Dendrimer conjugates of small molecule biologics for intracellular delivery

Abstract

We have developed compositions of hydroxyl-terminated dendrimers covalently conjugated with functional nucleic acids (D-FNAs) and methods of using the same for preventing, treating or diagnosing one or more diseases or disorders in a subject in need thereof. The covalent conjugation of FNAs to dendrimers significantly enhances serum half-life and bioavailability and protects the payload from proteosorption and enzymatic degradation. Preferably, the functional nucleic acids are covalently conjugated to the dendrimers with functionally releasable coupling elements for intracellular release of the FNAs in activated macrophages, including tumor-associated microglia (TAMs). An exemplary functionally releasable coupling element is a glutathione-sensitive coupling element.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to USSN 63 / 246,705, filed September 21, 2021, which is incorporated by reference in its entirety.

[0002] Sequence Listing Reference The sequence listing submitted as an xml file entitled "JHU_C_17048_PCT.xml", created on September 21, 2022 and having a size of 10,664 bytes, is hereby incorporated by reference herein in accordance with 37 C.FR § 1.834(c)(1).

[0003] FIELD OF THEINVENTION The present invention is generally in the field of nucleic acid delivery, and in particular, methods for delivering small molecules, such as RNA molecules, that are covalently linked to dendrimers for selective uptake at a site or region in need thereof. [Background technology]

[0004] 2. Background of the Invention Antisense oligonucleotides (ASOs) and small interfering RNA (siRNA) are the two most widely used strategies to silence gene expression. The potential use of antisense and siRNA oligonucleotides as therapeutic agents has generated much greater interest. However, a major problem with oligonucleotide-based therapeutics involves effective intracellular delivery of the active molecule. Delivering oligonucleotides throughout the organism requires crossing many barriers. Degradation by serum nucleases, clearance by the kidney, or improper biodistribution can prevent oligonucleotides from reaching their target organs. Oligonucleotides must cross vascular walls and navigate through interstitial spaces and the extracellular matrix. Finally, if the oligonucleotide succeeds in reaching the appropriate cell membrane, it will usually be internalized into an endosome, from which the oligonucleotide must escape to become active.

[0005] Small interfering RNA (siRNA) is a novel and powerful therapeutic agent for central nervous system (CNS) disorders due to its ability to inhibit specific genes essential for the progression of neurological diseases. However, successful delivery of siRNA to the brain parenchyma faces obstacles, such as the blood-brain barrier and poor cellular uptake. Furthermore, siRNA is highly unstable in physiological conditions, susceptible to protein binding and enzymatic degradation, and high doses are required to remain effective. Efforts to develop efficient viral and non-viral carriers face challenges of immunogenicity, vehicle toxicity, and aggregation. Furthermore, consistent nucleic acid loading is difficult to achieve in delivery systems that rely on non-covalent interactions.

[0006] It is therefore an object of the present invention to provide compositions for delivering functional nucleic acids, particularly RNA molecules capable of modulating gene expression and / or other biochemical activities in cells.

[0007] It is also an object of the present invention to provide drug delivery formulations for treating diseases, disorders, and injuries of the brain and central nervous system, particularly those associated with activated microglia and / or astrocytes.

[0008] It is a further object of the present invention to provide biocompatible and inexpensive nanomaterials for targeted or selective delivery of functional nucleic acids, particularly RNA molecules, to the central nervous system with little or no local or systemic toxicity. Summary of the Invention [Means for solving the problem]

[0009] Summary of the Invention It has been established that hydroxyl-terminated dendrimers can selectively deliver covalently conjugated small molecule biologics, such as functional nucleic acids, to activated macrophages and microglia and neurons at sites of injury and disease with high efficacy and low toxicity. Dendrimers sequester and stabilize functional nucleic acids in vivo, allowing efficient gene silencing and / or modulation of targeted gene expression to treat and prevent diseases and disorders.

[0010] Provided is a composition of hydroxyl-terminated dendrimers covalently conjugated to one or more functional nucleic acids, optionally via one or more spacers. Typically, the functional nucleic acids are conjugated to less than 50% of the terminal OH groups on the dendrimer surface. Typically, the one or more functional nucleic acids inhibit the transcription, translation, or function of a target gene. In some embodiments, the one or more functional nucleic acids are antisense molecules, small interfering RNAs (siRNAs), microRNAs (miRNAs), aptamers, ribozymes, triplex-forming molecules, or external guide sequences. Preferred functional nucleic acids are siRNAs or miRNAs. In certain embodiments, the miRNA is miR-126.

