Milbexian for preventing and treating thromboembolic disorders

Abstract

Factor XIa inhibitors having therapeutic properties useful in methods for treating a disease or disorder, such as a thrombotic or thromboembolic disorder.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 245,522, filed September 17, 2021, and U.S. Provisional Patent Application No. 63 / 278,582, filed November 12, 2021, each of which is incorporated herein by reference.

[0002] The present disclosure relates to the use of milbexian to treat thromboembolic disorders. [Background technology]

[0003] Oral anticoagulants are the primary agents for preventing and treating venous and arterial thromboembolism. Direct-acting oral anticoagulants have replaced vitamin K antagonists in many indications, but bleeding remains a major side effect. Underuse of anticoagulants in eligible patients with atrial fibrillation and inappropriate use of low-dose direct-acting oral anticoagulant regimens contribute in part to the risk of bleeding (Steinberg et al., International trends in clinical characteristics and oral anticoagulation treatment for patients with atrial fibrillation: Results from the GARFIELD-AF, ORBIT-AF I, and ORBIT-AF II registries. Am Heart J 2017;194:132-40; Sanghai et al., Rates of potentially inappropriate dosing of direct-acting oral anticoagulants and associations with geriatric conditions among older patients with atrial fibrillation: The SAGE-AF study. J Am Heart Assoc 2020;9:e014108). Thus, there remains a need for safer oral anticoagulants.

[0004] Although factor XI is a key promoter of growing clots, it also plays an ancillary role in hemostasis and is a promising target for developing new anticoagulants (Weitz et al., Factor XI inhibition to uncouple thrombosis from hemostasis: JACC review topic of the week. J Am Coll Cardiol 2021;78:625-31).

[0005] Only one phase 2 study has published data on the clinical safety and efficacy of reducing FXI activity to prevent VTE after TKR. Subjects were treated with antisense oligonucleotides targeting FXI (FXI-ASO, abelacimab) for 36 days before surgery to reduce FXI levels. This study showed a dose-dependent reduction in the risk of VTE events compared with enoxaparin. However, antisense oligonucleotides and abelacimab require parenteral administration (Buller et al., Factor XI antisense oligonucleotide for prevention of venous thrombosis. N Engl J Med 2015;372:232-40; Verhamme et al., Abelacimab for prevention of venous thrombosis. N Engl J Med 2021, 385(7):609-617).

[0006] Milbexian is a direct acting, reversible, small molecule therapeutic that binds with high affinity and selectivity to and inhibits the activated form of human coagulation factor XI (FXIa). Milbexian has the formula (I): [ka] It is a macrocyclic compound having the structure shown below.

[0007] The chemical name of milbexian is (5R,9S)-9-(4-(5-chloro-2-(4-chloro-1H-1,2,3-triazol-1-yl)phenyl)-6-oxopyrimidin-1(6H)-yl)-21-(difluoromethyl)-5-methyl-21H-3-aza-1(4,2)-pyridin-2(5,4)-pyrazolacyclononaphan-4-one. Milbexian and methods for making milbexian are described in U.S. Pat. No. 9,453,018, which is incorporated herein by reference in its entirety. Amorphous solid dispersion compositions of milbexian in one or more polymers are described in WO2020210629, which is incorporated herein by reference in its entirety.

[0008] There is a need in the art for new anticoagulant therapies that significantly reduce thrombosis without increasing the risk of clinically significant bleeding in patients either suffering from or at risk for a thrombotic event. Summary of the Invention

[0009] In some embodiments, the present disclosure is directed to a method of treating or preventing a venous thromboembolic disorder, comprising orally administering to a patient in need thereof milbexian or a pharma- ceutical acceptable salt thereof in a total daily dosage of 25 mg to 400 mg.

[0010] In another aspect, the present disclosure is directed to a method of preventing postoperative venous thromboembolic events in a patient recovering from surgery comprising administering to the patient a daily dose of milbexian or a pharma- ceutical acceptable salt thereof, wherein said administration results in the patient experiencing fewer postoperative venous thromboembolic events than would result from administering 40 mg of enoxaparin (a low molecular weight heparin) subcutaneously to the patient per day. [Brief description of the drawings]

[0011] [Figure 1]The study design of the study described in Example 1 is outlined below, which was designed to test the ability of milbexian to prevent venous thromboembolic events in individuals at risk of developing venous thromboembolism, such as individuals undergoing total knee arthroplasty. Interim Analysis (IA) #1 was conducted when approximately 50 subjects in each of the BID treatment groups had completed venography or experienced a symptomatic venous thromboembolic (VTE) event. IA #2 was an additional IA conducted at the discretion of the steering committee to determine the need to continue the 25 mg once daily regimen.

[0012] [Diagram 2] 1 shows the incidence of overall VTE and 95% confidence intervals in each treatment arm of the study described in Example 1.

[0013] [Diagram 3] FIG. 1 shows the incidence of thrombus by severity of thrombus in subjects with deep vein thrombosis (DVT) using venography during the study.

[0014] [Figure 4] 1 shows the mean DVT severity scores for subjects with DVT using venography from the study described in Example 1.

[0015] [Diagram 5] 1 shows the incidence of bleeding and 95% confidence intervals in each treatment arm of the study described in Example 1.

[0016] [Figure 6] The median activated partial thromboplastin time rates and incidence of any or clinically relevant bleeding with milbexian and enoxaparin are shown.

[0017] [Figure 7] Effect of IV administration of vehicle and milbexian on carotid blood flow after induction of thrombus in ECAT rabbits. Mean ± SEM and n = 6 per group.

[0018] [Figure 8] The effect of vehicle and milbexian on blood flow, expressed as % of control carotid blood flow (i.e., blood flow before injury), in ECAT rabbits is shown. *P<0.05 (one-tailed) compared with vehicle. Mean±SEM and n=6 per group.

[0019] [Figure 9] The relationship between the total plasma concentration of milbexian and the antithrombotic effect expressed as the % reduction in thrombus weight in prophylaxis of ECAT rabbits is shown. IV, intravenous; ECAT (electrically mediated carotid arterial thrombosis); SEM, standard deviation of the mean.

[0020] [Figure 10] The effects of vehicle and milbexian on aPTT, TT, and PT in ECAT rabbits are shown. *P<0.05 (one-tailed) compared with vehicle. Mean±SEM and n=6 per group.

[0021] [Figure 11] Antithrombotic activity of milbexian in ECAT rabbits monitored by ex vivo aPTT. aPTT, activated partial thromboplastin time; TT, thrombin time; PT, prothrombin time; ECAT, electrically mediated carotid artery thrombosis; SEM, standard deviation of the mean; IV, intravenous.

[0022] [Figure 12] The effect of vehicle and milbexian on carotid blood flow is shown (expressed as % of control carotid flow). The treatment protocol consisted of vehicle or milbexian administered IV (bolus + infusion) 15 minutes after initiation of arterial thrombosis. Mean ± SEM and n = 6 per group.

[0023] [Figure 13]1 shows a dose-dependent decrease in FXI levels and thrombus weight observed in rabbit ECAT experiments upon ASO-induced inhibition of FXI. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] As used herein, the term "treat" or "treatment" includes therapeutic treatment of thromboembolic disorders. The term "treat" or "treatment" refers to the treatment of a condition in a mammal, particularly a human, and includes (a) inhibiting the condition, i.e., preventing its onset; and / or (b) alleviating the condition, i.e., causing regression of the condition. In some embodiments, milbexian is used for the post-operative treatment of VTE in patients undergoing surgery. In some embodiments, milbexian is used for the short-term treatment of VTE (i.e., acute treatment of VTE).

[0025] As used herein, the term "prevention" or "preventing" refers to the prophylactic treatment of asymptomatic conditions in mammals, particularly in humans, with the aim of reducing the probability of developing clinical conditions. Patients are selected for prophylactic treatment based on factors known to increase the risk of developing clinical conditions compared to the general population. In some embodiments, "prevention" refers to the primary prevention of thromboembolic disorders in mammals, particularly in humans, with the aim of reducing the likelihood of developing all VTE events after TKR surgery, including proximal and / or distal deep vein thrombosis (both symptomatic DVT and asymptomatic DVT confirmed by venographic evaluation, or objectively confirmed symptomatic DVT); non-fatal PE; or any death during the treatment period. Patients are selected for prophylactic treatment based on factors known to increase the risk of developing clinical conditions compared to the general population. In some embodiments, milbexian is used for preoperative thromboprophylaxis of VTE in patients undergoing surgery. In some embodiments, milbexian is used for post-operative thromboprophylaxis of VTE in patients undergoing surgery.

[0026] As used herein, the term "therapeutically effective amount" is intended to include the amount of mirbexian, or a therapeutically effective salt or solvate thereof, that is effective when administered alone to inhibit factor XIa and / or plasma kallikrein and / or prevent or treat the disorders listed herein. In an embodiment, a therapeutically effective amount is intended to include the amount of mirbexian, or a therapeutically effective salt thereof, that is effective when administered alone to inhibit factor XIa and / or plasma kallikrein and / or prevent or treat the disorders listed herein. In an embodiment, a therapeutically effective amount of mirbexian is clinically proven to be effective in reducing the incidence of total VTE events in patients during treatment. In an embodiment, a therapeutically effective amount of mirbexian includes a therapeutically effective solvate of mirbexian, such as an acetone monosolvate.

