatively, the CD22 CAR and the CD19 CAR may contain the same non-antigen binding domain, but codon diversity at the nucleotide sequence level may be introduced to minimize the risk of recombination. In certain of these embodiments, the polycistronic vector may further contain a fourth expression cassette that includes a nucleotide sequence encoding a safety switch separated from the first, second, and / or third expression cassettes by one or more cleavage sites as described (e.g., a 2A site, a 2A site and a furin site). The placement of the safety switch may vary, such as, for example, before all other expression cassettes, between the two expression cassettes, or after all other expression cassettes in the 5' to 3' order.

[0238] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47 and a second expression cassette comprising a nucleotide sequence encoding a BCMA CAR, separated by one or more of the cleavage sites described (e.g., a 2A site, a 2A site and a furin site). In certain of these embodiments, the polycistronic vector can further comprise a third expression cassette comprising a nucleotide sequence encoding a safety switch, separated from the first and / or second expression cassette by one or more of the cleavage sites described (e.g., a 2A site, a 2A site and a furin site). The location of the safety switch can vary, for example, in 5' to 3' order before the CD47 and BCMA CAR cassettes, between the CD47 and BCMA CAR cassettes, or after the CD47 and BCMA CAR cassettes.

[0239] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47, separated by one or more of the cleavage sites described (e.g., a 2A site, a 2A site and a furin site), and a second expression cassette comprising a nucleotide sequence encoding a safety switch. The safety switch can be located either before or after CD47 in the 5' to 3' order.

[0240] In some embodiments, the polycistronic vector comprises a first expression cassette comprising a nucleotide sequence encoding CD47, and a second expression cassette comprising a nucleotide sequence encoding a safety switch, separated by one or more cleavage sites as described (e.g., a 2A site, a 2A site and a furin site), the safety switch comprising HSVtk and a membrane expressed protein (e.g., CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, RQR8, and CD47-SIRPα blocker). In certain of these embodiments, the CD47 and safety switch transgenes are flanked by homology arms for use in site-specific insertion (knock-in) into a particular locus in a host cell, for example, by a homology directed repair (HDR)-based approach as described. For example, a transgene can be flanked by the CLYBL left homology arm (LHA) and right homology arm (RHA) and inserted into the CLYBL locus of a host cell, such as a beta islet cell or a glial precursor cell (GPC).

[0241] Cutting site In certain embodiments, two or more expression cassettes of the polycistronic vector of the present technology can be separated by one or more cleavage sites.As the name suggests, polycistronic vector allows two or more separate proteins to be simultaneously expressed from one mRNA transcript in host cell.Cleavage sites can be used in the design of polycistronic vector to achieve the co-expression of such multiple genes.

[0242] In some embodiments, the one or more cleavage sites further comprise one or more autocleavage sites. In some embodiments, the autocleavage site comprises a 2A site. 2A peptides are a class of 18-22 amino acid long peptides first discovered in picornaviruses that can induce ribosome skipping during protein translation, resulting in equal amounts of multiple genes from the same mRNA transcript. 2A peptides function to "cleave" the mRNA transcript by forcing the ribosome to skip synthesis of the C-terminal peptide bond between a glycine (G) and a proline (P) residue, separating the end of the 2A sequence from the next downstream peptide. There are four 2A peptides commonly used in molecular biology, T2A, P2A, E2A, and F2A, whose sequences are summarized in Table 15. Optionally, a glycine-serine-glycine (GSG) linker can be added to the N-terminus of the 2A peptide to enhance cleavage efficiency. The use of "( )" around a sequence in this disclosure means that the enclosed sequence is optional.

[0243] [Table 15]

[0244] In some embodiments, the one or more cleavage sites further comprise one or more protease sites. The one or more protease sites may be located before or after the self-cleavage site (e.g., 2A site) in the 5' to 3' order of the polycistronic vector. The protease site may be cleaved by a protease after translation of the complete transcript or after translation of each expression cassette, thereby releasing the first expression product before the next expression cassette is translated. In these embodiments, having a protease site in addition to the 2A site, particularly before the 2A site in the 5' to 3' order, can reduce the number of extra amino acid residues attached to the expressed protein of interest. In some embodiments, the protease site comprises a furin site, also known as a PACE (Paired basic Amino acid Cleaving Enzyme) site. There are at least three furin cleavage sequences, FC1, FC2 and FC3, whose amino acid sequences are summarized in Table 16. As with the 2A site, optionally one or more glycine-serine-glycine (GSG) sequences may be included for cleavage efficiency.

[0245] [Table 16]

[0246] In some embodiments, the one or more cleavage sites include one or more autocleavage sites, one or more protease sites, and / or any combination thereof. For example, the cleavage site may include only a 2A site. In another example, the cleavage site may include a FC2 site or a FC3 site followed by a 2A site. In these embodiments, the one or more autocleavage sites may be the same or different. Similarly, the one or more protease sites may be the same or different.

[0247] Vectors and compositions thereof In some embodiments, the vector used for polycistronic expression of two or more proteins of the present technology can be any type of vector suitable for introducing nucleotide sequences into a host cell, including, for example, plasmids, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, phages, and homology directed repair (HDR)-based donor vectors.

[0248] In some embodiments, constructs comprising expression cassettes and cleavage sites according to various embodiments of the present technology may be operably linked to specific regulators of the vector. As known to those skilled in the art, expression vectors are generally engineered to contain polynucleotide sequences required to affect the expression and processing of coding sequences to which they are operably linked. Expression control sequences may include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency; sequences that increase protein stability, and may also include sequences that increase protein secretion. Expression control sequences are operably linked when they are close to the gene of interest and the expression control sequences act in trans or at a distance on the gene of interest.

[0249] In some embodiments, the promoter induces constitutive gene expression in mammalian cells. Commonly used promoters include, for example, the elongation factor 1 alpha (EF1α) promoter, the cytomegalovirus (CMV) immediate early promoter (Greenaway et al., Gene 18:355-360 (1982)), the simian vacuolating virus 40 (SV40) early promoter (Fiers et al., Nature 273:113-120 (1978)), the spleen focus forming virus (SFFV) promoter, the phosphoglycerate kinase (PGK) promoter (Adra et al., Gene 60(1):65-74 (1987)), the human beta actin promoter, the polyubiquitin C gene (UBC) promoter, and the CAG promoter (Nitoshi et al., Gene 108:193-199 (1991)). One example of a promoter that can express a CAR transgene in mammalian cells (e.g., T cells) is the EF1α promoter. The native EF1α promoter drives the expression of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl-tRNA to the ribosome. The EF1α promoter is widely used in mammalian expression plasmids and has been shown to be effective in driving CAR expression from transgenes cloned into lentiviral vectors (see, e.g., Milone et al., Mol. Ther. 17(8):1453-1464 (2009)).

[0250] In some embodiments, the promoter is an inducible promoter. Unlike constitutive promoters, inducible promoters can be switched between on and off states in response to specific stimuli (e.g., chemicals, temperature, light) and can be regulated in a tissue- or cell-specific manner. Non-limiting examples of commonly used inducible promoters include the tetracycline On (Tet-On) system and the tetracycline Off (Tet-Off) system, which utilize a tetracycline response element (TRE) placed upstream of a minimal promoter (e.g., the CMV promoter) (Gossen & Bujard, Proc. Natl. Acad. Sci. USA 89(12):5547-5551 (1992)). The TRE consists of seven repeats of the 19-nucleotide tetracycline operator (tetO) sequence and can be recognized by the tetracycline repressor (tetR). In the Tet-Off system, a tetracycline-controlled transactivator (tTA) has been developed by fusing tetR with the activation domain of virion protein 16 of herpes simplex virus. In the absence of tetracycline or its analogs (e.g., doxycycline), tTA binds to the tetO sequence of the TRE and induces expression, whereas in the presence of tetracycline, rTA binds to tetracycline but not to the TRE, resulting in reduced gene expression. Conversely, in the Tet-On system, a reverse transactivator (rtTA) has been created by mutagenesis of amino acid residues important for tetracycline-dependent repression, and rtTA binds to the TRE and promotes gene expression in the presence of tetracycline or doxycycline (Gossen et al., Science 268(5218):1766-1769(1995)). Other examples of inducible promoters include, for example, AlcA, LexA, and Cre.

[0251] In some embodiments, the polycistronic vector comprises a Kozak consensus sequence preceding the first expression cassette. The Kozak consensus sequence is a nucleic acid motif that functions as a protein translation initiation site in most eukaryotic mRNA transcripts and mediates ribosome assembly and translation initiation. In some embodiments, the Kozak consensus sequence comprises or consists of the sequence set forth in SEQ ID NO: 92: (gcc)gccrccatgg (SEQ ID NO: 92), where r is a purine (i.e., a or g).

[0252] In some embodiments, the polycistronic vector comprises a Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory element (WPRE) after the second expression cassette. The WPRE is a DNA sequence that produces tertiary structure-enhanced expression upon transcription. The WPRE sequence is commonly used to increase the expression of genes delivered by viral vectors. In some embodiments, the WPRE sequence comprises or consists of the amino acid sequence set forth in SEQ ID NO:93, or comprises or consists of an amino acid sequence that is at least 80% identical (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical) to the sequence set forth in SEQ ID NO:93: (SEQ ID NO:93).

[0253] In some embodiments, the polycistronic vector comprises homology arms flanking a fragment containing an expression cassette and / or a promoter for use in site-specific insertion (knock-in) into a specific locus of a host cell, for example by a described homology-directed repair (HDR)-based approach. The fragment of the polycistronic vector to be inserted (usually containing at least an expression cassette and optionally also a promoter) is flanked by homologous sequences (i.e., left homology arm (LHA) and right homology arm (RHA)) immediately upstream and downstream of the target insertion site. The homology arms are designed specifically for the target genomic locus such that the fragment serves as a template for HDR. The length of each homology arm is generally determined by the size of the insert to be introduced, with larger inserts requiring longer homology arms.

[0254] In some aspects, the technology provides compositions comprising a polycistronic vector according to various embodiments disclosed herein.

[0255] In some embodiments, the composition comprises a polycistronic vector according to an embodiment disclosed herein. In some embodiments, the composition can comprise a mixture of two or more polycistronic vectors according to different embodiments disclosed herein. In these embodiments, the two or more polycistronic vectors are different (e.g., comprise expression cassettes encoding different proteins of interest (e.g., different CARs)) and the composition can be used to transfect or transduce to generate a heterogeneous population of host cells. By way of non-limiting example, the composition can comprise two polycistronic vectors, one encoding CD47 and CD19 CARs and the other encoding CD47 and CD22 CARs.

[0256] In some embodiments, the composition may further comprise one or more pharma- ceutically acceptable carriers, excipients, preservatives, or combinations thereof. A "pharma- ceutically acceptable carrier or excipient" refers to a pharma- ceutically acceptable material, composition, or vehicle involved in carrying or transporting a compound of interest from one tissue, organ, or part of the body to another tissue, organ, or part of the body. For example, a carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of the carrier or excipient must be "pharma- ceutically acceptable" in that it must be compatible with the other components of the formulation. Each component must also be suitable for contact with any tissue, organ, or part of the body with which it may come into contact, i.e., it must not pose a risk of toxicity, irritation, allergic reaction, immunogenicity, or other complications that unduly outweigh its therapeutic benefits. Suitable excipients include water, saline, dextrose, glycerol, and the like, and combinations thereof. In some embodiments, the composition comprising the host cells disclosed herein further comprises a suitable infusion medium.

