Methods and compositions for treating subjects having or at risk of developing a non-primary hyperoxaluric disease or disorder - Patents.com
Patent Information
- Application Number
- JP2024503387
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-07-19
- Filing Date
- 2022-07-18
- Publication Date
- 2025-08-19
AI Technical Summary
There is a lack of effective treatment options for subjects with non-primary hyperoxaluria, who would benefit from oxalate reduction to prevent conditions such as kidney stones and renal damage, despite normal or elevated urinary oxalate levels.
Administration of nucleic acid inhibitors, such as double-stranded ribonucleic acid (dsRNA) agents targeting hydroxyacid oxidase (HAO1), lactate dehydrogenase A (LDHA), and proline dehydrogenase 2 (PRODH2), to inhibit gene expression and reduce urinary oxalate levels.
Reduces urinary oxalate levels, thereby preventing kidney stones and renal damage, including calcium oxalate kidney stones, and improving renal function in subjects with non-primary hyperoxaluria.
Smart Images

Figure 2023003805000001 
Figure 2023003805000002
Abstract
Description
[Technical Field]
[0001] Related Applications This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 223,278, filed July 19, 2021, the entire contents of which are incorporated herein by reference. [Background technology]
[0002] Oxalate (C2O4 2- Oxalate (CO₂) is a salt-forming ion of oxalic acid (C₂H₂O₄) that is widely distributed in both plants and animals. It is an inevitable component of the human diet and a ubiquitous component of plants and plant-derived foods. Oxalate can also be endogenously synthesized through metabolic pathways occurring in the liver. Dietary and endogenous contributions to urinary oxalate excretion are equal. Glyoxylate is the direct precursor of oxalate and is derived from the oxidation of glycolate by the enzyme glycolate oxidase (GO), also known as hydroxyacid oxidase (HAO1) and referred to herein, or by proline dehydrogenase 2 (PRODH2, also known as HYPDH) through the catabolism of hydroxyproline, a component of collagen. Transamination of glyoxylate with alanine by the enzyme alanine-glyoxylate aminotransferase (AGXT) results in the formation of pyruvate and glycine. Excess glyoxylate is converted to oxalate by lactate dehydrogenase A (LDHA). The endogenous pathway for oxalate metabolism is shown in Figure 1.
[0003] Because oxalate binds calcium in the kidney, urinary CaOx supersaturation can occur, leading to the formation and deposition of CaOx crystals in the kidney tissue or collecting system, even in the presence of normal levels of oxalate. These CaOx crystals contribute to the formation of diffuse nephrocalcinosis (nephrocalcinosis) and stones (nephrolithiasis). Subjects with diffuse nephrocalcinosis or non-obstructive stones typically have no symptoms. However, obstructive stones can cause severe pain. Moreover, over time, these CaOx crystals cause kidney injury and progressive inflammation. In the presence of secondary complications such as obstruction, these CaOx crystals can lead to a decline in renal function and, in severe cases, to end-stage renal failure and the need for dialysis.
[0004] Primary hyperoxaluria is a well-known disease associated with elevated levels of oxalate. Specifically, primary hyperoxaluria is characterized by impaired glyoxylate metabolism, leading to the overproduction and accumulation of oxalate throughout the body, typically manifesting as kidney and bladder stones. There are three main types of primary hyperoxaluria, differing in severity and genetic causes. Autosomal recessive mutations in the AGXT gene cause primary hyperoxaluria type 1 (PH1), autosomal recessive mutations in the GRHPR gene cause primary hyperoxaluria type 2 (PH2), and autosomal recessive mutations in the HOGA1 gene cause primary hyperoxaluria type 3 (PH3) (see Figure 1). Subjects with hereditary hyperoxaluria have few treatment options. Ultimately, some subjects with hereditary hyperoxaluria develop end-stage renal disease (ESRD) and require kidney or liver transplantation.
[0005] Recently, two investigational drugs for the treatment of subjects with oxalate-reducing PH1 or PH2 have advanced to the clinic. Specifically, lumasiran, an RNA interference (RNAi) therapeutic targeting glycolate oxidase (GO) for the treatment of PH1, is currently being evaluated in a Phase III clinical trial (see, e.g., NCT03681184), and an RNA interference (RNAi) therapeutic targeting LDHA for the treatment of PH1 and PH2 has advanced to a Phase II clinical trial (see, e.g., NCT03847909).
[0006] However, there are a considerable number of subjects who do not have primary hyperoxaluria, such as PH1, PH2 or PH3, but will still benefit from reducing oxalate, for example, subjects with non-primary hyperoxaluria diseases or disorders for which no effective treatment currently exists.For example, as mentioned above, even in the presence of normal levels of oxalate, CaOx crystals can form and deposit in renal tissue or collecting system, contributing to the formation of diffuse kidney calcification (nephrocalcinosis) and stones (nephrolithiasis).For example, in the presence of other comorbid diseases, such as metabolic disorders such as diabetes, Crohn's disease or bariatric surgery, subjects with such comorbid diseases may be at risk of developing, for example, obstructed stones, progressive kidney inflammation, reduced renal function and end-stage renal failure.
[0007] Thus, there is a need in the art for methods of treating subjects having or at risk of developing non-primary hyperoxaluria who would benefit from treatment with an oxalate-reducing agent, such as a nucleic acid inhibitor of lactate dehydrogenase AL (LDHA), a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), and / or a nucleic acid inhibitor of hydroxyacid oxidase (HAO1). Summary of the Invention
[0008] The present invention is based, at least in part, on the discovery that agents that reduce oxalate levels, such as, for example, nucleic acid inhibitors of lactate dehydroginase A (LDHA), nucleic acid inhibitors of hydroxyacid oxidase (HAO1) and / or nucleic acid inhibitors of proline dehydrogenase 2 (PRODH2), can be used to treat subjects with or at risk of developing a non-primary hyperoxaluric disease or disorder, such as subjects with normal urinary oxalate levels, e.g., normal urinary calcium oxalate levels, or subjects with elevated urinary oxalate levels, e.g., elevated urinary calcium oxalate levels, supersaturated urinary calcium oxalate levels, e.g., kidney stone disease, e.g., calcium oxalate kidney stone disease, e.g., recurrent calcium oxalate kidney stone disease.
[0009] Thus, the present invention provides methods for inhibiting the expression of hydroxyacid oxidase (HAO1) in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, methods for reducing urinary oxalate in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, methods for treating a subject having or at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from reduced oxalate, and provides compositions comprising nucleic acid inhibitors, such as double-stranded ribonucleic acid (dsRNA) agents or single-stranded antisense polynucleotide agents that target lactate dehydrogenase A (LDHA), hydroxyacid oxidase (HAO1), and / or proline dehydrogenase 2 (PRODH2).
[0010] In one aspect, the invention provides a method for inhibiting expression of hydroxyacid oxidase (HAO1) in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1, thereby inhibiting expression of HAO1 in the subject.
[0011] In another aspect, the invention provides a method for reducing urinary oxalate levels in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double-stranded ribonucleic acid (dsRNA) agent, or a salt thereof, that inhibits expression of HAO1, thereby reducing the level of urinary oxalate in the subject.
[0012] In one embodiment, the urinary oxalate is urinary calcium oxalate.
[0013] In one embodiment, the reduction in urinary calcium oxalate is a reduction in urinary calcium oxalate supersaturation.
[0014] In one aspect, the present invention provides a method for treating a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction, comprising: The present invention includes administering to a subject a fixed dose of about 200 mg to about 600 mg of a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1, thereby treating a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction.
[0015] In one embodiment, the non-primary hyperoxaluric disease or disorder is selected from the group consisting of secondary hyperoxaluria, kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, ethylene glycol poisoning, planned kidney transplant, and previous kidney transplant.
[0016] In one embodiment, the non-primary hyperoxaluric disease or disorder is kidney stone disease.
[0017] In one embodiment, the kidney stone disease is calcium oxalate kidney stone disease.
[0018] In one embodiment, the calcium oxalate kidney stone disease is recurrent calcium oxalate kidney stone disease.
[0019] In one embodiment, administration of a dsRNA agent or salt thereof to a subject reduces urinary oxalate levels.
[0020] In one embodiment, the urinary oxalate is urinary calcium oxalate.
[0021] In one embodiment, the reduction in urinary calcium oxalate is a reduction in urinary calcium oxalate supersaturation.
[0022] In one embodiment, administration of a dsRNA agent or salt thereof to a subject reduces clinical and radiological kidney stone events.
[0023] In one embodiment, the subject is a human.
[0024] In one embodiment, the dsRNA agent or salt thereof is administered to the subject at intervals of once every six months.
[0025] In one embodiment, the dsRNA agent or salt thereof is administered to the subject first every three months and then every six months thereafter.
[0026] In one embodiment, the fixed dose of the dsRNA agent or salt thereof is about 284 mg.
[0027] In one embodiment, the fixed dose of the dsRNA agent or salt thereof is about 567 mg.
[0028] In one embodiment, the dsRNA agent or salt thereof is administered to the subject subcutaneously.
[0029] In one embodiment, the subcutaneous administration is a subcutaneous injection.
[0030] In one embodiment, a dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO:21, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the corresponding portion of the nucleotide sequence of SEQ ID NO:22, such that the sense strand is complementary to at least 15 contiguous nucleotides in the antisense strand.
[0031] In one embodiment, a dsRNA agent or salt thereof includes a sense strand and an antisense strand that form a double-stranded region, and the antisense strand includes at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 4-14.
[0032] In one embodiment, the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises a nucleotide sequence that differs by no more than three nucleotides from the nucleotide sequence 5'-GACUUUCAUCCUGGAAAUAUA-3' (SEQ ID NO: 33), and the antisense strand comprises a nucleotide sequence that differs by no more than three nucleotides from the nucleotide sequence 5'-UAUAUUUCCAGGAUGAAAGUCCA-3' (SEQ ID NO: 34).
[0033] In one embodiment, the dsRNA agent includes at least one modified nucleotide.
[0034] In one embodiment, no more than five nucleotides in the sense strand and no more than five nucleotides in the antisense strand are unmodified nucleotides.
[0035] In one embodiment, substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand are modified nucleotides.
[0036] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.
[0037] In one embodiment, at least one of the modified nucleotides is a deoxy-nucleotide, a 3'-terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxy-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a tetrahydropyran-modified nucleotide, a 1,5-anhydrohexyl The nucleotides are selected from the group consisting of toll-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a 5'-phosphorothioate group, nucleotides containing a 5'-methylphosphonate group, nucleotides containing a 5' phosphate or a 5' phosphate mimic, nucleotides containing vinylphosphonate, nucleotides containing adenosine glycol nucleic acid (GNA), nucleotides containing thymidine glycol nucleic acid (GNA) S isomers, nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, and terminal nucleotides linked to cholesteryl derivatives and dodecanoic acid bisdecylamide groups, and combinations thereof.
[0038] In one embodiment, the dsRNA agent or salt thereof further comprises at least one phosphorothioate internucleotide linkage.
[0039] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of one strand.
[0040] In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5' end of one strand.
[0041] In one embodiment, phosphorothioate or methylphosphonate internucleotide linkages are at both the 5' and 3' ends of one strand.
[0042] In one embodiment, the dsRNA agent or salt thereof includes 6 to 8 phosphorothioate internucleotide linkages.
[0043] In one embodiment, at least one strand of the dsRNA agent or salt thereof further comprises a ligand.
[0044] In one embodiment, the ligand is attached to the 3' end of the sense strand.
[0045] In one embodiment, the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives.
[0046] In one embodiment, one or more GalNAc derivatives are attached via a monovalent, divalent, or trivalent branched linker.
[0047] In one embodiment, the ligand is: [ka]
[0048] In one embodiment, the dsRNA agent or salt thereof is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O or S.
[0049] In one embodiment, X is O.
[0050] In one embodiment, the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36); wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, and as is 2'-O-methyladenosine-3'-phosphorothioate; c is 2'-O-methylcytidine-3'-phosphate, cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage.
[0051] In one embodiment, the nucleotide sequence of the sense strand differs by no more than two nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than two nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0052] In one embodiment, the nucleotide sequence of the sense strand differs by no more than one nucleotide from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than one nucleotide from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0053] In one embodiment, the nucleotide sequence of the sense strand comprises the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0054] In one embodiment, the dsRNA agent or salt thereof is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O or S.
[0055] In one aspect, the invention provides a method for inhibiting expression of hydroxyacid oxidase (HAO1) in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1, wherein the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuCfaUfCfCfuggaaaua-3' (SEQ ID NO:35), and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO:36), wherein Af is 2'-fluoroadenosine-3'-phosphate and Afs is 2'-fluoroadenosine-3'-phosphate. Cf is 2'-fluoro cytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluoro uridine-3'-phosphate, a is 2'-O-methyl adenosine-3'-phosphate, as is 2'-O-methyl adenosine-3'-phosphorothioate, c is 2'-O-methyl cytidine-3'-phosphate, and cs is 2' -O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate bond, thereby inhibiting expression of HAO1 in a subject.
[0056] In another aspect, the invention provides a method for reducing urinary oxalate levels in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1, wherein the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuCfaUfCfCfuggaaaua-3' (SEQ ID NO:35), and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO:36), wherein Af is 2'-fluoroadenosine-3'-phosphate and Afs is 2'-fluoroadenosine-3'-phosphate. adenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, c is 2'-O-methylcytidine-3'-phosphate, and cs is 2'-O-methyl cytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage, thereby reducing urinary oxalate levels in the subject.
[0057] In one embodiment, the urinary oxalate is urinary calcium oxalate.
[0058] In one embodiment, the reduction in urinary calcium oxalate is a reduction in urinary calcium oxalate supersaturation.
[0059] In one embodiment, the invention provides a method for treating a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction, comprising administering to the subject a fixed dose of about 200 mg to about 600 mg of a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1, wherein the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuCfaUfCfCfuggaaaua-3' (SEQ ID NO:35), and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO:36), wherein Af is 2'-fluoroadenosine-3'-phosphate and Afs is 2'-fluoroadenosine-3'-phosphorothioate; Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, c is 2'-O-methylcytidine-3'-phosphate, cs is 2'-O-methylcytidine-3'-phosphorothioate, and g is wherein gs is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage, thereby treating a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction.
[0060] In one embodiment, the non-primary hyperoxaluric disease or disorder is selected from the group consisting of secondary hyperoxaluria, kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, ethylene glycol poisoning, planned kidney transplant, and previous kidney transplant.
[0061] In one embodiment, the non-primary hyperoxaluric disease or disorder is kidney stone disease.
[0062] In one embodiment, the kidney stone disease is calcium oxalate kidney stone disease.
[0063] In one embodiment, the calcium oxalate kidney stone disease is recurrent calcium oxalate kidney stone disease.
[0064] In one embodiment, administration of a dsRNA agent or salt thereof to a subject reduces urinary oxalate levels.
[0065] In one embodiment, the urinary oxalate is urinary calcium oxalate.
[0066] In one embodiment, the reduction in urinary calcium oxalate is a reduction in urinary calcium oxalate supersaturation.
[0067] In one embodiment, administration of a dsRNA agent or salt thereof to a subject reduces clinical and radiological kidney stone events.
[0068] In one embodiment, the subject is a human.
[0069] In one embodiment, the dsRNA agent or salt thereof is administered to the subject at intervals of once every six months.
[0070] In one embodiment, the dsRNA agent or salt thereof is administered to the subject first every three months and then every six months thereafter.
[0071] In one embodiment, the fixed dose of the dsRNA agent or salt thereof is about 284 mg.
[0072] In one embodiment, the fixed dose of the dsRNA agent or salt thereof is about 567 mg.
[0073] In one embodiment, the dsRNA agent or salt thereof is administered to the subject subcutaneously.
[0074] In one embodiment, the subcutaneous administration is a subcutaneous injection.
[0075] In one embodiment, the nucleotide sequence of the sense strand differs by no more than two nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than two nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0076] In one embodiment, the nucleotide sequence of the sense strand differs by no more than one nucleotide from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than one nucleotide from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0077] In one embodiment, the nucleotide sequence of the sense strand comprises the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0078] In one embodiment, the dsRNA agent or salt thereof is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O or S.
[0079] In one embodiment, X is O.
[0080] In one embodiment, the dsRNA agent is in a salt form.
[0081] In one embodiment, the dsRNA agent or salt thereof is administered to the subject as a pharmaceutical formulation.
[0082] In one embodiment, the methods of the invention further comprise administering to the subject an additional therapeutic agent.
[0083] In one aspect, the invention provides a method for reducing calcium oxalate kidney stone incidence in a subject, the method comprising administering to the subject a fixed dose of about 284 mg to about 567 mg of a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence 5'-gsascuuCfaUfCfCfuggaaaua-3' (SEQ ID NO:35) and the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO:36), where Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, and Cf is 2'-fluorocytidine-3'-phosphate; wherein U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, c is 2'-O-methylcytidine-3'-phosphate, cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, uis is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage; and the sense strand is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O, thereby reducing the incidence of calcium oxalate kidney stones in the subject.
[0084] In one embodiment, the subject has suffered from two or more oxalate stone events.
[0085] In one embodiment, the subject has elevated urinary oxalate levels.
[0086] In one embodiment, the subject has suffered from two or more oxalate stone events and has elevated urinary oxalate levels.
[0087] In one embodiment, the dsRNA agent or salt thereof is administered to the subject once every six months.
[0088] In one embodiment, the dsRNA agent or salt thereof is administered to the subject first every three months and then every six months thereafter.
[0089] In one aspect, the present invention provides a method for treating a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of hydroxyacid oxidase (HAO1) and / or a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), thereby treating the subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction.
[0090] In some embodiments, the non-primary hyperoxaluric disease or disorder is selected from the group consisting of secondary hyperoxaluria, kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, ethylene glycol poisoning, planned kidney transplant, and previous kidney transplant.
[0091] In another aspect, the present invention provides a method of treating a subject at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of lactate dehydroginase A (LDHA), a nucleic acid inhibitor of hydroxyacid oxidase (HAO1), and / or a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), thereby treating the subject at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction.
[0092] In some embodiments, subjects at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction suffer from Crohn's disease, inflammatory bowel disease, bariatric surgery, fibromyalgia, autoimmune disease, coronary artery disease, kidney stone disease, end-stage renal disease (ESRD), diabetes, obesity, HIV, or ethylene glycol poisoning.
[0093] In one embodiment, the subject is a human.
[0094] In one embodiment, the nucleic acid inhibitor is a double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of HAO1.
[0095] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO:21, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the corresponding portion of the nucleotide sequence of SEQ ID NO:22, such that the sense strand is complementary to at least 15 contiguous nucleotides in the antisense strand.
[0096] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 4-14.
[0097] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, the sense strand comprising the nucleotide sequence 5'-GACUUUCAUCCUGGAAAUAUA-3' (SEQ ID NO: 33) and the antisense strand comprising the nucleotide sequence 5'-UAUAUUUCCAGGAUGAAAGUCCA-3' (SEQ ID NO: 34).
[0098] In one embodiment, the nucleic acid inhibitor is a double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of LDHA.
[0099] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO:1, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a corresponding portion of the nucleotide sequence of SEQ ID NO:2, such that the sense strand is complementary to at least 15 contiguous nucleotides in the antisense strand.
[0100] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-3.
[0101] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, the sense strand comprising a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence 5'-AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC-3' (SEQ ID NO: 31), and the antisense strand comprising a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence 5'-UCAGAUAAAAAGGACAACAUGG-3 (SEQ ID NO: 32).
[0102] In one embodiment, the nucleic acid inhibitor is a double-stranded ribonucleic acid (dsRNA) agent that inhibits the expression of PRODH2.
[0103] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, wherein the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from a portion of the nucleotide sequence of SEQ ID NO: 4641, and the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the corresponding portion of the nucleotide sequence of SEQ ID NO: 4642, such that the sense strand is complementary to at least 15 contiguous nucleotides in the antisense strand.
[0104] In one embodiment, the dsRNA agent comprises a sense strand and an antisense strand that form a double-stranded region, and the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 15-16.
[0105] In one embodiment, the nucleic acid inhibitor is a dual-targeting double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of LDHA and HAO1.
[0106] In one embodiment, a dual-targeting dsRNA agent comprises a first double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactate dehydrogenase A (LDHA), comprising a sense strand and an antisense strand, and a second double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAO1), comprising a sense strand and an antisense strand, wherein the first dsRNA agent and the second dsRNA agent are covalently linked, and wherein the sense strand of the first dsRNA agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:1; the antisense strand of the first dsRNA agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:2; the sense strand of the second dsRNA agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:21; and the antisense strand of the second dsRNA agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:22.
[0107] In one embodiment, a dual-targeting dsRNA agent comprises a first double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of lactate dehydrogenase A (LDHA) comprising a sense strand and an antisense strand, and a second double-stranded ribonucleic acid (dsRNA) agent that inhibits expression of hydroxyacid oxidase 1 (glycolate oxidase) (HAO1) comprising a sense strand and an antisense strand, wherein the first dsRNA agent and the second dsRNA agent are covalently linked, and the antisense strand of the first dsRNA agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 2-3, and the antisense strand of the second dsRNA agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense sequences listed in any one of Tables 4-14.
[0108] In one embodiment, the dsRNA agent includes at least one modified nucleotide.
[0109] In one embodiment, no more than five nucleotides in the sense strand and no more than five nucleotides in the antisense strand are unmodified nucleotides.
[0110] In one embodiment, all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified nucleotides.
[0111] In one embodiment, at least one of the modified nucleotides is a deoxy-nucleotide, a 3'-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, a 2'-C-alkyl-modified nucleotide, a 2'-hydroxy-modified nucleotide, a 2'-methoxyethyl-modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a nucleotide containing a non-natural base, a tetrahydropyran-modified nucleotide, a 1,5-anhydrohexyl ... The nucleotides are selected from the group consisting of toll-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing a 5'-phosphorothioate group, nucleotides containing a 5'-methylphosphonate group, nucleotides containing a 5' phosphate or a 5' phosphate mimic, nucleotides containing vinylphosphonate, nucleotides containing adenosine glycol nucleic acid (GNA), nucleotides containing thymidine glycol nucleic acid (GNA) S isomers, nucleotides containing 2-hydroxymethyl-tetrahydrofuran-5-phosphate, nucleotides containing 2'-deoxythymidine-3' phosphate, nucleotides containing 2'-deoxyguanosine-3'-phosphate, and terminal nucleotides linked to cholesteryl derivatives and dodecanoic acid bisdecylamide groups, and combinations thereof.
[0112] In one embodiment, the dsRNA agent further comprises at least one phosphorothioate internucleotide linkage.
[0113] In one embodiment, the dsRNA agent includes six to eight phosphorothioate internucleotide linkages.
[0114] In one embodiment, at least one strand of the dsRNA agent further comprises a ligand.
[0115] In one embodiment, the ligand is attached to the 3' end of the sense strand.
[0116] In one embodiment, the ligand is one or more N-acetylgalactosamine (GalNAc) derivatives.
[0117] In one embodiment, one or more GalNAc derivatives are attached via a monovalent, divalent, or trivalent branched linker.