[0027] The term "thrombosis" as used herein refers to the formation or presence of a thrombus; the formation of a thrombus in a blood vessel that can cause ischemia or infarction of tissue supplied by the vessel. The term "embolism" as used herein refers to the sudden blockage of an artery by a thrombus or foreign body that has been carried along the bloodstream to its placement site. The term "thromboembolism" as used herein refers to the obstruction of a blood vessel with thrombotic material that has been carried along the bloodstream from its site of origin to plug another blood vessel. The term "thromboembolic disorder" encompasses both "thrombotic" and "embolic" disorders.

[0028] The term "thromboembolic disorder" as used herein also includes, but is not limited to, specific disorders selected from atherosclerosis, atherothrombosis, peripheral occlusive arterial disease, venous thrombosis, venous thromboembolism (VTE), deep vein thrombosis, thrombophlebitis, coronary artery thrombosis, renal embolism, pulmonary embolism, and thrombosis resulting from medical implants, devices, or procedures in which blood is exposed to artificial surfaces that promote thrombosis.

[0029] In some embodiments, "thromboembolic disorder" includes, but is not limited to, specific disorders selected from atherosclerosis, peripheral occlusive arterial disease, venous thrombosis, venous thromboembolism (VTE), deep vein thrombosis, thrombophlebitis, coronary artery thrombosis, renal embolism, pulmonary embolism, and thrombosis resulting from medical implants, devices, or procedures in which blood is exposed to artificial surfaces that promote thrombosis.

[0030] In another embodiment, the term "thromboembolic disorder" includes venous thromboembolism, deep vein thrombosis (DVT), proximal and / or distal DVT, symptomatic proximal and / or distal DVT, asymptomatic proximal and / or distal DVT, or pulmonary embolism.

[0031] In some embodiments, milbexian is used for primary prevention of VTE in patients undergoing surgery. In some embodiments, milbexian is used for preoperative thromboprophylaxis of VTE in patients undergoing surgery.

[0032] In some embodiments, the present disclosure is directed to a method of treating or preventing a venous thromboembolic disorder, comprising orally administering to a patient in need thereof a clinically effective amount of mirbexian or a pharma- ceutically acceptable salt thereof. In some embodiments, the clinically effective amount of mirbexian or a pharma- ceutically acceptable salt thereof may be a total daily dose of 25 mg to 400 mg. In other embodiments, the clinically effective amount may be a total daily dose of 50 mg to 400 mg.

[0033] In some embodiments, the present disclosure is directed to a method of treating or preventing a venous thromboembolic disorder, comprising orally administering to a patient in need thereof a total daily dose of 25 mg to 400 mg of mirbexian or a pharma- ceutical acceptable salt thereof, in other embodiments, the total daily dose is 50 mg to 400 mg of mirbexian or a pharma-ceutical acceptable salt thereof.

[0034] In some embodiments, the method of the present disclosure is directed to treating or preventing venous thromboembolic disorder.In some embodiments, the venous thromboembolic disorder is complex asymptomatic deep vein thrombosis, confirmed symptomatic venous thromboembolism (symptomatic deep vein thrombosis of the leg or non-fatal pulmonary embolism), or death.

[0035] In other embodiments, the venous thromboembolic disorder is proximal deep vein thrombosis (symptomatic or asymptomatic), distal deep vein thrombosis (symptomatic or asymptomatic), non-fatal pulmonary embolism, or death.

[0036] In other embodiments, the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis, non-fatal pulmonary embolism, or death.

[0037] In other embodiments, the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis.

[0038] In another embodiment, the venous thromboembolic disorder is non-fatal pulmonary embolism.

[0039] In another embodiment, the venous thromboembolic disorder is death.

[0040] In some embodiments, the present disclosure is directed to a method of preventing post-operative venous thromboembolic events in a patient recovering from surgery, comprising administering to the patient a daily dose of milbexian or a pharma- ceutical acceptable salt thereof, which administration causes the patient to experience fewer post-operative venous thromboembolic events than would result from administering 40 mg / day of enoxaparin subcutaneously to the patient.

[0041] In some embodiments of such method, the patient is at risk of experiencing postoperative venous thromboembolic events, such as the above-mentioned venous thromboembolic disorders.In some embodiments, the patient is recovering from a surgical operation.In some embodiments, the patient is recovering from abdominal surgery, knee replacement, or hip replacement.

[0042] In such methods, the patient may be administered milbexian or a pharma- ceutically acceptable salt thereof either immediately prior to undergoing the surgical procedure or immediately following the surgical procedure.

[0043] In some embodiments of these methods, the patient experiences fewer postoperative venous thromboembolic events than would result from administering 40 mg / day of enoxaparin subcutaneously to the patient, i.e., the risk of the patient experiencing a postoperative venous thromboembolic event is lower when milbexian or a pharma- ceutically acceptable salt thereof is administered to the patient than when 40 mg of enoxaparin is administered subcutaneously to the patient.

[0044] In some embodiments of these methods, the risk ratio is 0.6 or less, e.g., 0.55 or less, 0.5 or less, 0.45 or less, 0.4 or less, 0.35 or less, or 0.3 or less, i.e., in such methods, the patient's risk of experiencing a postoperative venous thromboembolic event is 0.6 or less than the risk the patient would experience if 40 mg of enoxaparin was administered subcutaneously to the patient.

[0045] In some aspects, the present disclosure is directed to a method of treating or preventing thrombosis resulting from a medical implant, device or procedure in which blood is exposed to an artificial surface that promotes clot formation, comprising administering to a patient a therapeutically effective amount of milbexian or a pharma- ceutical acceptable salt thereof.

[0046] In some embodiments, the disclosure provides a method of treating or preventing a venous thromboembolic disorder comprising orally administering milbexian or a pharma- ceutical acceptable salt thereof to a patient in need thereof once or twice daily, wherein the incidence of total venous thromboembolic events in patients treated with milbexian or a pharma- ceutical acceptable salt thereof is less than 25% with an alpha of 5%.

[0047] In some embodiments, in any of the methods described herein, treatment with milbexian in a patient in need thereof causes a statistically significant reduction in total VTE events (p<0.0001 (one-sided)) compared to the incidence of total VTE with enoxaparin.

[0048] In some embodiments, in any of the methods described herein, treatment with milbexian in a patient in need thereof prevents the occurrence of all VTE events in a dose-dependent response manner, with the incidence of all VTE events being statistically less than 30% with an alpha of 5%, where the all VTE events include proximal and / or distal DVT (deep vein thrombosis confirmed as asymptomatic by venographic evaluation or objectively confirmed as symptomatic), non-fatal PE, or any death during the treatment period.

[0049] In other embodiments, any of the methods described herein have a statistically lower incidence of overall VTE events in patients than 25%, with an alpha of 5%.

[0050] In other embodiments, any of the methods described herein have a statistically lower incidence of overall VTE events in a patient than 20%, with an alpha of 5%.

[0051] In other embodiments, any of the methods described herein have a statistically lower incidence of overall VTE events in the patient than 15%, with an alpha of 5%.

[0052] In other embodiments, any of the methods described herein have a statistically lower incidence of overall VTE events in a patient than 10%, with an alpha of 5%.

[0053] In some embodiments, the disclosure provides a method of treating or preventing a venous thromboembolic disorder comprising orally administering a therapeutically effective amount of milbexian or a pharmacologic acceptable salt thereof once or twice daily to a patient in need thereof, wherein the incidence of total venous thromboembolic events in patients treated with milbexian or a pharmacologic acceptable salt thereof is less than 25% in a modified intention to treat (ITT) population with a one-sided alpha of 5% and CI=95%.

[0054] In some embodiments, in any of the methods described herein, treatment with milbexian in a patient in need thereof causes a statistically significant reduction in total VTE events (p<0.0001 (one-sided)) compared to the incidence of total VTE with enoxaparin.

[0055] In some embodiments, in any of the methods described herein, treatment with milbexian in a patient in need thereof prevents the occurrence of all VTE events in a dose-dependent, responsive manner, with the occurrence of all VTE events being statistically lower than 30% in a modified intention-to-treat population with a one-sided alpha of 5% and CI=95% (CI means confidence interval of incidence), where the occurrence of all VTE events includes proximal and / or distal DVT (confirmed asymptomatic by venographic evaluation or objectively confirmed as symptomatic), non-fatal PE, or any death during the treatment period.

[0056] In other embodiments, in any of the methods described herein, the occurrence of all VTE events in patients is statistically lower than 25% with a one-sided alpha of 5% and CI=95% in the modified intention to treat population.

[0057] In other embodiments, in any of the methods described herein, the incidence of all VTE events in patients is statistically lower than 20% with a one-sided alpha of 5% and CI=95% in the modified intention to treat population.

[0058] In other embodiments, in any of the methods described herein, the incidence of all VTE events in patients is statistically lower than 15% with a one-sided alpha of 5% and CI=95% in the modified intention to treat population.

[0059] In other embodiments, in any of the methods described herein, the incidence of all VTE events in patients is statistically lower than 10% with a one-sided alpha of 5% and CI=95% in the modified intention to treat population.

[0060] As used herein, the term "intention-to-treat population" (ITT population) refers to all randomized subjects who signed informed consent in a clinical trial, such as described in Example 1 below. As used herein, the term "modified intention-to-treat population" (mITT-CEC assessment population) refers to a subset of the ITT population consisting of subjects who have received a valid assessment of a potential efficacy endpoint and have taken at least one dose of the study drug milbexian in a clinical study, such as described in Example 1 below.