[0257] Viruses and compositions thereof In some aspects, the present technology provides a virus comprising the polycistronic vector according to various embodiments disclosed herein for transducing a host cell. In certain embodiments, the polycistronic vector of the present technology can be in the form of a virus or packaged in a virus for transducing a host cell. The virus can be any type of virus suitable for transducing a host cell and introducing a nucleotide sequence into the host cell, including, for example, adenovirus, adeno-associated virus, retrovirus, lentivirus, and phage.

[0258] In some aspects, the technology provides compositions comprising viruses according to various embodiments disclosed herein. In some embodiments, the composition can comprise a polycistronic vector packaged in a virus according to an embodiment disclosed herein. In some embodiments, the composition can comprise a mixture of two or more viruses according to different embodiments disclosed herein. For example, the composition can comprise a first polycistronic vector packaged in a first virus and a second polycistronic vector packaged in a second virus. In any of these embodiments, the two or more viruses each have a different polycistronic vector packaged in the first virus (e.g., comprising expression cassettes encoding different proteins of interest (e.g., different CARs)), and the composition can be used to transduce host cells to generate a heterogeneous population. By way of non-limiting example, the composition can comprise two viruses, one of which comprises a polycistronic vector encoding CD47 and CD19 CARs, and the other of which comprises a polycistronic vector encoding CD47 and CD22 CARs. This composition can then be used to transduce host cells to generate a mixture of cells, some of which express CD47 and CD19 CARs, some of which express CD47 and CD22 CARs, and some of which express CD47, CD19 CAR, and CD22 CAR.

[0259] Methods for Producing Host Cells and Compositions Thereof Methods for Producing Host Cells In some aspects, the present technology provides methods for generating a population of host cells comprising a polycistronic vector according to various embodiments disclosed herein for cell therapy.

[0260] In some embodiments, the method includes introducing a polycistronic vector according to various embodiments of the present technology, or a composition or virus comprising the vector, into a host cell population for use in adoptive cell therapy. The host cell can be transformed by incorporating the polycistronic vector by any method known in the art, including, for example, viral transduction, calcium phosphate transfection, lipid-mediated transfection, DEAE-dextran, electroporation, microinjection, nucleoporation, liposomes, nanoparticles, or other methods. For example, the described viral vector or a polycistronic vector in the form of a virus can be used to transduce the host cell population. The transformed host cells can be harvested and / or screened using known techniques, and various subpopulations or combinations thereof can be enriched or depleted by known techniques, such as, for example, affinity binding to antibodies, flow cytometry, fluorescence-activated cell sorting (FACS), or immunomagnetic selection. After introduction into the host cell, the polycistronic vector or a fragment thereof can be integrated into the genome of the host cell by either random insertion or site-specific insertion (knock-in) as described.

[0261] In some embodiments, populations of host cells generated by the described methods have at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the population have the polycistronic vector integrated into their cells. In some embodiments, populations of host cells generated by methods according to various embodiments of the present technology, wherein at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the population express one or more proteins of interest encoded by the polycistronic vector.

[0262] In certain of these embodiments, the method may further include introducing a second polycistronic vector, or a composition or virus comprising a vector, according to various embodiments of the present technology, into the population of host cells. This step of introducing the second polycistronic vector, or a composition or virus comprising a vector, may be performed simultaneously with or after the step of introducing the first polycistronic vector, or a composition or virus comprising a vector, into the host cells. In these embodiments, the first and second polycistronic vectors may be different, for example, may include expression cassettes encoding different proteins of interest (e.g., different CARs), and the host cells generated may be a heterogeneous population. By way of non-limiting example, a host cell can be transformed with a first polycistronic vector encoding CD47 and CD19 CARs and a second polycistronic vector encoding CD47 and CD22 CARs, either sequentially or in combination, to generate a heterogeneous population in which some cells express CD47 and CD19 CARs, some cells express CD47 and CD22 CARs, and some cells express CD47, CD19, and CD22 CARs. In some embodiments, a heterogeneous population of host cells generated by the described methods has at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the population have a second polycistronic vector integrated into the cells.In some embodiments, the heterogeneous population of host cells generated by the described methods has at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the population express one or more proteins of interest encoded by the second polycistronic vector. In certain of these embodiments, the methods may further include a step of sorting or isolating a subpopulation of the generated heterogeneous population of host cells, wherein at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the subpopulation have both the first and second polycistronic vectors integrated therein, or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the subpopulation express a protein of interest encoded by both the first and second polycistronic vectors.

[0263] In some embodiments, the method includes introducing a mixture or combination of two or more polycistronic vectors or a composition comprising vectors according to various embodiments of the present technology into a population of host cells. In these embodiments, the two or more polycistronic vectors may be different, for example, may contain expression cassettes encoding different proteins of interest (e.g., different CARs), and the resulting host cells may be a heterogeneous population. The mixture of polycistronic vectors may be in the form of a viral vector or a mixture of viruses as described. By way of non-limiting example, a mixture of two polycistronic vectors, one encoding CD47 and CD19 CARs and the other encoding CD47 and CD22 CARs, may be used to transform host cells to generate a heterogeneous population in which some cells express CD47 and CD19 CARs, some cells express CD47 and CD22 CARs, and some cells express CD47, CD19, and CD22 CARs. In some embodiments, a heterogeneous population of host cells generated by the described methods has at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the population have at least one of two or more polycistronic vectors integrated into their cells.In some embodiments, a heterogeneous population of host cells generated by the described methods is one in which at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the population express a protein of interest encoded by at least one of the two or more polycistronic vectors. In certain of these embodiments, the methods may further comprise a step of sorting or isolating a subpopulation of the generated heterogeneous population of host cells, wherein at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the subpopulation have two or more polycistronic vectors integrated therein, or at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the host cells in the subpopulation express a protein of interest encoded by the two or more polycistronic vectors.

[0264] In any of these embodiments, the method may further comprise further modification of the host cells to reduce the immunogenicity of these cells. In cell therapy, if the host cells are allogeneic, i.e., derived from a person other than the recipient, further modification is required to reduce the risk of graft-versus-host after infusion into the recipient, or the risk of being eliminated by the recipient's natural immune system. In some embodiments, the further modification comprises reducing or eliminating the expression of major histocompatibility complex (MHC) class I and / or II (MHC I and / or MHC II) molecules in the host cells. This step of modifying MHC1 and / or MHC II molecules may occur before, simultaneously with, or after the step of introducing the first polycistronic vector or a composition comprising it into the host cells, and / or the step of introducing the second polycistronic vector or a composition comprising it into the host cells.

[0265] MHC I and / or MHC II genes code for cell surface molecules specialized to present antigenic peptides to immune cells. Reduced expression of MHC I and / or MHC II on allogeneic cells can prevent recognition of these cells by the recipient's immune cells and thus rejection of the graft. Human MHCs are called human leukocyte antigens (HLA). Class I HLA (HLA I) corresponding to MHC I includes HLA-A, HLA-B, and HLA-C genes, while class II HLA (HLA I) corresponding to MHC II includes HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO genes.

[0266] In some embodiments, further modification of the host cells to reduce the immunogenicity of these cells includes genetically modifying the cells to reduce expression of one or more immune factors, including, for example, CIITA, beta2 microglobulin (B2M), NLRC5, CTLA-4, PD-1, HLA-A, HLA-BM, HLA-C, RFX-ANK, NFY-A, RFX5, RFX-AP, NFY-B, NFY-C, IRF1, MIC-A, MIC-B, and TAP1.

[0267] In some embodiments, allogeneic host cells can be modified to have reduced expression of MHC I genes by targeting and modulating one or more HLA loci, such as HLA-A, HLA-B, and / or HLA-C, individually, or collectively with HLA-Razor. In some embodiments, this modulation is performed by insertion deletion (indel) modification of one or more HLA loci, including HLA-A, HLA-B, and / or HLA-C, for example, by using the CRISPR / Cas system described. Modulating (e.g., reducing or eliminating) the expression of any of the HLA genes can make the cells less immunogenic and less capable of eliciting an immune response in the recipient subject. In some embodiments, reduced expression of any of the HLA loci reduces or eliminates the expression of one or more of the HLA-A, HLA-B, and HLA-C genes. In some embodiments, the host cells have a knockout of HLA-A, HLA-B, and / or HLA-C. In some embodiments, the targeted genetic modification of any of the HLA loci comprises inserting an exogenous nucleic acid (e.g., a polycistronic vector or a fragment thereof) encoding a polypeptide disclosed herein into the HLA locus according to embodiments disclosed herein. In certain of these embodiments, the insertion of the polycistronic vector or a fragment thereof into any of the HLA loci results in knockout of HLA-A, HLA-B, and / or HLA-C.

[0268] In some embodiments, allogeneic host cells can be modified to have reduced expression of MHC I genes by targeted modulation of the B2M locus. The B2M gene encodes a component of the MHC I molecule. In some embodiments, this modulation is performed by insertion deletion (indel) modification of the B2M locus, for example, by using the described CRISPR / Cas system. Modulating (e.g., reducing or eliminating) the expression of B2M blocks surface trafficking of MHC-I molecules, thereby rendering the cells less immunogenic. In some embodiments, allogeneic host cells modified to have reduced expression of MHC I genes have a reduced ability to induce an immune response in a recipient subject. In some embodiments, reduced expression of B2M reduces or eliminates expression of one or more of the HLA-A, HLA-B, and HLA-C genes. In some embodiments, the host cells have a B2M knockout. In some embodiments, the genetic modification targeted to the B2M locus comprises inserting an exogenous nucleic acid (e.g., a polycistronic vector or a fragment thereof) encoding a polypeptide disclosed herein into the B2M locus according to the embodiments disclosed herein. In certain of these embodiments, the insertion of the polycistronic vector or a fragment thereof into the B2M locus results in a knockout of B2M.

[0269] In some embodiments, allogeneic host cells can be modified to have reduced expression of MHC I genes by targeted modulation of the TAP1 locus. TAP1, encoded by the TAP1 gene, combines with TAP2, encoded by the TAP2 gene, to form the transporter associated with antigen processing (TAP) complex, which is found in the endoplasmic reticulum (ER) and transports foreign peptides to the ER for binding to MHC class I proteins and presentation to the immune system at the cell surface. In some embodiments, this modulation is achieved by insertion deletion (indel) modification of the TAP1 locus, for example, by using the described CRISPR / Cas system. Modulating (e.g., reducing or eliminating) the expression of TAP1 blocks surface trafficking of MHC-I molecules, thereby rendering the cells less immunogenic. In some embodiments, reduced expression of TAP1 reduces or eliminates expression of one or more of the HLA-A, HLA-B, and HLA-C genes. In some embodiments, the host cells have a TAP1 knockout. In some embodiments, the genetic modification targeted to the TAP1 locus comprises inserting an exogenous nucleic acid (e.g., a polycistronic vector or a fragment thereof) encoding a polypeptide disclosed herein into the TAP1 locus according to the embodiments disclosed herein. In certain of these embodiments, the insertion of the polycistronic vector or a fragment thereof into the TAP1 locus results in a knockout of TAP1.