[0011] Hydroxyl-terminated dendrimers are generally second generation (G2), third generation (G3), fourth generation (G4), fifth generation (G5), sixth generation (G6), seventh generation (G7), or eighth generation (G8) dendrimers. In preferred embodiments, the dendrimer is a poly(amidoamine) (PAMAM) dendrimer. In some embodiments, the dendrimer is covalently conjugated to one or more functional nucleic acids via one or more spacers. Suitable spacers include one of the following: N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), glutathione, gamma-aminobutyric acid (GABA), polyethylene glycol (PEG). In preferred embodiments, the dendrimer is covalently conjugated to one or more functional nucleic acids via a disulfide bond. In some embodiments, the dendrimer is further conjugated to one or more additional therapeutic, prophylactic, and / or diagnostic agents. The composition of the dendrimer conjugated to the functional nucleic acid includes one of the following structures: [ka] and [ka] (where the circle designated D is a hydroxyl-terminated dendrimer and the oval designated FNA is a functional nucleic acid).

[0012] Also provided is a pharmaceutical composition comprising a hydroxyl-terminated dendrimer covalently conjugated to one or more functional nucleic acids, optionally via one or more spacers, and one or more pharma- ceutically acceptable excipients.The pharmaceutical composition is generally formulated in some form, such as hydrogels, nanoparticles or microparticles, suspensions, powders, tablets, capsules, and solutions, for parenteral or oral administration.

[0013] A method for treating one or more symptoms of a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a hydroxyl-terminated dendrimer covalently conjugated to one or more functional nucleic acids, optionally via one or more spacers, and one or more pharma- ceutically acceptable excipients, effective to alleviate one or more symptoms of the disease or disorder. Typically, the method treats or prevents inflammation, proliferative disease, such as cancer, or neurological disease in the subject. In some embodiments, the method is for treating inflammation associated with one or more diseases, conditions, and / or injuries of the eye, brain, and / or nervous system (CNS). Exemplary diseases, conditions, and / or injuries of the eye that may be treated by the method are those associated with choroidal neovascularization. In some embodiments, the functional nucleic acid is a miRNA specific for vascular endothelial growth factor (VEGF). An exemplary miRNA specific for VEGF is miR-126. In a preferred embodiment, dendrimers covalently conjugated to miR-126 are selectively delivered to the eye to treat or prevent one or more symptoms of macular degeneration in a subject.

[0014] In some embodiments, the method delivers one or more functional nucleic acids conjugated to a dendrimer to treat or prevent cancer in a subject. Exemplary cancers that can be treated include breast cancer, cervical cancer, ovarian cancer, uterine cancer, pancreatic cancer, skin cancer, multiple myeloma, prostate cancer, testicular germ cell tumor, brain cancer, oral cancer, esophageal cancer, lung cancer, liver cancer, renal cell cancer, colorectal cancer, duodenal cancer, gastric cancer, and colon cancer. Thus, in some embodiments, the method delivers an effective amount of functional nucleic acid to reduce tumor size or inhibit tumor growth. In some embodiments, the method administers the dendrimer-functional nucleic acid composition directly to the eye. An exemplary method for administration to the eye is by intravitreal injection. In other embodiments, the composition is administered orally or parenterally. For example, in certain embodiments, the composition is administered intravenously.

[0015] The method typically involves administering the dendrimer-functional nucleic acid composition at a time selected from once every day, once every other day, once every 3 days, once every week, once every 10 days, once every 2 weeks, once every 3 weeks, and once every month. For example, in some embodiments, the composition is administered once every 2 weeks or less frequently. Typically, the amount of functional nucleic acid effective to treat a disease or disorder according to the described method is 50% or less of the amount of the same functional nucleic acid required to treat the disease or disorder in the absence of the dendrimer.

