Compounds and methods for modulating SCN1A expression

JP2024534157A5Pending Publication Date: 2025-09-02IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024513011
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-08-27
Filing Date
2022-08-26
Publication Date
2025-09-02

AI Technical Summary

Technical Problem

Current therapies are inadequate for treating developmental and epileptic encephalopathy diseases such as Dravet syndrome, which are characterized by prolonged seizures, behavioral dysfunctions, and other neurological deficits due to SCN1A mutations and haploinsufficiency.

Method used

Development of oligomeric compounds, including modified oligonucleotides, to modulate SCN1A RNA and protein expression by increasing full-length SCN1A RNA and protein levels, and reducing nonsense-mediated decay of SCN1A transcripts, thereby alleviating symptoms associated with SCN1A-related disorders.

Benefits of technology

The compounds effectively reduce seizure frequency and duration, improve behavioral and motor functions, and alleviate cognitive and autonomic nervous system dysfunctions in subjects with SCN1A-related disorders.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Provided are oligomeric compounds, methods, and pharmaceutical compositions for modulating the expression of SCN1A RNA and / or protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom of developmental disorders or epileptic encephalopathy disorders, such as, for example, Dravet syndrome. Such symptoms include convulsions, unexpected sudden death in epilepsy, status epilepticus, behavioral dysfunction, motor and balance dysfunction, orthopedic conditions, motor dysfunction, cognitive dysfunction, speech and language development delay, visual-motor integration dysfunction, visual-perceptual dysfunction, executive dysfunction, and autonomic dysfunction.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Sequence Listing This application has been filed with an electronic sequence listing, which is provided as a file named BIOL0440WOSEQ.xml, created on August 22, 2022, and having a size of 789 KB. The information in the electronic format of this sequence listing is incorporated herein by reference in its entirety.

[0002] Provided are oligomeric compounds, methods, and pharmaceutical compositions for modulating the expression of SCN1A RNA and / or protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom of developmental disorders or epileptic encephalopathy disorders, such as, for example, Dravet syndrome. Such symptoms include convulsions, unexpected sudden death in epilepsy, status epilepticus, behavioral dysfunction, motor and balance dysfunction, orthopedic conditions, motor dysfunction, cognitive dysfunction, speech and language development delay, visual-motor integration dysfunction, visual-perceptual dysfunction, executive dysfunction, and autonomic dysfunction. [Background technology]

[0003] The human gene SCN1A encodes the human SCN1A protein, which is the α-1 subunit of the voltage-gated sodium channel NaV1.1. Mutations in SCN1A result in developmental and epileptic encephalopathies (DEE), including Dravet syndrome (previously known as severe myoclonic epilepsy of infancy (SMEI)), one of the most severe childhood forms of epilepsy; other epileptic disorders, including genetic epilepsy with febrile seizures plus (GEFS+) and other febrile seizures, idiopathic / generalized epilepsy (IGE / GGE), temporal lobe epilepsy, micronion-atonic epilepsy (MAE), Lennox-Gastaut syndrome, and focal migratory childhood epilepsy (MMPSI); and familial hemiplegic migraine with or without epilepsy (Harkin, LA, et al., 2007, Brain 130, 843-852; Escayg, A., et al., 2007, Brain 130, 843-852; al., 2010, Epilepsia 51, 1650-1658; Miller IO, et al., 2007 Nov 29 [Updated 2019 Apr 18]. In: Adam MP, Ardinger HH, Pagon RA, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2020. Available from: https: / / www.ncbi.nlm.nih.gov / books / NBK1318 / ).

[0004] DEE is also associated with SCN1A haploinsufficiency (Parihar, R., et al., 2013, J. Human Genetics, 58, 573-580). Symptoms associated with DEE, including Dravet syndrome, include prolonged convulsions (often lasting more than 10 minutes), frequent convulsions (e.g., ictal, clonic, absence, focal, tomographic, and tonic convulsions), sudden unexpected death in epilepsy, status epilepticus, behavioral dysfunction (e.g., aggression, agitation, obsession, maintenance, hoarding, or sleep disorders), motor and balance dysfunction, orthopedic condition, motor system dysfunction (e.g., ataxia, tremor, dysarthria, pyramidal, and extrapyramidal signs), cognitive dysfunction, delayed speech development, visual-motor integration dysfunction, visual-perceptual dysfunction, executive dysfunction, and autonomic dysfunction. Patients with Dravet syndrome experience further neurodevelopmental delays, which lead to severe nervous system disorders (Guzzetta, F., 2011, Epilepsia 52:S2, 35-38; Anwar et al., 2019, Cureus 11, e5006).

[0005] Alternative splicing of SCN1A results in multiple SCN1A transcript variants (Parihar, R., et al., 2013). Certain transcript variants include nonsense-mediated decay inclusion exons (NIEs) (Steward, CA, et al., 2019, npj Genom. Med. 4, 31; Carvill et al., 2018, American J. Human Genetics, 103, 1022-1029). One such NIE (NIE-1), which is 64 nucleobases long and located in SCN1A intron 20, causes the degradation of SCN1A transcripts (Carvill et al., 2018).

[0006] Currently, there remains a need for therapies to treat Dravet syndrome, GEFS+, and other DEE. It is therefore an object herein to provide oligomeric compounds, methods, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0007] Provided herein are compounds, methods, and pharmaceutical compositions for modulating the expression of SCN1A RNA and / or protein in a cell or subject. In certain embodiments, the amount of SCN1A RNA and / or SCN1A protein is increased. In certain embodiments, the compound, method, or pharmaceutical composition modulates splicing of SCN1A RNA. In certain embodiments, the amount of full-length SCN1A RNA and / or full-length SCN1A protein is increased. In certain embodiments, the amount of SCN1A RNA including NIE is decreased. In certain embodiments, the amount of SCN1A RNA excluding NIE is increased. In certain embodiments, the NIE is NIE-1. In certain embodiments, the compounds, methods, and pharmaceutical compositions are useful for treating a disease or disorder associated with SCN1A. In certain embodiments, the disease or disorder associated with SCN1A is SCN1A haploinsufficiency. In certain embodiments, the disease or disorder associated with SCN1A is developmental disorder or epileptic encephalopathy disease (DEE). In certain embodiments, the developmental disorder or epileptic encephalopathy disease is any of genetic epilepsy with febrile seizures plus (GEFS+), febrile seizures, idiopathic / generalized epilepsy (IGE / GGE), temporal lobe epilepsy, micrognathic epilepsy (MAE), Lennox-Gastaut syndrome, or focal migratory childhood epilepsy (MMPSI). In certain embodiments, the developmental disorder or epileptic encephalopathy disease is Dravet syndrome. In certain embodiments, DEE is treated by increasing the amount of full-length SCN1A RNA and / or full-length SCN1A protein in a subject, or in cells thereof, with a compound capable of excluding the NIE from SCN1A RNA. In certain embodiments, excluding the NIE from SCN1A RNA reduces or prevents degradation of the SCN1A transcript by the NMD pathway. In certain embodiments, excluding the NIE from SCN1A RNA increases full-length SCN1A RNA and / or full-length SCN1A protein, where removing the NIE prevents degradation of the SCN1A transcript by the NMD pathway. In certain embodiments, compounds useful for modulating splicing of SCN1A RNA are oligomeric compounds.In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide.

[0008] Also provided are compounds useful for alleviating at least one symptom or characteristic of a disease or disorder associated with SCN1A. In some embodiments, the disease or disorder associated with SCN1A is DEE. In certain embodiments, the DEE is Dravet syndrome. In certain embodiments, the symptoms or characteristics of DEE include prolonged convulsions (often lasting more than 10 minutes), frequent convulsions (e.g., seizure state, clonic state, absence state, focal state, obsessive state, and tonic convulsions), unexpected sudden death in epilepsy, status epilepticus, behavioral dysfunction (e.g., aggression, agitation, obsession, maintenance, food hoarding, or sleep disorder), motor and balance dysfunction, orthopedic state, motor system dysfunction (e.g., ataxia, tremor, dysarthria, pyramidal, and extrapyramidal signs), cognitive dysfunction, speech and language development delay, visual-motor integration dysfunction, visual-perceptual dysfunction, executive dysfunction, and autonomic neuropathy. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] It should be understood that both the foregoing Summary of the Invention and the following Detailed Description are merely exemplary and explanatory, and not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the term "including" and other forms of "includes" and "included" are not limiting. Also, terms such as "element" or "component" encompass both elements and components that include one unit, and elements and components that include two or more subunits, unless expressly stated otherwise.