[0270] In some embodiments, the allogeneic host cells can be engineered to have reduced expression of MHC II genes by overexpression of CD74.

[0271] In some embodiments, the allogeneic host cell can be modified to have reduced expression of MHC II genes by targeting and regulating the class II transactivator (CIITA) locus. CIITA is a member of the nucleotide-binding domain (NBD) leucine-rich repeat (LRR) family of proteins and controls the transcription of MHC II by associating with the MHC enhanceosome. In some embodiments, this regulation is performed by insertion-deletion (indel) modification of the CIITA locus, for example, by using the CRISPR / Cas system described. In some embodiments, the reduced expression of CIITA reduces or eliminates the expression of one or more of the HLA-DR, HLA-DQ, HLA-DP, HLA-DM, and HLA-DO genes. In some embodiments, the host cell has a CIITA knockout. In some embodiments, the genetic modification targeting the CIITA locus comprises inserting an exogenous nucleic acid (e.g., a polycistronic vector or a fragment thereof) encoding a polypeptide disclosed herein into the CIITA locus according to embodiments disclosed herein. In certain of these embodiments, insertion of the polycistronic vector, or fragments thereof, into the CIITA locus results in knockout of CIITA.

[0272] In some embodiments, the allogeneic host cells have genetic modifications at the B2M, TAP1, and / or CIITA loci, have B2M, TAP1, and / or CIITA knockouts, or have CD74 overexpression. The B2M, TAP1, and / or CIITA knockouts can occur at one or both alleles of the respective loci. In some embodiments, the B2M, TAP1, and / or CIITA loci are modified such that the allogeneic host cells have reduced or no expression of B2M, TAP1, and / or CIITA, respectively. In these embodiments, the allogeneic host cells have reduced expression of MHC I and / or MHC II genes (HLA I and / or HLA II in humans) as a result of the deletion or knockout of B2M, TAP1, and / or CIITA, or the overexpression of CD74.

[0273] In certain embodiments, the allogeneic host cell has a genetic modification of MIC-A. MIC-A is a protein with known isoforms and variants (see, e.g., UniProt Q29983, accessed July 18, 2022), and all such forms of MIC-A are encompassed by the disclosure set forth herein. In some embodiments, the genetic modification is performed using a CRISPR / Cas system. For example, in some embodiments, a gRNA having a targeting sequence GATGACCCTGGCTCATATCA (SEQ ID NO: 137) can be used. In some embodiments, a method of gene editing using a CRISPR / Cas system and a gRNA targeting MIC-A, such as the targeting sequence GATGACCCTGGCTCATATCA (SEQ ID NO: 137), knocks out all alleles of MIC-A in a cell, such as a host cell.

[0274] In some embodiments, the engineered cells include modifications, such as genetic modifications that target the MIC-A gene. In some embodiments, the genetic modifications that target the MIC-A gene are performed using a targeted nuclease system that includes a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the MICA gene.

[0275] In some embodiments, the polycistronic vector is inserted into the MIC-A gene.

[0276] In certain embodiments, the allogeneic host cell has a genetic modification of MIC-B. MIC-B is a protein with known isoforms and variants (see, e.g., UniProt Q29980, accessed July 18, 2022), and all such forms of MIC-B are encompassed by the disclosure set forth herein. In some embodiments, the genetic modification is performed using a CRISPR / Cas system. For example, in some embodiments, a gRNA having a targeting sequence GTTTCTGCCTGTCATAGCGC (SEQ ID NO: 138) can be used. In some embodiments, a method of gene editing using a CRISPR / Cas system and a gRNA targeting MIC-B, such as the targeting sequence GTTTCTGCCTGTCATAGCGC (SEQ ID NO: 138), knocks out all alleles of MIC-B in a cell, such as a host cell.

[0277] In some embodiments, the engineered cells include modifications, such as genetic modifications that target the MIC-B gene. In some embodiments, the genetic modifications that target the MIC-B gene are performed using a targeted nuclease system that includes a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the MIC-B gene.

[0278] In some embodiments, the polycistronic vector is inserted into the MIC-B gene.

[0279] host cell In some aspects, the technology provides a population of host cells, such as T cells, natural killer (NK) cells, natural killer T (NKT) cells, pluripotent stem cells (PSCs) or cells derived therefrom, generated by the described methods that contain a polycistronic vector according to various embodiments disclosed herein. In some embodiments, the host cells may be a heterogeneous population, e.g., a mixture of cells that contain different polycistronic vectors according to various embodiments disclosed herein.

[0280] In some embodiments, the host cell is a T cell, e.g., a naive T cell, a helper T cell (CD4+), a cytotoxic T cell (CD8+), a regulatory T cell (Treg), a central memory T cell (T CM ), effector memory T cells (T EM ), stem cell memory T cells (T SCM ), or any combination thereof. In some embodiments, the host cells express a tolerogenic factor (e.g., CD47, HLA-E, HLA-G, PD-L1, CTLA-4), a CAR (e.g., CD19 CAR, CD22 CAR, BCMA CAR), and / or a safety switch encoded by a polycistronic vector according to various embodiments disclosed herein. In these embodiments, the host cells recognize target cells expressing the antigen (e.g., CD19, CD22, BCMA) that the CAR was designed to target and initiate an immune response against the target cells, and the host cells are hypoimmune in an allogeneic recipient due to the expression of the tolerogenic factor.

[0281] In some embodiments, the T cells are autologous (i.e., obtained from the subject to whom the modified T cells are to be administered). In some embodiments, the T cells are allogeneic (i.e., obtained from a person other than the subject to whom the modified T cells are to be administered). In either of these embodiments, the T cells can be primary T cells obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In other embodiments, for example in the case of allogeneic T cells, the T cells can be derived or differentiated from PSCs, such as embryonic stem cells (ESCs) or induced pluripotent cells (iPSCs).

[0282] In some embodiments, the host cell is a NK cell. NK cells (also defined as "large granular lymphocytes") represent a cell lineage differentiated from a common lymphoid progenitor (which also gives rise to B and T lymphocytes). Unlike T cells, NK cells do not naturally express CD3 on the plasma membrane. Importantly, NK cells do not express TCRs and typically lack other antigen-specific cell surface receptors. The cytotoxic activity of NK cells does not require sensitization, but is enhanced by activation with various cytokines, including IL-2. NK cells are generally believed to lack the appropriate or complete signaling pathways required for antigen-receptor mediated signaling, and therefore are not believed to be capable of antigen receptor-dependent signaling, activation, and proliferation. NK cells are cytotoxic and regulate their cytotoxic activity by balancing activating and inhibitory receptor signaling. For example, NK cells expressing CD16 can bind to the Fc domain of antibodies bound to infected cells, resulting in activation of the NK cells. In contrast, activity is reduced against cells expressing high levels of MHC class I proteins. Upon contact with target cells, NK cells release proteins such as perforin and enzymes such as proteases (granzymes). Perforin can form holes in the cell membrane of target cells to induce apoptosis or cell lysis. In some embodiments, the NK cells are autologous (i.e., obtained from the subject to whom the modified NK cells are administered). In some embodiments, the NK cells are allogeneic (i.e., obtained from a person other than the subject to whom the modified NK cells are administered). In either of these embodiments, the NK cells can be primary NK cells obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, the NK cells can be derived or differentiated from ESCs or iPSCs.There are many techniques that can be used to generate NK cells from pluripotent stem cells (e.g., iPSCs) (e.g., Zhu et al., Methods Mol Biol. 2019;2048:107-119; Knorr et al., Stem Cells Transl Med. 2013 2(4):274-83. doi:10.5966 / sctm.2012-0084; Zeng et al., Stem Cell Reports. 2017 Dec 12;9(6):1796-1812; Ni et al., Methods Mol Biol. 2013;1029:33-41; Bernaregggi et al., Exp Hematol. 2019 71:13-23; Shankar et al., Stem Cell Res ... Ther. 2020;11(1):234). Differentiation can be assayed as known in the art by assessing the presence of NK cell-associated and / or specific markers, generally including, but not limited to, CD56, KIR, CD16, NKp44, NKp46, NKG2D, TRAIL, CD122, CD27, CD244, NK1.1, NKG2A / C, NCR1, Ly49, CD49b, CD11b, KLRG1, CD43, CD62L, and / or CD226.

[0283] In some embodiments, the host cells are NKT cells. NKT cells are a heterogeneous population of T cells that share properties of both T cells and NK cells. Many of these cells recognize non-polymorphic CD1d molecules, which are antigen-presenting molecules that bind self and foreign lipids as well as glycolipids. NKT cells make up only about 1% of all peripheral blood T cells. In some embodiments, the NKT cells are autologous (i.e., obtained from the subject to whom the modified NKT cells are administered). In some embodiments, the NKT cells are allogeneic (i.e., obtained from someone other than the subject to whom the modified NKT cells are administered). In either of these embodiments, the NKT cells can be primary NKT cells obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, the NKT cells can be derived or differentiated from ESCs or iPSCs.

[0284] In some embodiments, the host cells are pancreatic islet cells, including, for example, β cells (also referred to as beta cells or β islet cells). Exemplary pancreatic islet cell types include, but are not limited to, islet progenitor cells, immature islet cells, mature islet cells, and the like. In some embodiments, the β islet cells are autologous (i.e., obtained from the subject to whom the modified β islet cells are administered). In some embodiments, the β islet cells are allogeneic (i.e., obtained from a person other than the subject to whom the modified β islet cells are administered). In either of these embodiments, the β islet cells can be primary β islet cells. In some embodiments, the β islet cells can be derived or differentiated from ESCs or iPSCs. Methods useful for differentiating pluripotent stem cells into pancreatic islet cells are disclosed, for example, in US9,683,215, US9,157,062, and US8,927,280.

[0285] In some embodiments, the beta islet cells produced by the methods disclosed herein secrete insulin. In some embodiments, the beta islet cells exhibit at least two properties of endogenous islet cells, including but not limited to, secretion of insulin in response to increased glucose and expression of beta cell markers. In some embodiments, the beta islet cells disclosed herein are administered to a subject to treat diabetes. Exemplary beta cell or beta cell progenitor markers include, but are not limited to, c-peptide, Pdx1, glucose transporter 2 (Glut2), HNF6, VEGF, glucokinase (GCK), prohormone convertase (PC 1 / 3), Cdcp1, NeuroD, Ngn3, Nkx2.2, Nkx6.1, Nkx6.2, Pax4, Pax6, Ptf1a, Isl1, Sox9, Sox17, and FoxA2. In some embodiments, PSCs are differentiated into beta-like cells or pancreatic islet organoids for transplantation to treat type I diabetes mellitus (T1DM). Cell systems are a promising method to treat T1DM (see, for example, Ellis et al., Nat Rev Gastroenterol Hepatol. 2017 Oct; 14(10): 612-628, which is incorporated herein by reference). In addition, Pagliuca et al. (Cell, 2014, 159(2): 428-39) have reported on the successful differentiation of beta cells from hiPSCs (incorporated herein in its entirety, particularly with respect to the methods and reagents disclosed therein for large-scale production of functional human beta cells from human pluripotent stem cells). Additionally, Vegas et al. have demonstrated the production of human beta cells from human pluripotent stem cells followed by encapsulation to avoid immune rejection by the recipient (Vegas et al., Nat Med, 2016, 22(3):306-11, which is incorporated herein by reference in its entirety, particularly with respect to the methods and reagents disclosed therein for large-scale production of functional human beta cells from human pluripotent stem cells). Further disclosure of pancreatic islet cells, including beta islet cells, for use in the present technology can be found in WO2020 / 018615, the disclosure of which is incorporated herein by reference in its entirety.