[0118] In one embodiment, the ligand is: [ka]
[0119] In one embodiment, the dsRNA agent is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O or S.
[0120] In one embodiment, X is O.
[0121] In one embodiment, the sense strand comprises the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36); wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, and as is 2'-O-methyladenosine-3'-phosphorothioate; c is 2'-O-methylcytidine-3'-phosphate, cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage.
[0122] In one embodiment, the dsRNA agent is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O or S.
[0123] In one embodiment, the dsRNA agent includes at least one modified nucleotide.
[0124] In one embodiment, all of the nucleotides of the dsRNA agent are modified nucleotides.
[0125] In one embodiment, the modified nucleotide comprises a 2' modification.
[0126] In one embodiment, the 2'-modification is a 2'-fluoro or a 2'-O-methyl modification.
[0127] In one embodiment, one or more of the following positions are modified with 2'-O-methyl: 1, 2, 4, 6, 7, 12, 14, 16, 18-26, or 31-36 of the sense strand, and / or 1, 6, 8, 11-13, 15, 17, or 19-22 of the antisense strand.
[0128] In one embodiment, all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and all of positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are modified with 2'-O-methyl.
[0129] In one embodiment, one or more of the following positions are modified with 2'-fluoro: 3, 5, 8-11, 13, 15, or 17 of the sense strand, and / or 2-5, 7, 9, 10, 14, 16, or 18 of the antisense strand.
[0130] In one embodiment, all of positions 3, 5, 8-11, 13, 15, or 17 of the sense strand and all of positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with 2'-fluoro.
[0131] In one embodiment, the dsRNA agent includes at least one modified internucleotide linkage.
[0132] In one embodiment, at least one modified internucleotide linkage is a phosphorothioate linkage.
[0133] In one embodiment, the dsRNA agent has phosphorothioate linkages between one or more of the following: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
[0134] In one embodiment, the dsRNA agent has phosphorothioate linkages between each of the following: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand.
[0135] In one embodiment, the uridine at the first position of the antisense strand comprises a phosphate analog.
[0136] In one embodiment, the dsRNA comprises the following structure at position 1 of the antisense strand: [ka]
[0137] In one embodiment, one or more of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.
[0138] In one embodiment, each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety.
[0139] In one embodiment, the -GAAA- motif has the following structure: [ka] wherein L represents a bond, a click chemistry handle, or a linker of consecutive, covalently bonded atoms, 1 to 20 in length, inclusive, selected from the group consisting of substituted and unsubstituted alkylene, substituted and unsubstituted alkenylene, substituted and unsubstituted alkynylene, substituted and unsubstituted heteroalkylene, substituted and unsubstituted heteroalkenylene, substituted and unsubstituted heteroalkynylene, substituted and unsubstituted heteroalkenylene, and combinations thereof; X is O, S, or N.
[0140] In one embodiment, L is an acetal linker.
[0141] In one embodiment, X is O.
[0142] In one embodiment, the -GAAA- sequence comprises the following structure: [ka]
[0143] In one embodiment, the dsRNA comprises an antisense strand having the sequence set forth as UCAGAUAAAAAGGACAACAUGG (SEQ ID NO: 32) and a sense strand having the sequence set forth as AUGUUGUCCUUUUUAUCUGAGCAGCCGAAAGGCUGC (SEQ ID NO: 31), wherein all of positions 1, 2, 4, 6, 7, 12, 14, 16, 18-26, and 31-36 of the sense strand and all of positions 1, 6, 8, 11-13, 15, 17, and 19-22 of the antisense strand are 2'-O-methyl. positions 3, 5, 8-11, 13, 15, and 17 of the sense strand and positions 2-5, 7, 9, 10, 14, 16, and 18 of the antisense strand are modified with 2'-fluoro, and the oligonucleotide has a phosphorothioate bond between each of the following: positions 1 and 2 of the sense strand, positions 1 and 2 of the antisense strand, positions 2 and 3 of the antisense strand, positions 3 and 4 of the antisense strand, positions 20 and 21 of the antisense strand, and positions 21 and 22 of the antisense strand. The dsRNA contains the following structure at position 1 of the antisense strand: [ka] Each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety comprising the structure: [ka]
[0144] In one embodiment, the dsRNA agent is present in a composition comprising a dsRNA agent and a Na+ counterion.
[0145] In one embodiment, the nucleic acid inhibitor is a single-stranded antisense polynucleotide agent that inhibits expression of LDHA.
[0146] In one embodiment, a single-stranded antisense polynucleotide agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense nucleotide sequences of any one of Tables 2-3.
[0147] In one embodiment, the nucleic acid inhibitor is a single-stranded antisense polynucleotide agent that inhibits expression of PRODH2.
[0148] In one embodiment, a single-stranded antisense polynucleotide agent comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from any one of the antisense nucleotide sequences of any one of Tables 15-16.
[0149] In one embodiment, a single-stranded antisense polynucleotide agent is about 8 to about 50 nucleotides in length.
[0150] In one embodiment, substantially all of the nucleotides of the single-stranded antisense polynucleotide agent are modified nucleotides.
[0151] In one embodiment, all nucleotides of a single stranded antisense polynucleotide agent are modified nucleotides.
[0152] In one embodiment, the modified nucleotide comprises a modified sugar moiety selected from the group consisting of: a 2'-O-methoxyethyl modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.
[0153] In one embodiment, the bicyclic sugar moiety has a (-CRH-)n group that forms a bridge between the 2' oxygen and the 4' carbon atom of the sugar ring, where n is 1 or 2 and R is H, CH3 or CH3OCH3.
[0154] In one embodiment, n is 1 and R is CH3.
[0155] In one embodiment, the modified nucleotide is 5-methylcytosine.
[0156] In one embodiment, the single-stranded antisense polynucleotide agent comprises a modified internucleoside linkage.
[0157] In one embodiment, the modified internucleoside linkage is a phosphorothioate internucleoside linkage.
[0158] In one embodiment, a single-stranded antisense polynucleotide agent comprises a plurality of 2'-deoxynucleotides flanked on each side by at least one nucleotide having a modified sugar moiety.
[0159] In one embodiment, the single-stranded antisense polynucleotide agent is a gapmer that includes a gap segment consisting of linked 2'-deoxynucleotides positioned between the 5' and 3' wing segments.
[0160] In one embodiment, the modified sugar moiety is selected from the group consisting of a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.
[0161] In one embodiment, the nucleic acid inhibitor is present in a pharmaceutical formulation.
[0162] In some embodiments, the methods of the invention further comprise administering to the subject an additional therapeutic agent.
[0163] In one embodiment, the nucleic acid inhibitor is administered to a subject at a dose of about 0.01 mg / kg to about 10 mg / kg or about 0.5 mg / kg to about 50 mg / kg.
[0164] In one embodiment, the nucleic acid inhibitor is administered subcutaneously to the subject.
[0165] The present invention also provides a method for treating a subject having chronic kidney disease (CKD), comprising administering to the subject a weight-based dose of a dsRNA agent, or salt thereof, that inhibits expression of HAO1 in a dosing regimen comprising closely spaced loading phases that may be followed by a maintenance phase in which the dsRNA agent, or salt thereof, is administered at longer intervals.
[0166] Accordingly, in one aspect, the invention provides a method for inhibiting expression of hydroxyacid oxidase (HAO1) in a subject having chronic kidney disease (CKD), comprising administering to the subject a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1 in a dosing regimen comprising a loading phase followed by a maintenance phase, wherein the subject has a body weight of less than about 10 kilograms (kg), and the loading phase comprises administering to the subject a dose of about 6 milligrams per kilogram (mg / kg) of the double-stranded RNAi agent or salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject a dose of about 6 milligrams per kilogram (mg / kg) of the double-stranded RNAi agent or salt thereof about once a month for about three months. or the subject has a body weight of about 10 kg to less than 20 kg, and the loading phase comprises administering to the subject a dose of about 6 mg / kg of the double-stranded RNAi agent or salt thereof about once a month for about three months; and the maintenance phase comprises administering to the subject a dose of about 6 mg / kg of the double-stranded RNAi agent or salt thereof about every three months; or the subject has a body weight of more than about 20 kg, and the loading phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or salt thereof for about three months. the maintenance phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or salt thereof about every three months, wherein the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfa agucscsa-3' (SEQ ID NO:36) differs by no more than three nucleotides, wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, and c iswherein cs is 2'-O-methylcytidine-3'-phosphate, cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate bond, thereby inhibiting expression of HAO1 in a subject.
[0167] In another aspect, the invention provides a method for reducing urinary oxalate levels in a subject having chronic kidney disease, comprising administering to the subject a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof that inhibits expression of HAO1 in a dosing regimen comprising a loading phase followed by a maintenance phase, wherein the subject has a body weight of less than about 10 kilograms (kg), and the loading phase comprises administering to the subject a dose of about 6 milligrams per kilogram (mg / kg) of the double-stranded RNAi agent or a salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or a salt thereof about once a month for about three months. or a salt thereof about once a month to the subject, or the subject has a body weight of about 10 kg to less than 20 kg, and the loading phase comprises administering to the subject a dose of about 6 mg / kg of the double-stranded RNAi agent or a salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject a dose of about 6 mg / kg of the double-stranded RNAi agent or a salt thereof about every three months, or the subject has a body weight of more than about 20 kg, and the loading phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or a salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject The method comprises administering to a subject about every three months a double-stranded RNAi agent or salt thereof at a dose of about 3 mg / kg, wherein the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the nucleotide sequence of the sense strand differs from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) by no more than three nucleotides, and the nucleotide sequence of the antisense strand differs from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36) by no more than three nucleotides. wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, and c is 2'-O-methylcytidine-3'-phosphate;cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate bond, thereby reducing urinary oxalate in a subject.
[0168] In one aspect, the invention provides a method for treating a subject having chronic kidney disease, comprising administering to the subject a double-stranded ribonucleic acid (dsRNA) agent or salt thereof that inhibits expression of HAO1 in a dosing regimen comprising a loading phase followed by a maintenance phase, wherein the subject has a body weight of less than about 10 kilograms (kg), and the loading phase comprises administering to the subject a dose of about 6 milligrams per kilogram (mg / kg) of the double-stranded RNAi agent or salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or salt thereof about once a month for about three months. or the subject has a body weight of about 10 kg to less than 20 kg, and the loading phase comprises administering to the subject a dose of about 6 mg / kg of the double-stranded RNAi agent or a salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject a dose of about 6 mg / kg of the double-stranded RNAi agent or a salt thereof about every three months; or the subject has a body weight of more than about 20 kg, and the loading phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or a salt thereof about once a month for about three months, and the maintenance phase comprises administering to the subject a dose of about 3 mg / kg of the double-stranded RNAi agent or a salt thereof about every three months. and administering to a subject approximately every three months a dose of a double-stranded RNAi agent or salt thereof, wherein the dsRNA agent or salt thereof comprises a sense strand and an antisense strand that form a double-stranded region, wherein the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36). wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, c is 2'-O-methylcytidine-3'-phosphate, and cs is2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage, thereby treating a subject.
[0169] In one embodiment, the subject is a human.
[0170] In one embodiment, the dsRNA agent or salt thereof is administered to the subject subcutaneously.
[0171] In one embodiment, the subcutaneous administration is a subcutaneous injection.
[0172] In one embodiment, the nucleotide sequence of the sense strand differs by no more than two nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than two nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0173] In one embodiment, the nucleotide sequence of the sense strand differs by no more than one nucleotide from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than one nucleotide from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0174] In one embodiment, the nucleotide sequence of the sense strand comprises the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
[0175] In one embodiment, the dsRNA agent or salt thereof is conjugated to a ligand as shown in the following scheme: [ka] wherein X is O or S.
[0176] In one embodiment, X is O.
[0177] In one embodiment, the dsRNA agent is in a salt form.
[0178] In one embodiment, the dsRNA agent or salt thereof is administered to the subject as a pharmaceutical formulation.
[0179] In one embodiment, the method further comprises administering to the subject an additional therapeutic agent. [Brief explanation of the drawings]
[0180] [Figure 1] FIG. 1 is a schematic diagram of the endogenous pathway for oxalate synthesis. DETAILED DESCRIPTION OF THE INVENTION
[0181] The present invention is based, at least in part, on the discovery that agents that reduce oxalate levels, such as, for example, nucleic acid inhibitors of lactate dehydroginase A (LDHA), nucleic acid inhibitors of hydroxyacid oxidase (HAO1) and / or nucleic acid inhibitors of proline dehydrogenase 2 (PRODH2), can be used to treat subjects with or at risk of developing a non-primary hyperoxaluric disease or disorder, such as subjects with normal urinary oxalate levels, e.g., normal urinary calcium oxalate levels, or subjects with elevated urinary oxalate levels, e.g., elevated urinary calcium oxalate levels, supersaturated urinary calcium oxalate levels, e.g., kidney stone disease, e.g., calcium oxalate kidney stone disease, e.g., recurrent calcium oxalate kidney stone disease.
[0182] Thus, the present invention provides methods for inhibiting the expression of hydroxyacid oxidase (HAO1) in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, methods for reducing urinary oxalate in a subject having a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate, methods for treating a subject having or at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from reduced oxalate, and provides compositions comprising nucleic acid inhibitors, such as double-stranded ribonucleic acid (dsRNA) agents or single-stranded antisense polynucleotide agents that target lactate dehydrogenase A (LDHA), hydroxyacid oxidase (HAO1), and / or proline dehydrogenase 2 (PRODH2).
[0183] The following detailed description discloses methods for making and using compositions containing iRNAs that inhibit expression of the HAO1 gene, the LDHA gene, the PRODH2 gene, and / or both the LDHA gene and the HAO1 gene, as well as compositions and methods for treating subjects with diseases and disorders that would benefit from inhibiting or reducing expression of these genes.
[0184] I. Definition In order that the present invention may be more readily understood, certain terms are first defined. Additionally, it should be noted that whenever a value or range of values for a parameter is listed, it is intended that values and ranges intermediate to the listed values are also intended to be part of the present invention.
[0185] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. For example, "an element" means one element or to more than one element, e.g., a plurality of elements.
[0186] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise.
[0187] The term "about" is used herein to mean within a typical tolerance in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about precedes a series of numbers or ranges, it is understood that "about" can modify each of the consecutive numbers or ranges.
[0188] The terms "at least," "more than," or "or more" preceding a number or series of numbers are understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that may be logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21-nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the specified property. When at least precedes a series of numbers or ranges, it is understood that "at least" can modify each of the series of numbers or ranges.
[0189] As used herein, "less than" or "less than" refers to the value adjacent to the phrase and any logically smaller value or integer up to zero, if logical from the context. For example, a duplex with an overhang of "2 nucleotides or less" has an overhang of 2, 1, or 0 nucleotides. When "less than" is used before a series of numbers or ranges, it is understood that "less than" can modify each of the series of numbers or ranges.
[0190] In the event of a conflict between a shown target site and the nucleotide sequence for either the sense or antisense strand, the shown sequence controls.
[0191] If the chemical structure and chemical name do not match, the chemical structure takes precedence.
[0192] As used herein, the term "hyperoxaluria" refers to a condition characterized by increased urinary excretion of oxalate. Generally, hyperoxaluria can be divided into two categories: primary and secondary hyperoxaluria.
[0193] Primary hyperoxaluria, as used herein, refers to an autosomal recessive disorder of glyoxylate metabolism. Primary hyperoxaluria is the result of an inherited enzyme deficiency that leads to increased endogenous oxalate synthesis. Primary hyperoxaluria can be divided into primary hyperoxaluria type 1 (PH1), primary hyperoxaluria type 2 (PH2), primary hyperoxaluria type 3 (PH3), or primary hyperoxaluria non-type 1, non-type 2, or non-type 3 (PH-non-type 1, non-type 2, non-type 3). PH1 is a genetic disorder caused by mutations in alanine glyoxylate aminotransferase (AGT). PH2 is due to mutations in glyoxylate reductase / hydroxypyruvate reductase (GRHPR). PH3 is caused by mutations in HOGA1 (formerly DHDPSL). Subjects with PH-non-type 1, non-type 2, non-type 3 have clinical characteristics indistinguishable from types 1, 2, and 3, but have normal AGT, GRHPR, and HOGA1 liver enzyme activities, and the etiology of marked hyperoxaluria in such subjects remains unknown.
[0194] Deficiencies in either AGT or GRHPR activity result in excess glyoxylate and oxalate (see, e.g., Knight et al., (2011) Am J Physiol Renal Physiol 302(6):F688-F693). Therefore, inhibition of glycolate oxidase (HAO1) and proline dehydrogenase 2 (PRODH2) reduces glyoxylate levels. Furthermore, inhibition of LDHA expression and / or activity reduces excess oxalate levels. Accumulation of oxalate in subjects with PH leads to increased oxalate excretion, which then leads to kidney and bladder stones. Stones can cause urinary tract obstruction (often accompanied by severe and acute pain), secondary urinary infection, and ultimately kidney damage. Oxalate stones tend to be severe and result in relatively early kidney damage (e.g., onset in teenage years to early adulthood), impairing oxalate excretion and further accelerating oxalate accumulation in the body. After renal failure develops, patients may develop oxalate deposits in the bones, joints, and bone marrow. Severe cases may develop hematologic problems such as anemia and thrombocytopenia. Oxalate deposition in the body is sometimes called "oxalosis" to distinguish it from "oxaluria," which refers to oxalate in the urine. Renal failure is a serious complication that requires treatment in itself. Dialysis can control renal failure but tends to be insufficient to eliminate excess oxalate. Kidney transplantation is more effective and is the primary treatment for severe hyperoxaluria. Liver transplantation (often in addition to kidney transplantation) may control the disease by correcting metabolic defects. In some patients with primary hyperoxaluria type 1, pyridoxine treatment (vitamin B6) may also reduce oxalate excretion and prevent kidney stone formation.
[0195] As used herein, the term "non-primary hyperoxaluric disease or disorder" refers to a disease, disorder, or condition that is associated with oxalate metabolism and would benefit from a reduction in oxalate and / or decreased gene expression, replication, or protein activity of lactate dehydrogenase A (LDHA), hydroxyacid oxidase (HAO1), and / or proline dehydrogenase 2 (PRODH2).
[0196] As used herein, the term "non-primary hyperoxaluria disease or disorder" does not include primary hyperoxaluria, e.g., primary hyperoxaluria 1 (PH1), primary hyperoxaluria 2 (PH2), or primary hyperoxaluria 3 (PH3).
[0197] Subjects with non-primary hyperoxaluric diseases or disorders who would benefit from oxalate reduction include those with elevated oxalate levels, e.g., mild hyperoxaluric conditions, i.e., urinary calcium oxalate excretion levels of about 40 to about 60 mg / day, or severe hyperoxaluric conditions, i.e., urinary calcium oxalate excretion levels of greater than about 60 mg / day. In one embodiment, subjects with severe hyperoxaluric conditions have supersaturated levels of calcium oxalate, e.g., calcium oxalate (i.e., urinary concentrations exceed the solubility of oxalate, which drives crystallization and kidney stone formation). In other embodiments, subjects with severe hyperoxaluric conditions do not have supersaturated levels of calcium oxalate, e.g., calcium oxalate. In some embodiments, subjects at risk of developing a non-primary hyperoxaluric disease or disorder have normal levels of urinary oxalate excretion, i.e., urinary oxalate excretion levels of <40 mg / day, and would still benefit from oxalate reduction.
[0198] Such subjects include those suffering from secondary hyperoxaluria, such as enteric hyperoxaluria, dietary hyperoxaluria, or idiopathic hyperoxaluria, kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, skin oxalate deposits, or ethylene glycol poisoning.Such subjects also include those who are planning to undergo kidney transplantation or have undergone kidney transplantation.In one embodiment, the subject suffers from kidney stone disease, such as calcium oxalate kidney stone disease, for example, recurrent calcium oxalate kidney stone disease.
[0199] In certain embodiments, the methods of the invention reduce urinary oxalate, eg, urinary calcium oxalate, levels by about ≧20% from baseline as assessed by a 24-hour urinary oxalate analysis.
[0200] In certain embodiments, the methods of the present invention reduce supersaturated urinary oxalate, eg, urinary calcium oxalate, levels from baseline as assessed by a 24-hour urinary oxalate analysis.
[0201] As used herein, "kidney stone disease" refers to a condition in which kidney stones (also called nephrolithiasis or urinary tract stones) form in one or both kidneys of a subject. Kidney stones are small, hard deposits composed of minerals or other compounds found in urine. Kidney stones come in a variety of sizes, shapes, and colors. To be removed (or "passed") from the body, stones must travel through tubes that carry urine from the kidney to the bladder (ureter) and are excreted. Depending on their size, kidney stones typically take several days to several weeks to pass from the body. There are four main types of kidney stones, classified by the material from which they are made. Up to 75% of all kidney stones are composed primarily of calcium. Stones can also form from uric acid (a normal waste product), cystine (a protein component), or struvite (a phosphate mineral). Stones form when there are more compounds in the urine than can be dissolved. This imbalance can occur when there is an increase in the amount of substances in the urine, a decrease in the amount of liquid urine, or a combination of both. People are most likely to develop kidney stones between the ages of 40 and 60, but stones can appear at any age. Studies show that 35 to 50 percent of people with one kidney stone develop additional stones, usually within 10 years of the first stone.
[0202] In one embodiment, the kidney stone disease is calcium oxalate kidney stone disease. In another embodiment, the kidney stone disease is non-calcium oxalate kidney stone disease.
[0203] In some embodiments, the kidney stone disease (either calcium oxalate kidney stone disease or non-calcium oxalate kidney stone disease) is non-recurrent kidney stone disease. In other embodiments, the kidney stone disease (either calcium oxalate kidney stone disease or non-calcium oxalate kidney stone disease) is recurrent kidney stone disease.
[0204] As used herein, the term "non-recurrent kidney stone disease" refers to newly diagnosed kidney stone disease in a subject, i.e., the subject has not been previously diagnosed with kidney stone disease.
[0205] As used herein, the term "recurrent kidney stone disease" refers to kidney stone disease that recurs in a subject who previously had kidney stone disease and whose disease was successfully treated (e.g., surgically treated to remove kidney stones) or who passed kidney stones. Recurrent kidney stone disease can recur at any time interval after a subject's treatment for kidney stone disease. In one embodiment, recurrent kidney stone disease is ≥ 2 stone events within 5 years.
[0206] "Chronic kidney disease" ("CKD") or "chronic renal failure" ("CRF"), as defined by the Kidney Foundation's Kidney Disease Outcomes Quality Initiative (KDOQI) and the international guidelines group, Kidney Disease International Guidelines Organization (KDIGO), is either kidney damage or a reduced glomerular filtration rate (GFR) of less than 60 mL / min / 1.73 m2 for at least three months.
[0207] The different stages of CKD form a continuum. CKD stages are classified as follows: Stage 1: Kidney damage with normal or increased GFR (>90 mL / min / 1.73 m 2 ), Stage 2: Mild decline in GFR (60-89 mL / min / 1.73 m 2 ), Stage 3a: Moderate decrease in GFR (45-59 mL / min / 1.73 m 2 ), Stage 3a: Moderate decrease in GFR (30-44 mL / min / 1.73 m 2 ), Stage 4: Severely decreased GFR (15-29 mL / min / 1.73 m 2 ), Stage 5: Renal failure (GFR < 15 mL / min / 1.73 m 2 or dialysis).