[0010] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including, but not limited to, patents, patent applications, articles, books, and papers, and GenBank and NCBI reference sequence records, are expressly incorporated herein by reference in their entirety with respect to the portions of the documents discussed herein.

[0011] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0012] Unless otherwise indicated, the following terms have the following meanings.

[0013] As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D ribosyl structure as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside can include a modified nucleobase or can include an RNA nucleobase (uracil).

[0014] As used herein, "2'-MOE" means a 2'-O(CH2)2OCH3 group in place of the 2'-OH group in a furanosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" means a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.

[0015] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0016] As used herein, "2'-NMA" refers to a -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group in a furanosyl sugar moiety. "2'-NMA sugar moiety" refers to a sugar moiety having a 2'-O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of the furanosyl sugar moiety. Unless otherwise indicated, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" refers to ON-methylacetamide.

[0017] As used herein, "2'-NMA nucleoside" means a nucleoside that includes a 2'-NMA sugar moiety.

[0018] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with reference to the sugar moiety means that the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0019] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0020] As used herein, "administering" means providing a pharmaceutical agent to a subject.

[0021] As used herein, "ameliorating" in the context of treatment means that at least one symptom or characteristic is improved compared to the same symptom or characteristic in the absence of the treatment. In certain embodiments, amelioration is a decrease in the severity or frequency of the symptom or characteristic, or a delay in the onset or progression of the symptom or characteristic. In certain embodiments, the symptom or feature is prolonged convulsions (often lasting more than 10 minutes), frequent convulsions (e.g., ictal, clonic, absence, focal, tonic, and tonic convulsions), sudden unexpected death in epilepsy, status epilepticus, behavioral dysfunction (e.g., aggression, agitation, obsession, maintenance, food hoarding, or sleep disorders), and developmental delay, motor and balance dysfunction, orthopedic conditions, motor system and cognitive dysfunction (e.g., ataxia, tremor, dysarthria, pyramidal, and extrapyramidal signs), cognitive dysfunction, delayed speech development problems, visual-motor integration dysfunction, visual-perceptual dysfunction, executive dysfunction, growth and nutrition problems, insomnia, chronic infections, sensory integration disorders, or autonomic neuropathy.

[0022] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0023] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0024] As used herein, "conjugate linker" means a single bond or a group of atoms that contains at least one bond that connects a conjugate moiety to an oligonucleotide.

[0025] As used herein, "conjugate moiety" means a grouping of atoms that alters one or more properties of a molecule, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance, compared to the same molecule lacking the conjugate moiety.

[0026] As used herein, an "internucleoside linkage" is a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, a "modified internucleoside linkage" means any internucleoside linkage other than a phosphodiester internucleoside linkage.

[0027] As used herein, "linked nucleosides" are nucleosides that are joined in a contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0028] As used herein, "linker-nucleoside" refers to a nucleoside that links an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker-nucleoside is located within the conjugate linker of an oligomeric compound. The linker-nucleoside is not considered part of the oligonucleotide portion of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0029] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0030] As used herein, a "nonsense-mediated decay inclusion exon (NIE)" is an exon, or pseudoexon, that can activate the nonsense-mediated decay (NMD) pathway when included in an mRNA transcript. "NIE-1" is a 64 nucleobase long NIE located in intron 20 of the SCN1A gene (chr2:166863579-166864271, hg19; Carvill et al., 2018) that, when present in the transcript, triggers degradation of the SCN1A transcript. In certain embodiments, human NIE-1 has the nucleobase sequence of SEQ ID NO: 16. In certain embodiments, mouse NIE-1 has the nucleobase sequence of SEQ ID NO: 17.

[0031] As used herein, "modified nucleoside" means a nucleoside that contains a modified nucleobase and / or a modified sugar moiety.

[0032] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclyl moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other modified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0033] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0034] As used herein, "nucleoside" means a compound, or a fragment of such a compound, that includes a nucleobase and a sugar moiety, each of which is independently unmodified or modified.

[0035] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound can be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or can be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0036] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences.

[0037] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside bonds, where each nucleoside and internucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0038] As used herein, "pharmaceutical acceptable carriers or diluents" refers to any substance suitable for use in administration to animals. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutical acceptable diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0039] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharma- ceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects.

[0040] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition shows activity in a free uptake assay in certain cell lines.

[0041] As used herein, "stereically random" or "stereically random chiral center" in the context of a population of molecules having the same molecular formula means a chiral center that is not controlled during synthesis or enriched after synthesis for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules that includes a stereochemically random chiral center, the number of molecules having the stereochemically random chiral center's (S) configuration may be the same as the number of molecules having the stereochemically random chiral center's (R) configuration ("racemic"), but is not necessarily the same. In certain embodiments, the stereochemically random chiral center is not racemic, for example, due to the action of non-chiral reagents near the enriched stereochemistry of the adjacent sugar moieties, resulting in a certain absolute configuration being enriched after synthesis. In certain embodiments, the stereochemically random chiral center is a stereochemically random phosphorothioate internucleoside linkage.

[0042] As used herein, "subject" means a human or non-human animal.

[0043] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl sugar moiety, as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H) deoxyribosyl sugar moiety, as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0044] As used herein, "sugar surrogate" refers to a modified sugar moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group, in an oligonucleotide, but is not a furanosyl sugar moiety or a bicyclic sugar moiety. Modified nucleosides, including sugar surrogates, can be incorporated into one or more positions in an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids. Examples of sugar surrogates include GNA (glycol nucleic acid), FHNA (fluorohexitol nucleic acid), morpholino, and other structures described herein and known in the art.

[0045] As used herein, "symptom or characteristic" refers to any physical feature or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristic is apparent during an invasive diagnostic test, including but not limited to a post-mortem test. In certain embodiments, the characteristic is apparent during an MRI scan of the brain.

[0046] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an oligomeric compound is designed to affect. Target RNA refers to an RNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.

[0047] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0048] As used herein, "terminal group" refers to a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0049] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of an antisense compound. In certain embodiments, antisense activity is the modulation of splicing of target pre-mRNA.

[0050] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0051] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0052] As used herein, a "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0053] As used herein, "antisense oligonucleotide" refers to an oligonucleotide that comprises an oligonucleotide portion of an antisense compound that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0054] As used herein, "sense oligonucleotide" means an oligonucleotide that contains an oligonucleotide portion of a sense compound that is capable of hybridizing to an antisense oligonucleotide.

[0055] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Without being limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0056] As used herein, "treating" means improving a disease or condition in a subject by administering an oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom as compared to the same symptom without treatment. In certain embodiments, treating reduces the severity or frequency of a symptom, delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.

[0057] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that confers a therapeutic effect on a subject. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0058] Certain embodiments Embodiment 1. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: A ns G no T no T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 23), A ns G no T ns T no G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 24), A ns G no T ns T ns G no G ns A ns G ns m C ns A ns A ns G ns A ns T nsT ns A ns T ns m C n (Allocation number 25), A ns G no T ns T ns G ns G no A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (Allocation number 26), A ns G no T ns T ns G ns G ns A ns G no m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (Allocation number 27), A ns G ns T ns T no G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (Allocation number 28), Ans G ns T ns T ns G ns G ns A ns G no m C no A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 29), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A no A no G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 30), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A no T ns T ns A ns T ns m C n (SEQ ID NO: 31), A ns G no T ns T ns G ns G ns A ns Gns m C ns A no A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 32), A ns G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A ns T ns T ns A ns T ns m C n (SEQ ID NO: 33), A ns G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 34), A ns G ns T ns T ns G ns G no A no G ns m C ns A ns A ns G ns A ns Tns T ns A ns T ns m C n (Allocation number 35), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T no T no A ns T ns m C n (Allocation number 36), A ns G ns T ns T ns G ns G ns A no G ns m C ns A ns A ns G ns A ns T ns T no A ns T ns m C n (Allocation number 37), A ns G ns T ns T ns G ns G ns A ns G ns m C no A ns A ns G ns A ns T ns T no A ns T ns m C n (Allocation number 38), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A no G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 39), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A no T ns T no A ns T ns m C n (SEQ ID NO: 40), A ns G ns T ns T ns G ns G ns A ns G ns m C no A ns A ns G ns A ns T no T ns A ns T ns m C n (SEQ ID NO: 41), A ns G ns T ns T ns G ns G ns A ns Gns m C ns A ns A ns G no A ns T no T ns A ns T ns m C n (SEQ ID NO: 42), A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO:43), or A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C no m C n (SEQ ID NO:44) [In formula: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, n=2'-NMA sugar moiety, s=phosphorothioate internucleoside linkage, and o=phosphodiester internucleoside linkage].