[0286] In some embodiments, the host cell is a primary cell. In some embodiments, the host cell is a PSC, such as an ESC or an iPSC. In some embodiments, the host cell is a cell differentiated from an ESC or an iPSC. ESCs and iPSCs have the ability to differentiate into any cell type in the body, including, for example, neurons, astrocytes, oligodendrocytes, retinal epithelial cells, epidermal cells, hair cells, keratinocytes, hepatocytes, pancreatic beta islet cells, intestinal epithelial cells, alveolar cells, hematopoietic cells, endothelial cells, cardiomyocytes, smooth muscle cells, kidney cells, adipocytes, chondrocytes, and bone cells. In some embodiments, the host cell is a T cell, a NK cell, or a NKT cell. In some embodiments, the host cell is a beta pancreatic islet cell or a glial progenitor cell (GPC).

[0287] Composition of host cells In some aspects, the present technology provides compositions comprising a population of host cells according to various embodiments disclosed herein.

[0288] In some embodiments, the compositions can have various formulations, for example, injectable formulations, lyophilized formulations, liquid formulations, oral formulations, etc., depending on the appropriate route of administration.

[0289] In some embodiments, the compositions can be co-formulated in the same dosage unit or separately in separate dosage units. As used herein, the terms "dose unit" and "dosage unit" refer to a portion of a composition that contains an amount of a therapeutic agent suitable for a single administration to provide a therapeutic effect. Such dosage units can be administered one to multiple times daily (i.e., 1-10 times, 1-8 times, 1-6 times, 1-4 times, or 1-2 times), or as many times as necessary to elicit a therapeutic response.

[0290] In some embodiments, a single dosage unit contains at least about 1 x 10 2 , 5×10 2 , 1×10 3 , 5×10 3 , 1×10 4 , 5×104 , 1×10 5 , 5×10 5 , 1×10 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 5×10 8 , 1×10 9 , 5×10 9 , 1×10 10 , or 5 × 10 10 It contains cells.

[0291] Insertion of polycistronic vectors into host cells In some aspects, the polycistronic vector of the present technology or a fragment thereof can be integrated into the genome of a host cell. In certain embodiments, methods and compositions are provided herein for carrying out this integration. In embodiments in which a fragment of the polycistronic vector is integrated into the genome, the fragment can include at least an expression cassette containing the transgene(s) of interest (e.g., immune tolerogenic factor, CAR and / or safety switch), and can optionally include a promoter(s).

[0292] Random Insertion In some embodiments, the polycistronic vector of the present technology or fragments thereof are inserted into random genomic loci of host cells. As known to those skilled in the art, viral vectors, including retroviral vectors, lentiviral vectors, adenoviral vectors and adeno-associated viral vectors, are widely used to deliver genetic material into host cells and randomly insert foreign or exogenous genes into the host cell genome to promote stable expression and replication of the genes.

[0293] Site-specific insertion (knock-in) In some embodiments, the polycistronic vector or its fragments of the present technology is inserted into a specific genomic locus of a host cell.Many gene editing methods can be used to insert the polycistronic vector or its fragments into a specific selected genomic locus.Gene editing is a type of genetic engineering that can insert, delete, modify or replace nucleotide sequences in the genome of an organism.Current gene editing technologies generally utilize the inherent mechanism of cells to repair double-strand breaks (DSBs) in DNA.

[0294] Eukaryotic cells repair DSBs by two primary repair pathways: non-homologous end joining (NHEJ) and homology-directed repair (HDR). HDR usually occurs in late S or G2 phase when sister chromatids are available as repair templates. NHEJ is more common and can occur in any phase of the cell cycle, but is more error-prone. In gene editing, NHEJ is commonly used to generate insertion / deletion mutations (indels), which can shift the open reading frame (ORF) and cause changes in the coding region or associated regulatory regions, resulting in targeted loss of function of the target gene. In contrast, HDR is the preferred pathway to generate targeted knock-ins, knock-outs, or insertions of specific mutations in the presence of a repair template with homologous sequences. For example, several methods are known to those skilled in the art to enhance the efficiency of HDR, including chemical regulation (e.g., treating cells with inhibitors of key enzymes in the NHEJ pathway), delivery of gene editing systems timed to the S and G2 phases of the cell cycle, arresting cell cycle at the S and G2 phases, and introducing repair templates with homologous sequences. The methods provided herein can use HDR-mediated repair, NHEJ-mediated repair, prime editing, or a combination thereof.

[0295] Prime editing is a versatile and precise genome editing method that uses a catalytically incompetent Cas9 endonuclease fused to an engineered reverse transcriptase programmed with a prime editing guide RNA (pegRNA) that identifies the target site and encodes the desired edit to write new genetic information directly into a designated DNA site (see, e.g., Anzalone et al., Nature, 576:149-157 (2019); WO2021072328; WO2022067130, all of which are incorporated by reference in their entireties).

[0296] In some embodiments, the methods for performing site-specific insertion provided herein utilize site-specific nucleases, including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and CRISPR (clustered regularly interspaced short palindromic repeats) / Cas systems. In some embodiments, the site-specific insertion is by prime editing or mismatch repair-based insertion.

[0297] ZFN ZFNs are fusion proteins that contain numerous site-specific DNA binding domains adapted from zinc finger-containing transcription factors linked to the endonuclease domain of the bacterial FokI restriction enzyme. ZFNs may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) DNA binding or zinc finger domains (see, e.g., Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160). Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and typically recognizes a 3-4 bp DNA sequence. Tandem domains may therefore potentially bind long nucleotide sequences that are unique within the genome of a cell.

[0298] Various zinc fingers with known specificity can be combined to generate multi-finger polypeptides that recognize sequences of about 6, 9, 12, 15, or 18 bp. A variety of selection and modular assembly techniques are available for generating zinc fingers (and combinations thereof) that recognize specific sequences, including fuzzy display, yeast one-hybrid system, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind to a predefined nucleic acid sequence. Criteria for engineering zinc fingers to bind to a predefined nucleic acid sequence are known in the art. See, for example, Sera et al., Biochemistry (2002) 41: 7074-7081, Liu et al., Bioinformatics (2008) 24: 1850-1857.

[0299] ZFNs containing FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. Two individual ZFNs must bind to opposite strands of DNA with their nucleases appropriately spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs is designed to recognize two sequences located on either side of the site, one on the forward strand and the other on the reverse strand. When ZFNs bind on either side of the site, the nuclease domains dimerize and cleave the DNA at the site, creating a DSB with a 5' overhang. HDR can then be used to induce a specific mutation with the aid of a repair template containing the desired mutation flanked on either side by homology arms. The repair template is usually an exogenous double-stranded DNA vector that is introduced into the cell. See Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734.

[0300] TALEN TALENs are another example of artificial nucleases that can be used to edit target genes. TALENs are derived from a DNA-binding domain called a TALE repeat, which usually contains a tandem array with 10-30 repeats that bind and recognize long DNA sequences. Each repeat is 33-35 amino acids long, of which two adjacent amino acids (called repeat-variable di-residues or RVDs) confer specificity for one of four DNA base pairs. Thus, there is a one-to-one correspondence between repeats and base pairs in the target DNA sequence.

[0301] TALENs are artificially produced by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) to a nuclease domain, such as a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations have been made to FokI for use in TALENs, which improve, for example, cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39: e82; Miller et al., Nature Biotech. (2011) 29: 143-148; Hockemeyer et al., Nature Biotech. (2011) 29: 731-734; Wood et al., Science (2011) 333: 307; Doyon et al., Nature Methods (2010) 8: 74-79; Szczepek et al., Nature Biotech (2007) 25: 786-793; Guo et al., J. Mol. Biol. (2010) 200: 96. The FokI domain functions as a dimer and therefore requires two constructs with unique DNA binding domains in the proper orientation and spacing for sites in the target genome. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain, and the number of bases between two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29:143-148.

[0302] By combining engineered TALE repeats with nuclease domains, site-specific nucleases can be produced that are specific to any desired DNA sequence.Similar to ZFNs, TALENs can be introduced into cells to generate DSBs at desired target sites in genomes, and can be used to knock out genes or knock in mutations in a similar HDR-mediated pathway.See Boch, Nature Biotech. (2011) 29: 135-136; Boch et al., Science (2009) 326: 1509-1512; Moscou et al., Science (2009) 326: 3501.

[0303] Meganuclease Meganucleases are enzymes in the endonuclease family that are characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). Meganucleases are grouped into families based on their structural motifs that affect nuclease activity and / or DNA recognition. The most widespread and best known meganucleases are proteins in the LAGLIDADG family, whose name is derived from a conserved amino acid sequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. On the other hand, GIY-YIG family members have GIY-YIG modules that are 70-100 residues long and contain four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. The His-Cys family of meganucleases are characterized by a highly conserved series of histidines and cysteines spanning a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by a motif containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.

[0304] Since the probability of identifying a natural meganuclease for a particular target DNA sequence is low due to the need for high specificity, various methods, including mutagenesis and high-throughput screening methods, have been used to generate meganuclease variants that recognize unique sequences. For example, strategies are known in the art for engineering meganucleases with altered DNA-binding specificity to bind to defined nucleic acid sequences. For example, Chevalier et al., Mol. Cell. (2002) 10:895-905, Epinat et al., Nucleic Acids Res (2003) 31:2952-2962, Silva et al., J Mol. Biol. (2006) 361:744-754, Seligman et al., Nucleic Acids Res(2002)30:3870-3879, Sussman et al.,J Mol Biol(2004)342:31-41, Doyon et al.,J Am Chem Soc(2006)128:2477-2484, Chen et al.,Protein Eng Des Sel(2009)22:249-256, Arnould et al.,J Mol See Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.

[0305] Like ZFNs and TALENs, meganucleases can generate DSBs in genomic DNA, which, when improperly repaired, for example, via NHEJ, can generate frameshift mutations, resulting in reduced expression of target genes in cells. Alternatively, foreign DNA can be introduced into cells together with meganucleases. Depending on the sequence of the foreign DNA and the chromosomal sequence, this process can be used to modify target genes. See Silva et al., Current Gene Therapy (2011) 11:11-27.