[0061] In some embodiments of the methods disclosed herein, the therapeutically effective amount of milbexian or a pharma- ceutical acceptable salt thereof is an amount clinically proven effective to achieve an incidence of total venous thromboembolic events of less than 25% in patients treated with milbexian or a pharma- ceutical acceptable salt thereof.

[0062] In some embodiments, an amount of 50 mg to 400 mg of milbexian or a pharma- ceutical acceptable salt thereof has been clinically proven effective in eliciting a statistically significant reduction (p<0.0001, one-sided) in total VTE events compared to the incidence of all VTE events with enoxaparin.

[0063] In some embodiments of the disclosed methods, milbexian, or a pharma- ceutically acceptable salt thereof, is orally administered to the patient.

[0064] The dosage of milbexian or a pharma- ceutically acceptable salt thereof may be administered in any suitable oral dosage form, formulation or pharmaceutical preparation, such as, for example, tablets, capsules (including capsules containing sustained or timed release formulations), pills, powders, granules, elixirs, tinctures, suspensions, syrups, and emulsions.

[0065] In some embodiments, the administered dose of milbexian or its pharma- ceutically acceptable salt may be formulated as an immediate release formulation. In some embodiments, the administered dose of milbexian may be formulated as an immediate release capsule formulation. In some embodiments, the administered dose of milbexian may be formulated as an amorphous solid dispersion composition of milbexian in one or more polymers. In some embodiments, the polymer in the amorphous solid dispersion is hypromellose acetate succinate (HPMCAS). In some embodiments, the amorphous solid dispersion composition of milbexian in one or more polymers is prepared by spray drying. In some embodiments, the amorphous solid dispersion composition of milbexian in one or more polymers includes those in which milbexian is molecularly dispersed in one or more polymers.

[0066] In some embodiments of the disclosed methods, the patient to whom milbexian or a pharma- ceutically acceptable salt thereof is administered is a mammal. In some embodiments, the patient is a human. In other embodiments, the patient is a male. The patient is a female. In some embodiments, the patient is a human 50 years of age or older. In other embodiments, the patient is a human less than 50 years of age. In some embodiments, the patient is a human less than 18 years of age.

[0067] In some embodiments of the disclosed methods, the patient is administered milbexian or a pharma- ceutical acceptable salt thereof.

[0068] In some embodiments, the patient is administered milbexian.

[0069] In other embodiments, the patient is administered a pharma- ceutically acceptable salt of milbexian.

[0070] As used herein, "pharmaceutical acceptable salt" refers to a derivative in which a compound is modified by making its acid or base salt. Examples of pharmaceutical acceptable salts include, but are not limited to, inorganic or organic acid salts of basic groups such as amines; alkali or organic salts of acidic groups such as carboxylic acids. Pharmaceutically acceptable salts include, for example, conventional non-toxic salts or quaternary ammonium salts of the parent compound formed from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include salts derived from inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid; and salts prepared from organic acids such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, and isethionic acid. Pharmaceutically acceptable salts of milbexian can be synthesized using conventional chemical methods. Generally, such salts can be prepared by reacting milbexian with a stoichiometric amount of an appropriate base or acid in water or an organic solvent, or in a mixture of the two; generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts can be found in Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Company, Easton, Pa. (1990), the disclosure of which is incorporated herein by reference.

[0071] In the disclosed method embodiment where a pharmacologic acceptable salt of mirbexian is administered, the specified amount is based on mirbexian. That is, an amount of pharmacologic acceptable salt containing a specified amount of mirbexian is administered. For example, administering 50 mg of mirbexian or its pharmacologic acceptable salt refers to administering either 50 mg of mirbexian or an amount of pharmacologic acceptable salt of mirbexian that contains 50 mg of mirbexian.

[0072] In some embodiments of the disclosed methods, the patient is administered a total daily dose of 50 mg to 400 mg of milbexian or a pharma- ceutical acceptable salt thereof.

[0073] As used herein, the term "total daily dose" refers to the total amount of milbexian administered in a day.Thus, the total daily dose represents the cumulative amount administered in every dosing episode on a given day.For example, if on a given day, a patient is administered 25 mg of milbexian in each of two dosing episodes, then the total daily dose for that day is 50 mg.

[0074] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutical acceptable salt thereof, is administered such that the total daily dose is administered in a single dose.

[0075] In some embodiments, the once daily dose may be administered to a patient about once every 18-30 hours, about once every 20-28 hours, about once every 22-26 hours, or about once every 23-25 ​​hours.

[0076] In other embodiments, the once daily dose may be administered to a patient about once every 20 hours, about once every 21 hours, about once every 22 hours, about once every 23 hours, about once every 24 hours, about once every 25 hours, about once every 26 hours, about once every 27 hours, or about once every 28 hours.

[0077] In other embodiments, in any of the methods described herein, milbexian, or a pharma- ceutical acceptable salt thereof, is administered such that the total daily dose is administered in divided doses.

[0078] In other embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered such that the total daily dose is administered in two doses.

[0079] In some embodiments where the total daily dose is administered in two doses, the doses may be administered to the patient about once every 8-16 hours, about once every 9-15 hours, about once every 10-14 hours, or about once every 11-13 hours.

[0080] In some embodiments where the total daily dose is administered in two doses, the dose may be administered about once every 10 hours, about once every 10 hours, about once every 10 hours, about once every 10 hours, about once every 10.5 hours, about once every 11 hours, about once every 11.5 hours, about once every 12 hours, about once every 12.5 hours, about once every 13 hours, about once every 13.5 hours, or about once every 14 hours.

[0081] In other embodiments, in any of the methods described herein, milbexian, or a pharma- ceutical acceptable salt thereof, is administered in more than two doses total daily.

[0082] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, may be administered to a patient once or twice daily for at least 10 consecutive days.

[0083] In other embodiments of any of the methods described herein, milbexian or a pharma- ceutically acceptable salt thereof may be administered to the patient once or twice daily for at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 30 days, at least 6 months, at least 1 year, or at least 5 years.

[0084] In embodiments in which milbexian or a pharma- ceutical acceptable salt thereof is administered to prevent total venous thromboembolic events (VTE) in a patient undergoing knee or hip replacement surgery, it may be administered to the patient once or twice daily for at least 10 consecutive days, at least 11 consecutive days, at least 12 consecutive days, at least 13 consecutive days, or at least 14 consecutive days.

[0085] In some embodiments, in any of the methods described herein, milbexian or a pharma- ceutical acceptable salt thereof is administered at a dose of, for example, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205 , 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, or 400 mg.

[0086] In some embodiments, in any of the methods described herein, milbexian or a pharma- ceutical acceptable salt thereof is administered at a dose of, for example, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 320, 330, 340, 350, 360, 370, 385, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 495, 500, 505, 510, 520, 530, 540, 550, 560, 570, 580, 595, 600, 610, 620, 630, 640, 650, 660, 670, 685, 690, 705, 710, 720, 730, and / or 400 mg.

[0087] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered at a total daily dose selected from the group consisting of 50 mg, 100 mg, 200 mg, and 400 mg.

[0088] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of 25 mg.

[0089] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of 50 mg.

[0090] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of at least 50 mg.

[0091] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of 100 mg.

[0092] In certain embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of at least 100 mg.

[0093] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of 200 mg.

[0094] In certain embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of at least 200 mg.

[0095] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of 400 mg.

[0096] In some embodiments, in any of the methods described herein, milbexian, or a pharma- ceutically acceptable salt thereof, is administered in a total daily dose of at least 400 mg.

[0097] In some embodiments of the methods described herein, there is no dose-dependent response between milbexian and the occurrence of any bleeding event endpoint during the 10-14 day treatment period.

[0098] In some embodiments of any of the methods described herein, administration of milbexian or a pharma- ceutical acceptable salt thereof to a patient does not increase the patient's incidence of bleeding, e.g., does not increase the patient's incidence of bleeding by more than 1%, more than 2%, more than 3%, more than 4%, more than 5%, more than 6%, more than 7%, or more than 8%.

[0099] In some embodiments of any of the methods of treating or preventing a thromboembolic disorder described herein, administration of milbexian or a pharma- ceutical acceptable salt thereof to a patient does not increase the incidence of major bleeding in the patient by more than 0.5%, 0.75%, 1%, 1.25%, or 1.5%.

[0100] When referring to either an amount of milbexian (or a pharma- ceutically acceptable salt thereof), or a time interval over which milbexian (or a pharma- ceutically acceptable salt thereof) is administered, it will be understood that the use of approximation or about may be an amount or time interval that is within 5% (more or less), within 10% (more or less), within 12.5% ​​(more or less), within 15% (more or less), within 17.5% (more or less), or within 20% (more or less) of any particular amount or time interval.