[0208] By itself, measuring GFR may not be sufficient to identify stage 1 and stage 2 CKD because in these patients, the GFR may actually be normal or borderline normal. In such cases, the presence of one or more of the following markers of kidney damage can establish the diagnosis: Albuminuria (albumin excretion >30 mg / 24 hours or albumin:creatinine ratio >30 mg / g [>3 mg / mmol]); abnormal urinary sediment; electrolyte and other abnormalities due to tubular damage; histologic abnormalities; structural abnormalities detected by imaging; and a history of renal transplantation in such cases.
[0209] "End-stage renal disease" is the final stage of chronic kidney disease. Patients with end-stage renal disease will require dialysis or a kidney transplant to survive. In most cases, kidney failure is caused by other health problems, such as diabetes or high blood pressure, that have permanently damaged the kidneys over time.
[0210] "Secondary hyperoxaluria" results from excessive absorption of oxalate from the diet and is further characterized as either enteric, which results from chronic and irremediable underlying GI disorders related to malabsorption, such as bariatric surgery complications or Crohn's disease, predisposing patients to excessive oxalate absorption, or idiopathic, meaning the underlying cause is unknown. Enteric hyperoxaluria is a more severe form of secondary hyperoxaluria. Secondary hyperoxaluria can also result from conditions underlying increased intestinal oxalate absorption, such as alterations in intestinal oxalate-degrading microorganisms and genetic mutations in intestinal oxalate transporters. Furthermore, hyperoxaluria can also occur after kidney transplantation due to the rapid clearance of accumulated oxalate.
[0211] In some embodiments, the non-primary hyperoxaluric disease or disorder is enteric hyperoxaluria, which is the formation of calcium oxalate stones in the urinary tract due to excessive absorption of oxalate from the colon, resulting from intestinal bacterial overload syndrome, fat malabsorption, chronic biliary or pancreatic disease, various intestinal surgical procedures, gastric bypass surgery, inflammatory bowel disease, or any medical condition that causes chronic diarrhea, such as Crohn's disease or ulcerative colitis.
[0212] In some embodiments, the non-primary hyperoxaluric disease or disorder is dietary hyperoxaluria, hyperoxaluria resulting from excess oxalate in foods such as spinach, rhubarb, almonds, bulgur, millet, cornmeal, soybean flour, cornmeal, and white beans.
[0213] In some embodiments, the non-primary hyperoxaluric disease or disorder is dietary hyperoxaluria. Subjects with idiopathic hyperoxaluria have above-normal levels of urinary oxalate for unknown reasons and still develop stones.
[0214] In some embodiments, the non-primary hyperoxaluric disease or disorder is a calcium oxalate tissue deposition disease. For example, a glomerular filtration rate (GFR) of 1.73 m 2 When blood flow drops below approximately 30-40 mL / min, the kidney's ability to excrete calcium oxalate becomes severely impaired. At this stage, calcium oxalate begins to deposit outside of renal tissues. Calcium oxalate deposits can occur in the thyroid, breast, kidney, bone, bone marrow, myocardium, or cardiac conduction system. This can lead to cardiomyopathy, heart block, and other cardiac conduction defects, vascular disease, retinopathy, synovitis, oxalate osteopathy, and anemia that is notable for being resistant to treatment. Calcium oxalate deposition can be systemic or tissue-specific.
[0215] The subject with arthritis, sarcoidosis, end-stage renal disease is at risk of developing systemic calcium oxalate tissue deposition disease.The subject with risk of developing tissue-specific deposition in kidney includes, for example, the subject with sponge kidney, nephrocalcinosis, renal tubular acidosis (RTA), and transplant recipient, for example, kidney transplant recipient.In some embodiments, the subject with risk of developing tissue-specific deposition includes the subject with coronary artery disease or other vascular disease, especially in the patient with end-stage renal disease, HIV, and other conditions in which oxalate deposition occurs in plaque or vasculature.
[0216] In some embodiments, the non-primary hyperoxaluria disease or disorder is cutaneous oxalate deposition.Oxalate deposition in the skin can contribute to livedo reticularis, ulceration, and distal ischemia.In contrast to patients with primary hyperoxaluria, in which oxalic acidosis rarely occurs in the skin, patients with systemic oxalic acidosis in chronic renal failure are more likely to present with extravascular calcified deposits in the skin, including cutaneous and subcutaneous nodules, tender subungual nodules, and pigmented skin, usually distributed in the acral region or on the face, as yellow patches and papules.In some embodiments, the non-primary hyperoxaluria disease or disorder is cutaneous oxalate deposition in the setting of dialysis.
[0217] In some embodiments, the non-primary hyperoxaluric disease or disorder is ethylene glycol poisoning. Ethylene glycol is an important cause of metabolic acidosis and subsequent acute renal failure, and the toxicity is due to its depressant effect on the central nervous system. Specifically, metabolic acidosis and renal failure are caused by the conversion of ethylene glycol to harmful metabolites. Oxidative reactions convert ethylene glycol to glycoaldehyde, which is then converted to glycolic acid, the main cause of metabolic acidosis. Both of these processes promote the production of lactate from pyruvate. The conversion of glycolic acid to glyoxylic acid proceeds slowly, further increasing serum concentrations of glycolic acid. Glyoxylic acid is ultimately converted to oxalic acid and glycine. Oxalic acid does not contribute to metabolic acidosis, but it is deposited as calcium oxalate crystals in many tissues.
[0218] As used herein, a "subject" is an animal, such as a mammal, including a primate (such as a human, a monkey, and a non-human primate, e.g., a chimpanzee), a non-primate (such as a cow, pig, camel, llama, horse, goat, rabbit, sheep, hamster, guinea pig, cat, dog, rat, mouse, and whale), or a bird (such as a duck or goose). In one embodiment, the subject is a human subject.
[0219] As used herein, the term "treating" or "treatment" refers to a beneficial or desired result, such as inhibiting oxalate accumulation and / or reducing urinary oxalate excretion levels in a subject. The term "treating" or "treatment" also includes, but is not limited to, the reduction or amelioration of one or more symptoms of a non-primary hyperoxaluric disease or disorder, such as, for example, slowing the course of the disease, reducing the severity of subsequent disease, and / or preventing further oxalate tissue deposition. "Treatment" can also mean increasing survival time compared to expected survival time in the absence of treatment.
[0220] The term "reduce" in the context of a disease marker or symptom refers to a statistically significant decrease in such levels, which can be, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more, to levels that are accepted as being within the normal range for individuals without such disorder.
[0221] As used herein, when used in relation to a disease, "prevention" or "preventing" refers to a reduction in the likelihood that a subject will develop symptoms associated with such a disease, disorder, or condition, e.g., oxalate accumulation or stone formation. For example, the likelihood of oxalate accumulation or stone formation is reduced if an individual with one or more risk factors for stone formation either does not form stones or develops stones that are less severe than a population with the same risk factors described herein but not receiving treatment. A failure to develop the disease or a reduction in the onset of symptoms associated with such a disease, disorder, or condition (e.g., by at least about 10% of the clinically acceptable magnitude for the disease or disorder), or a delay in the onset of delayed symptoms (e.g., by days, weeks, months, or years) is considered effective prevention.
[0222] A "therapeutically effective amount," as used herein, is intended to include an amount of an inhibitor that, when administered to a subject with non-primary hyperoxaluric disease, is sufficient to treat the disease (e.g., by reducing, ameliorating, or maintaining the existing disease or one or more symptoms of the disease). A "therapeutically effective amount" may vary depending on the inhibitor, the method of administration of the inhibitor, the disease and its severity and medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other personal characteristics of the subject to be treated.
[0223] A "prophylactically effective amount," as used herein, is intended to include an amount of an inhibitor that, when administered to a subject with non-primary hyperoxaluric disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Amelioration of the disease includes slowing the course of the disease or reducing the severity of subsequent disease. A "prophylactically effective amount" can vary depending on the inhibitor, the method of administration of the inhibitor, the degree of risk of the disease, and the medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment, if any, and other personal characteristics of the patient to be treated.
[0224] A "therapeutically effective amount" or "prophylactically effective amount" also encompasses that amount of an inhibitor that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The inhibitors used in the methods of the invention can be administered in amounts sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.
[0225] In the method of the present invention, comprising administering to a subject a pharmaceutical composition comprising a first dsRNA agent that targets LDHA and a second dsRNA agent that targets HAO1, the therapeutically effective amount of the first dsRNA agent can be the same as or different from the therapeutically effective amount of the second dsRNA agent.Similarly, in the method of the present invention, comprising administering to a subject a pharmaceutical composition comprising a first dsRNA agent that targets LDHA and a second dsRNA agent that targets HAO1, the prophylactically effective amount of the first dsRNA agent can be the same as or different from the prophylactically effective amount of the second dsRNA agent.
[0226] Furthermore, in methods of the present invention comprising administering to a subject a pharmaceutical composition comprising a first single-stranded antisense polynucleotide agent targeting LDHA and a second single-stranded antisense polynucleotide agent targeting HAO1, the therapeutically effective amount of the first single-stranded antisense polynucleotide agent may be the same as or different from the therapeutically effective amount of the second single-stranded antisense polynucleotide agent. Similarly, in methods of the present invention comprising administering to a subject a pharmaceutical composition comprising a first single-stranded antisense polynucleotide agent targeting LDHA and a second single-stranded antisense polynucleotide agent targeting HAO1, the prophylactically effective amount of the first single-stranded antisense polynucleotide agent may be the same as or different from the prophylactically effective amount of the second single-stranded antisense polynucleotide agent.
[0227] As used herein, the term "nucleic acid inhibitor" includes iRNA agents and antisense polynucleotide agents.
[0228] As used herein interchangeably, the terms "iRNA", "RNAi agent", "iRNA agent", "RNA interference agent" refer to the agent that contains the RNA as defined herein and mediates the targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway.RNA interference (RNAi) is the process that controls the sequence-specific degradation of mRNA.RNAi regulates, for example, inhibits, the expression of LDHA, PRODH2 and / or HAO1 in cells, such as cells in a subject, for example, a subject suffering from non-primary hyperoxaluria disease or disorder.
[0229] In one embodiment, the RNAi agent of the present disclosure comprises a single-stranded RNAi that interacts with a target RNA sequence, e.g., an LDHA, PRODH2, and / or HAO1 target mRNA sequence, to mediate cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNAs introduced into cells are degraded into double-stranded small interfering RNAs (siRNAs) comprising a sense strand and an antisense strand by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, an RNase III-like enzyme, processes these dsRNAs into 19-23 base pair small interfering RNAs with characteristic two-base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). These siRNAs are then incorporated into the RNA-induced silencing complex (RISC), where one or more helicases unwind the siRNA duplex, thereby allowing target recognition to be induced by the complementary antisense strand (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target, inducing silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect, the present disclosure relates to single-stranded RNA (ssRNA) (the antisense strand of the siRNA duplex) that is produced in cells and promotes the formation of a RISC complex to silence target genes, i.e., LDHA, PRODH2 and / or HAO1 genes. Therefore, the term "siRNA" is used herein to also refer to the RNAi described above.
[0230] In another embodiment, the RNAi agent can be a single-stranded RNA introduced into a cell or organism to inhibit target mRNA. The single-stranded RNAi agent binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15-30 nucleotides and chemically modified. The design and testing of single-stranded RNAs are described in U.S. Patent No. 8,101,348 and Lima et al., (2012) Cell 150:883-894, the entire contents of each of which are incorporated herein by reference. Any of the antisense nucleotide sequences described herein can be used as the single-stranded siRNA described herein or as the single-stranded siRNA that is chemically modified by the method described in Lima et al., (2012) Cell 150:883-894.
[0231] In another embodiment, the "RNAi agent" used in the compositions and methods of the present disclosure is double-stranded RNA, and is herein referred to as "double-stranded RNAi agent," "double-stranded RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules with a duplex structure, comprising two antiparallel, substantially complementary nucleic acid strands, which are referred to as having "sense" or "antisense" orientation with respect to target RNA, i.e., LDHA, PRODH2 and / or HAO1 gene. In some embodiments of the present disclosure, double-stranded RNA (dsRNA) induces the degradation of target RNA, for example, mRNA, through a post-transcriptional gene silencing mechanism, herein referred to as RNA interference or RNAi.
[0232] In yet another embodiment, the "iRNA" for use in the compositions and methods of the present invention is a "dual-targeting RNAi agent." The term "dual-targeting RNAi agent" refers to a molecule comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, and comprising a first dsRNA agent, designated as having a "sense" and "antisense" orientation relative to a first target RNA, i.e., the LDHA gene, which is covalently linked to a molecule comprising a complex of ribonucleic acid molecules, having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, and comprising a second dsRNA agent, designated as having a "sense" and "antisense" orientation relative to a second target RNA, i.e., the HAO1 gene. In some embodiments of the present invention, the dual-targeting RNAi agent induces the degradation of the first and second target RNAs, e.g., mRNAs, via a post-transcriptional gene silencing mechanism, herein referred to as RNA interference or RNAi.
[0233] The terms "polynucleotide agent," "antisense polynucleotide agent," "antisense compound," and "agent," as used interchangeably herein, refer to agents containing RNA as defined herein and comprising single-stranded oligonucleotides that target nucleic acid molecules encoding LDHA, PRODH2, and / or HAO1 (e.g., mRNA encoding LDHA, PRODH2, and / or HAO1). Antisense polynucleotide agents specifically bind to target nucleic acid molecules via hydrogen bonds (e.g., Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonds) and interfere with the normal function of the target nucleic acid (e.g., via an antisense mechanism of action). Interference or regulation of the function of a target nucleic acid by a polynucleotide agent of the present invention is referred to as "antisense inhibition." The function of a target nucleic acid molecule that is interfered with can include, for example, translocation of RNA to a protein translation site, translation of protein from RNA, splicing of RNA to produce one or more mRNA species, and catalytic activities that may be involved in or promoted by RNA.
[0234] As used herein, "target sequence" means a contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the LDHA gene, PRODH2 gene, or HAO1 gene, including, for example, mRNA that is the product of RNA processing of a primary transcript.
[0235] In one embodiment, the target portion of the sequence will be at least sufficiently long to serve as a substrate for iRNA-dependent cleavage at or near a portion of the nucleotide sequence of an mRNA molecule formed during transcription of the LDHA gene. In another embodiment, the target portion of the sequence will be at least sufficiently long to serve as a substrate for iRNA-dependent cleavage at or near a portion of the nucleotide sequence of an mRNA molecule formed during transcription of the PRODH2 gene. In another embodiment, the target portion of the sequence will be at least sufficiently long to serve as a substrate for iRNA-dependent cleavage at or near a portion of the nucleotide sequence of an mRNA molecule formed during transcription of the HAO1 gene.
[0236] The target sequence of the LDHA gene, PRODH2 gene, or HAO1 gene may be about 19-36 nucleotides in length, such as about 19-30 nucleotides in length. For example, the target sequence may be about 19-30, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. In certain embodiments, the target sequence is 19 to 23 nucleotides in length, optionally 21 to 23 nucleotides in length. Ranges and lengths between the ranges and lengths listed above are also intended to be part of this disclosure.
[0237] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently linked (i.e., a dual-targeting RNAi agent), the length of the LDHA target sequence can be the same as or different from the length of the HAO1 target sequence.
[0238] The target sequence may be about 4 to 50 nucleotides in length, e.g., 8 to 45, 10 to 45, 10 to 40, 10 to 35, 10 to 30, 10 to 20, 11 to 45, 11 to 40, 11 to 35, 11 to 30, 11 to 20, 12 to 45, 12 to 50 ... 40, 12-35, 12-30, 12-25, 12-20, 13-45, 13-40, 13-35, 13-30, 13-25, 13-20, 14-45, 14-40, 14-35, 14-30, 14-25, 14-20, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 16-45, 16-40 , 16~35, 16~30, 16~25, 16~20, 17~45, 17~40, 17~35, 17~30, 17~25, 17~20, 18~45, 18~40, 18~35, 18~30, 18~25, 18~20, 19~45, 19~40, 19~35, 19~30, 19~25, 19~20, eg, 4, 5, 6, 7, 8, It may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides. Ranges and lengths that fall between the ranges and lengths listed above are also intended to be part of the invention.
[0239] The terms "complementary," "fully complementary," and "substantially complementary" are used herein in reference to base matches between a nucleic acid inhibitor and a target sequence. The term "complementarity" refers to the ability for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
[0240] As used herein, a nucleic acid inhibitor that is "substantially complementary to at least a portion of" a messenger RNA (mRNA) refers to a nucleic acid inhibitor that is substantially complementary to a contiguous portion of an mRNA of interest (e.g., an mRNA encoding LDHA, an mRNA encoding PRODH2, and / or an mRNA encoding HAO1). For example, a polynucleotide is complementary to at least a portion of an HAO1 mRNA if the sequence is substantially complementary to an uninterrupted portion of the mRNA encoding HAO1.
[0241] As used herein, the term " complementary region " refers to the region of nucleic acid inhibitor that is substantially complementary to the sequence defined herein, for example, target sequence, for example, LDHA nucleotide sequence, PRODH2 nucleotide sequence, and / or HAO1 nucleotide sequence.If complementary region is not completely complementary to target sequence, its mismatch can be in the internal region or terminal region of molecule.In general, the most tolerable mismatch is in the terminal region, for example, within 5, 4, 3, or 2 nucleotides of the 5'-end or 3'-end of polynucleotide.
[0242] As used herein, unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in the context of a second nucleotide sequence, refers to the ability of a polynucleotide comprising the first nucleotide sequence to hybridize to form a duplex structure under specified conditions with the second nucleotide sequence, as would be understood by one of skill in the art. Such conditions can be, for example, stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50°C or 70°C for 12-16 hours followed by a wash (see, e.g., "Molecular Cloning: A Laboratory Manual," Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions that may be encountered in an organism, can be applied. Those skilled in the art can determine the most appropriate set of conditions for testing the complementarity of two sequences depending on the ultimate use of the nucleotides.
[0243] Complementary sequences include the nucleotide sequences of the nucleic acid inhibitors of the present invention that base pair with the second nucleotide sequence over the entire length of one or both nucleotide sequences.Such sequences can be referred to herein as "fully complementary" to each other.However, when the first sequence is referred to herein as "substantially complementary" to the second sequence, these two sequences can be completely complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs when hybridizing up to 30 base pairs of double strands, while maintaining the ability to hybridize under the conditions most relevant to its final use, for example, inhibiting target gene expression.
[0244] "Complementary" sequences, as used herein, may also include or be formed entirely of non-Watson-Crick base pairs and / or base pairs formed from unnatural and modified nucleotides, so long as they meet the above requirements regarding their ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble base pairs or Hoogsteen base pairs. As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a strand of nucleotides described by a sequence referenced using standard nucleotide nomenclature.
[0245] Each "G", "C", "A", "T" and "U" generally represent nucleotides containing guanine, cytosine, adenine, thymidine and uracil as bases, respectively. However, it should be understood that the term "deoxyribonucleotide" or "ribonucleotide" or "nucleotide" can also refer to modified nucleotides or alternative replacement moieties, as described in more detail below (see Table 1). Those skilled in the art are well aware that guanine, cytosine, adenine and uracil can be substituted with other moieties without substantially changing the base pairing properties of oligonucleotides containing nucleotides with such replacement moieties. For example, but not limited to, a nucleotide containing inosine as its base can base pair with a nucleotide containing adenine, cytosine or uracil. Thus, a nucleotide containing uracil, guanine or adenine can be substituted with a nucleotide containing inosine, for example, in the nucleotide sequence of the agent featured in the present invention. In another example, adenine and cytosine anywhere within an oligonucleotide can be substituted with guanine and uracil, respectively, to form a GU wobble base that pairs with the target mRNA. Sequences containing such substitutions are suitable for the compositions and methods featured herein.
[0246] A "nucleoside" is a base-sugar combination. The "nucleobase" (also known as the "base") portion of a nucleoside is typically a heterocyclic base moiety. A "nucleotide" is a nucleoside that further includes a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. A "polynucleotide," also called an "oligonucleotide," is formed through the covalent linkage of adjacent nucleosides to one another to form a linear polymeric oligonucleotide. Within the polynucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the polynucleotide.
[0247] Generally, the majority of the nucleotides in a nucleic acid inhibitor are ribonucleotides, but as described in detail herein, the inhibitor may also contain one or more non-ribonucleotides, e.g., deoxyribonucleotides. Furthermore, as used herein, "nucleic acid inhibitor" may include nucleotides (e.g., ribonucleotides or deoxyribonucleotides) having chemical modifications, and the nucleic acid inhibitor may contain substantial modifications in multiple nucleotides.
[0248] As used herein, the term "modified nucleotide" refers to a nucleotide that independently has a modified sugar moiety, a modified internucleotide bond, and / or a modified nucleobase.Thus, the term modified nucleotide encompasses the substitution, addition, or removal of, for example, functional groups or atoms, to the internucleoside bond, sugar moiety, or nucleobase.The modifications suitable for use in the nucleic acid inhibitor of the present invention include all types of modifications disclosed herein or known in the art.All of these modifications, when used in nucleotides, are encompassed by "nucleic acid inhibitor" for the purposes of this specification and claims.
[0249] The term "LDHA" (interchangeably used herein with the term "Ldha") is also known as cell proliferation-inducing gene 19 protein, renal cancer antigen NY-REN-59, LDH muscle subunit, EC 1.1.1.27 4 61, LDH-A, LDH-M, epididymal secretory sperm-binding protein Li 133P, L-lactate dehydroginase A chain, proliferation-inducing gene 19, lactate dehydroginase M, HEL-S-133P, EC 1.1.1, GSD11, PIG19, and LDHM, and refers to the well-known gene encoding lactate dehydroginase A from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, pig, sheep, primate, monkey, or guinea pig, unless otherwise specified.
[0250] The term also refers to fragments and variants of native LDHA that maintain at least one in vivo or in vitro activity of native LDHA. The term encompasses the full-length unprocessed precursor form of LDHA, as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing.
[0251] The sequence of the human LDHA mRNA transcript is found, for example, in GenBank Accession No. GI:207028493 (NM_001135239.1; SEQ ID NO:1), GenBank Accession No. GI:260099722 (NM_001165414.1; SEQ ID NO:3), GenBank Accession No. GI:260099724 (NM_001165415.1; SEQ ID NO:5), GenBank Accession No. GI:260099726 (NM_001165416.1; SEQ ID NO:7), and GenBank Accession No. GI:207028465 (NM_005566.3; SEQ ID NO:9). The sequence of the mRNA transcript can be found, for example, in GenBank accession number GI:257743038 (NM_001136069.2; SEQ ID NO:11), GenBank accession number GI:257743036 (NM_010699.2; SEQ ID NO:13), the sequence of the rat LDHA mRNA transcript can be found, for example, in GenBank accession number GI:8393705 (NM_017025.1; SEQ ID NO:15), and the sequence of the monkey LDHA mRNA transcript can be found, for example, in GenBank accession number GI:402766306 (NM_001257735.2; SEQ ID NO:17), GenBank accession number GI:545687102 (NM_001283551.1, SEQ ID NO:19).