[0306] Transposase Transposase is an enzyme that binds to the end of transposon and catalyzes its transfer to another part of genome by cut-and-paste mechanism or replicative translocation mechanism. By linking transposase with other systems, such as CRISPR / Cas system, new gene editing tools can be developed to enable site-specific insertion or manipulation of genomic DNA. There are two known DNA integration methods using transposons, which catalytically use inactive Cas effector proteins and Tn7-like transposons. Transposase-dependent DNA integration does not induce DSB in genome, which can ensure safer and more specific DNA integration.

[0307] CRISPR / Cas The CRISPR system was originally discovered in prokaryotes (e.g., bacteria and archaea) as a system involved in defense against invading phages and plasmids, conferring a form of adaptive immunity, and has now been adapted and used as a popular gene editing tool in research and clinical applications.

[0308] CRISPR / Cas systems typically contain at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces a DSB at the target site. CRISPR-Cas systems are divided into two major classes: class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids; class 2 systems use a single large Cas protein for the same purpose. Class 1 is divided into types I, III, and IV; class 2 is divided into types II, V, and VI. The various Cas proteins that have been adapted for gene editing applications include Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas1 These include, but are not limited to, Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. See, for example, Jinek et al., Science (2012) 337 (6096): 816-821; Dang et al., Genome Biology (2015) 16: 280; Ran et al., Nature (2015) 520: 186-191; Zetsche et al., Cell (2015) 163: 759-771; Strecker et al., Nature Comm. (2019) 10: 212; Yan et al., Science (2019) 363: 88-91. The most widely used Cas9 is a type II Cas protein, and is described herein by way of example. These Cas proteins may originate from different source species. For example, Cas9 may be derived from S. pyogenes or S. aureus.

[0309] In the original microbial genome, the type II CRISPR system incorporates sequences from the invading DNA between the CRISPR repeat sequences encoded as an array in the host genome. The transcripts from the CRISPR repeat array are processed into CRISPR RNAs (crRNAs), each of which carries a variable element sequence transcribed from the invading DNA, known as a "protospacer" sequence, and a portion of the CRISPR repeat. Each crRNA hybridizes with a second transactivating CRISPR RNA (tracrRNA), and these two RNAs form a complex with Cas9 nuclease. The protospacer-encoded portion of the crRNA guides the Cas9 complex to cleave complementary target DNA sequences, provided they are flanked by short sequences known as "protospacer adjacent motifs" (PAMs).

[0310] While the above description has focused on Cas9 nuclease, it should be understood that there are other RNA-guided nucleases that utilize gRNAs that differ in some respects from those described thus far. For example, Cpf1 (CRISPR 1 from Prevotella and Francisella; also known as Cas12a) is an RNA-guided nuclease that requires only crRNA and not tracrRNA to function.

[0311] Since its discovery, the CRISPR system has been adapted to induce sequence-specific DSBs and targeted genome editing in a wide range of cells and organisms, from bacteria to eukaryotic cells, including human cells. In its use in gene editing applications, artificially designed synthetic gRNAs are replacing the original crRNA:tracrRNA complex, including certain embodiments with a single gRNA. For example, the gRNA can be a single guide RNA (sgRNA) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA usually contains a complementary region (also called a spacer, usually about 20 nucleotides in length) designed by the user to recognize the target DNA of interest. The tracrRNA sequence contains a scaffold region for Cas nuclease binding. The crRNA sequence and the tracrRNA sequence are linked by a tetraloop, each with a short repeat sequence for hybridization with each other, thus generating a chimeric sgRNA. The genome target of the Cas nuclease can be changed by simply changing the spacer or complementary region sequence present in the gRNA. The complementary region guides the Cas nuclease to the target DNA site via standard RNA-DNA complementary base-pairing rules.

[0312] For Cas nucleases to function, a PAM must be present in the genomic DNA immediately downstream of the target sequence. It is believed that recognition of the PAM by the Cas protein destabilizes the adjacent genomic sequence, allowing the gRNA to interrogate the sequence, resulting in gRNA-DNA pairing if a matching sequence is present. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease from S. pyogenes recognizes a PAM sequence of 5'-NGG-3' or, at a less efficient rate, 5'-NAG-3' (where "N" can be any nucleotide). Other Cas nuclease variants with alternative PAMs have also been characterized and effectively used for genome editing, and are summarized in Table 17 below.

[0313] [Table 17]

[0314] In some embodiments, Cas nucleases may include one or more mutations to alter their activity, specificity, recognition, and / or other properties. For example, a Cas nuclease may have one or more mutations that alter its fidelity to reduce off-target effects (e.g., eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 are high-fidelity variants of SpCas9). As another example, a Cas nuclease may have one or more mutations that alter its PAM specificity.

[0315] In certain embodiments, the polycistronic vector or a fragment thereof can serve as a DNA repair template that is integrated into the target site by HDR associated with the described gene editing system (e.g., CRISPR / Cas system). In general, the fragment of the polycistronic vector to be inserted contains at least an expression cassette containing the transgene of interest (e.g., immune tolerogenic factor, CAR and / or safety switch expression cassette), and optionally also a promoter. In certain of these embodiments, the fragment containing the expression cassette and / or promoter to be inserted is flanked by homologous sequences immediately upstream and downstream of the target, i.e., a left homology arm (LHA) and a right homology arm (RHA), specifically designed to allow the target genomic locus to serve as a template for HDR. The length of each homology arm is generally determined by the size of the insert to be introduced, with larger inserts requiring longer homology arms.

[0316] In some embodiments, the specific genomic locus for site-specific insertion of the polycistronic vector or a fragment thereof is selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, and the safe harbor locus. Non-limiting examples of safe harbor loci include, but are not limited to, the AAVS1 (also known as PPP1R12C), ABO, CCR5, CLYBL, CXCR4, F3 (also known as CD142), FUT1, HMGB1, KDM5D, LRP1 (also known as CD91), MICA, MICB, RHD, ROSA26, and SHS231 loci. The vector or a fragment thereof can be inserted into the appropriate region of the safe harbor locus, including, for example, an intron, an exon, and / or a gene coding region (also known as CoDing Sequence, or "CDS"). In some embodiments, the safe harbor locus is selected from the group consisting of the AAVS1 locus, the CCR5 locus, and the CLYBL locus. In some embodiments, the insertion occurs in one allele of a particular genomic locus. In some embodiments, the insertion occurs in both alleles of a particular genomic locus. In either of these embodiments, the orientation of the transgene inserted into the target genomic locus can be the same or opposite to the orientation of the gene at that locus. In some embodiments, the insertion of the polycistronic vector or a fragment thereof into the genomic locus as described results in the knockout (KO) of the endogenous gene.

[0317] In some embodiments, a host cell or composition thereof is provided having a genomic locus modified by any of the gene editing systems described. In some embodiments, the genetic modification is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a(Cpf1), Cas12b(C2c1), Cas12c(C2c3), Cas12d(CasY), Cas12e(CasX), Cas12f(C2c10), Cas12g, Cas12h, Cas12i, Cas12k(C2c5), Cas13, Cas13a(C2c2 ... 13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and CRISPR-associated transposases. In certain of these embodiments, the modified genomic locus is the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, or the safe harbor locus. Non-limiting examples of safe harbor loci include, but are not limited to, the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, SHS231 loci. In some embodiments, the host cell has a knockout (KO) of an endogenous gene by modification (e.g., insertion of a polycistronic vector or fragment thereof) to a genomic locus as described.

[0318] Guide RNA (gRNA) for gene editing In some embodiments, a gRNA is provided for use in site-specific insertion of the polycistronic vectors provided herein or fragments thereof, for example in the context of a CRISPR / Cas system. The gRNA comprises a crRNA sequence, which comprises a complementary region (also called a spacer) that recognizes and binds to a complementary target DNA of interest. The length of the spacer or complementary region is generally 15-30 nucleotides, usually about 20 nucleotides in length, but varies depending on the requirements of the particular CRISPR / Cas system. In certain embodiments, the spacer or complementary region is fully complementary to the target DNA sequence. In other embodiments, the spacer is partially complementary to the target DNA sequence, for example at least 80%, 85%, 90%, 95%, 98% or 99% complementary.

[0319] In certain embodiments, the gRNA provided herein further comprises a tracrRNA sequence that includes a scaffold region for binding to a nuclease. The length and / or sequence of the tracrRNA may vary depending on the particular nuclease used for editing. In certain embodiments, nuclease binding by the gRNA does not require the tracrRNA sequence. In embodiments where the gRNA comprises a tracrRNA, the crRNA sequence may further comprise a repeat region for hybridizing to a complementary sequence of the tracrRNA.

[0320] In some embodiments, the gRNA provided herein comprises two or more gRNA molecules, such as a crRNA and a tracrRNA, as two separate molecules. In other embodiments, the gRNA is a single guide RNA (sgRNA), such as an sgRNA, which comprises a crRNA and a tracrRNA in a single RNA molecule. In certain of these embodiments, the crRNA and the tracrRNA are linked by an intervening tetraloop.

[0321] In some embodiments, one gRNA can be used in combination with a site-specific nuclease for targeted editing of a locus of interest. In other embodiments, two or more gRNAs targeting the same locus of interest can be used in combination with a site-specific nuclease.

[0322] In some embodiments, exemplary gRNAs (e.g., sgRNAs) for use with different common Cas nucleases that require both crRNA and tracrRNA, including Cas9 and Cas12b (C2c1), are shown in Table 18. See, e.g., Jinek et al., Science (2012) 337(6096):816-821; Dang et al., Genome Biology (2015) 16:280; Ran et al., Nature (2015) 520:186-191; Strecker et al., Nature Comm. (2019) 10:212. For each of the exemplary gRNAs, the sequences of different portions of the gRNA are shown, including the complementary region or spacer, the crRNA repeat region, the tetraloop, and the tracrRNA. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 94-97. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 98-101. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 102-105. In some embodiments, the gRNA comprises all or a portion of the nucleotide sequence set forth in SEQ ID NOs: 106-109.

[0323] In some embodiments, the gRNA comprises a crRNA repeat region comprising, consisting of, or essentially consisting of the nucleotide sequence set forth in SEQ ID NO:95, SEQ ID NO:99, SEQ ID NO:103, or SEQ ID NO:108. In some embodiments, the gRNA comprises a tetraloop comprising, consisting of, or essentially consisting of the nucleotide sequence set forth in SEQ ID NO:96 or SEQ ID NO:107. In some embodiments, the gRNA comprises a tracrRNA comprising, consisting of, or essentially consisting of the nucleotide sequence set forth in SEQ ID NO:97, SEQ ID NO:101, SEQ ID NO:105, or SEQ ID NO:106.

[0324] [Table 18]

[0325] In some embodiments, the gRNA comprises a complementary region specific to a locus of interest, for example, the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, or a safe harbor locus selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 loci. The complementary region may bind to a sequence in any region of the target locus, including, for example, a CDS, an exon, an intron, a sequence spanning a portion of an exon and a portion of an adjacent intron, or a regulatory region (e.g., a promoter, an enhancer). When the target sequence is a CDS, an exon, an intron, or a sequence spanning a portion of an exon and a portion of an intron, the CDS, exon, intron, or exon / intron boundary may be defined by any splice variant of the target gene. In some embodiments, the genomic locus targeted by the gRNA is located within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of any of the listed loci or regions. Further provided herein are compositions comprising one or more gRNAs provided herein and a Cas protein or a nucleotide sequence encoding a Cas protein. In certain of these embodiments, the one or more gRNAs and the nucleotide sequence encoding the Cas protein are contained within a vector, e.g., a viral vector.