[0101] The present disclosure also relates to the following aspects: Aspect 1. A method of treating or preventing a venous thromboembolic disorder, comprising orally administering to a patient in need thereof a total daily dose of 25 mg to 400 mg of milbexian, or a pharma- ceutically acceptable salt thereof; Aspect 2. The method of aspect 1, wherein the total daily dose is 50 mg to 400 mg; Aspect 3. The method of aspect 1, wherein the total daily dose is 25 mg; Embodiment 4. The method of embodiment 1, wherein the total daily dose is 50 mg; Embodiment 5. The method of embodiment 1, wherein the total daily dose is 100 mg; Embodiment 6. The method of embodiment 1, wherein the total daily dose is 150 mg; Embodiment 7. The method of embodiment 1, wherein the total daily dose is 200 mg; Embodiment 8. The method of any one of embodiments 1 to 7, wherein the total daily dose is administered in a single dose; Embodiment 9. The method of any one of embodiments 1 to 7, wherein the total daily dose is administered in divided doses; Embodiment 10. The method of embodiment 9, wherein the total daily dose is administered in two doses; Embodiment 11. The method of any one of embodiments 1 to 10, wherein the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis, non-fatal pulmonary embolism, or death; 12. The method of claim 11, wherein the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis; 13. The method of claim 11, wherein the venous thromboembolic disorder is non-fatal pulmonary embolism; 14. The method of claim 11, wherein the venous thromboembolic disorder is death; Embodiment 15. A method for preventing postoperative venous thromboembolic events in a patient recovering from surgery, comprising administering to the patient a daily dosage of milbexian or a pharma- ceutical acceptable salt thereof, wherein said administration results in the patient experiencing fewer postoperative venous thromboembolic events than would result from administering 40 mg of enoxaparin subcutaneously to the patient per day; Aspect 16. The method of aspect 15, wherein the patient is recovering from abdominal surgery, knee replacement, or hip replacement; 17. The method of claim 15 or 16, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 50 mg; 18. The method of claim 15 or 16, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 100 mg; 19. The method of claim 15 or 16, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 150 mg; 20. The method of claim 15 or 16, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 200 mg; 21. The method of any one of 15 to 20, wherein the daily dosage of milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a single dose; 22. The method of any one of 15 to 20, wherein the daily dosage of milbexian, or a pharma- ceutical acceptable salt thereof, is administered in divided doses; Aspect 23. A method for treating or preventing a venous thromboembolic disorder comprising orally administering a therapeutically effective amount of mirbexian or a pharmacologic acceptable salt thereof once or twice daily to a patient in need thereof, wherein the incidence of total venous thromboembolic events in patients treated with mirbexian or a pharmacologic acceptable salt thereof is less than 25% and has an alpha of 5%; Embodiment 24. The method of embodiment 23, wherein the incidence of total venous thromboembolic events is less than 20%; Embodiment 25. The method of embodiment 23, wherein the incidence of total venous thromboembolic events is less than 15%; Embodiment 26. The method of embodiment 23, wherein the incidence of total venous thromboembolic events is less than 10%; 27. The method of claim 23, wherein milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a total daily dose ranging from 50 mg to 400 mg; 28. The method of claim 23, wherein milbexian or a pharma- ceutically acceptable salt thereof is administered at a total daily dose selected from the group consisting of 50 mg, 100 mg, 200 mg, and 400 mg; 29. The method of claim 23, wherein milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a total daily dose of 50 mg; 30. The method of claim 23, wherein milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a total daily dose of 100 mg; 31. The method of claim 23, wherein milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a total daily dose of 150 mg; 32. The method of claim 23, wherein milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a total daily dose of 200 mg; 33. The method of claim 23, wherein milbexian, or a pharma- ceutical acceptable salt thereof, is administered in a total daily dose of 400 mg; 34. The method of any one of 23 to 33, wherein milbexian is administered twice daily; 35. The method of any one of 23 to 33, wherein milbexian is administered once a day; Embodiment 36. The method of any one of embodiments 23 to 35, wherein the incidence of venous thromboembolism occurs in a dose-dependent manner without increasing the risk of bleeding compared to enoxaparin; Embodiment 37. The method of any one of embodiments 23 to 36, wherein the therapeutically effective amount has been clinically proven effective to reduce the incidence of total venous thromboembolic events to less than 25% in patients treated with milbexian or a pharma- ceutical acceptable salt thereof; Aspect 38. Use of an oral dosage form of mirbexian, or a pharma- ceutical acceptable salt thereof, in the manufacture of a medicament for treating or preventing a venous thromboembolic disorder by orally administering to a patient in need of such treatment or prevention a total daily dose of 25 mg to 400 mg of mirbexian, or a pharma-ceutical acceptable salt thereof. Aspect 39. The use according to Aspect 38, wherein the total daily dose is 50 mg to 400 mg. Embodiment 40. The use according to embodiment 38, wherein the total daily dose is 25 mg; Embodiment 41. The use according to embodiment 38, wherein the total daily dose is 50 mg; 42. The use of claim 38, wherein the total daily dose is 100 mg; 43. The use according to claim 38, wherein the total daily dose is 150 mg; Embodiment 44. The use according to embodiment 38, wherein the total daily dose is 200 mg; Embodiment 45. The use according to any one of embodiments 38 to 44, wherein the total daily dose is administered in a single dose; Embodiment 46. The use according to any one of embodiments 38 to 44, wherein the total daily dose is administered in divided doses; Embodiment 47. The use according to embodiment 46, wherein the total daily dose is administered in two doses; Embodiment 48. The use according to any one of embodiments 38 to 47, wherein the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis, non-fatal pulmonary embolism, or death; Embodiment 49. The use according to embodiment 48, wherein the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis; Embodiment 50. The use according to embodiment 48, wherein the venous thromboembolic disorder is non-fatal pulmonary embolism; 51. The use of claim 48, wherein the venous thromboembolic disorder is death; Aspect 52. The use of an oral dosage form of milbexian, or a pharma- ceutical acceptable salt thereof, in the manufacture of a medicament for preventing postoperative venous thromboembolic events in a patient recovering from surgery, wherein administering the medicament to the patient results in the patient experiencing fewer postoperative venous thromboembolic events than would be achieved by administering 40 mg of enoxaparin subcutaneously to the patient per day; 53. The use of claim 52, wherein the patient is recovering from abdominal surgery, knee replacement, or hip replacement; 54. The use according to claim 52 or 53, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 50 mg; 55. The use according to claim 52 or 53, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 100 mg; 56. The use according to claim 52 or 53, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 150 mg; 57. The use according to claim 52 or 53, wherein the daily dosage of milbexian or a pharma- ceutical acceptable salt thereof is 200 mg; Embodiment 58. The use according to any one of embodiments 52 to 57, wherein the daily dosage of milbexian or a pharma- ceutically acceptable salt thereof is administered in a single dose; Embodiment 59. The use according to any one of embodiments 52 to 57, wherein the daily dosage of milbexian or a pharma- ceutically acceptable salt thereof is administered in divided doses; Aspect 60. Use of a solid dosage form of milbexian, or a pharma- ceutical acceptable salt thereof, for the manufacture of a medicament suitable for administration once or twice daily to a patient for treating or preventing a venous thromboembolic disorder, wherein said administration results in an overall venous thromboembolic event rate of less than 25% and an alpha of 5%; Embodiment 61. The use according to embodiment 60, wherein the incidence of total venous thromboembolic events is less than 20%; Embodiment 62. The use of embodiment 60, wherein the incidence of total venous thromboembolic events is less than 15%; Embodiment 63. The use according to embodiment 60, wherein the incidence of total venous thromboembolic events is less than 10%; 64. The use according to claim 60, wherein milbexian or a pharma- ceutical acceptable salt thereof is administered in a total daily dose ranging from 50 mg to 400 mg; 65. The use according to claim 60, wherein milbexian or a pharma- ceutically acceptable salt thereof is administered in a total daily dose selected from the group consisting of 50 mg, 100 mg, 200 mg, and 400 mg; 66. The use according to claim 60, wherein milbexian or a pharma- ceutically acceptable salt thereof is administered in a total daily dose of 50 mg; 67. The use of embodiment 60, wherein milbexian or a pharma- ceutically acceptable salt thereof is administered in a total daily dose of 100 mg; 68. The use according to embodiment 60, wherein milbexian or a pharma- ceutically acceptable salt thereof is administered in a total daily dose of 150 mg; 69. The use according to claim 60, wherein milbexian or a pharma- ceutically acceptable salt thereof is administered in a total daily dose of 200 mg; Embodiment 70. The use according to embodiment 60, wherein milbexian or a pharma- ceutical acceptable salt thereof is administered in a total daily dose of 400 mg; Embodiment 71. The use according to any one of embodiments 60 to 70, wherein milbexian is administered twice a day; Embodiment 72. The use according to any one of embodiments 60 to 70, wherein milbexian is administered once a day; Embodiment 73. The use according to any one of embodiments 60 to 72, wherein the incidence of venous thromboembolism occurs in a dose-dependent manner without increasing the risk of bleeding compared to enoxaparin; Embodiment 74. The use according to any one of embodiments 60 to 73, wherein the therapeutically effective amount has been clinically proven to be effective in reducing the incidence of total venous thromboembolic events to less than 25% in patients treated with milbexian or a pharma- ceutical acceptable salt thereof; is directed towards.

[0102] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the embodiments described herein.

[0103] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference herein.

[0104] Working Example Example 1 The following study of Milbexian versus subcutaneous enoxaparin was conducted in participants undergoing elective knee arthroplasty.

[0105] This was a randomized, open-label, investigational drug-dose blinded, multicenter study evaluating the efficacy and safety of milbexian, an oral factor XIa inhibitor, versus subcutaneous enoxaparin in subjects undergoing elective total knee arthroplasty.

