Liver-specific expression cassettes, vectors and uses thereof for expressing therapeutic proteins

JP2024534362A5Pending Publication Date: 2025-09-25GENERATION BIO CO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024515860
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-09-16
Filing Date
2022-09-16
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

Current liver-directed gene therapy faces challenges in efficiently targeting hepatocytes, maintaining vector genome stability, and achieving sustained high-level expression, particularly for large proteins like FVIII, due to packaging constraints and immunogenicity issues with existing viral vectors.

Method used

Optimization of liver-specific nucleic acid regulatory elements, including enhancer-promoter combinations, to enhance protein expression in liver cells while minimizing CpG content and spacer optimization, using both viral (AAV-based) and non-viral (ceDNA) vectors, ensuring tissue specificity and reduced immunogenicity.

Benefits of technology

The optimized liver-specific expression cassettes achieve substantially increased and sustained protein expression in hepatocytes, overcoming packaging limitations and immunogenicity, thereby improving the efficacy of liver-directed gene therapy for conditions like hemophilia A.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure provides a liver-specific expression cassette, a vector containing the expression cassette, and its use in gene therapy, particularly liver-directed gene therapy.The present disclosure applies a range of bioinformatics analysis to identify a series of novel and inventive non-natural modifications to the native liver-specific serpin enhancer region, which surprisingly results in improved sequence characteristics known to affect acute expression levels and expression durability of gene products.The present disclosure also provides an evolutionary conservation analysis for selective removal of CpGs in enhancers without destroying function.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] (Related Applications) This application claims priority to U.S. Provisional Application No. 63 / 245,013, filed September 16, 2021, the contents of which are incorporated by reference herein in their entirety. [Background technology]

[0002] Gene therapy aims to improve clinical outcomes for patients suffering from either genetic mutations or acquired diseases caused by abnormalities in gene expression profiles. Gene therapy includes the treatment or prevention of medical conditions resulting from defective genes or aberrant regulation or expression, e.g., under- or over-expression, that can result in disorders, diseases, malignancies, etc. For example, diseases or disorders caused by defective genes can be treated, prevented, or ameliorated by delivery of repair genetic material to the patient, or by modifying or silencing the defective gene with repair genetic material to the patient, resulting in therapeutic expression of the genetic material in the patient.

[0003] The basis of gene therapy is the provision of an active gene product (sometimes referred to as a transgene) in a transcription cassette, which may result, for example, in a positive gain-of-function effect, a negative loss-of-function effect, or another outcome. Such an outcome may result from the expression of a therapeutic protein, such as an antibody, a functional enzyme, or a fusion protein. Gene therapy may also be used to treat diseases or malignancies caused by other factors. Human monogenic disorders can be treated by the delivery and expression of normal genes into target cells. The delivery and expression of repair genes in the target cells of a patient can be carried out through a number of methods, including the use of engineered viruses and viral gene delivery vectors.

[0004] The liver is directly or indirectly involved in many essential processes and is affected by a large number of genetic diseases. Thus, many genetic diseases can be effectively treated by targeting the liver using gene transfer approaches. However, there are still challenges associated with liver-directed gene therapy, including efficiently targeting hepatocytes, maintaining vector genome stability, and achieving sustained high-level expression. Among the many available virus-derived vectors (e.g., recombinant retroviruses, lentiviruses, adenoviruses, etc.), recombinant adeno-associated virus (rAAV) has gained popularity as a versatile vector in gene therapy. Liver-directed gene therapy clinical trials using AAV vectors have reported clinical efficacy data (Rodriguez-Marquez et al., Expert Opinion on Biological Therapy Volume 21, 2021-Issue 6). Although clinical progress has been made using rAAV vectors for Factor IX (FIX) expression in the liver, the use of rAAV for FVIII expression in hemophilia A patients has been difficult due to ineffective biosynthesis of human FVIII (hFVIII). rAAV vectors produce capsids with limited space for encapsulating nucleic acid. FVIII is a large glycoprotein, and the rAAV sequences required to code and express FVIII generally exceed the packaging capacity of the capsid.

[0005] Recombinant capsid-free AAV vectors can be obtained as isolated linear nucleic acid molecules that contain an expressible transgene and a promoter region flanked by two wild-type AAV inverted terminal repeat sequences (ITRs) that contain a Rep binding site and a terminal resolution site. These recombinant AAV vectors lack the sequence encoding the AAV capsid protein and can be single-stranded, double-stranded, or duplexed with one or both ends covalently linked through two wild-type ITR palindromic sequences (e.g., WO 2012 / 123430, U.S. Pat. No. 9,598,703). They avoid many of the AAV-mediated gene therapies in that they have a much higher transgene capacity, a faster onset of transgene expression, and the patient's immune system recognizes the DNA molecule as a virus to be cleared.

[0006] Non-viral gene therapy is assumed to be less toxic to the host and safer for gene delivery compared to viral vectors. Closed-ended DNA ("ceDNA") vectors, an example of non-viral gene therapy, have many attractive features for gene-based therapy. For example, ceDNA vectors do not have the packaging constraints imposed by the limited space within the viral capsid. ceDNA vectors represent a versatile eukaryotically produced alternative to prokaryotically produced plasmid DNA vectors as opposed to the enclosed AAV genome. This allows the insertion of control elements, such as large transgenes, multiple transgenes, regulatory switches, etc., and, if necessary, the incorporation of the native gene regulatory elements of the transgene. However, in most living organisms, especially eukaryotes with large genome sizes, there appears to be no driving force limiting enhancer / promoter size, and thus most endogenous enhancers / promoters span hundreds, and more frequently thousands, of base pairs (bp) of DNA. Due to their size, these endogenous native gene enhancers / promoters are generally not suitable for inclusion in gene therapy products due to size limitations. Regardless of viral or non-viral delivery, there remains a need for technologies that allow for robust expression of therapeutic proteins, such as liver-specific therapeutic proteins, in cells, tissues, or subjects to improve the efficiency and safety of treating genetic diseases or disorders. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication No. 2012 / 123430 [Patent Document 2] U.S. Pat. No. 9,598,703 [Non-patent literature]

[0008] [Non-Patent Document 1] Rodriguez-Marquez et al.,Expert Opinion on Biological Therapy Volume 21,2021-Issue 6 Summary of the Invention

[0009] The present disclosure applies a range of bioinformatics analyses to identify a series of novel and inventive non-natural modifications to native liver-specific serpin enhancer regions that surprisingly resulted in improvements in sequence features known to affect acute expression levels and expression durability of the gene product.

[0010] The present disclosure also provides an evolutionary conservation analysis for selective removal of CpGs in enhancers without disrupting function. Enhancers are often combined in series to drive higher levels of transcription initiation. However, the principles underlying the optimal number and orientation of enhancer regions remain poorly understood. The spacing between transcription factor binding sites is likely to be an important selection attribute that affects function, especially considering that DNA is helical, so that the number of nucleotides between binding sites also changes their rotational spatial orientation. As described herein, a range of enhancer combinations, including different numbers of enhancers and nucleotide spacer content, were tested for improved function. Bioinformatics analysis was used to guide sequence selection for the sequence replacements tested.

[0011] The technology described herein relates to liver-specific nucleic acid expression cassettes that contain specific regulatory elements (enhancer-promoter combinations) that have been improved to enhance liver-specific gene expression, such that the native cis-regulatory regions have been optimized to minimize CpG content and enhance spacer optimization, and vectors, either viral vectors (e.g., AAV-based vectors) or non-viral vectors (e.g., ceDNA vectors).

[0012] As disclosed herein, the liver-specific expression cassette surprisingly promotes substantially increased protein expression in the liver and hepatocytes over other tissue types while retaining tissue specificity. In some embodiments, the liver-specific regulatory element (e.g., enhancer-promoter combination) can be included in a viral vector (such as an adeno-associated virus vector (AAV)) or a non-viral vector, a capsid-free (e.g., non-viral) DNA vector with covalently closed ends (referred to herein as a "closed-end DNA vector" or "ceDNA vector") in operative combination with a heterologous nucleic acid sequence encoding a protein of interest to promote expression of the protein of interest in liver tissue and / or cells. An advantage of the promoters of the present disclosure is that the enhancer-promoter can be designed and selected for the amount of expression of gene product by the vector, while also ensuring that the amount of promoter is not immunogenic. In some embodiments, the vector (e.g., an AAV vector or a ceDNA vector) provides effective expression of a protein of interest at a dose that is not predicted to cause immunogenicity in humans. In some embodiments, the vector (e.g., AAV vector or ceDNA vector) provides effective expression of a protein of interest at doses that are not predicted to cause toxicity in humans. The improvements described herein can be generalized to improved expression of any transgene (e.g., AAV, ceDNA).

[0013] In a first aspect, the present disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 1-80, 138 or 139. In one embodiment, the nucleic acid regulatory element has a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 1-80, 138 or 139. In one embodiment, the nucleic acid regulatory element has a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 1-80, 138 or 139. In one embodiment, the nucleic acid regulatory element has a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 1-80, 138 or 139. In one embodiment, the nucleic acid regulatory element has a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 1-80, 138 or 139. In one embodiment, the nucleic acid regulatory element has a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 1-80, 138 or 139. In one embodiment, the nucleic acid has a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 1-80, 138, or 139. In one embodiment, the nucleic acid consists of any one of SEQ ID NOs: 1-80, 138, or 139. In one embodiment, the nucleic acid sequence comprises any one of SEQ ID NOs: 1-80, 138, or 139.

[0014] In a first aspect, the present disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO: 131. In one embodiment, the nucleic acid sequence has at least 96% identity to SEQ ID NO: 131. In one embodiment, the nucleic acid sequence has at least 97% identity to SEQ ID NO: 131. In one embodiment, the nucleic acid sequence has at least 98% identity to SEQ ID NO: 131. In one embodiment, the nucleic acid sequence has at least 99% identity to SEQ ID NO: 131. In one embodiment, the nucleic acid sequence comprises SEQ ID NO: 131. In one embodiment, the nucleic acid sequence consists of SEQ ID NO: 131.

[0015] In a first aspect, the present disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO: 122. In one embodiment, the nucleic acid sequence has at least 96% identity to SEQ ID NO: 122. In one embodiment, the nucleic acid sequence has at least 97% identity to SEQ ID NO: 122. In one embodiment, the nucleic acid sequence has at least 98% identity to SEQ ID NO: 122. In one embodiment, the nucleic acid sequence has at least 99% identity to SEQ ID NO: 122. In one embodiment, the nucleic acid sequence comprises SEQ ID NO: 122. In one embodiment, the nucleic acid sequence consists of SEQ ID NO: 122.

[0016] In a first aspect, the present disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO:81. In one embodiment, the nucleic acid sequence has at least 96% identity to SEQ ID NO:81. In one embodiment, the nucleic acid sequence has at least 97% identity to SEQ ID NO:81. In one embodiment, the nucleic acid sequence has at least 98% identity to SEQ ID NO:81. In one embodiment, the nucleic acid sequence has at least 99% identity to SEQ ID NO:81. In one embodiment, the nucleic acid sequence comprises SEQ ID NO:81. In one embodiment, the nucleic acid sequence consists of SEQ ID NO:81.

[0017] In a first aspect, the present disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO:82. In one embodiment, the nucleic acid sequence has at least 96% identity to SEQ ID NO:82. In one embodiment, the nucleic acid sequence has at least 97% identity to SEQ ID NO:82. In one embodiment, the nucleic acid sequence has at least 98% identity to SEQ ID NO:82. In one embodiment, the nucleic acid sequence has at least 99% identity to SEQ ID NO:82. In one embodiment, the nucleic acid sequence comprises SEQ ID NO:82. In one embodiment, the nucleic acid sequence consists of SEQ ID NO:82.

[0018] In a first aspect, the present disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 95% identity to SEQ ID NO: 83. In one embodiment, the nucleic acid sequence has at least 96% identity to SEQ ID NO: 83. In one embodiment, the nucleic acid sequence has at least 97% identity to SEQ ID NO: 83. In one embodiment, the nucleic acid sequence has at least 98% identity to SEQ ID NO: 83. In one embodiment, the nucleic acid sequence has at least 99% identity to SEQ ID NO: 83. In one embodiment, the nucleic acid sequence comprises SEQ ID NO: 83. In one embodiment, the nucleic acid sequence consists of SEQ ID NO: 83.

[0019] In another aspect, disclosed herein is a liver-specific nucleic acid regulatory element consisting essentially of a nucleic acid sequence as set forth in any one of Tables 10, 11, 12, or 13.

[0020] In another aspect, disclosed herein is a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence as set forth in any one of Table 10, Table 11, Table 12, or Table 13.

[0021] In another aspect, disclosed herein is a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to a sequence set forth in any one of Table 10, Table 11, Table 12, or Table 13.

[0022] In one embodiment, the element comprises at least two nucleic acid sequences set forth in any one of Tables 10, 11, 12, or 13. In one embodiment, the two nucleic acid sequences are identical. In one embodiment, the element comprises three nucleic acid sequences set forth in any one of Tables 10, 11, 12, or 13, optionally, the three sequences are identical. In one embodiment, the element consists essentially of between two and ten nucleic acid sequences set forth in any one of Tables 10, 11, 12, or 13.

[0023] In one embodiment, the element comprises a spacer disposed between the nucleic acid sequences set forth in any one of Table 10, Table 11, Table 12, or Table 13. In one embodiment, the spacer is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 base pairs in length.

[0024] In one embodiment, the element comprises: GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCAAAGTCCAC (SEQ ID NO: 223), GGGGGAAGCTACTGGTGAATATTAACCAAGGTCACCCAGTTATCAGGGAGCAAACAGGAGCAAAGTCCAT (SEQ ID NO: 1381), GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCCGTTATCGGAGGAGCAAACAAGGGCTAAGTCCAC (SEQ ID NO: 1073), or The present invention includes a nucleic acid sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCAGTTATCGGAGGAGCAAACAAGGGCAAAGTCCAC (SEQ ID NO: 1113).

[0025] In one embodiment, the element comprises: GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCAAAGTCCAC (SEQ ID NO: 223), GGGGGAAGCTACTGGTGAATATTAACCAAGGTCACCCAGTTATCAGGGAGCAAACAGGAGCAAAGTCCAT (SEQ ID NO: 1381), GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCCGTTATCGGAGGAGCAAACAAGGGCTAAGTCCAC (SEQ ID NO: 1073), or The nucleic acid comprises GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCAGTTATCGGAGGAGCAAACAAGGGCAAAGTCCAC (SEQ ID NO: 1113).

[0026] In another aspect, the disclosure relates to a liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 90% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 91% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 92% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 93% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 94% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 95% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 96% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 97% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 98% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence has at least 99% identity to any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence comprises any one of SEQ ID NOs: 81, 82, 122, 83, or 85. In one embodiment, the nucleic acid sequence consists of any one of SEQ ID NOs:81, 82, 122, 83, or 85.

[0027] In another aspect, the present disclosure provides a liver-specific expression cassette comprising at least one liver-specific regulatory element of any one of the aspects and embodiments herein. In one embodiment, the liver-specific expression cassette further comprises a liver-specific promoter operably linked to the transgene. In one embodiment, two or more nucleotides separate each liver-specific nucleic acid regulatory element. In one embodiment, five or more nucleotides separate each liver-specific nucleic acid regulatory element. In one embodiment, ten or more nucleotides separate each liver-specific nucleic acid regulatory element. In one embodiment, fifteen or more nucleotides separate each liver-specific nucleic acid regulatory element. In one embodiment, twenty or more nucleotides separate each liver-specific nucleic acid regulatory element. In one embodiment, twenty-five or more nucleotides separate each liver-specific nucleic acid regulatory element. In one embodiment, 2 to 30 nucleotides separate each liver-specific regulatory element, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0028] In another aspect, the disclosure provides a liver-specific expression cassette comprising a liver-specific nucleic acid regulatory element and at least three repeats of a liver-specific promoter operably linked to a transgene, wherein the liver-specific nucleic acid regulatory element comprises a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs:81-137, and two or more nucleotides separate each liver-specific nucleic acid regulatory element.

[0029] In one embodiment, 2-30 nucleotides separate each regulatory element. In one embodiment, 2-10, 5-15, 10-15, 10-20, 15-25, 20-30, or 25-30 nucleotides separate each regulatory element. In one embodiment, 5 nucleotides separate each regulatory element. In one embodiment, 11 nucleotides separate each regulatory element. In one embodiment, 30 nucleotides separate each regulatory element. In one embodiment, the liver-specific expression cassette comprises 2, 3, 4, or 5 repeats of the liver-specific nucleic acid regulatory element. In one embodiment, the liver-specific expression cassette comprises 6, 7, 8, 9, or 10 repeats of the liver-specific nucleic acid regulatory element. In one embodiment, the liver-specific expression cassette comprises one or more FOXA and HNF4 transcription factor consensus sites. In one embodiment, the liver-specific nucleic acid regulatory element comprises one or more CpG-minimized sites.In one embodiment, the liver-specific promoter is a transthyretin (TTR) promoter, a minimal TTR promoter (TTRm), an AAT promoter, an albumin (ALB) promoter or minimal promoter, an apolipoprotein A1 (APOA1) promoter or minimal promoter, a complement factor B (CFB) promoter, a ketohexokinase (KHK) promoter, a hemopexin (HPX) promoter or minimal promoter, a nicotinamide N-methyltransferase (NNMT) promoter or minimal promoter, a carboxylesterase 1 (CES1) promoter or minimal promoter, a protein C (PROC) promoter or minimal promoter, an apolipoprotein C3 (APOC3) promoter or minimal promoter, a mannan-binding lectin serine protease 2 (mannan ... protease 2, MASP2 promoter or minimal promoter, hepcidin antimicrobial peptide, HAMP promoter or minimal promoter, and serpin peptidase inhibitor, clade C (antithrombin), member 1, SERPINC1 promoter or minimal promoter. In one embodiment, the promoter comprises any sequence from Table 1. In one embodiment, the liver-specific promoter is a TTR promoter or a TTRm promoter. In one embodiment, the transgene encodes a liver-specific therapeutic protein. In one embodiment, the liver-specific therapeutic protein is coagulation factor VIII (FVIII). In one embodiment, the coagulation FVIII comprises a codon-optimized nucleic acid sequence.In one embodiment, the coagulation FVIII comprises a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO: 143, comprises SEQ ID NO: 143, or consists of SEQ ID NO: 143.

[0030] In another aspect, the present disclosure provides a vector comprising the liver-specific nucleic acid regulatory element of any one of the aspects or embodiments herein, or the liver-specific expression cassette according to any one of the aspects or embodiments herein.In one embodiment, the vector is a viral vector or a non-viral vector.In one embodiment, the vector is a plasmid.In one embodiment, the vector is a closed-end DNA (ceDNA) vector.

[0031] In another aspect, the present disclosure provides a pharmaceutical composition comprising a liver-specific expression cassette according to any one of the aspects or embodiments herein, or a vector according to any one of the aspects or embodiments herein, and a pharma- ceutically acceptable excipient.

[0032] In another aspect, the present disclosure provides a method for treating liver-specific disease or disorder, comprising transducing or transfecting a vector according to any one of the aspects and embodiments herein, or a pharmaceutical composition of the aspect or embodiment herein, into a subject.In one embodiment, the subject is a human subject suffering from a genetic disorder.In one embodiment, the subject has hemophilia A. In one embodiment, the genetic disorder is sickle cell anemia, melanoma, hemophilia A (clotting factor VIII (FVIII) deficiency) and hemophilia B (clotting factor IX (FIX) deficiency), cystic fibrosis (CFTR), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidosis (e.g., Hurler syndrome (MPS I), Scheie syndrome (MPS IS), Hurler-Scheie syndrome (MPS I HS), Hunter syndrome (MPS II), Sanfilippo types A, B, C, and D (MPS III A, B, C, and D), Morquio types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), hyaluronidase deficiency (MPS IX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAMP-2 deficiency),Lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy infancy, GACI), Leber congenital amaurosis, Stargardt macular dystrophy (ABCA4), ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11), type III (ABCB4), or type IV (TJP2), and cathepsin A deficiency.

[0033] In another aspect, disclosed herein is a method for increasing the expression potential of a liver-specific enhancer element comprising the nucleic acid sequence CTAAG, comprising introducing a single nucleotide substitution (T to A) mutation such that the substitution results in a nucleic acid sequence comprising CAAAG.

[0034] In another aspect, disclosed herein is a liver-specific enhancer element comprising a nucleic acid sequence selected from CAAAG, CAAAGT, CAAAGTC, GCAAAGT, GCAAAG, or GCAAAGTC.

[0035] These and other aspects of the disclosure are described in further detail below. [Brief description of the drawings]