[0016] Kits are also described which contain the dendrimer-functional nucleic acid compositions, and optionally contain reagents, buffers and equipment for administering the compositions to a subject, and / or instructions for use. [Brief description of the drawings]

[0017] [Figure 1] FIG. 1 is a schematic showing the molecular structures in the stepwise synthetic route to generate functionalized Cy5-D-PEG4-TCO. A sixth generation hydroxyl PAMAM dendrimer (PAMAM-G6-OH) was treated with 4-tert-butoxycarbonylamino)butyric acid (Boc-protected GABA) linker (2), and the resulting product (3) was deprotected using dichloromethane (DCM) / trifluoroacetic acid (TFA) (4:1). The product (4) was labeled with a Cy5 fluorophore using Cy5N-hydroxysuccinimide (NHS) ester, and the resulting intermediate (5) was conjugated with a trans-cyclooctene (TCO) linker, PEG4-TCO, to give functionalized Cy5-D-PEG4-TCO (6). The subscript numbers in the formula indicate the number of GABA BOC, PEG4-TCO, or fluorophore attached per dendrimer.

[0018] [Diagram 2]Figure 2 is a schematic showing molecular structures in a stepwise synthetic route to generate dendrimer-Cy5-ASO conjugates, including modification of ASO for conjugation with dendrimers. The ASO was first substituted with pegylated tetrazine using methyltetrazine-PEG4-SS-NHS (8) reagent to form ASO-PEG4-Tz (9), which was then reacted with Cy5-D-PEG4-TCO (6) to give the final product Cy5-D-ASO (10).

[0019] [Diagram 3] 3 is a schematic diagram showing the synthesis of functionalized Cy5-D-PEG4-SPDP. A sixth generation hydroxyl PAMAM dendrimer (PAMAM-G6-OH) was treated with a Boc-protected GABA linker (2), and the resulting product (3) was deprotected using TFA. The product (4) was labeled with a Cy5 fluorophore, and the resulting intermediate (5) was conjugated with SPDP to give functionalized Cy5-D-PEG4-SPDP (6).

[0020] [Figure 4] 4 is a schematic diagram showing the synthesis of Cy5-D-siRNA conjugates. siRNA (7) was activated by reducing the dithiol groups using DTT, and the resulting product (8) was reacted with activated Cy5-D-PEG4-SPDP, 6, to give the final product, Cy5-D-siRNA (9).

[0021] [Diagram 5] Figure 5 is a bar graph of dose-dependent knockdown of green fluorescent protein (GFP) expression by D-siGFP in HEK-293T cells, showing relative fluorescence (0-1.5) versus dosage (0-500 nm) for each of the control, 24 h, 48 h, and 72 h samples.

[0022] [Figure 6] FIG. 6 is a bar graph of D-si-GFP dose response curve 24 h, showing relative fluorescence (0-2) versus dosage (0-500 nm) for the 24 h samples.

[0023] [Figure 7] Figures 7A-7C are bar graphs showing delivery methods that result in significant GFP knockdown in HEK-293T cells. Relative fluorescence was obtained using background-corrected intensity in the GFP channel and normalized to an internal control at 0 hours. Figure 7A is a bar graph of vehicle-dependent GFP knockdown showing -50 to 100% knockdown relative to OH for each of the control, siGFP, RNA / Max LIPOFECTAMINE® 2000, LIPOFECTAMINE® 3000, and D-siGFP samples for 24 or 48 hours, respectively. Data presented as mean ± SEM of duplicates. Figure 7B is a bar graph of GFP protein expression (0-2.5) for each of the control, siGFP, RNA / Max LIPOFECTAMINE® 2000, LIPOFECTAMINE® 3000, and D-siGFP. Relative expression of GFP was obtained by normalizing GFP expression to Cyclophilin B expression. Figure 7C is a bar graph of confluency (0-1.5) over time (0-48 hours) for control, D-siGFP, Lipo2000, Lipo3000, RNAi Max, and siGFP, respectively. No cytotoxic effects were suggested by cell viability via confluency.

[0024] [Figure 8] FIG. 8 is a bar graph of in vivo GFP knockdown showing tumor KD as CH(0-80)% for control, siGFP, D-scRNA, and D-siGFP, respectively.

[0025] [Figure 9]9 is a schematic diagram showing the synthesis of dendrimer-miR126 conjugates. The surface of the sixth generation hydroxyl-terminated dendrimer is functionalized with a disulfide linker (PDP). The thiol-modified miR-126 is activated by reducing the dithiol group using DTT, and the resulting product (8) is reacted with the thiol-modified dendrimer to give the final product D-miR126.

