Talaromyces purpurogenum D2 and application thereof

Abstract

The invention relates to talaromyces purpurogenus D2 and application thereof, and belongs to the technical field of microorganisms. The talaromyces purpurogenus D2 disclosed by the invention has the preservation number of GDMCC (Graphics Decific Microorganism Center) NO.66320 The strain is obtained by being separated from soil and domesticated, the zinc tolerance concentration of the strain can reach 2g / L, and the strain can efficiently convert inorganic zinc into organic active zinc which can be easily absorbed and utilized by a human body. The organic zinc prepared from the strain has a remarkable ABTS free radical scavenging capability, and also has tyrosine kinase and 5-alpha reductase inhibition capability; the organic zinc prepared from the talaromyces purpurogenum D2 can be used for preparing zinc-supplementing health-care products, can also be used as cosmetic active matter raw materials with free radical scavenging and whitening effects, and has a wide market application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly to Talaromyces purpureogenus D2 and its applications. Background Art

[0002] Zinc (Zn) is an essential trace mineral element in the human body. It is the second most abundant element in the human body after iron and is distributed in all tissues and body fluids. As a cofactor or structural component of various enzymes, zinc is widely involved in key physiological processes such as metabolism, immunity, nerve signal transduction, DNA synthesis and repair.

[0003] Since the human body cannot synthesize or store zinc, it must be continuously supplemented through diet. Zinc supplementation in the human body is mainly achieved by exogenous supplementation of inorganic or organic zinc preparations, and there are significant differences in the bioavailability of different zinc preparations. Although inorganic zinc has a lower cost, its absorption efficiency is poor and it is prone to cause gastrointestinal adverse reactions. In contrast, zinc-rich bacteria, as a new way of zinc supplementation, can enrich and transform inorganic zinc through microorganisms, and organically combine zinc with proteins and polysaccharides in the bacteria to form bioactive zinc, thus significantly improving the bioavailability of zinc and reducing adverse reactions to the human body.

[0004] In addition, studies have shown that bioactive zinc can play multiple effects in cosmetics and skin care products through its moisturizing, oil control, antioxidant and other mechanisms. Compared with inorganic zinc, bioactive zinc usually exists in an organic form, which not only improves its bioavailability but also reduces the irritation to the skin.

[0005] Due to the above advantages of bioactive zinc, the enrichment of zinc by microorganisms has become a research hotspot in recent years. In order to meet the broad market application prospects of organic zinc, it is urgent to isolate and obtain microorganisms with high zinc enrichment efficiency, which is of great significance for the development of the food and cosmetics fields. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies of the prior art and provide a strain of Talaromyces purpureogenus D2 with high efficiency in enriching organic zinc. This strain is obtained by separating from soil and domestication, and its zinc tolerance concentration can reach 2 g / L. Moreover, this bacterium can efficiently convert inorganic zinc into bioactive zinc that is easily absorbed and utilized by the human body. After fermentation, 2.5 g of freeze-dried powder containing organic zinc can be prepared from every 1 L of fermentation broth, the content of organic zinc is 111.4 mg / g, and the organic zinc transformed by Talaromyces purpureogenus accounts for about 55.7% of the zinc content in the culture medium.

[0007] In the first aspect, the present invention provides Talaromyces purpureogenus D2, which was deposited at the Guangdong Microbial Culture Collection Center on May 13, 2025, with the deposit number GDMCC NO.66320 and the deposit address being the 5th floor, Building 59, No. 100 compound, Xianlie Middle Road, Guangzhou.

[0008] In the second aspect, the present invention provides a method for fermenting and producing organic zinc using the Talaromyces sp. D2 described in the first aspect, comprising: 1) inoculating Talaromyces purpureogenus D2 into a liquid fermentation medium supplemented with zinc salt for fermentation culture; 2) centrifuging the fermentation broth after fermentation; separating the supernatant after centrifugation through a 200 Da nanofiltration membrane, collecting the retentate, washing the nanofiltration membrane with water to obtain the nanofiltration membrane washing solution, and combining the nanofiltration membrane washing solution and the retentate to obtain an extracellular organic zinc solution; resuspending the precipitate after centrifugation, performing ultrasonic treatment, centrifuging to collect the bacterial cell leaching solution; 3) combining the bacterial cell leaching solution and the extracellular organic zinc solution and then freeze-drying to obtain the product.