[0036] [Figure 1A] Depicts the alignment of human and 20 other vertebrate sequences and conserved enhancer regions. 115 non-human vertebrate genomes were assessed for conserved SERPINA1 enhancer regions using UCSC multiz100way and multiz30way multiple alignments. Highlighted nucleotides in the aligned sequences represent differences from the human reference sequence. [Figure 1B] Depicts the alignment of human and 20 other vertebrate sequences and conserved enhancer regions. 115 non-human vertebrate genomes were assessed for conserved SERPINA1 enhancer regions using UCSC multiz100way and multiz30way multiple alignments. Highlighted nucleotides in the aligned sequences represent differences from the human reference sequence. [Diagram 2] Depicts the identification of near-consensus binding sites for various transcription factors (TFs) in the human SERPINA1 enhancer (hSerpEnh) region, including HNF4 and FOXA, key regulators of hepatic gene expression. The bottom three rows of arrows represent TF binding motifs described by Chuah et al. (2014). The top 15 rows of arrows represent transcription factor (TF) binding motifs identified by independent analyses described herein. Positions where the human SERPINA1 sequence differs from the most highly preferred nucleotide in the sequence logo are boxed. [Diagram 3]Depicts multiple bioinformatics analyses employed to inform potential removal of CpGs (i.e., CpG excision). The human SERPINA1 enhancer contains one internal CpG and the ability to form CpGs at its 5' and 3' ends (highlighted in red and boxed in the "hSerpEnh" track). Low sequence conservation, the presence of human SNPs not known to be disease-associated, and the absence of predicted TF binding sites were assessed to inform sequence changes to remove the central CpG and potential CpG formation at the ends of the sequence. [Figure 4A] Depicts the results of the top 11 constructs (plasmids) in a screen of 30 single (1x) variants using an in vitro luciferase reporter assay (n=3). Results are categorized by rationally designed enhancer variants (1xTFBS consensus variants) or conserved SERPINA1 enhancer regions identified in other species (1xconserved genomic variants). Error bars represent standard deviation. [Figure 4B] The sequence design of the top variant hSerpEnh_FOXA_HNF4_consensus_v1 in this screen is depicted. hSerpEnh_FOXA_HNF4_consensus_v1 was designed by modifying the FOXA and HNF4 motifs identified in the human SERPINA1 enhancer to match their respective consensus sequences (GTGAATA to GTAAACA for FOXA and CTAAGT to CAAACT for HNF4). Internal CpGs have lower sequence conservation than C and were removed by changing the G at the position of the human SNP to A, which matches the SNP. [Diagram 5]Figure 1 depicts the results of screening 10 multimerization variants in plasmids using an in vitro (HepG2 cells) luciferase reporter assay (n=3). Results are categorized by rationally designed enhancer variants with 3x repeats (3xTFBS variants), conserved 3x repeat SERPINA1 enhancer regions identified in other species (3xconserved variants), 3x repeat human SERPINA1 enhancers separated by spacers of various lengths and sequences (3xhSerpEnhspacer variants), and enhancers with various numbers of repeats (#repeat variants). Wild-type human SERPINA1 enhancers are labeled (wt). Comparison of 3x human SERPINA1 enhancer variants with 3x best performing variants is boxed. Two sets of technical triplicates were performed for 1x and 3x human enhancers and the best performing 3x variant (r1, r2). Error bars represent standard deviation. [Figure 6A] Schematic diagram of spacer sequence optimization to improve the performance of hSerpEnh variant repeats. The length and sequence of the spacer between the SERPINA1 enhancer variant repeats were modified to screen for sequences that improved enhancer function. Spacers of length 2, 3, 5, 11, and 30 were designed to prevent the introduction of CpG or ATG that may create cryptic translation start sites. 11nt and 30nt spacers containing consensus FOXA and HNF4 binding sites were also designed and tested. [Figure 6B] Three major configurations of enhancer elements are depicted for screening of improved enhancer variants. Enhancer variants were tested in two major configurations: (1) as a single copy of the enhancer variant upstream of the transthyretin (TTR) promoter, TTR 5'UTR, and minute virus of mice (MVM) intron, or (2) as three copies of the enhancer variant upstream of the TTR enhancer, TTR promoter, TTR 5'UTR, and MVM intron. [Figure 7A]Figure 7A depicts the expression levels of FVIII constructs with multimeric repeats of serpin enhancer variants compared to multimeric human serpin enhancer (3x, 5x, and 10x) variants. Figure 7A depicts the expression levels of 3xHNF_FOXA_v1 variants with CpG minimization, GC-rich region (I motif secondary structure) minimization, or Aspacer (no spacer) performed comparable to the levels seen with 3xhSerpEnh. However, the HNF4 FOXA v1 variant repeated 10 times (10x) did not show significant levels of FVIII (see, e.g., Figure 7C), suggesting that the serpin enhancer performs better when repeated at a certain number, e.g., 3x-5x, preferably 3x, but not when repeated at an excessive number (e.g., 10x). Consistent observations were made with other serpin enhancer elements, including, for example, the bush baby serpin enhancer, the Chinese tree shrew serpin enhancer, and the human serpin enhancer (hSerpEnh) elements, in particular, the 5× and 10× bush baby serpin enhancer elements did not show detectable expression levels of FVIII when mice were hydrodynamically injected with a plasmid containing the element operably linked to FVIII ( FIG. 7D ). [Figure 7B]Figure 7A depicts the expression levels of FVIII constructs with multimeric repeats of serpin enhancer variants compared to multimeric human serpin enhancer (3x, 5x, and 10x) variants. Figure 7A depicts the expression levels of 3xHNF_FOXA_v1 variants with CpG minimization, GC-rich region (I motif secondary structure) minimization, or Aspacer (no spacer) performed comparable to the levels seen with 3xhSerpEnh. However, the HNF4 FOXA v1 variant repeated 10 times (10x) did not show significant levels of FVIII (see, e.g., Figure 7C), suggesting that the serpin enhancer performs better when repeated at a certain number, e.g., 3x-5x, preferably 3x, but not when repeated at an excessive number (e.g., 10x). Consistent observations were made with other serpin enhancer elements, including, for example, the bush baby serpin enhancer, the Chinese tree shrew serpin enhancer, and the human serpin enhancer (hSerpEnh) elements, in particular, the 5× and 10× bush baby serpin enhancer elements did not show detectable expression levels of FVIII when mice were hydrodynamically injected with a plasmid containing the element operably linked to FVIII ( FIG. 7D ). [Figure 7C]Figure 7A depicts the expression levels of FVIII constructs with multimeric repeats of serpin enhancer variants compared to multimeric human serpin enhancer (3x, 5x, and 10x) variants. Figure 7A depicts the expression levels of 3xHNF_FOXA_v1 variants with CpG minimization, GC-rich region (I motif secondary structure) minimization, or Aspacer (no spacer) performed comparable to the levels seen with 3xhSerpEnh. However, the HNF4 FOXA v1 variant repeated 10 times (10x) did not show significant levels of FVIII (see, e.g., Figure 7C), suggesting that the serpin enhancer performs better when repeated at a certain number, e.g., 3x-5x, preferably 3x, but not when repeated at an excessive number (e.g., 10x). Consistent observations were made with other serpin enhancer elements, including, for example, the bush baby serpin enhancer, the Chinese tree shrew serpin enhancer, and the human serpin enhancer (hSerpEnh) elements, in particular, the 5× and 10× bush baby serpin enhancer elements did not show detectable expression levels of FVIII when mice were hydrodynamically injected with a plasmid containing the element operably linked to FVIII ( FIG. 7D ). [Figure 7D]Figure 7A depicts the expression levels of FVIII constructs with multimeric repeats of serpin enhancer variants compared to multimeric human serpin enhancer (3x, 5x, and 10x) variants. Figure 7A depicts the expression levels of 3xHNF_FOXA_v1 variants with CpG minimization, GC-rich region (I motif secondary structure) minimization, or Aspacer (no spacer) performed comparable to the levels seen with 3xhSerpEnh. However, the HNF4 FOXA v1 variant repeated 10 times (10x) did not show significant levels of FVIII (see, e.g., Figure 7C), suggesting that the serpin enhancer performs better when repeated at a certain number, e.g., 3x-5x, preferably 3x, but not when repeated at an excessive number (e.g., 10x). Consistent observations were made with other serpin enhancer elements, including, for example, the bush baby serpin enhancer, the Chinese tree shrew serpin enhancer, and the human serpin enhancer (hSerpEnh) elements, in particular, the 5× and 10× bush baby serpin enhancer elements did not show detectable expression levels of FVIII when mice were hydrodynamically injected with a plasmid containing the element operably linked to FVIII ( FIG. 7D ). [Figure 8A] 8A-8E depict FVIII expression as measured by FVIII activity from serum of mice hydrodynamically injected with plasmids containing various spacer variants (2 nucleotide long spacer, (2-mer, FIG. 8A), 3 nucleotide long spacer (3-mer, FIG. 8B), 5 nucleotide long spacer (5-mer, FIG. 8C), 11 nucleotide long spacer (11-mer, FIG. 8D), and 30 nucleotide long spacer (30-mer, FIG. 8E). [Figure 8B]8A-8E depict FVIII expression as measured by FVIII activity from serum of mice hydrodynamically injected with plasmids containing various spacer variants (2 nucleotide long spacer, (2-mer, FIG. 8A), 3 nucleotide long spacer (3-mer, FIG. 8B), 5 nucleotide long spacer (5-mer, FIG. 8C), 11 nucleotide long spacer (11-mer, FIG. 8D), and 30 nucleotide long spacer (30-mer, FIG. 8E). [Figure 8C] 8A-8E depict FVIII expression as measured by FVIII activity from serum of mice hydrodynamically injected with plasmids containing various spacer variants (2 nucleotide long spacer, (2-mer, FIG. 8A), 3 nucleotide long spacer (3-mer, FIG. 8B), 5 nucleotide long spacer (5-mer, FIG. 8C), 11 nucleotide long spacer (11-mer, FIG. 8D), and 30 nucleotide long spacer (30-mer, FIG. 8E). [Figure 8D] 8A-8E depict FVIII expression as measured by FVIII activity from serum of mice hydrodynamically injected with plasmids containing various spacer variants (2 nucleotide long spacer, (2-mer, FIG. 8A), 3 nucleotide long spacer (3-mer, FIG. 8B), 5 nucleotide long spacer (5-mer, FIG. 8C), 11 nucleotide long spacer (11-mer, FIG. 8D), and 30 nucleotide long spacer (30-mer, FIG. 8E). [Figure 8E] 8A-8E depict FVIII expression as measured by FVIII activity from serum of mice hydrodynamically injected with plasmids containing various spacer variants (2 nucleotide long spacer, (2-mer, FIG. 8A), 3 nucleotide long spacer (3-mer, FIG. 8B), 5 nucleotide long spacer (5-mer, FIG. 8C), 11 nucleotide long spacer (11-mer, FIG. 8D), and 30 nucleotide long spacer (30-mer, FIG. 8E). [Figure 9]1 depicts a chart showing the results of FVIII expression using various spacer variants of hSerpEnh (2mer and 11mer as spacers), and other serpin enhancer variants (3x Bushbaby serpin enhancer to 3x Chinese Tree Shrew Serpin Enhancer). A single dose of 50 ng of plasmid was hydrodynamically injected into Rag2 mice on day 0 with a single terminal harvest on day 3 (approximately 72 hours post-dose). [Figure 10] 1 depicts a chart showing the results of FVIII expression using various spacer variants of hSerpEnh (2mer and 11mer), and other serpin enhancer variants (3x Bushbaby serpin enhancer to 3x Chinese Tree Shrew Serpin Enhancer). One dose of ceDNA was hydrodynamically injected into Rag2 mice on day 0 with a single terminal harvest on day 3 (approximately 72 hours post-dose). [Figure 11-1] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-2] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-3]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-4] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-5] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-6] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-7]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-8] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-9] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-10] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-11]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-12] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-13] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-14] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-15]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-16] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-17] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-18] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-19]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-20] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-21] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-22] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-23]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-24] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-25] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-26] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-27]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-28] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-29] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-30] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-31]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-32] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-33] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-34] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-35]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-36] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-37] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-38] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-39]Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-40] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 11-41] Figures 11-1 to 11-41 depict an exemplary annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe, a TTR liver-specific promoter, an MVM intron, a codon-optimized B domain deleted FVIII (hFVIII-F309S-BD226seq124-BDD-F309), a WPRE 3'UTR, and a 3xBushbaby_Aspacer serpin enhancer element linked to bGH (SEQ ID NO: 146). [Figure 12-1] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-2]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-3] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-4] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-5] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-6]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-7] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-8] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-9] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-10]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-11] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-12] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-13] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-14]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-15] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-16] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-17] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-18]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-19] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-20] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-21] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-22]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-23] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-24] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-25] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-26]Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 12-27] Figures 12-1 to 12-27 depict the annotated nucleotide sequence of a plasmid containing a FVIII ceDNA construct comprising TTRe_PromoterSet, Consensus_Kozak, codon-optimized hFVIII (hFVIII-F309S-BD226seq124-BDD-F309), PacI_site, WPRE_3pUTR, and a 3x human serpin enhancer element linked to bGH (SEQ ID NO: 147). [Figure 13] Depicts FVIII expression levels in mice hydrodynamically administered ceDNA constructs with various FVIII and serpin enhancer combinations via tail vein injection at a low dose of 0.5 mg / kg or a high dose of 2.0 mg / kg on day 0 (n=5). Factor VIII expression was measured on days 7, 14, 21, and 28. Expression of FVIII driven from 3x human SerpEnh with a 2 bp spacer and an 11 bp spacer was compared to 3x human SerpEnh without a spacer. [Figure 14] 1 depicts FVIII expression levels in mice hydrodynamically administered via tail vein injection with ceDNA constructs carrying various FVIII and serpin enhancer combinations at a dose of 50 ng on day 0 (n=5). Factor VIII expression was measured on days 1 and 3. [Figure 15] 1 depicts FVIII expression levels in mice hydrodynamically administered a 10 ng dose via tail vein injection on day 0 (n=5). Factor VIII expression was measured on day 3. [Figure 16A]ceDNA constructs with various FVIII and serpin enhancer combinations (3x Tibetan Antelope SERPINA1, 3x Armadillo CpG-Minimized SERPINA1, 3x Chinese Tree Shrew and 3x Chinese Tree Shrew CpG-Minimized, and 3x Bush Baby Aspacer) were used to depict FVIII expression levels in mice treated via hydrodynamic tail vein injection at three different dose levels: 25ng / an, 50ng / an, and 100ng / an on day 0 (n=4). Factor VIII expression was measured on day 3. [Figure 16B] ceDNA constructs with various FVIII and serpin enhancer combinations (3x Tibetan Antelope SERPINA1, 3x Armadillo CpG-Minimized SERPINA1, 3x Chinese Tree Shrew and 3x Chinese Tree Shrew CpG-Minimized, and 3x Bush Baby Aspacer) were used to depict FVIII expression levels in mice treated via hydrodynamic tail vein injection at three different dose levels: 25ng / an, 50ng / an, and 100ng / an on day 0 (n=4). Factor VIII expression was measured on day 3. [Figure 17] 1 depicts an annotated map of pHTS002L, a plasmid employed in generating a library of enhancer-luciferase constructs. [Figure 18A] A comparison for two biological replicates of barcode counts for each RNA sample normalized to the corresponding barcode counts for the input DNA sample that were mapped back to the associated enhancer sequence is depicted (custom MATLAB script). [Figure 18B] A comparison for two biological replicates of barcode counts for each RNA sample normalized to the corresponding barcode counts for the input DNA sample that were mapped back to the associated enhancer sequence is depicted (custom MATLAB script). [Figure 18C]A comparison for two biological replicates of barcode counts for each RNA sample normalized to the corresponding barcode counts for the input DNA sample that were mapped back to the associated enhancer sequence is depicted (custom MATLAB script). [Figure 18D] A comparison for two biological replicates of barcode counts for each RNA sample normalized to the corresponding barcode counts for the input DNA sample that were mapped back to the associated enhancer sequence is depicted (custom MATLAB script). [Figure 19] 1 depicts an alignment of multiple SERPINA1 enhancer sequences. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0037] Provided herein is a liver-specific promoter, whose native cis-regulatory region is optimized to minimize CpG content and enhance spacer optimization.The liver-specific promoter of the present disclosure represents an improvement over previously known ones by providing enhanced efficiency and safety for liver-specific gene therapy.

[0038] definition Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those of ordinary skill in the art to which this disclosure belongs. It is to be understood that this disclosure is not limited to the specific methodology, protocols, and reagents, etc. described herein, and as such may vary. The terminology used herein is for the purpose of describing specific embodiments only, and is not intended to limit the scope of the disclosure, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3), Robert S. Porter et al. (eds.), Fields Virology, 6 thEdition, published by Lippincott Williams & Wilkins, Philadelphia, PA, USA (2013); Knipe, DM and Howley, PM (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305,9780815345305), Lewin's Genes XI, Published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055), Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) (ISBN 1936113414), Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X), Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542), Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338 Strobe, (ed.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of all of which are incorporated herein by reference in their entireties.

[0039] As used herein, the terms "administration", "administering" and variations thereof refer to the introduction of a composition or agent (e.g., a therapeutic nucleic acid or an immunosuppressant described herein) into a subject, including simultaneous and sequential introduction of one or more compositions or agents. "Administration" can refer to, for example, therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also encompasses in vitro and ex vivo treatments. The introduction of a composition or agent into a subject is by any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intratumoral, or topical. The introduction of a composition or agent into a subject is by electroporation. Administration includes self-administration and administration by another person. Administration can be performed by any suitable route. A suitable route of administration allows the composition or agent to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or agent into the subject's vein.

[0040] As used herein, the phrases "nucleic acid therapy", "therapeutic nucleic acid" and "TNA" are used interchangeably and refer to any modality of therapy that uses nucleic acids as the active ingredient of a therapeutic agent to treat a disease or disorder. As used herein, these terms refer to RNA-based therapeutic agents and DNA-based therapeutic agents. Non-limiting examples of RNA-based therapeutic agents include mRNA, antisense RNA and oligonucleotides, ribozymes, aptamers, interfering RNA (RNAi), dicer substrate dsRNA, small hairpin RNA (shRNA), guide RNA (gRNA) asymmetrical interfering RNA (aiRNA), and microRNA (miRNA). Non-limiting examples of DNA-based therapeutics include minicircle DNA, minigenes, viral DNA (e.g., lentivirus or AAV genome) or non-viral synthetic DNA vectors, closed-ended linear double-stranded DNA (ceDNA / CELiD), plasmids, bacmids, doggybone (dbDNA™) DNA vectors, minimally immunologically defined gene expression (MIDGE) vectors, non-viral ministring DNA vectors (linear covalently closed DNA vectors), or dumbbell-shaped DNA minimal vectors ("dumbbell DNA").

[0041] As used herein, an "effective amount" or "therapeutically effective amount" of a therapeutic agent, such as a FVIII therapeutic protein or fragment thereof, is an amount sufficient to produce a desired effect, e.g., treatment or prevention of hemophilia A. Suitable assays for measuring expression of a target gene or target sequence include, for example, examination of protein or RNA levels using techniques known to those skilled in the art, such as dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, and phenotypic assays also known to those skilled in the art. However, dosage levels are based on a variety of factors, including the type of injury, age, weight, sex, medical condition of the patient, the severity of the medical condition, route of administration, and the particular active agent used. Thus, dosage regimens can vary widely, but can be routinely determined by a physician using standard methods. Additionally, the terms "therapeutic amount," "therapeutically effective amount," and "pharmacologically effective amount" include prophylactic or preventative amounts of the disclosed compositions described. In the prophylactic or preventative uses of the disclosure described, the pharmaceutical composition or medicament is administered to a patient susceptible to or otherwise at risk of a disease, disorder or condition, including biochemical, histological and / or behavioral symptoms of the disease, disorder or condition, its complications, and intermediate pathological phenotypes manifested during the development of the disease, disorder or condition, in an amount sufficient to eliminate or reduce the risk, reduce the severity, or delay the onset of the disease, disorder or condition. It is generally preferred to use the maximum dose, i.e., the highest safe dose, according to some medical judgment. In one embodiment, the disease, disorder, or condition is hemophilia A. The terms "dose" and "administration" are used interchangeably herein.

[0042] As used herein, the term "therapeutic effect" refers to the outcome of treatment, which outcome is deemed desirable and beneficial. Therapeutic effect can include, directly or indirectly, the prevention, reduction, or elimination of disease symptoms. Therapeutic effect can also include, directly or indirectly, the prevention, reduction, or elimination of the progression of disease symptoms.

[0043] For any therapeutic agent described herein, the therapeutically effective amount can be initially determined from preliminary in vitro studies and / or animal models. Therapeutically effective doses can also be determined from human data. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. It is within the ability of one of ordinary skill in the art to adjust the dose to achieve maximum efficacy based on the above and other known methods. See Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10, incorporated herein by reference. th General principles for determining therapeutic efficacy are summarized below and can be found in Chapter 1 of The American Clinical Trials Association (Academic Press, 2001).

[0044] Pharmacokinetic principles provide the basis for modifying dosing regimens to obtain the desired degree of therapeutic effect while minimizing unacceptable side effects. In situations where plasma concentrations of a drug can be measured and are related to the therapeutic window, additional guidance regarding dosage modifications can be obtained.

[0045] As used herein, the terms "heterologous nucleic acid sequence" and "transgene" are used interchangeably and refer to a nucleic acid of interest (other than a nucleic acid encoding a capsid polypeptide) that can be incorporated into, delivered and expressed by, a ceDNA vector disclosed herein. In one embodiment, the nucleic acid sequence can be a heterologous nucleic acid sequence. In one embodiment, the term "heterologous nucleic acid" is intended to refer to a nucleic acid (or transgene) that is not present in, expressed by, or derived from a contacted cell or subject.

[0046] As used herein, the terms "expression cassette" and "transcription cassette" are used interchangeably and refer to a linear stretch of nucleic acid that includes a transgene operably linked to one or more promoters or other regulatory sequences sufficient to direct transcription of the transgene, but does not include capsid coding sequences, other vector sequences, or inverted terminal repeat regions. An expression cassette may additionally include one or more cis-acting sequences (e.g., promoters, enhancers, or repressors), one or more introns, and one or more post-transcriptional regulatory elements.

[0047] The terms "polynucleotide" and "nucleic acid", used interchangeably herein, refer to polymeric forms of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, the terms include single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. An "oligonucleotide" generally refers to a polynucleotide of about 5 to about 100 nucleotides of single-stranded or double-stranded DNA. However, for purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides, also known as "oligomers" or "oligos", can be isolated from genes or chemically synthesized by methods known in the art. The terms "polynucleotide" and "nucleic acid" should be understood to include single-stranded (such as sense or antisense) and double-stranded polynucleotides, as applicable to the described embodiments. The DNA can be in the form of, for example, antisense molecules, plasmid DNA, DNA-DNA duplexes, pre-condensed DNA, PCR products, vectors (P1, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. The DNA can be in the form of minicircles, plasmids, bacmids, minigenes, ministring DNA (linear covalently closed DNA vectors), closed-end linear double-stranded DNA (CELiD or ceDNA), doggybone (dbDNA™) DNA, dumbbell-shaped DNA, minimally immunologically defined gene expression (MIDGE) vectors, viral vectors or non-viral vectors. The RNA can be in the form of small interfering RNA (siRNA), dicer substrate dsRNA, small hairpin RNA (shRNA), guide RNA (gRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof.Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and have similar binding properties as the reference nucleic acid. Examples of such analogs and / or modified residues include phosphorothioates, phosphorodiamidate morpholino oligomers (morpholinos), phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2'-O-methyl ribonucleotides, locked nucleic acids (LNA™), and peptide nucleic acids (PNAs). Unless otherwise limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid. Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the sequence explicitly indicated.

[0048] A "nucleotide" contains the sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate group.

[0049] "Base" includes purines and pyrimidines, which include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogues, and further include synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications that place new reactive groups, such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0050] The term "nucleic acid construct" as used herein refers to a single- or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or modified to contain a segment of nucleic acid in a manner that would not otherwise occur in nature, or is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences required for expression of the coding sequence of the present disclosure. An "expression cassette" comprises a DNA coding sequence operably linked to a promoter.

[0051] "Hybridizable" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA) contains a sequence of nucleotides that allows it to non-covalently bind, i.e., to "anneal" or "hybridize" to another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to a complementary nucleic acid) under suitable in vitro and / or in vivo conditions of temperature and solution ionic strength that form Watson-Crick base pairs and / or G / U base pairs. As is known in the art, standard Watson-Crick base pairing includes adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C). In addition, it is also known in the art that guanine (G) bases pair with uracil (U) for hybridization between two RNA molecules (e.g., dsRNA). For example, G / U base pairing is partially responsible for the degeneracy (i.e. redundancy) of the genetic code in the context of tRNA anticodon base pairing with codons in mRNA. In the context of this disclosure, guanine (G) of the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule is considered to be complementary to uracil (U), and vice versa. Thus, if a G / U base pair can be made at a given nucleotide position of the protein-binding segment (dsRNA duplex) of a subject DNA-targeting RNA molecule, that position is not considered to be non-complementary, but instead is considered to be complementary.

[0052] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymeric forms of amino acids of any length, which may include coded and non-coded amino acids, amino acids that have been chemically or biochemically modified or derivatized, and polypeptides with modified peptide backbones.

[0053] A DNA sequence that "encodes" a particular FVIII protein is a DNA nucleic acid sequence that is transcribed into a particular RNA and / or protein. The DNA polynucleotide may encode an RNA (mRNA) that is translated into a protein, or the DNA polynucleotide may encode an RNA that is not translated into a protein (e.g., tRNA, rRNA, or DNA-targeting RNA, also called "non-coding" RNA or "ncRNA").

[0054] As used herein, the term "fusion protein" refers to a polypeptide comprising protein domains from at least two different proteins. For example, a fusion protein may comprise (i) a therapeutic protein or fragment thereof (e.g., FVIII or a fragment thereof), and (ii) at least one non-GOI protein. Fusion proteins encompassed herein include, but are not limited to, an antibody or an Fc or antigen-binding fragment of an antibody fused to an extracellular domain of a therapeutic protein (e.g., FVIII protein), such as a receptor, ligand, enzyme, or peptide. The protein or fragment thereof that is part of the fusion protein may be a monospecific antibody or a bispecific or multispecific antibody.

[0055] As used herein, the term "genomic safe harbor gene" or "safe harbor gene" refers to a gene or locus into which a nucleic acid sequence can be inserted such that the sequence can integrate and function in a predictable manner (e.g., express a protein of interest) without significantly adversely affecting endogenous gene activity or promoting cancer. In some embodiments, a safe harbor gene is also a locus or gene where the inserted nucleic acid sequence can be expressed more efficiently and at higher levels than at a non-safe harbor site.

[0056] As used herein, the term "gene delivery" refers to the process by which foreign DNA is introduced into a host cell for gene therapy applications.

[0057] As used herein, the term "terminal repeat" or "TR" includes any viral terminal repeat or synthetic sequence that includes at least one minimally necessary origin of replication and a region that includes a palindromic hairpin structure. The Rep-binding sequence ("Rep-binding sequence, RBS") (also referred to as RBE (Rep-binding element)) and the terminal separation site ("TRS") together constitute the "minimally necessary origin of replication", and thus a TR includes at least one RBS and at least one TRS. TRs that are reverse complements of each other within a given stretch of a polynucleotide sequence are typically referred to as "inverted terminal repeats" or "ITRs", respectively. In the context of viruses, ITRs mediate replication, viral packaging, integration, and proviral rescue. As unexpectedly found in the present disclosure herein, TRs that are not reverse complements over their entire length can still perform the traditional functions of ITRs, and thus the term ITR is used herein to refer to TRs in a ceDNA genome or ceDNA vector that can mediate replication of the ceDNA vector. It will be understood by those skilled in the art that there may be more than two ITRs or asymmetric ITR pairs in a composite ceDNA vector configuration. The ITRs may be AAV ITRs or non-AAV ITRs or may be derived from AAV ITRs or non-AAV ITRs. For example, the ITRs may be derived from the Parvoviridae family, which includes parvoviruses and dependoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin, which serves as the origin of SV40 replication, may be used as an ITR, which may be further modified by truncation, substitution, deletion, insertion, and / or addition. The Parvoviridae family of viruses consists of two subfamilies: Parvovirinae, which infect vertebrates, and Densovirinae, which infect invertebrates. Dependoparvoviruses include the adeno-associated virus (AAV) family of viruses capable of replication in vertebrate hosts, including, but not limited to, human, primate, bovine, canine, equine, and ovine species.For convenience herein, an ITR located 5' to (upstream of) an expression cassette in a ceDNA vector is referred to as the "5' ITR" or "left ITR," and an ITR located 3' to (downstream of) an expression cassette in a ceDNA vector is referred to as the "3' ITR" or "right ITR."