[0026] [Figure 10] Figures 10A-10C are bar graphs showing the relative mRNA expression levels of TNFα (Figure 10A) and IL-1β (Figure 10B) in BV2 cells in the untreated control group and in the experimental groups stimulated with LPS in the presence of D-miR126 and miR-126 at concentrations of 1 nM, 5 nM, 10 nM, and 100 nM; and the relative mRNA expression levels of VEGF-α in HMECs in the untreated control group and in the experimental groups treated with D-miR126 and miR-126 at concentrations of 1 nM, 5 nM, 10 nM, and 100 nM (Figure 10C).

[0027] [Figure 11-1] Figures 11A-11D are bar graphs showing the total length (Figure 11A), number of isolated segments (Figure 11B), total area enclosed (Figure 11C), and number of nodes and fragments (Figure 11D) of the cellular networks formed by HMECs in the untreated control group and in the experimental groups treated with D-miR126 at concentrations of 1 nM, 5 nM, 10 nM, and 100 nM; or miR-126 at concentrations of 10 nM and 100 nM, based on a Matrigel-based tube formation assay. [Figure 11-2]Figures 11A-11D are bar graphs showing the total length (Figure 11A), number of isolated segments (Figure 11B), total area enclosed (Figure 11C), and number of nodes and fragments (Figure 11D) of the cellular networks formed by HMECs in the untreated control group and in the experimental groups treated with D-miR126 at concentrations of 1 nM, 5 nM, 10 nM, and 100 nM; or miR-126 at concentrations of 10 nM and 100 nM, based on a Matrigel-based tube formation assay.

[0028] [Figure 12] Figures 12A-12B are bar graphs showing CNV areas stained with isolectin antibody and quantified by fluorescence microscopy in untreated controls or experimental groups treated with D-mirR126 at concentrations of 0.1 μg / μL, 1 μg / μL, and 2 μg / μL, or miR-126 at a concentration of 1 μg / μL, 7 days after CNV (Figure 12A) and 14 days after CNV (Figure 12B).

[0029] [Figure 13-1] Figures 13A-13D are bar graphs showing the relative VEGF-α protein expression levels measured by ELISA in untreated controls or experimental groups treated with D-mirR126 or miR-126 at concentrations of 0.1 μg / μL and 1 μg / μL (Figure 13A); and the relative mRNA expression levels of VEGF-α in PBS-treated mice (control group) and in experimental groups treated with D-miR126 or miR-126 (Figure 13B); and the relative mRNA expression levels of TNFα (Figure 13C) and IL-1β (Figure 13D) in PBS-treated mice (control group) and in experimental groups treated with D-miR126 or miR-126. [Figure 13-2]Figures 13A-13D are bar graphs showing the relative VEGF-α protein expression levels measured by ELISA in untreated controls or experimental groups treated with D-mirR126 or miR-126 at concentrations of 0.1 μg / μL and 1 μg / μL (Figure 13A); and the relative mRNA expression levels of VEGF-α in PBS-treated mice (control group) and in experimental groups treated with D-miR126 or miR-126 (Figure 13B); and the relative mRNA expression levels of TNFα (Figure 13C) and IL-1β (Figure 13D) in PBS-treated mice (control group) and in experimental groups treated with D-miR126 or miR-126.

[0030] [Figure 14] Figures 14A-14D are bar graphs showing the percentage of colocalization of Cy3 and Cy5 signals using isolectin GS-IB4 staining (vessels + macrophages) and Iba1 (macrophages) staining 1, 3, 5, 7, and 14 days after miR-126 administration (Figure 14A), Cy3 colocalization after D-miR126 administration (Figure 14B), Cy5 colocalization after D-miR126 administration (Figure 14C), and colocalization between dendrimer (Cy5) and miR-126 (Cy3) as a measure of payload release in vivo (Figure 14D).

[0031] [Figure 15] Figure 15 is a schematic diagram showing the synthesis of dendrimer-ALG1001. The surface of a sixth generation hydroxyl-terminated dendrimer is functionalized with an alkyne-terminated linker. The ALG-1001 peptide is then attached using a copper-catalyzed click reaction to obtain the D-ALG conjugate.

[0032] [Figure 16]FIG. 16 is a bar graph showing metrics extracted for angiogenesis completeness and expansion indicating the number of times blood vessels cross each other (junction count), the number of spaces surrounded by blood vessels (meshes), the number of connected blood vessels (segments), and the number of isolated blood vessels (isolated segments) in an untreated control group and in experimental groups treated with D-ALG and ALG-1001 at concentrations of 1 mM, 100 nM, and 10 nM.