[0059] Embodiment 2. The oligomeric compound of embodiment 1, consisting of the modified oligonucleotide described above.

[0060] Embodiment 3. The oligomeric compound of embodiment 1 or embodiment 2, wherein said modified oligonucleotide is a free acid.

[0061] Embodiment 4. The oligomeric compound of embodiment 1 or embodiment 2, wherein said modified oligonucleotide is a salt.

[0062] Embodiment 5. The oligomeric compound of embodiment 4, wherein said modified oligonucleotide is a sodium or potassium salt.

[0063] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide consisting of 17 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 19-22, or 63-86, wherein said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0064] Embodiment 7. The oligomeric compound of embodiment 6, wherein said modified oligonucleotide consists of 18 to 25 linked nucleosides.

[0065] Embodiment 8. The oligomeric compound according to any of embodiments 6 to 7, wherein said modified oligonucleotide consists of 18, 23, or 25 linked nucleosides.

[0066] Embodiment 9. The oligomeric compound according to embodiment 6, wherein the nucleobase sequence of the modified oligonucleotide comprises any of the nucleobase sequences of SEQ ID NOs: 19-22, or 63-86.

[0067] Embodiment 10. The oligomeric compound according to embodiment 6, wherein the nucleobase sequence of the modified oligonucleotide consists of any one of the nucleobase sequences of SEQ ID NOs: 19 to 22, or 63 to 86.

[0068] Embodiment 11. The oligomeric compound of any of embodiments 6 to 10, wherein said modified oligonucleotide comprises at least one modified sugar moiety.

[0069] Embodiment 12. The oligomeric compound of any of embodiments 11, wherein said modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.

[0070] Embodiment 13. The oligomeric compound of embodiment 12, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-NMA sugar moiety.

[0071] Embodiment 14. The oligomeric compound of any of embodiments 11-13, wherein each nucleoside of said modified oligonucleotide comprises a modified sugar moiety.

[0072] Embodiment 15. The oligomeric compound according to any of embodiments 11-14, wherein each modified sugar moiety is a 2'-NMA sugar moiety.

[0073] Embodiment 16. The oligomeric compound according to any of embodiments 6 to 15, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

[0074] Embodiment 17. The oligomeric compound of embodiment 16, wherein said at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0075] Embodiment 18. The oligomeric compound according to embodiment 16 or embodiment 17, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0076] Embodiment 19. The oligomeric compound of any of embodiments 16-18, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage, and a phosphorothioate internucleoside linkage.

[0077] Embodiment 20. The oligomeric compound of any of embodiments 16, 17, or 19, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0078] Embodiment 21. The oligomeric compound according to any of embodiments 6 to 20, wherein said modified oligonucleotide comprises at least one modified nucleobase.

[0079] Embodiment 22. The oligomeric compound of embodiment 21, wherein said modified nucleobase is 5-methylcytosine.

[0080] Embodiment 23. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: G ns G ns T no A no G ns m C ns A ns A ns A ns A ns G ns G ns G ns G ns T ns A ns A ns T ns A ns m C ns A ns G ns T n (SEQ ID NO:45); G ns Gns T ns A ns G ns m C ns A ns A ns A ns A ns G ns G ns G ns G ns T ns A ns A ns T ns A ns m C ns A ns G ns T n (SEQ ID NO: 46), A ns T ns m C no m C no A ns A no G no T ns T no G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 47), T ns m C ns m C no A no A ns G no T no T ns G no G no A ns G ns m Cns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 48), m C ns m C ns A no A no G ns T no T no G ns G no A no G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 49), m C ns A ns A no G no T ns T no G no G ns A no G no m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m Cns T ns A ns T ns A n (Array No. 50), A ns T ns m C no m C no A ns A no G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (Array No. 51), T ns m C ns m C no A no A ns G no T no T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (Array No. 52), m C ns mC ns A no A no G ns T no T no G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 53), m C ns A ns A no G no T ns T no G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 54), A ns T ns m C no m C no A ns A ns G ns T ns T ns G ns Gns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 55), T ns m C ns m C no A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 56), m C ns m C ns A no A no G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns Tns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 57), m C ns A ns A no G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 58), A ns T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m Cns T n (Array No. 59), T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (Array No. 60), m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (Array No. 61), or m C ns A ns A ns Gns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO:62) [In formula: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, n=2'-NMA sugar moiety, s=phosphorothioate internucleoside linkage, and o=phosphodiester bond].

[0081] Embodiment 24. The oligomeric compound of embodiment 23, consisting of the modified oligonucleotide described above.

[0082] Embodiment 25. The oligomeric compound according to embodiment 23 or embodiment 24, wherein said modified oligonucleotide is a free acid.

[0083] Embodiment 26. The oligomeric compound according to embodiment 23 or embodiment 24, wherein said modified oligonucleotide is a salt.

[0084] Embodiment 27. The oligomeric compound of embodiment 26, wherein said modified oligonucleotide is a sodium or potassium salt.

[0085] Embodiment 28. The population of oligomeric compounds according to any of embodiments 1-27, wherein all of said modified oligonucleotides' phosphorothioate internucleoside linkages are sterically random.

[0086] Embodiment 29. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 27, or a population of oligomeric compounds according to embodiment 28, and a pharma- ceutically acceptable diluent.

[0087] Embodiment 30. The pharmaceutical composition of embodiment 29, wherein the pharma- cerebrospinal fluid (aCSF) or PBS is used.

[0088] Embodiment 31. The pharmaceutical composition of embodiment 29 or embodiment 30, consisting essentially of the oligomeric compound and aCSF or PBS.

[0089] Embodiment 32. The pharmaceutical composition of any of embodiments 29-31, consisting essentially of the population of modified oligonucleotides or the population of oligomeric compounds described above and aCSF or PBS.

[0090] Embodiment 33. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1-27, a population of oligomeric compounds according to embodiment 28, or a pharmaceutical composition according to any one of embodiments 29-32.

[0091] Embodiment 34. A method for treating a disease associated with SCN1A, comprising administering to a subject having a disease associated with SCN1A a therapeutically effective amount of an oligomeric compound according to any one of embodiments 1-27, a population of oligomeric compounds according to embodiment 28, or a pharmaceutical composition according to any one of embodiments 29-32, thereby treating the disease associated with SCN1A.

[0092] Embodiment 35. The method of embodiment 34, wherein the disease associated with SCN1A is a developmental disorder or an epileptic encephalopathy disease.

[0093] Embodiment 36. The method of embodiment 35, wherein the developmental disorder or epileptic encephalopathy disease is Dravet Syndrome.

[0094] Embodiment 37. The method of embodiment 35 or embodiment 36, wherein the developmental disorder or epileptic encephalopathy disease is any of genetic epilepsy with febrile seizures plus (GEFS+), febrile seizures, idiopathic / generalized epilepsy (IGE / GGE), temporal lobe epilepsy, microglia-atonic epilepsy (MAE), Lennox-Gastaut syndrome, or focal migratory childhood epilepsy (MMPSI).

[0095] Embodiment 38. The method of any of embodiments 33-37, wherein administering the oligomeric compound, population of oligomeric compounds, or pharmaceutical composition reduces seizure frequency, reduces seizure duration, alleviates status epilepticus, improves behavioral function, improves movement and balance, improves orthopedic status, improves motor function, alleviates cognitive impairment, improves speech, improves visual motor integration function, improves visual perception function, improves executive function, or alleviates autonomic dysfunction.