[0058] "Wild-type ITR" or "WT-ITR" refers to the sequence of a naturally occurring ITR sequence in an AAV or other depend virus that retains, for example, Rep binding activity and Rep nicking ability. The nucleic acid sequence of a WT-ITR from any AAV serotype may differ slightly from the naturally occurring canonical sequence due to degeneracy of the genetic code or drift, and thus WT-ITR sequences encompassed for use herein include WT-ITR sequences as a result of naturally occurring changes (e.g., replication errors) that occur during the production process.

[0059] As used herein, the term "substantially symmetric WT-ITR" or "substantially symmetric WT-ITR pair" refers to a pair of WT-ITRs in a single ceDNA genome or ceDNA vector, both of which are wild-type ITRs with reverse-complementary sequences over their entire length. For example, an ITR can be considered to be a wild-type sequence even if it has one or more nucleotides that deviate from the naturally occurring canonical sequence, as long as the changes do not affect the sequence's properties and overall three-dimensional structure. In some embodiments, the deviating nucleotides represent conservative sequence changes. As a non-limiting example, the sequence has at least 95%, 96%, 97%, 98%, or 99% sequence identity (e.g., as measured using BLAST with default settings) with the canonical sequence and has a symmetric three-dimensional spatial organization with respect to the other WT-ITR, such that their three-dimensional structures have the same shape in geometric space. A substantially symmetric WT-ITR has the same A, C-C', and B-B' loops in three-dimensional space. A substantially symmetric WT-ITR can be functionally confirmed as WT by determining that it has an operable Rep binding site (RBE or RBE') and terminal separation site (TRS) that pairs with the appropriate Rep protein. Optionally, other functions can be tested, including transgene expression under permissive conditions.

[0060] As used herein, the phrases "modified ITR" or "mod-ITR" or "mutated ITR" are used interchangeably herein and refer to an ITR that has a mutation in at least one or more nucleotides compared to the WT-ITR from the same serotype. The mutation may result in a change in one or more of the A, C, C', B, B' regions of the ITR, and may result in a change in the three-dimensional spatial configuration (i.e., its three-dimensional structure in geometric space) compared to the three-dimensional spatial configuration of the WT-ITR of the same serotype.

[0061] As used herein, the term "asymmetric ITR", also referred to as "asymmetric ITR pair", refers to a pair of ITRs in a single ceDNA genome or ceDNA vector that are not reverse complements over the entire length. As a non-limiting example, an asymmetric ITR pair does not have a symmetric three-dimensional spatial configuration with respect to their cognate ITRs, such that their three-dimensional structures are different shapes in geometric space. In other words, an asymmetric ITR pair differs in overall geometric structure, i.e., the configuration of their A, C-C', and B-B' loops in three-dimensional space (e.g., one ITR may have a shorter C-C' arm and / or a shorter B-B' arm compared to the cognate ITR). The sequence difference between the two ITRs may be due to one or more nucleotide additions, deletions, truncations, or point mutations. In one embodiment, one ITR of the asymmetric ITR pair may be a wild-type AAV ITR sequence, and the other ITR may be a modified ITR (e.g., a non-wild-type or synthetic ITR sequence) as defined herein. In another embodiment, neither ITR of the asymmetric ITR pair is a wild-type AAV sequence, and the two ITRs are modified ITRs that have different shapes in geometric space (i.e., different overall geometric structures). In some embodiments, one mod-ITR of the asymmetric ITR pair can have a short C-C' arm, and the other ITR can have a different modification (e.g., a single arm, or a short B-B' arm, etc.) such that they have a different three-dimensional spatial organization compared to their cognate asymmetric mod-ITR.

[0062] As used herein, the term "symmetric ITR" refers to a pair of ITRs in a single ceDNA genome or ceDNA vector that are wild-type or mutant (e.g., modified relative to wild-type) depend virus ITR sequences and are reverse-complementary over their entire length. In one non-limiting example, both ITRs are wild-type ITR sequences from AAV2. In another example, neither ITR is a wild-type ITR AAV2 sequence (i.e., they are modified ITRs, also referred to as mutant ITRs), and may differ in sequence from the wild-type ITR due to nucleotide additions, deletions, substitutions, truncations, or point mutations. For convenience herein, the ITR located 5' (upstream of) the expression cassette in the ceDNA vector is referred to as the "5'ITR" or "left ITR", and the ITR located 3' (downstream of) the expression cassette in the ceDNA vector is referred to as the "3'ITR" or "right ITR".

[0063] As used herein, the term "substantially symmetric modified ITR" or "substantially symmetric mod-ITR pair" refers to a pair of modified ITRs in a single ceDNA genome or ceDNA vector, both of which have reverse-complementary sequences over their entire length. For example, modified ITRs can be considered substantially symmetric even if there are some nucleic acid sequences that deviate from the reverse-complementary sequence, as long as the changes do not affect the properties and overall shape. As a non-limiting example, the sequences have at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity (measured using BLAST with default settings) to the canonical sequence and have a symmetric three-dimensional spatial organization with respect to their cognate modified ITRs, such that their three-dimensional structures have the same shape in geometric space. In other words, substantially symmetric modified ITR pairs have the same A, C-C', and B-B' loops organized in three-dimensional space. In some embodiments, the ITRs from a mod-ITR pair may have different reverse-complementary nucleic acid sequences, but still have the same symmetrical three-dimensional spatial organization. That is, both ITRs have mutations that result in the same overall three-dimensional shape. For example, one ITR (e.g., the 5'ITR) of a mod-ITR pair may be from one serotype, and the other ITR (e.g., the 3'ITR) may be from a different serotype, but both may have the same corresponding mutations (e.g., if the 5'ITR has a deletion in the C region, the cognate modified 3'ITR of the different serotype has a deletion in the corresponding position of the C' region), so that the modified ITR pair has the same symmetrical three-dimensional spatial organization. In such embodiments, each ITR of the modified ITR pair may be derived from a different serotype (e.g., AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12), such as a combination of AAV2 and AAV6, and the modification of one ITR is reflected in the corresponding position of the cognate ITR of the different serotype. In one embodiment, a substantially symmetric modified ITR pair refers to a pair of modified ITRs (mod-ITRs), so long as the differences in the nucleic acid sequences between the ITRs do not affect the properties or overall shape, and they have substantially the same shape in three-dimensional space.As non-limiting examples, a mod-ITR has at least 95%, 96%, 97%, 98%, or 99% sequence identity to a canonical mod-ITR as determined by standard means well known in the art, such as BLAST (Basic Local Alignment Search Tool) or BLASTN with default settings, and has a symmetric three-dimensional spatial organization such that their three-dimensional structures have the same shape in geometric space. A substantially symmetric mod-ITR pair has the same A, C-C', and B-B' loops in three-dimensional space. For example, if a modified ITR of a substantially symmetric mod-ITR pair has a deletion of the C-C' arm, then the cognate mod-ITR has a corresponding deletion of the C-C' loop and has a similar three-dimensional structure of the remaining A and B-B' loops that are the same shape in geometric space as its cognate mod-ITR.

[0064] The term "flanking" refers to the relative position of one nucleic acid sequence with respect to another. Generally, in the sequence ABC, B is flanked by A and C. Similarly for the sequence AxBxC. Thus, a flanking sequence precedes or follows the flanked sequence, but need not be contiguous or immediately adjacent to the flanked sequence. In one embodiment, the term flanking refers to the terminal repeats at each end of a linear double-stranded ceDNA vector.

[0065] As used herein, the terms "treat", "treating" and / or "treatment" include arresting, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating the clinical symptoms of a condition, or substantially preventing the appearance of clinical symptoms of a condition, to obtain beneficial or desired clinical results. In one embodiment, the condition is hemophilia A. Treating further refers to achieving one or more of the following: (a) reducing the severity of the disorder, (b) limiting the onset of symptoms characteristic of the disorder being treated, (c) limiting the worsening of symptoms characteristic of the disorder being treated, (d) limiting recurrence of the disorder in patients who previously had the disorder, and (e) limiting recurrence of symptoms in patients who were previously asymptomatic for the disorder. Beneficial or desired clinical results, such as pharmacological and / or physiological effects, include, but are not limited to, preventing the occurrence of a disease, disorder or condition in a subject who may have a predisposition to the disease, disorder or condition, but who has not yet experienced or exhibited symptoms of the disease (prophylactic treatment), alleviating the symptoms of the disease, disorder or condition, reducing the severity of the disease, disorder or condition, stabilizing (i.e., not worsening) the disease, disorder or condition, preventing the spread of the disease, disorder or condition, slowing or retarding the progression of the disease, disorder or condition, ameliorating or alleviating the disease, disorder or condition, and combinations thereof, as well as prolonging survival as compared to expected survival if not receiving treatment.

[0066] As used herein, the terms "increase," "enhance," "elevate" (and similar terms) generally refer to the act of directly or indirectly increasing a concentration, level, function, activity, or behavior relative to natural, expected or average, or relative to a control condition.

[0067] As used herein, the terms "minimize," "reduce," "lower," and / or "inhibit" (and similar terms) generally refer to the act of decreasing, either directly or indirectly, a concentration, level, function, activity, or behavior relative to natural, expected or average, or relative to a control condition.

[0068] As used herein, the term "ceDNA genome" refers to an expression cassette that further incorporates at least one inverted terminal repeat region. The ceDNA genome may further comprise one or more spacer regions. In some embodiments, the ceDNA genome is incorporated into a plasmid or viral genome as an intermolecular double-stranded polynucleotide of DNA.

[0069] As used herein, the term "ceDNA spacer region" refers to an intervening sequence that separates functional elements in a ceDNA vector or ceDNA genome. In some embodiments, a ceDNA spacer region maintains two functional elements at a desired distance for optimal functionality. In some embodiments, a ceDNA spacer region provides or increases the genetic stability of a ceDNA genome, for example, in a plasmid or baculovirus. In some embodiments, a ceDNA spacer region facilitates easy genetic manipulation of a ceDNA genome by providing a convenient location for a cloning site or the like. For example, in certain aspects, an oligonucleotide "polylinker" containing several restriction endonuclease sites, or a non-open reading frame sequence designed to have no known protein (e.g., transcription factor) binding sites, can be positioned in a ceDNA genome to separate cis-acting elements, for example, inserting a 6mer, 12mer, 18mer, 24mer, 48mer, 86mer, 176mer, etc., between the terminal separation site and the upstream transcriptional regulatory element. Similarly, a spacer can be incorporated between a polyadenylation signal sequence and the 3' terminal separation site.

[0070] As used herein, "Rep binding site", "Rep binding element", "RBE", and "RBS" are used interchangeably and refer to a binding site of a Rep protein (e.g., AAV Rep 78 or AAV Rep 68) that, upon binding by the Rep protein, allows the Rep protein to perform its site-specific endonuclease activity on a sequence incorporating the RBS. An RBS sequence and its reverse complement together form a single RBS. RBS sequences are known in the art and include, for example, the RBS sequence identified in AAV2, 5'-GCGCGCTCGCTCGCTC-3' (SEQ ID NO: 140). Any known RBS sequence may be used in the embodiments of the present disclosure, including other known AAV RBS sequences and other naturally known or synthetic RBS sequences. Without wishing to be bound by theory, it is believed that the nuclease domain of the Rep protein binds to the double-stranded nucleic acid sequence GCTC, and thus the two known AAV Rep proteins bind directly to the double-stranded oligonucleotide, 5'-(GCGC)(GCTC)(GCTC)(GCTC)-3' (SEQ ID NO: 140), and stably assemble. In addition, the soluble aggregated conformers (i.e., an indefinite number of inter-associated Rep proteins) dissociate and bind to oligonucleotides containing the Rep binding site. Each Rep protein interacts with both the nitrogenous bases and the phosphodiester backbone on each strand. The interactions with the nitrogenous bases provide sequence specificity, while the interactions with the phosphodiester backbone are non- or low-sequence specific, stabilizing the protein-DNA complex.

[0071] As used herein, the terms "terminal separation site" and "TRS" are used interchangeably herein and refer to the region where Rep forms a tyrosine-phosphodiester bond with 5' thymidine that generates a 3'OH that serves as a substrate for DNA elongation via a cellular DNA polymerase, such as DNA pol delta or DNA pol epsilon. Alternatively, the Rep-thymidine complex can participate in a coordinate ligation reaction. In some embodiments, the TRS minimally includes a non-base paired thymidine. In some embodiments, the nicking efficiency of the TRS can be controlled at least in part by its distance within the same molecule from the RBS. When the acceptor substrate is a complementary ITR, the resulting product is an intermolecular duplex. TRS sequences are known in the art and include, for example, 5'-GGTTGA-3', a hexanucleotide sequence identified in AAV2. Other known AAV TRS sequences and other naturally occurring or synthetic TRS sequences such as AGTT (SEQ ID NO: 1690), GGTTGG, AGTTGG, AGTTGA, and any known TRS sequence containing other motifs such as RRTTRR may be used in embodiments of the present disclosure.

[0072] As used herein, the term "ceDNA-plasmid" refers to a plasmid that contains a ceDNA genome as an intermolecular duplex.

[0073] As used herein, the term "ceDNA-bacmid" refers to an infectious baculovirus genome that contains a ceDNA genome as an intermolecular duplex that can be propagated as a plasmid in E. coli, thereby acting as a shuttle vector for the baculovirus.

[0074] As used herein, the term "ceDNA-baculovirus" refers to a baculovirus that contains a ceDNA genome as an intermolecular duplex within the baculovirus genome.

[0075] As used herein, the terms "ceDNA-baculovirus-infected insect cells" and "ceDNA-BIIC" are used interchangeably and refer to invertebrate host cells (including but not limited to insect cells (e.g., Sf9 cells)) infected with a ceDNA-baculovirus.

[0076] As used herein, the term "ceDNA" refers to capsid-free closed-end linear double stranded (ds) duplex DNA for synthetic or other non-viral gene transfer. A detailed description of ceDNA is described in International Patent Application No. PCT / US2017 / 020828, filed March 3, 2017, the entire contents of which are expressly incorporated herein by reference. Certain methods for the production of ceDNA containing various inverted terminal repeat (ITR) sequences and configurations using cell-based methods are described in Example 1 of International Patent Application Nos. PCT / US18 / 49996, filed September 7, 2018, and PCT / US2018 / 064242, filed December 6, 2018, each of which is incorporated herein by reference in its entirety. Certain methods for the production of synthetic ceDNA vectors containing various ITR sequences and configurations are described, for example, in International Application No. PCT / US2019 / 14122, filed January 18, 2019, the entire contents of which are incorporated herein by reference.

[0077] As used herein, the term "closed-ended DNA vector" refers to a capsid-free DNA vector having at least one covalently closed end and at least a portion of the vector having an intramolecular double-stranded structure.

[0078] As used herein, the terms "ceDNA vector" and "ceDNA" are used interchangeably and refer to a closed-end DNA vector that contains at least one terminal palindrome. In some embodiments, the ceDNA contains two covalently closed ends.

[0079] As used herein, the term "neDNA" or "nicked ceDNA" refers to closed-end DNA that has a nick or gap of 1-100 base pairs in the stem or spacer region 5' upstream of an open reading frame (e.g., an expressed promoter and transgene).

[0080] As used herein, the term "gap" refers to an interrupted portion of the synthetic DNA vector of the present disclosure, where a stretch of single-stranded DNA is created in the otherwise double-stranded ceDNA. A gap can be as long as 1 base pair to 100 base pairs in length for a single strand of the double-stranded DNA. Exemplary gaps designed and created by the methods described herein, and synthetic vectors generated thereby, can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 bp in length. Exemplary gaps in the present disclosure can be 1 bp to 10 bp in length, 1 to 20 bp in length, or 1 to 30 bp in length.

[0081] As defined herein, a "reporter" refers to a protein that can be used to provide a detectable readout. Reporters generally produce a measurable signal, such as fluorescence, color, or luminescence. A reporter protein coding sequence encodes a protein whose presence in a cell or organism is easily observed. For example, fluorescent proteins cause cells to fluoresce when excited with a particular wavelength of light, luciferase causes cells to catalyze a reaction that produces light, and enzymes such as β-galactosidase convert a substrate into a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.

[0082] As used herein, the terms "sense" and "antisense" refer to the orientation of a structural element on a polynucleotide. The sense and antisense versions of an element are the reverse complements of each other.

[0083] As used herein, the terms "synthetic AAV vector" and "synthetic production of AAV vector" refer to AAV vectors and methods for their synthetic production in an entirely cell-free environment.

[0084] As used herein, "reporter" refers to a protein that can be used to provide a detectable readout. Reporters generally produce a measurable signal, such as fluorescence, color, or luminescence. A reporter protein coding sequence encodes a protein whose presence in a cell or organism is easily observed. For example, fluorescent proteins cause cells to fluoresce when excited with a particular wavelength of light, luciferase causes cells to catalyze a reaction that produces light, and enzymes such as β-galactosidase convert a substrate into a colored product. Exemplary reporter polypeptides useful for experimental or diagnostic purposes include, but are not limited to, β-lactamase, β-galactosidase (LacZ), alkaline phosphatase (AP), thymidine kinase (TK), green fluorescent protein (GFP) and other fluorescent proteins, chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.

[0085] As used herein, the term "effector protein" refers to a polypeptide that provides a detectable readout, for example, as a reporter polypeptide, or more appropriately, as a polypeptide that kills a cell, such as a toxin, or an agent that renders the cell susceptible to killing with a selected agent or its deletion. Effector proteins include any protein or peptide that directly targets or damages the DNA and / or RNA of a host cell. For example, effector proteins may include, but are not limited to, restriction endonucleases (whether genomic or extrachromosomal elements) that target host cell DNA sequences, proteases that target polypeptides required for cell survival, DNA gyrase inhibitors, and ribonuclease-type toxins. In some embodiments, the expression of effector proteins controlled by the synthetic biological circuits described herein may participate as a factor in another synthetic biological circuit, thereby expanding the scope and complexity of the responsiveness of the biological circuit system.

[0086] Transcriptional regulators refer to transcriptional activators and repressors that activate or repress the transcription of a gene of interest, such as FVIII. A promoter is a region of nucleic acid that initiates the transcription of a particular gene. Transcriptional activators typically bind near the transcriptional promoter and recruit RNA polymerase to directly initiate transcription. Repressors bind to the transcriptional promoter and sterically hinder the initiation of transcription by RNA polymerase. Other transcriptional regulators can serve as either activators or repressors, depending on where they bind and on cellular and environmental conditions. Non-limiting examples of transcriptional regulator classes include, but are not limited to, homeodomain proteins, zinc finger proteins, winged helix (forkhead) proteins, and leucine-zipper proteins.

[0087] As used herein, a "repressor protein" or an "inducer protein" is a protein that binds to a regulatory sequence element and represses or activates, respectively, the transcription of a sequence operably linked to the regulatory sequence element. Preferred repressor and inducer proteins described herein are sensitive to the presence or absence of at least one input agent or environmental input. Preferred proteins described herein are modular in form, for example, containing separable DNA-binding and input agent-binding or response elements or domains.

[0088] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharma-ceutically active substances is well known in the art. Supplementary active ingredients can also be incorporated into the composition. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce toxic, allergic, or similar untoward reactions when administered to a host.

[0089] As used herein, an "input agent responsive domain" is a domain of a transcription factor that responds to a condition or input agent such that it binds to the condition or input agent or otherwise renders the linked DNA-binding fusion domain responsive to the presence of that condition or input. In one embodiment, the presence of the condition or input results in a conformational change in the input agent responsive domain or the protein to which it is fused, which modifies the transcriptional regulatory activity of the transcription factor.

[0090] The term "in vivo" refers to an assay or process that occurs in or within an organism, such as a multicellular animal. In some of the aspects described herein, the method or use may be said to occur "in vivo" when a unicellular organism, such as a bacterium, is used. The term "ex vivo" refers to methods and uses that are carried out using live cells with intact membranes outside the body of a multicellular animal or plant, such as explants, cultured cells (including primary cells and cell lines), transformed cell lines, and extracted tissues or cells (including blood cells), among others. The term "in vitro" refers to assays and methods that do not require the presence of cells with intact membranes, such as cell extracts, and may refer to the introduction of a programmable synthetic biological circuit into a non-cellular system, such as a cell or cell system-free medium, such as a cell extract.

[0091] As used herein, the term "promoter" refers to any nucleic acid sequence that regulates the expression of another nucleic acid sequence by driving the transcription of the nucleic acid sequence, which may be a target gene (e.g., a heterologous target gene encoding a protein or RNA). Promoters can be constitutive, inducible, repressible, tissue-specific, or any combination thereof. A promoter is a control region of a nucleic acid sequence where the initiation and rate of transcription of the remainder of the nucleic acid sequence is controlled. Promoters can also contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. In some embodiments of the aspects described herein, a promoter can drive the expression of transcription factors that regulate the expression of the promoter itself. Within the promoter sequence will be found transcription initiation sites, as well as protein binding domains involved in the binding of RNA polymerase. Eukaryotic promoters often, but not necessarily, contain "TATA" boxes and "CAT" boxes. A variety of promoters, including inducible promoters, can be used to drive the expression of transgenes in the ceDNA vectors disclosed herein. A promoter sequence is bounded at its 3' end by a transcription initiation site and extends upstream (5' orientation) to include the minimum number of bases or elements necessary to initiate transcription at a level detectable above background.

[0092] In one embodiment, the promoter contained in the nucleic acid expression cassettes and vectors disclosed herein is a liver-specific promoter.

[0093] The term "liver-specific promoter" encompasses any promoter that confers liver-specific expression to a (trans)gene. Non-limiting examples of liver-specific promoters are provided in the Liver-Specific Gene Promoter Database (LSPD, rulai.cshl.edu / LSPD / ) and include, for example, the transthyretin (TTR) promoter or the TTR minimal promoter (TTRm), alpha-1 antitrypsin (alpha 1-antitrypsin, AAT) promoter, albumin (ALB) promoter or minimal promoter, apolipoprotein A1 (APOA1) promoter or minimal promoter, complement factor B (CFB) promoter, ketohexokinase (KHK) promoter, hemopexin (HPX) promoter or minimal promoter, nicotinamide N-methyltransferase (NNMT) promoter or minimal promoter, (hepatic) carboxylesterase 1 (CES1) promoter or minimal promoter, protein C (PROC) promoter or minimal promoter, apolipoprotein C3 (APOC3) promoter or minimal promoter, mannan-binding lectin serine protease 2 (MASP2) promoter or minimal promoter, hepcidin antimicrobial peptide (HAMP) promoter or minimal promoter, and serpin peptidase inhibitor, clade C (antithrombin), member 1 (SERPINC1) promoter or minimal promoter.

[0094] In some embodiments, the promoter is a mammalian liver-specific promoter, in particular a mouse or human liver-specific promoter.

[0095] As used herein, the term "enhancer" refers to a cis-acting regulatory sequence (e.g., 50-1,500 base pairs) that binds to one or more proteins (e.g., activator proteins or transcription factors) to increase transcriptional activation of a nucleic acid sequence. Enhancers can be located up to 1,000,000 base pairs upstream of the start site of the gene they regulate or downstream of the start site of the gene. Enhancers can be located within intronic or exonic regions of unrelated genes.

[0096] A promoter can be said to drive expression or drive transcription of the nucleic acid sequence it regulates. The phrases "operably linked," "operably positioned," "operably linked," "under control," and "under transcriptional control" indicate that the promoter is in the correct functional location and / or orientation with respect to a nucleic acid sequence and regulates to control transcription initiation and / or expression of that sequence. As used herein, an "inverted promoter" refers to a promoter in which a nucleic acid sequence is in an inverted orientation, whereby what was the coding strand is now the non-coding strand, and vice versa. Inverted promoter sequences can be used in various embodiments to regulate the state of a switch. Additionally, in various embodiments, a promoter can be used in conjunction with an enhancer.

[0097] A promoter may be one that is naturally associated with a gene or sequence, which may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and / or exons of a given gene or sequence. Such a promoter may be referred to as "endogenous." Similarly, in some embodiments, an enhancer may be one that is naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.

[0098] In some embodiments, the coding nucleic acid segment is placed under the control of a "recombinant promoter" or a "heterologous promoter," both of which refer to a promoter that is not normally associated with an operably linked encoded nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers to an enhancer that is not normally associated with a given nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and synthetic promoters or enhancers that are not "naturally occurring," i.e., may contain different elements of different transcriptional regulatory regions and / or mutations that alter expression through methods of genetic engineering known in the art. In addition to synthetically producing promoter and enhancer nucleic acid sequences, promoter sequences may be produced using recombinant cloning and / or nucleic acid amplification techniques, including PCR, for the synthetic biological circuits and modules disclosed herein (see, e.g., U.S. Pat. Nos. 4,683,202 and 5,928,906, each of which is incorporated herein by reference). Additionally, it is contemplated that control sequences that direct transcription and / or expression of sequences within non-nuclear organelles, such as mitochondria, chloroplasts, etc., can be used as well.