[0252] Further examples of LDHA mRNA sequences are readily available using public databases such as GenBank, UniProt, and OMIM.
[0253] As used herein, the term "LDHA" also refers to a specific polypeptide expressed in cells due to naturally occurring DNA sequence variations of the LDHA gene, such as single nucleotide polymorphisms in the LDHA gene. Many SNPs within the LDHA gene have been identified and can be found, for example, in NCBI dbSNP (see, for example, www.ncbi.nlm.nih.gov / snp).
[0254] As used herein, the term "HAO1," unless otherwise specified, refers to the well-known gene encoding the enzyme hydroxyacid oxidase 1 from any vertebrate or mammalian source, including, but not limited to, human, bovine, chicken, rodent, mouse, rat, pig, sheep, primate, monkey, and guinea pig. Other gene names include GO, GOX, GOX1, HAO, and HAOX1. The protein is also known as glycolate oxidase and (S)-2-hydroxy-acid oxidase.
[0255] The term also refers to fragments and variants of native HAO1 that maintain at least one in vivo or in vitro activity of native HAO1. The term encompasses the full-length unprocessed precursor form of HAO1, as well as mature forms resulting from post-translational cleavage of the signal peptide and forms resulting from proteolytic processing. The sequence of the human HAO1 mRNA transcript can be found, for example, in GenBank accession number GI:11184232 (NM_017545.2, SEQ ID NO:21), the sequence of the monkey HAO1 mRNA transcript can be found, for example, in GenBank accession number GI:544464345 (XM_005568381.1, SEQ ID NO:23), the sequence of the mouse HAO1 mRNA transcript can be found, for example, in GenBank accession number GI:133893166 (NM_010403.2, SEQ ID NO:25), and the sequence of the rat HAO1 mRNA transcript can be found, for example, in GenBank accession number GI:166157785 (NM_001107780.2, SEQ ID NO:27).
[0256] As used herein, the term "HAO1" also refers to naturally occurring DNA sequence variations of the HAO1 gene, such as single nucleotide polymorphisms (SNPs) in the HAO1 gene. Exemplary SNPs include: www.ncbi.nlm.nih.gov / projects / SNP These sequences are found in the NCBI dbSNP Short Genetic Variations database available at:
[0257] As used herein, "proline dehydrogenase 2," used interchangeably with the term "PRODH2," refers to the enzyme that catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through dietary intake and collagen turnover. Glyoxylate is one of the downstream products of hydroxyproline catabolism, which can lead to elevated oxalate levels and calcium oxalate kidney stone formation in people with disorders of glyoxalate metabolism. PRODH2 is also known as proline dehydrogenase, HYPDH, HSPOX1, and hydroxyproline dehydrogenase.
[0258] The sequence of human PRODH2 mRNA transcript can be found, for example, in GenBank accession number GI:1818882103 (NM_021232.2, SEQ ID NO:4641, reverse complement, SEQ ID NO:4642). The sequence of mouse PRODH2 mRNA can be found, for example, in GenBank accession number GI:142372879 (NM_019546.5, SEQ ID NO:4643, reverse complement, SEQ ID NO:4644). The sequence of rat PRODH2 mRNA can be found, for example, in GenBank accession number GI:198278487 (NM_001038588.1, SEQ ID NO:4645, reverse complement, SEQ ID NO:4646). The sequence of cynomolgus monkey PRODH2 mRNA can be found, for example, in GenBank Accession No. GI:982316449 (XM_005588902.2, SEQ ID NO:4647, reverse complement, SEQ ID NO:4648). The sequence of rhesus monkey PRODH2 mRNA can be found, for example, in GenBank Accession No. GI:1622893613 (XM_015123711.2, SEQ ID NO:4649, reverse complement, SEQ ID NO:4650).
[0259] Further examples of PRODH2 mRNA sequences are readily available through public databases such as GenBank, UniProt, OMIM, and the Macaca Genome Project website.
[0260] Further information regarding PRODH2 can be found, for example, at www.ncbi.nlm.nih.gov / gene / ?term=PRODH2.
[0261] The entire contents of each of the foregoing GenBank Accession Numbers and Gene Database Numbers are incorporated herein by reference as of the filing date of this application.
[0262] The term PRODH2 as used herein also refers to variations of the PRODH2 gene, including variants provided in SNP databases. Numerous sequence variations within the PRODH2 gene have been identified and can be found, for example, in NCBI dbSNP and UniProt (see, for example, www.ncbi.nlm.nih.gov / snp / ?term=PRODH2, the entire contents of which are incorporated herein by reference as of the filing date of this application).
[0263] II. The Methods of the Invention The present invention provides methods for inhibiting the expression of hydroxyacid oxidase (HAO1) in a subject, e.g., a human subject, with a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate. The present invention also provides methods for reducing urinary oxalate levels, e.g., urinary calcium oxalate, e.g., urinary calcium oxalate supersaturation in a subject, e.g., a human subject, with a non-primary hyperoxaluric disease or disorder that would benefit from reduced urinary oxalate. Furthermore, the present invention provides methods for treating a subject, e.g., a human subject with a non-primary hyperoxaluric disease or disorder that would benefit from reduced oxalate. The method includes administering to the subject, e.g., by subcutaneous administration, e.g., by subcutaneous injection, a fixed dose of about 200 mg to about 600 mg, e.g., about 284 mg or about 567 mg, of a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof that inhibits expression of HAO1, thereby inhibiting expression of HAO1 in the subject.
[0264] In another aspect, the present invention also provides a method for treating a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of hydroxyacid oxidase (HAO1) and / or a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), thereby treating the subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction.
[0265] Furthermore, the present invention also provides a method for treating a subject at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction, comprising administering to the subject a therapeutically effective amount of a nucleic acid inhibitor of lactate dehydroginase (LDHA), a nucleic acid inhibitor of hydroxyacid oxidase (HAO1), and / or a nucleic acid inhibitor of proline dehydrogenase 2 (PRODH2), thereby treating the subject at risk of developing a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction.
[0266] Subjects with non-primary hyperoxaluric diseases or disorders who would benefit from reduced oxalate include those with elevated oxalate levels, e.g., mild hyperoxaluric conditions, i.e., urinary calcium oxalate excretion levels of about 40 to about 60 mg / day, or severe hyperoxaluric conditions, i.e., urinary calcium oxalate excretion levels greater than about 60 mg / day. In one embodiment, subjects with severe hyperoxaluric conditions have supersaturated levels of calcium oxalate, e.g., calcium oxalate (i.e., urinary concentrations exceed the solubility of oxalate, which drives crystallization and kidney stone formation). In other embodiments, subjects with severe hyperoxaluric conditions do not have supersaturated levels of calcium oxalate, e.g., calcium oxalate. In some embodiments, subjects at risk of developing a non-primary hyperoxaluric disease or disorder have normal levels of urinary oxalate excretion, i.e., urinary oxalate excretion levels of <40 mg / day, and would still benefit from oxalate reduction.
[0267] Such subjects include those suffering from secondary hyperoxaluria, such as enteric hyperoxaluria, dietary hyperoxaluria, or idiopathic hyperoxaluria, kidney stone disease, chronic kidney disease (CKD), end-stage renal disease (ESRD), coronary artery disease, cutaneous oxalate deposition, or ethylene glycol poisoning. Such subjects also include those who are planning to receive or have received a kidney transplant.
[0268] In the methods of the present invention, a subject having a non-primary hyperoxaluric disease or disorder that would benefit from oxalate reduction does not have primary hyperoxaluria (PH), ie, PH1, PH2, or PH3.
[0269] In some embodiments, the non-primary hyperoxaluric disease or disorder is kidney stone disease, eg, calcium oxalate kidney stone disease, eg, recurrent calcium oxalate kidney stone disease.
[0270] Administration of the dsRNA agent or salt thereof to the subject can be repeated periodically, for example, at intervals of once every three months or once every six months.
[0271] In one embodiment, the dsRNA agent or salt thereof is administered to the subject at intervals of once every six months.
[0272] In other embodiments, the dsRNA agent or salt thereof is administered to the subject first every three months and then every six months thereafter.
[0273] Administration of dsRNA or a salt thereof to a subject can reduce urinary oxalate levels, such as urinary calcium oxalate, urinary calcium oxalate supersaturation, for example, by about 20% from baseline, as assessed by, for example, a 24-hour urinary oxalate analysis, and / or reduce clinical and radiological kidney stone events.
[0274] When the subject to be treated is a mammal, for example, a human, nucleic acid inhibitor can be administered by any means known in the art, including but not limited to, parenteral routes, including oral, intraperitoneal, or intracranial (for example, intracerebroventricular, intraparenchymal and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal and topical (including buccal and sublingual) administration.In certain embodiments, the composition is administered by intravenous infusion or injection.In certain embodiments, the composition is administered by subcutaneous injection.
[0275] In some embodiments, administration is by depot injection. Depot injection can release nucleic acid inhibitor consistently over a sustained period of time. Therefore, depot injection can reduce the number of doses required to achieve the desired effect, for example, the desired inhibition of LDHA or HAO1 or PRODH2, or both LDHA and HAO1, or a therapeutic or prophylactic effect. Depot injection can also provide a more consistent serum concentration. Depot injection can include subcutaneous injection or intramuscular injection. In certain embodiments, the depot injection is a subcutaneous injection.
[0276] In some embodiments, administration is via a pump. The pump can be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. Infusion pumps can be used for intravenous, subcutaneous, arterial, or epidural infusion. In certain embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the nucleic acid inhibitor to the liver.
[0277] The nucleic acid inhibitor of the present invention, for example, dsRNA agent or its salt, can be present in pharmaceutical composition, such as in a suitable buffer solution.The buffer solution can contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof.In one embodiment, the buffer solution is phosphate buffered saline (PBS).The pH and osmolality of the buffer solution containing iRNA can be adjusted to be suitable for administration to a subject.
[0278] Alternatively, the nucleic acid inhibitors of the present invention can be administered as pharmaceutical compositions, for example, as dsRNA liposome formulations.
[0279] The mode of administration can be selected depending on whether local or systemic treatment is desired and based on the area to be treated. The route and site of administration can be selected to enhance targeting.
[0280] The methods (and uses) of the invention include administering to a subject, such as a human, a therapeutically effective amount of a nucleic acid inhibitor, e.g., a dsRNA agent, a dual-targeting iRNA agent, a single-stranded antisense polynucleotide agent, or a pharmaceutical composition comprising a nucleic acid inhibitor such as a dsRNA, a pharmaceutical composition comprising a dual-targeting RNAi agent, a pharmaceutical composition of the invention comprising a first dsRNA agent that inhibits expression of LDHA and a second dsRNA agent that inhibits expression of HAO1, or a pharmaceutical composition of the invention comprising a single-stranded antisense polynucleotide agent.
[0281] Subjects who would benefit from the methods of the present invention include those who have or are at risk of developing non-primary hyperoxaluric disease.
[0282] In the methods (and uses) of the invention that involve administering to a subject a first nucleic acid inhibitor, such as a dsRNA agent that targets LDHA, and a second dsRNA agent that targets HAO1, the first and second nucleic acid inhibitors may be formulated in the same or different compositions and may be administered to the subject in the same or separate compositions.
[0283] The nucleic acid inhibitor may be administered to a subject at a dose of about 0.1 mg / kg to about 50 mg / kg. Typically, a suitable dose will be in the range of about 0.1 mg / kg to about 5.0 mg / kg, for example, about 0.3 mg / kg to about 3.0 mg / kg.
[0284] In the methods (and uses) of the invention that involve administering to a subject a first nucleic acid inhibitor, such as a dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1, the first and second nucleic acid inhibitors may be administered to the subject in the same volume or at different doses.
[0285] The nucleic acid inhibitors can be administered by intravenous infusion periodically over a period of time. In certain embodiments, treatment can be administered less frequently after an initial treatment regimen.
[0286] Administration of a nucleic acid inhibitor can, for example, reduce LDHA levels in a patient's cells, tissues, blood, urine, or other compartment by at least about 5%, , 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In one embodiment, administration of a nucleic acid inhibitor can reduce LDHA levels in a patient's cells, tissues, blood, urine, or other compartments by at least 20%, for example.
[0287] Administration of a nucleic acid inhibitor can, for example, reduce HAO1 levels in a patient's cells, tissues, blood, urine, or other compartment by at least about 5%, , 48, 39, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least about 99% or more. In one embodiment, administration of a nucleic acid inhibitor can reduce HAO1 levels in a patient's cells, tissues, blood, urine, or other compartments by at least 20%, for example.
[0288] Administration of a nucleic acid inhibitor can, for example, increase PRODH2 levels in a patient's cells, tissues, blood, urine, or other compartment by at least about 5%, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 120 95, 96, 97, 98, or at least about 99% or more. In one embodiment, administration of a nucleic acid inhibitor can reduce PRODH2 levels in a patient's cells, tissues, blood, urine, or other compartments by at least 20%, for example.
[0289] In the methods (and uses) of the present invention that involve administering to a subject a first nucleic acid inhibitor, e.g., a dsRNA agent targeting LDHA, and a second nucleic acid inhibitor, e.g., a dsRNA agent targeting HAO1, the level of inhibition of LDHA may be the same as or different from the level of inhibition of HAO1.
[0290] In methods (and uses) of the invention that involve administering a dual-targeting RNAi agent to a subject, the dual-targeting RNAi agent may inhibit expression of the LDHA gene and the HAO1 gene to a level substantially the same as the level of inhibition of expression obtained by contacting a cell with both dsRNA agents individually, or the dual-targeting RNAi agent may inhibit expression of the LDHA gene and the HAO1 gene to a level greater than the level of inhibition of expression obtained by contacting a cell with both dsRNA agents individually.
[0291] Prior to administration of the full dose of the nucleic acid inhibitor, the patient may be administered a smaller dose, e.g., a 5% infusion reaction, and monitored for adverse effects, e.g., allergic reactions. In another example, the patient may be monitored for undesirable immune stimulatory effects, e.g., elevated cytokine (e.g., TNF-alpha or INF-alpha) levels.
[0292] Alternatively, the nucleic acid inhibitor can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections may be used to deliver a desired dose of the nucleic acid inhibitor to a subject. The injections may be repeated over a period of time. The administration may be repeated periodically. In certain embodiments, after an initial treatment regimen, treatment may be administered less frequently. Repeated administration regimens may include regular administration of a therapeutic amount of the nucleic acid inhibitor every other day, every month, once a year, for example, once a month to once a year. In certain embodiments, the nucleic acid inhibitor is administered about once a month to about once a quarter (i.e., about once every three months).
[0293] In one embodiment, the method includes administering a composition featured herein such that expression of the target LDHA gene, target PRODH2 gene, and / or target HAO1 gene is reduced for a period of about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32, or about 36 hours, etc. In one embodiment, expression of the target LDHA gene, target PRODH2 gene, and / or HAO1 gene is reduced for an extended period of time, e.g., at least about two, three, four days or more, e.g., about one week, two weeks, three weeks, or four weeks or more.
[0294] In some embodiments, nucleic acid inhibitors useful for the methods and compositions featured herein specifically target the RNA (primary or processed) of the target LDHA, PRODH2, and / or HAO1 genes. Compositions and methods for inhibiting expression of these genes using iRNAs can be prepared and performed as described herein.
[0295] Administration of nucleic acid inhibitors according to the methods of the present invention can result in a reduction in the severity, signs, symptoms, and / or markers of kidney stone disease in patients with such diseases or disorders. "Reduction" in this context means a statistically significant decrease in such levels. The reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
[0296] The effectiveness of treating or preventing kidney stone disease can be assessed, for example, by measuring disease progression, disease remission, symptom severity, pain reduction, quality of life, the dose of medication required to sustain the treatment effect, the level of a disease marker, or any other measurable parameter appropriate to the given disease being treated or targeted for prevention. It is well within the capabilities of one skilled in the art to monitor the effectiveness of treatment or prevention by measuring any one or any combination of such parameters. Comparing later readings with earlier readings provides the physician with an indication of whether the treatment is effective. It is well within the capabilities of one skilled in the art to monitor the effectiveness of treatment or prevention by measuring any one or any combination of such parameters. In the context of administering a nucleic acid inhibitor or pharmaceutical composition thereof, "effective against" indicates that administration in a clinically relevant manner results in a beneficial effect for at least a statistically significant proportion of patients, such as symptom improvement, cure, disease reduction, prolonged lifespan, improved quality of life, or other effect typically recognized as positive by physicians familiar with the treatment of kidney stone disease and related causes.
[0297] A therapeutic or prophylactic effect is evident when there is a statistically significant improvement in one or more parameters of the disease state, or when there is no worsening or otherwise expected symptoms. For example, a favorable change in a measurable parameter of the disease of at least 10%, e.g., at least 20%, 30%, 40%, 50% or more, can be indicative of effective treatment. The efficacy of a given nucleic acid inhibitor, or formulation of that nucleic acid inhibitor, can also be determined using experimental animal models of a given disease known in the art, such as alanine-glyoxylate aminotransferase deficient (Agxt knockout) mice (see, e.g., Salido, et al. (2006) Proc Natl Acad Sci USA 103:18249) and / or glyoxylate reductase / hydroxypyruvate reductase deficient (Grhprn knockout) mice (see, e.g., Knight, et al. (2011) Am J Physiol Renal Physiol 302:F688).
[0298] The present invention further provides methods for the use of the nucleic acid inhibitors of the present invention or pharmaceutical compositions thereof in combination with other medicaments and / or other treatment methods, e.g., known medicaments and / or known treatment methods, e.g., those currently used to treat these disorders, for example, to treat subjects having or at risk of developing non-primary hyperoxaluric disorders that would benefit from oxalate reduction or inhibition. For example, in certain embodiments, the nucleic acid inhibitors or pharmaceutical compositions of the present invention are administered in combination with other medicaments and / or known ... pyridoxine; ACE inhibitors (angiotensin-converting enzyme inhibitors), e.g., benazepril (Lotensin); angiotensin II receptor antagonists (ARBs) (e.g., losartan potassium, e.g., Cozaar® from Merck & Co.), e.g., candesartan (Atacand); HMG-CoA reductase inhibitors (e.g., statins); food oxalate-degrading compounds, e.g., oxalate decarboxylase (Oxazyme); calcium iodate inhibitors (CITs), e.g., pyridoxine; sodium cellulose phosphate (Calcibind); diuretics, e.g., thiazide diuretics, e.g., hydrochlorothiazide (Microzide); phosphate binders, e.g., sevelamer (Renagel); magnesium and vitamin B6 supplements; potassium citrate, orthophosphate, bisphosphonates; oral phosphate and citrate solutions; high fluid intake, urinary endoscopy; extracorporeal shock wave lithotripsy; kidney dialysis; kidney stone removal (e.g., surgery); and kidney / liver transplantation; or administered in combination with any combination of the foregoing.
[0299] III. Nucleic Acid Inhibitors for Use in the Methods of the Invention A. Double-stranded Ribonucleic Acid Agents of the Invention In one embodiment, the nucleic acid inhibitor for use in the method of the present invention is a dsRNA agent.In one embodiment, the dsRNA agent targets LDHA gene.In one embodiment, the dsRNA agent targets PRODH2 gene.In another embodiment, the dsRNA agent targets HAO1 gene.In one embodiment, the dsRNA agent is a dual-targeting dsRNA agent that targets LDHA gene and HAO1 gene.
[0300] Suitable dsRNA agents for use in the methods of the invention are known in the art, and are described, for example, in U.S. Patent Application Publication No. 20200113927 (Alnylam Pharmaceuticals, Inc.), U.S. Patent Application Publication Nos. 2017 / 0304446 (lumasiran) (Alnylam Pharmaceuticals, Inc.), 2017 / 0306332 (Dicerna Pharmaceuticals), and 2019 / 0323014 (Dicerna Pharmaceuticals), U.S. Patent Nos. 10,478,500 (lumasiran) (Alnylam Pharmaceuticals, Inc.), and 10,351,854 (Dicerna Pharmaceuticals), and WO 2019 / 014530 (Attorney Docket No. 121301-07520) and WO 2019 / 075419 (Dicerna Pharmaceuticals). Pharmaceuticals), the entire contents of each of which are incorporated herein by reference. Any of these agents may further comprise a ligand. In one embodiment, a suitable dsRNA agent is nedosirane (formerly known as DCR-PHXC) (Dicerna Pharmaceuticals).
[0301] In certain embodiments, the nucleic acid inhibitor of the invention is a dsRNA agent that inhibits expression of the LDHA gene and is selected from the group of agents listed in any one of Tables 2-3. In other embodiments, the nucleic acid inhibitor of the invention is a dsRNA agent that inhibits expression of the HAO1 gene and is selected from the group of agents listed in any one of Tables 4-12. In other embodiments, the nucleic acid inhibitor of the invention is a dsRNA agent that inhibits expression of the PRODH2 gene and is selected from the group of agents listed in any one of Tables 15-16. In yet other embodiments, the nucleic acid inhibitor of the invention is a dual-targeting iRNA agent that inhibits expression of the LDHA gene and the HAO1 gene, wherein a first dsRNA inhibits expression of the LDHA gene and is selected from the group of agents listed in any one of Tables 2-3, and a second dsRNA inhibits expression of the HAO1 gene and is selected from the group of agents listed in any one of Tables 4-12.
[0302] The dsRNAi of the present invention targeting LDHA has a length of about 30 nucleotides or less, for example, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 1 The LDHA gene may comprise an RNA strand (antisense strand) having a region that is 9 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length, which region is substantially complementary to at least a portion of an mRNA transcript of the LDHA gene.
[0303] The dsRNAi of the present invention targeting HAO1 has a length of about 30 nucleotides or less, for example, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-26, 19-27, 19-28, 19-25, 19-26, 19-25, 19-28, 19-29, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-26, 19-26, 19 The RNA strand may comprise an RNA strand (antisense strand) having a region that is 9 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length, which region is substantially complementary to at least a portion of an mRNA transcript of the HAO1 gene.
[0304] The dsRNAi of the present invention targeting PRODH2 has a length of about 30 nucleotides or less, for example, 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-26, 19-27, 19-28, 19-25, 19-26, 19-25, 19-26, 19-27, 19-28, 19-29, 19-26, 19-25, 19-26 ...6, 19 The RNA strand may comprise an RNA strand (antisense strand) having a region that is 9 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 30, 20 to 29, 20 to 28, 20 to 27, 20 to 26, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 30, 21 to 29, 21 to 28, 21 to 27, 21 to 26, 21 to 25, 21 to 24, 21 to 23, or 21 to 22 nucleotides in length, which region is substantially complementary to at least a portion of an mRNA transcript of the PRODH2 gene.
[0305] As described herein, when a dsRNA agent is a dual-targeting agent, the agent targeting LDHA can include an antisense strand that includes a region of complementarity to LDHA that is the same length as or a different length from the region of complementarity of the antisense strand of the agent targeting HAO1.