[0009] Preferably, the zinc salt is zinc sulfate; and the liquid fermentation medium supplemented with zinc salt contains 2 - 8 g / L of glucose, 2 - 8 g / L of yeast extract, 8 - 15 g / L of malt extract, and the zinc concentration is 0.5 - 2 g / L.

[0010] More preferably, the fermentation is carried out at 15 - 30 °C for fermentation culture.

[0011] Furthermore, the method for fermenting and producing organic zinc using the Talaromyces sp. D2 described in the first aspect comprises: (1) Strain activation: Inoculating the bacterial solution of the zinc-rich Talaromyces purpureogenus strain D2 stored in frozen state onto a PDA plate and culturing at 28 °C for 7 days; (2) Seed liquid preparation: Transferring a part of the spores of the zinc-rich Talaromyces purpureogenus strain D2 obtained by activation into a PDB medium, culturing at 28 °C and 180 rpm overnight to obtain a seed liquid; (3) Fermentation: Inoculating the obtained seed liquid into a liquid fermentation medium supplemented with zinc salt for fermentation culture in an amount of 5 - 10%, and fermenting at 15 - 30 °C for 3 - 7 days; (4) Preparation of Talaromyces purpureogenus organic zinc: ① Centrifuging the fermentation broth at 8000 rpm for 30 min after fermentation; ② Separating the supernatant after centrifugation through a 200 Da nanofiltration membrane, collecting the retentate, washing the nanofiltration membrane with ultrapure water to obtain the nanofiltration membrane washing solution, combining the nanofiltration membrane washing solution and the retentate to obtain an extracellular organic zinc solution; resuspending the precipitate after centrifugation, performing ultrasonic treatment at 600 w for 15 - 30 min, centrifuging to collect the bacterial cell leaching solution, and repeating this step 3 times and then discarding the cell debris; ③ Combine the bacterial extract and the extracellular organic zinc solution and then freeze-dry them.

[0012] In a third aspect, the present invention provides a product comprising the Bacillaceae D2 described in the first aspect.

[0013] Preferably, the product is food, health care product or cosmetics.

[0014] In a fourth aspect, the present invention provides the use of the Bacillaceae D2 described in the first aspect in the preparation of food, health products or cosmetics.

[0015] In a fifth aspect, the present invention provides use of the organic zinc prepared by the method described in the second aspect in the preparation of food, health products or cosmetics.

[0016] Preferably, the health care product is a zinc supplement health care product, and the cosmetics are oil-control, anti-oxidation, and whitening cosmetics.

[0017] Compared with the prior art, the present invention has the following beneficial effects: 1) The inventors of the present application isolated, purified, and further domesticated the purple tularensis D2 from the soil, which has a zinc tolerance concentration of up to 2g / L, and can efficiently convert inorganic zinc into organic active zinc that is easily absorbed and utilized by the human body. After fermentation of the strain, 2.5g of freeze-dried powder containing organic zinc can be produced per 1L of fermentation liquid, in which the content of organic zinc is 111.4mg / g, and the organic zinc converted by the purple tularensis accounts for about 55.7% of the zinc content in the culture medium.

[0018] 2) The organic zinc obtained by fermentation of T. purpurogenum D2 was experimentally verified to have significant ABTS free radical scavenging ability, and also had tyrosine kinase and 5-α reductase inhibitory ability; this showed that the bacteria can be used to prepare zinc supplement health products, and can also be used as a raw material for cosmetic active ingredients that have both free radical scavenging and whitening effects, and has broad application prospects.

[0019] Biomaterial Deposit A strain of Talaromyces purpureogenus D2, classified and named Talaromyces purpureogenus, was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 13, 2025, with the collection number GDMCC NO.66320, and the collection address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The growth of purple blue fungus on the culture medium containing different concentrations of zinc sulfate. DETAILED DESCRIPTION

[0021] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0022] Other materials, reagents, etc. used in the examples can be obtained from commercial sources without special instructions.

[0023] The culture media involved in the present invention: PDA culture medium: 20 g / L glucose, 200 g / L potato, 20 g / L agar, distilled water, pH natural.

[0024] PDB liquid culture medium: 20 g / L glucose, 200 g / L potato, distilled water, pH natural.