[0106] The objective of this study was to determine the efficacy of milbexian in the overall incidence of venous thromboembolism (VTE) events (proximal and / or distal deep vein thrombosis [DVT] [asymptomatic confirmed by venographic evaluation or objectively confirmed symptomatic deep vein thrombosis], nonfatal pulmonary embolism [PE], or any death) during the treatment period. [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9] [Table 10] [Table 11] [Table 12] [Table 13]

[0107] This was a dose-guided study of mirbexian, a direct-acting factor XIa inhibitor. The objective of the study was to evaluate the safety, tolerability, and efficacy of mirbexian at different oral doses (twice a day (BID or bid) and once a day (QD or qd)) compared with 40 mg subcutaneous enoxaparin in the prevention of venous thromboembolism.

[0108] method This study was a phase 2, open-label, double-blind, randomized, active-controlled, multicenter, dose-ranging study of milbexian in subjects undergoing primary elective unilateral total knee replacement (TKR) surgery. The study used a prospective, randomized, open-label, blinded endpoint (PROBE) design.

[0109] A total of 1242 subjects were randomized. Patients were randomly assigned to treatment groups containing either mirbexian or enoxaparin. Subject characteristics in the mirbexian and enoxaparin groups were balanced and typical for subjects in similar studies.

[0110] There were a total of eight treatment arms over the course of the study: four milbexian BID dosing regimens ranging from 25 to 200 mg BID, three milbexian once-daily dosing regimens at 25, 50, and 200 mg, and a 40 mg enoxaparin once-daily control arm. The four milbexian BID dosing regimens, and the 200 mg milbexian once-daily arm, continued without interruption, allowing randomization of 150 subjects in each arm. The enoxaparin control arm likewise completed its pre-specified randomization with 300 subjects. The milbexian 25 mg once-daily dosing regimen was paused by the open-label Operations Committee (OC), responsible for reviewing ongoing safety and efficacy data by subject treatment assignment approximately every 3 to 8 weeks, during the ad hoc interim analysis (IA); enoxaparin 25 mg once-daily treatment arm was censored in 34 subjects. At this point, an amendment was made to the protocol to start with a regimen of milbexian 50 mg once daily. Under subsequent OC recommendations, the randomization ratio was modified to include the milbexian 50 mg once daily group, allowing for a complete randomization of 150 subjects. Figure 1 provides the study design, including the number of subjects randomly assigned to each study group.

[0111] The study consisted of three phases: a screening phase up to 30 days before TKR surgery, a treatment phase 10-14 days after surgery (mean duration of treatment in the co-treatment group was 11.7 days), and a 4-week follow-up phase. The first dose of milbexian was administered 12-24 hours after surgery, defined as the start of wound closure.

[0112] patient Patients undergoing elective unilateral total knee arthroplasty were eligible if they were 50 years of age or older, scheduled to undergo elective primary unilateral TKR surgery, medically stable, and an appropriate candidate for anticoagulant prophylaxis based on clinical laboratory tests performed as part of the local standard of care as part of screening for elective TKR surgery. Major exclusion criteria were contraindications to enoxaparin (e.g., creatinine clearance <30 mL / min), severe hepatic dysfunction or history of prior venous thromboembolism, need for chronic antithrombotic therapy other than aspirin (≤100 mg / day), or inability to undergo venography.

[0113] Randomization and study treatment An adaptive design was used to optimize patient recruitment for dose-response evaluation. The number of dose regimens, the option to implement additional once-daily dosing regimens, and the randomization ratio were based on the results of regular reviews and interim analyses. Eligible patients were initially randomly assigned in a 1:1:1:1:1:1:2 ratio to one of seven parallel treatment groups (four groups receiving a twice-daily milbexian regimen (25 mg, 50 mg, 100 mg, or 200 mg), two groups receiving a once-daily milbexian regimen (25 mg or 200 mg), and one group receiving enoxaparin) (Figure 1). Randomization was performed postoperatively using a centralized interactive web-based response system and stratified by geographical region of the study center.

[0114] Oral administration of milbexian or a matching placebo was started 12 to 24 hours after surgery. Enoxaparin was administered subcutaneously at a dose of 40 mg once daily and was started either the evening before surgery or 12 to 24 hours after surgery. Treatment with milbexian or enoxaparin was continued for 10 to 14 days after surgery.

[0115] Study endpoints The primary efficacy outcome was venous thromboembolism, defined as composite asymptomatic deep vein thrombosis (detected by mandatory unilateral venography performed 10 to 14 days after surgery), confirmed symptomatic venous thromboembolism (symptomatic deep vein thrombosis of the legs or nonfatal pulmonary embolism), or death. In patients undergoing unilateral knee arthroplasty, unilateral venography performed on only the operated leg detects more than 90% of deep vein thrombosis and reduces the patient's risk (Buller et al., Factor XI antisense oligonucleotide for prevention of venous thrombosis. N Engl J Med 2015;372:232-40; Fuji et al., A dose-ranging study evaluating the oral factor Xa inhibitor edoxaban for the prevention of thromboembolism in patients undergoing total knee arthroplasty. J Thromb Haemost 2010;8:2458-68).

[0116] The main secondary efficacy outcomes were (a) proximal deep vein thrombosis (symptomatic or asymptomatic), (b) distal deep vein thrombosis (symptomatic or asymptomatic), (c) nonfatal pulmonary embolism, and (d) death. The efficacy outcome investigated was the degree of venous thrombosis on venography, which was assessed by an adjudication committee using predefined categories.

[0117] The primary safety outcome was any bleeding, defined as composite major bleeding, clinically relevant nonmajor bleeding, and minimal bleeding. Secondary safety outcomes were (a) major bleeding, (b) clinically relevant nonmajor bleeding, (c) clinically relevant bleeding, defined as composite major bleeding and clinically relevant nonmajor bleeding, and (d) minimal bleeding. Bleeding was classified as major if it was overt and associated with a decrease in hemoglobin of ≥2 g / dL or required the infusion of ≥2 units of blood in a time-dependent manner within 24 to 48 hours of the bleed; or occurred in a critical area or organ or resulted in death. Bleeding at the surgical site was defined as major only if it required procedural intervention, caused hemodynamic instability, or resulted in hemarthrosis that delayed mobilization or wound healing, leading to prolonged hospitalization or deep wound infection. Overt bleeding that required consultation or intervention or had clinical consequences but did not meet the criteria for major bleeding was classified as clinically relevant nonmajor bleeding. Bleeding that did not meet the criteria for major or clinically relevant nonmajor bleeding was classified as minimal bleeding (Schulman et al., Definition of major bleeding in clinical investigations of antihemostatic medicinal products in surgical patients. J Thromb Haemost 2010;8:202-4).

[0118] Monitoring and Tracking Patients were evaluated at the time of randomization within 30 days prior to surgery, on postoperative days 1, 4, 7, and 10 to 14, and at 6 weeks (± 10 days). Patients were instructed to report any symptoms suggestive of venous thromboembolism or bleeding.

[0119] Laboratory Measurements Activated partial thromboplastin time and prothrombin time were measured in a central laboratory using Actin FS and Innovin, respectively (Siemens Healthcare, Tarrytown, NY). The ratio of activated partial thromboplastin time to prothrombin time was calculated by dividing the postoperative values ​​by those measured preoperatively. The primary efficacy endpoint focused on the twice-daily milbexian regimen, as milbexian is suitable for twice-daily administration and has a half-life of approximately 11 hours.

[0120] statistical analysis Proof of efficacy was defined as either a statistically significant dose-response or, for the BID arm combined with mirbexian, the incidence of the primary end point event was statistically lower than 30% with a 95% confidence interval (95% CI, one-sided alpha 5%) from the network meta-analysis. From the network meta-analysis data, the placebo incidence of all VTE was estimated to be 50% (95% CI, 40, 60). For research purposes, a more conservative incidence of 30% (upper 95% limit for enoxaparin in the network meta-analysis) was chosen.

[0121] The primary efficacy analysis was performed in the modified intention-to-treat population, including all patients who had received at least one dose of study drug and had an evaluable venogram, documented symptomatic venous thromboembolic event, or fatal event within a predefined time frame. The incidence of venous thromboembolism in the combined twice-daily dose group of mirbexian was compared to 30% using a binomial test. Evidence for a dose-response trend with the twice-daily mirbexian regimen was evaluated in the MCP-Mod framework using a predefined model (Pinheiro et al., Model-based dose finding under model uncertainty using general parametric models. Statistics in Medicine 2014;33:1646-61). To analyze the main secondary efficacy endpoints, the risk proportions of each group of mirbexian relative to enoxaparin and their corresponding confidence intervals were calculated using the Cochran-Mantel-Haenszel method using study area as a stratification factor.

[0122] Analyses of safety outcomes were performed in the safety population, which included all randomized patients who received at least one dose of study medication; time for analysis included the duration of treatment plus 2 days. For each bleeding outcome, the incidence in each milbexian group was compared to the incidence in the enoxaparin group using the same methods used to evaluate the secondary efficacy outcomes. Kaplan-Meier methods were used to evaluate the time to first bleeding event with either milbexian or enoxaparin.