[0099] As described herein, an "inducible promoter" is characterized by initiating or enhancing transcriptional activity when in the presence of, affected by, or contacted by an inducer or inducer agent. As defined herein, an "inducer" or "inducer agent" can be endogenous or can be a compound or protein, usually exogenous, administered in such a manner that it is active in inducing transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducer agent, i.e., a chemical, compound, or protein, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., the inducer can be an inducer protein expressed by another component or module) and can itself be under the control of an inducible promoter. In some embodiments, an inducible promoter is induced in the absence of a certain agent, such as a repressor. Examples of inducible promoters include, but are not limited to, tetracycline, metallothionine, ecdysone, mammalian viruses (e.g., adenovirus late promoter and mouse mammary tumor virus long terminal repeat (MMTV-LTR)), as well as other steroid-responsive promoters, rapamycin-responsive promoters, and the like.

[0100] The terms "DNA regulatory sequence," "control element," and "regulatory element," used interchangeably herein, refer to transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, proteolytic signals, etc., that provide and / or regulate the transcription of a non-coding sequence (e.g., a DNA-targeting RNA) or a coding sequence (e.g., a site-directed modifying polypeptide or a Cas9 / Csn1 polypeptide) and / or regulate the translation of the encoded polypeptide.

[0101] A regulatory element comprises at least one transcription factor binding site (TFBS), more particularly at least one binding site for a tissue-specific transcription factor, most particularly at least one binding site for a liver-specific transcription factor. Typically, a regulatory element as used herein increases or enhances promoter-driven gene expression when compared to transcription of the gene from the promoter alone without the regulatory element. Thus, while regulatory elements specifically include enhancer sequences, it should be understood that regulatory elements that enhance transcription are not limited to typical far upstream enhancer sequences, but may be present at any distance from the gene they regulate. Indeed, it is known in the art that sequences that regulate transcription may be located either upstream (e.g., in the promoter region) or downstream (e.g., in the 3'UTR) of the gene they regulate in vivo, and may be located in the immediate vicinity of the gene or further away. The regulatory elements disclosed herein are typically naturally occurring sequences, but (some) combinations of such regulatory elements or several copies of regulatory elements, i.e., non-naturally occurring sequences, are also envisaged as regulatory elements in themselves. As used herein, a regulatory element may be part of a larger sequence involved in transcriptional control, such as a promoter sequence, However, a regulatory element alone is typically not sufficient to initiate transcription, but requires a promoter for this purpose.

[0102] In one embodiment, one or more regulatory elements contained in the nucleic acid expression cassettes and vectors disclosed herein are preferably liver-specific. Non-limiting examples of liver-specific regulatory elements are disclosed in WO 2009 / 130208, which is incorporated herein by reference in its entirety. Another example of a liver-specific regulatory element is the regulatory element derived from the transthyretin (TTR) gene, referred to herein as "TTRe". "Liver-specific expression", as used herein, refers to preferential or predominant expression of a (trans)gene (as RNA and / or polypeptide) in the liver compared to other tissues. In one embodiment, at least 50% of the (trans)gene expression occurs in the liver. According to some embodiments, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% of the (trans)gene expression occurs in the liver. In one embodiment, liver-specific expression involves no "leakage" of the expressed gene product to other organs, such as the spleen, muscle, heart, and / or lung. When liver-specific is referred to in the context of expression, it should be understood that hepatocyte-specific expression is also expressly envisaged. Similarly, when tissue-specific expression is used in the specification, cell type-specific expression of the cell type that mainly constitutes the tissue is also envisaged.

[0103] As used herein, the term "hepatocytes" includes cells that reside primarily in the liver, and primarily includes hepatocytes, oval cells, liver sinusoidal endothelial cells (LSECs), and cholangiocytes (epithelial cells that form the bile ducts).

[0104] "Operably linked" refers to a juxtaposition in which the components so described are in a relationship that permits them to function in their intended manner. For example, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. An "expression cassette" includes a heterologous DNA sequence operably linked to a DNA sequence, e.g., a promoter or other regulatory sequence sufficient to direct the transcription of a transgene in a ceDNA vector. Suitable promoters include, for example, tissue-specific promoters or promoters of AAV origin.

[0105] As used herein, the term "subject" refers to a human or animal to which treatment, including prophylactic treatment, with a ceDNA vector according to the present disclosure is provided. Typically, the animal is a vertebrate, such as, but not limited to, a primate, a rodent, a domestic animal, or a game animal. Primates include, but are not limited to, chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, such as rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Domestic and game animals include, but are not limited to, cows, horses, pigs, deer, bison, buffalo, feline species, such as domestic cats, canine species, such as dogs, foxes, wolves, avian species, such as chickens, emus, ostriches, and fish. In certain embodiments of the aspects described herein, the subject is a mammal, such as a primate or a human. The subject may be male or female. Additionally, the subject may be an infant or child. In some embodiments, the subject may be a neonatal or fetal subject, e.g., the subject is present in utero. Preferably, the subject is a mammal. The mammal may be, but is not limited to, a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, or a cow. Non-human mammals may be advantageously used as subjects that represent animal models of diseases and disorders. In addition, the methods and compositions described herein may be used with domestic animals and / or pets. Human subjects may be of any age, sex, race, or ethnic group, e.g., Caucasian (white), Asian, African, Black, African American, African European, Latin American, Middle Eastern, etc. In some embodiments, the subject may be a patient or other subject in a clinical setting. In some embodiments, the subject has already undergone treatment. In some embodiments, the subject is an embryo, fetus, newborn, infant, child, adolescent, or adult. In some embodiments, the subject is a human fetus, a human newborn, a human infant, a human child, a human adolescent, or a human adult. In some embodiments, the subject is an animal embryo, or a non-human embryo or a non-human primate embryo, hi some embodiments, the subject is a human embryo.

[0106] The term "control" as used herein is intended to refer to a reference standard. In one embodiment, the control may be a negative control sample obtained from a healthy patient. According to other embodiments, the control is a positive control sample obtained from a patient diagnosed with a genetic disease or disorder. In one embodiment, the control is a historical control or a standard reference value or range of values ​​(such as a previously tested control sample, such as a group of hemophilia A patients with a known prognosis or outcome, or a group of samples representing baseline or normal values).

[0107] The difference between the test sample and the control may be an increase or, conversely, a decrease. The difference may be a qualitative difference or a quantitative difference, for example, a statistically significant difference. In some examples, the difference is an increase or decrease of at least about 5%, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or more than 500%, compared to the control.

[0108] As used herein, the term "host cell" includes any cell type that is amenable to transformation, transfection, transduction, etc. with a nucleic acid construct or ceDNA expression vector of the present disclosure. By way of non-limiting example, host cells include isolated primary cells, pluripotent stem cells, CD34 + The host cell may be any of several immortalized cell lines (e.g., HepG2 cells), induced pluripotent stem cells, or any of several immortalized cell lines (e.g., HepG2 cells). Alternatively, the host cell may be an in situ or in vivo cell in a tissue, organ, or organism.

[0109] The term "exogenous" refers to a substance present in a cell other than its natural source. As used herein, the term "exogenous" may refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or a polypeptide that is not normally found and that has been introduced into a biological system, such as a cell or organism, by a process involving the hand of man, where it is desired to introduce the nucleic acid or polypeptide into such a cell or organism. Alternatively, "exogenous" may refer to a nucleic acid or polypeptide that is found in relatively low amounts and that has been introduced into a biological system, such as a cell or organism, by a process involving the hand of man, where it is desired to increase the amount of the nucleic acid or polypeptide in the cell or organism, e.g., to cause ectopic expression or levels. In contrast, the term "endogenous" refers to a substance that is natural to a biological system or cell.

[0110] The term "sequence identity" refers to the relationship between two nucleic acid sequences. For the purposes of this disclosure, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. Optional parameters used are gap open penalty 10, gap extension penalty 0.5, and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity, calculated as follows: (identical deoxyribonucleotides x 100) / (length of alignment - total number of gaps in alignment). The length of the alignment is preferably at least 10 nucleotides, preferably at least 25 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides.

[0111] The term "homology" or "homology" as used herein is defined as the percentage of nucleotide residues that are identical to the nucleotide residues of the corresponding sequence on the target chromosome, after aligning the sequences as necessary and introducing gaps to achieve the maximum sequence identity percentage. Alignment for the purpose of determining the nucleotide sequence homology percentage can be achieved in various ways that are within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ClustalW2, or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment over the entire length of the sequences being compared. In some embodiments, for example, a nucleic acid sequence (e.g., a DNA sequence) of an arm of homology is considered "homologous" if the sequence is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more identical to a corresponding native or unedited nucleic acid sequence (e.g., a genomic sequence) of the host cell.

[0112] The term "heterologous" as used herein refers to a nucleotide or polypeptide sequence that is not found in a naturally occurring nucleic acid or protein, respectively. A heterologous nucleic acid sequence may be linked (e.g., by genetic engineering) to a naturally occurring nucleic acid sequence (or a variant thereof) to generate a chimeric nucleotide sequence that encodes a chimeric polypeptide. A heterologous nucleic acid sequence may be linked (e.g., by genetic engineering) to a variant polypeptide to generate a nucleotide sequence that encodes a fusion variant polypeptide.

[0113] A "vector" or "expression vector" is a replicon, such as a plasmid, bacmid, phage, virus, virion, or cosmid, to which another DNA segment, or "insert," can be attached to effect replication of the attached segment in a cell. A vector can be a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. A vector can include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. A vector can also include one or more selectable marker genes and other genetic elements. The term "vector" encompasses any genetic element that can replicate and transfer genetic sequences to a cell when associated with the appropriate control elements. In some embodiments, a vector can be an expression vector or a recombinant vector. In some embodiments, a vector is an expression vector that contains the necessary regulatory sequences to allow transcription and translation of the inserted gene. In some embodiments, a vector is a ceDNA vector. In some embodiments, a vector is an AAV vector. In some embodiments, a vector is a retroviral gamma vector, a lentiviral vector, or an adenoviral vector.

[0114] As used herein, the term "expression vector" refers to a vector that directs the expression of an RNA or polypeptide from a sequence linked to a transcriptional regulatory sequence on the vector. The sequence to be expressed is often, but not necessarily, heterologous to the cell. An expression vector can contain additional elements, for example, an expression vector can have two replication systems, so that it can be maintained in two organisms, for example, human cells for expression, and prokaryotic hosts for cloning and amplification. The term "expression" refers to the cellular processes involved in the production of RNA and proteins, and optionally secreted proteins, including, but not limited to, transcription, transcriptional processing, translation, and protein folding, modification, and processing. "Expression products" include RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene. The term "gene" refers to a nucleic acid sequence (DNA) that is transcribed into RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. A gene may or may not include regions preceding and following the coding region, such as 5' untranslated (5'UTR) or "leader" sequences and 3'UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons).

[0115] By "recombinant vector" is meant a vector that contains a nucleic acid sequence (e.g., a heterologous nucleic acid sequence) or a "transgene" that can be expressed in vivo. It should be understood that the vectors described herein can be combined with other suitable compositions and therapies in some embodiments. In some embodiments, the vector is episomal. The use of a suitable episomal vector provides a means to maintain a nucleotide of interest in a subject in high copy number of extrachromosomal DNA, thereby eliminating the potential effects of chromosomal integration.

[0116] The phrase "genetic disease" as used herein refers to a disease that is caused, directly or indirectly, partially or completely, by one or more abnormalities in the genome, particularly conditions that are present from birth. The abnormality may be a mutation, an insertion, or a deletion. The abnormality may affect the coding sequence of the gene or its regulatory sequence. The genetic disease may be, but is not limited to, DMD, hemophilia, cystic fibrosis, Huntington's disease, familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, congenital hepatic porphyria, inherited disorders of hepatic metabolism, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, and Tay-Sachs disease.

[0117] As used herein, the terms "comprising" or "comprises" are used in reference to compositions, methods, and their respective components that are essential to the method or composition, but are open to the inclusion of non-specified elements, whether essential or not.

[0118] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristics of the embodiment. The use of "comprises" indicates inclusion rather than limitation.

[0119] The term "consisting of" refers to compositions, methods, and their respective components described herein, excluding any element not recited in the description of the embodiment.

[0120] As used herein, the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristics of that embodiment of the present disclosure.

[0121] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to a "method" includes one or more methods, and / or steps of the type described herein and / or that will be apparent to one of ordinary skill in the art upon reading this disclosure, and so forth. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "eg" is derived from the Latin exempli gratia and is used herein to denote a non-limiting example. Thus, the abbreviation "eg" is synonymous with "for example."

[0122] Grouping of alternative elements or embodiments of the disclosure disclosed herein should not be construed as limiting. Members of each group may be referenced and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group may be included in or deleted from a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed herein to include the modified group, thus satisfying the description of all Markush groups used in the appended claims.

[0123] In some embodiments of any of the aspects, the disclosure described herein does not pertain to human cloning processes, processes for correcting the genetic identity of human germ lines, the use of human embryos for industrial or commercial purposes, or animals that are likely to cause suffering without providing any substantial medical benefit to humans or animals, and processes for correcting the genetic identity of animals resulting from such processes.

[0124] Other terms are defined herein within the description of various aspects of the disclosure.

[0125] All patents and other publications, including literature references, issued patents, published patent applications, and co-pending patent applications, cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that may be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure or for any other reason. All statements as to the date or representation as to the contents of these documents are based on the information available to the applicant and do not constitute any admission as to the accuracy of the dates or contents of these documents.

[0126] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Although specific embodiments and examples of the present disclosure are described herein for illustrative purposes, those skilled in the art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while method steps or functions are presented in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the present disclosure can be modified as appropriate to provide further embodiments of the present disclosure using the compositions, functions, and concepts of the above references and applications. Furthermore, some changes can be made to protein structures without affecting the type or amount of biological or chemical action, due to considerations of biological functional equivalence. These and other changes can be made to the present disclosure in light of the detailed description. All such modifications are intended to be within the scope of the appended claims.

[0127] Particular elements of any of the foregoing embodiments can be combined with or substituted for elements of other embodiments. Additionally, although advantages associated with particular embodiments of the present disclosure have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily exhibit such advantages, to be within the scope of the present disclosure.

[0128] II. Expression cassettes optimized for liver-specific expression The present disclosure provides a liver-specific expression cassette for enhancing transcription in liver tissues and / or cells. As discussed in the Examples, the present disclosure provides a novel set of non-natural modifications to the native liver-specific enhancer region that unexpectedly increase acute protein expression levels and improve sequence characteristics known to affect protein expression durability.

[0129] In one embodiment, the liver-specific expression cassette provided herein comprises an enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette provided herein comprises two or more repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provided herein comprises two repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provided herein comprises three repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provided herein comprises five repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provided herein comprises between two and ten repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provided herein comprises ten repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provided herein comprises between three and ten repeated enhancer nucleic acid sequences. In one embodiment, the liver-specific expression cassette provides more than three repeated enhancer nucleic acid sequences.

[0130] In one embodiment, the liver-specific expression cassette comprises two or more repetitive enhancer nucleic acid sequences, with at least two nucleic acids (2-mers) separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises three or more repetitive enhancer nucleic acid sequences, with at least two nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises five or more repetitive enhancer nucleic acid sequences, with at least two nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises ten or more repetitive enhancer nucleic acid sequences, with at least two nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises about three to ten repetitive enhancer nucleic acid sequences, with at least two nucleic acids separating each repetitive enhancer nucleic acid sequence.

[0131] In one embodiment, the liver-specific expression cassette provided herein comprises two or more repetitive enhancer nucleic acid sequences, with at least three nucleic acids (3-mers) separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises three or more repetitive enhancer nucleic acid sequences, with at least three nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises five or more repetitive enhancer nucleic acid sequences, with at least three nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises ten or more repetitive enhancer nucleic acid sequences, with at least three nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises three to ten repetitive enhancer nucleic acid sequences, with at least three nucleic acids separating each repetitive enhancer nucleic acid sequence.

[0132] In one embodiment, the liver-specific expression cassette provided herein comprises two or more repetitive enhancer nucleic acid sequences, with at least five nucleic acids (5-mers) separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises three or more repetitive enhancer nucleic acid sequences, with at least five nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises five or more repetitive enhancer nucleic acid sequences, with at least five nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises ten or more repetitive enhancer nucleic acid sequences, with at least five nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises about three to ten repetitive enhancer nucleic acid sequences, with at least five nucleic acids separating each repetitive enhancer nucleic acid sequence.

[0133] In one embodiment, the liver-specific expression cassette provided herein comprises two or more repetitive enhancer nucleic acid sequences, with at least 11 nucleic acids (11mer) separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises three or more repetitive enhancer nucleic acid sequences, with at least 11 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises five or more repetitive enhancer nucleic acid sequences, with at least 11 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises ten or more repetitive enhancer nucleic acid sequences, with at least 11 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises about three to ten repetitive enhancer nucleic acid sequences, with at least 11 nucleic acids separating each repetitive enhancer nucleic acid sequence.

[0134] In one embodiment, the liver-specific expression cassette provided herein comprises two or more repetitive enhancer nucleic acid sequences, with at least 30 nucleic acids (30-mers) separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises three or more repetitive enhancer nucleic acid sequences, with at least 30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises five or more repetitive enhancer nucleic acid sequences, with at least 30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette comprises ten or more repetitive enhancer nucleic acid sequences, with at least 30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette provided herein comprises about three to ten repetitive enhancer nucleic acid sequences, with at least 30 nucleic acids separating each repetitive enhancer nucleic acid sequence.

[0135] In one embodiment, the liver-specific expression cassette provided herein comprises two or more repetitive enhancer nucleic acid sequences, with about 2-30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette provided herein comprises three or more repetitive enhancer nucleic acid sequences, with about 2-30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette provided herein comprises five or more repetitive enhancer nucleic acid sequences, with about 2-30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette provided herein comprises ten or more repetitive enhancer nucleic acid sequences, with about 2-30 nucleic acids separating each repetitive enhancer nucleic acid sequence. In one embodiment, the liver-specific expression cassette provided herein comprises about 3-10 repetitive enhancer nucleic acid sequences, with about 2-30 nucleic acids separating each repetitive enhancer nucleic acid sequence.

[0136] In one embodiment, the enhancer nucleic acid sequence is further operably linked to a liver-specific promoter and the transgene. In one embodiment, the liver-specific promoter is a human liver-specific promoter.

[0137] In one embodiment, the liver-specific promoter is selected from the group consisting of a minimal TTR promoter (TTRm), an AAT promoter, an albumin (ALB) promoter or minimal promoter, an apolipoprotein A1 (APOA1) promoter or minimal promoter, a complement factor B (CFB) promoter, a ketohexokinase (KHK) promoter, a hemopexin (HPX) promoter or minimal promoter, a nicotinamide N-methyltransferase (NNMT) promoter or minimal promoter, a carboxylesterase 1 (CES1) promoter or minimal promoter, a protein C (PROC) promoter or minimal promoter, apolipoprotein C3 (APOC3) promoter or minimal promoter, a mannan-binding lectin serine protease 2 (MASP2) promoter or minimal promoter, a hepcidin antimicrobial peptide (HAMP) promoter or minimal promoter, and a serpin peptidase inhibitor, clade C (antithrombin), member 1 (SERPINC1) promoter or minimal promoter.

[0138] In some embodiments, the promoter may be a promoter from a human gene. The promoter may also be a tissue-specific promoter, such as a liver-specific promoter, such as human alpha 1-antitrypsin (HAAT). In one embodiment, the promoter may be synthetic.

[0139] Non-limiting examples of suitable promoters for use in accordance with the present disclosure include any of the promoters described herein, or any of the following:

[0140] In one embodiment, the promoter is the hAAT core, human a1 antitrypsin (hAAT) promoter (core promoter sequence from the human A1AT gene). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 210: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGC TGTACACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGG (SEQ ID NO:210)

[0141] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:210. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:210. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:210. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:210. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:210. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:210. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:210. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:210.

[0142] In one embodiment, the promoter is a minimal transthyretin promoter (TTRm). In one embodiment, the TTRm promoter comprises the sequence shown as SEQ ID NO: 211: GTCTGTCTGCACATTTCGTAGAGCGAGTGTTCCGATACTCTAATCTCCCTAGGCAAGGTTCATATTTGTGTAGGTTACTTATTCTCCTTTTGTTGACTAAGTCAATAATCAGAATCAGCAGGTTTGGAGTCAGCTTGGCAGGGATCAGCAGCCTGGGTTGGAAGGAGGGGGTATAAAAGCCCCTTCACCAGGAGAAGCCGTC (SEQ ID NO: 211)

[0143] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:211. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:211. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:211. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:211. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:211. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:211. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:211. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:211.

[0144] In one embodiment, the promoter is hAAT_core_C06, a CpG-minimized version of the hAAT core promoter (A1AT gene promoter). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 212 below: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCATGCCACCCCCTCCACCTTGGACACAGGACACTGTGGTTCTGAGCCAGGTACAATGACTCCTTTTGGTAAGTGCAGTGGAAGCTGTAC ACTGCCCAGGCAAAGTGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGG (SEQ ID NO: 212).

[0145] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:212. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:212. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:212. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:212. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:212. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:212. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:212. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:212.

[0146] In one embodiment, the promoter is hAAT_core_C07, a CpG-minimized version of the hAAT core promoter (A1AT gene promoter). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 213 below: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTA CACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCTGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCTGTTGCCCCTCTGGATCCACTGCTTAAATACGGACAAGGACAGG (SEQ ID NO: 213)

[0147] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:213. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:213. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:213. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:213. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:213. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:213. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:213. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:213.

[0148] In one embodiment, the promoter is hAAT_core_C08, a CpG-minimized version of the hAAT core promoter (A1AT gene promoter). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 214 below: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTA CACTGCCCAGGCAAAGCGTCTGGGCAGCATAGGCAGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGG (SEQ ID NO: 214)

[0149] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:214. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:214. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:214. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:214. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:214. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:214. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:214. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:214.

[0150] In one embodiment, the promoter is hAAT_core_C09, a CpG-minimized version of the hAAT core promoter (A1AT gene promoter). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 215: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTA CACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCTGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACAGACGAGGACAGG (SEQ ID NO: 215)

[0151] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:215. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:215. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:215. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:215. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:215. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:215. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:215. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:215.

[0152] In one embodiment, the promoter is hAAT_core_C10, a CpG-minimized version of the hAAT core promoter (A1AT gene promoter). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 216: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTA CACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCTGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACAGACGAGGACAGG (SEQ ID NO: 216)

[0153] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:216. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:216. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:216. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:216. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:216. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:216. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:216. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:216.

[0154] In one embodiment, the promoter is hAAT_core_truncated, a 5p truncated hAAT core promoter derived from hAAT_core (SEQ ID NO: 210). In one embodiment, the hAAT promoter comprises the sequence shown as SEQ ID NO: 217 below: GATCTTGCTACCAGTGGAACAGCCACTAAGGATTCTGCAGTGAGAGCAGAGGGCCAGCTAAGTGGTACTCTCCCAGAGACTGTCTGACTCACGCCACCCCCTCCACCTTGGACACAGGACGCTGTGGTTTCTGAGCCAGGTACAATGACTCCTTTCGGTAAGTGCAGTGGAAGCTGTA CACTGCCCAGGCAAAGCGTCCGGGCAGCGTAGGCGGGCGACTCAGATCCCAGCCAGTGACTTAGCCCCTGTTTGCTCCTCTGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACAGACGAGGACAGG (SEQ ID NO: 217)

[0155] In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 85% identical to SEQ ID NO:217. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 90% identical to SEQ ID NO:217. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 95% identical to SEQ ID NO:217. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 96% identical to SEQ ID NO:217. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 97% identical to SEQ ID NO:217. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 98% identical to SEQ ID NO:217. In one embodiment, the promoter comprises a nucleic acid sequence that is at least about 99% identical to SEQ ID NO:217. In one embodiment, the promoter consists of the nucleic acid sequence of SEQ ID NO:217.

[0156] Table 1 lists core promoter sequences, and their corresponding SEQ ID NOs, that may be implemented in the ceDNA FVIII therapeutics described herein.

[0157] [Table 1]

[0158] According to certain embodiments, the promoter is selected from the group consisting of the human alpha 1-antitrypsin (hAAT) promoter (including the CpG-minimized hAAT(979) promoter (CpGmin hAAT_core_C10) and other CpGmin_hAAT promoters such as hAAT_core_C06, hAAT_core_C07, hAAT_core_C08, and hAAT_core_C09), and the transthyretin (TTR) liver-specific promoter.

[0159] In one embodiment, the TTRm comprises SEQ ID NO: 211. In one embodiment, the serpin enhancer comprises SEQ ID NO: 19. In one embodiment, the TTRm 5'UTR comprises SEQ ID NO: 141 (ACACAGATCCACAAGCTCCTG).

[0160] In one embodiment, the CpGmin_hAAT promoter comprises a sequence selected from any one of SEQ ID NOs: 212, 213, 214, 215, or 216.