[0025] Liquid fermentation culture medium: 8 g / L glucose, 2 g / L yeast extract, 10 g / L malt extract, 0.5 g / L ZnSO4, distilled water.

[0026] The above culture media all need to go through a sterilization step, and the sterilization conditions are 121 °C for 20 min.

[0027] Example 1: Isolation, purification and domestication of zinc-rich bacteria with high efficiency (1) Collect soil samples near the exit of Guangzhou Taihe Subway Station, and use sterile normal saline to perform gradient dilution from 10 to 10 -6 to obtain soil dilutions, and then take 100 μl of dilutions with dilution factors of 10 -3 , 10 -4 , 10 -5 , 10 -6 and spread them on potato dextrose agar medium (PDA) containing 0.1 g / L zinc sulfate. Incubate at 28 °C until colonies can be observed on the medium. Pick single colonies with different colony morphological characteristics and good growth conditions, and use the plate streaking method for repeated isolation and purification to obtain purified strains, which are numbered and recorded. The purified strains are inoculated into 30% glycerol solution and stored in a -80 °C refrigerator.

[0028] (2) Inoculate the purified strains successively on PDA culture media containing 0.2, 0.3, 0.4, 0.5, 1 and 2 g / L zinc sulfate, and finally obtain zinc-rich bacterium D2 that can grow on the plate containing 2 g / L zinc sulfate.

[0029] (3)Inoculate zinc-rich bacterium D2 into PDB liquid medium and culture it overnight at 28 °C with 180 rpm. Take 100 μl of the seed solution and spread it on fermentation medium plates containing 0.5, 1, and 2 g / L zinc sulfate, and incubate at 28 °C for 5 days. It can be observed that when the zinc sulfate concentration is 0.5 g / L, the mycelium of D2 can completely cover the surface of the medium, and at this time, the biomass of D2 is the highest; while when the zinc sulfate concentration is 2 g / L, the growth of D2 is inhibited to a certain extent.

[0030] Example 2 Identification of High-efficiency Zinc-rich Bacterium Morphological characteristics: After culturing the strain at a constant temperature of 28 °C for 4 - 6 days, dark green spores are formed on the front of the colony, and the surface of the colony is velvety. Under an optical microscope, typical broom-shaped branches can be seen, the mycelium is septate, and the conidia are spherical or ellipsoidal.

[0031] Identification by molecular biology method: Perform 18S rDNA identification. Extract the genomic DNA of zinc-rich bacterium D2 as a template according to the operation instructions of the fungal genomic DNA extraction kit, and use 18S rDNA universal primers (NS1: 5'-GTAGTCATATGCTTGTCTC-3', FUNG: 5'-ATTCCCCGTTACCCGTTG-3') for PCR amplification to obtain its 18S rDNA. Subsequently, entrust BGI for sequencing. Perform sequence alignment and analysis of the obtained sequence information in the NCBI database, and confirm that zinc-rich bacterium D2 is Talaromyces purpureogenus by combining its morphological characteristics.

[0032] Among them, the 18S rDNA sequence of this strain is shown in SEQ ID NO.1: CAGTGTAGTCATAAATATTGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAAGCACTCTTTTACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATCGTTTATTTGATAGTACCCTACTACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCGCAAAACCCCGACTTCGGAAGGGGTGTATTTATTAGATAAAAAACCAATGCCCTTCGGGGCTCCTTGGTGATTCATAATAACTTCACGAATCGCATGGCCTTGCGCCGGCGATGGTTCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGTGGCCTACCATGGTGGCAACGGAAAACGGGGGGAATA.