[0096] Embodiment 39. The method of embodiment 38, wherein the convulsions are frequent or of long duration.

[0097] Embodiment 40. The method of embodiment 38 or embodiment 39, wherein the convulsions are either ictal, clonic, absent, focal, hypokinetic, or tonic.

[0098] Embodiment 41. The method of any of embodiments 33-40, wherein the frequency of seizures is reduced.

[0099] Embodiment 42. The method of any of embodiments 33-41, wherein the duration of a seizure is reduced.

[0100] Embodiment 43. The method of any one of embodiments 33-42, wherein the subject is a human.

[0101] Embodiment 44. A method of increasing expression of SCN1A in a cell, comprising contacting said cell with an oligomeric compound according to any one of embodiments 1 to 27, a population of oligomeric compounds according to embodiment 28, or a pharmaceutical composition according to any one of embodiments 29 to 32.

[0102] Embodiment 45. A method of modulating splicing of SCN1A RNA in a cell, comprising contacting said cell with an oligomeric compound according to any of embodiments 1 to 27.

[0103]

[0046] Embodiment 46. The method of embodiment 45, wherein the amount of SCN1A RNA that contains a NIE is reduced.

[0104]

[0046] Embodiment 47. The method of embodiment 45 or embodiment 46, wherein the amount of SCN1A RNA, which contains NIE-1, is reduced.

[0105] Embodiment 48. The method of any of embodiments 45-47, wherein the amount of SCN1A RNA excluding NIE is increased.

[0106] Embodiment 49. The method of any of embodiments 45-48, wherein the amount of SCN1A RNA, excluding NIE-1, is increased.

[0107] Embodiment 50. The method of any of embodiments 45-49, wherein the cell is a cerebral cortex, hippocampus, brainstem, or thalamus cell.

[0108] Embodiment 51. The method of any one of embodiments 45 to 50, wherein the cell is a human cell.

[0109] Embodiment 52. Use of an oligomeric compound according to any of embodiments 1 to 27, a population of oligomeric compounds according to embodiment 28, or a pharmaceutical composition according to any of embodiments 29 to 32 for treating a disease associated with SCN1A.

[0110] Embodiment 53. Use of an oligomeric compound according to any of embodiments 1 to 27, a population of oligomeric compounds according to embodiment 28, or a pharmaceutical composition according to any of embodiments 29 to 32 in the manufacture of a medicament for the treatment of a disease associated with SCN1A.

[0111] Embodiment 54. The use according to embodiment 52 or embodiment 53, wherein the disease associated with SCN1A is a developmental disorder or an epileptic encephalopathy disease.

[0112] Embodiment 55. The use of embodiment 54, wherein the developmental disorder or epileptic encephalopathy disease is Dravet syndrome.

[0113] Embodiment 56. The use according to embodiment 54 or embodiment 55, wherein the developmental disorder or epileptic encephalopathy disease is any of genetic epilepsy with febrile seizures plus (GEFS+), febrile seizures, idiopathic / generalized epilepsy (IGE / GGE), temporal lobe epilepsy, microglia-atonic epilepsy (MAE), Lennox-Gastaut syndrome, or focal migratory childhood epilepsy (MMPSI).

[0114] Certain compositions In certain embodiments, the compound is represented by the chemical symbols in the table below. [Table 1-1] [Table 1-2] [In the formula, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, n=2'-NMA sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage]

[0115] I. Certain Oligonucleotides In certain embodiments, oligomeric compounds are provided herein that include oligonucleotides that are comprised of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or can be modified oligonucleotides. Modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (including modified sugar moieties and / or modified nucleobases) and / or at least one modified internucleoside linkage.

[0116] Certain embodiments provide oligomeric compounds comprising modified oligonucleotides consisting of 17-30 linked nucleosides, the oligomeric compounds having a nucleobase sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 19-22, or 63-86, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified oligonucleotide consists of 18-25 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18, 23, or 25 linked nucleosides.

[0117] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide comprising a nucleobase sequence set forth in any of SEQ ID NOs: 19-22, or 63-86.

[0118] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of a nucleobase sequence set forth in any of SEQ ID NOs: 19-22, or 63-86.

[0119] Certain embodiments provide oligomeric compounds comprising modified oligonucleotides according to the following chemical representations: A ns G no T no T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 23), A ns G no T ns T no G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 24), A ns G no T ns T ns G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 25), A ns G no Tns T ns G ns G no A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 26), A ns G no T ns T ns G ns G ns A ns G no m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 27), A ns G ns T ns T no G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 28), A ns G ns T ns T ns G ns G ns A ns G no m Cno A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 29), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A no A no G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 30), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A no T ns T ns A ns T ns m C n (SEQ ID NO: 31), A ns G no T ns T ns G ns G ns A ns G ns m C ns A no A ns G ns A ns T ns T ns Ans T ns m C n (Allocation number 32), A ns G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A ns T ns T ns A ns T ns m C n (Allocation number 33), A ns G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T no A ns T ns m C n (Allocation number 34), A ns G ns T ns T ns G ns G no A no G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (Allocation number 35), A ns G nsT ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T no T no A ns T ns m C n (SEQ ID NO: 36), A ns G ns T ns T ns G ns G ns A no G ns m C ns A ns A ns G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 37), A ns G ns T ns T ns G ns G ns A ns G ns m C no A ns A ns G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 38), A ns G ns T ns T ns G ns G ns A ns G ns m Cns A ns A no G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 39), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A no T ns T no A ns T ns m C n (SEQ ID NO: 40), A ns G ns T ns T ns G ns G ns A ns G ns m C no A ns A ns G ns A ns T no T ns A ns T ns m C n (SEQ ID NO: 41), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A ns T no T ns Ans T ns m C n (SEQ ID NO: 42), A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 43), or A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C no m C n (SEQ ID NO:44) [In formula: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, n=2'-NMA sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage]

[0120] Certain embodiments provide oligomeric compounds comprising modified oligonucleotides according to the following chemical representations: G ns G ns T no A no G ns m C ns A ns A ns A ns A ns G ns G ns G ns G ns T ns A ns A ns T ns A ns m C ns A ns G ns T n (SEQ ID NO:45), G ns G ns T ns A ns G ns m C ns A ns A ns A ns A ns G ns G ns G ns G ns T ns A ns A ns T ns A ns m C ns A ns G ns T n (SEQ ID NO:46), A ns T ns m C no m C no A ns A no G no T ns T no G no G ns A ns Gns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 47), T ns m C ns m C no A no A ns G no T no T ns G no G no A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 48), m C ns m C ns A no A no G ns T no T no G ns G no A no G ns m C ns A ns A ns G ns A ns T ns T ns A ns T nsm C ns m C ns T ns A ns T n (SEQ ID NO:49), m C ns A ns A no G no T ns T no G no G ns A no G no m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO:50), A ns T ns m C no m C no A ns A no G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO:51), T nsm C ns m C no A no A ns G no T no T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 52), m C ns m C ns A no A no G ns T no T no G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 53), m C ns A ns A no G no T ns T no G no G ns A ns Gns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 54), A ns T ns m C no m C no A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 55), T ns m C ns m C no A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns Tns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 56), m C ns m C ns A no A no G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 57), m C ns A ns A no G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n(Array No. 58), A ns T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (Array No. 59), T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (Array No. 60), m C ns m C ns A ns A ns G ns Tns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 61), or m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO:62) [In formula: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, n=2'-NMA sugar moiety, s=phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage]

[0121] A. Certain modified nucleosides A modified nucleoside comprises a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases can be incorporated into a modified oligonucleotide:

[0122] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring containing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be present at any position of the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-O(CH2)2OCH3 ("MOE", or "O-methoxyethyl") and 2'-ON methylacetamide ("NMA") (see US 6,147,200, Prakash et al., 2003, Org. Lett., 5,403-6).

[0123] "2'-ON-methylacetamide nucleoside," or "2'-NMA nucleoside," is shown below. [ka]

[0124] In certain embodiments, the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-NMA sugar moiety. In certain embodiments, each nucleoside of a modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each modified sugar moiety is a 2'-NMA sugar moiety. In certain embodiments, each nucleoside of a modified oligonucleotide comprises a 2'-NMA sugar moiety.