[0161] In one embodiment, the enhancer is selected from the group consisting of SERPIN enhancer (SerpEnh), human SERPINA1 enhancer, hepatic nuclear factor 4 binding site (HNF4), transthyretin (TTRe) gene enhancer (TTRe), hepatic nuclear factor 1 binding site (HNF1), human apolipoprotein E / CI liver-specific enhancer (ApoE_Enh), and enhancer region from the proalbumin gene (ProEnh).

[0162] In one embodiment, the enhancer is a SERPINA1 enhancer. In one embodiment, the enhancer is a SERPINA1 enhancer variant selected from the nucleic acid sequences shown herein in Table 4. In one embodiment, the SERPINA1 enhancer comprises, comprises, or consists of a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to any one of the nucleic acid sequences shown herein in Table 2.

[0163] According to a further embodiment, the enhancer is a human SERPIN1A enhancer. According to a further embodiment, the human SERPIN1A enhancer comprises SEQ ID NO: 81, as shown below. SEQ ID NO:81 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCTAAGTCCAC (SEQ ID NO: 81)

[0164] In one embodiment, the enhancer is a Chinese tree shrew SERPINA1 enhancer. According to a further embodiment, the Chinese tree shrew SERPINA1 enhancer comprises SEQ ID NO: 82, as shown below. GGAGGCTGTTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAAGGGCTAAGTCCAC (SEQ ID NO: 82)

[0165] In one embodiment, the enhancer is a Chinese tree shrew SERPINA1 enhancer. According to a further embodiment, the Chinese tree shrew SERPINA1 enhancer comprises SEQ ID NO: 122, as shown below. GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCAGTTATCGGAGGAGCAAACAAGGGCTAAGTCCAC (SEQ ID NO: 122)

[0166] In one embodiment, the enhancer is a bush baby SERPINA1 enhancer. According to a further embodiment, the bush baby SERPINA1 enhancer comprises SEQ ID NO: 83, as shown below. GGGGGAAGCTACTGGTGAATATTAACCAAGGTCACCCAGTTATCAGGGAGCAAACAGGAGCTAAGTCCAT (SEQ ID NO: 83)

[0167] In one embodiment, the enhancer is an HNF4 enhancer. In one embodiment, the enhancer is HNF4. According to a further embodiment, the HNF4 enhancer comprises SEQ ID NO: 84, as shown below. GAGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCTCAGTTATCAGAGGAGCAAACAGGGGCAAAGTCCAT (SEQ ID NO: 84)

[0168] In one embodiment, the enhancer is HNF4_FOXA. According to a further embodiment, the HNF4_FOXA enhancer comprises SEQ ID NO: 85, as shown below. GGGGGAGGCTGCTGGTAAACATTAACCAAGGTCACCCCAGTTATCAGAGGAGCAAACAGGGGCAAAGTCCAC (SEQ ID NO: 85)

[0169] CpG dinucleotides are undesirable for gene therapy applications. CpG can affect expression persistence through stimulation of the innate immune system and through methylation-based silencing. Therefore, in some embodiments, CpG is removed from enhancer nucleic acid sequences. In one embodiment, internal CpG is removed.

[0170] In one embodiment, the enhancer comprises the human SERPINA1 enhancer in which CpG dinucleotides have been minimized.

[0171] In one embodiment, the enhancer comprises the Chinese tree shrew SERPINA1 enhancer in which CpG dinucleotides have been minimized.

[0172] In one embodiment, the enhancer comprises a bushbaby SERPINA1 enhancer in which CpG dinucleotides have been minimized.

[0173] In one embodiment, the enhancer comprises HNF4 with CpG dinucleotides minimized.

[0174] In one embodiment, the enhancer comprises HNF4_FOXA, which has been minimized for CpG dinucleotides.

[0175] In one embodiment, the enhancer comprises a poly-C / poly-G minimized human SERPINA1 enhancer.

[0176] In one embodiment, the enhancer comprises the poly-C / poly-G minimized Chinese tree shrew SERPINA1 enhancer.

[0177] In one embodiment, the enhancer comprises a poly-C / poly-G minimized bushbaby SERPINA1 enhancer.

[0178] In one embodiment, the enhancer comprises poly-C / poly-G minimized HNF4.

[0179] In one embodiment, the enhancer comprises HNF4_FOXA which is poly-C / poly-G minimized.

[0180] In one embodiment, the enhancer comprises the human SERPINA1 enhancer that has been minimized for CpG dinucleotides and poly-C / poly-G.

[0181] In one embodiment, the enhancer comprises the Chinese tree shrew SERPINA1 enhancer that has been minimized for CpG dinucleotides and poly-C / poly-G.

[0182] In one embodiment, the enhancer comprises the bush baby SERPINA1 enhancer which has been minimized for CpG dinucleotides and poly-C / poly-G.

[0183] In one embodiment, the enhancer comprises HNF4 that has been minimized for CpG dinucleotides and poly-C / poly-G.

[0184] In one embodiment, the enhancer comprises HNF4_FOXA, which is CpG dinucleotide and poly-C / poly-G minimized.

[0185] In some embodiments, the enhancer is selected from the sequences shown in Table 2 below.

[0186] [Table 2-1]

[0187] [Table 2-2]

[0188] [Table 2-3]

[0189] [Table 2-4]

[0190] [Table 2-5]

[0191] [Table 2-6]

[0192]

Table 2-7

[0193]

Table 2-8

[0194]

Table 2-9

[0195]

Table 2-10

[0196]

Table 2-11

[0197]

Table 2-12

[0198]

Table 2-13

[0199]

Table 2-14

[0200]

Table 2-15

[0201]

Table 2-16

[0202] [Table 2-17]

[0203] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of the human SERPINA1 enhancer with FOXA and HNF4 consensus sites. In certain embodiments, the regulatory element comprising a 3x repeat of the human SERPINA1 enhancer with FOXA and HNF4 consensus sites comprises SEQ ID NO:1.

[0204] In some embodiments, the expression cassette comprises a regulatory element, e.g., an enhancer, comprising a 3x repeat of HNF4_FOXA_v1 with CpG minimization. In certain embodiments, the regulatory element comprising a 3x repeat of HNF4_FOXA_v1 with CpG minimization comprises SEQ ID NO:2.

[0205] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v1. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v1 comprises SEQ ID NO:3.

[0206] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v1. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v1 comprises SEQ ID NO:4.

[0207] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v2. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v2 comprises SEQ ID NO:5.

[0208] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v2. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v2 comprises SEQ ID NO:6.

[0209] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v3. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v3 comprises SEQ ID NO:7.

[0210] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v3. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v3 comprises SEQ ID NO:8.

[0211] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v4. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v4 comprises SEQ ID NO:9.

[0212] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v5. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v5 comprises SEQ ID NO: 10.

[0213] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v6. In certain embodiments, the regulatory element comprising 3x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v6 comprises SEQ ID NO: 11.

[0214] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3× repeat of the Chinese tree shrew SERPINA1 enhancer. In certain embodiments, the regulatory element comprising a 3× repeat of the Chinese tree shrew SERPINA1 enhancer comprises SEQ ID NO:12.

[0215] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat Chinese tree shrew SERPINA1 enhancer with CpG minimization. In certain embodiments, the regulatory element comprising a 3x repeat Chinese tree shrew SERPINA1 enhancer with CpG minimization comprises SEQ ID NO: 13.

[0216] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) that comprises a 3x repeat of the human SERPINA1 enhancer with one adenine between the repeats. In certain embodiments, the regulatory element that comprises a 3x repeat of the human SERPINA1 enhancer with one adenine between the repeats comprises SEQ ID NO: 14.

[0217] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of the bush baby SERPINA1 enhancer with an adenine nucleotide spacer. In certain embodiments, the regulatory element comprising a 3x repeat of the bush baby SERPINA1 enhancer with an adenine nucleotide spacer comprises SEQ ID NO: 15.

[0218] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 comprises SEQ ID NO: 16.

[0219] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v1. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v1 comprises SEQ ID NO: 17.

[0220] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v1. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v1 comprises SEQ ID NO: 18.

[0221] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v2. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v2 comprises SEQ ID NO: 19.

[0222] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v2. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v2 comprises SEQ ID NO:20.

[0223] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v3. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v3 comprises SEQ ID NO:21.

[0224] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v3. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v3 comprises SEQ ID NO:22.

[0225] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v4. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v4 comprises SEQ ID NO:23.

[0226] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v5. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v5 comprises SEQ ID NO:24.

[0227] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v6. In certain embodiments, the regulatory element comprising 5x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v6 comprises SEQ ID NO:25.

[0228] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 5× repeat of the Chinese tree shrew SERPINA1 enhancer. In certain embodiments, the regulatory element comprising a 5× repeat of the Chinese tree shrew SERPINA1 enhancer comprises SEQ ID NO:26.

[0229] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 5x repeat Chinese tree shrew SERPINA1 enhancer with CpG minimization. In certain embodiments, the regulatory element comprising a 5x repeat Chinese tree shrew SERPINA1 enhancer with CpG minimization comprises SEQ ID NO:27.

[0230] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 5x repeat of the bush baby SERPINA1 enhancer with an adenine nucleotide spacer. In certain embodiments, the regulatory element comprising a 5x repeat of the bush baby SERPINA1 enhancer with an adenine nucleotide spacer comprises SEQ ID NO:28.

[0231] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) that comprises a 5x repeat of the human SERPINA1 enhancer. In certain embodiments, the regulatory element that comprises a 5x repeat of the human SERPINA1 enhancer comprises SEQ ID NO:29.

[0232] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 comprises SEQ ID NO:30.

[0233] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v1. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v1 comprises SEQ ID NO:31.

[0234] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v1. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v1 comprises SEQ ID NO:32.

[0235] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v2. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v2 comprises SEQ ID NO:33.

[0236] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v2. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v2 comprises SEQ ID NO:34.

[0237] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v3. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized v3 comprises SEQ ID NO:35.

[0238] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v3. In certain embodiments, the regulatory element comprising 10x repeats of HNF4_FOXA_v1 with poly-C / poly-G minimized and CpG minimized v3 comprises SEQ ID NO:36.

[0239] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 10x repeat of the human SERPINA1 enhancer. In certain embodiments, the regulatory element comprising a 10x repeat of the human SERPINA1 enhancer comprises SEQ ID NO:37.

[0240] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 10x repeat of the bush baby SERPINA1 enhancer with an adenine nucleotide spacer. In certain embodiments, the regulatory element comprising a 10x repeat of the bush baby SERPINA1 enhancer with an adenine nucleotide spacer comprises SEQ ID NO:38.

[0241] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a bush baby SERPINA1 enhancer, a FOXA_HNF4_v1 enhancer, an HNF4 consensus binding site enhancer. In certain embodiments, the regulatory element comprising a bush baby SERPINA1 enhancer, a FOXA_HNF4_v1 enhancer, an HNF4 consensus binding site enhancer comprises SEQ ID NO:39.

[0242] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising an HNF4 consensus binding site enhancer, a bush baby SERPINA1 enhancer, a FOXA_HNF4_v1 enhancer. In certain embodiments, the regulatory element comprising an HNF4 consensus binding site enhancer, a bush baby SERPINA1 enhancer, a FOXA_HNF4_v1 enhancer comprises SEQ ID NO:40.

[0243] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v1. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v1 comprises SEQ ID NO:41.

[0244] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v2. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v2 comprises SEQ ID NO:42.

[0245] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v3. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v3 comprises SEQ ID NO:43.

[0246] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v4. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v4 comprises SEQ ID NO:44.

[0247] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v5. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v5 comprises SEQ ID NO:45.

[0248] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v6. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v6 comprises SEQ ID NO:46.

[0249] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v7. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v7 comprises SEQ ID NO:47.

[0250] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v8. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v8 comprises SEQ ID NO:48.

[0251] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v9. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v9 comprises SEQ ID NO:49.

[0252] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v10. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v10 comprises SEQ ID NO:50.

[0253] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v11. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v11 comprises SEQ ID NO:51.

[0254] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v12. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v12 comprises SEQ ID NO:52.

[0255] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v13. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v13 comprises SEQ ID NO:53.

[0256] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v14. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v14 comprises SEQ ID NO:54.

[0257] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v15. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v15 comprises SEQ ID NO:55.

[0258] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v16. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v16 comprises SEQ ID NO:56.

[0259] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v17. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v17 comprises SEQ ID NO:57.

[0260] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v18. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v18 comprises SEQ ID NO:58.

[0261] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v19. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v19 comprises SEQ ID NO:59.

[0262] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 2mer spacer v20. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 2mer spacer v20 comprises SEQ ID NO:60.

[0263] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 3mer spacer v1. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 3mer spacer v1 comprises SEQ ID NO:61.

[0264] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 3mer spacer v2. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 3mer spacer v2 comprises SEQ ID NO:62.

[0265] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 3mer spacer v3. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 3mer spacer v3 comprises SEQ ID NO:63.

[0266] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 5mer spacer v1. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 5mer spacer v1 comprises SEQ ID NO:64.

[0267] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 5mer spacer v2. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 5mer spacer v2 comprises SEQ ID NO:65.

[0268] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 5mer spacer v3. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 5mer spacer v3 comprises SEQ ID NO:66.

[0269] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with an 11mer spacer v1. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with an 11mer spacer v1 comprises SEQ ID NO:67.

[0270] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with an 11mer spacer v2. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with an 11mer spacer v2 comprises SEQ ID NO:68.

[0271] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with an 11mer spacer v3. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with an 11mer spacer v3 comprises SEQ ID NO:69.

[0272] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3× repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 1. In certain embodiments, the regulatory element comprising 3× repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 1 comprises SEQ ID NO:70.

[0273] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 2. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 2 comprises SEQ ID NO:71.

[0274] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 1. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 1 comprises SEQ ID NO:72.

[0275] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 2. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with an 11mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 2 comprises SEQ ID NO:73.

[0276] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 30mer spacer v1. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 30mer spacer v1 comprises SEQ ID NO:74.

[0277] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising a 3x repeat of hSerpEnh with a 30mer spacer v2. In certain embodiments, the regulatory element comprising a 3x repeat of hSerpEnh with a 30mer spacer v2 comprises SEQ ID NO:75.

[0278] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 30mer spacer v3. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 30mer spacer v3 comprises SEQ ID NO:76.

[0279] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 1. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 1 comprises SEQ ID NO:77.

[0280] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 2. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 1 and a FOXA binding site in orientation 2 comprises SEQ ID NO:78.

[0281] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 1. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 1 comprises SEQ ID NO:79.

[0282] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 2. In certain embodiments, the regulatory element comprising 3x repeats of hSerpEnh with a 30mer spacer, with an HNF4 binding site in orientation 2 and a FOXA binding site in orientation 2 comprises SEQ ID NO:80.

[0283] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) comprising 3 repeats of the SERPINA1 enhancer from Tibetan antelope separated by T. In certain embodiments, the regulatory element comprising 3x repeats of Tibetan antelope SERPINA1 comprises SEQ ID NO: 138.

[0284] In some embodiments, the expression cassette comprises a regulatory element (e.g., an enhancer) derived from armadillo with minimal CpGs and comprising 3 repeats of the SERPINA1 enhancer separated by T. In certain embodiments, the regulatory element comprising 3x repeats of Tibetan antelope SERPINA1 comprises SEQ ID NO: 139.

[0285] In one embodiment, the present disclosure provides the following sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43 , SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.

[0286] In one embodiment, the expression cassette comprises SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, 46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.

[0287] In one embodiment, the present disclosure provides SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, The present invention provides an expression cassette consisting of sequence number 43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.

[0288] The disclosed expression cassettes can be used in any situation where liver-specific transcription is desired. In various embodiments, any of the expression cassettes comprising one or more of the enhancers, spacers, promoters of the present disclosure can be included in a viral vector (e.g., an AAV vector) or a non-viral vector (e.g., a ceDNA vector) for gene therapy methods where liver-specific expression of a transgene is desired, such as liver-specific expression of a clotting factor (e.g., as described herein).

[0289] III. Viral Vectors In one embodiment, the present disclosure relates to a recombinant viral vector comprising a nucleic acid sequence of a liver-specific promoter described herein operably combined with a heterologous nucleic acid sequence encoding a therapeutic protein.

[0290] In one embodiment, the vector comprises a viral nucleic acid sequence of more than 10, 20, 30, 40, 50, 100, or 200 nucleotides. In certain embodiments, the viral nucleic acid sequence comprises serotype 1, 2, 3B, 4, 5, 6, 7, 8, 9 human adeno-associated virus (hAAV), or a combination or variant thereof, which generally includes the inverted terminal repeats of AAV.

[0291] In one embodiment, the present disclosure provides a viral particle, e.g., a viral capsid comprising a vector disclosed herein, e.g., a vector is packaged in the capsid. The capsid can be a recombinant or chimeric capsid or particle, e.g., a capsid having an amino acid sequence that is a combination of AAV pseudotypes for VP1, VP2, or VP3. The AAV capsid VP can be derived from a human AAV gene or an animal AAV gene, or a combination with engineered modifications, i.e., AAV isolated from infected human cells or non-human primates. Animal AAV includes those derived from birds, cows, pigs, mice, etc. In one embodiment, the capsid can have an amino acid sequence that is an engineered or synthetic capsid identified by methods such as directed evolution or rational design.

[0292] In one embodiment, the vector is incapable of replicating in a human host, e.g., the vector does not encode a viral polymerase.

[0293] In one embodiment, the liver-specific expression cassette comprises a sequence having at least 50, 60, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% sequence identity to any one of SEQ ID NOs: 1-80, 138, or 139 above.

[0294] Protein expression from AAV vectors In one embodiment, the nucleic acid sequences and promoters of the present disclosure are useful in the production of AAV vectors. AAV belongs to the family Parvoviridae and the genus Dependovirus. AAV is a small enveloped virus that packages a single-stranded linear DNA genome. Both sense and antisense AAV DNA strands are packaged into AAV capsids at the same frequency.

[0295] The AAV genome is characterized by two inverted terminal repeats (ITRs) that flank two open reading frames (ORFs). In the AAV2 genome, for example, the first 125 nucleotides of the ITR are palindromic, which fold back on itself to maximize base pairing and form a T-shaped hairpin structure. The other 20 bases of the ITR, called sequence D, remain unpaired. The ITRs are cis-acting sequences important for AAV DNA replication. They are the origin of replication and function as primers for the synthesis of the second strand by DNA polymerase. The double-stranded DNA formed during this synthesis, called replicative monomers, is used for a second round of self-priming replication to form replicative dimers. These double-stranded intermediates are processed using a strand-shifting mechanism to generate single-stranded DNA used for packaging and double-stranded DNA used for transcription. Located within the ITRs are Rep binding elements and terminal separation sites (TRS). These features are used by the viral regulatory protein Rep during AAV replication to process the double-stranded intermediates. In addition to their role in AAV replication, the ITRs are also essential for AAV genome packaging, transcription, downregulation under non-permissive conditions, and site-specific integration (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).

[0296] The left ORF of AAV contains the Rep gene, which encodes four proteins: Rep78, Rep68, Rep52, and Rep40. The right ORF contains the Cap gene, which produces three viral capsid proteins (VP1, VP2, and VP3). The AAV capsid contains 60 viral capsid proteins arranged in an icosahedral symmetry. VP1, VP2, and VP3 are present in a molar ratio of 1:1:10 (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).

[0297] AAV vectors generally contain a transgene expression cassette between the ITRs that replaces the rep and cap genes. Vector particles are produced by co-transfecting cells with a plasmid containing the vector genome and a packaging / helper construct that expresses the rep and cap proteins in trans. During infection, the genome of the AAV vector enters the cell nucleus and can persist in multiple molecular states. The general outcome is the conversion of the AAV genome into a double-stranded circular episome by synthesis of a second strand or pairing with a complementary strand.

[0298] In the context of AAV vectors, the disclosed vectors generally have a recombinant genome that includes the following structures: (5'ITR of AAV)-(promoter)-(transgene)-(3'ITR of AAV)

[0299] As discussed above, these recombinant AAV vectors contain a transgene expression cassette between the ITRs that replaces the rep and cap genes. Vector particles are produced, for example, by co-transfecting cells with a plasmid containing the recombinant vector genome and a packaging / helper construct that expresses the rep and cap proteins in trans.

[0300] AAV ITRs, and other selected AAV components described herein, can be readily selected from any AAV serotype, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and functional variants thereof. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those of skill in the art. The AAV can be isolated or obtained from academic, commercial, or public sources (e.g., American Type Culture Collection, Manassas, Va.). Alternatively, AAV sequences can be obtained by synthetic or other suitable means, for example, by reference to published sequences, such as sequences available in the literature or databases, such as GenBank, PubMed, etc.

[0301] In one embodiment, the nucleic acid of the present disclosure is part of an expression cassette or transgene. See, for example, US Patent Publication No. 20150139953. The expression cassette is composed of a transgene and regulatory sequences, such as a promoter and 5' and 3' AAV inverted terminal repeats (ITRs). In a preferred embodiment, the ITRs of AAV serotypes 2 or 8 are used. However, the ITRs can be selected from other suitable serotypes. The expression cassette is generally packaged into a capsid protein and delivered to a selected host cell.

[0302] In one embodiment, the present disclosure provides a method for producing a recombinant adeno-associated virus (AAV) having an AAV serotype capsid or a portion thereof. Such a method includes culturing a host cell that contains a nucleic acid sequence encoding an adeno-associated virus (AAV) serotype capsid protein, an expression cassette consisting of a functional rep gene, an AAV inverted terminal repeat (ITR) and a transgene, and sufficient accessory functions to allow packaging of the expression cassette into an AAV capsid protein. See, e.g., U.S. Patent Application Publication No. 20150139953.

[0303] Components for culture in a host cell to package the AAV expression cassette into an AAV capsid can be provided to the host cell in trans. Alternatively, one or more of the components (e.g., the expression cassette, rep sequences, cap sequences, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the components.

[0304] In one embodiment, the present disclosure relates to a recombinant vector comprising the liver-specific promoter nucleic acid sequence of the present disclosure operably combined with a transgene. The transgene is a nucleic acid sequence that encodes a protein, e.g., a therapeutic protein, or other product of interest, heterologous to the vector sequences adjacent to the transgene. The nucleic acid coding sequence is operably linked to regulatory components in a manner that allows transcription, translation, and / or transgene expression in a host cell.

[0305] A typical transgene is a sequence that codes for a product that is useful in biology and medicine, such as a protein, peptide, RNA, enzyme, dominant negative mutant, or catalytic RNA. Desirable RNA molecules include mRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNA, siRNA, guide RNA (gRNA), microRNA, small hairpin RNA, trans-splicing RNA, and antisense RNA. One example of a useful RNA sequence is a sequence that inhibits or eliminates the expression of a target nucleic acid sequence in the treated animal.

[0306] Transgenes can be used to correct or improve genetic defects, which may include defects where normal genes are expressed at lower than normal levels, or where functional gene products are not expressed. A preferred type of transgenic sequence encodes a therapeutic protein or polypeptide that is expressed in a host cell. The present disclosure further contemplates the use of multiple transgenes, for example, to correct or improve genetic defects caused by multi-subunit proteins. In certain circumstances, different transgenes can be used to code for each subunit of a protein, or to code for different peptides or proteins. This is desirable when the size of the DNA encoding the protein subunits is large, for example, in the case of immunoglobulins, platelet-derived growth factor, or dystrophin proteins. For cells to produce a multi-subunit protein, the cells are infected with a recombinant virus that contains each of the different subunits. Alternatively, different subunits of a protein can be encoded by the same transgene.

[0307] The expression cassette can be carried in any suitable viral vector that is provided to the host cell. Plasmids useful in the present disclosure can be engineered to be suitable for replication and optionally integration in prokaryotic cells, mammalian cells, or both. These plasmids (or other vectors carrying AAV 5'ITR-heterologous molecule-3'ITR) contain sequences that allow replication of the expression cassette in eukaryotes and / or prokaryotes, as well as selection markers for these systems. Preferably, the molecule carrying the expression cassette is transfected into the cell and can be present therein transiently. Alternatively, the expression cassette (carrying AAV 5'ITR-heterologous molecule-3'ITR) can be stably integrated into the genome of the host cell, either chromosomally or episomally. In certain embodiments, the expression cassette can be present in multiple copies, optionally in head-to-head, head-to-tail, or tail-to-tail concatemers. Suitable transfection techniques are known and can be readily used to deliver the expression cassette into the host cell.

[0308] In general, when a vector containing an expression cassette is delivered by transfection, the relative amounts of vector and vector DNA can be adjusted for the host cell, taking into account factors such as the selected vector, the delivery method, and the selected host cell. In addition to the expression cassette, the host cell contains sequences that drive expression of AAV capsid proteins in the host cell, and rep sequences of the same serotype as the AAV ITR serotype found in the expression cassette, or of a cross-complementary serotype. Molecules that provide rep and cap can be present in the host cell transiently (i.e., via transfection), but it is preferred that one or both of the rep and cap proteins and the promoters that control their expression are stably expressed in the host cell, for example, as an episome or by integration into the host cell chromosome.