[0306] In some embodiments, one or both strands of a double-stranded RNAi agent of the invention are up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, or 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a portion of an mRNA transcript of the LDHA gene. In some embodiments, such dsRNA agents with longer antisense strands can include a second RNA strand (sense strand) 20-60 nucleotides in length, where the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
[0307] In other embodiments, one or both strands of a double-stranded RNAi agent of the invention are up to 66 nucleotides in length, e.g., 36-66, 26-36, 25-36, 31-60, 22-43, 27-53 nucleotides in length, with a region of at least 19 contiguous nucleotides that is substantially complementary to at least a portion of an mRNA transcript of the HAO1 gene. In some embodiments, such dsRNA agents with longer antisense strands can include a second RNA strand (sense strand) that is 20-60 nucleotides in length, where the sense and antisense strands form a duplex of 18-30 contiguous nucleotides.
[0308] In embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently linked, the duplex lengths of the first and second agents can be the same or different.
[0309] The use of these dsRNA agents described herein allows for the targeted degradation of LDHA, PRODH2 and / or HAO1 gene mRNA in mammals.
[0310] The dsRNA comprises an antisense strand with a complementary region that is complementary to at least a portion of the mRNA formed during the expression of LDHA gene or HAO1 gene or PRODH2 gene.The complementary region is about 30 nucleotides or less in length (for example, about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19 or 18 nucleotides in length).When the iRNA contacts with the cell that expresses the target gene, it inhibits the expression of the target gene (for example, human, primate, non-primate or avian target gene) by at least about 10%, as determined by, for example, PCR or branched DNA (bDNA)-based method, or by protein-based method, such as immunofluorescence, for example, by Western blotting or flow cytometry.
[0311] dsRNA comprises two RNA strands, which are complementary and hybridize to form a duplex structure under the conditions in which dsRNA is used. One strand of dsRNA (antisense strand) comprises a complementary region that is substantially complementary to the target sequence, and is generally completely complementary. The target sequence can be obtained from the sequence of mRNA formed during the expression of the LDHA gene, HAO1 gene, or PRODH2 gene. The other strand (sense strand) comprises a region that is complementary to the antisense strand, so that the two strands hybridize to form a duplex structure when combined under suitable conditions. As described elsewhere herein and known in the art, the complementary sequences of dsRNA can also be contained as self-complementary regions of a single nucleic acid molecule, so that they are opposite each other on separate oligonucleotides.
[0312] Generally, the duplex structure is 15-30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 19-31, 19-32, 19-33, 19-34, 19-35, 19-36, 19-37, 19-38, 19-39, 19-40, 19-41, 19-42, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-49, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-59, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65, 19-6 21-23, 21-22, 21-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. Ranges and lengths that lie between the ranges and lengths listed above are also intended to be part of the invention.
[0313] Similarly, the region of complementarity to the target sequence may be 15 to 30 nucleotides in length, e.g., 15 to 29, 15 to 28, 15 to 27, 15 to 26, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 15 to 20, 15 to 19, 15 to 18, 15 to 17, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 30, 19 to 31, 19 to 32, 19 to 33, 19 to 34, 19 to 35, 19 to 36, 19 to 37, 19 to 38, 19 to 40, 19 to 41, 19 to 42, 19 to 43, 19 to 44, 19 to 45, 19 to 46, 19 to 47, 19 to 48, 19 to 50, 19 to 51, 19 to 52, 19 to 53, 19 to 54, 19 to 55, 19 to 56, 19 to 57, 19 to 58, 19 to 59, 19 to 60, 19 to 61, 19 to 62, 19 to 63, 19 to 64, 19 to 65, 19 to 66, 19 to 67, 21-23, or 21-22 nucleotides in length. Ranges and lengths between the above-listed ranges and lengths are also intended to be part of the invention.
[0314] In some embodiments, the dsRNA is about 15 to about 23 nucleotides in length, or about 25 to about 30 nucleotides in length. Generally, the dsRNA is long enough to serve as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNA longer than about 21 to 23 nucleotides can function as a substrate for Dicer. As those skilled in the art will recognize, the region of RNA targeted for cleavage will most often be a portion of a longer RNA molecule, often an mRNA molecule. In relevant cases, a "portion" of an mRNA target is a contiguous sequence of the mRNA target long enough to allow it to serve as a substrate for RNAi-dependent cleavage (i.e., cleavage via the RISC pathway).
[0315] Those skilled in the art will appreciate that the double-stranded region is the primary functional portion of the dsRNA, and may be, for example, about 9 to about 36 base pairs, e.g., about 10 to 36, 11 to 36, 12 to 36, 13 to 36, 14 to 36, 15 to 36, 9 to 35, 10 to 35, 11 to 35, 12 to 35, 13 to 35, 14 to 35, 15 to 35, 9 to 34, 10 to 34, 11 to 34, 12 to 34, 13 to 34, 14 to 34 , 15-34, 9-33, 10-33, 11-33, 12-33, 13-33, 14-33, 15-33, 9-32, 10-32, 11-32, 12-32, 13-32, 14-32, 15-32, 9-31, 10-31, 11-31, 12-31, 13-32, 14-31, 15-31, 15-30, 15-29, 15-28, 15-27, 15-26, 15 ~25, 15~24, 15~23, 15~22, 15~21, 15~20, 15~19, 15~18, 15~17, 18~30, 18~29, 18~28, 18~27, 18~26, 18~25, 18~24, 18~23, 18~22, 18~21, 18~20, 19~30, 19~29, 19~28, 19~27, 19~26, 19~25, 19~24, 19 It will also be recognized that a duplex region of 15-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs is a dsRNA. That is, in one embodiment, an RNA molecule or complex of RNA molecules having a duplex region of more than 30 base pairs is a dsRNA, as long as it is processed into a functional duplex of, for example, 15-30 base pairs that targets the desired RNA for cleavage. Thus, those skilled in the art will recognize that, in one embodiment, an miRNA is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful for targeting LDHA or HAO1 or PRODH2 expression, or LDHA and HAO1 expression, is not generated in the target cell by cleavage of a larger dsRNA.
[0316] The dsRNA described herein can further comprise one or more single-stranded nucleotide overhangs, for example, 1, 2, 3 or 4 nucleotides.Compared with their blunt-end counterparts, the dsRNA with at least one nucleotide overhang can have unexpectedly superior inhibitory properties.The nucleotide overhang can comprise or consist of nucleotide / nucleoside analogs, such as deoxynucleotides / nucleosides.The overhang can be on the sense strand, on the antisense strand, or any combination thereof.Furthermore, the nucleotide of a certain overhang can be present on the 5'-end, 3'-end, or both ends of either the antisense strand or the sense strand of dsRNA.
[0317] dsRNA can be synthesized by standard methods known in the art, for example, using an automated DNA synthesizer, such as those commercially available from Biosearch, Applied Biosystems, Inc., as discussed further below.
[0318] The dsRNA of the present invention can be prepared using two-step method.First, each strand of double-stranded RNA molecule is prepared separately.Then, the strands of these components are annealed.The individual strands of siRNA compound can be prepared using solution phase or solid phase organic synthesis or both.Organic synthesis has the advantage that it can easily prepare the oligonucleotide strand that contains non-natural nucleotide or modified nucleotide.The single-stranded oligonucleotide of the present invention can be prepared using solution phase or solid phase organic synthesis or both.
[0319] In one embodiment, the dsRNA of the present invention targets the LDHA gene and comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence is selected from the sequences provided in any one of Tables 2-3, and the corresponding nucleotide sequence of the antisense strand is selected from the sequences provided in any one of Tables 2-3. In this embodiment, one of the two sequences is complementary to the other of the two sequences, where one of the sequences is substantially complementary to the sequence of the mRNA produced upon expression of the LDHA gene. Thus, in this embodiment, the dsRNA comprises two oligonucleotides, one of which is designated in any one of Tables 2-3 as the sense strand (passenger strand) and the second of which is designated in any one of Tables 2-3 as the corresponding antisense strand (guide strand). In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
[0320] In another aspect, the dsRNA of the invention targets the HAO1 gene and comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence is selected from the sequences provided in any one of Tables 4-14, and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the sequences provided in any one of Tables 4-14. In this aspect, one of the two sequences is complementary to the other of the two sequences, where one of the sequences is substantially complementary to the sequence of mRNA produced upon expression of the HAO1 gene. Thus, in this aspect, the dsRNA comprises two oligonucleotides, one oligonucleotide being designated as the sense strand (passenger strand) in any one of Tables 4-14 and the second oligonucleotide being designated as the corresponding antisense strand (guide strand) of the sense strand in any one of Tables 4-14. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
[0321] In yet another aspect, the dsRNA of the present invention targets the PRODH2 gene and comprises at least two nucleotide sequences, a sense sequence and an antisense sequence. The sense strand sequence is selected from the sequences provided in any one of Tables 15-16, and the corresponding nucleotide sequence of the antisense strand of the sense strand is selected from the sequences provided in any one of Tables 15-16. In this aspect, one of the two sequences is complementary to the other of the two sequences, where one of the sequences is substantially complementary to the sequence of mRNA produced upon expression of the PRODH2 gene. Thus, in this aspect, the dsRNA comprises two oligonucleotides, one oligonucleotide being described in any one of Tables 15-16 as the sense strand (passenger strand) and the second oligonucleotide being described in any one of Tables 15-16 as the corresponding antisense strand (guide strand) of the sense strand. In one embodiment, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides. In another embodiment, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.
[0322] Although the sequences in Tables 2-16 are described as modified, unmodified, unconjugated, and / or conjugated sequences, the RNA of the dsRNA of the invention, e.g., the dsRNA of the invention, can comprise any one of the sequences set forth in any one of Tables 2-16, which are unmodified, unconjugated, and / or modified and / or conjugated differently than those described herein.
[0323] Those skilled in the art are well aware that dsRNAs having duplex structures of approximately 20-23 base pairs, e.g., 21 base pairs, have been hailed as particularly effective in inducing RNA interference (Elbashir et al., (2001) EMBO J., 20:6877-6888). However, others have discovered that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the above-described embodiments, due to the nature of the oligonucleotide sequences provided herein, the dsRNAs described herein can comprise at least one strand that is a minimum of 21 nucleotides in length. It can be reasonably predicted that shorter duplexes, minus only a few nucleotides at one or both ends, can be similarly effective compared to the dsRNAs described above. Therefore, dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20 or more consecutive nucleotides derived from any one of the sequences described herein and differing from dsRNAs containing the entire sequence in their ability to inhibit expression of the LDHA gene, HAO1 gene or PRODH2 gene by an inhibition rate of about 5, 10, 15, 20, 25, or 30% or less are contemplated to be within the scope of the present invention.
[0324] Furthermore, RNAs listed in any one of Tables 2-3 specify a site in the LDHA transcript that is susceptible to RISC-mediated cleavage, RNAs listed in any one of Tables 4-14 specify a site in the HAO1 transcript that is susceptible to RISC-mediated cleavage, and RNAs listed in any one of Tables 15-16 specify a site in the PRODH2 transcript that is susceptible to RISC-mediated cleavage. Thus, the present invention also features iRNAs that target within these sites. As used herein, an iRNA is said to target within a specific site in an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within the specific site. Such iRNAs will generally comprise at least about 15 contiguous nucleotides from one of the sequences provided herein linked to additional nucleotide sequences taken from regions adjacent to the selected sequence within the gene.
[0325] Target sequences are generally approximately 15-30 nucleotides in length, although there is wide variation in the suitability of specific sequences within this range to direct cleavage of any given target RNA. While the various software packages and guidelines described herein provide guidance for identifying optimal target sequences for any given gene target, an empirical approach can also be undertaken in which a "window" or "mask" of a given size (21 nucleotides, as a non-limiting example) is placed literally or figuratively (including, for example, in silico) over the target RNA sequence to identify sequences within a size range that can function as target sequences. By incrementally shifting the sequence "window" one nucleotide upstream or downstream from the initial target sequence position, the next potential target sequence can be identified until a complete set of possible sequences has been identified for any given target size selected. This process, combined with systematic synthesis and testing of identified sequences (using assays described herein or known in the art) to identify optimally performing sequences, can identify RNA sequences that mediate the best inhibition of target gene expression when targeted with an iRNA agent. Thus, while the sequences identified herein represent effective target sequences, it is contemplated that further optimization of inhibitory efficiency may be achieved by incrementally "window walking" by one nucleotide upstream or downstream of a given sequence to identify sequences with equivalent or better inhibitory properties.
[0326] Furthermore, it is contemplated that further optimization can be achieved by, for example, systematically adding or removing nucleotides from any sequence identified herein to generate longer or shorter sequences, and then testing the sequences generated by walking up and down the target RNA, through longer or shorter size windows.Again, combining this approach with generating new candidate targets, along with testing the effectiveness of iRNAs based on these target sequences in inhibition assays known in the art and / or described herein, can result in further improvements in the efficiency of inhibition.Furthermore, such optimized sequences can be further optimized as expression inhibitors (e.g., by increasing serum stability or circulating half-life, increasing thermostability, enhancing transmembrane delivery, targeting specific locations or cell types, increasing interaction with silencing pathway enzymes, increasing release from endosomes), for example, by introducing modified nucleotides described herein or known in the art, adding or changing overhangs, or other modifications known in the art and / or discussed herein.
[0327] The dsRNA agent described herein may contain one or more mismatches to the target sequence. In one embodiment, the iRNA described herein contains three or fewer mismatches. When the antisense strand of an iRNA contains a mismatch to the target sequence, it is preferable that the area of the mismatch is not located in the center of the complementary region. When the antisense strand of an iRNA contains a mismatch to the target sequence, it is preferable that the mismatch is limited to within the last 5 nucleotides from either the 5'-end or 3'-end of the complementary region. For example, in the case of a 23-nucleotide iRNA agent, the strand complementary to the region of the LDHA gene, HAO1 gene, or PRODH2 gene generally does not contain any mismatches within the central 13 nucleotides. By using the methods described herein or known in the art, it can be determined whether an iRNA containing a mismatch to the target sequence is effective in inhibiting the expression of the LDHA gene, PRODH2 gene, and / or HAO1 gene. In particular, if a particular complementary region in the LDHA gene, PRODH2 gene, and / or HAO1 gene is known to have polymorphic sequence variation within the population, it is important to consider the effectiveness of iRNAs with mismatches in inhibiting expression of the LDHA gene, PRODH2 gene, and / or HAO1 gene.
[0328] The dual-targeting RNAi agent of the present invention, which comprises two dsRNA agents, is covalently linked, for example, via a covalent linker.Covalent linkers are well known in the art, and include, for example, nucleic acid linkers, peptide linkers, carbohydrate linkers, etc.Covalent linkers can comprise RNA and / or DNA and / or peptide.Linkers can be single-stranded, double-stranded, partially single-stranded, or partially double-stranded.Modified nucleotides or a mixture of nucleotides can also be present in nucleic acid linkers.
[0329] Suitable linkers for use in the dual targeting agents of the present invention include those described in US Pat. No. 9,187,746, the entire contents of which are incorporated herein by reference.
[0330] In some embodiments, the linker comprises a disulfide bond. The linker may or may not be cleavable.
[0331] Examples of linkers include dTsdTuu (5'-2' deoxythymidyl-3'-thiophosphate-5'-2' deoxythymidyl-3'-phosphate-5'-uridyl-3'-phosphate-5'-uridyl-3'-phosphate), rUsrU (thiophosphate linker: 5'-uridyl-3'-thiophosphate-5'-uridyl-3'-phosphate), rUrU linker, dTsdTaa (aadTsdT, 5'-2' deoxythymidyl-3'-thiophosphate-5'-uridyl-3'-phosphate), 'deoxythymidyl-3'-phosphate-5'-adenyI-3'-phosphate), dTsdT (5'-2'deoxythymidyl-3'-thiophosphate-5'-2'deoxythymidyl-3'-phosphate), dTsdTuu = uudTsdT = 5'-2'deoxythymidyl-3'-thiophosphate-5'-2'deoxythymidyl-3'-phosphate-5'-uridyl-3'-phosphate-5'-uridyl-3'-phosphate.
[0332] The linker may be polyRNA, such as poly(5'-adenyI-3'-phosphate-AAAAAAAA) or poly(5'-cytidyl-3'-phosphate-5'-uridyl-3'-phosphate-CUCUCUCU), e.g., an Xn single-stranded polyRNA linker, where n is an integer between 2 and 50, inclusive, e.g., an integer between 4 and 15, inclusive, or an integer between 7 and 8, inclusive. Modified nucleotides or mixtures of nucleotides may also be present in the aforementioned polyRNA linkers. The covalent linker may be polyDNA, such as poly(5'-2'deoxythymidyl-3'-phosphate-TTTTTTTT), e.g., an integer between 2 and 50, inclusive, e.g., an integer between 4 and 15, inclusive, or an integer between 7 and 8, inclusive. A modified nucleotide or a mixture of nucleotides may also be present in the aforementioned polyDNA linker or single-stranded polyDNA linker, where n is an integer of 2 to 50, inclusive, such as an integer of 4 to 15, or an integer of 7 to 8, inclusive. A modified nucleotide or a mixture of nucleotides may also be present in the aforementioned polyDNA linker.
[0333] The linker may comprise a disulfide bond, optionally a bis-hexyl-disulfide linker. In one embodiment, the disulfide linker is: [ka]
[0334] The linker can include a peptide bond, e.g., an amino acid. In one embodiment, the covalent linker is a 1-10 amino acid long linker, e.g., including 4-5 amino acids, optionally X-Gly-Phe-Gly-Y, where X and Y represent any amino acid.
[0335] The linker may include HEG, a hexaethylene glycol linker.
[0336] The covalent linker can attach the sense strand of a first dsRNA agent to the sense strand of a second dsRNA agent, the antisense strand of a first dsRNA agent to the antisense strand of a second dsRNA agent, the sense strand of a first dsRNA agent to the antisense strand of a second dsRNA agent, or the antisense strand of a first dsRNA agent to the sense strand of a second dsRNA agent.
[0337] In some embodiments, the covalent linker further comprises at least one ligand, as described below.
[0338] i. Modified dsRNA Agents of the Invention In one embodiment, the nucleic acid, e.g., RNA, of the nucleic acid inhibitor of the present invention is unmodified, e.g., does not contain chemical modifications and / or conjugations known in the art and described herein. In another embodiment, the nucleic acid, e.g., RNA, of the nucleic acid inhibitor of the present invention is chemically modified to enhance stability or other beneficial characteristics. In certain embodiments of the present invention, substantially all of the nucleotides of the nucleic acid inhibitor of the present invention are modified. In other embodiments of the present invention, all of the nucleotides of the nucleic acid inhibitor of the present invention are modified. Nucleic acid inhibitors of the present invention in which "substantially all of the nucleotides are modified" are widely, but not entirely, modified and may contain no more than 5, 4, 3, 2, or 1 unmodified nucleotide.
[0339] A first nucleic acid inhibitor, e.g., a dsRNA agent targeting LDHA, and a second nucleic acid inhibitor, e.g., a dsRNA agent targeting HAO1, are covalently linked (i.e., a dual-targeting RNAi agent), and substantially all of the nucleotides of the first agent and substantially all of the nucleotides of the second agent may be independently modified; all of the nucleotides of the first agent may be modified and all of the nucleotides of the second agent may be independently modified; substantially all of the nucleotides of the first agent and all of the nucleotides of the second agent may be independently modified; or all of the nucleotides of the first agent may be modified and substantially all of the nucleotides of the second agent may be independently modified.
[0340] In some aspects of the present invention, substantially all of the nucleotides of the nucleic acid inhibitors of the present invention are modified, and the nucleic acid inhibitors contain 10 or fewer nucleotides containing 2'-fluoro modifications (e.g., 9 or fewer 2'-fluoro modifications, 8 or fewer 2'-fluoro modifications, 7 or fewer 2'-fluoro modifications, 6 or fewer 2'-fluoro modifications, 5 or fewer 2'-fluoro modifications, 4 or fewer 2'-fluoro modifications, 5 or fewer 2'-fluoro modifications, 4 or fewer 2'-fluoro modifications, 3 or fewer 2'-fluoro modifications, or 2 or fewer 2'-fluoro modifications). For example, in some embodiments, the sense strand contains 4 or fewer nucleotides containing 2'-fluoro modifications (e.g., 3 or fewer 2'-fluoro modifications, or 2 or fewer 2'-fluoro modifications). In other embodiments, the antisense strand contains 6 or fewer nucleotides containing 2-fluoro modifications (e.g., 5 or fewer 2'-fluoro modifications, 4 or fewer 2'-fluoro modifications, 4 or fewer 2'-fluoro modifications, or 2 or fewer 2'-fluoro modifications).
[0341] In embodiments in which a first nucleic acid inhibitor, e.g., a dsRNA agent targeting LDHA, and a second nucleic acid inhibitor, e.g., a dsRNA agent targeting HAO1, are covalently linked (i.e., a dual-targeting RNAi agent), substantially all of the nucleotides of the first agent and / or substantially all of the nucleotides of the second agent may be independently modified, and the first and second agents may independently comprise 10 or fewer nucleotides that include 2'-fluoro modifications.
[0342] In other aspects of the invention, all of the nucleotides of the nucleic acid inhibitors of the invention are modified, and the nucleic acid inhibitor comprises 10 or fewer nucleotides that include 2'-fluoro modifications (e.g., 9 or fewer 2'-fluoro modifications, 8 or fewer 2'-fluoro modifications, 7 or fewer 2'-fluoro modifications, 6 or fewer 2'-fluoro modifications, 5 or fewer 2'-fluoro modifications, 4 or fewer 2'-fluoro modifications, 5 or fewer 2'-fluoro modifications, 4 or fewer 2'-fluoro modifications, 3 or fewer 2'-fluoro modifications, or 2 or fewer 2'-fluoro modifications).
[0343] In embodiments in which a first nucleic acid inhibitor, e.g., a dsRNA agent targeting LDHA, and a second nucleic acid inhibitor, e.g., a dsRNA agent targeting HAO1, are covalently linked (i.e., a dual-targeting RNAi agent), all of the nucleotides of the first agent and / or all of the nucleotides of the second agent may be independently modified, and the first and second agents may independently comprise 10 or fewer nucleotides that include 2'-fluoro modifications.
[0344] In one embodiment, the nucleic acid inhibitor of the present invention further comprises a 5'-phosphate or 5'-phosphate mimic of the 5' nucleotide of the antisense strand.In another embodiment, the double-stranded RNAi agent further comprises a 5'-phosphate mimic of the 5' nucleotide of the antisense strand.In a specific embodiment, the 5' phosphate mimic is 5'-vinylphosphonate (5'-VP).
[0345] In embodiments in which a first nucleic acid inhibitor, e.g., a dsRNA agent targeting LDHA, and a second nucleic acid inhibitor, e.g., a dsRNA agent targeting HAO1, are covalently linked (i.e., a dual-targeting RNAi agent), the first agent may further comprise a 5'-phosphate or a 5'-phosphate mimic at the 5' nucleotide of the antisense strand, the second agent may further comprise a 5'-phosphate or a 5'-phosphate mimic at the 5' nucleotide of the antisense strand, or the first agent and the second agent may independently further comprise a 5'-phosphate or a 5'-phosphate mimic at the 5' nucleotide of the antisense strand.