[0125] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric structure. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric structures other than the naturally occurring β-D-deoxyribosyl structure. Such modified sugar moieties are described, for example, in WO 2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional chiral center at the 2' position compared to 2'-deoxyfuranosyl sugar moieties. Thus, such sugar moieties have a total of 16 possible isomeric structures. 2'-modified sugar moieties described herein are β-D-ribosyl isomeric structures unless otherwise specified.

[0126] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobase.Examples of modified nucleobase include 5-methylcytosine.

[0127] Publications that teach the preparation of certain modified nucleobases include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al. al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.

[0128] 3. Certain modified internucleoside linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide can be linked together using one or more modified internucleoside linkages. Two main classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphates, including phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S"). Compared to naturally occurring phosphate linkages, modified internucleoside linkages can be used to alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0129] Representative internucleoside linkages with chiral centers include, but are not limited to, phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing sterically random internucleoside linkages, or as a population of modified oligonucleotides containing phosphorothioate or other linkages that contain chiral centers in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are sterically random. Such modified oligonucleotides can be produced using a synthetic method that results in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific structure of the specific phosphorothioate bond is present in at least 99% of the molecules in the population. Such a population of chiral enriched modified oligonucleotides can be produced using synthetic methods well known in the art, for example, methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0130] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can have a specific stereochemical configuration.

[0131] B. A specific motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif refers to modifications to the nucleobases regardless of the sequence of the nucleobases).

[0132] 1. Certain glyco-motifs In certain embodiments, an oligonucleotide comprises one or more modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in a defined pattern or sugar motif, in certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0133] In certain embodiments, each nucleoside of a modified oligonucleotide, or a portion thereof, comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate, or a 2'-deoxyribosyl sugar moiety, hi certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety or a 2'-NMA sugar moiety.

[0134] In certain embodiments, each nucleoside of a modified oligonucleotide comprises a modified sugar moiety (a "fully modified oligonucleotide"). In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises a 2'-substituted sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, or a 2'-NMA sugar moiety. In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same modified sugar moiety (a "uniformly modified sugar motif"). In certain embodiments, the uniformly modified sugar motif is 7-20 nucleosides in length. In certain embodiments, each nucleoside of a uniformly modified sugar motif comprises a 2'-substituted sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE sugar moiety, or a 2'-NMA sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is a 2'-NMA sugar moiety.

[0135] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or its regions in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0136] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a sterically random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0137] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') soosssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sososssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sossosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sosssosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssssoosssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssssssoosssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssssssssssoosssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sosssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssoosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssssssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') sssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ossssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ossssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssoosoosoosssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssoossssssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssoosssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5'→3') ssoosoossssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0138] 4. A certain length In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X≦Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26, 19~27, 19~28, 19~29, 19~30, 20~21, 20~22, 20~23, 20~24, 20~25, 20~26, 20~27, 20~28, 20~ 29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, It consists of 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0139] In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the oligonucleotide consists of 23 linked nucleosides. In certain embodiments, the oligonucleotide consists of 25 linked nucleosides.

[0140] B. A population of certain modified oligonucleotides A population of modified oligonucleotides, where all of the modified oligonucleotides in the population have the same molecular formula, can be a stereo-random population or a chiral enriched population. All of the chiral centers of all of the modified oligonucleotides are stereo-random in a stereo-random population. In a chiral enriched population, at least one particular chiral center is not stereo-random in the modified oligonucleotides of the population.

[0141] Certain oligomeric compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group can be attached to either or both termini of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to either or both termini of an oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached at the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of an oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached at the 5' terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0142] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0143] A. Certain Conjugate Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0144] In certain embodiments, the conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar in one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred to herein as a ribose-replacement modified subunit ("RRMS"), which is a modified sugar moiety. The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds.

[0145] In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide. Certain conjugate groups and conjugate moieties, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids, 1997, 10, 1021-1025), and thioesters, such as ... Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid and palmityl moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620) have been previously described.

[0146] In certain embodiments, the conjugate group can comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0147] In certain embodiments, the conjugate group can comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C17 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, where the alkyl chain has one or more unsaturated bonds.

[0148] In certain embodiments, the conjugate group is a lipid having the following structure: [ka]

[0149] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0150] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiazide, chlorothiazide, diazepine, indomethacin, barbituric acid, cephalosporin, sulfa drug, antidiabetic drug, antibacterial agent, or antibiotic.

[0151] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide by a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide by a single bond). In certain embodiments, the conjugate linker comprises a chain structure (such as a hydrocarbyl chain) or an oligomer of repeating units (such as ethylene glycol, nucleoside, or amino acid units).

[0152] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0153] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0154] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known to be useful for attaching a conjugate moiety to a compound, such as an oligonucleotide, provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of these functional groups is selected to react with a specific site of the compound, and the other is selected to react with the conjugate moiety. Examples of functional groups useful in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups, and nucleophiles for reacting with electrophilic groups. In certain embodiments, a bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0155] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C-C 10 and alkynyl, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0156] In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker-nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise modified sugar moieties. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the linker-nucleoside is preferably cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0157] Herein, linker-nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide comprised of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising a linker-nucleoside, these linker-nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound can comprise (1) a modified oligonucleotide comprised of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound can comprise a modified oligonucleotide comprised of 8-30 nucleosides and does not comprise a conjugate group. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker-nucleoside.

[0158] In certain embodiments, it is preferred that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but once the oligomeric compound is taken up, it is desirable to cleave the conjugate group and release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers can include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0159] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0160] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0161] 3. Cell targeting moiety In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0162] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0163] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand, hi certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to a branching group.

[0164] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor on target cell.In certain embodiments, each ligand has affinity for at least one receptor on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0165] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0166] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0167] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently bonded to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently bonded to the branching group.

[0168] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate group. Stabilized 5'-phosphate groups include, but are not limited to, 5'-phosphonates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0169] II. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid and provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense compound has antisense activity when it reduces or inhibits the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids and provide one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in a manner that provides significant undesirable antisense activity.

[0170] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are described herein that are "DNA-like" enough to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0171] In certain antisense activity, antisense compound or part of antisense compound is loaded into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound loaded into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0172] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an oligomeric compound to a target nucleic acid results in the inclusion of an exon. In certain embodiments, hybridization of an oligomeric compound to a target nucleic acid results in the exclusion of an exon. In certain embodiments, hybridization of an oligomeric compound to a target nucleic acid results in a reduction in the amount or level of an RNA that contains an NIE. In certain embodiments, hybridization of an oligomeric compound to a target nucleic acid results in an increase in the amount or activity of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0173] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a phenotypic change in a cell or animal.

[0174] III. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including intronic regions, exonic regions, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0175] A.SCN1A In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide complementary to a target nucleic acid encoding SCN1A, or a portion thereof. In certain embodiments, the SCN1A target nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (the complement of GENBANK Accession No. NC_000002.12 truncated from nucleotides 165982001-166152000). In certain embodiments, the SCN1A target nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 2 (GENBANK Accession No. NM_001165963.2).

[0176] In certain embodiments, contacting a cell or subject with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 modulates splicing of SCN1A RNA in the cell or subject. In certain embodiments, contacting a cell or subject with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 increases the amount of SCN1A RNA and / or protein. In certain embodiments, contacting a cell or subject with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 decreases the amount of SCN1A RNA that includes a NIE. In certain embodiments, contacting a cell or subject with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 increases the amount of SCN1A RNA that excludes a NIE. In certain embodiments, the NIE is NIE-1. In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide.

[0177] In certain embodiments, contacting a subject's cells with an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 alleviates one or more symptoms or characteristics of a disease or disorder associated with SCN1A. In certain embodiments, the disease or disorder associated with SCN1A is DEE. In certain embodiments, the DEE is Dravet syndrome. In certain embodiments, the symptoms are any convulsions of prolonged duration (often lasting more than 10 minutes), frequent convulsions (e.g., ictal, clonic, absence, focal, hypokinetic, and tonic convulsions), sudden unexpected death in epilepsy, status epilepticus, behavioral dysfunction (e.g., aggression, agitation, obsession, maintenance, food hoarding, or sleep disorders), and developmental delay, motor and balance dysfunction, orthopedic conditions, motor system and cognitive dysfunction (e.g., ataxia, tremor, dysarthria, pyramidal, and extrapyramidal signs), cognitive dysfunction, delayed speech development problems, visual-motor integration dysfunction, visual-perceptual dysfunction, executive dysfunction, growth and nutrition problems, insomnia, chronic infections, sensory integration disorders, and autonomic neuropathy.