[0309] The packaging host cell will generally also contain helper functions for packaging the rAAV of the present disclosure. Optionally, these functions can be provided by a herpesvirus. More desirably, each of the necessary accessory functions is provided from a human or non-human primate adenovirus source, such as those listed above and / or available from a variety of sources, including the American Type Culture Collection (ATCC), Manassas, Va. (USA). The desired accessory functions can be provided using any means that allows for their expression in the cell.

[0310] Introduction of the vector into the host cell can be accomplished by any means known in the art, including transfection, infection, electroporation, liposome delivery, membrane fusion techniques, high-velocity DNA-coated microgranules, infectious virus or protoplast fusion, among others, or as disclosed above. One or more of the adenoviral genes can be stably integrated into the genome of the host cell, stably expressed episomally, or expressed transiently. All gene products can be expressed episomally or stably integrated, or some of the gene products can be stably expressed while others are expressed transiently. Furthermore, the promoter for each of the adenoviral genes can be independently selected from constitutive promoters, inducible promoters, or native adenoviral promoters. The promoter can be regulated, for example, by the particular physiological state of the organism or cell (i.e., by the state of differentiation, or in replicating or quiescent cells), or by exogenously added factors.

[0311] Introduction of molecules (such as plasmids or viruses) into host cells can be accomplished using techniques known to those skilled in the art. In a preferred embodiment, conventional transfection techniques, such as transfection or electroporation using CaPO4, and / or infection with adenovirus / AAV hybrid vectors, are used in cell lines such as the HEK293 human embryonic kidney cell line (a cell line containing a functional adenovirus E1 gene that provides a trans-acting E1 protein human kidney).

[0312] Those skilled in the art will easily understand that AAV technology can be adapted for use in these and other viral vector systems for in vitro, ex vivo, or in vivo gene delivery.In certain embodiments, the present disclosure contemplates the use of the nucleic acids and vectors disclosed herein in various rAAV and non-rAAV vector systems.Such vector systems can include, for example, lentivirus, retrovirus, poxvirus, vaccinia virus, and adenovirus systems, among others.

[0313] In certain embodiments, the protein is fVIII or fIX or variants thereof as described herein. In certain embodiments, the codon and promoter optimization scheme disclosed herein can be used for any gene therapy by AAV that targets the liver. Hepatic enzyme deficiency and other metabolic diseases caused by the expression of these functional proteins are contemplated.

[0314] In certain embodiments, the nucleic acid sequence encoding a Therapeutic protein includes codons that are used or differentially represented in genes that are highly expressed in the liver or other specific tissues, and avoids codons that are under-represented in the liver or other specific tissues, as compared to codon usage from the entire coding region of the human genome.

[0315] IV. Non-viral Vectors In one embodiment, the expression cassettes described herein are useful in non-vector production.

[0316] In one embodiment, the expression cassettes described herein are useful in the production of ceDNA vectors. In one embodiment, the present disclosure provides for the expression and / or production of therapeutic proteins (e.g., liver-specific proteins, e.g., FVIII proteins) in cells, e.g., hepatocytes, from non-viral DNA vectors, e.g., ceDNA vectors described herein. In particular, a ceDNA vector for the expression of a therapeutic protein (e.g., FVIII protein) comprises a pair of ITRs (e.g., symmetric or asymmetric as described herein) and, between the ITR pair, a nucleic acid encoding a therapeutic protein (e.g., FVIII protein) operably linked to a promoter or regulatory sequence. A distinct advantage of ceDNA vectors over conventional AAV vectors, and even lentiviral vectors, for the expression of a therapeutic protein (e.g., FVIII protein) is that there is no size constraint on the nucleic acid sequence, e.g., heterologous nucleic acid sequence, encoding the desired protein. Even a full-length 6.8 kb FVIII protein can be expressed from a single ceDNA vector. Thus, the ceDNA vectors described herein can be used to express a therapeutic FVIII protein in a subject in need thereof, e.g., a subject with hemophilia A.

[0317] In general, the ceDNA vector for expressing a therapeutic protein disclosed herein comprises, in the 5' to 3' direction, a first adeno-associated virus (AAV) inverted terminal repeat (ITR), a nucleic acid sequence of interest (e.g., an expression cassette described herein), and a second AAV ITR. The ITR sequences are selected from any of the following: (i) at least one WT ITR and at least one modified AAV inverted terminal repeat (mod-ITR) (e.g., an asymmetric modified ITR), (ii) two modified ITRs (e.g., an asymmetric modified ITR) in which the mod-ITR pair has a different three-dimensional spatial configuration relative to each other, or (iii) a symmetric or substantially symmetric WT-WT ITR pair in which each WT-ITR has the same three-dimensional spatial configuration, or (iv) a symmetric or substantially symmetric modified ITR pair in which each mod-ITR has the same three-dimensional spatial configuration.

[0318] As will be appreciated, ceDNA vector technology can be adapted to any level of complexity or used in a modular manner where the expression of different components of a therapeutic protein (e.g., FVIII protein) can be controlled in an independent manner. For example, the ceDNA vector technology described herein can be as simple as using a single ceDNA vector to express a single gene sequence therapeutic protein (e.g., FVIII protein) or as complex as using multiple ceDNA vectors, each vector expressing multiple FVIII therapeutic proteins or related cofactors or accessory proteins, each independently controlled by a different promoter. The following embodiments are specifically contemplated and can be adapted by those skilled in the art as needed.

[0319] In one embodiment, a single ceDNA vector can be used to express a single component of a therapeutic protein (e.g., a FVIII protein). Alternatively, a single ceDNA vector can be used to express multiple components (e.g., at least two) of a therapeutic protein (e.g., a FVIII protein) under the control of a single promoter (e.g., a strong promoter), optionally using an IRES sequence to ensure proper expression of each of the components, e.g., cofactors or accessory proteins.

[0320] As one skilled in the art will appreciate, it is often desirable to express components of a therapeutic protein (e.g., FVIII protein) at different expression levels, thus controlling the stoichiometry of the individual components expressed to ensure efficient protein folding and combination in the cell. Further variations of ceDNA vector technology can be envisioned by one skilled in the art or can be adapted from protein production methods using conventional vectors.

[0321] Certain methods of production of ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) comprising asymmetric or symmetric ITR pairs as defined herein are described in Section IV of International Application PCT / US18 / 49996, filed September 7, 2018, which is incorporated herein by reference in its entirety. In some embodiments, ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein can be produced using insect cells as described herein. In alternative embodiments, ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein can be produced synthetically, and in some embodiments, cell-free, as disclosed in International Application PCT / US19 / 14122, filed January 18, 2019, which is incorporated herein by reference in its entirety.

[0322] As described herein, in one embodiment, a ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) can be obtained, for example, by a process comprising: a) incubating a population of host cells (e.g., insect cells) harboring a polynucleotide expression construct template (e.g., ceDNA-plasmid, ceDNA-bacmid, and / or ceDNA-baculovirus), where the host cells lack viral capsid coding sequences under conditions effective to induce production of the ceDNA vector in the host cells in the presence of Rep proteins and for a sufficient time therefor, and b) harvesting and isolating the ceDNA vector from the host cells. The presence of Rep proteins induces replication of the vector polynucleotide with modified ITRs to produce the ceDNA vector in the host cells, with the exception that no viral particles (e.g., AAV virions) are expressed. Thus, there is no size restriction such as that naturally imposed in AAV or other virus-based vectors.

[0323] The presence of a ceDNA vector isolated from a host cell may be confirmed by digesting the DNA isolated from the host cell with a restriction enzyme that has a single recognition site on the ceDNA vector and analyzing the digested DNA material on a non-denaturing gel to confirm the presence of a characteristic linear and continuous DNA band compared to linear and discontinuous DNA.

[0324] In yet another aspect, the present disclosure provides for the use of host cell lines that have stably integrated a DNA vector polynucleotide expression template (ceDNA template) into their own genome in the production of non-viral DNA vectors, for example as described in Lee, L. et al. (2013) Plos One 8(8):e69879. Preferably, Rep is added to the host cells at an MOI of about 3. If the host cell line is a mammalian cell line, for example HEK293 cells, the cell line may have a stably integrated polynucleotide vector template, and a second vector, such as a herpes virus, may be used to introduce Rep proteins into the cells, allowing excision and amplification of the ceDNA in the presence of Rep and a helper virus.

[0325] In one embodiment, the host cells used to generate ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) described herein are insect cells, and baculovirus is used to deliver both the polynucleotides encoding the Rep proteins and the non-viral DNA vector polynucleotide expression construct template for ceDNA. In some embodiments, the host cells are engineered to express the Rep proteins.

[0326] The ceDNA vector is then harvested and isolated from the host cells. The time for harvesting and collecting the ceDNA vectors described herein from the cells can be selected and optimized to achieve high yield production of the ceDNA vector. For example, the harvest time can be selected taking into consideration cell viability, cell morphology, cell growth, etc. In one embodiment, the cells are grown under sufficient conditions and harvested after sufficient time has passed since baculovirus infection to produce the ceDNA vector, but before the majority of the cells begin to die due to the toxicity of the baculovirus. The DNA vector can be isolated using a plasmid purification kit, such as the Qiagen Endo-Free Plasmid Kit. Other methods developed for plasmid isolation can also be adapted for DNA vectors. In general, any nucleic acid purification method can be employed.

[0327] The DNA vector may be purified by any means known to those skilled in the art for the purification of DNA. In one embodiment, the ceDNA vector is purified as a DNA molecule. In another embodiment, the ceDNA vector is purified as an exosome or microparticle.

[0328] The presence of a ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) can be confirmed by digesting vector DNA isolated from cells with a restriction enzyme that has a single recognition site on the DNA vector and analyzing both the digested and undigested DNA material using gel electrophoresis to confirm the presence of a characteristic linear and continuous DNA band compared to linear and discontinuous DNA.

[0329] ceDNA Plasmids A ceDNA-plasmid is a plasmid used for the later production of a ceDNA vector for the expression of a therapeutic protein (e.g., FVIII protein). In some embodiments, a ceDNA-plasmid can be constructed using known techniques that provide, as operably linked components in the transcriptional direction, at least (1) a modified 5'ITR sequence, (2) an expression cassette as described herein that includes any one of SEQ ID NOs: 1-80, 138, and 139 and includes a therapeutic transgene, and (3) a modified 3'ITR sequence that is symmetrical to the 5'ITR sequence. In some embodiments, the expression cassette flanked by ITRs includes cloning sites for introducing exogenous sequences. The expression cassette replaces the rep and cap coding regions of the AAV genome.

[0330] In one aspect, a ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) is obtained from a plasmid, referred to herein as a "ceDNA-plasmid," comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), any one of sequence IDs NsS:1-80, 138, and 139, and encoding an expression cassette as described herein comprising a therapeutic transgene, and a mutated or modified AAV ITR, in that order, said ceDNA-plasmid lacking an AAV capsid protein coding sequence. In an alternative embodiment, a ceDNA-plasmid encodes a first (or 5') modified or mutated AAV ITR, an expression cassette comprising a transgene, and a second (or 3') modified AAV ITR, in that order, said ceDNA-plasmid lacking an AAV capsid protein coding sequence, and the 5' and 3' ITRs are symmetrical with respect to each other. In an alternative embodiment, a ceDNA-plasmid encodes, in that order, a first (or 5') modified or mutated AAV ITR, any one of SEQ ID NOs: 1-80, 138, and 139, an expression cassette as described herein comprising a therapeutic transgene, and a second (or 3') mutated or modified AAV ITR, wherein the ceDNA-plasmid lacks the AAV capsid protein coding sequence, and the 5' and 3' modified ITRs have the same modifications (i.e., they are reverse complementary or symmetrical to each other).

[0331] In further embodiments, the ceDNA-plasmid system lacks viral capsid protein coding sequences (i.e., lacks not only AAV capsid genes, but also capsid genes of other viruses). In addition, in certain embodiments, the ceDNA-plasmid also lacks AAV Rep protein coding sequences. Thus, in preferred embodiments, the ceDNA-plasmid lacks functional AAV cap and AAV rep genes (GG-3' for AAV2) as well as variable palindrome sequences that allow hairpin formation.

[0332] The ceDNA-plasmids of the present disclosure may be generated using the native nucleotide sequence of the genome of any AAV serotype known in the art. In one embodiment, the ceDNA-plasmid backbone is derived from the AAV1, AAV2, AAV3, AAV4, AAV5, AAV5, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ, and AAV-DJ8 genomes. For example, from Kotin and Smith, The Springer Index of Viruses, available at NCBI:NC002077, NC001401, NC001729, NC001829, NC006152, NC006260, NC006261, URLs maintained by Springer. In a particular embodiment, the ceDNA-plasmid backbone is derived from the AAV2 genome. In another specific embodiment, the ceDNA-plasmid backbone is a synthetic backbone engineered to contain 5' and 3' ITRs from one of these AAV genomes.

[0333] The ceDNA-plasmid may optionally contain a selectable or selectable marker for use in establishing ceDNA vector producing cell lines. In one embodiment, the selectable marker may be inserted downstream (i.e., 3') of the 3'ITR sequence. In another embodiment, the selectable marker may be inserted upstream (i.e., 5') of the 5'ITR sequence. Suitable selectable markers include, for example, those that confer drug resistance. The selectable marker may be, for example, the Blasticidin S resistance gene, kanamycin, geneticin, etc. In a preferred embodiment, the drug selectable marker is the Blasticidin S resistance gene.

[0334] An exemplary ceDNA (e.g., rAAV0) vector for expression of a therapeutic protein (e.g., FVIII protein) is produced from a rAAV plasmid. A method for producing a rAAV vector can include (a) providing a host cell with a rAAV plasmid as described above, where both the host cell and the plasmid lack a capsid protein-encoding gene, (b) culturing the host cell under conditions that allow for the production of a ceDNA genome, and (c) harvesting the cells and isolating the AAV genome produced from the cells.

[0335] Exemplary Methods for Producing ceDNA Vectors from ceDNA Plasmids Also provided herein are methods for generating capsid-less ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins), particularly methods that have yields high enough to provide sufficient vectors for in vivo experiments.

[0336] In some embodiments, a method for producing a ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) includes the steps of: (1) introducing a nucleic acid construct comprising an expression cassette and two symmetric ITR sequences into a host cell (e.g., Sf9 cell); (2) optionally establishing a clonal cell line, e.g., by using a selection marker present on a plasmid; (3) introducing a Rep-encoding gene into the insect cell (either by transfection or infection with a baculovirus carrying the gene); and (4) harvesting the cells and purifying the ceDNA vector. The nucleic acid construct comprising the expression cassette and two ITR sequences described above for the production of a ceDNA vector can be in the form of a ceDNA-plasmid, or a bacmid or baculovirus produced with a ceDNA plasmid as described below. The nucleic acid construct can be introduced into the host cell by transfection, viral transduction, stable integration, or other methods known in the art.

[0337] cell line Host cell lines used in the production of ceDNA vectors for the expression of therapeutic proteins (e.g., FVIII proteins) may include insect cell lines derived from Spodoptera frugiperda (Sf9, Sf21, etc.) or Trichoplusia ni cells, or other eukaryotic cell lines including other invertebrate, vertebrate, or mammalian cells. Other cell lines known to those skilled in the art can also be used, such as HEK293, Huh-7, HeLa, HepG2, HeplA, 911, CHO, COS, MeWo, NIH3T3, A549, HT1 180, monocytes, and mature and immature dendritic cells. Host cell lines can be transfected for stable expression of ceDNA-plasmids for high yield ceDNA vector production.

[0338] The ceDNA-plasmid can be introduced into Sf9 cells by transient transfection using reagents known in the art (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation). Alternatively, stable Sf9 cell lines can be established that stably integrate the ceDNA-plasmid into their genome. Such stable cell lines can be established by incorporating a selection marker into the ceDNA-plasmid described above. If the ceDNA-plasmid used to transfect the cell line contains a selection marker, such as an antibiotic, cells that have been transfected with the ceDNA-plasmid and have integrated the ceDNA-plasmid DNA into their genome can be selected by adding the antibiotic to the cell growth medium. Resistant clones of cells can then be isolated and propagated by single cell dilution or colony transfer techniques.

[0339] Isolation and purification of ceDNA vectors The ceDNA-vectors for the expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein can be obtained from producer cells expressing AAV Rep proteins and further transformed with ceDNA-plasmids, ceDNA-bacmids, or ceDNA-baculoviruses. Plasmids useful for the production of ceDNA vectors include plasmids encoding therapeutic proteins (e.g., FVIII proteins) or plasmids encoding one or more REP proteins.

[0340] In one aspect, the polynucleotide encodes an AAV Rep protein (Rep 78 or 68) delivered to a producer cell in a plasmid (Rep-plasmid), a bacmid (Rep-bacmid), or a baculovirus (Rep-baculovirus). The Rep-plasmid, Rep-bacmid, and Rep-baculovirus can be generated by the methods described above.

[0341] Methods for producing ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) are described herein. The expression constructs used to generate ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) described herein can be plasmids (e.g., ceDNA-plasmids), bacmids (e.g., ceDNA-bacmids), and / or baculoviruses (e.g., ceDNA-baculoviruses). By way of example only, ceDNA vectors can be generated from cells co-infected with ceDNA-baculoviruses and Rep-baculoviruses. Rep proteins produced from Rep-baculoviruses can replicate ceDNA-baculoviruses to generate ceDNA vectors. Alternatively, ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) can be generated from cells stably transfected with constructs comprising sequences encoding AAV Rep proteins (Rep78 / 52) delivered in Rep-plasmids, Rep-bacmids, or Rep-baculoviruses. The ceDNA-baculovirus can be transiently transfected into cells and replicated by the Rep proteins to produce the ceDNA vector.

[0342] The bacmid (e.g., ceDNA-bacmid) can be transfected into permissive insect cells, such as Sf9, Sf21, Tni (Trichoplusia ni) cells, High Five cells, etc., to generate ceDNA-baculovirus, a recombinant baculovirus that contains sequences that include symmetric ITRs and an expression cassette. The ceDNA-baculovirus can be reinfected into insect cells to obtain the next generation of recombinant baculovirus. Optionally, this step can be repeated one or more times to produce larger quantities of recombinant baculovirus.

[0343] The time for harvesting and harvesting the ceDNA vector for expression of the therapeutic protein (e.g., FVIII protein) described herein from the cells can be selected and optimized to achieve high-yield production of the ceDNA vector. For example, the harvest time can be selected taking into consideration cell viability, cell morphology, cell growth, etc. Usually, the cells can be harvested after sufficient time has passed since baculovirus infection to produce the ceDNA vector (e.g., ceDNA vector), but before the majority of the cells begin to die due to viral toxicity. The ceDNA vector can be isolated from Sf9 cells using a plasmid purification kit, such as the Qiagen ENDO-FREE PLASMID® kit. Other methods developed for plasmid isolation can also be adapted for ceDNA vectors. In general, any nucleic acid purification method known in the art can be employed, as well as commercially available DNA extraction kits.

[0344] Alternatively, purification can be implemented by subjecting the cell pellet to an alkaline lysis process, centrifuging the resulting lysate, and performing chromatographic separation. As one non-limiting example, this process can be performed by loading the supernatant onto an ion exchange column (e.g., SARTOBIND Q®) that retains nucleic acids, then eluting (e.g., with 1.2M NaCl solution), and performing further chromatographic purification on a gel filtration column (e.g., 6 Fast Flow GE). The capsid-free AAV vector is then recovered, for example, by precipitation.

[0345] In some embodiments, ceDNA vectors for the expression of therapeutic proteins (e.g., FVIII protein) can also be purified in the form of exosomes or microparticles. It is known in the art that many cell types release not only soluble proteins but also complex protein / nucleic acid cargoes via shedding of membrane microvesicles (Cocucci et al, 2009, EP 10306226.1). Such vesicles include microvesicles (also called microparticles) and exosomes (also called nanovesicles), both of which contain proteins and RNA as cargo. Microvesicles are generated from direct budding of the plasma membrane, and exosomes are released into the extracellular environment upon fusion of multivesicular endosomes with the plasma membrane. Thus, microvesicles and / or exosomes containing ceDNA vectors can be isolated from cells transduced with ceDNA plasmids, or bacmids or baculoviruses generated with ceDNA plasmids.

[0346] Microvesicles can be isolated by subjecting the culture medium to filtration or ultracentrifugation at 20,000×g, and exosomes can be isolated at 100,000×g. The optimal duration of ultracentrifugation can be determined experimentally and depends on the particular cell type from which the vesicles are isolated. Preferably, the culture medium is first cleared by low speed centrifugation (e.g., 2000×g for 5-20 minutes) and subjected to spin concentration, for example, using AMICON® spin columns (Millipore, Watford, UK). Microvesicles and exosomes can be further purified via FACS or MACS by using specific antibodies that recognize specific surface antigens present on the microvesicles and exosomes. Other microvesicles and exosome purification methods include, but are not limited to, immunoprecipitation, affinity chromatography, filtration, and magnetic beads coated with specific antibodies or aptamers. During purification, the vesicles are washed, for example, with phosphate buffered saline. One advantage of using microvesicles or exosomes to deliver ceDNA-containing vesicles is that these vesicles can be targeted to various cell types by containing on them membrane proteins that are recognized by specific receptors on each cell type. (See also EP 10306226)

[0347] Another aspect of the disclosure herein relates to a method for purifying ceDNA vectors from host cell lines that have stably integrated the ceDNA construct into their own genome. In one embodiment, the ceDNA vectors are purified as DNA molecules. In another embodiment, the ceDNA vectors are purified as exosomes or microparticles.

[0348] FIG. 5 of International Patent Application No. PCT / US18 / 49996 shows a gel confirming the production of ceDNA from several ceDNA-plasmid constructs using the methods described in the Examples.

[0349] V. Exemplary Recombinant Vectors The nucleic acid sequences disclosed herein are useful in the production of expression plasmids, viral vectors (AAV and rAAV) and non-viral vectors (ceDNA), and are also useful as antisense delivery vectors, gene therapy vectors, gene editing vectors (gRNA), or vaccine vectors.

[0350] In one embodiment, the present disclosure provides a method for the preparation of a polypeptide comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, Viral gene delivery vectors are provided comprising any one of SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.In one embodiment, the present disclosure provides a method for the preparation of a polypeptide comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 The present invention provides a viral gene delivery vector comprising a nucleic acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.In one embodiment, the present disclosure provides a method for the preparation of a polypeptide comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, Provided is a viral gene delivery vector consisting of any one of SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.In one embodiment, the present disclosure provides a method for the preparation of a polypeptide comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, Provided is a non-viral gene delivery vector comprising any one of SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.In one embodiment, the present disclosure provides a method for the preparation of a polypeptide comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 No. 45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.In one embodiment, the disclosure provides a method for the preparation of a polypeptide comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, Provided is a non-viral gene delivery vector consisting of any one of sequence number 42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:138, or SEQ ID NO:139.

[0351] In one embodiment, the nucleic acids of the disclosure can be part of any genetic element (vector) that can be delivered to a host cell, such as naked DNA, a plasmid, a phage, a transposon, a cosmid, an episome, a protein in a non-viral delivery vehicle (e.g., lipid-based transporters), a virus that delivers the sequences carried therein, and the like.

[0352] In one embodiment, the vector can be a lentiviral-based vector (containing genes or lentiviral sequences), for example, having nucleic acid sequences derived from a VSVG or GP64 pseudotype, or both.

[0353] According to some aspects, the present disclosure refers to viral particles, e.g., capsids, that contain the nucleic acid sequences encoding the expression cassettes and proteins disclosed herein. The viral particles, capsids, and recombinant vectors are useful for delivering heterologous genes or other nucleic acid sequences to target cells. The nucleic acid can be easily used in a variety of vector systems, capsids, and host cells. In one embodiment, the nucleic acid is in a vector contained within a capsid that includes AAV capsid proteins vp1, vp2, vp3, and terminal protection proteins that include hypervariable regions.

[0354] Exemplary Therapeutic Proteins (e.g., FVIII Proteins) In particular, the ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein can encode, for example, but not limited to, FVIII proteins, and variants and / or active fragments thereof, for use in treating, preventing, and / or ameliorating one or more symptoms of hemophilia A. In one aspect, hemophilia A is human hemophilia A.

[0355] FVIII therapeutic protein and fragments thereof Essentially any version of a FVIII therapeutic protein or a fragment thereof (e.g., functional fragment) can be encoded by, expressed in, and from a viral or non-viral vector as described herein. Those skilled in the art will understand that a FVIII therapeutic protein includes all splice variants and orthologs of a therapeutic protein (e.g., FVIII protein). A FVIII therapeutic protein includes the intact molecule as well as fragments thereof (e.g., functional).