[0033] Example 3 Preparation and Quantitative Analysis of Organic Zinc 1. Preparation of organic zinc using the zinc-rich strain Dactylella purpurea D2 (1)Strain activation: Inoculate the frozen bacterial solution of the zinc-rich Dactylella purpurea strain D2 onto a PDA plate and culture it at 28 °C for 7 days; (2)Seed solution preparation: Transfer a part of the spores of the activated Dactylella purpurea strain D2 to a PDB medium and culture it overnight at 28 °C and 180 rpm to obtain a seed solution; (3)Fermentation: Inoculate the obtained seed solution into a liquid fermentation medium at a rate of 8% and ferment and culture it at 28 °C for 5 days; (4)Preparation of Dactylella purpurea organic zinc: ① After fermentation is completed, centrifuge at 8000 rpm for 30 min to obtain a fermentation supernatant and a cell precipitate A; ② Resuspend and wash the cell precipitate A with ultrapure water 3 times, and combine the washing supernatant obtained after centrifugation at 8000 rpm for 20 min with the fermentation supernatant to obtain a mixed supernatant (the combined supernatant contains substances such as inorganic zinc not utilized by strain D2 and organic zinc transformed by strain D2), and the cell precipitate obtained after centrifugation is cell precipitate B; ③ Subject the mixed supernatant obtained in the previous step to nanofiltration through a nanofiltration membrane with a molecular weight cut-off of 200 Da (this step can remove the clear liquid containing inorganic zinc with a molecular weight less than 200 Da and retain the retentate containing organic zinc with a molecular weight greater than 200 Da), collect the retentate, and wash the nanofiltration membrane with an appropriate amount of ultrapure water 2 times, and combine the nanofiltration membrane washing liquid with the retentate to obtain an extracellular organic zinc solution; ④ Resuspend the cell precipitate B described in step ② with an equal volume of ultrapure water, ultrasonicate at 600 w for 20 min, and centrifuge at 8000 rpm for 30 min to collect the leaching solution. Repeat this step 3 times, then discard the precipitated cell debris, and mix the 3 leaching solutions to obtain a mixed leaching solution; ⑤ Combine the extracellular organic zinc solution obtained after nanofiltration in step ③ with the mixed leaching solution obtained in step ④, and freeze-dry to obtain a zinc-rich freeze-dried powder.

[0034] 2. Detection of the organic zinc content in zinc-rich Dactylella purpurea (1)Microwave digestion: Accurately weigh 0.2 g of the zinc-rich freeze-dried powder obtained from the aforementioned preparation and dissolve it in 1000 ml of ultrapure water. Stir well to completely dissolve it to prepare a liquid sample with a concentration of 0.2 g / L. Accurately pipette 1 ml of the liquid sample into a microwave digestion vessel, and add 5 mL of nitric acid for microwave digestion. After cooling, take out the digestion vessel and heat it on a hot plate at 150 °C to drive off the acid until about 1 mL remains. After the digestion vessel has cooled, transfer the digestion solution to a 50 mL volumetric flask, wash the digestion vessel 3 times with a small amount of water, combine the washing solutions in the volumetric flask, and make up the volume to the mark with water and mix well for standby. At the same time, conduct a reagent blank test.

[0035] (2)Preparation of standard solutions: ① Zinc standard stock solution (1000 mg / L): Accurately weigh 1.2447 g (accurate to 0.0001 g) of zinc oxide, add a small amount of nitric acid solution with a volume fraction of 50%, heat to dissolve, cool, and transfer it to a 1000 mL volumetric flask, then add water to the mark and mix well.

[0036] ② Zinc standard intermediate solution (10 mg / L): Accurately pipette 1 mL of the zinc standard stock solution (1000 mg / L) into a 100 mL volumetric flask, add nitric acid solution with a volume fraction of 5% to the mark, and mix well.

[0037] ③ Zinc standard series solutions: Accurately pipette 0 mL, 1 mL, 2 mL, 4 mL, 8 mL, and 10 mL of the zinc standard intermediate solution into 100 mL volumetric flasks respectively, add 5% nitric acid solution to the mark, and mix well. The mass concentrations of these zinc standard series solutions are 0 mg / L, 0.1 mg / L, 0.2 mg / L, 0.4 mg / L, 0.8 mg / L, and 1 mg / L respectively.

[0038] And referring to the first method, flame atomic absorption spectrometry, in the National Standard of the People's Republic of China GB 5009.14-2017 to measure the zinc content in the sample, the test result shows that the zinc content in the zinc-rich freeze-dried powder is 111.4 mg / g.