[0326] In some embodiments, the gRNA used herein to perform site-specific insertion of a transgene comprises a complementary region that recognizes a target sequence of AAVS1. In certain of these embodiments, the target sequence is located in intron 1 of AAVS1. AAVS1 is located at 55,090,918-55,117,637 reverse strand of chromosome 19, and AAVS1 intron 1 (based on transcript ENSG00000125503) is located at 55,117,222-55,112,796 reverse strand of chromosome 19. In certain embodiments, the gRNA targets a genomic locus within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of a site located anywhere between 55,117,222 and 55,112,796 on chromosome 19. In certain embodiments, the gRNA targets a genomic locus within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of 55,115,674 on chromosome 19. In certain embodiments, the gRNA is configured to generate a cleavage site at 55,115,674 on chromosome 19 or within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 55,115,674 on chromosome 19. In certain embodiments, the gRNA is GET000046, also known as "sgAAVS1-1," as described in Li et al., Nat. Methods 16:866-869 (2019). This gRNA includes a complementary region comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO:110 and targets intron 1 of AAVS1 (also known as PPP1R12C).

[0327] In some embodiments, the gRNA used herein to perform site-specific insertion of a transgene comprises a complementary region that recognizes a target sequence of CLYBL. In certain of these embodiments, the target sequence is located in intron 2 of CLYBL. CLYBL is located at 99,606,669-99,897,134 of strand 13, and CLYBL intron 2 (based on transcript ENST00000376355.7) is located at 99,773,011-99,858,860 of strand 13. In certain embodiments, the gRNA targets a genomic locus within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of a site located anywhere between 99,773,011 and 99,858,860 on chromosome 13. In certain embodiments, the gRNA targets a genomic locus within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of 99,822,980 on chromosome 13. In certain embodiments, the gRNA is configured to generate a cleavage site at 99,822,980 on chromosome 13 or within 5, 10, 15, 20, 30, 40, or 50 nucleotides of 99,822,980 on chromosome 13. In certain embodiments, the gRNA is GET000047, which comprises a complementary region comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO:111, and targets intron 2 of CLYBL. The target site is similar to the target site of TALEN, as described in Cerbini et al., PLoS One, 10(1):e0116032 (2015).

[0328] In some embodiments, the gRNA used herein to effect site-specific insertion of a transgene comprises a complementary region that recognizes a target sequence of CCR5. In certain of these embodiments, the target sequence is located in exon 3 of CCR5. CCR5 is located at 46,370,854-46,376,206 on the strand of chromosome 3, and CCR5 exon 3 (based on transcript ENST00000292303.4) is located at 46,372,892-46,376,206 on the strand of chromosome 3. In certain embodiments, the gRNA targets a genomic locus within 4000 bp, within 3500 bp, within 3000 bp, within 2500 bp, within 2000 bp, within 1500 bp, within 1000 bp, or within 500 bp of a site located anywhere between 46,372,892-46,376,206 on chromosome 3. In certain embodiments, the gRNA targets a genomic locus within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of chromosome 3 46,373,180. In certain embodiments, the gRNA is configured to generate a cleavage site at chromosome 3 46,373,180 or within 5, 10, 15, 20, 30, 40, or 50 nucleotides of chromosome 3 46,373,180. In certain embodiments, the gRNA is GET000048, also known as "crCCR5_D," described in Mandal et al., Cell Stem Cell 15:643-652 (2014). The gRNA comprises a complementary region comprising, consisting of, or consisting essentially of the nucleic acid sequence set forth in SEQ ID NO: 112 and targets intron 3 of CCR5 (also annotated as exon 2 in the Ensembl genome database). See Gomez-Ospina et al., Nat. Comm. 10(1):4045 (2019).

[0329] In certain embodiments of the gRNAs used herein, one or more thymines in the sequences of the complementary regions set forth in Table 19 are replaced with uracil.

[0330] [Table 19]

[0331] In some embodiments, methods are provided for identifying new loci and / or gRNA sequences for use in the site-specific gene editing approaches described. For example, in a CRISPR / Cas system, if an existing gRNA is known for a particular locus (e.g., within a safe harbor locus), an "inch-worming" approach can be used to identify additional loci for targeted insertion of transgenes by scanning the flanking regions on either side of the locus for PAM sequences (which typically occur approximately every 100 base pairs (bp) across the genome). The PAM sequence will depend on the particular Cas nuclease used, as different nucleases typically have different corresponding PAM sequences. The flanking regions on either side of the locus can be about 500-4000 bp in length, e.g., about 500 bp, about 1000 bp, about 1500 bp, about 2000 bp, about 2500 bp, about 3000 bp, about 3500 bp, or about 4000 bp in length. Once a PAM sequence is identified within the search range, new guides based on the sequence of that locus can be designed and used for site-specific insertion of a transgene. Although the CRISPR / Cas system is described as an example, this method of identifying new loci can use any of the gene editing approaches described, including those using ZFNs, TALENs, meganucleases, and transposases.

[0332] In some embodiments, the activity, stability, and / or other properties of the gRNA can be modified by incorporating chemical and / or sequential modifications. As an example, transiently expressed or delivered nucleic acids can be susceptible to degradation, for example, by cellular nucleases. Thus, the gRNAs described herein can include one or more modified nucleosides or nucleotides that provide stability against nucleases. Without being bound to a particular theory, it is believed that certain modified gRNAs described herein elicit a lower innate immune response when introduced into a cell population, particularly cells of the present technology. As used herein, the term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, generally of viral or bacterial origin, that induce the expression and release of cytokines, particularly interferons, and cell death. Other common chemical modifications of gRNAs to improve stability, increase nuclease resistance, and / or reduce immune responses include 2'-O-methyl modifications, 2'-fluoro modifications, 2'-O-methyl phosphorothioate linkage modifications, and 2'-O-methyl 3'thio PACE modifications.

[0333] One common 3' end modification is the addition of a polyA tract that contains one or more (usually 5-200) adenine (A) residues. The polyA tract may be included in the nucleic acid sequence encoding the gRNA or may be added to the gRNA during chemical synthesis or after in vitro transcription using a polyadenosine polymerase (e.g., E. coli poly(A) polymerase). In vivo, the polyA tract may be added to the sequence transcribed from the DNA vector by using a polyadenylation signal. Examples of such signals are described in Maeder. Other suitable gRNA modifications include, but are not limited to, those described in U.S. Patent Application Publication No. 2017 / 0073674A1 and International Publication No. WO2017 / 165862A1, each of which is incorporated herein by reference in its entirety.

[0334] Delivery of the gene editing system into the host cell In some embodiments, compositions are provided that include one or more components of the gene editing system described herein, including one or more gRNAs, a nucleotide sequence encoding a site-specific nuclease (e.g., a Cas nuclease) or a site-specific nuclease protein, and optionally a transgene for targeted insertion. In some embodiments, the compositions are formulated for delivery to a cell.

[0335] In some embodiments, the components of the gene editing system provided herein, including one or more gRNAs, a nucleotide sequence encoding a site-specific nuclease (e.g., Cas nuclease) or a site-specific nuclease protein, and optionally a transgene for targeted insertion (e.g., a polycistronic vector of the present technology or a fragment thereof), can be delivered into a cell in the form of a delivery vector. The delivery vector can be any type of vector suitable for introducing a nucleotide sequence into a cell, including, for example, a plasmid, an adenovirus vector, an adeno-associated virus (AAV) vector, a retrovirus vector, a lentivirus vector, a phage, and an HDR-based donor vector. The different components can be introduced into a cell together or separately, and can be delivered in a single vector or multiple vectors.

[0336] In some embodiments, the delivery vector can be introduced into cells by any method known in the art, including, for example, viral transformation, calcium phosphate transfection, lipid-mediated transfection, DEAE-dextran, electroporation, microinjection, nucleoporation, liposomes, nanoparticles, or other methods.

[0337] In some embodiments, the technology provides a composition comprising a delivery vector according to various embodiments disclosed herein. In some embodiments, the composition can further comprise one or more pharma- ceutically acceptable carriers, excipients, preservatives, or combinations thereof. A "pharma-ceutically acceptable carrier or excipient" refers to a pharma-ceutically acceptable material, composition, or vehicle involved in carrying or transporting a compound of interest from one tissue, organ, or part of the body to another tissue, organ, or part of the body. For example, a carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of a carrier or excipient must be "pharma-ceutically acceptable" in that it must be compatible with the other components of the formulation. Each component must also be suitable for contact with any tissue, organ, or part of the body with which it may come into contact, i.e., it must not pose a risk of toxicity, irritation, allergic reaction, immunogenicity, or other complications that unduly outweigh its therapeutic benefits. Suitable excipients include water, saline, dextrose, glycerol, and the like, and combinations thereof. In some embodiments, the compositions comprising the cells disclosed herein further comprise a suitable infusion medium.

[0338] In some embodiments, cells or compositions thereof are provided that contain one or more components of the gene editing system described herein, including one or more gRNAs, a nucleotide sequence encoding a site-specific nuclease (e.g., a Cas nuclease) or a site-specific nuclease protein, and optionally a transgene for targeted insertion.

[0339] Treatment method In some aspects, the present technology provides a method for treating and / or preventing a disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a population of host cells comprising a polycistronic vector according to various embodiments disclosed herein, or a pharmaceutical composition comprising same.

[0340] In some embodiments, the host cell is a T cell. The T cell may be autologous (i.e., obtained from the subject to whom the modified T cell is to be administered). Alternatively, the T cell may be allogeneic (i.e., obtained from a person other than the subject to whom the modified T cell is to be administered). In either of these embodiments, the T cell may be a primary T cell obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In other embodiments, for example, in the case of allogeneic T cells, the T cell may be derived from ESCs or iPSCs.

[0341] In some embodiments, the T cells are selected from the group consisting of naive T cells, helper T cells (CD4+), cytotoxic T cells (CD8+), regulatory T cells (Treg), central memory T cells (T CM ), effector memory T cells (T EM ), stem cell memory T cells (T SCM ), or any combination thereof. More specifically, the T cells are naive T cells (never exposed to an antigen; T CM A T cell may be a T cell (higher expression of CD62L, CCR7, CD28, CD3, CD127, and CD45RA, and lower expression of CD45RO compared to T cells), a memory T cell (which has been exposed to antigen and is long-lived), or an effector cell (which has been exposed to antigen and is cytotoxic). CM (higher expression of CD62L, CCR7, CD28, CD127, CD45RO, and CD95, and lower expression of CD54RA compared to naive T cells) and T EM (Naive T cells or T CM Effector T cells can be classified into a subset of T cells (low expression of CD62L, CCR7, CD28, and CD45RA, and high expression of CD127 compared to T cells). CMHelper T cells refer to CD8+ cytotoxic T cells that have been exposed to antigen and have low expression of CD62L, CCR7, CD28 compared to helper T cells, and are positive for granzymes and perforin. Helper T cells are CD4+ cells that affect the activity of other immune cells by releasing cytokines. CD4+ T cells can activate or suppress adaptive immune responses, and which of these two functions is induced depends on the presence of other cells and signals. T cells can be harvested using known techniques, and various subpopulations or combinations thereof can be enriched or depleted by known techniques, such as, for example, affinity binding to antibodies, flow cytometry, or immunomagnetic selection.