[0178] B. A particular target nucleic acid in a particular tissue In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide that comprises a portion that is complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue.In certain embodiments, the pharmacologically relevant tissue is the cells and tissues that comprise the central nervous system (CNS).Such tissues include brain tissues, such as the cerebral cortex, hippocampus, brainstem, and thalamus.

[0179] IV. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0180] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0181] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and the artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and the artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0182] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0183] In certain embodiments, the oligomeric compounds can be mixed with pharma- ceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for the formulation of pharmaceutical compositions depends on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0184] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides upon administration to animals, including humans, can provide (directly or indirectly) biologically active metabolites or residues thereof. Thus, for example, the present disclosure is also directed to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the modified oligonucleotide, and the conjugate groups are cleaved in the body by endogenous nucleases.

[0185] Lipid moieties are used in nucleic acid therapeutics in various ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes made with a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to certain cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to lipid tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissues.

[0186] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0187] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0188] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% (w / v) benzyl alcohol, 8% (w / v) of the non-polar surfactant Polysorbate 80™, and 65% (w / v) of polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary significantly without significantly changing their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0189] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water, or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain injectable pharmaceutical compositions are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulating agents, such as suspending agents, stabilizing agents, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0190] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized, cationic (salt) form, but aqueous solutions of such compounds are in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution is in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms, all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, when a structure depicting the free acid of a compound is followed by the term "or a salt thereof," it explicitly includes all such forms, which may be fully or partially associated with protonated / deprotonated / cationic forms. In certain cases, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, the structure representing the free acid of a compound followed by the term "or a pharma-ceutically acceptable salt thereof" expressly includes all such forms that can be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0191] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to the desired pH.

[0192] Certain specific dosage amounts are described herein. The dosage amount may be in the form of a dosage unit. For clarity, a dosage amount (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams shall represent the mass of the modified oligonucleotide or oligomeric compound in free acid form. As stated above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for purposes of calculating the dosage amount, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with Na+ ions. However, the mass of the protons is still counted in the weight of the dosage amount, and the mass of the Na+ ions is not counted in the weight of the dosage amount. Thus, for example, a 10 mg dosage or dosage unit of compound number 1464713 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1464713. When an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. When the conjugate group also contains an acid, the conjugate group is also presumed to be fully protonated for the purposes of dosage calculation.

[0193] In certain embodiments where the oligomeric compound is present in a solution, such as aCSF, that contains sodium, potassium, calcium, and magnesium, the oligomeric compound may be partially or fully deprotonated and associated with sodium, potassium, calcium, and / or magnesium, but the mass of the protons is still counted in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the weight of the dose.

[0194] In certain embodiments, when an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of the dosage calculation.

[0195] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety.

[0196] Although certain compounds, compositions, and methods described herein have been specifically described according to certain embodiments, the following examples only serve to illustrate the compounds described herein and are not intended to limit such compounds. Each of the references, GenBank accession numbers, ENSEMBL identifiers, etc. listed in this application are hereby incorporated by reference in their entirety.

[0197] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in reality these sequences can be modified by any combination of chemical modifications. Those skilled in the art will readily appreciate that such designations, such as "RNA" or "DNA", indicate that the modified oligonucleotide is arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (a 2'-OH instead of a single 2'-H in DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil in RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those set forth in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases, unless otherwise specified. By way of further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" is intended to be illustrative, but not limiting, of any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including those compounds that contain RNA bases, e.g., those having the sequence "AUCGAUCG", as well as those that have some DNA bases and some RNA bases, e.g., "AUCGAUCG". m CGAUCG” (in the formula, m C represents a cytosine base containing a methyl group at the 5-position).

[0198] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, and therefore give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry, such as (R) or (S), α or β (e.g., for sugar anomers), or (D) or (L) (e.g., for amino acids). Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compound depicted. Compounds provided herein that are depicted or described without a defined stereochemistry include all such possible isomers, including stereochemically random and optically pure forms, unless otherwise indicated. Similarly, tautomeric forms of the compounds described herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0199] The compounds described herein include modifications in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isomeric substitutions encompassed by the compounds herein include: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36In certain embodiments, non-radioactive isotope substitution can provide novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0200] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting. Moreover, when specific embodiments are provided, the inventors intend the general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides reasonable support for further oligonucleotides having that motif or a similar motif. Similarly, for example, if a specific high affinity modification is found at a specific position, other high affinity modifications at the same position are also considered appropriate, unless otherwise indicated.

[0201] Example 1: Design of modified oligonucleotides complementary to human SCN1A nucleic acid Modified oligonucleotides complementary to human SCN1A nucleic acids were designed and synthesized as shown in the table below.

[0202] Each modified oligonucleotide listed in the table below is 100% complementary to the human SCN1A genomic sequence shown herein as SEQ ID NO: 1 (complement of GENBANK Accession No. NC_000002.12 truncated from nucleotides 165982001-166152000) and 100% complementary to the mouse SCN1A genomic sequence shown herein as SEQ ID NO: 3 (complement of GENBANK Accession No. NC_000068.7 truncated from nucleotides 66268001-66444000). "Start position" indicates the 5' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence.

[0203] The modified oligonucleotides in the table below are 18 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for each modified oligonucleotide is indicated in the table below in the "Internucleoside Linkage Motif (5'→3')" column, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 2]

[0204] The modified oligonucleotides in the table below are 19 nucleosides in length. The sugar motif for the modified oligonucleotides is (5'→3') nnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3) osssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 3]

[0205] The modified oligonucleotides in the table below are 20 nucleosides in length. The sugar motif for the modified oligonucleotides is (5'→3') nnnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3) ossssssssssssssssso, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 4]

[0206] Example 2: Effects of modified oligonucleotides targeting SCN1A in wild-type mice Wild-type C57BL / 6 female mice were divided into groups of 3 mice each. Each mouse received a single ICV bolus of 50 μg of the modified oligonucleotide. A group of 4 mice received PBS as a negative control.

[0207] Compound 1429226 is a modified oligonucleotide having a nucleobase sequence (5'→3') of AGTTGGAGCAAGATTATC (SEQ ID NO: 13), in which each nucleoside comprises a 2'-NMA sugar moiety, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5-methylcytosine. Comparative compound 1367010 has the nucleobase sequence, sugar motif, and internucleoside linkage motif of compound example 20X+1, previously described in WO 2019 / 040923 (incorporated herein by reference). Comparative compound 1367010 has a nucleobase sequence (5'→3') of AGTTGGAGCAAGATTATC (SEQ ID NO: 13), in which each nucleoside comprises a 2'-MOE sugar moiety, and each internucleoside linkage is a phosphorothioate internucleoside linkage. Each cytosine in comparative compound 1367010 is a 5-methylcytosine. SEQ ID NO:13 is 100% complementary to SEQ ID NO:1 from start position 144708 to end position 144725 and 100% complementary to SEQ ID NO:3 from start position 150106 to end position 150123. "Start position" indicates the 5' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence.