[0356] In one embodiment, the nucleic acid sequence encoding the protein comprises a higher percentage of hepatocyte-specific amino acid codons compared to the general use of human codons. According to some aspects, the present disclosure provides a method of treating a subject diagnosed with a genetic disease or disorder that results in the expression of a mutant or truncated non-functional protein by administering an effective amount of a vector (e.g., an AAV vector or a ceDNA vector) disclosed herein to express a functional liver protein.

[0357] Factor VIII Factor VIII is a nonenzymatic cofactor of activated coagulation factor IX (FIXa) that, upon proteolytic activation, interacts with FIXa to form a tight, noncovalent complex that binds and activates factor X (FX).

[0358] The factor VIII gene or protein may also be referred to as F8, coagulation factor VIII, procoagulant component, antihemophilic factor, F8C, AHF, DXS1253E, FVIII, HEMA, or F8B. Expression of the factor VIII gene is tissue specific and is observed primarily in hepatocytes. The highest levels of mRNA and factor VIII protein have been detected in hepatic sinusoidal cells. Significant amounts of factor VIII are also present in hepatocytes and Kupffer cells (resident macrophages of the hepatic sinusoids). Moderate levels of factor VIII protein are detectable in serum and plasma. Low to moderate levels of factor VIII protein are expressed in fetal brain, retina, kidney, and testis.

[0359] Factor VIII mRNA is expressed throughout many tissues of the body, including bone marrow, whole blood, white blood cells, lymph nodes, thymus, brain, cerebral cortex, cerebellum, retina, spinal cord, tibial nerve, heart, artery, smooth muscle, skeletal muscle, small intestine, colon, adipocytes, kidney, liver, lung, spleen, stomach, esophagus, bladder, pancreas, thyroid, salivary gland, adrenal gland, pituitary gland, breast, skin, ovary, uterus, placenta, prostate, and thymus. The FVIII gene, located on the long arm of the X chromosome, occupies a region approximately 186 kbp long and is composed of 26 exons (69-3,106 bp) and introns (207-32.4 kbp). The total length of the coding sequence of this gene is 9 kbp.

[0360] The mature factor VIII polypeptide contains the A1-A2-B-A3-C1-C2 structural domains. Three acidic subdomains, designated a1-a3-A1(a1)-A2(a2)-B-(a3)A3-C1-C2, are located at the interface of the A domain and play important roles in the interaction between FVIII and other proteins, including thrombin in particular. Mutations in these subdomains reduce the level of factor VIII activation by thrombin.

[0361] The factor VIII protein (coagulation factor VIII isoform) is a preproprotein [Homo sapiens]; nucleotide number: NP_000123.1 (2351 aa) and has the following sequence:

[0362] In one embodiment, the FVIII therapeutic protein may be a "therapeutic protein variant", which refers to a FVIII therapeutic protein that has an altered amino acid sequence, composition, or structure compared to the corresponding native FVIII therapeutic protein. In one embodiment, the FVIII is a functional version (e.g., a wild-type therapeutic protein (e.g., FVIII protein)). As described in many examples herein, it may be useful to express mutant versions of a therapeutic protein (e.g., FVIII protein), such as point mutations (F309 mutations) or deletion mutations (e.g., B-domain deleted and / or single-chain recombinant FVIII). The FVIII therapeutic protein expressed from a ceDNA vector may further comprise sequences / moieties that confer additional functions, such as fluorescence, enzymatic activity, or secretion signals. In one embodiment, the FVIII therapeutic protein variant comprises a non-native tag sequence (e.g., an immunotag) for identification, which allows it to be distinguished from the endogenous FVIII therapeutic protein in the recipient host cell.

[0363] For example, it is well within the capabilities of one of ordinary skill in the art to take a known and / or publicly available protein sequence of a FVIII therapeutic protein and reverse engineer a cDNA sequence to encode such a protein. The cDNA can then be codon optimized for compatibility with the intended host cell and inserted into a vector as described herein.

[0364] In one embodiment, the FVIII therapeutic protein coding sequence may be derived from an existing host cell or cell line, for example, by reverse transcribing mRNA obtained from the host and amplifying the sequence using PCR.

[0365] Vector expressing FVIII protein The ceDNA vector having one or more sequences encoding a desired FVIII therapeutic protein can include regulatory sequences such as promoters, secretion signals, introns, polyA regions, and enhancers to maximize expression of the FVIII therapeutic protein when delivered to a desired cell or tissue. At a minimum, the ceDNA vector includes one or more nucleic acid sequences encoding a FVIII therapeutic protein or a functional fragment thereof.

[0366] In some embodiments, the ceDNA vector comprises a codon-optimized FVIII sequence. In some embodiments, the ceDNA vector comprises the codon-optimized FVIII sequence (hFVIII-F309S-BD226seq124-BDD-F309) shown in Figures 11 and 12. In some embodiments, the ceDNA vector comprises a FVIII sequence comprising the nucleic acid sequence shown in SEQ ID NO: 143, as shown below: ceDNA 1651 ORF sequence (GE_715; hFVIII-F309S-BD226seq124-BDD-F309)

[0367] In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 85% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 90% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 95% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 96% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 97% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 98% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence that is at least 99% identical to the nucleic acid sequence set forth in SEQ ID NO: 143. In some embodiments, the ceDNA vector comprises a FVIII sequence consisting of SEQ ID NO: 143.

[0368] FVIII therapeutic protein and uses thereof for the treatment of hemophilia A - Patents.com Viral and non-viral vectors comprising the expression cassettes described herein can be used to deliver liver-specific therapeutic proteins (e.g., FVIII proteins) for the treatment of hemophilia A, which is associated with inappropriate expression of and / or mutations in a liver-specific therapeutic protein (e.g., FVIII protein).

[0369] The vectors described herein can be used to express any desired FVIII therapeutic protein. Exemplary therapeutic FVIII therapeutic proteins include, but are not limited to, any therapeutic protein (e.g., FVIII protein) or portion thereof expressed by a nucleic acid that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:143.

[0370] In one embodiment, the expressed FVIII therapeutic protein is functional for the treatment of hemophilia A. In some embodiments, the FVIII therapeutic protein does not provoke an immune system response.

[0371] In another embodiment, a vector encoding a FVIII therapeutic protein or a fragment thereof (e.g., a functional fragment) can be used to generate a chimeric protein. Thus, it is specifically contemplated herein that a vector expressing a chimeric protein can be administered to any one or more tissues selected from, for example, the liver, kidney, gallbladder, prostate, and adrenal gland. In some embodiments, when a vector engineered to express FVIII is administered to an infant or administered to a subject in utero, the vector can be administered to any one or more tissues selected from the liver, adrenal gland, heart, intestine, lung, and stomach, or to liver stem cell precursors thereof, for in vivo or ex vivo treatment of hemophilia A.

[0372] hemophilia Hemophilia A is a genetic deficiency of clotting factor VIII that causes increased bleeding and usually affects males. In most cases, it is inherited as an X-linked recessive trait, but it can also result from spontaneous mutations. Symptoms of hemophilia A include internal or external bleeding episodes. Individuals with more severe hemophilia suffer from more severe and more frequent bleeding, while others with mild hemophilia typically suffer from milder symptoms, except after surgery or severe trauma. Patients with moderate hemophilia have a variety of symptoms that appear along a spectrum between the severe and mild forms.

[0373] Current treatments to prevent bleeding in people with hemophilia A include factor VIII drug therapy. Most individuals with severe hemophilia require regular supplementation with intravenous recombinant or plasma-concentrated forms of factor VIII. Recombinant blood clotting factor VIII is one of the most complex proteins for industrial production due to the low efficiency of its gene transcription, the large intracellular losses of its proprotein during post-translational processing, and the instability of the secreted protein. Patients with mild hemophilia can manage their condition with desmopressin, a drug that releases stored factor VIII from blood vessel walls.

[0374] There are many complications associated with the treatment of hemophilia A. In children, easily accessible intravenous ports can be inserted to minimize frequent traumatic intravenous cannulations. However, these ports are associated with high infection rates and the risk of blood clots forming at the tip of the catheter, rendering them useless. Viral infections can be common in hemophilia patients due to frequent blood transfusions that put patients at risk of contracting blood-borne infections such as HIV, Hepatitis B, and Hepatitis C. Prion infections can also be transmitted by blood transfusions. Another treatment complication for hemophilia A is the development of inhibitor antibodies against factor VIII due to frequent infusions. These occur when the body recognizes the infused factor VIII as foreign because the body does not produce its own copies. In these individuals, activated factor VII, the precursor of factor VIII in the clotting cascade, can be infused as a treatment for bleeding and replacement antibodies against factor VIII in individuals with hemophilia.

[0375] Coagulation cascade Coagulation, also called thrombus formation, is the process by which blood changes from a liquid to a gel to form a clot, potentially resulting in hemostasis, the cessation of blood loss from an injured blood vessel and subsequent repair. The mechanism of clotting includes platelet activation, adhesion, and aggregation, as well as fibrin deposition and maturation. Disorders of coagulation are disease states that can result in bleeding (bleeding or bruising) or obstructive clotting (thrombosis).

[0376] Coagulation begins almost instantly after a vascular injury damages the endothelium that lines the blood vessels. Exposure of blood to the subendothelial space initiates two processes: changes in platelets and exposure of subendothelial tissue factor to plasma factor VII that ultimately lead to fibrin formation. Platelets immediately form a clot at the site of injury. This is called primary hemostasis. Secondary hemostasis occurs simultaneously: additional clotting or thrombogenic factors beyond factor VII (including factor VIII) react in a complex cascade to form fibrin strands and strengthen the platelet clot.

[0377] The coagulation cascade of secondary hemostasis has two initial pathways that lead to fibrin formation. These are the contact activation pathway (also known as the intrinsic pathway) and the tissue factor pathway (also known as the extrinsic pathway), both of which trigger the same basic reactions that generate fibrin. The primary pathway for initiating blood clotting is the tissue factor (extrinsic) pathway. A pathway is a series of reactions in which a zymogen (an inactive enzyme precursor) of a serine protease and its glycoprotein cofactor are activated into an active component that catalyzes the next reaction in the cascade, ultimately resulting in cross-linked fibrin. Clotting factors are commonly designated by Roman numerals, with a lower case letter added to indicate the active form.

[0378] Clotting factors are generally serine proteases (enzymes) that act by cleaving downstream proteins. The exceptions are tissue factors FV, ​​FVIII, and FXIII. Tissue factors FV and FVIII are glycoproteins, and factor XIII is a transglutaminase. Clotting factors circulate as inactive zymogens. Thus, the coagulation cascade is classically divided into three pathways. The tissue factor pathway and the contact activation pathway both activate the "final common pathway" of factor X, thrombin, and fibrin.

[0379] The main role of the tissue factor (extrinsic) pathway is to generate the "thrombin burst", a process in which thrombin, the most important component of the coagulation cascade in terms of its feedback activation role, is released very rapidly. FVIIa circulates in greater amounts than any other activated coagulation factor. This process involves the following steps:

[0380] Step 1: After vascular injury, FVII leaves the circulation and comes into contact with tissue factor (TF) expressed on tissue factor-containing cells (stromal fibroblasts and leukocytes), forming an activation complex (TF-FVIIa).

[0381] Step 2: TF-FVIIa activates FIX and FX.

[0382] Step 3: FVII itself is activated by thrombin, FXIa, FXII, and FXa.

[0383] Step 4: Activation of FX by TF-FVIIa (to form FXa) is almost immediately inhibited by tissue factor pathway inhibitor (TFPI).

[0384] Step 5: FXa and its cofactor FVa form the prothrombinase complex that activates prothrombin to thrombin.

[0385] Step 6: Thrombin then activates other components of the coagulation cascade, including FV and FVIII (which forms a complex with FIX), activating FVIII and releasing it from its binding to von Willebrand factor (vWF).

[0386] Step 7: FVIIIa is a cofactor for FIXa, together they form the "tenase" complex that activates FX, thereby continuing the cycle.

[0387] The contact activation (intrinsic) pathway begins with the formation of a primary complex on collagen by high molecular weight kininogen (HMWK), prekallikrein, and FXII (Hageman factor). Prekallikrein is converted to kallikrein, and FXII becomes FXIIa. FXIIa converts FXI to FXIa. Factor XIa activates FIX, which forms a tenase complex with its cofactor FVIIIa and activates FX to FXa. The minor role of the contact activation pathway in the initiation of thrombus formation can be explained by the fact that patients with severe deficiencies of FXII, HMWK, and prekallikrein do not have bleeding disorders. Instead, the contact activation system is more involved in inflammation and innate immunity.

[0388] The final common pathway shared by the intrinsic and extrinsic coagulation pathways involves the conversion of prothrombin to thrombin and fibrinogen to fibrin. Thrombin has a wide variety of functions beyond just the conversion of fibrinogen to fibrin, a component of the hemostatic plug. In addition, it is the most important platelet activating factor, as well as activating factors VIII and V and their inhibitor protein C (in the presence of thrombomodulin), and activating factor XIII, which forms covalent bonds that crosslink the fibrin polymers that form from the activated monomers.

[0389] Following activation by the contact factor or tissue factor pathways, the coagulation cascade is maintained in a prothrombotic state by continued activation of FVIII and FIX to form tenase complexes until down-regulation by the anticoagulant pathway.

[0390] In some embodiments, vectors for the expression of therapeutic proteins (e.g., FVIII proteins) comprising the expression cassettes disclosed herein can also encode cofactors or other polypeptides, sense or antisense oligonucleotides, or RNA (coding or non-coding; e.g., siRNA, shRNA, microRNA, and their antisense counterparts (e.g., antagoMiR)), which can be used in conjunction with the therapeutic proteins (e.g., FVIII proteins) expressed from ceDNA. Additionally, expression cassettes comprising sequences encoding therapeutic proteins (e.g., FVIII proteins) can also include exogenous sequences encoding reporter proteins used for experimental or diagnostic purposes, such as β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others known in the art.

[0391] In one embodiment, the ceDNA vector comprises a nucleic acid sequence for expressing a therapeutic protein (e.g., a FVIII protein) that is functional for the treatment of hemophilia A. In a preferred embodiment, the therapeutic protein (e.g., a FVIII protein) does not provoke an immune system response unless one is desired.

[0392] VI. Pharmaceutical Compositions In another aspect, a pharmaceutical composition is provided, comprising a ceDNA vector for expression of a therapeutic protein (e.g., a FVIII protein) as described herein, and a pharma- ceutically acceptable carrier or diluent.

[0393] The viral and non-viral vectors for the expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein can be incorporated into pharmaceutical compositions suitable for administration to a subject for in vivo delivery to cells, tissues, or organs of the subject. Typically, the pharmaceutical composition comprises a viral or non-viral vector (e.g., AAV vector, ceDNA vector) disclosed herein and a pharmaceutically acceptable carrier. For example, the vectors for the expression of therapeutic proteins (e.g., FVIII proteins) described herein can be incorporated into pharmaceutical compositions suitable for the desired route of therapeutic administration (e.g., parenteral administration). Passive tissue transduction via high pressure intravenous or intra-arterial infusion is also contemplated, as well as intracellular injections such as intranuclear microinjection or intracytoplasmic injection.

[0394] In one embodiment, pharmaceutical compositions for therapeutic purposes can be formulated as solutions, microemulsions, dispersions, liposomes, or other ordered structures suitable for high vector concentrations, particularly high ceDNA vector concentrations. Sterile injections can be prepared by incorporating the required amount of vector compounds in a suitable buffer, optionally with one or a combination of the above listed components, followed by filtration sterilization containing the vector, and can be formulated to deliver the transgene in the nucleic acid to recipient cells, resulting in therapeutic expression of the transgene or donor sequence therein. The compositions can also include a pharmaceutically acceptable carrier.

[0395] Pharmaceutically active compositions, including vectors (e.g., AAV vectors, ceDNA vectors) for expression of therapeutic proteins (e.g., FVIII proteins), can be formulated to deliver transgenes for various purposes to cells, e.g., cells of a subject.

[0396] Pharmaceutical compositions for therapeutic purposes must typically be sterile and stable under the conditions of manufacture and storage.Compositions can be formulated as solution, microemulsion, dispersion, liposome, or other ordered structures suitable for high vector, especially high ceDNA vector concentration.Sterile injectable solution can be prepared by incorporating the required amount of ceDNA vector compound in a suitable buffer with one or a combination of the above-listed components as necessary, followed by filtration sterilization.

[0397] The vectors for expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein can be incorporated into pharmaceutical compositions suitable for local, systemic, intra-amniotic, intra-thecal, intracranial, intra-arterial, intravenous, intralymphatic, intraperitoneal, subcutaneous, tracheal, intratissue (e.g., intramuscular, intracardiac, intrahepatic, intrarenal, intracerebral), intrathecal, intravesical, conjunctival (e.g., extraorbital, intraorbital, retroorbital, intraretinal, subretinal, choroidal, subchoroidal, intrastitial, intracameral, and intravitreal), intracochlear, and mucosal (e.g., oral, rectal, nasal) administration. Passive tissue transduction via high pressure intravenous or intra-arterial infusion is also contemplated, as well as intracellular injections such as intranuclear microinjection or intracytoplasmic injection.

[0398] In some aspects, the methods provided herein include delivering one or more vectors for the expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein to a host cell. Also provided herein are cells produced by such methods, and organisms (such as animals, plants, or fungi) that contain or are produced from such cells. Nucleic acid delivery methods may include lipofection, nucleofection, microinjection, biolistics, liposomes, immunoliposomes, polycations, or lipid:nucleic acid conjugates, naked DNA, and drug-enhanced DNA uptake. Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355 (the contents of each of which are incorporated herein by reference in their entirety), and lipofection reagents are commercially available (e.g., TRANSFECTAM™ and LIPFECTIN™). Delivery can be to a cell (eg, in vitro or ex vivo administration) or to a target tissue (eg, in vivo administration).

[0399] Various techniques and methods for delivering nucleic acids to cells are known in the art. Nucleic acids, such as ceDNA for the expression of therapeutic proteins (e.g., FVIII proteins), can be formulated in lipid nanoparticles (LNPs), lipidoids, liposomes, lipid nanoparticles, lipoplexes, or core-shell nanoparticles. Typically, LNPs are composed of nucleic acid (e.g., ceDNA) molecules, one or more ionized or cationic lipids (or their salts), one or more non-ionic or neutral lipids (e.g., phospholipids), molecules that prevent aggregation (e.g., PEG or PEG-lipid conjugates), and optionally sterols (e.g., cholesterol).

[0400] Another method for delivering nucleic acids, such as ceDNA for expression of therapeutic proteins (e.g., FVIII protein), to cells is by complexing the nucleic acid with a ligand that is internalized by the cell. For example, the ligand can bind to a receptor on the cell surface and be internalized via plasma membrane invagination. The ligand can be covalently linked to a nucleotide in the nucleic acid. Exemplary conjugates for delivering nucleic acids into cells are described, for example, in WO 2015 / 006740, WO 2014 / 025805, WO 2012 / 037254, WO 2009 / 082606, WO 2009 / 073809, WO 2009 / 018332, WO 2006 / 112872, WO 2004 / 090108, WO 2004 / 091515, and WO 2017 / 177326, the contents of each of which are incorporated herein by reference in their entirety.

[0401] Nucleic acids such as ceDNA for expression of therapeutic proteins (e.g., FVIII proteins) can also be delivered to cells by transfection. Useful transfection methods include, but are not limited to, lipid-mediated transfection, cationic polymer-mediated transfection, or calcium phosphate precipitation. Transfection reagents are well known in the art and include TurboFect Transfection Reagent (Thermo Fisher Scientific), Pro-Ject Reagent (Thermo Fisher Scientific), TRANSPASS™ P Protein Transfection Reagent (New England Biolabs), CHARIOT™ Protein Delivery Reagent (Active Motif), PROTEOJUICE™ Protein Transfection Reagent (EMD Millipore), 293fectin, LIPOFECTAMINE™ 2000, LIPOFECTAMINE™ 3000 (Thermo Fisher Scientific), LIPOFECTAMINE™ (Thermo Fisher Scientific), LIPOFECTIN™ (Thermo Fisher Scientific), DMRIE-C, CELLFECTIN™ (Thermo Fisher Scientific), OLIGOFECTAMINE™ (Thermo Fisher Scientific), CELLFECTIN ... Scientific), LIPOFECTACE(TM), FUGENE(TM)(Roche, Basel, Switzerland), FUGENE(TM) HD(Roche), TRANSFECTAM(TM)(Transfectam, Promega, Madison, Wis.), TFX-10(TM)(Pr omega), TFX-20(TM)(Promega), TFX-50(TM)(Promega), TRANSFECTIN(TM)(BioRad, Hercules, Calif.), SILENTFECT(TM)(Bio-Rad), Effectene(TM)(Qiagen, Valencia, Calif.).), DC-chol (Avanti Polar Lipids), GENEPORTER™ (Gene Therapy Systems, San Diego, Calif.), DHARMAFECT 1™ (Dharmacon, Lafayette, Colo.), DHARMAFECT 2™ (Dharmacon), DHARMAFECT 3™ (Dharmacon), DHARMAFECT 4™ (Dharmacon), ESCORT™ III (Sigma, St. Louis, Mo.), and ESCORT™ IV (Sigma Chemical Co.). Nucleic acids, such as ceDNA, can also be delivered to cells via microfluidics methods known to those of skill in the art.

[0402] Vectors (e.g., AAV vectors or ceDNA vectors) for expression of therapeutic proteins (e.g., FVIII proteins) described herein can also be administered directly to an organism for transduction of cells in vivo. Administration is by any of the routes normally used to ultimately contact molecules with blood or tissue cells, including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods of administering such nucleic acids are available and well known by those skilled in the art, and while more than one route may be used to administer a particular composition, a particular route may often provide a more immediate and more effective response than another route.

[0403] A ceDNA vector introduction method for a nucleic acid vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein can be delivered to a hematopoietic stem cell by, for example, the method described in U.S. Pat. No. 5,928,638, the contents of which are incorporated herein by reference in their entirety.

[0404] VII. Method of Use The non-viral or viral vectors for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein can also be used in methods for delivering a nucleic acid sequence of interest (e.g., encoding a therapeutic protein (e.g., FVIII protein)) to a target cell (e.g., a host cell). In some embodiments, the methods include methods for delivering a therapeutic protein (e.g., FVIII protein) to a cell of a subject in need thereof and for treating hemophilia A. The present disclosure allows for in vivo expression of a therapeutic protein (e.g., FVIII protein) encoded by a ceDNA vector in a cell of a subject, such that the therapeutic effect of expression of the therapeutic protein (e.g., FVIII protein) occurs. These results are seen in both in vivo and in vitro forms of vector delivery.

[0405] In some embodiments, the present disclosure provides a method for delivery of a therapeutic protein (e.g., FVIII protein) in cells of a subject in need thereof, comprising multiple administrations of a vector of the present disclosure encoding said therapeutic protein (e.g., FVIII protein). In some embodiments, such multiple administration strategies will be more successful in ceDNA-based systems, since the ceDNA vectors of the present disclosure do not induce immune responses as typically observed against encapsidated viral vectors. The ceDNA vectors are administered in sufficient amounts to transfect cells of the desired tissue and result in sufficient levels of gene transfer and expression of the therapeutic protein (e.g., FVIII protein) without excessive side effects.

[0406] The present disclosure also provides a method of treating hemophilia A in a subject, comprising introducing a therapeutically effective amount of a vector described herein, optionally with a pharma- ceutically acceptable carrier, into a target cell (particularly a muscle cell or tissue) of a subject in need thereof. The vector may be introduced in the presence of a carrier, but such a carrier is not required. The selected ceDNA vector comprises a nucleic acid sequence encoding a therapeutic protein (e.g., FVIII protein) useful for treating hemophilia A.

[0407] The compositions and vectors provided herein can be used to deliver therapeutic proteins (e.g., FVIII proteins) for a variety of purposes. In some embodiments, the transgene encodes a therapeutic protein (e.g., FVIII protein) intended to be used for research purposes, e.g., to generate a somatic transgenic animal model harboring the transgene, e.g., to study the function of the therapeutic protein (e.g., FVIII protein) product. In another example, the transgene encodes a therapeutic protein (e.g., FVIII protein) intended to be used to generate an animal model of hemophilia A. In some embodiments, the encoded therapeutic protein (e.g., FVIII protein) is useful for treating or preventing a hemophilia A condition in a mammalian subject. The therapeutic protein (e.g., FVIII protein) can be introduced (e.g., expressed) into a patient in an amount sufficient to treat hemophilia A associated with reduced expression, lack of expression, or dysfunction of the gene.

[0408] In principle, the expression cassette may include a nucleic acid or any transgene that encodes a therapeutic protein (e.g., a FVIII protein) that is reduced or absent due to a mutation, or that provides a therapeutic effect, where overexpression is considered to be within the scope of this disclosure. Preferably, there is no uninserted bacterial DNA, and preferably no bacterial DNA is present in the ceDNA compositions provided herein.