[0342] In some embodiments, the host cell is a NK cell. NK cells (also defined as "large granular lymphocytes") represent a cell lineage differentiated from a common lymphoid progenitor (which also gives rise to B and T lymphocytes). Unlike T cells, NK cells do not naturally express CD3 on the plasma membrane. Importantly, NK cells do not express TCRs and typically lack other antigen-specific cell surface receptors. The cytotoxic activity of NK cells does not require sensitization, but is enhanced by activation with various cytokines, including IL-2. NK cells are generally believed to lack the appropriate or complete signaling pathways required for antigen-receptor mediated signaling, and therefore are not believed to be capable of antigen receptor-dependent signaling, activation, and proliferation. NK cells are cytotoxic and regulate their cytotoxic activity by balancing activating and inhibitory receptor signaling. For example, NK cells expressing CD16 can bind to the Fc domain of antibodies bound to infected cells, resulting in activation of the NK cells. In contrast, activity is reduced against cells expressing high levels of MHC class I proteins. Upon contact with target cells, NK cells release proteins such as perforin and enzymes such as proteases (granzymes). Perforin can form holes in the cell membrane of target cells to induce apoptosis or cell lysis. In some embodiments, the NK cells are autologous (i.e., obtained from the subject to whom the modified NK cells are administered). In some embodiments, the NK cells are allogeneic (i.e., obtained from a person other than the subject to whom the modified NK cells are administered). In either of these embodiments, the NK cells can be primary NK cells obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, the NK cells can be derived or differentiated from ESCs or iPSCs.There are many techniques that can be used to generate NK cells from pluripotent stem cells (e.g., iPSCs) (e.g., Zhu et al., Methods Mol Biol. 2019;2048:107-119; Knorr et al., Stem Cells Transl Med. 2013 2(4):274-83. doi:10.5966 / sctm.2012-0084; Zeng et al., Stem Cell Reports. 2017 Dec 12;9(6):1796-1812; Ni et al., Methods Mol Biol. 2013;1029:33-41; Bernaregggi et al., Exp Hematol. 2019 71:13-23; Shankar et al., Stem Cell Res ... Ther. 2020;11(1):234). Differentiation can be assayed as known in the art by assessing the presence of NK cell-associated and / or specific markers, generally including, but not limited to, CD56, KIR, CD16, NKp44, NKp46, NKG2D, TRAIL, CD122, CD27, CD244, NK1.1, NKG2A / C, NCR1, Ly49, CD49b, CD11b, KLRG1, CD43, CD62L, and / or CD226.

[0343] In some embodiments, the host cells are NKT cells. NKT cells are a heterogeneous population of T cells that share properties of both T cells and NK cells. Many of these cells recognize non-polymorphic CD1d molecules, which are antigen-presenting molecules that bind self and foreign lipids as well as glycolipids. NKT cells make up only about 1% of all peripheral blood T cells. In some embodiments, the NKT cells are autologous (i.e., obtained from the subject to whom the modified NKT cells are administered). In some embodiments, the NKT cells are allogeneic (i.e., obtained from someone other than the subject to whom the modified NKT cells are administered). In either of these embodiments, the NKT cells can be primary NKT cells obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, the NKT cells can be derived or differentiated from ESCs or iPSCs.

[0344] In some embodiments, the host cells are pancreatic islet cells, including, for example, β cells (also referred to as beta cells or β islet cells). Exemplary pancreatic islet cell types include, but are not limited to, islet progenitor cells, immature islet cells, mature islet cells, and the like. In some embodiments, the β islet cells are autologous (i.e., obtained from the subject to whom the modified β islet cells are administered). In some embodiments, the β islet cells are allogeneic (i.e., obtained from a person other than the subject to whom the modified β islet cells are administered). In either of these embodiments, the β islet cells can be primary β islet cells. In some embodiments, the β islet cells can be derived or differentiated from ESCs or iPSCs.

[0345] In some embodiments, the host cell is a pluripotent stem cell, such as an ESC or an iPSC. In some embodiments, the host cell is a cell differentiated from an ESC or an iPSC. ESCs and iPSCs have the ability to differentiate into any cell type in the body, including, for example, neurons, astrocytes, oligodendrocytes, retinal epithelial cells, epidermal cells, hair cells, keratinocytes, hepatocytes, pancreatic beta islet cells, intestinal epithelial cells, alveolar cells, hematopoietic cells, endothelial cells, cardiomyocytes, smooth muscle cells, kidney cells, adipocytes, chondrocytes, and bone cells. In some embodiments, the host cell is a beta pancreatic islet cell or a glial progenitor cell (GPC).

[0346] In some embodiments, the disease is cancer, e.g., one associated with expression of CD19, CD22, or BCMA (i.e., the cancer cells express CD19, CD22, or BCMA). In these embodiments, the method includes contacting the cancer cells with a host cell that contains the polycistronic vector of the present technology and expresses the corresponding CAR, such that the CAR begins killing the cancer cells after being activated in response to an antigen expressed on the cancer cells.

[0347] In some embodiments, the cancer is a hematological malignancy. Non-limiting examples of hematological malignancies include myeloid neoplasms, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, acute lymphocytic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), B-cell acute lymphocytic leukemia (B-ALL), T-cell acute lymphocytic leukemia (T-ALL), T-cell lymphoma, and B-cell lymphoma. In one embodiment, the hematological malignancy is a CD19+ B-lymphocyte-derived malignancy.

[0348] In some embodiments, the disease comprises an autoimmune disease, such as lupus, systemic lupus erythematosus, rheumatoid arthritis, psoriasis, psoriatic arthritis, multiple sclerosis, Crohn's disease, ulcerative colitis, Addison's disease, Graves' disease, Sjogren's syndrome, Hashimoto's thyroiditis, and celiac disease.

[0349] In some embodiments, the disease is diabetes, including, for example, type 1 diabetes, type 2 diabetes, pre-diabetes, and gestational diabetes.

[0350] In some embodiments, the disease is a neurological disease, including, for example, catalepsy, epilepsy, encephalitis, meningitis, migraine, Huntington's disease, Alzheimer's disease, Parkinson's disease, Pelizaeus-Merzbach disease, and multiple sclerosis.

[0351] In some embodiments, the host cell population or pharmaceutical composition comprising the host cell population according to the present technology can be administered in a manner appropriate for the disease, condition or disorder being treated, as determined by one of skill in the art. In any of the above embodiments, the host cell population or pharmaceutical composition comprising the host cell population can be administered intravenously, intraperitoneally, intratumorally, intrabone marrow, intralymph node, or into the cerebrospinal fluid so as to contact the target antigen or cells. The appropriate dose, suitable duration, and frequency of administration are determined by factors such as the patient's condition; the size, type, and severity of the disease, condition, or disorder; the undesirable type or level or activity of cells; the specific form of the active ingredient; and the method of administration.

[0352] In some embodiments, the amount of host cells in the pharmaceutical composition is typically about 10 2 More than 1 x 10 cells, e.g., about 1 x 10 2 , 5×10 2 , 1×10 3 , 5×10 3 , 1×10 4 , 5×10 4 , 1×10 5 , 5×10 5 , 1×10 6 , 5×10 6 , 1×10 7 , 5×10 7 , 1×10 8 , 5×10 8 , 1×10 9 , 5×10 9 , 1×10 10 , 5×10 10 cells, or even more cells.

[0353] In some embodiments, the method comprises administering to a subject a population of host cells, or a pharmaceutical composition comprising same, once daily, twice daily, three times daily, or four times daily for a period of about 3 days, about 5 days, about 7 days, about 10 days, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 2 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, about 10 months, about 11 months, about 1 year, about 1.25 years, about 1.5 years, about 1.75 years, about 2 years, about 2.25 years, about 2.5 years, about 2.75 years, about 3 years, about 3.25 years, about 3.5 years, about 3.75 years, about 4 years, about 4.25 years, about 4.5 years, about 4.75 years, about 5 years, or more than about 5 years. In some embodiments, the host cell population, or pharmaceutical composition comprising same, may be administered daily, every other day, every third day, weekly, biweekly (i.e., every two weeks), every three weeks, monthly, bimonthly, or every three months.

[0354] In some embodiments, the host cell population or pharmaceutical composition comprising the same can be administered for a predetermined period of time. Alternatively, the host cell population or pharmaceutical composition comprising the same can be administered until a certain therapeutic benchmark is reached. In some embodiments, the method provided herein includes evaluating one or more therapeutic benchmarks in a biological sample, such as, but not limited to, the level of a cancer biomarker, to determine whether to continue administering the host cell or pharmaceutical composition comprising the host cell.

[0355] In some embodiments, the methods further comprise administering to the subject, sequentially or simultaneously, one or more other cancer therapies, such as surgery, immunotherapy, radiation therapy, and / or chemotherapy.

[0356] In some embodiments, the method further comprises administering to the subject a pharma- ceutical effective amount of one or more additional therapeutic agents to obtain an improved or synergistic therapeutic effect. In some embodiments, the one or more additional therapeutic agents are selected from the group consisting of immunotherapeutic agents, chemotherapeutic agents, and biologics. In some embodiments, the one or more additional therapeutic agents are administered to the sub...

Claims

1. (a)a first expression cassette comprising a nucleotide sequence encoding an immunotolerogenic factor; (b)a second expression cassette comprising a nucleotide sequence encoding a chimeric antigen receptor (CAR); (c)one or more cleavage sites separating the first expression cassette and the second expression cassette; A polycistronic vector comprising: wherein the first expression cassette is located in front of the second expression cassette in the order from 5' to 3'; The polycistronic vector.

2. The immunotolerogenic factor is selected from the group consisting of CD47, A20 / TNFαIP3, CD16, CD16 Fc receptor, CD24, CD35, CD39, CD46, CD52, CD55, CD59, CD200, CCL22, CTLA4-Ig, C1 inhibitor, CR1, DUX4, FASL, H2-M3, IDO1, IL15-RF, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, MANF, PD-1, PD-L1, serpinb9, CCl21, and Mfge8. The polycistronic vector according to claim 1.

3. The immunotolerogenic factor comprises CD47, and (i)the CD47 is human CD47, and the human CD47 comprises an amino acid sequence that is at least 80% identical to the amino acid sequence set forth in any one of SEQ ID NOs: 1 to 5, and / or (ii)the nucleotide sequence encoding CD47 is at least 80% identical to the nucleotide sequence set forth in any one of SEQ ID NOs: 129 to 134. The polycistronic vector according to claim 2.