[0208] After 2 weeks of treatment, the mice were sacrificed and RNA was extracted with 100% IgG4-dependent ELISA (100% IgG4-dependent ELISA). -) mouse primer probe set RTS48951 for measuring the amount of SCN1A RNA (forward sequence CCCTAAGAGCCTTATCACGATTT, set forth herein as SEQ ID NO:4; reverse sequence GGCAAACCAGAAGCACATTC, set forth herein as SEQ ID NO:5; probe sequence AGGGTGTGTTGAATGCCCTGTTA, set forth herein as SEQ ID NO:6), as well as the mouse form of NIE-1 (NIE-1 + ) Cortical brain tissue was extracted for real-time qPCR analysis of SCN1A RNA using mouse primer probe set RTS48949 (forward sequence AGCCCTTATTATGGGTGGTT, described herein as SEQ ID NO:7; reverse sequence CCAGAATATAAGGCAAACCAGAAG, described herein as SEQ ID NO:8; probe sequence TGGATGGAATTGCTCCTAACAGGGC, described herein as SEQ ID NO:9) to measure the amount of SCN1A transcript. SCN1A RNA is expressed as a percentage of SCN1A RNA relative to the average amount of PBS-treated animals (% control), normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, set forth herein as SEQ ID NO:10; reverse sequence GGGTCTCGCTCCTGGAAGAT, set forth herein as SEQ ID NO:11; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, set forth herein as SEQ ID NO:12). [Table 5]

[0209] Example 3: Tolerance of modified oligonucleotides complementary to SCN1A in wild-type mice The modified oligonucleotides described above were tested in wild type mice to investigate the tolerability of the oligonucleotides.

[0210] Wild-type female C57 / Bl6 mice each received a single ICV dose of 700 μg of modified oligonucleotide. Each treatment group consisted of 3-4 mice. A group of 4 mice received PBS as a negative control. Three hours after injection, the mice were evaluated according to seven different criteria: (1) the mice were brightly colored, alert, and responsive; (2) the mice stood or hunched without stimulation; (3) the mice showed any movement without stimulation; (4) the mice showed forward movement after being lifted; (5) the mice showed any movement after being lifted; (6) the mice responded to tail pinching; and (7) they were breathing regularly. For each of the seven criteria, the mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not meet the criterion (Functional Observation Battery score, or FOB). After all seven criteria were assessed, scores were summed for each mouse and averaged within each treatment group. [Table 6] [Table 7] [Table 8]

[0211] Example 4: Tolerance of modified oligonucleotides complementary to human SCN1A in rats, 3 hour study The modified oligonucleotides described above were tested in rats to investigate the tolerability of the oligonucleotides. Sprague Dawley rats each received a single intrathecal (IT) dose of 3 mg of oligonucleotide as listed in the table below. Each treatment group consisted of 3-4 rats. A group of 4 rats received PBS as a negative control. Three hours after injection, movement in seven different body locations was assessed for each rat. The seven body locations were: (1) rat tail, (2) rat rear posture, (3) rat hind limbs, (4) rat hind paws, (5) rat front paws, (6) rat forward posture, and (7) rat head. For each of the seven different body locations, each rat was given a subscore of 0 if the body location was moving and 1 if the body location was paralyzed (Functional Observation Battery score, or FOB). After each of the seven body locations was assessed, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other body parts evaluated were moving 3 hours after an IT dose of 3 mg, it would receive a total score of 0. If another rat was not moving its tail but was moving all other body parts evaluated 3 hours after an IT dose of 3 mg, it would receive a score of 1. Results are expressed as the mean score for each treatment group. [Table 9] [Table 10] [Table 11]

[0212] Example 5: Design of modified oligonucleotides complementary to SCN1A nucleic acids Modified oligonucleotides complementary to SCN1A nucleic acids were designed and synthesized as shown in the table below.

[0213] The modified oligonucleotides listed in the table below are 100% complementary to the human SCN1A genomic sequence set forth herein as SEQ ID NO: 1 (set forth herein above) and the mouse SCN1A genomic sequence set forth herein as SEQ ID NO: 3 (set forth herein above). "Start position" indicates the 5' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the modified oligonucleotide is complementary within the target nucleic acid sequence. "NA" indicates that the modified oligonucleotide is not 100% complementary to the target nucleic acid sequence.

[0214] The modified oligonucleotides in the table below are 18 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3') sssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 12]

[0215] The modified oligonucleotides in the table below are 25 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3) ssoosoosoosssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 13]

[0216] The modified oligonucleotides in the table below are 25 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3) ssoosoosssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 14]

[0217] The modified oligonucleotides in the table below are 25 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3) ssoosssssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 15]

[0218] The modified oligonucleotides in the table below are 25 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3') sssssssssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 16]

[0219] The modified oligonucleotides in the table below are 23 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3')nnnnnnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is represented in the table below in the column labeled "Internucleoside Linkage (5'→3')," where within the column, each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 17]

[0220] "Start position" indicates the 5' terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "End position" indicates the 3' terminal nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The modified oligonucleotides listed in the table below are 100% complementary to the mouse SCN1A sequence set forth herein as SEQ ID NO:3 (set forth herein above), and the sequence is complementary to the human SCN1A sequence of SEQ ID NO:1 (set forth herein above), with a single mismatch at the position indicated in the column labeled "Position of mismatch in compound (5'→3')". The non-complementary nucleobases are labeled in the nucleobase sequence column in an underlined, bold, italic font. In addition, the modified oligonucleotides listed in the table below are 100% complementary to the mouse SCN1A genomic sequence set forth herein as SEQ ID NO:3 (set forth herein above).

[0221] The modified oligonucleotides in the table below are 18 nucleosides in length. The sugar motif for the modified oligonucleotides in the table below is (5'→3') nnnnnnnnnnnnnnnnnn, where each "n" represents a 2'-NMA sugar moiety. The internucleoside linkage motif for the modified oligonucleotides is (5'→3') sssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 18]

[0222] Example 6: Effects of modified oligonucleotides targeting SCN1A in wild-type mice Wild-type C57BL / 6 mice were divided into groups of 3 mice each. Each mouse received a single ICV bolus of 50 μg of the modified oligonucleotide. A group of 4 mice received PBS as a negative control.

[0223] After 2 weeks of treatment, the mice were sacrificed and RNA was extracted with 100% IgG4-dependent ELISA (100% IgG4-dependent ELISA). - ) Mouse primer probe set RTS48951 (described herein above) for measuring the amount of SCN1A RNA, and the mouse form of NIE-1 (NIE-1 +) Cortical brain tissue was extracted for real-time qPCR analysis of SCN1A RNA using mouse primer probe set RTS48949 (as shown herein above) to measure the amount of SCN1A transcript. SCN1A RNA is expressed as a percentage of SCN1A RNA (% control) relative to the average amount of PBS-treated animals, normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (as shown herein above). Values ​​marked with "†" result from oligonucleotides complementary to the amplicon region of the primer probe set. Additional assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[0224] Comparative compound 1367010 is described herein above. [Table 19] [Table 20] [Table 21]

[0225] Example 7: Efficacy of modified oligonucleotides targeting SCN1A in wild-type mice Wild-type C57BL / 6 female mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at various doses as defined in the table below. A group of 4 mice received PBS as a negative control.

[0226] After 2 weeks of treatment, the mice were sacrificed and RNA was extracted with 100% IgG4-dependent ELISA (100% IgG4-dependent ELISA). - ) Mouse primer probe set RTS48951 (described herein above) for measuring the amount of SCN1A RNA, and the mouse form of NIE-1 (NIE-1 +) Cortical brain tissue was extracted for real-time qPCR analysis of SCN1A RNA using mouse primer probe set RTS48949 (as shown hereinabove) to measure the amount of SCN1A transcript. SCN1A RNA is expressed as a percentage of SCN1A RNA relative to the average amount of PBS-treated animals normalized to mouse GAPDH (% control). Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (as shown hereinabove). ED50 was calculated using GraphPad Prism.

[0227] Comparative compound 1367010 is described herein above. [Table 22] [Table 23]

[0228] Example 8: Tolerance of modified oligonucleotides complementary to SCN1A in wild-type mice The modified oligonucleotides described above were tested in wild type mice to investigate the tolerability of the oligonucleotides.