[0346] Nucleic acids featured in the present invention can be synthesized and / or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S. Lett. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted ligation) or 3'-end modifications (conjugation, DNA nucleotides, inverted ligation, etc.), base modifications, such as substitution with stabilizing bases, destabilizing bases, or bases that base-pair with partners in the extended repertoire, base removal (abasic nucleotides) or conjugated bases, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, and / or backbone modifications, including modification or substitution of phosphodiester linkages. Specific examples of nucleic acid inhibitor compounds useful in the embodiments described herein include, but are not limited to, nucleic acid inhibitors containing modified backbones or containing non-natural internucleoside linkages.Nucleic acid inhibitors with modified backbones include those that do not have a phosphorus atom in the backbone.For the purposes of this specification, as sometimes referred to in the art, modified nucleic acid inhibitors that do not have a phosphorus atom in their internucleoside backbone can also be considered oligonucleosides.In some embodiments, modified nucleic acid inhibitors will have a phosphorus atom in their internucleoside backbone.
[0347] Modified nucleic acid inhibitor backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, including 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reversed polarity, where adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.
[0348] Representative U.S. patents that teach the preparation of the above-described phosphorus-containing linkages include, but are not limited to, U.S. Patents 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 286,717;5,321,131;5,399,676;5,405,939;5,453,496;5,455,233;5,466,677;5,476,925;5,519,126;5,536,821;5,541,316;5,550,111;5,563,253;5,571,799;5, 587,361;5,625,050;6,028,188;6,124,445;6,160,109;6,169,170;6,172,209;6,239,265;6,277,603;6,326,199;6,346,614;6,444,423;6,531,590;6,534,639;6 ,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029 and U.S. Patent No. RE39464, the entire contents of each of which are incorporated herein by reference.
[0349] Modified nucleic acid inhibitor backbones that do not contain a phosphorus atom in the backbone have backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages, including those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH2 moieties.
[0350] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patents 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; ,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437, and 5,677,439, the entire contents of each of which are incorporated herein by reference.
[0351] In another embodiment, RNA mimics suitable for use in nucleic acid inhibitors are considered, in which both the sugar and internucleoside linkages, i.e., the backbone, of nucleotide units are replaced with novel groups. The base units are maintained for hybridization with appropriate nucleic acid target compounds. One such oligomeric compound, an RNA mimic known to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are directly or indirectly linked to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262, the entire contents of each of which are incorporated herein by reference. Further PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
[0352] Some embodiments featured herein include nucleic acid inhibitors such as RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly those of the above-referenced U.S. Patent No. 5,489,677, --CH2--NH--CH2--, --CH2--N(CH3)--O--CH2-- (known as the methylene (methylimino) or MMI backbone), --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2--CH2--, and the amide backbones of the above-referenced U.S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have the morpholino backbone structure of the above-referenced U.S. Patent No. 5,034,506. The natural phosphodiester backbone can be represented as OP(O)(OH)-OCH2-.
[0353] Modified nucleic acid inhibitors may also contain one or more substituted sugar moieties. The nucleic acid inhibitors featured herein, e.g., dsRNA, may include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 O-alkyl-O-alkyl, which are alkenyl and alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3)]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA includes one of the following at the 2' position: C1 to C 10The substituents include lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, interfering substances, groups for improving the pharmacokinetic properties of iRNA, or groups for improving the pharmacodynamic properties of nucleic acid inhibitors, and other substituents with similar properties. In some embodiments, the modification includes 2'-methoxyethoxy (2'-O-CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is the 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described herein below in the Examples, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2. Further exemplary modifications include: 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides (both R and S isomers within these three families), 2'-alkoxyalkyl, and 2'-NMA (N-methylacetamide).
[0354] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of nucleic acid inhibitors, particularly the 3' position of the sugar on the 3'-terminal nucleotide or in 2'-5'-linked dsRNA and the 5' position of the 5'-terminal nucleotide. Nucleic acid inhibitors can also have sugar mimetics, such as a cyclobutyl moiety in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, portions of which are commonly owned with this application. The entire contents of each of the foregoing are incorporated herein by reference.
[0355] Additional nucleotides with modified or substituted sugar moieties for use in the nucleic acid inhibitors of the present invention include nucleotides containing bicyclic sugars. A "bicyclic sugar" is a furanose ring modified by bridging two atoms. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety containing a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring. Thus, in some embodiments, nucleic acid inhibitors can include one or more locked nucleic acids. A "locked nucleic acid" ("LNA") is a nucleotide having a modified ribose moiety in which the ribose moiety contains an additional bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in a 3'-endo conformation. The addition of a locked nucleic acid to a polynucleotide agent has been shown to increase the stability of the polynucleotide agent in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0356] Examples of bicyclic nucleosides for use in the nucleic acid inhibitors of the present invention include, but are not limited to, nucleosides comprising a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the nucleic acid inhibitors of the present invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt"), and 4'-CH(CHOCH3)-O-2' (and analogs thereof, see, e.g., U.S. Pat. No. 7,399,845), 4'-C(CH3)(CH3)-O-2' (and analogs thereof, e.g., U.S. Pat. No. 7,399,845). No. 8,278,283), 4'-CH2-N(OCH3)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Patent Application Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2', where R is H, C1-C12 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C(=CH2)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are incorporated herein by reference.
[0357] Additional representative U.S. patents and U.S. patent application publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Patents 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,3 99,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; U.S. Patent Application Publication Nos. 2008 / 0039618, and 2009 / 0012281, the entire contents of each of which are incorporated herein by reference.
[0358] Any of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see WO 99 / 14226).
[0359] In one specific embodiment of the present invention, a nucleic acid inhibitor may comprise one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge. In one embodiment, the constrained ethyl nucleotide is in the S conformation and is referred to as an "S-constrained ethyl nucleotide" or "S-cEt."
[0360] The modified nucleotides contained in the nucleic acid inhibitors of the present invention may also contain one or more sugar mimetics. For example, the nucleic acid inhibitors may include "modified tetrahydropyran nucleotides" or "modified THP nucleotides." "Modified tetrahydropyran nucleotides" have a six-membered tetrahydropyran "sugar" that replaces the pentofuranosyl residue in a normal nucleotide (sugar substitute). Modified THP nucleotides include, but are not limited to, those referred to in the art as hexitol nucleic acids (HNA), anitol nucleic acids (ANA), mannitol nucleic acids (MNA) (see, e.g., Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), or fluoro-HNA (F-HNA).
[0361] In some embodiments of the present invention, the sugar surrogate comprises a ring having more than five atoms and more than two heteroatoms. For example, nucleotides containing morpholino sugar moieties and their use in oligomeric compounds have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and U.S. Patent Nos. 5,698,685, 5,166,315, 5,185,444, and 5,034,506). Morpholinos can be modified, for example, by adding or changing various substituents from the above morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."
[0362] Combinations of modifications are also provided, including, but not limited to, 2'-F-5'-methyl substituted nucleosides (see WO 2008 / 101157, published August 21, 2008, for other disclosed 5',2'-bis substituted nucleosides), and substitution of the ribosyl ring oxygen atom with S and further substitution at the 2' position (see U.S. Patent Application Publication No. 2005-0130923, published June 16, 2005), or alternatively 5' substitution of bicyclic nucleic acids (WO 2007 / 134181, published November 22, 2007, in which 4'-CH2-O-2' bicyclic nucleosides are further substituted at the 5' position with a 5'-methyl or 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides, as well as their oligomerization and biochemical studies, have also been described (see, for example, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0363] In certain embodiments, nucleic acid inhibitors include one or more modified cyclohexenyl nucleosides, which are nucleosides having a six-membered cyclohexenyl in place of the pentofuranosyl residue in a naturally occurring nucleoside.Modified cyclohexenyl nucleosides include, but are not limited to, those described in the art (e.g., commonly owned International Publication No. WO 2010 / 036696, published April 10, 2010; Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids, 2005, 24(5-7), 993-998). Research,2005,33(8),2452-2463;Robeyns et al.,Acta Crystallographica,Section F:Structural Biology and Crystallization Communications,2005,F61(6),585-586;Gu et al.,Tetrahedron,2004,60(9),2111-2123;Gu et al. al.,Oligonucleotides,2003,13(6),479-489;Wang et al.,J.Org.Chem.,2003,68,4499-4505;Verbeure et al.,Nucleic Acids Research,2001,29(24),4941-4947;Wang et al. al.,J.Org.Chem.,2001,66,8478-82;Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; WO 06 / 047842, and WO 01 / 049687, the texts of each of which are incorporated herein by reference in their entirety.
[0364] The nucleic acid inhibitors of the present invention may also include modifications or substitutions of nucleobases (often simply referred to as "bases" in the art).As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).Modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine. , 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine.Additional nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed.Wiley-VCH, 2008, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, JL, ed.John Wiley&Sons, 1990, those disclosed in Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed in Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993.Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines, such as 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T., and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are exemplary base substitutions, especially when combined with 2'-O-methoxyethyl sugar modifications.
[0365] Representative U.S. patents that teach the preparation of some of the above-described modified nucleobases, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patents: 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469 ;5,594,121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672 and 7,495,088, the entire contents of each of which are incorporated herein by reference.
[0366] The nucleic acid inhibitors of the present invention can also be modified to include one or more locked nucleic acids (LNA).Locked nucleic acids are nucleotides with modified ribose moieties that contain an additional bridge connecting the 2' and 4' carbons of the ribose moiety. This structure effectively "locks" the ribose in a 3'-endo conformation.The addition of locked nucleic acids to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193).
[0367] The nucleic acid inhibitors of the present invention can also be modified to contain one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by a ring formed by bridging two carbon atoms, whether adjacent or non-adjacent. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety containing a ring formed by bridging two carbon atoms of the sugar ring, whether adjacent or non-adjacent, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring, optionally via a 2'-acyclic oxygen atom. Thus, in some embodiments, the agents of the present invention can contain one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety contains an additional bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in a 3'-endo conformation. The addition of a locked nucleic acid to siRNA has been shown to increase siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the present invention include, but are not limited to, nucleosides containing a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agent of the present invention includes one or more bicyclic nucleosides containing a 4' to 2' bridge.
[0368] A locked nucleoside can be represented by this structure (stereochemistry omitted): [ka] wherein B is a nucleobase or modified nucleobase, and L is a linking group connecting the 2'-carbon and the 4'-carbon of the ribose ring. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt"), and 4'-CH(CHOCH3)-O-2' (and analogs thereof, see, e.g., U.S. Pat. No. 7,399,845), 4'-C(CH3)(CH3)-O-2' (and analogs thereof, e.g., U.S. Pat. No. 7,399,845). , U.S. Pat. No. 8,278,283), 4'-CH2-N(OCH3)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Patent Application Publication No. 2004 / 0171570), 4'-CH2-N(R)-O-2', where R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g., U.S. Pat. No. 7,427,672), 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C(═CH2)-2' (and analogs thereof, see, e.g., U.S. Pat. No. 8,278,426). The entire contents of each of the foregoing are incorporated herein by reference.
[0369] Additional representative U.S. patents and U.S. patent application publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Patents 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,3 99,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; U.S. Patent Application Publication Nos. 2008 / 0039618, and 2009 / 0012281, the entire contents of each of which are incorporated herein by reference.
[0370] Any of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see WO 99 / 14226).
[0371] The nucleic acid inhibitors of the present invention can also be modified to contain one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge (L in the preceding structure). In one embodiment, the constrained ethyl nucleotide is in the S conformation and is referred to herein as an "S-cEt."
[0372] The nucleic acid inhibitors of the present invention may also contain one or more "conformationally restricted nucleotides" ("CRNs"). A CRN is a nucleotide analogue with a linker connecting the C2' and C4' carbons of ribose or the C3 and C5' carbons of ribose. The CRN locks the ribose ring into a stable conformation, increasing hybridization affinity to mRNA. The linker is long enough to position the oxygen at an optimal position for stability and affinity, thereby reducing puckering of the ribose ring.
[0373] Representative publications that teach the preparation of certain of the above CRNs include, but are not limited to, U.S. Patent Application Publication No. 2013 / 0190383 and PCT Publication No. WO 2013 / 036868, the entire contents of each of which are incorporated herein by reference.
[0374] In some embodiments, the nucleic acid inhibitors of the present invention comprise one or more monomers that are UNA (unlocked nucleic acid) nucleotides. UNAs are unlocked acyclic nucleic acids in which any of their sugar linkages have been removed to form an unlocked "sugar" residue. In one example, UNAs also encompass monomers in which the C1'-C4' bond has been removed (i.e., a covalent carbon-oxygen-carbon bond between the C1' and C4' carbons). In another example, the C2'-C3' bond of the sugar (i.e., a covalent carbon-carbon bond between the C2' and C3' carbons) has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference).
[0375] Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Application Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.
[0376] Potential stabilizing modifications to the termini of nucleic acid inhibitors may include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"-phosphate, inverted base dT (idT), and others. Disclosure of this modification can be found in WO 2011 / 005861.
[0377] Other modifications of the nucleic acid inhibitors of the present invention include 5' phosphate or 5' phosphate mimics, such as 5' terminal phosphate or phosphate mimics on the antisense strand of the nucleic acid inhibitor.Suitable phosphate mimics are disclosed, for example, in U.S. Patent Application Publication No. 2012 / 0157511, the entire contents of which are incorporated herein by reference.
[0378] Any of the nucleic acid inhibitors of the present invention may optionally be conjugated to a ligand, such as a GalNAc derivative ligand, as described below.
[0379] As described in more detail below, nucleic acid inhibitors containing one or more carbohydrate moieties conjugated to the nucleic acid inhibitor can optimize one or more properties of the inhibitor. In many cases, the carbohydrate moiety will be attached to a modified subunit of the nucleic acid inhibitor. For example, the ribose sugar of one or more ribonucleotide subunits of the inhibitor can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbon-cyclic system, i.e., all ring atoms are carbon atoms, or a heterocyclic system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, e.g., fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.
[0380] The ligand may be attached to the nucleic acid inhibitor via a carrier. The carrier comprises (i) at least one "backbone attachment point," for example, two "backbone attachment points," and (ii) at least one "tethering attachment point." As used herein, "backbone attachment point" refers to a functional group, such as a hydroxyl group, or generally refers to an available and suitable bond for incorporating the carrier into the backbone of a ribonucleic acid, for example, a phosphate, or a modified phosphate, such as a sulfur-containing one. In some embodiments, the "tethering attachment point" (TAP) refers to a ring atom, such as a carbon atom or heteroatom (other than the atom that provides the backbone attachment point), of the cyclic carrier to which the selected moiety is attached. This moiety may be, for example, a carbohydrate, such as a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is connected to the cyclic carrier via an intervening tether. Thus, cyclic carriers often contain functional groups, such as amino groups, or generally bonds, that provide a linkage suitable for the incorporation or tethering of another chemical entity, such as a ligand, to the constituent ring.
[0381] The nucleic acid inhibitor may be conjugated to the ligand via a carrier, which may be a cyclic or acyclic group; in some embodiments, the cyclic group is selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; in some embodiments, the acyclic group is selected from a serinol backbone or a diethanolamine backbone.
[0382] ii. Modified dsRNA agents containing motifs of the invention In certain embodiments of the invention, the double-stranded RNAi agents of the invention include agents having chemical modifications as disclosed, for example, in WO 2013 / 075035, filed November 16, 2012, the entire contents of which are incorporated herein by reference.
[0383] It will be appreciated that in embodiments in which a first dsRNA agent targeting LDHA and a second dsRNA agent targeting HAO1 are covalently linked (i.e., a dual-targeting RNAi agent), the first agent may comprise any one or more of the motifs described below, the second agent may comprise any one or more of the motifs described below, or both the first and second agents may independently comprise any one or more of the motifs described below.
[0384] Thus, the present invention provides double-stranded RNAi agents capable of inhibiting the expression of a target gene (i.e., the LDHA gene, the HAO1 gene, the PRODH2 gene, or both the LDHA gene and the HAO1 gene) in vivo. The RNAi agents include a sense strand and an antisense strand. Each strand of the RNAi agent can be 12 to 30 nucleotides in length. Each strand can be, for example, 14 to 30 nucleotides in length, 17 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotides in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.
[0385] The sense and antisense strands typically form a duplex, double-stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent." The duplex region of an RNAi agent can be 12-30 nucleotide pairs in length. For example, the duplex region can be 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
[0386] In one embodiment, the RNAi agent can contain one or more overhang regions and / or capping groups at the 3'-end, 5'-end, or both ends of one or both strands. The overhangs can be 1 to 6 nucleotides in length, e.g., 2 to 6 nucleotides in length, 1 to 5 nucleotides in length, 2 to 5 nucleotides in length, 1 to 4 nucleotides in length, 2 to 4 nucleotides in length, 1 to 3 nucleotides in length, 2 to 3 nucleotides in length, or 1 to 2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being twisted. The overhangs can form mismatches with the target mRNA, be complementary to the targeted gene sequence, or be of a different sequence. The first and second strands can also be linked by additional bases, for example, to form a hairpin, or by other non-basic linkers.
[0387] In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be modified or unmodified nucleotides, including, but not limited to, modified 2'-sugars, such as 2-F, 2'-O-methyl thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combination thereof.For example, TT can be the overhang sequence for either end on either strand.This overhang can form a mismatch with target mRNA, or can be complementary to the target gene sequence, or can be another sequence.
[0388] The 5'- or 3'-overhang of the sense strand, antisense strand, or both strands of the RNAi agent can be phosphorylated. In some embodiments, the overhang region contains two nucleotides with a phosphorothioate between them, and the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3'-end of the sense strand, antisense strand, or both strands. In one embodiment, the 3'-overhang is present in the antisense strand. In one embodiment, the 3'-overhang is present in the sense strand.
[0389] RNAi agent can contain only a single overhang, which can enhance the interference activity of RNAi without affecting its overall stability.For example, the single-stranded overhang can be located at the 3'-end of the sense strand or at the 3'-end of the antisense strand.RNAi can also have a blunt end, which is located at the 5'-end of the antisense strand (or the 3'-end of the sense strand), or vice versa.Generally, the antisense strand of RNAi has a nucleotide overhang at the 3'-end, and its 5'-end is blunt.Without wishing to be bound by theory, the asymmetry between the blunt end at the 5'-end of the antisense strand and the 3'-end overhang of the antisense strand is favorable for the insertion of guide strand into RISC process.
[0390] In one embodiment, the RNAi agent is 19 nucleotides in length and double-blunt ended, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, and 9 from the 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.
[0391] In another embodiment, the RNAi agent is 20 nucleotides in length and double-blunt ended, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, and 10 from the 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.
[0392] In yet another embodiment, the RNAi agent is 21 nucleotides in length and double-blunt ended, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end.
[0393] In one embodiment, the RNAi agent comprises a 21-nucleotide sense strand and a 23-nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, and 11 from the 5' end, and the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, and one end of the RNAi agent is blunt and the other end contains a two-nucleotide overhang. For example, the two-nucleotide overhang is at the 3' end of the antisense strand.
[0394] When a two-nucleotide overhang is at the 3'-end of the antisense strand, there can be two phosphorothioate internucleotide bonds between the three terminal nucleotides, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide adjacent to the overhanging nucleotide.In one embodiment, the RNAi agent further has two phosphorothioate internucleotide bonds between the three terminal nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand.In one embodiment, every nucleotide in the sense strand and antisense strand of the RNAi agent, including the nucleotide that is part of a motif, is a modified nucleotide.In one embodiment, each residue is independently modified with 2'-O-methyl or 2'-fluoro, for example, within an alternating motif.Optionally, the RNAi agent further comprises a ligand (e.g., GalNAc3).
[0395] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, and starting from the 5'-terminal nucleotide (position 1), positions 1-23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length, and starting from the 3'-terminal nucleotide, comprises at least 8 ribonucleotides at positions 1-23 of the sense strand to form a duplex; at least the 3'-terminal nucleotide of the antisense strand is unpaired with the sense strand, and up to 6 consecutive 3'-terminal nucleotides are unpaired with the sense strand, thereby forming a 3' single-stranded overhang of 1-6 nucleotides; and the 5'-end of the antisense strand comprises 10-30 consecutive ribonucleotides that are not paired with the sense strand. The double-stranded nucleic acid comprises at least 19 ribonucleotides of the sense strand, thereby forming a single-stranded 5' overhang of 10 to 30 nucleotides, at least the 5'- and 3'-terminal nucleotides of the sense strand base-pair with nucleotides of the antisense strand when the sense strand and the antisense strand are aligned for maximum complementarity, thereby forming a substantially double-stranded region between the sense strand and the antisense strand, and the antisense strand is sufficiently complementary to the target RNA along at least 19 ribonucleotides of the antisense strand length, so that when the double-stranded nucleic acid is introduced into a mammalian cell, target gene expression is reduced, and the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides, at least one of the motifs occurring at or near the cleavage site. The antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at or near the cleavage site.
[0396] In one embodiment, the RNAi agent comprises a sense strand and an antisense strand, the RNAi agent comprising a first strand having a length of at least 25 nucleotides and a maximum of 29 nucleotides, and a second strand having a length of at least 30 nucleotides and having at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, and 13 from the 5' end, the 3' end of the first strand and the 5' end of the second strand forming a blunt end, the second strand being 1-4 nucleotides longer at its 3' end than the first strand, the duplex region being at least 25 nucleotides in length, the second strand being sufficiently complementary to a target mRNA along at least 19 nucleotides of the second strand length, the RNAi agent reducing target gene expression when introduced into a mammalian cell, and Dicer cleavage of the RNAi agent resulting in an siRNA comprising the 3' end of the second strand, thereby reducing target gene expression in the mammalian cell. Optionally, the RNAi agent further comprises a ligand.
[0397] In one embodiment, the sense strand of the RNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, one of which motifs occurs at the cleavage site within the sense strand.
[0398] In one embodiment, the antisense strand of the RNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, one of which occurs at or near the cleavage site in the antisense strand.
[0399] For RNAi agents with a duplex region of 17 to 23 nucleotides in length, the cleavage site of the antisense strand is typically approximately 10, 11, and 12 from the 5' end. Thus, three identical modification motifs can occur at positions 9, 10, and 11, 10, 11, and 12, 11, 12, and 13, 12, 13, and 14, or 13, 14, and 15 of the antisense strand, starting from the first nucleotide from the 5' end of the antisense strand, or starting from the first paired nucleotide within the duplex region from the 5' end of the antisense strand. The cleavage site within the antisense strand can also vary depending on the length of the duplex region of the RNAi from the 5' end.
[0400] The sense strand of RNAi agent can contain at least one motif of three identical modifications on three consecutive nucleotides at the break site of its strand, and antisense strand can have at least one motif of three identical modifications on three consecutive nucleotides at or near the break site of strand.When sense strand and antisense strand form dsRNA duplex, sense strand and antisense strand can be aligned so that one motif of three nucleotides on sense strand and one motif of three nucleotides on antisense strand have at least one nucleotide overlap, that is, at least one of the three nucleotides of the motif in sense strand and at least one of the three nucleotides of the motif in antisense strand form base pairing.Alternatively, at least two nucleotides can overlap, or all three nucleotides can overlap.