4. The nucleotide sequence encoding CD47 is codon-optimized, and the codon-optimized nucleotide sequence is at least 80% identical to the nucleotide sequence set forth in SEQ ID NO:

135. The polycistronic vector according to claim 3.

5. The CAR is (i)a CD19 CAR comprising a signal peptide, an extracellular binding domain specific for CD19, a hinge domain, a transmembrane domain, an intracellular co-stimulatory domain, and / or an intracellular signaling domain; (ii)a CD20 CAR comprising a signal peptide, an extracellular binding domain specific for CD20, a hinge domain, a transmembrane domain, an intracellular co-stimulatory domain, and / or an intracellular signaling domain; (iii) A CD22 CAR comprising a signal peptide, an extracellular binding domain specific for CD22, a hinge domain, a transmembrane domain, an intracellular co-stimulatory domain, and / or an intracellular signaling domain, and / or (iv) A BCMA CAR comprising a signal peptide, an extracellular binding domain specific for BCMA, a hinge domain, a transmembrane domain, an intracellular co-stimulatory domain, and / or an intracellular signaling domain The polycistronic vector according to claim 1, comprising the same. **Claim 6**: (i) The signal peptide comprises a CD8α signal peptide, an IgK signal peptide, or a GMCSFR-α signal peptide; (ii) The extracellular binding domain specific for CD19, CD20, CD22, or BCMA comprises a scFv or a fully human heavy chain variable domain (FHVH); (iii) The hinge domain comprises a CD8α hinge domain, a CD28 hinge domain, an IgG4 hinge domain, or an IgG4 hinge-CH2-CH3 domain; (iv) The transmembrane domain comprises a CD8α transmembrane domain or a CD28 transmembrane domain; (v) The intracellular co-stimulatory domain comprises a 4-1BB co-stimulatory domain or a CD28 co-stimulatory domain; and / or (vi) The intracellular signaling domain comprises a CD3 zeta (ζ) signaling domain, The polycistronic vector according to claim 5. **Claim 7** The anti-CD19 scFv is (i) The light chain variable region (V L ) and the heavy chain variable region (V H ); and / or (ii) A light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 21-23, and / or a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 26-28 The polycistronic vector according to claim 6, comprising the same. (i) The CD19 CAR comprises the amino acid sequence set forth in SEQ ID NOs: 32, 34, 36, or 117, or is at least 80% identical to the amino acid sequence set forth in SEQ ID NOs: 32, 34, 36, or 117, and / or (ii) The nucleotide sequence encoding the CD19 CAR comprises the nucleotide sequence set forth in SEQ ID NOs: 31, 33, 35, or 116, or is at least 80% identical to the nucleotide sequence set forth in SEQ ID NOs: 31, 33, 35, or 116, The polycistronic vector according to claim 7. **Claim 9** The anti-CD20 scFv is (i) V of Leu16 L and V H , and / or a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 39 to 41, and / or a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 43 to 44 The polycistronic vector according to claim 28, comprising:

10. The anti-CD22 scFv is (i) V of m971 or m971-L7 H and V L and / or (ii)a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 47 to 49 or 56 to 58, and / or a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 51 to 53 or 60 to 62 The polycistronic vector according to claim 6, comprising:

11. The anti-BCMA scFv or anti-BCMA FHVH is (i) V of C11D5.3 or C12A3.2 L and V H and / or VH of FHVH33 (ii)a heavy chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 69 to 71, 78 to 80, 82 to 84, or 124 to 126, and / or a light chain having one or more CDRs having the amino acid sequences set forth in SEQ ID NOs: 65 to 67, 74 to 76, or 120 to 122 The polycistronic vector according to claim 6, comprising:

12. The polycistronic vector according to claim 1, wherein the one or more cleavage sites include a self-cleaving site and / or a protease site.

13. The polycistronic vector according to claim 12, wherein the self-cleaving site includes a 2A site selected from the group consisting of T2A, P2A, E2A, and F2A sites, and / or the protease site includes a furin site selected from the group consisting of FC1, FC2, and FC3 sites.

14. (d)a third expression cassette comprising a nucleotide sequence encoding a safety switch further comprising the third expression cassette is separated from the first expression cassette and / or the second expression cassette by one or more cleavage sites, and The safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSVtk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, RQR8, and CD47-SIRPα blocker. The polycistronic vector according to claim 1.

15. The polycistronic vector according to claim 1, further comprising a homology arm adjacent to the expression cassette and / or further comprising a promoter for homologous recombination repair (HDR)-mediated insertion into a genomic locus.

16. (i) (a) a first expression cassette comprising a nucleotide sequence encoding CD47, (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR, and (c) a 2A site separating the first expression cassette and the second expression cassette. (ii) (a) a first expression cassette comprising a nucleotide sequence encoding CD47, (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR, and (c) a Furin site and a 2A site separating the first expression cassette and the second expression cassette, wherein the Furin site is located before the 2A site in the order from 5' to 3'. (iii) (a) a first expression cassette comprising a nucleotide sequence encoding an immunotolerogenic factor, (b) a second expression cassette comprising a nucleotide sequence encoding a CD19 CAR, and (c) one or more cleavage sites separating the first expression cassette and the second expression cassette, wherein the CD19 CAR comprises a CD8α signal peptide, an FMC63 scFv, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain. (iv) (a) A first expression cassette comprising a nucleotide sequence encoding an immunotolerogenic factor, (b) A second expression cassette comprising a nucleotide sequence encoding a CD19 CAR, and (c) One or more cleavage sites separating the first expression cassette and the second expression cassette, wherein the CD19 CAR comprises a GMCSFR-α signal peptide, an FMC63 scFv, an IgG4 hinge domain, a CD28 transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain. (v) (a) A first expression cassette comprising a nucleotide sequence encoding an immunotolerogenic factor, (b) A second expression cassette comprising a nucleotide sequence encoding a CD19 CAR, and (c) One or more cleavage sites separating the first expression cassette and the second expression cassette, wherein the CD19 CAR comprises a GMCSFR-α signal peptide, an FMC63 scFv, a CD28 hinge domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3ζ signaling domain. (vi) (a) A first expression cassette comprising a nucleotide sequence encoding CD47, (b) A second expression cassette comprising a nucleotide sequence encoding a CD20 CAR, and (c) A 2A site separating the first expression cassette and the second expression cassette. (vii) (a) A first expression cassette comprising a nucleotide sequence encoding CD47, (b) A second expression cassette comprising a nucleotide sequence encoding a CD20 CAR, and (c) A Furin site and a 2A site separating the first expression cassette and the second expression cassette, wherein the Furin site is located in front of the 2A site in the order from 5' to 3'. (viii) (a) A first expression cassette comprising a nucleotide sequence encoding CD47, (b) A second expression cassette comprising a nucleotide sequence encoding a CD22 CAR, and (c) A 2A site separating the first expression cassette and the second expression cassette. (ix) (a) A first expression cassette comprising a nucleotide sequence encoding CD47; (b) A second expression cassette comprising a nucleotide sequence encoding a CD22 CAR; (c) A Furin site and a 2A site separating the first expression cassette from the second expression cassette, wherein the Furin site is located before the 2A site in the order from 5' to 3'. (x) (a) A first expression cassette comprising a nucleotide sequence encoding CD47; (b) A second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; (c) A third expression cassette comprising a nucleotide sequence encoding a CD22 CAR; (d) A 2A site separating any two adjacent expression cassettes. (xi) (a) A first expression cassette comprising a nucleotide sequence encoding CD47; (b) A second expression cassette comprising a nucleotide sequence encoding a CD19 CAR; (c) A third expression cassette comprising a nucleotide sequence encoding a CD22 CAR; (d) A Furin site and a 2A site separating any two adjacent expression cassettes, wherein the Furin site is located before the 2A site in the order from 5' to 3'. (xii) (a) A first expression cassette comprising a nucleotide sequence encoding CD47; (b) A second expression cassette comprising a nucleotide sequence encoding a BCMA CAR; (c) A 2A site separating the first expression cassette from the second expression cassette. (xiii) (a) A first expression cassette comprising a nucleotide sequence encoding CD47; (b) A second expression cassette comprising a nucleotide sequence encoding a BCMA CAR; (c) A Furin site and a 2A site separating the first expression cassette from the second expression cassette, wherein the Furin site is located before the 2A site in the order from 5' to 3'. (xiv) (a) A first expression cassette comprising a nucleotide sequence encoding an immunotolerogenic factor; (b) A second expression cassette comprising a nucleotide sequence encoding a BCMA CAR; (c) One or more cleavage sites separating the first expression cassette from the second expression cassette, wherein the BCMA CAR comprises a BB2121 binder, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain. (xv) (a) a first expression cassette comprising a nucleotide sequence encoding an immunotolerogenic factor; (b) a second expression cassette comprising a nucleotide sequence encoding a BCMA CAR; and (c) one or more cleavage sites separating the first expression cassette from the second expression cassette, wherein the BCMA CAR comprises a CD8α signal peptide, a CT103A scFv, a CD8α hinge domain, a CD8α transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3ζ signaling domain. (xvi) (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding a safety switch; and (c) a 2A site separating the first expression cassette from the second expression cassette, or (xvii) (a) a first expression cassette comprising a nucleotide sequence encoding CD47; (b) a second expression cassette comprising a nucleotide sequence encoding a safety switch; and (c) a Furin site and a 2A site separating the first expression cassette from the second expression cassette, wherein the Furin site is located upstream of the 2A site in the 5' to 3' direction. A polycistronic vector.

17. (xviii) (d) further comprising a third expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the third expression cassette is separated from the first expression cassette and / or the second expression cassette by a 2A site, and optionally, (xix) (e) further comprising a fourth expression cassette comprising a nucleotide sequence encoding a safety switch, wherein the fourth expression cassette is separated from the first expression cassette, the second expression cassette, and / or the third expression cassette by a 2A site. The polycistronic vector according to claim 16.

18. A virus containing the polycistronic vector according to any one of claims 1 to 17 or a fragment thereof, optionally, the virus being an adenovirus, an adeno-associated virus, a retrovirus, a lentivirus, or a phage.

19. A cell or a heterogeneous population of cells containing the polycistronic vector according to any one of claims 1 to 17 or a fragment thereof. **Claim 20** A pharmaceutical composition comprising (i) one or more of the cells or heterogeneous population of cells according to claim 19, and (ii) a pharmaceutically acceptable carrier. **Claim 21** A guide RNA (gRNA) for use in HDR-mediated insertion of a transgene into a genomic locus selected from the group consisting of the B2M locus, the TAP1 locus, the CIITA locus, the TRAC locus, the TRBC locus, the MIC-A locus, the MIC-B locus, and a safe harbor locus, wherein the safe harbor locus is selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 loci, and wherein the gRNA comprises a crRNA and optionally a tracrRNA. **Claim 22** A method for HDR-mediated insertion of a transgene encoded by any of the polycistronic vectors according to any one of claims 1 to 17 into a genomic locus, the method comprising the step of introducing into a host cell a gRNA, a site-specific nuclease or a nucleotide sequence encoding a site-specific nuclease, and a transgene flanked by homology arms, wherein the site-specific nuclease is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csfl, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, and CRISPR-associated transposase; The method. **Claim 23** A medicament for use in treating a disease in a subject in need thereof, the medicament comprising the pharmaceutical composition according to claim 20.