[0229] Wild-type female C57BL / 6 mice each received a single ICV dose of 700 μg of modified oligonucleotides as shown in the table below. Each treatment group consisted of 3-4 mice. A group of 4 mice received PBS as a negative control. Three hours after injection, the mice were evaluated according to seven different criteria. The criteria were: (1) the mice were brightly colored, alert, and responsive; (2) the mice stood or hunched without stimulation; (3) the mice showed any movement without stimulation; (4) the mice showed forward movement after being lifted; (5) the mice showed any movement after being lifted; (6) the mice responded to tail pinching; and (7) they were breathing regularly. For each of the seven criteria, the mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not meet the criterion (Functional Observation Battery score, or FOB). After all seven criteria were assessed, scores were summed for each mouse and averaged within each treatment group. [Table 24] [Table 25] [Table 26] [Table 27]

[0230] Example 9: Tolerance of modified oligonucleotides complementary to human SCN1A in rats, 3 hour study The modified oligonucleotides described above were tested in rats to investigate the tolerability of the oligonucleotides. Each Sprague Dawley rat received a single intrathecal (IT) dose of 3 mg of oligonucleotide as shown in the table below. Each treatment group consisted of 4 rats. A group of 4 rats received PBS as a negative control. Three hours after injection, movement in 7 different body locations was assessed for each rat. The 7 body locations were: (1) rat tail, (2) rat rear posture, (3) rat hind legs, (4) rat hind paws, (5) rat front paws, (6) rat forward posture, and (7) rat head. For each of the 7 different body locations, each rat was given a subscore of 0 if the body location was moving and 1 if the body location was paralyzed (Functional Observation Battery score, or FOB). After each of the 7 body locations was assessed, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other body parts evaluated were moving 3 hours after an IT dose of 3 mg, it would receive a total score of 0. If another rat was not moving its tail but was moving all other body parts evaluated 3 hours after an IT dose of 3 mg, it would receive a score of 1. Results are expressed as the mean score for each treatment group. [Table 28] [Table 29] [Table 30]

Claims

1. Oligomeric compounds comprising modified oligonucleotides according to the following chemical representation: A ns G no T ns T no G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 24) A ns G no T ns T ns G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 25), A ns G no T no T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 23), A ns G no T ns T ns G ns G no A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 26) A ns G no T ns T ns G ns G ns A ns G no m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 27) A ns G ns T ns T no G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 28), A ns G ns T ns T ns G ns G ns A ns G no m C no A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 29), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A no A no G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 30), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A no T ns T ns A ns T ns m C n (SEQ ID NO: 31) A ns G no T ns T ns G ns G ns A ns G ns m C ns A no A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 32) A ns G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A ns T ns T ns A ns T ns m C n (SEQ ID NO: 33) A ns G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 34) A ns G ns T ns T ns G ns G no A no G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (SEQ ID NO: 35), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T no T no A ns T ns m C n (SEQ ID NO: 36), A ns G ns T ns T ns G ns G ns A no G ns m C ns A ns A ns G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 37) A ns G ns T ns T ns G ns G ns A ns G ns m C no A ns A ns G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 38) A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A no G ns A ns T ns T no A ns T ns m C n (SEQ ID NO: 39), A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A no T ns T no A ns T ns m C n (SEQ ID NO: 40) A ns G ns T ns T ns G ns G ns A ns G ns m C no A ns A ns G ns A ns T no T ns A ns T ns m C n (SEQ ID NO: 41) A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G no A ns T no T ns A ns T ns m C n (SEQ ID NO: 42) A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C n (Allocation number 43), and teeth A no A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C no m C n (SEQ ID NO: 44) [In the formula: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, n=2'-NMA sugar moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage].

2. An oligomeric compound comprising a modified oligonucleotide according to the following chemical designation: G ns G ns T no A no G ns m C ns A ns A ns A ns A ns G ns G ns G ns G ns T ns A ns A ns T ns A ns m C ns A ns G ns T n (SEQ ID NO: 45), G ns G ns T ns A ns G ns m C ns A ns A ns A ns A ns G ns G ns G ns G ns T ns A ns A ns T ns A ns m C ns A ns G ns T n (SEQ ID NO: 46), A ns T ns m C no m C no A ns A no G no T ns T no G no G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 47), T ns m C ns m C no A no A ns G no T no T ns G no G no A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 48), m C ns m C ns A no A no G ns T no T no G ns G no A no G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 49); m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 50), A ns T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 51), T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 52), m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 53), m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 54), A ns T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 55), T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 56), m C ns m C ns A no A no G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 57), m C ns A ns A no G no T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 58), A ns T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T n (SEQ ID NO: 59), T ns m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A n (SEQ ID NO: 60), m C ns m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T n (SEQ ID NO: 61), or m C ns A ns A ns G ns T ns T ns G ns G ns A ns G ns m C ns A ns A ns G ns A ns T ns T ns A ns T ns m C ns m C ns T ns A ns T ns A n (SEQ ID NO: 62) [In the formula: A = adenine nucleobase, m C=5-methylcytosine nucleobase; G = guanine nucleobase; T = thymine nucleobase, n=2'-NMA sugar moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage].

3. 3. The oligomeric compound of claim 1 or claim 2, consisting of said modified oligonucleotide.

4. a. the modified oligonucleotide is a free acid; or b. the modified oligonucleotide is a salt, and optionally the modified oligonucleotide is a sodium salt or a potassium salt; 3. The oligomeric compound according to claim 1 or claim 2.

5. A modified oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleic acid sequence of any of SEQ ID NOs: 19-22, or 63-86 is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 86, at least 87, at least 88, An oligomeric compound having a nucleobase sequence comprising 3, at least 24, or at least 25 consecutive nucleobases, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

6. The oligomeric compound of claim 5, wherein the modified oligonucleotide consists of 18 to 25 linked nucleosides.

7. The oligomeric compound of claim 5 , wherein the modified oligonucleotide consists of 18, 23, or 25 linked nucleosides.

8. The oligomeric compound of any one of claims 5 to 7, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 19 to 22, or 63 to 86.

9. The oligomeric compound according to any one of claims 5 to 7, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any one of SEQ ID NOs: 19 to 22, or 63 to 86.

10. The modified oligonucleotide comprises at least one modified sugar moiety, and optionally: a. the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety, optionally a 2'-MOE or a 2'-NMA sugar moiety; and / or b. each nucleoside of the modified oligonucleotide comprises a modified sugar moiety; and / or c. each modified sugar moiety is a 2'-NMA sugar moiety; The oligomeric compound according to any one of claims 5 to 7.

11. The modified oligonucleotide comprises at least one modified internucleoside linkage, and optionally: a. the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage; and / or b. the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage; and / or c. each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage; The oligomeric compound according to any one of claims 5 to 7.

12. 8. The oligomeric compound of any one of claims 5 to 7, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

13. The oligomeric compound of any one of claims 5 to 7, wherein said modified oligonucleotide comprises at least one modified nucleobase, optionally wherein said modified nucleobase is 5-methylcytosine.

14. 8. The population of oligomeric compounds of any one of claims 1, 2, 5-7, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are sterically random.

15. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1, 2, 5 to 7, and a pharmaceutically acceptable diluent.

16. A pharmaceutical composition comprising the population of oligomeric compounds of claim 14 and a pharmaceutically acceptable diluent.

17. 16. The pharmaceutical composition of claim 15, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or PBS.

18. 18. The pharmaceutical composition of claim 17, wherein the pharmaceutical composition consists essentially of the oligomeric compound and aCSF or PBS.

19. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1, 2, 5 to 7 for treating a disease associated with SCN1A in a subject.

20. The disease associated with SCN1A is a developmental disorder or an epileptic encephalopathy disease, and optionally comprises: a. The developmental disorder or epileptic encephalopathy disease is Dravet syndrome; and / or b. The developmental disorder or epileptic encephalopathy disorder is any of genetic epilepsy with febrile seizures plus (GEFS+), febrile seizures, idiopathic / generalized epilepsy (IGE / GGE), temporal lobe epilepsy, migratory epilepsy with epilepsy (MAE), Lennox-Gastaut syndrome, or focal migratory childhood epilepsy (MMPSI); 20. The pharmaceutical composition of claim 19.

21. The treatment results in a decrease in frequency of seizures, a decrease in duration of seizures, a reduction in status epilepticus, improved behavioral function, improved movement and balance, improved orthopedic status, improved motor function, a reduction in cognitive impairment, improved speech production, improved visual-motor integration, improved visual-perceptual function, improved executive function, or a reduction in autonomic dysfunction. Optionally, a. the seizures are frequent or of long duration; and / or b. The convulsion is either ictal, clonic, absent, focal, tonic, or persistent; 20. The pharmaceutical composition of claim 19.

22. 20. The pharmaceutical composition of claim 19, wherein the subject is a human.