[0039] Result analysis: In the present invention, the fermentation broth is collected after fermenting with the zinc-rich strain of Talaromyces purpureogenus D2, the thalli are collected after centrifugation, and the thalli are resuspended and washed with ultrapure water to elute the residual inorganic zinc salts on the surface of the thalli. The elution supernatant is combined with the fermentation supernatant and then subjected to nanofiltration treatment through a 200 Da nanofiltration membrane. The nanofiltration step can remove the inorganic zinc that cannot be utilized by strain D2 (the molecular weight of zinc sulfate is about 161.5 Da), while the organic zinc with a molecular weight greater than 200 Da (such as the molecular weight of zinc glycinate is about 213.5 Da) will remain on the membrane or in the retentate. Therefore, nanofiltration can remove the inorganic salts in the fermentation products and obtain an extracellular supernatant containing organic zinc. In addition, the thalli collected after centrifugation can be ultrasonically broken to obtain a thallus leaching solution containing organic zinc. Finally, the extracellular supernatant containing organic zinc with a molecular weight greater than 200 Da after nanofiltration is combined with the thallus leaching solution, and after freeze-drying, an organic zinc-rich zinc freeze-dried powder can be obtained. The zinc content measured using the zinc-rich freeze-dried powder is the content of organic zinc in the product, which can reach 111.4 mg / g; it shows that Talaromyces purpureogenus D2 is a microorganism with high zinc enrichment efficiency, and this strain can efficiently convert inorganic zinc into organic zinc, and the converted organic zinc accounts for about 55.7% of the zinc content in the culture medium.

[0040] Example 4. Determination of ABTS radical scavenging rate of Talaromyces bio-organic zinc: (1) Preparation of ABTS·+ working solution: Mix an aqueous ABTS solution with a concentration of 7 mmol / L and an aqueous potassium persulfate solution with a concentration of 2.45 mmol / L in a 1:1 ratio. React in the dark at 25 °C for 16 hours to form an ABTS·+ stock solution. Dilute the stock solution 40 - 50 times with absolute ethanol so that the absorbance of the diluted solution is 0.7 ± 0.02, and this is the ABTS·+ working solution.

[0041] (2) Talaromyces organic zinc solution: Prepare a series of mass concentration gradient solutions of 30 g / L, 20 g / L, 10 g / L, 5 g / L, 1 g / L, and 0.8 g / L with the zinc-rich freeze-dried powder using ultrapure water.

[0042] (3) Referring to the reagent addition amounts in Table 1, add ultrapure water, absolute ethanol, sample solution, and ABTS .+ working solution to each well in sequence, and mix well. Each sample is repeated in 3 parallels. React at a constant temperature of 30 °C for 10 min, and measure the absorbance at a wavelength of 734 nm using a microplate reader. The calculation formula for the ABTS radical scavenging rate is as follows:

[0043] Table 1 Reagent addition table for ABTS radical scavenging rate test Reagent <![CDATA[Solvent background pore (T a )]]> <![CDATA[Solvent reaction pore (T b )]]> <![CDATA[Sample background hole (T c )]]> <![CDATA[Sample reaction well (T d )]]> <![CDATA[ABTS .+ Working solution (μl)]]> 0 180 0 180 Ultra-pure water (μl) 20 20 0 0 Absolute ethanol (μl) 180 0 180 0 Sample (μl) 0 0 20 20 Total (μl) 200 200 200 200 Note: The measured readings of wells Ta, Tb, Tc, and Td are recorded as Aa, Ab, Ac, and Ad respectively.

[0044] (4)Under the aforementioned experimental conditions, the experimental results of the scavenging rate of zinc-rich freeze-dried powder on ABTS free radicals are shown in Table 2 below: Table 2 Scavenging rate of zinc-rich freeze-dried powder on ABTS free radicals Concentration of zinc-rich freeze-dried powder (g / L) ABTS free radical scavenging rate (%) 30 275.97±1.32 20 224.03±2.06 10 172.25±3.76 5 78.54±1.82 1 56.99±0.29 0.8 49.55±0.74 (5)Experimental results: According to the results in Table 2, it can be seen that the zinc-rich freeze-dried powder prepared from the zinc-rich Talaromyces purpureogenus strain D2 in the present invention has significant ABTS free radical scavenging ability in the concentration range of 0.8 - 30 g / L, indicating that the organic zinc prepared from the zinc-rich Talaromyces purpureogenus strain D2 has antioxidant ability.