[0123] result participants A total of 1242 subjects were randomized, all of whom were included in the ITT analysis set. Of the 1242 subjects, 1219 subjects (98.1%) received at least one dose of study drug and were therefore included in the safety analysis set. Additionally, 1048 subjects (84.4%) were included in the mITT-CEC (day 14) analysis set. In the ITT analysis set, 1230 subjects (99.0%) completed the study, and 12 subjects (1.0%) discontinued the study early (11 [0.9%] due to subject withdrawal and 1 [0.1%] due to death). In the safety analysis set, 1162 (95.3%) subjects completed study treatment, and 57 (4.7%) subjects discontinued study treatment prematurely (35 [2.9%] due to adverse events, 16 [1.3%] because the subject refused further study treatment, 1 [0.1%] because of death, and 5 [0.4%] for other reasons). As shown in Table 1, in the intention-to-treat analysis set, 366 (29.5%) subjects were male, and 1081 (87.5%) subjects were white. The mean (SD) age was 68.0 years (8.02 years), and the median age was 68.0 years. Demographic and baseline characteristics were balanced between groups. Baseline characteristics are shown in Figure 1 and Table 1. [Table 14] [Table 15] (i) Mean age was similar between the milbexane combination and enoxaparin (68.1 vs 67.8 years). (ii) Approximately two-thirds of the subjects > In the 65-year-old group, the response rate was 67.6% with the milbexane combination and 65.4% with enoxaparin. (iii) The majority of subjects were female, 71% in the milbexane combination and 69.1% in the enoxaparin combination. (iv) Mean BMI was similar between the milbexian combination (31.2 kg / m2) and enoxaparin (30.7 kg / m2). (v) The majority of subjects had a BMI of > The BMI was 30 kg / m2, 54.4% with milbexian and 49.5% with enoxaparin. > At 30 kg / m2, it was slightly higher at 62.0% and 60.8. (vi) The normal range of activated partial thromboplastin time is 22 to 29 seconds.

[0124] Efficacy - Prevention of all venous thromboembolic events (VTE) Evaluable venograms were obtained in 1047 of 1219 patients (86%) who received the study drug (Figure 1). This study provides conceptual proof that mirbexian is an effective antithrombotic agent. See, for example, Ting et al., Phase II clinical development of new drugs. pp. iv-v, 5-10 New York: Springer;2017. Mirbexian significantly reduced the incidence of venous thromboembolism after elective total knee arthroplasty in a dose-dependent manner in both twice-daily and once-daily regimens. Our data indicate that postoperative mirbexian provides effective thromboprophylaxis against venous thromboembolism.

[0125] Efficacy endpoints are provided in Table 2. In the twice-daily mirbexian group, the primary efficacy endpoint occurred in 27 (21.0%) of 129 patients, 14 (11.3%) of 124 patients, 12 (9.0%) of 134 patients, and 10 (7.6%) of 131 patients receiving 25 mg, 50 mg, 100 mg, or 200 mg of mirbexian (total daily mirbexian doses of 50 mg, 100 mg, 200 mg, and 400 mg), respectively (Table 2); the findings were consistent with a statistically significant dose-response (P=0.0004, one-sided). The primary efficacy endpoint occurred in 63 of 518 patients (12.2%) receiving milbexian twice daily; the incidence was significantly lower than the predefined benchmark of 30% (P<0.0001, one-sided). Thus, both criteria for demonstrating efficacy were met.

[0126] With the once-daily milbexian regimen, the dose-response for the primary efficacy endpoint was statistically significant (P = 0.0003, one-sided) (Table 2).

[0127] The primary objective of the study was to measure the efficacy of milbexian in preventing total VTE. Total VTE was defined as proximal and / or distal deep vein thrombosis ((DVT); asymptomatic confirmed by venographic evaluation or symptomatic confirmed objectively), nonfatal pulmonary embolism (PE), or any death during the 10-14 day treatment period. Proof of efficacy was defined as either a statistically significant dose-response or a statistically lower than 30% incidence of the primary endpoint event in the combined BID milbexian group. The study met this primary objective with a statistically significant reduction in total VTE compared to the pre-determined target of 30% (p<0.0001 (one-sided)) for the pooled BID milbexian dose regimen.

[0128] Of the 1242 subjects randomized into the study, 1048 (48%) had evaluable venograms performed to assess for the occurrence of VTE. In the "analysis set" of these 1048 subjects, for example, all VTE was reported in 108 (13%) of 796 subjects receiving mirbexian (combined mirbexian at all doses / dose regimens), 63 (12.2%) of 518 subjects receiving mirbexian in the BID dose regimen, and 54 (21.4%) of 252 subjects receiving enoxaparin (relative risk ratio for mirbexian combination vs. enoxaparin was 0.64 (95% CI 0.48-0.85); for mirbexian BID vs. enoxaparin, relative risk ratio was 0.57 (95% CI 0.41-0.79)). Table 2: Primary Efficacy Events and Components of Major VTE - Relative Risks and Confidence Intervals for Comparison Between Milbexian and Enoxaparin (Enox) The mITT was assessed by the CEC on day 14. [Table 16] Legend: RR = relative risk ratio; CI = 95% confidence interval of incidence; RR was calculated using the Cochran-Mantel-Haenszel method with region as a stratification factor; VTE = venous thromboembolism; DVT = deep vein thrombosis.

[0129] As shown in Figure 2 and Table 2, a statistically significant dose response for total VTE was seen across the four milbexian BID regimens (p=0.0004, one-sided) and the three once-daily regimens (p=0.0003, one-sided). The 50 mg, 100 mg, and 200 mg BID and 200 mg QD regimens produced statistically significant reductions in VTE relative to enoxaparin, whereas the 25 mg BID and 25 mg and 50 mg once-daily regimens behaved similarly to enoxaparin. Notably, none of the milbexian arms across the eight-fold range of daily doses was shown to be less effective than enoxaparin. Major VTE events were infrequent, occurring in four subjects (1.6%) in the enoxaparin group, one subject (0.8%) in the 25 mg BID milbexian group, one subject (0.8%) in the 50 mg BID milbexian group, two subjects (1.5%) in the 100 mg BID milbexian group, and two subjects (1.6%) in the 50 mg once daily milbexian group. Major VTE events (e.g., proximal DVT, PE, and death) were rare, so the majority of all VTE events were minor, e.g., distal DVT. See Table 3 below. Table 3: Total VTE events by event type per Clinical Event Committee through Day 14 [Table 17]

[0130] Overall, the dosing data indicate that the total daily dose (TDD) of milbexian is > At 100 mg, milbexian significantly reduced total VTE events when compared with enoxaparin, and the TDD of > At 200 mg, milbexian was found to significantly reduce total VTE by >50% when compared to enoxaparin. Milbexian demonstrated comparable VTE rates when compared to enoxaparin in the lowest completed dose groups (25 mg once daily, 50 mg once daily, and 25 mg BID).

[0131] Milbexian is > TDD at 100 mg not only significantly reduced the number of total VTE events when compared to enoxaparin, but also significantly reduced the severity of DVT, the factor that contributed most to the number of total VTE events, in subjects with DVT. Venograms assessed by independent blinded reviewers were used to identify subjects with DVT and to assign a DVT severity grade. To evaluate each venogram, 11 segments were assessed for the presence and extent of thrombus. When evaluating each segment, a severity grade was assigned depending on the presence of thrombus in the vein segment and, if present, the extent of the thrombus. Severity grades were assigned on a scale of 0 to 3, as follows: 0 = no thrombus; 1 = less than 1 / 3 of the length of the vein segment; 2 = 1 / 3 or more but less than 2 / 3; and 3 = greater than 2 / 3. As shown in Figure 3, TDD significantly reduced the severity of DVT. > The incidence of the most severe grade of a segment 3 in subjects treated with 100 mg milbexian (incidence of 0, 1.52, 2.73, and 0% in subjects treated with 50 mg BID, 100 mg BID, 200 mg BID, and 200 mg once daily milbexian, respectively) was less than half that of subjects treated with enoxaparin (incidence of 5.42%). Moreover, and surprisingly, the incidence of DVT with a severity rating of 3 was 0% in subjects treated with either 50 mg BID milbexian or 200 mg once daily milbexian. Overall, the mean severity rating of DVT subjects on venography was significantly lower than that of subjects treated with enoxaparin. > The decrease was 1.17 to 1.81 in subjects treated with milbexian at a TDD of 100 mg. See Figure 4.

[0132] Safety - Incidence of bleeding The key secondary objective of the study was to evaluate the dose-response trend of milbexian in the occurrence of any bleeding events during the treatment period. Any bleeding was defined as major bleeding according to the International Society on Thrombosis and Haemostasis (ISTH) criteria modified for complex surgical settings, clinically relevant nonmajor bleeding events as assessed by the Clinical Events Committee (CEC), or minimal bleeding events. The incidence of venous thromboembolism was significantly lower with milbexian at a dose of 100 mg daily than with enoxaparin. The incidence of any bleeding was 4.1% for both milbexian and enoxaparin, but the incidence of combined major and clinically relevant nonmajor bleeding was low, and no evidence of a dose response was found over a 16-fold range of total daily doses of milbexian from 25 mg to 400 mg. Thus, postoperative milbexian is effective in preventing venous thromboembolism and is associated with a low risk of clinically relevant bleeding.

[0133] Bleeding outcomes are shown in Table 4. The primary safety outcome, any bleeding, occurred in 38 of 923 patients (4.1%) receiving milbexian and 12 of 296 patients (4.1%) receiving enoxaparin. Most bleeding was in the lowest category and involved the surgical site. There were no major bleeding events with milbexian and one with enoxaparin. The incidence of clinically relevant nonmajor bleeding with milbexian and enoxaparin was 0.8% and 1.4%, respectively.