[0033] [Figure 17] FIG. 17 is a bar graph of relative protein expression of MAPL, FAK phosphorylated MAPK (p-MAPL), and phosphorylated FAK (p-FAK) in response to VEGF stimulation in untreated control groups and in experimental groups treated with D-ALG and ALG-1001 at concentrations of 1 mM and 100 nM, as determined by protein bands associated with ERK (42 and 44 kDa) and FAK (110 kDa) from Western blot analysis and normalized to an internal control (cyclophilin B).

[0034] [Figure 18] 18A-18B are bar graphs showing the relative expression of the pro-inflammatory cytokines IL1β (FIG. 18A) and TNFα (FIG. 18B) produced by RAW264.7 cells in response to LPS stimulation after pretreatment with ALG-1001 and D-ALG1001. P-values ​​shown compare the levels of IL1β and TNFα expression relative to untreated controls.

[0035] [Figure 19] Figures 19A-19B are bar graphs showing CNV areas stained with isolectin antibodies and quantified by fluorescence microscopy in untreated controls or in experimental groups administered 150 μg of peptide-based D-ALG1001 (150 μg) or ALG-1001 (150 μg) intraperitoneally every 4 days at 7 days after CNV (Figure 19A) and 14 days after CNV (Figure 19B).

[0036] [Figure 20-1] 20A-20D are bar graphs showing the protein amounts (U / ml) of FAK (FIG. 20A), phospho-FAK(Y397) (FIG. 20B), p44 / 42ERK (FIG. 20C), and phospho-p44 / 42ERK (FIG. 20D) as determined by ELISA. [Figure 20-2] 20A-20D are bar graphs showing the protein amounts (U / ml) of FAK (FIG. 20A), phospho-FAK(Y397) (FIG. 20B), p44 / 42ERK (FIG. 20C), and phospho-p44 / 42ERK (FIG. 20D) as determined by ELISA.

[0037] [Figure 21-1] Figures 21A-21C are bar graphs showing the relative mRNA expression levels of VEGF-α (Figure 21A), TNFα (Figure 21B), and IL-1β (Figure 21C) in animals treated with PBS (control group) and in the experimental groups treated with D-ALG and ALG-1001. [Figure 21-2] Figures 21A-21C are bar graphs showing the relative mRNA expression levels of VEGF-α (Figure 21A), TNFα (Figure 21B), and IL-1β (Figure 21C) in animals treated with PBS (control group) and in the experimental groups treated with D-ALG and ALG-1001.

[0038] [Figure 22] Figure 22 is a schematic diagram showing the synthesis of G1-glucose. Stepwise synthesis of G1-glucose; hexapropagylated core 1 was treated with AB4 building block (β-glucose-PEG4-azide), 2, under classical click reagent (CuAAC click reaction), catalytic amount of copper sulfate pentahydrate (CuSO4.5H2O) and sodium ascorbate in DMF:HO (1:1) to generate G1-glucose-24-OAc, 3. Compound 3 was then treated under typical Zemplen conditions (to remove acetate group) to give the desired product 4 (G1-glucose).

[0039] [Figure 23] Figure 23 is a schematic diagram showing the synthesis of Glu-G2 dendrimer. Stepwise synthesis of G2-glucose; G1-glucose dendrimer, 4, was treated with sodium hydride (60% dispersion in mineral oil) at 0°C for 15 min, followed by propargyl bromide (80% w / w solution in toluene). The reaction was stirred at room temperature for 8 h to form compound 5. Compound 5 was then treated with AB4 building block (β-glucose-PEG4-azide), 2, under classical click reagent (CuAAC click reaction) in DMF:H2O (1:1), catalytic amount of copper sulfate pentahydrate (CuSO4.5H2O) and sodium ascorbate to generate G2-glucose-96-OAc, 6. Compound 6 was then reacted under typical Zemplen conditions to give the desired product 7 (G2-glucose).