[0401] In one embodiment, the sense strand of an RNAi agent may contain multiple motifs of three identical modifications on three consecutive nucleotides. The first motif may occur at or near the site of strand cleavage, and the other motifs may be wing modifications. As used herein, the term "wing modification" refers to a motif that occurs in another portion of the strand separated from a motif at or near the site of cleavage of the same strand. The wing modifications may be adjacent to the first motif or separated by at least one or more nucleotides. When the motifs are immediately adjacent to each other, the chemical nature of the motifs is distinct from each other, and when the motifs are separated by one or more nucleotides, the chemical nature may be the same or different. Two or more wing modifications may be present. For example, when two wing modifications are present, each wing modification may occur at one end of the first motif at or near the cleavage site, or on either side of the lead motif.
[0402] Like the sense strand, the antisense strand of an RNAi agent may contain multiple motifs of three identical modifications on three consecutive nucleotides, at least one of which occurs at or near the site of cleavage on that strand. The antisense strand may also contain one or more wing modifications in the same alignment as the wing modifications that may be present on the sense strand.
[0403] In one embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.
[0404] In another embodiment, wing modifications on the sense or antisense strand of an RNAi agent typically do not include the first one or two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.
[0405] When the sense and antisense strands of an RNAi agent each contain at least one wing modification, the wing modifications can be located at the same end of the duplex region and have an overlap of 1, 2, or 3 nucleotides.
[0406] When the sense and antisense strands of an RNAi agent each contain at least two wing modifications, the sense and antisense strands can be aligned such that the two modifications from each single strand are located at one end of a duplex region with 1, 2, or 3 nucleotide overlap, the two modifications from each single strand are located at the other end of a duplex region with 1, 2, or 3 nucleotide overlap, and the two modifications from each single strand are located on either side of a lead motif with 1, 2, or 3 nucleotide overlap within the duplex region.
[0407] In one embodiment, any nucleotide in the sense strand and antisense strand of an RNAi agent, including a nucleotide that is part of a motif, can be modified. Each nucleotide can be modified with the same or different modifications, and the modifications can include one or more of the following: changing one or both of the non-binding phosphate oxygens and / or changing one or more of the binding phosphate oxygens; changing the ribose sugar, for example, the 2'-hydroxyl component on the ribose sugar; extensively replacing the phosphate moiety with a "dephosphorylation" linker; modifying or substituting a naturally occurring base; and substituting or modifying the ribose phosphate backbone.
[0408] Because nucleic acid is a polymer of subunits, many modifications occur at positions that are repeated within nucleic acid, such as modification of base or phosphate moiety, or unlinked O of phosphate moiety.In some cases, modifications occur at all target positions in nucleic acid, but in many cases, they do not occur.For example, modifications can occur only at the 3'-end or 5'-end position, or only at terminal regions, such as at the position on the terminal nucleotide of the chain, or at the last 2, 3, 4, 5, or 10 nucleotides of the chain.Modifications can occur in double-stranded regions, single-stranded regions, or both.Modifications can occur only in the double-stranded region of RNA, or only in the single-stranded region of RNA. For example, phosphorothioate modifications at non-linked O positions can occur only at one or both termini, can occur only in terminal regions, e.g., at the terminal nucleotide of the strand or within the last 2, 3, 4, 5, or 10 nucleotides of the strand, or can occur in double-stranded and single-stranded regions, especially at the termini. The 5' termini can be phosphorylated.
[0409] For example, it may be possible to enhance stability, include specific bases in the overhang, or include modified nucleotides or nucleotide substitutes in a single-stranded overhang, for example, in the 5' or 3' overhang, or in both overhangs.For example, it may be desirable to include purine nucleotides in the overhang.In some embodiments, all or some of the bases in the 3' or 5' overhang can be modified, for example, with the modifications described herein.Modifications can include, for example, the use of modifications at the 2' position of the ribose sugar with modifications known in the art, for example, the use of modified deoxyribonucleotides, 2'-deoxy-2'-fluoro (2'-F) or 2'-O-methyl, instead of the ribosugar of the nucleobase, and modifications at the phosphate group, for example, phosphorothioate modifications.The overhang does not need to be homologous to the target sequence.
[0410] In one embodiment, each residue of the sense strand and the antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. A strand can contain two or more modifications. In one embodiment, each residue of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.
[0411] At least two different modifications are typically present on the sense and antisense strands, which may be 2'-O-methyl or 2'-fluoro modifications.
[0412] In one embodiment, N a and / or N b includes an alternating pattern of modifications. The term "alternating motif," as used herein, refers to a motif having one or more modifications, each modification occurring on alternating nucleotides in a single strand. Alternating nucleotides can refer to one every other nucleotide or one every three nucleotides, or similar patterns. For example, if A, B, and C each represent one type of modification to a nucleotide, the alternating motif could be "ABABABABABAB...," "AABBAABBAABB...," "AABAABAABAAB...," "AAABAAABAAAB...," "AAABBBAAABBB...," or "ABCABCABCABC...," etc.
[0413] The types of modifications contained within an alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification on a nucleotide, the alternation pattern, i.e., the modifications on every other nucleotide, can be the same, but each of the sense or antisense strands can be selected from several possible modifications within the alternating motif, such as "ABABAB...," "ACACAC...," "BDBDBD...," or "CDCDCD...."
[0414] In one embodiment, an RNAi agent of the present invention comprises an alternating motif modification pattern on the sense strand that is shifted relative to the alternating motif modification pattern on the antisense strand. The shift can be such that modified groups on nucleotides in the sense strand correspond to differently modified groups on nucleotides in the antisense strand, or vice versa. For example, when a sense strand is paired with an antisense strand in a dsRNA duplex, the alternating motif in the sense strand can begin with "ABABAB" from the 5'-3' end of the strand, and the alternating motif in the antisense strand can begin with "BABABA" from the 5'-3' end of the strand in the duplex region. As another example, the alternating motif in the sense strand can begin with "AABBAABB" from the 5'-3' end of the strand, and the alternating motif in the antisense strand can begin with "BBAABBAA" from the 5'-3' end of the strand in the duplex region, resulting in a complete or partial shift in the modification patterns between the sense and antisense strands.
[0415] In one embodiment, the RNAi agent comprises a pattern of alternating motifs of 2'-O-methyl modification and 2'-F modification on the sense strand, and first has a relative shift with respect to the pattern of alternating motifs of 2'-O-methyl modification and 2'-F modification on the antisense strand, that is, the 2'-O-methyl modified nucleotide on the sense strand base pairs with the 2'-F modified nucleotide on the antisense strand, and vice versa.Position 1 of the sense strand can start with 2'-F modification, and position 1 of the antisense strand can start with 2'-O-methyl modification.
[0416] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand interrupts the original modification pattern present in the sense strand and / or antisense strand. The interruption of the modification pattern of the sense strand and / or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense strand and / or antisense strand can unexpectedly enhance the gene silencing activity against the target gene.
[0417] In one embodiment, when a motif of three identical modifications on three consecutive nucleotides is introduced into either strand, the modifications of the nucleotides adjacent to the motif are different modifications from the modification of the motif. For example, the portion of the sequence containing the motif may be described as "...N a YYYN b ...", where "Y" represents a modification of a motif of three identical modifications on three consecutive nucleotides, and "N a " and "N b " represents a modification to the nucleotide adjacent to the motif "YYY" that is different from the modification of Y, and N a and N b may be the same or different modifications. Alternatively, when wing modifications are present, N a and / or N b may or may not be present.
[0418] The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur at any nucleotide at any position on the sense strand, the antisense strand, or both strands. For example, the internucleotide linkage modification may occur at every nucleotide on the sense strand and / or the antisense strand, each internucleotide linkage modification may occur in an alternating pattern on the sense strand and / or the antisense strand, or the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of internucleotide linkage modifications on the sense strand may be the same or different from that of the antisense strand, and the alternating pattern of internucleotide linkage modifications on the sense strand may have a shift relative to the alternating pattern of internucleotide linkage modifications on the antisense strand. In one embodiment, the double-stranded RNAi agent comprises 6 to 8 phosphorothioate internucleotide linkages. In one embodiment, the antisense strand contains two phosphorothioate internucleotide linkages at the 5' end and two phosphorothioate internucleotide linkages at the 3' end, and the sense strand contains at least two phosphorothioate internucleotide linkages at either the 5' end or the 3' end.
[0419] In one embodiment, the RNAi agent comprises phosphorothioate or methylphosphonate internucleotide bond modification in the overhang region.For example, the overhang region can contain two nucleotides with phosphorothioate or methylphosphonate internucleotide bond between the two nucleotides.Internucleotide bond modification can also be made to connect the overhang nucleotide with the terminal paired nucleotide in the double-stranded region.For example, at least 2, 3, 4 or all of the overhang nucleotides can be linked by phosphorothioate or methylphosphonate internucleotide bond, and optionally there can be additional phosphorothioate or methylphosphonate internucleotide bond that connects the overhang nucleotide with the paired nucleotide adjacent to the overhang nucleotide.For example, there can be at least two phosphorothioate internucleotide bonds between the terminal three nucleotides, where two of the three nucleotides are overhang nucleotides and the third is the paired nucleotide adjacent to the overhang nucleotide. These terminal three nucleotides can be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and / or the 5' end of the antisense strand.
[0420] In one embodiment, the 2-nucleotide overhang is at the 3'-end of the antisense strand, and two phosphorothioate internucleotide linkages are present between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide adjacent to the overhanging nucleotide. Optionally, the RNAi agent can further have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5'-end of the sense strand and the 5'-end of the antisense strand.
[0421] In one embodiment, the RNAi agent contains mismatches or combinations thereof in the duplex with the target. Mismatches can occur in the overhang region or the duplex region. Base pairs can be ranked based on their tendency to promote dissociation or melting (e.g., based on the free energy of association or dissociation of a particular pairing; the simplest approach is to examine each pair individually, but adjacent or similar analysis can also be used). In terms of promoting dissociation, A:U is preferred to G:C, G:U is preferred to G:C, and I:C is preferred to G:C (I=inosine). Mismatches, such as non-standard pairings or non-standard pairings (described elsewhere herein), are preferred to standard pairings (A:T, A:U, G:C), and pairings containing universal bases are preferred to standard pairings.
[0422] In one embodiment, the RNAi agent comprises the first 1, 2, 3, 4, or 5 base pairs within the duplex region from the 5' end of the antisense strand independently selected from the group of A:U, G:U, I:C, and at least one mismatch pair, e.g., a non-canonical pairing or a non-canonical pairing or a pairing containing a universal base, to promote dissociation of the antisense strand at the 5' end of the duplex.
[0423] In one embodiment, the nucleotide at position 1 from the 5' end of the antisense strand to the duplex region is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first one, two, or three base pairs from the 5' end of the antisense strand to the duplex region is an AU base pair. For example, the first base pair from the 5' end of the antisense strand to the duplex region is an AU base pair.
[0424] In another embodiment, the nucleotide at the 3' end of the sense strand is deoxythymidine (dT). In another embodiment, the nucleotide at the 3' end of the antisense strand is deoxythymidine (dT). In one embodiment, there is a short sequence of deoxythymine nucleotides, for example, two dT nucleotides on the 3' end of the sense strand and / or antisense strand.
[0425] In one embodiment, the sense strand sequence has formula (I): 5'n p -N a -(XXX) i -N b -YY YN b -(ZZZ) j -N a -n q 3'(I), During the ceremony, i and j are each independently 0 or 1; p and q each independently represent 0 to 6; each N a each independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b independently represent an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p and n q independently represent overhanging nucleotides, wherein Nb and Y do not have the same modification, and XXX, YYY and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides. In some embodiments, YYY are all 2'-F modified nucleotides.
[0426] In one embodiment, N a and / or N b includes alternating pattern modifications.
[0427] In one embodiment, YYY motif occurs at or near the cleavage site of sense strand.For example, when RNAi agent has a double-stranded region of 17-23 nucleotides in length, YYY motif can occur at or near the cleavage site of sense strand (for example, can occur at position 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12, or 11, 12, 13), and this number starts from the first nucleotide from the 5' end, or optionally this number starts from the first paired nucleotide in the double-stranded region from the 5' end.
[0428] In one embodiment, i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1. Thus, the sense strand has the following formula: 5'n p -N a -YYY-N b -ZZZ-N a -n q 3'(Ib), 5'n p -N a -XXX-N b -YYY-N a -n q 3'(Ic), or 5'n p -N a -XXX-N b -YYY-N b -ZZZ-N a -n q 3'(Id) It can be expressed as:
[0429] When the sense strand is represented by formula (Ib), N b represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0430] When the sense strand is represented by formula (Ic), N brepresents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a can independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0431] When the sense strand is represented by formula (Id), each N b independently represent an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. b is 0, 1, 2, 3, 4, 5, or 6. Each N a can independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0432] Each of X, Y and Z may be the same or different from one another.
[0433] In other embodiments, i is 0 and j is 0, and the sense strand has the formula 5'n p -N a -YYY-N a -n q 3'(Ia) It can be expressed as:
[0434] When the sense strand is represented by formula (Ia), each N a can independently represent an oligonucleotide sequence that includes 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0435] In one embodiment, the antisense strand sequence of the RNAi is represented by formula (II): 5'n q’ -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p '3'(II), During the ceremony, k and l are each independently 0 or 1; p' and q' each independently represent 0 to 6; each N a ' independently represent an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; each n p ' and n q ' independently represent an overhanging nucleotide; In the formula, N b ' and Y' do not have the same modification, and X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0436] In one embodiment, N a ' and / or N b ' includes alternating pattern modifications.
[0437] Y'Y'Y' motif occurs at or near the cleavage site of antisense strand.For example, when RNAi agent has a double-stranded region of 17-23 nucleotides in length, Y'Y'Y' motif can occur at position 9, 10, 11, 10, 11, 12, 11, 12, 13, 12, 13, 14, or 13, 14, 15 of antisense strand, this number starting from the first nucleotide from the 5' end, or optionally this number starting from the first paired nucleotide in the double-stranded region from the 5' end.In some embodiments, Y'Y'Y' motif occurs at position 11, 12, 13.
[0438] In one embodiment, the Y'Y'Y' motif is all 2'-OMe modified nucleotides.
[0439] In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or k and l are both 1.
[0440] Thus, the antisense strand has the formula: 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p’ 3'(IIb), 5'n q’ -N a '-Y'Y'Y'-N b '-X'X'X'-n p’ 3'(IIc), or 5'n q’ -N a '-Z'Z'Z'-N b '-Y'Y'Y'-N b '-X'X'X'-N a '-n p’ 3'(IId), It can be expressed as:
[0441] When the antisense strand is represented by formula (IIb), N b ’ represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0442] When the antisense strand is represented by formula (IIc), N b ' represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a ' independently represent an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0443] When the antisense strand is represented by formula (IId), each N bEach N' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. a In some embodiments, N' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. b is 0, 1, 2, 3, 4, 5, or 6.
[0444] In other embodiments, k is 0 and l is 0 and the antisense strand has the formula: 5'n p’ -N a’ -Y'Y'Y'-N a’ -n q’ 3'(Ia) It can be expressed as:
[0445] When the antisense strand is represented by formula (IIa), each N a ' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0446] Each of X', Y' and Z' may be the same as or different from one another.
[0447] Each nucleotide of sense strand and antisense strand can be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro.For example, each nucleotide of sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.Each X, Y, Z, X', Y' and Z' can specifically represent 2'-O-methyl modification or 2'-fluoro modification.
[0448] In one embodiment, the sense strand of the RNAi agent can contain a YYY motif occurring at positions 9, 10, and 11 of the strand when the duplex region is 21 nt, the numbers starting from the first nucleotide from the 5' end, or optionally, the numbers starting from the 5' end with the first paired nucleotide in the duplex region, and Y represents a 2'-F modification. The sense strand can further contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the duplex region, and XXX and ZZZ each independently represent a 2'-OMe modification or a 2'-F modification.
[0449] In one embodiment, the antisense strand can contain a Y'Y'Y' motif occurring at positions 11, 12, or 13 of the strand, where the numbering starts from the first nucleotide from the 5' end, or optionally, the numbering starts from the 5' end with the first paired nucleotide in the duplex region, and Y' represents a 2'-O-methyl modification. The antisense strand can further contain an X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the duplex region, and X'X'X' and Z'Z'Z' each independently represent a 2'-OMe modification or a 2'-F modification.
[0450] The sense strand represented by any one of the above formulas (Ia), (Ib), (Ic), and (Id) forms a duplex with the antisense strand represented by any one of the above formulas (IIa), (IIb), (IIc), and (IId), respectively.
[0451] Thus, the RNAi agents used in the methods of the invention can include a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, and the RNAi duplex can have the formula (III): Sense: 5'np-Na-(XXX)i-Nb-YYY-Nb-(ZZZ)j-Na-nq3' Antisense: 3'np'-Na'-(X'X'X')k-Nb'-Y'Y'Y'-Nb'-(Z'Z'Z')l-Na'-nq'5' (III) During the ceremony, i, j, k, and l are each independently 0 or 1; p, p', q and q' each independently represent 0 to 6; each Na and Na' independently represents an oligonucleotide sequence containing 0 to 25 modified nucleotides, each sequence containing at least two differently modified nucleotides; each Nb and Nb' independently represents an oligonucleotide sequence comprising 0 to 10 modified nucleotides; wherein each np', np, nq', and nq, each of which may be present or absent, independently represents an overhanging nucleotide; XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
[0452] In one embodiment, i is 0 and j is 0, or i is 1 and j is 0, or i is 0 and j is 1, or i and j are both 0, or i and j are both 1. In another embodiment, k is 0 and l is 0, or k is 1 and l is 0, or k is 0 and l is 1, or k and l are both 0, or k and l are both 1.
[0453] An exemplary combination of sense and antisense strands that form an RNAi duplex is of the following formula: 5'np-Na-YYY-Na-nq3' 3'np'-Na'-Y'Y'Y'-Na'nq'5' (IIIa) 5'np-Na-YYY-Nb-ZZZ-Na-nq3' 3'np'-Na'-Y'Y'Y'-Nb'-Z'Z'Z'-Na'nq'5' (IIIb) 5'np-Na-XXX-Nb-YYY-Na-nq3' 3'np'-Na'-X'X'X'-Nb'-Y'Y'Y'-Na'-nq'5' (IIIc) 5'np-Na-XXX-Nb-YYY-Nb-ZZZ-Na-nq3' 3'np'-Na'-X'X'X'-Nb'-Y'Y'Y'-Nb'-Z'Z'Z'-Na-nq'5' (IIId).
[0454] When the RNAi agent is represented by Formula (IIIa), each Na independently represents an oligonucleotide sequence comprising 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0455] When an RNAi agent is represented by Formula (IIIb), each Nb independently represents an oligonucleotide sequence containing 1 to 10, 1 to 7, 1 to 5, or 1 to 4 modified nucleotides. Each Na' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0456] When an RNAi agent is represented by Formula (IIIc), each Nb, Nb' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. Each Na' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides.
[0457] When an RNAi agent is represented by Formula (IIId), each Nb, Nb' independently represents an oligonucleotide sequence containing 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 modified nucleotides. Each Na, Na' independently represents an oligonucleotide sequence containing 2 to 20, 2 to 15, or 2 to 10 modified nucleotides. Each of Na, Na', Nb, and Nb' independently comprises an alternating pattern of modifications.
[0458] Each of X, Y, and Z in formulas (III), (IIIa), (IIIb), (IIIc), and (IIId) may be the same or different from one another.
[0459] When an RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId), at least one of the Y nucleotides can be base-paired to one of the Y' nucleotides, alternatively, at least two of the Y nucleotides are base-paired to the corresponding Y' nucleotide, or all three Y nucleotides are base-paired to the corresponding Y' nucleotide.
[0460] When the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides can be base-paired with one of the Z' nucleotides, or at least two of the Z nucleotides can be base-paired with a corresponding Z' nucleotide, or all three Z nucleotides can be base-paired with a corresponding Z' nucleotide.
[0461] When the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides can be base-paired to one of the X' nucleotides, alternatively, at least two of the X nucleotides are base-paired to the corresponding X' nucleotide, or all three of the X nucleotides are base-paired to the corresponding X' nucleotide.
[0462] In one embodiment, the modification on the Y nucleotide is different from the modification on the Y' nucleotide, the modification on the Z nucleotide is different from the modification on the Z' nucleotide, and / or the modification on the X nucleotide is different from the modification on the X' nucleotide.
[0463] In one embodiment, when the RNAi agent has formula (IIId), the Na modification is a 2'-O-methyl or 2'-fluoro modification. In another embodiment, when the RNAi agent has formula (IIId), the Na modification is a 2'-O-methyl or 2'-fluoro modification, and np'>0 and at least one np' are linked to adjacent nucleotides via phosphorothioate linkages. In yet another embodiment, when the RNAi agent has formula (IIId), the Na modification is a 2'-O-methyl or 2'-fluoro modification, np'>0 and at least one np' are linked to adjacent nucleotides via phosphorothioate linkages, and the sense strand is conjugated to one or more GalNAc derivatives linked through a bivalent or trivalent branched linker (described below). In another embodiment, when the RNAi agent is represented by formula (IIId), the Na modification is a 2'-O-methyl or 2'-fluoro modification, np'>0 and at least one np' is linked to an adjacent nucleotide via a phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a divalent or trivalent branched linker.
[0464] In one embodiment, when the RNAi agent is represented by formula (IIIa), the Na modification is a 2'-O-methyl or 2'-fluoro modification, np'>0 and at least one np' is linked to an adjacent nucleotide via a phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a divalent or trivalent branched linker.
[0465] In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and these duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each duplex may target the same gene or two different genes, or each duplex may target the same gene at two different target sites.
[0466] In one embodiment, the RNAi agent is a multimer containing three, four, five, six or more double strands represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), and the double strands are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further comprises a ligand. Each double strand can target the same gene or two different genes, or each double strand can target the same gene at two different target sites.
[0467] In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc), and (IIId) are linked to each other at their 5' ends and optionally conjugated to a ligand at one or both of their 3' ends. The agents can each target the same gene or two different genes, or the agents can each target the same gene at two different target sites.
[0468] In certain embodiments, the RNAi agent of the present invention may contain a small number of nucleotides containing 2'-fluoro modifications, for example, 10 or fewer nucleotides with 2'-fluoro modifications. For example, the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides with 2'-fluoro modifications. In certain embodiments, the RNAi agent of the present invention contains 10 nucleotides with 2'-fluoro modifications, for example, 4 nucleotides with 2'-fluoro modifications in the sense strand and 6 nucleotides with 2'-fluoro modifications in the antisense strand. In another specific embodiment, the RNAi agent of the present invention contains 6 nucleotides with 2'-fluoro modifications, for example, 4 nucleotides with 2'-fluoro modifications in the sense strand and 2 nucleotides with 2'-fluoro modifications in the antisense strand.