[0409] In another embodiment, different proteins, or multiple vectors expressing the same therapeutic protein (e.g., FVIII protein) but operably linked to different promoters or cis-regulatory elements, can be delivered simultaneously or sequentially to a target cell, tissue, organ, or subject. Thus, this strategy allows gene therapy or gene delivery of multiple proteins simultaneously. Different parts of the therapeutic protein (e.g., FVIII protein) can also be separated into separate vectors (e.g., different domains and / or cofactors required for the function of the therapeutic protein (e.g., FVIII protein)), which can be administered simultaneously or at different times and can be separately regulatable, thereby adding an additional level of control of the expression of the therapeutic protein (e.g., FVIII protein).

[0410] The present disclosure also provides a method of treating hemophilia A in a subject, comprising introducing a therapeutically effective amount of a ceDNA vector disclosed herein, optionally with a pharma- ceutically acceptable carrier, into a target cell (particularly a muscle cell or tissue) of a subject in need thereof. The ceDNA vector may be introduced in the presence of a carrier, but such a carrier is not required. The ceDNA vector as implemented comprises a nucleic acid sequence of interest useful for treating hemophilia A. In particular, the ceDNA vector may comprise a desired exogenous DNA sequence operably linked to a control element capable of directing transcription of a desired polypeptide, protein, or oligonucleotide encoded by the exogenous DNA sequence when introduced into a subject. The ceDNA vector may be administered via any suitable route as provided above and elsewhere herein.

[0411] VIII. Method of Delivery In some embodiments, the non-viral and viral vectors for the expression of therapeutic proteins described herein can be delivered to target cells in vitro or in vivo by various suitable methods. The vectors can be applied or injected alone. According to embodiments, the vectors can be delivered to cells without the aid of transfection reagents or other physical means. Alternatively, according to other embodiments, the vectors for the expression of therapeutic proteins (e.g., FVIII proteins) can be delivered using any art-known transfection reagents or other art-known physical means that facilitate DNA entry into cells, such as liposomes, alcohol, polylysine-rich compounds, arginine-rich compounds, calcium phosphate, microvesicles, microinjection, electroporation, etc.

[0412] One aspect of the technology described herein relates to a method for delivering a therapeutic protein (e.g., FVIII protein) to a cell. Typically, in in vivo and in vitro methods, a non-viral or viral vector for expressing a therapeutic protein (e.g., FVIII protein) disclosed herein may be introduced into a cell using the methods disclosed herein, as well as other methods known in the art. The vector for expressing a therapeutic protein (e.g., FVIII protein) disclosed herein is preferably administered to a cell in a biologically effective amount. When the vector is administered to a cell in vivo (e.g., to a subject), the biologically effective amount of the vector is an amount sufficient to cause the transduction and expression of a therapeutic protein (e.g., FVIII protein) in a target cell.

[0413] Exemplary modes of administration of vector compositions for expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intradermal, intrauterine (or intraovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intracranial, intramuscular (including administration to the skeleton, diaphragm, and / or myocardium), intrapleural, intracerebral, and intra-arterial). Administration can be systemic or direct delivery to the liver or other sites (e.g., any of the kidneys, gallbladder, prostate, adrenal glands, heart, intestine, lungs, and stomach).

[0414] Administration can be topical (e.g., to skin and mucosal surfaces, including respiratory tract surfaces, and transdermal administration), intralymphatic, etc., as well as by direct tissue or organ injection (e.g., to muscles, including but not limited to, the liver, eye, skeletal muscle, cardiac muscle, diaphragm, or brain).

[0415] A method for vector introduction of a nucleic acid vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein can be delivered to a hematopoietic stem cell by, for example, the method described in U.S. Pat. No. 5,928,638, the contents of which are incorporated herein by reference in their entirety.

[0416] Administration of the vectors described herein (e.g., AAV, ceDNA) can be to any site of a subject, including, but not limited to, the liver and / or a site selected from the group consisting of the eye, brain, skeletal muscle, smooth muscle, heart, diaphragm, airway epithelium, kidney, spleen, pancreas, and skin.

[0417] The most suitable route in any given case will depend on the nature and severity of the condition being treated, ameliorated, and / or prevented, and on the nature of the particular vector being used.

[0418] In one embodiment, the delivery is to the liver. A vector containing a nucleic acid disclosed herein can be delivered to the liver through the hepatic artery, portal vein, or intravenously to produce therapeutic levels of a therapeutic protein or coagulation factor in the blood. The capsid or vector can be suspended, preferably in a physiologically compatible transporter, and administered to a human or non-human mammalian patient. Those skilled in the art can easily select a suitable transporter, taking into account the indication for which the transfer virus is directed. For example, suitable carriers include saline, which can be formulated with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, sesame oil, and water.

[0419] In some embodiments, cells are removed from a subject, and a ceDNA vector for expressing a therapeutic protein (e.g., FVIII protein) disclosed herein is introduced therein, and then the cells are returned to the subject. Methods for removing cells from a subject for ex vivo treatment and then returning them to the subject are known in the art (see, e.g., U.S. Patent No. 5,399,346, the disclosure of which is incorporated herein in its entirety). Alternatively, the ceDNA vector is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and these cells are administered to a subject in need thereof.

[0420] Cells transduced with ceDNA vectors for expression of therapeutic proteins (e.g., FVIII proteins) disclosed herein are preferably administered to a subject in a "therapeutically effective amount" in combination with a pharmaceutical carrier. Those skilled in the art will appreciate that the therapeutic effect need not be complete or curative, as long as some benefit is provided to the subject.

[0421] In some embodiments, the ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein can encode a therapeutic protein (e.g., FVIII protein) described herein (sometimes referred to as a transgene or heterologous nucleic acid sequence) that is produced in a cell in vitro, ex vivo, or in vivo. For example, in contrast to the use of the ceDNA vectors described herein in the therapeutic methods discussed herein, in some embodiments, the ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) can be introduced into cultured cells and the expressed therapeutic protein (e.g., FVIII protein) can be isolated from the cells for, e.g., production of antibodies and fusion proteins. In some embodiments, cultured cells containing the ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein can be used for commercial production of antibodies or fusion proteins, for example, serving as a cell source for small- or large-scale biomanufacturing of antibodies or fusion proteins. In an alternative embodiment, the ceDNA vectors for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein are introduced into cells of a host non-human subject for in vivo production of antibodies or fusion proteins, including small scale production, as well as commercial large scale production of a therapeutic protein (e.g., FVIII protein).

[0422] The ceDNA vectors for expressing therapeutic proteins (e.g., FVIII proteins) disclosed herein can be used in both veterinary and medical applications. Subjects suitable for the above ex vivo gene delivery methods include birds (e.g., chickens, ducks, geese, quails, turkeys, and pheasants) and mammals (e.g., humans, cows, sheep, goats, horses, cats, dogs, and lagomorphs), with mammals being preferred. Human subjects are most preferred. Human subjects include neonates, infants, juveniles, and adults.

[0423] Dose Range Provided herein is a method of treatment comprising administering to a subject an effective amount of a composition comprising a vector encoding a therapeutic protein (e.g., FVIII protein) as described herein. As will be understood by those skilled in the art, the term "effective amount" refers to the amount of the administered composition that results in expression of a therapeutic protein (e.g., FVIII protein) in a "therapeutically effective amount" for the treatment of hemophilia A.

[0424] In vivo and / or in vitro assays can optionally be used to help identify optimal dosage ranges for use. The precise dose to be used in the formulation will also depend on the route of administration and the severity of the condition, and should be determined according to the judgment of the skilled artisan and each subject's circumstances. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0425] The ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein is administered in an amount sufficient to transfect cells of the desired tissue and provide sufficient levels of gene transfer and expression without excessive side effects. Conventional pharmacologic acceptable routes of administration include, but are not limited to, those described above in the "Administration" section, such as direct delivery to a selected organ (e.g., intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, and other parenteral routes of administration. Administration routes can be combined if desired.

[0426] The amount of vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein required to achieve a particular "therapeutic effect" will vary based on several factors, including, but not limited to, the route of nucleic acid administration, the level of gene or RNA expression required to achieve the therapeutic effect, the particular disease or disorder being treated, and the stability of the gene, RNA product, or resulting expressed protein. One of skill in the art can readily determine the vector dosage range for treating a patient with a particular disease or disorder based on the aforementioned factors as well as other factors well known in the art.

[0427] Dosage regime can be adjusted to provide optimal therapeutic response.For example, oligonucleotide can be repeatedly administered, for example, several doses can be administered daily, or dose can be proportionally reduced as indicated by the exigencies of therapeutic situation.Those skilled in the art can easily determine the appropriate dose and schedule of administration of subject oligonucleotide, regardless of whether oligonucleotide is administered to cell or to subject.

[0428] The FVIII therapeutic protein may be expressed in a subject for at least 1 week, at least 2 weeks, at least 1 month, at least 2 months, at least 6 months, at least 12 months / year, at least 2 years, at least 5 years, at least 10 years, at least 15 years, at least 20 years, at least 30 years, at least 40 years, at least 50 years, or more. Long-term expression can be achieved by repeated administration of the ceDNA vectors described herein at predetermined or desired intervals.

[0429] The duration of treatment will depend on the subject's clinical progress and responsiveness to treatment. Continuous, relatively low maintenance doses are contemplated after an initial, higher therapeutic dose.

[0430] Unit dosage form In some embodiments, pharmaceutical compositions comprising viral or non-viral vectors comprising expression cassettes described herein for expression of therapeutic proteins disclosed herein (e.g., FVIII proteins) can be conveniently presented in unit dosage form. The unit dosage form will typically be adapted for one or more routes of administration of the pharmaceutical composition. In some embodiments, the unit dosage form is adapted for drops to be administered directly to the eye. In some embodiments, the unit dosage form is adapted for administration by inhalation. In some embodiments, the unit dosage form is adapted for administration by an inhaler. In some embodiments, the unit dosage form is adapted for administration by a nebulizer. In some embodiments, the unit dosage form is adapted for administration by an aerosolizer. In some embodiments, the unit dosage form is adapted for oral administration, buccal administration, or sublingual administration. In some embodiments, the unit dosage form is adapted for intravenous, intramuscular, or subcutaneous administration. In some embodiments, the unit dosage form is adapted for subretinal, suprachoroidal, or intravitreal injection.

[0431] In some embodiments, the unit dosage form is adapted for intrathecal or intraventricular administration. In some embodiments, the pharmaceutical composition is formulated for local administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect.

[0432] IX. Treatment method The technology described herein also demonstrates methods for making the disclosed viral and non-viral vectors for expression of therapeutic proteins and how to use them in a variety of methods (e.g., ex vivo, ex situ, in vitro, and in vivo applications, methodologies, diagnostic procedures, gene editing and / or gene therapy regimens for treating subjects suffering from genetic disorders).

[0433] According to some embodiments, the subject is a human. According to some embodiments, the genetic disorder is sickle cell anemia, melanoma, hemophilia A (clotting factor VIII (FVIII) deficiency) and hemophilia B (clotting factor IX (FIX) deficiency), cystic fibrosis (CFTR), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidosis (e.g., Hurler syndrome (MPS I), Scheie syndrome (MPS IS), Hurler-Scheie syndrome (MPS I HS), Hunter syndrome (MPS II), Sanfilippo types A, B, C, and D (MPS III), A, B, C, and D), Morquio A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS VI), Sly syndrome (MPS VII), hyaluronidase deficiency (MPS IX), Niemann-Pick disease A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipoproteins Fuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Huntington's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy (GACI), Leber's congenital amaurosis, Stargardt macular dystrophy (ABCA4),The genetic disorder is selected from the group consisting of ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11), type III (ABCB4), or type IV (TJP2), and cathepsin A deficiency. According to some embodiments, the genetic disorder is Leber congenital amaurosis (LCA). According to some embodiments, the LCA is LCA10. According to some embodiments, the genetic disorder is Niemann-Pick disease. According to some embodiments, the genetic disorder is Stargardt macular dystrophy. According to some embodiments, the genetic disorder is glucose-6-phosphatase (G6Pase) deficiency (glycogen storage disease type I) or Pompe disease (glycogen storage disease type II). According to some embodiments, the genetic disorder is hemophilia A (factor VIII deficiency). According to some embodiments, the genetic disorder is hemophilia B (Factor IX deficiency). According to some embodiments, the genetic disorder is Hunter syndrome (mucopolysaccharidosis type II). According to some embodiments, the genetic disorder is cystic fibrosis. According to some embodiments, the genetic disorder is dystrophic epidermolysis bullosa (DEB). According to some embodiments, the genetic disorder is phenylketonuria (PKU). According to some embodiments, the genetic disorder is progressive familial intrahepatic cholestasis (PFIC). According to some embodiments, the genetic disorder is Wilson's disease. According to some embodiments, the genetic disorder is Gaucher disease type I, II or III.

[0434] In one embodiment, the expressed therapeutic protein (e.g., FVIII protein) expressed from the vectors disclosed herein is functional for the treatment of disease. In a preferred embodiment, the therapeutic protein (e.g., FVIII protein) does not provoke an immune system response unless one is desired.

[0435] Provided herein is a method of treating hemophilia A in a subject, comprising introducing a therapeutically effective amount of a ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein, optionally with a pharma- ceutically acceptable carrier, into a target cell (e.g., muscle cell or tissue, or other diseased cell type) of a subject in need of treatment. The vector may be introduced in the presence of a carrier, but such a carrier is not required. The vector as implemented comprises a nucleic acid sequence encoding a therapeutic protein (e.g., FVIII protein) described herein, useful for treating the disease. In particular, a ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein may comprise a desired therapeutic protein (e.g., FVIII protein) DNA sequence operably linked to a control element capable of directing transcription of the desired therapeutic protein (e.g., FVIII protein) encoded by an exogenous DNA sequence when introduced into a subject. A ceDNA vector for expression of a therapeutic protein (e.g., FVIII protein) disclosed herein may be administered via any suitable route as provided above and elsewhere herein.

[0436] Disclosed herein are ceDNA vector compositions and formulations for expression of a therapeutic protein (e.g., FVIII protein) disclosed...

Claims

1. A liver-specific nucleic acid regulatory element comprising a nucleic acid sequence having at least 93% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

2. 2. The liver-specific nucleic acid regulatory element of claim 1, wherein the nucleic acid sequence has at least 94% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

3. 3. The liver-specific nucleic acid regulatory element of claim 2, wherein the nucleic acid sequence has at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

4. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence has at least 96% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

5. 5. The liver-specific nucleic acid regulatory element of claim 4, wherein the nucleic acid sequence has at least 97% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

6. 6. The liver-specific nucleic acid regulatory element of claim 5, wherein the nucleic acid sequence has at least 98% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

7. 7. The liver-specific nucleic acid regulatory element of claim 6, wherein the nucleic acid sequence has at least 99% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139.

8. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence consists of a sequence selected from the group consisting of SEQ ID NOs: 1-80, 138, and 139.

9. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 95% identity to SEQ ID NO:

131.

10. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 96% identity to SEQ ID NO:

131.

11. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 97% identity to SEQ ID NO:

131.

12. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 98% identity to SEQ ID NO:

131.

13. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 99% identity to SEQ ID NO:

131.

14. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence comprising SEQ ID NO:

131.

15. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 95% identity to SEQ ID NO:

122.

16. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 96% identity to SEQ ID NO:

122.

17. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 97% identity to SEQ ID NO:

122.

18. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 98% identity to SEQ ID NO:

122.

19. 4. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence having at least 99% identity to SEQ ID NO:

122.

20. The liver-specific nucleic acid regulatory element of claim 3, wherein the nucleic acid sequence comprises at least one enhancer sequence comprising SEQ ID NO:

122.

21. The liver-specific nucleic acid regulatory element described in claim 1, wherein the nucleic acid sequence comprises at least one enhancer sequence selected from the group consisting of enhancer sequences listed in Table 10, Table 11, Table 12, and Table 13.

22. the element comprises at least two enhancer sequences selected from the group consisting of enhancer sequences set forth in Table 10, Table 11, Table 12, and Table 13; the element comprises three enhancer sequences selected from the group consisting of enhancer sequences set forth in Table 10, Table 11, Table 12, and Table 13, and optionally, the three enhancer sequences are identical; the element consists essentially of 2 to 10 enhancer sequences selected from the group consisting of the enhancer sequences set forth in Table 10, Table 11, Table 12, and Table 13; and / or 22. The liver-specific nucleic acid regulatory element of Claim 21, wherein the element comprises at least two enhancer sequences selected from the group consisting of enhancer sequences set forth in Table 10, Table 11, Table 12, and Table 13, and further comprises a spacer disposed between the enhancer sequences.

23. The element is GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCAAGTCCAC (SEQ ID NO: 223), GGGGGAAGCTACTGGTGAATATTAACCAAGGTCACCCAGTTATCAGGGAGCAAACAGGAGCAAAGTCCAT (SEQ ID NO: 1381), GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCCGTTATCGGAGGAGCAAACAAGGGCTAAGTCCAC (SEQ ID NO: 1073), or or comprising at least one enhancer sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCAGTTATCGGAGGAGCAAACAAGGGCAAAGTCCAC (SEQ ID NO: 1113); or The element is GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGGGGCAAGTCCAC (SEQ ID NO: 223), GGGGGAAGCTACTGGTGAATATTAACCAAGGTCACCCAGTTATCAGGGAGCAAACAGGAGCAAAGTCCAT (SEQ ID NO: 1381), GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCCGTTATCGGAGGAGCAAACAAGGGCTAAGTCCAC (SEQ ID NO: 1073), or 22. The liver-specific nucleic acid regulatory element of claim 21, comprising at least one enhancer sequence consisting of GGAGGCTGTTGGTGAATATTAACCAAGGTCACCTCAGTTATCGGAGGAGCAAACAAGGGCAAAGTCCAC (SEQ ID NO: 1113).

24. A liver-specific expression cassette comprising the liver-specific nucleic acid regulatory element of any one of claims 1 to 23 and a liver-specific promoter linked to a transgene.

25. A liver-specific expression cassette as described in claim 24, wherein the liver-specific nucleic acid regulatory element comprises at least two enhancer sequences, with two or more nucleotides separating each enhancer sequence.

26. A liver-specific expression cassette comprising a liver-specific nucleic acid regulatory element comprising at least three enhancer sequences, and a liver-specific promoter linked to a transgene, the liver-specific nucleic acid regulatory element comprises a nucleic acid sequence having at least 95% identity to a sequence selected from the group consisting of SEQ ID NOs: 15, 1, 13, 2-12, 14, 16-80, 138, and 139; A liver-specific expression cassette in which two or more nucleotides separate each enhancer sequence.

27. 27. The liver-specific expression cassette of claim 26, wherein 2 to 30 nucleotides separate each enhancer sequence.

28. 28. The liver-specific expression cassette of claim 27, wherein five nucleotides separate each enhancer sequence.

29. 28. The liver-specific expression cassette of claim 27, wherein 11 nucleotides separate each enhancer sequence.

30. 28. The liver-specific expression cassette of claim 27, wherein 30 nucleotides separate each enhancer sequence.

31. The liver-specific expression cassette according to any one of claims 26 to 30, wherein the liver-specific expression cassette comprises 2, 3, 4, or 5 repeats of the enhancer sequence.

32. The liver-specific expression cassette according to any one of claims 26 to 30, wherein the liver-specific expression cassette comprises 6, 7, 8, 9, or 10 repeats of the enhancer sequence.

33. 25. The liver-specific expression cassette of claim 24, comprising one or more FOXA and HNF4 transcription factor consensus sites.

34. A liver-specific expression cassette as described in claim 24, wherein the liver-specific nucleic acid regulatory element comprises one or more CpG-minimized sites.

35. The liver-specific promoter is a transthyretin (TTR) promoter, a minimal TTR promoter (TTRm), an AAT promoter, an albumin (ALB) promoter or minimal promoter, an apolipoprotein A1 (APOA1) promoter or minimal promoter, a complement factor B (CFB) promoter, a ketohexokinase (KHK) promoter, a hemopexin (HPX) promoter or minimal promoter, a nicotinamide N-methyltransferase (NNMT) promoter or minimal promoter, or a carboxylesterase 1 (CES1) promoter.

25. The liver-specific expression cassette of claim 24, wherein the promoter or minimal promoter is selected from the group consisting of a protein C (PROC) promoter or minimal promoter, an apolipoprotein C3 (APOC3) promoter or minimal promoter, a mannan-binding lectin serine protease 2 (MASP2) promoter or minimal promoter, a hepcidin antimicrobial peptide (HAMP) promoter or minimal promoter, a serpin peptidase inhibitor, clade C (antithrombin), and member 1 (SERPINC1) promoter or minimal promoter.

36. 36. The liver-specific expression cassette of claim 35, wherein the promoter comprises a sequence selected from the group consisting of SEQ ID NOs: 210-217.

37. 25. The liver-specific expression cassette of claim 24, wherein the transgene encodes a liver-specific therapeutic protein.

38. 38. The liver-specific expression cassette of claim 37, wherein the liver-specific therapeutic protein is coagulation factor VIII (FVIII).

39. The coagulation FVIII comprises a codon-optimized nucleic acid sequence; or The liver-specific expression cassette of claim 38, wherein the coagulation FVIII comprises a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 143, the coagulation FVIII comprises SEQ ID NO: 143, or the coagulation FVIII consists of SEQ ID NO:

143.

40. A vector comprising the liver-specific nucleic acid regulatory element of claim 1.

41. The vector is Viral or non-viral vectors; a plasmid; or Closed-end DNA (ceDNA) vectors 41. The vector of claim 40,

42. A pharmaceutical composition comprising the vector described in claim 40 and a pharmaceutically acceptable excipient.

43. A pharmaceutical composition for treating a liver-specific disease or disorder, comprising the vector described in claim 40.

44. 44. The pharmaceutical composition of claim 43, wherein the subject is a human subject suffering from a genetic disorder.

45. 45. The pharmaceutical composition of claim 44, wherein the human subject has hemophilia A.

46. The genetic disorder may be melanoma, hemophilia A (clotting factor VIII (FVIII) deficiency) and hemophilia B (clotting factor IX (FIX) deficiency), cystic fibrosis (CFTR deficiency), familial hypercholesterolemia (LDL receptor deficiency), hepatoblastoma, Wilson's disease, phenylketonuria (PKU), congenital hepatic porphyria, inherited liver metabolic disorders, Lesch-Nyhan syndrome, sickle cell anemia, thalassemia, xeroderma pigmentosum, Fanconi anemia, retinitis pigmentosa, ataxia-telangiectasia, Bloom's syndrome, retinoblastoma, mucopolysaccharidosis (e.g., Hurler syndrome (MPS type I), Scheie syndrome (MPS type S), Hurler-Scheie syndrome (MPS type I H-S), Hunter syndrome (MPS type II), Sanfilippo types A, B, C, and D (MPS III MPS types A, B, C, and D), Morquio syndrome types A and B (MPS IVA and MPS IVB), Maroteaux-Lamy syndrome (MPS type VI), Sly syndrome (MPS type VII), hyaluronidase deficiency (MPSIX), Niemann-Pick disease types A / B, C1, and C2, Fabry disease, Schindler disease, GM2-gangliosidosis type II (Sandhoff disease), Tay-Sachs disease, metachromatic leukodystrophy, Krabbe disease, mucolipidosis types I, II / III, and IV, sialidosis types I and II, glycogen storage disease types I and II (Pompe disease), Gaucher disease types I, II, and III, Fabry disease, cystinosis, Batten disease, aspartylglucosaminuria, Salla disease, Danon disease (LAMP-2 deficiency), lysosomal acid lipase (LAL) deficiency, neuronal ceroid lipofuscinosis (CLN1-8, INCL, and LINCL), sphingolipidoses, galactosialidosis, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Alzheimer's disease, Hansen's disease, 45. The pharmaceutical composition of claim 44, wherein the inflammatory bowel disease is selected from the group consisting of Chinton's disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), dystrophic epidermolysis bullosa (DEB), ectonucleotide pyrophosphatase 1 deficiency, generalized arterial calcification of infancy (GACI), Leber's congenital amaurosis, Stargardt's macular dystrophy (ABCA4 deficiency), ornithine transcarbamylase (OTC) deficiency, Usher syndrome, alpha-1 antitrypsin deficiency, progressive familial intrahepatic cholestasis (PFIC) type I (ATP8B1 deficiency), type II (ABCB11 deficiency), type III (ABCB4 deficiency), or type IV (TJP2 deficiency), and cathepsin A deficiency.

47. A method for increasing the expression potential of a liver-specific enhancer sequence comprising the nucleic acid sequence CTAAG, the method comprising introducing a single nucleotide substitution (T to A) mutation such that the substitution results in a nucleic acid sequence comprising the sequence CAAAG.

48. A liver-specific expression cassette as described in claim 24, which comprises at least two enhancer sequences or at least three enhancer sequences.

49. A liver-specific expression cassette as described in claim 48, wherein two or more nucleotides separate each of the enhancer sequences.