[0040] [Figure 24] Figure 24 is a schematic showing the synthesis of Cy5-Glu-G2-PEG4-SPDP. Glu-G2 dendrimer was treated with NaH and propargyl bromide, and the resulting product 2 was further reacted with N3-PEG3-amine, 3, using CUAAC click conditions to form compound 4. Product 4 was labeled with Cy5 fluorophore, and the resulting intermediate 5 was conjugated with SPDP to give functionalized Cy5-Glu-G2-PEG4-SPDP, 6. The subscript numbers in the formula indicate the number of attachments per dendrimer.

[0041] [Diagram 25] 25 is a schematic diagram showing the synthesis of Cy5-Glu-G2-siRNA conjugate. siRNA, 7, was activated by reducing the dithiol group using DTT, and the resulting product, 8, was reacted with activated Cy5-Glu-G2-PEG4-SPDP, 6, to give the final product, Cy5-Glu-G2-siRNA, 9. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] Detailed Description of the Invention I. Definition The terms "active agent" or "biological agent" are therapeutic, prophylactic or diagnostic agents used interchangeably to refer to chemical or biological compounds that induce a desired pharmacological and / or physiological effect, which may be prophylactic, therapeutic or diagnostic. These may be nucleic acids, nucleic acid analogs, small molecules having a molecular weight of less than 2 kD, more typically less than 1 kD, peptidomimetics, proteins or peptides, carbohydrates or sugars, lipids, or combinations thereof. These terms also encompass pharma- ceutically acceptable and pharmacologically active derivatives of the agents, including, but not limited to, salts, esters, amides, prodrugs, active metabolites, and analogs.

[0043] The term "nucleotide" refers to a molecule that includes a base moiety, a sugar moiety, and a phosphate moiety. Nucleotides can be linked together through their phosphate and sugar moieties to produce an internucleoside linkage. The base moiety of a nucleotide can be adenine-9-yl (A), cytosine-1-yl (C), guanine-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The sugar moiety of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is a pentavalent phosphate. Non-limiting examples of nucleotides are 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). There are many variations of these types of molecules available in the art and available herein.

[0044] The term "oligonucleotide" or "polynucleotide" is a synthetic or isolated nucleic acid polymer containing multiple nucleotide subunits.

[0045] The terms "nucleic acid", "polynucleotide", and "oligonucleotide" are interchangeable and refer to deoxyribonucleotide or ribonucleotide polymers in either single- or double-stranded form in linear or cyclic conformation. For the purposes of this disclosure, these terms should not be construed as limiting on the length of the polymer. The terms may encompass known analogs of natural nucleotides, as well as nucleotides modified at the base, sugar and / or phosphate moieties (e.g., phosphorothioate backbones, locked nucleic acids). Generally, unless otherwise specified, analogs of a particular nucleotide have the same base-pairing specificity, i.e., an analog of A will base pair with T.

[0046] The term "pharmaceutically acceptable salt" is recognized in the art and includes relatively non-toxic inorganic and organic acid addition salts of a compound. Examples of pharmaceutically acceptable salts include those derived from inorganic acids, such as hydrochloric acid and sulfuric acid, and those derived from organic acids, such as ethanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid. Examples of inorganic bases suitable for forming salts include hydroxides, carbonates, and bicarbonates of ammonia, sodium, lithium, potassium, calcium, magnesium, aluminum, and zinc. Salts may also be formed with suitable organic bases, including those that are non-toxic and strong enough to form such salts. By way of example, classes of such organic bases can include mono-, di-, and trialkylamines, such as methylamine, dimethylamine, and triethylamine; mono-, di-, or trihydroxyalkylamines, such as mono-, di-, and triethanolamine; amino acids, such as arginine and lysine; guanidine; N-methylglucosamine; N-methylglucamine; L-glutamine; N-methylpiperazine; morpholine; ethylenediamine; and N-benzylphenethylamine.

[0047] The term "therapeutic agent" refers to an agent that can be administered to treat one or more symptoms of a disease or disorder.

[0048] The term "diagnostic agent" generally refers to an agent that can be administered to localize, identify, and reveal a pathological process. A diagnostic agent can label target cells and allow for subsequent detection or imaging of these labeled target cells. In some embodiments, a diagnostic agent can target / bind to activated microglia in the central nervous system (CNS) via a dendrimer or suitable delivery vehicle.

[0049] The term "prophylactic agent" refers generally to an agent, such as a vaccine, that can be administered to prevent disease or to prevent a particular condition.