[0469] In other embodiments, the RNAi agent of the present invention may contain a very small number of nucleotides containing 2'-fluoro modifications, for example, two or fewer nucleotides containing 2'-fluoro modifications. For example, the RNAi agent may contain two, one, or zero nucleotides with 2'-fluoro modifications. In certain embodiments, the RNAi agent may contain two nucleotides with 2'-fluoro modifications, for example, zero nucleotides with 2'-fluoro modifications in the sense strand and two nucleotides with 2'-fluoro modifications in the antisense strand.
[0470] Various publications describe the multimeric RNAi agent that can be used in the method of the present invention.These publications include WO2007 / 091269, US Patent No. 7,858,769, WO2010 / 141511, WO2007 / 117686, WO2009 / 014887 and WO2011 / 031520, each of which is incorporated herein by reference in its entirety.
[0471] In certain embodiments, the compositions and methods of the present disclosure include vinyl phosphonate (VP) modifications of RNAi agents as described herein. In exemplary embodiments, the 5'-vinyl phosphonate modified nucleotides of the present disclosure have the following structure: [ka] wherein X is O or S; R is hydrogen, hydroxy, fluoro, or C 1~20 alkoxy (e.g., methoxy or n-hexadecyloxy); R 5’ is =C(H)-P(O)(OH)2, and the C5' carbon and R 5’ and the double bond between B is a nucleobase or modified nucleobase, optionally B is adenine, guanine, cytosine, thymine, or uracil.
[0472] The vinyl phosphonate of the present disclosure can be attached to either the antisense or sense strand of the dsRNA of the present disclosure. In certain embodiments, the vinyl phosphonate of the present disclosure is attached to the antisense strand of the dsRNA, optionally at the 5' end of the antisense strand of the dsRNA.
[0473] Vinyl phosphonate modifications are also contemplated in the compositions and methods of the present disclosure. Exemplary vinyl phosphonate structures include those previously described, where R 5’ is =C(H)-OP(O)(OH)2, and the C5' carbon and R 5’ The double bond between is in the E or Z configuration (eg, E configuration).
[0474] As described in more detail below, RNAi agents containing one or more carbohydrate moieties conjugated to them can optimize one or more properties of the RNAi agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with a non-carbohydrate (preferably cyclic) carrier to which another moiety, such as a carbohydrate ligand, is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbon-cyclic system, i.e., all ring atoms are carbon atoms, or a heterocyclic system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.
[0475] The ligand can be attached to the polynucleotide via a carrier. The carrier comprises (i) at least one "backbone attachment point," e.g., two "backbone attachment points," and (ii) at least one "tethering attachment point." As used herein, "backbone attachment point" refers to a functional group, e.g., a hydroxyl group, or generally refers to a bond that is available and suitable for incorporating the carrier into the backbone of a ribonucleic acid, e.g., a phosphate or modified phosphate, e.g., sulfur-containing. In some embodiments, a "tethering attachment point" (TAP) refers to a ring atom, e.g., a carbon atom or heteroatom (other than the atom that provides the backbone attachment point), of the cyclic carrier to which the selected moiety is attached. This moiety can be, for example, a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide. Optionally, the selected moiety is attached to the cyclic carrier by an intervening tether. Thus, cyclic carriers often contain functional groups, such as amino groups, or generally bonds, that provide a linkage suitable for the incorporation or tethering of another chemical entity, such as a ligand, to the constituent ring.
[0476] The RNAi agent may be conjugated to the ligand via a carrier, which may be a cyclic or acyclic group; in some embodiments, the cyclic group is selected from the group consisting of pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; in some embodiments, the acyclic group is selected from a serinol backbone or a diethanolamine backbone.
[0477] iii.Thermal destabilization modification In certain embodiments, nucleic acid inhibitor molecules can be optimized for RNA interference by incorporating thermally destabilizing modifications into the seed region of the antisense strand.As used herein, "seed region" refers to the 2-9 positions of the 5' end of the reference strand.For example, thermally destabilizing modifications can be incorporated into the seed region of the antisense strand to reduce or inhibit off-target gene silencing.
[0478] The term "thermally destabilizing modification" refers to the melting temperature (T m ) lower than the overall melting temperature (T m For example, thermally destabilizing modifications include modifications that result in dsRNAs with a T m can be decreased by 1-4° C., e.g., 1, 2, 3, or 4 degrees Celsius. Also, the term "thermally destabilized nucleotide" refers to a nucleotide that contains one or more thermally destabilizing modifications.
[0479] It has been discovered that dsRNAs having an antisense strand containing at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5' end of the antisense strand have reduced off-target gene silencing activity. Thus, in some embodiments, the antisense strand contains at least one (e.g., one, two, three, four, five, or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5' region of the antisense strand. In some embodiments, the one or more thermally destabilizing modifications of the duplex are located at positions 2-9, e.g., positions 4-8, from the 5' end of the antisense strand. In some further embodiments, the thermally destabilizing modification of the duplex is located at positions 6, 7, or 8 from the 5' end of the antisense strand. In even further embodiments, the thermally destabilizing modification of the duplex is located at position 7 from the 5' end of the antisense strand. In some embodiments, the thermally destabilizing modification of the duplex is located at positions 2, 3, 4, 5, or 9 from the 5' end of the antisense strand.
[0480] In another embodiment of the invention, the iRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides. The RNAi agent has the following formula (L): [ka] (L), which can be expressed as:
[0481] In formula (L), B1, B2, B3, B1', B2', B3', and B4' are each independently a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA. In one embodiment, B1, B2, B3, B1', B2', B3', and B4' each contain a 2'-OMe modification. In one embodiment, B1, B2, B3, B1', B2', B3', and B4' each contain a 2'-OMe modification or a 2'-F modification. In one embodiment, at least one of B1, B2, B3, B1', B2', B3', and B4' contains a 2'-ON-methylacetamide (2'-O-NMA) modification.
[0482] C1 is a thermally destabilizing nucleotide located opposite the seed region of the antisense strand (i.e., positions 2-8 of the 5' end of the antisense strand). For example, C1 is located in the sense strand at a position that pairs with the nucleotide at positions 2-8 of the 5' end of the antisense strand. In one example, C1 is located at position 15 from the 5' end of the sense strand. The C1 nucleotide carries a thermally destabilizing modification that may include an abasic modification, a mismatch with the opposing nucleotide in the duplex, and a sugar modification, such as a 2'-deoxy modification, or an acyclic nucleotide, such as an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA). In one embodiment, C1 has a thermally destabilizing modification selected from the group consisting of: i) a mismatch with the opposing nucleotide in the antisense strand; ii) an abasic modification selected from the group consisting of: [ka] and iii) a sugar modification selected from the group consisting of: [ka] where B is a modified or unmodified nucleobase and R 1 and R 2 are independently H, halogen, OR, or alkyl; R 3 is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar. In one embodiment, the thermally destabilizing modification in C1 is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T, and optionally at least one nucleobase in the mismatch pair is a 2'-deoxynucleobase. In one example, the thermally destabilizing modification in C1 is GNA or [ka] is.
[0483] T1, T1', T2', and T3' each independently represent a nucleotide containing a modification that provides the nucleotide with steric bulk equal to or less than that of the 2'-OMe modification. Steric bulk refers to the sum of the steric effects of the modifications. Methods for determining the steric effect of a nucleotide modification are known to those skilled in the art. The modification may be at the 2'-position of the ribose sugar of the nucleotide, or may be a non-ribose nucleotide, an acyclic nucleotide, or a modification to the backbone of the nucleotide that is similar or equivalent to the 2'-position of the ribose sugar, and provides the nucleotide with steric bulk equal to or less than that of the 2'-OMe modification. For example, T1, T1', T2', and T3' are each independently selected from DNA, RNA, LNA, 2'-F, and 2'-F-5'-methyl. In one embodiment, T1 is DNA. In one embodiment, T1' is DNA, RNA, or LNA. In one embodiment, T2' is DNA or RNA. In one embodiment, T3' is DNA or RNA.
[0484] n 1 , n 3 , and q 1 are independently 4 to 15 nucleotides in length.
[0485] n 5 , q 3 , and q 7 are independently 1 to 6 nucleotides in length.
[0486] n 4 , q 2 , and q 6 are independently 1 to 3 nucleotides in length, or n 4 is 0 nucleotides long.
[0487] q 5 are independently 0 to 10 nucleotides in length.
[0488] n 2 , and q 4 are independently 0 to 3 nucleotides in length.
[0489] Or, n 4 is 0 to 3 nucleotides in length.
[0490] In one embodiment, n 4 can be 0. In one embodiment, n 4 is 0 and q 2 and q 6 is 1. In another example, n 4 is 0 and q 2 and q 6 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).
[0491] In one embodiment, n 4 , q 2 , and q 6 are each 1.
[0492] In one embodiment, n 2 , n 4 , q 2 , q 4 , and q 6 are each 1.
[0493] In one embodiment, C1 is selected from the group consisting of a sense strand having a length of 19 to 22 nucleotides and a 4 When C1 is 1, it is at positions 14 to 17 of the 5' end of the sense strand. In one embodiment, C1 is at position 15 of the 5' end of the sense strand.
[0494] In one embodiment, T3' begins at position 2 from the 5' end of the antisense strand. In one example, T3' is at position 2 from the 5' end of the antisense strand and 6 is equal to 1.
[0495] In one embodiment, T1' begins at position 14 from the 5' end of the antisense strand. 2 is equal to 1.
[0496] In an exemplary embodiment, T3' starts at position 2 from the 5' end of the antisense strand, and T1' starts at position 14 from the 5' end of the antisense strand. In one example, T3' starts at position 2 from the 5' end of the antisense strand, and q 6 is equal to 1, and T1' starts at position 14 from the 5' end of the antisense strand, and q 2 is equal to 1.
[0497] In one embodiment, T1' and T3' are separated by a length of 11 nucleotides (ie, not counting the T1' and T3' nucleotides).
[0498] In one embodiment, T1' is at position 14 from the 5' end of the antisense strand. In one example, T1' is at position 14 from the 5' end of the antisense strand, and 2 is equal to 1, and non-ribose acyclic or backbone modifications at the 2' position are less sterically bulky than 2'-OMe ribose.
[0499] In one embodiment, T3' is at position 2 from the 5' end of the antisense strand. In one example, T3' is at position 2 from the 5' end of the antisense strand, and 6 is equal to 1, and non-ribose acyclic or backbone modifications at the 2' position are less or equally sterically bulky than 2'-OMe ribose.
[0500] In one embodiment, T1 is at the cleavage site of the sense strand. In one example, T1 is at the cleavage site of the sense strand, where the sense strand is 19-22 nucleotides in length and n 2 is 1, it is at position 11 from the 5' end of the sense strand. In an exemplary embodiment, T1 is at position 11 from the 5' end of the sense strand when the sense strand is 19-22 nucleotides in length and n 2When is 1, it is at the cleavage site of the sense strand, which is at position 11 from the 5' end of the sense strand.
[0501] In one embodiment, T2' begins at position 6 from the 5' end of the antisense strand. In one example, T2' is at positions 6-10 from the 5' end of the antisense strand, and 4 is 1.
[0502] In an exemplary embodiment, T1 is a sequence in which the sense strand is 19-22 nucleotides in length and n 2 When T1 is 1, the cleavage site is in the sense strand, for example, at position 11 from the 5' end of the sense strand; T1' is at position 14 from the 5' end of the antisense strand, and q 2 is equal to 1, the modification to T1' is at the 2' position of the ribose sugar or at a non-ribose, acyclic, or intramolecular position that is less sterically bulky than 2'-OMe ribose; T2' is at positions 6-10 from the 5' end of the antisense strand, and q 4 is 1; and T3' is at position 2 from the 5' end of the antisense strand, and q 6 is equal to 1, and the modification to T3' is at the 2' position or at a non-ribose, acyclic, or backbone position that is less or equal in steric bulk to 2'-OMe ribose.
[0503] In one embodiment, T2' starts at position 8 from the 5' end of the antisense strand. In one example, T2' starts at position 8 from the 5' end of the antisense strand and 4 is 2.
[0504] In one embodiment, T2' begins at position 9 from the 5' end of the antisense strand. 4 is 1.
[0505] In one embodiment, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end of the antisense strand).
[0506] In one embodiment, n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end of the antisense strand).
[0507] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.
[0508] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end of the antisense strand).
[0509] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1is 6, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 7, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.
[0510] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 6, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 7, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand).
[0511] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.
[0512] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 6, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end of the antisense strand).
[0513] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 5, T2' is 2'-F, and q 4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, optionally accompanied by at least two additional TTs at the 3' end of the antisense strand.
[0514] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 5, T2' is 2'-F, and q4 is 1, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, optionally with at least two additional TTs at the 3' end of the antisense strand, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 of the sense strand (counting from the 5' end of the sense strand), and with two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 of the antisense strand (counting from the 5' end of the antisense strand).
[0515] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1.
[0516] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1 to 5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18 to 23 (counting from the 5' end) of the antisense strand.
[0517] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1.
[0518] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand).
[0519] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1.
[0520] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end of the antisense strand).
[0521] The dsRNAi agent can contain a phosphorus-containing group at the 5'-end of the sense or antisense strand. The 5'-terminal phosphorus-containing group can be 5'-terminal phosphate (5'-P), 5'-terminal phosphorothioate (5'-PS), 5'-terminal phosphorodithioate (5'-PS2), 5'-terminal vinylphosphonate (5'-VP), 5'-terminal methylphosphonate (MePhos), or 5'-deoxy-5'-C-malonyl ( [ka] When the 5'-terminal phosphorus-containing group is a 5'-terminal vinyl phosphonate (5'-VP), the 5'-VP may be a 5'-E-VP isomer (i.e., a trans-vinyl phosphonate, [ka] 5'-Z-VP isomer (i.e., cis-vinyl phosphonate, [ka] or a mixture thereof.
[0522] In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'-end of the sense strand.In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'-end of the antisense strand.
[0523] In one embodiment, the RNAi agent comprises a 5'-P. In one embodiment, the RNAi agent comprises a 5'-P in the antisense strand.
[0524] In one embodiment, the RNAi agent comprises a 5'-PS. In one embodiment, the RNAi agent comprises a 5'-PS in the antisense strand.
[0525] In one embodiment, the RNAi agent comprises a 5'-VP. In one embodiment, the RNAi agent comprises a 5'-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-Z-VP in the antisense strand.
[0526] In one embodiment, the RNAi agent comprises a 5'-PS2. In one embodiment, the RNAi agent comprises a 5'-PS2 in the antisense strand.
[0527] In one embodiment, the RNAi agent comprises a 5'-PS2. In one embodiment, the RNAi agent comprises a 5'-deoxy-5'-C-malonyl in the antisense strand.
[0528] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-PS.
[0529] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-P.
[0530] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0531] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-PS2.
[0532] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.
[0533] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.
[0534] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.
[0535] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0536] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.
[0537] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.
[0538] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also contains a 5'-P.
[0539] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The dsRNA agent also includes a 5'-PS.
[0540] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0541] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. The RNAi agent also includes a 5'-PS2.
[0542] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.
[0543] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end). The RNAi agent also includes a 5'-P.
[0544] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end). The RNAi agent also includes a 5'-PS.
[0545] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0546] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS2.
[0547] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes 5'-deoxy-5'-C-malonyl.
[0548] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-P.
[0549] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-PS.
[0550] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0551] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The dsRNAi RNA agent also includes a 5'-PS2.
[0552] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.
[0553] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.
[0554] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.
[0555] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0556] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.
[0557] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.
[0558] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-P.
[0559] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also contains a 5'-PS.
[0560] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0561] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. The RNAi agent also includes a 5'-PS2.
[0562] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1. RNAi agents also include 5'-deoxy-5'-C-malonyl.
[0563] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P.
[0564] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS.
[0565] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP. The 5'-VP can be a 5'-E-VP, a 5'-Z-VP, or a combination thereof.
[0566] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2.
[0567] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes 5'-deoxy-5'-C-malonyl.
[0568] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.
[0569] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.
[0570] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications at positions 1-5 of the sense strand (counting from the 5' end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand, and two phosphorothioate internucleotide linkage modifications at positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.
[0571] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.
[0572] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand), and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand, and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.
[0573] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.
[0574] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.
[0575] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-VP (e.g., 5'-E-VP, 5'-Z-VP, or a combination thereof) and a targeting ligand. In one embodiment, the 5'-VP is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.
[0576] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-PS2 and a targeting ligand. In one embodiment, the 5'-PS2 is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.
[0577] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4 and q 4 is 0, B3' is 2'-OMe or 2'-F, and q 5 is 7, T3' is 2'-F, and q 6 is 1, B4' is 2'-OMe, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 (counting from the 5' end) of the sense strand, and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18-23 (counting from the 5' end) of the antisense strand. The RNAi agent also includes a 5'-deoxy-5'-C-malonyl and a targeting ligand. In one embodiment, the 5'-deoxy-5'-C-malonyl is at the 5' end of the antisense strand, and the targeting ligand is at the 3' end of the sense strand.
[0578] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4 is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-P and a targeting ligand. In one embodiment, the 5'-P is at the 5' end of the antisense strand and the targeting ligand is at the 3' end of the sense strand.
[0579] In one embodiment, B1 is 2'-OMe or 2'-F, and n 1 is 8, T1 is 2'F, and n 2 is 3, B2 is 2'-OMe, and n 3 is 7 and n 4 is 0, B3 is 2'-OMe, and n 5 is 3, B1' is 2'-OMe or 2'-F, and q 1 is 9, T1' is 2'-F, and q 2 is 1, B2' is 2'-OMe or 2'-F, and q 3 is 4, T2' is 2'-F, and q 4is 2, B3' is 2'-OMe or 2'-F, and q 5 is 5, T3' is 2'-F, and q 6 is 1, B4' is 2'-F, and q 7 is 1, with two phosphorothioate internucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' end of the sense strand) and two phosphorothioate internucleotide linkage modifications at positions 1 and 2 of the antisense strand and two phosphorothioate internucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' end of the antisense strand). The RNAi agent also includes a 5'-PS and a targeting ligand. In one embodiment, the 5'-PS...
Claims
1. A pharmaceutical composition for reducing urinary oxalate levels in a human subject with recurrent calcium oxalate kidney stone disease, comprising a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof that inhibits expression of hydroxyacid oxidase 1 (HAO1), the dsRNA agent or salt thereof comprises a sense strand and an antisense strand forming a double-stranded region; the nucleotide sequence of the sense strand differs by no more than three nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand differs by no more than three nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36); wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, and as is 2'-O-methyladenosine-3'-phosphorothioate. c is 2'-O-methylcytidine-3'-phosphate, cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage; The pharmaceutical composition wherein said dsRNA agent or salt thereof is administered to said subject in a fixed dose of about 200 mg to about 600 mg.
2. The pharmaceutical composition according to claim 1, wherein the reduction of urinary calcium oxalate is a reduction of urinary calcium oxalate supersaturation.
3. 10. The pharmaceutical composition of claim 1, wherein administration of said dsRNA agent or salt thereof to said subject reduces clinical and radiological kidney stone events.
4. 10. The pharmaceutical composition of claim 1, wherein the dsRNA agent or salt thereof is administered to the subject at intervals of once every six months.
5. 10. The pharmaceutical composition of claim 1, wherein the dsRNA agent or salt thereof is administered to the subject initially, three months thereafter, and every six months thereafter.
6. 10. The pharmaceutical composition of claim 1, wherein said fixed dose of said dsRNA agent or salt thereof is about 284 mg.
7. 10. The pharmaceutical composition of claim 1, wherein said fixed dose of said dsRNA agent or salt thereof is about 567 mg.
8. 10. The pharmaceutical composition of claim 1, wherein the dsRNA agent or salt thereof is administered to the subject subcutaneously.
9. The pharmaceutical composition of claim 8, wherein the subcutaneous administration is a subcutaneous injection.
10. 2. The pharmaceutical composition of claim 1, wherein the nucleotide sequence of the sense strand differs by no more than two nucleotides from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the nucleotide sequence of the antisense strand differs by no more than two nucleotides from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
11. 2. The pharmaceutical composition of claim 1, wherein the nucleotide sequence of the sense strand differs by no more than one nucleotide from the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35) and the nucleotide sequence of the antisense strand differs by no more than one nucleotide from the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
12. 2. The pharmaceutical composition of claim 1, wherein the nucleotide sequence of the sense strand comprises the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the nucleotide sequence of the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36).
13. the dsRNA agent or salt thereof is conjugated to a ligand as shown in the following scheme: 【Chemical 1】 2. The pharmaceutical composition of claim 1, wherein X is O or S.
14. 14. The pharmaceutical composition of claim 13, wherein X is O.
15. 10. The pharmaceutical composition of claim 1, wherein the dsRNA agent is in a salt form.
16. 10. The pharmaceutical composition of claim 1, wherein the dsRNA agent or salt thereof is administered to the subject as a pharmaceutical formulation.
17. A pharmaceutical composition according to any one of claims 1 to 16 for use in combination with an additional therapeutic agent.
18. A pharmaceutical composition comprising a double-stranded ribonucleic acid (dsRNA) agent or a salt thereof that inhibits expression of hydroxyacid oxidase 1 (HAO1) for reducing calcium oxalate kidney stone incidence in a human subject with recurrent calcium oxalate kidney stone disease, the sense strand comprises the nucleotide sequence 5'-gsascuuuCfaUfCfCfuggaaauaua-3' (SEQ ID NO: 35), and the antisense strand comprises the nucleotide sequence 5'-usAfsuauUfuCfCfaggaUfgAfaagucscsa-3' (SEQ ID NO: 36); wherein Af is 2'-fluoroadenosine-3'-phosphate, Afs is 2'-fluoroadenosine-3'-phosphorothioate, Cf is 2'-fluorocytidine-3'-phosphate, U is uridine-3'-phosphate, Uf is 2'-fluorouridine-3'-phosphate, a is 2'-O-methyladenosine-3'-phosphate, as is 2'-O-methyladenosine-3'-phosphorothioate, and c is 2'-O-methylcytidine-3'-phosphate. cs is 2'-O-methylcytidine-3'-phosphorothioate, g is 2'-O-methylguanosine-3'-phosphate, gs is 2'-O-methylguanosine-3'-phosphorothioate, u is 2'-O-methyluridine-3'-phosphate, us is 2'-O-methyluridine-3'-phosphorothioate, and s is a phosphorothioate linkage, wherein the sense strand is conjugated to a ligand as shown in the following scheme: 【Chemistry 2】 wherein X is O; The pharmaceutical composition, wherein said dsRNA agent or salt thereof is administered to said subject in a fixed dose of from about 284 mg to about 567 mg.
19. 19. The pharmaceutical composition of claim 18, wherein the subject is suffering from two or more oxalate stone events.
20. 20. The pharmaceutical composition of claim 18, wherein the subject has elevated urinary oxalate levels.
21. 19. The pharmaceutical composition of claim 18, wherein the subject has suffered from two or more oxalate stone events and has elevated urinary oxalate levels.
22. 22. The pharmaceutical composition of any one of claims 18-21, wherein the dsRNA agent or salt thereof is administered to the subject once every six months.
23. 22. The pharmaceutical composition of any one of claims 18-21, wherein the dsRNA agent or salt thereof is administered to the subject initially, three months thereafter, and every six months thereafter.