[0045] Example 5. Determination of tyrosinase inhibition rate of Talaromyces bio-organic zinc: (1)3.1 Phosphate buffer solution (PBS): pH = 6.8, 0.1 mol / L; Weigh 17.91 g of disodium hydrogen phosphate dodecahydrate and dissolve it in water, and make up the volume to 500 mL with water to obtain solution A. Weigh 7.80 g of sodium dihydrogen phosphate and dissolve it in water, and make up the volume to 500 mL with water to obtain solution B. Respectively take 212.98 mL of solution A and 247.65 mL of solution B and prepare 460 mL of phosphate buffer solution with pH 6.8.

[0046] (2)L-Tyrosine solution: Weigh 25 mg of L-tyrosine, dissolve it with PBS buffer solution and make up the volume to 50 mL, store it in the dark at low temperature, and prepare it freshly before use.

[0047] (3)Use PBS buffer solution to prepare tyrosinase into 500 U / mL.

[0048] (4)Referring to the reagent addition amounts in Table 3, add L-tyrosine solution, sample solution, and PBS buffer solution into each well in sequence, mix well, incubate in a constant temperature environment at 37 °C for 10 min, then add 20 μL of tyrosinase solution into each well in sequence, mix well at 37 °C and react for 5 min ± 5 s, and immediately put it into a microplate reader to measure the absorbance at 475 nm. The calculation formula for tyrosinase inhibition rate is as follows:

[0049] (5)Preparation of sample solution: Use ultrapure water to prepare a series of mass concentration gradient solutions of zinc-rich freeze-dried powder with concentrations of 25 g / L, 20 g / L, 15 g / L, 10 g / L, 5 g / L, and 1 g / L.

[0050] Table 3 Sample addition table for tyrosinase activity inhibition test Reagent <![CDATA[Solvent background pore (T a )]]> <![CDATA[Solvent reaction pore (T b )]]> <![CDATA[Sample background hole (T c )]]> <![CDATA[Sample reaction well (T d )]]> L-Tyrosine solution (μl) 0 40 0 40 Sample solution (μl) 0 0 40 40 Solvent (PBS buffer) (μl) 40 40 0 0 PBS buffer (μl) 70 30 70 30 Tyrosinase solution ((μl) 20 20 20 20 Total (μl) 130 130 130 130 Note: The readings after measuring the Ta, Tb, Tc, and Td holes are denoted as Aa, Ab, Ac, and Ad respectively.

[0051] (6) Under the aforementioned experimental conditions, the experimental results of the inhibition rate of zinc-rich freeze-dried powder on tyrosinase are shown in Table 4 below: Table 4 Inhibition rate of zinc-rich freeze-dried powder on tyrosinase Concentration of zinc-rich freeze-dried powder (g / L) Tyrosinase inhibition rate (%) 25 110.26±12.76 20 107.83±12.28 15 81.29±12.80 10 76.01±4.01 5 69.73±4.43 1 50.76±7.30 (7) Experimental results: According to the results in Table 4, it can be seen that the zinc-rich freeze-dried powder prepared from the zinc-rich Talaromyces purpureogenus strain D2 in the present invention has significant tyrosinase inhibition ability in the concentration range of 1 - 25 g / L, indicating that the organic zinc prepared from the zinc-rich Talaromyces purpureogenus strain D2 has the ability to inhibit melanin synthesis, can be used in whitening skin care products, and also has the potential to be used as a natural preservative.

[0052] Example 6. Determination of the 5α-reductase inhibition rate of Talaromyces bio-organic zinc (kit method): (1) Preparation of working solution: In this experiment, a 5α-reductase inhibition rate evaluation kit (purchased from Huizhi Heyuan Biotechnology Co., Ltd.) was used. Appropriate amounts of SD rat testicular 5α-reductase (20 mg / mL), NADPH Solution (30 mM), and testosterone T (1 mM) were accurately pipetted and diluted according to a ratio of 1:10 (v:v) with Buffer A (pH 6.0) for standby.

[0053] (2) Preparation of Reaction Solution: Prepare according to the experimental dosage in a ratio of Buffer B:Reagent I:Reagent II = 98:1:1.