[0134] The incidence of any bleeding across the 8-fold dose range of Milvexian and for Enoxaparin was low, occurring in only 50 subjects. For the comparator Enoxaparin, the overall incidence of bleeding was less than half the expected incidence based on an internally conducted network meta-analysis (7.22% estimated vs. 4.1% observed); a network meta-analysis of published results for various anticoagulants in the setting of preventing VTE after TKR (Weitz et al., Milvexian for Prevention of Venous Thromboembolism. NEJM. 2021; Protocol). See Table 4. Table 4: Predicted event rates for total VTE, any bleeding, and major + CRNM bleeding by treatment using network meta-analysis [Table 18] *Any bleed was an ISTH major bleed, a clinically relevant non-major bleeding (CRNM) event, or a minimal bleeding event in the complex surgical setting.

[0135] With milbexian, any bleeding events ranged from 0% in subjects randomized to 25 mg once daily to 6.1% in subjects randomized to the 200 mg once daily regimen. With the administration of 25 mg once daily or BID, bleeding was uncommon (0% and 1.4% for once daily and BID, respectively). The incidence of any bleeding events increased with higher doses of milbexian from 4.7% (50 mg or 100 mg BID) to 6.1% (200 mg QD). However, there was no dose response when assessed by total daily dose administered. See Figure 5 and Table 5. Table 5: Relative risks and confidence intervals for comparing the primary safety endpoint and components of treatment major bleeding + CRNM and minimal bleeding events (CEC adjudication) between the milbexian and enoxaparin groups [Table 19] Legend: RR = relative risk ratio; CI = 95% confidence interval of incidence; RR was calculated using the Cochran-Mantel-Haenszel method with region as a stratification factor. Note: On-treatment period was defined as the first day of study medication up to the last dose + 2 days. Source output: TSFMOD02C

[0136] The incidence of ISTH major + CRNM bleeding across an 8-fold dose range of milbexian and for enoxaparin was lower than expected for a study of this size and duration, occurring in only 12 subjects in total, but providing a more clinically relevant and objective assessment of milbexian's bleeding profile. Major + CRNM bleeding was reported in five (1.7%) enoxaparin-treated subjects, approximately half the historical incidence of 3.55% in the VTE setting. There were no fatal bleeding events and only one major bleeding event in a subject who presented with a subdural hematoma while taking enoxaparin. Major + CRNM bleeding was reported in seven subjects (0.8%) treated with milbexian, resulting in incidence rates ranging from 0, 1.4%, 0.7%, 0.7%, 1.3%, and 0.7% for milbexian at 25, 50, 100, and 200 mg BID and 50 and 200 mg QD, respectively, i.e., 0.7% to 1.4%. There were no fatal or major bleeding events with milbexian, and it was not associated with any clear bleeding liability. The incidence of any bleeding was comparable between enoxaparin and milbexian (combination) in the three bleeding categories (major, CRNM, minimal bleeding) (Table 6). The CEC identified no major bleeding in the milbexian group (one with enoxaparin). The incidence of CRNM bleeding was higher with enoxaparin, but numerically low in both groups. The majority of bleeding was skin-related, with no trend toward increased bleeding in areas of high fibrinolytic activity (e.g., oral cavity, nose, and urinary tract) in the milbexian group. Numerously more minimal bleeding events were reported with milbexian (all combinations) than with enoxaparin. The higher incidence was due to cutaneous bleeding sites, most of which were reported around the surgical site. Table 6. Incidence and relative risks for comparing primary safety endpoints and components (CEC assessments) between the milbexian and enoxaparin groups; safety analysis set / treatment [Table 20]

[0137] Overall, there was no dose response in bleeding incidence in the milbexian group; no increased bleeding risk was observed with increasing doses, and bleeding incidence with milbexian was low and stable at all doses tested. This is in contrast to all approved anticoagulants, including direct-acting oral anticoagulants (DOACs) (e.g., apixaban, rivaroxaban, etc.), where bleeding rates increase with increasing exposure.

[0138] Milbexian treatment increased the activated partial thromboplastin time percentage in a dose-dependent manner, whereas enoxaparin had no apparent effect. No evidence of a dose-dependent increase in bleeding was observed with milbexian (Figure 6). Neither milbexian nor enoxaparin increased the prothrombin time percentage. The median activated partial thromboplastin time (aPTT) percentage and the rates of any bleeding and clinically relevant bleeding (defined as major bleeding and clinically relevant non-major bleeding) for various doses of milbexian and enoxaparin are shown in Figure 6. In the plot of activated partial thromboplastin time percentage, the center line indicates the median; the top and bottom edges of the box indicate the upper and lower limits of the interquartile range, respectively; the vertical lines at the top and bottom of the box indicate the upper and lower limits of the range, respectively. Squares indicate the incidence of any bleeding, whereas circles indicate the incidence of clinically relevant bleeding, combined major bleeding, and clinically relevant non-major bleeding. aPTT stands for activated partial thromboplastin time.

[0139] Example 2 Milbexian was evaluated to prevent and treat thrombus formation in an electrically induced carotid artery thrombosis (ECAT) rabbit study. The rabbit ECAT study was calibrated to clinical outcomes in apixaban-based VTE prophylaxis, where targeting the concentration resulting in a 50% reduction in thrombus weight was correlated with the steady-state trough concentration of the clinical dose of apixaban.

[0140] The ECAT experiment in rabbits, as described by Wong et al. in Nonpeptide factor Xa inhibitors:II. Antithrombotic evaluation in a rabbit model of electrically induced carotid artery thrombosis. J Pharmacol Exp Ther. 2000;295:212-8, was used in this study to evaluate the effects of vehicle and milbexian on carotid blood flow after thrombus induction.

[0141] Male New Zealand White rabbits were anesthetized with ketamine (50 mg / kg + 50 mg / kg / h i.m.) and xylazine (10 mg / kg + 10 mg / kg / h i.m.). Thrombus formation was induced by electrical stimulation of the control carotid artery at 4 mA for 3 min using an external stainless steel bipolar electrode. Carotid blood flow was measured continuously for 90 min using an electromagnetic flow probe to monitor thrombus-induced occlusion. Integrated carotid blood flow was measured as the area under the flow-time curve (see Wong et al.). In addition, thrombus from the arterial injury was removed and blotted twice on weighing paper to remove remaining fluid and weighed.

[0142] Compounds were administered by IV infusion to achieve stable plasma levels with minimal experimental variation. Thrombus formation was then electrically induced in the contralateral carotid artery using the same method as described above. In preventive ECAT experiments, milbexian or its vehicle was administered by bolus injection 30 minutes before vessel injury and supplemented by continuous IV infusion. In therapeutic ECAT experiments (see Wong PC et al., BMS-593214, an active site-directed factor VIIa inhibitor: enzyme kinetics, antithrombotic and antihaemostatic studies. Thromb Haemost. 2010;104:261-9), milbexian and vehicle were administered as described above 15 minutes after vessel injury. IV infusion was continued for the duration of the experiment in both experiments. The concentration of milbexian in plasma samples was measured by specific and sensitive liquid chromatography / mass spectrometry (LC / MS / MS).

[0143] In the prevention study, the milbexian groups consisted of vehicle (10% N,N-dimethylacetamide:25% PEG300:65% 5% dextrose) and milbexian (mg / kg+mg / kg / h) at 0.063+0.04, 0.25+0.17, and 1+0.67 (n=6 per group). In the treatment study, the milbexian groups consisted of vehicle (10% N,N-dimethylacetamide:25% PEG300:65% 5% dextrose; n=6) and milbexian (mg / kg+mg / kg / h) at 0.25+0.17, and 1+0.67 (n=6 per group).

[0144] In the prophylactic ECAT study, the plasma concentration of milbexian was measured 30 and 120 minutes after the start of the infusion. The mean plasma concentration of milbexian in each animal 30 and 120 minutes after the start of the infusion was then analyzed for concentration-response curves to determine the antithrombotic ECAT. 50(the concentration giving 50% of the maximal response). Integrated blood flow, clot weight, aPTT (activated partial thromboplastin time), TT (thrombin time) and PT (prothrombin time) were also measured. In the therapeutic ECAT study, only the plasma concentration of milbexian was measured at the end of the study.

[0145] FIG. 7 shows the effect of vehicle and milbexian on carotid blood flow after thrombus induction in a prophylactic ECAT rabbit study. After electrical current stimulation, thrombus formation was induced, blood flow was reduced to zero, and the artery was occluded in approximately 40-45 minutes in vehicle-treated animals. Milbexian was associated with a dose-dependent increase in carotid patency. FIG. 8 shows the effect of vehicle and milbexian on integrated blood flow in a prophylactic ECAT rabbit study. Integral blood flow after thrombus induction in vehicle-treated animals averaged 11±2%. By blocking thrombus formation, milbexian was associated with a dose-dependent increase in integrated blood flow. At the highest dose, integrated blood flow was 76±5% of control levels.

[0146] Milbexian was associated with a dose-dependent reduction in thrombus weight. At the highest dose, thrombus weight was reduced to 70±2% of control levels. Figure 9 shows the dose-response curve of milbexian in a prophylactic ECAT experiment. Milbexian had a 20% maximal effective concentration (EC) of 55 nM. 20 ) (95% confidence interval [CI] = 23-128), EC 50 (95%CI=250-561) and was associated with a concentration-dependent antithrombotic effect with a Hill slope of 0.7 (95%CI=0.4-1).