[0054] (3) Add the corresponding Buffer A, testosterone, NADPH, sample or control solution, and 5α-reductase to a centrifuge tube in sequence, mix well, incubate at 37°C, inactivate by centrifugation, take the supernatant and transfer it to a 96-well plate, add Reaction Solution and mix well, incubate at 37°C, then add Start Solution and mix well to start the reaction. Place it in an enzyme-labeling instrument and incubate at 37°C for 8 min, then measure the change in OD value before and after incubation at 405 nm, and calculate the inhibition rate of the test substance on 5α-reductase. The calculation formula is as follows:

[0055] Table 5 The first-step experimental incubation system in the determination experiment Experimental group Blank control group (water) Negative control group Positive control group (finasteride) Buffer A 149 170 150 149 Sample 1 / / / Positive control / / / 1 Testosterone 10 10 10 10 5α-Reductase 20 / 20 20 NADPH Solution 20 20 20 20 Table 6 The second-step experimental incubation system in the determination experiment Experimental group Blank control group Negative control group Positive control group Reaction Solution 75 75 75 75 Supernatant 20 20 20 20 Start Solution 5 5 5 5 (4)The experimental results of the inhibition rate of zinc-rich freeze-dried powder on 5α-reductase are shown in Table 7 below: Table 7 Inhibition rate of zinc-rich freeze-dried powder on 5α-reductase

[0056] (5)Experimental results: According to the results in Table 7, it can be seen that the zinc-rich freeze-dried powder prepared from the zinc-rich strain D2 of Talaromyces purpureogenus in the present invention has the ability to inhibit 5α-reductase, indicating that the organic zinc prepared from the zinc-rich strain D2 of Talaromyces purpureogenus can achieve the purpose of oil control.

[0057] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A strain of Talaromyces purpureogenus D2, characterized in that, Its preservation number is GDMCC NO. 66320.

2. A method for fermenting and producing organic zinc using the purple-producing Talaromyces D2 as described in claim 1, characterized in that, It includes: 1) Inoculating Talaromyces purpureogenus D2 into a liquid fermentation medium supplemented with zinc salt for fermentation culture; 2) Centrifuging the fermentation broth after fermentation; The supernatant after centrifugation is separated by a 200 Da nanofiltration membrane, the retentate is collected, and the nanofiltration membrane is washed with water to obtain the nanofiltration membrane washing solution. The nanofiltration membrane washing solution and the retentate are combined to obtain an extracellular organic zinc solution; the precipitate after centrifugation is resuspended and then subjected to ultrasonic treatment, and the bacterial cell leaching solution is collected by centrifugation; 3) Freeze-drying after combining the bacterial cell leaching solution and the extracellular organic zinc solution to obtain the product.

3. The method according to claim 2, wherein The zinc salt is zinc sulfate.

4. The method according to claim 2, characterized in that The liquid fermentation medium supplemented with zinc salt contains 2 - 8 g / L of glucose, 2 - 8 g / L of yeast extract, 8 - 15 g / L of malt extract, and the zinc concentration is 0.5 - 2 g / L.

5. The method according to claim 2, wherein The fermentation is carried out at 15 - 30 °C for fermentation culture.

6. The method according to claim 2, wherein It includes the following steps: (1) Strain activation: Inoculating the frozen stock solution of Talaromyces purpureogenus D2 onto a PDA plate for culture; (2) Seed solution preparation: Transferring the spores of the activated Talaromyces purpureogenus D2 into a PDB medium for culture to obtain a seed solution; (3) Fermentation: Inoculating the obtained seed solution into a liquid fermentation medium supplemented with zinc salt for fermentation culture; (4) Preparation of organic zinc: Centrifuging the fermentation broth after fermentation; the supernatant after centrifugation is separated by a 200 Da nanofiltration membrane, the retentate is collected, and the nanofiltration membrane is washed with ultrapure water to obtain the nanofiltration membrane washing solution. The nanofiltration membrane washing solution and the retentate are combined to obtain an extracellular organic zinc solution; the precipitate after centrifugation is resuspended and then subjected to ultrasonic treatment, and the bacterial cell leaching solution is collected by centrifugation; Freeze-drying after combining the bacterial cell leaching solution and the extracellular organic zinc solution to obtain the product.

7. A product, characterized in that, It contains Talaromyces sp. D2 as described in claim 1.

8. The product according to claim 7, wherein The product is a food, a health product or a cosmetic.

9. Use of Talaromyces sp. D2 as described in claim 1 in the preparation of a food, a health product or a cosmetic.

10. Use of the organic zinc prepared by the method as described in claim 2 in the preparation of a food, a health product or a cosmetic.

Images