[0147] Figure 10 shows the ex vivo effects of mirbexian on aPTT, TT, and PT. Milbexian significantly increased aPTT at the two highest doses and did not significantly alter TT and PT, consistent with a mechanism of action of FXIa inhibition. Figure 11 shows a good correlation (r ) between the antithrombotic effect of mirbexian in rabbit ECAT and its ex vivo aPTT activity. 2= 0.83). Figure 11 also shows that aPTT had to be 1.6 times longer to achieve a 50% reduction in thrombus weight in this experiment.

[0148] Figure 12 shows the antithrombotic effect of vehicle and milbexian in therapeutic ECAT. After initiating thrombus formation, blood flow gradually decreased and reached the same level after 15 min among different groups. Administration of milbexian after 15 min improved the patency of the injured artery in a dose-dependent manner, with carotid blood flow after 90 min being on average 1 ± 0.3, 39 ± 10, and 66 ± 2%* in groups treated with vehicle and milbexian at 0.25 + 0.17 and 1 + 0.67 mg / kg ± mg / kg / h, respectively (*P < 0.05 vs vehicle; n = 6 / group, Figure 12). Also, doses of 0.25 + 0.17 and 1 + 0.67 mg / kg + mg / kg / h resulted in a significant dose-dependent reduction in thrombus weight of 25 ± 7, and 61 ± 6%, respectively (*P < 0.05; n = 6 / dose). Treatment of Milbexian EC in ECAT 50 was 1.06 μM (95% CI = 0.76-1.47), which is the EC obtained with prophylactic ECAT. 50 This was approximately 2.8 times higher than that in the control group (Figure 9).

[0149] In the rabbit ECAT experiment, milbexian dose-dependently induced both a reduction in thrombus weight (Figure 9) and maintenance of blood flow without a significant increase in bleeding time. 50 ) was 235 ng / mL (375 nM). Correcting for the difference in potency of human FXIa versus rabbit FXIa (milbexian is more potent than rabbit FXIa) and the difference in plasma protein binding between rabbit and human (protein binding is lower in human plasma than in rabbit plasma), a trough target concentration of 34.5 ng / mL (55 nM) of the human target is obtained.

[0150] Example 3 The rabbit ECAT experiment described by Wong et al. was used in the rabbit ECAT study (Wang et al., J. Pharmacol. Exp. Ther. 295:212-8, 2002). ECAT experiments were performed 3 to 4 days after the last administration of vehicle, FXI-ASO2, or FXI-ASO1. FXI-ASO1 has a nominal nucleotide sequence of GTAACATGTGCCCTTTCCTT, which is complementary to a sequence in rabbit FXI mRNA. FXI-ASO2 (control ASO) has a nominal nucleotide sequence of CCTTCCCTGAAGGTTCCTCC, which has no known complementary sequence in rabbit mRNA. Oligonucleotides were chemically modified with phosphorothioates in the backbone and 2'-O-methoxyethyl in the wings with a central deoxy gap (so-called 5-10-5 design). Cytosine bases were expressed as 5-methylcytosines.

[0151] Separate samples of FXI-ASO1 and FXI-ASO2 were weighed out chemically for each dose. The ASO content was taken into account as weight % so that the administered dose represented the true amount of FXI-ASO. Just before administration, ASO was dissolved in saline to a concentration of 4, 10 or 30 mg / mL, allowing subcutaneous administration of doses of 2, 5 or 15 mg / kg in a volume of 0.5 mL / kg. Administration was performed twice a week, approximately 3 and a half days apart, for a total of 4 weeks (8 administrations).

[0152] Male New Zealand White rabbits were anesthetized with ketamine (50 mg / kg + 50 mg / kg / h i.m.) and xylazine (10 mg / kg + 10 mg / kg / h i.m.). Thrombus formation was induced by electrical stimulation of the carotid artery at 4 mA for 3 min using an external stainless steel bipolar electrode. Carotid blood flow was continuously measured using an electromagnetic flow probe 30 min before and 90 min after the start of electrical stimulation to monitor thrombus-induced occlusion. Integrated carotid blood flow was measured as the area under the flow-time curve as a percentage of the control period before electrical stimulation. In addition, thrombus from the arterial injury was removed and blotted twice on weighing paper to remove remaining fluid and weigh.

[0153] After electrical current stimulation, thrombus formation was induced, blood flow was reduced to zero, and the artery was occluded in approximately 40-45 min in vehicle-treated animals. FXI-ASO1 caused a dose-dependent increase in the patency period of the carotid artery.

[0154] Compared with the period before electrical stimulation, the integral blood flow after induction of thrombus formation was, on average, 12 ± 3% in vehicle-treated animals and 23 ± 8% in FXI-ASO1-treated animals. By blocking thrombus formation, FXI-ASO1 treatment caused a dose-dependent increase in integral blood flow. At a dose of 2 mg / kg, the integral blood flow was 64 ± 8% of the pre-wounding level. At higher doses, the integral blood flow remained above 90%.

[0155] FXI-ASO2 did not reduce thrombus weight. FXI-ASO1 caused a dose-dependent reduction in thrombus weight. At the highest dose, thrombus weight was reduced by 82% compared to vehicle. Figure 13 shows the dose-dependent reduction in FXI levels and in thrombus weight observed in rabbit ECAT experiments upon ASO-induced inhibition of FXI.

[0156] Reducing circulating FXI in rabbits showed potent antithrombotic efficacy in preventing arterial thrombus formation in ECAT experiments. A 1.3-fold prolongation of the aPTT was observed and an 80% reduction in thrombus weight was achieved in rabbit ECAT experiments. Factor XI clotting activity measured by coagulation assay correlated well with plasma FXI concentrations measured by mass spectrometry. Reducing FXI:C to less than 30% of normal levels preserved the integral blood flow almost completely and reduced thrombus weight by more than 80% in rabbit ECAT experiments.

[0157] Based on data from healthy subjects, population PK modeling suggests that potential doses to achieve apixaban and ASO-based trough concentration targets in VTE prevention studies are between 100-200 mg once daily and 25-50 mg BID. Dosing at 50 mg once daily prolonged aPTT by 1.5-fold over approximately 24 hours in healthy volunteers and provided plasma concentrations above the concentration required for antithrombotic efficacy (EC50) for sustained periods in rabbit ECAT studies of thrombosis. Data showing the range of concentrations targeted in rabbit ECAT studies for both apixaban and the FXI inhibitor FXI-ASO1 support the potential for milbexian to provide comparable or better efficacy in patients.

Claims

1. Use of an oral dosage form of milbexian, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating or preventing a venous thromboembolic disorder by orally administering a total daily dose of 100 mg to 400 mg of milbexian, or a pharmaceutically acceptable salt thereof, to a patient in need of such treatment or prevention.

2. 2. The use of claim 1, wherein the total daily dose is 100 mg, 150 mg, or 200 mg.

3. 3. The use according to claim 1 or 2, wherein the total daily dose is administered in a single dose.

4. 3. The use according to claim 1 or 2, wherein the total daily dose is administered in divided doses, or the total daily dose is administered in two doses.

5. 3. The use according to claim 1 or 2, wherein the venous thromboembolic disorder is proximal and / or distal deep vein thrombosis, non-fatal pulmonary embolism, or death.

6. Use of an oral dosage form of milbexian or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for preventing postoperative venous thromboembolic events in a patient recovering from surgery, wherein administration of the medicament to the patient provides a total daily dose of milbexian or a pharmaceutically acceptable salt thereof of at least 100 mg.

7. 7. The use of claim 6, wherein the patient is recovering from abdominal surgery, knee replacement, or hip replacement.

8. 8. The use according to claim 6 or 7, wherein the total daily dose of milbexian or a pharmaceutically acceptable salt thereof is 100 mg, 150 mg, or 200 mg.

9. 9. The use according to claim 8, wherein the total daily dose of milbexian or a pharmaceutically acceptable salt thereof is administered in a single dose.

10. 9. The use according to claim 8, wherein the total daily dose of milbexian or a pharmaceutically acceptable salt thereof is administered in divided doses.

11. Use of a solid dosage form of milbexian or a pharmaceutically acceptable salt thereof to manufacture a pharmaceutical suitable for administration to a patient once or twice daily at a total daily dose of at least 100 mg of milbexian or a pharmaceutically acceptable salt thereof for treating or preventing venous thromboembolic disorders, wherein said administration results in an incidence of total venous thromboembolic events of less than 25% and an alpha of 5%.

12. 12. The use of claim 11, wherein the incidence of all venous thromboembolic events is less than 20%, less than 15%, or less than 10%.

13. 12. The use according to claim 11, wherein milbexian or a pharmaceutically acceptable salt thereof is administered in a total daily dose of 100 mg, 150 mg, 200 mg, or 400 mg.

14. The use according to any one of claims 11 to 13, wherein milbexian or a pharmaceutically acceptable salt thereof is administered twice a day.

15. The use according to any one of claims 11 to 13, wherein milbexian or a pharmaceutically acceptable salt thereof is administered once a day.

16. 14. The use according to any one of claims 11 to 13, wherein the incidence of venous thromboembolism occurs in a dose-dependent manner without increasing the risk of bleeding compared to enoxaparin.

17. The use described in claim 2, wherein the total daily dose is 50 mg of milbexian administered twice a day.

18. The use described in claim 1, wherein milbexian or a pharmaceutically acceptable salt thereof is milbexian.

19. The use described in claim 6, wherein milbexian or a pharmaceutically acceptable salt thereof is milbexian.

20. The use described in claim 11, wherein milbexian or a pharmaceutically acceptable salt thereof is milbexian.

Images