[0050] The phrases "pharmacologically acceptable" or "biocompatible" refer to compositions, polymers, and other materials and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with human and animal tissues, without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmacologically acceptable carrier" refers to a pharma- ceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, solvent, or encapsulating material involved in carrying or transporting any subject composition from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other components of the subject composition and not harmful to the patient.

[0051] The term "therapeutically effective amount" refers to an amount of a therapeutic agent that, when incorporated into and / or onto a dendrimer, produces some desired effect at a reasonable benefit / risk ratio applicable to any medical treatment. The effective amount may vary depending on factors such as the disease or condition being treated, the particular construct being administered, the size of the subject, or the severity of the disease or condition. Those skilled in the art may empirically determine the effective amount of a particular compound without undue experimentation. In some embodiments, the term "effective amount" refers to an amount of a therapeutic or prophylactic agent to reduce or reduce the symptoms of one or more diseases or disorders, for example, to reduce, prevent, or reverse learning and / or memory deficits in individuals affected by Alzheimer's disease, etc. In one or more neurological or neurodegenerative diseases, an effective amount of a drug may have the effect of stimulating or inducing neuronal mitosis, which results in the generation of new neurons, i.e., exhibiting a neurogenic effect; and preventing or slowing neuronal loss, including a reduction in the rate of neuronal loss, i.e., exhibiting a neuroprotective effect. An effective amount may be administered in one or more administrations.

[0052] The term "inhibit" or "reduce" in the context of inhibition means a decrease or reduction in activity and amount. This may be a complete inhibition or reduction or a partial inhibition or reduction in activity or amount. The inhibition or reduction may be compared to a control or standard level. The inhibition may be 5, 10, 25, 50, 75, 80, 85, 90, 95, 99, or 100%. For example, a dendrimer composition comprising one or more inhibitors may inhibit or reduce the activity and / or amount of activated microglia associated with nSMase2 by about 10%, 20%, 30%, 40%, 50%, 75%, 85%, 90%, 95%, or 99% from the activity and / or amount of the same cells in a comparable tissue of a subject that has not been given or treated with the dendrimer composition. In some embodiments, the inhibition and reduction are compared at the mRNA, protein, cell, tissue, and organ levels. For example, the inhibition and reduction in choroidal neovascularization of the eye when compared to an untreated control subject.

[0053] The term "treating" or "preventing" refers to a disease, disorder or condition occurring in an animal that may be susceptible to, but has not yet been diagnosed as having, a disease, disorder and / or condition, inhibiting the progression of the disease, disorder or condition, as well as relieving the disease, disorder or condition, e.g., causing regression of the disease, disorder and / or condition. Treating a disease or condition includes reversing at least one symptom of a particular disease or condition, even if the underlying pathophysiology is not affected, e.g., treating a subject's pain by administering a painkiller, even if such an agent does not treat the cause of the pain. Desirable effects of treatment include slowing the rate of disease progression, reversing or alleviating the disease state, and remission or improving prognosis. For example, an individual is successfully "treated" if one or more symptoms associated with a brain tumor are reduced or eliminated, including, but not limited to, slowing the rate of tumor growth, reducing symptoms caused by the disease, improving the quality of life of those affected by the disease, reducing the dose of other medications required to treat the disease, slowing the progression of the disease, and / or prolonging the individual's survival.

[0054] The term "biodegradable" generally refers to a material that will break down or erode under physiological conditions into smaller units or chemical species that can be metabolized, eliminated, or excreted by a subject. Degradation time is a function of composition and morphology.

[0055] The term "dendrimer" includes, but is not limited to, a molecular structure with an inner core, inner layers or "generations" of repeating units regularly attached to this initial core, and an outer surface of terminal groups attached to the outermost generation.

[0056] The term "functionalization" means modifying a compound or molecule in a manner that results in the attachment of a functional group or moiety. For example, a molecule may be functionalized by introducing a molecule that makes it a strong nucleophile or a strong electrophile.

[0057] The term "targeting moiety" refers to a moiety that localizes or localizes away from a specific location. The moiety may be, for example, a protein, a nucleic acid, a nucleic acid analog, a carbohydrate, or a small molecule. The entity may be, for example, a therapeutic compound, for example, a small molecule, or a diagnostic entity, for example, a detectable label. The location may be a tissue, a specific cell type, or a subcellular compartment. In an embodiment, the targeting moiety localizes the agent. In a preferred embodiment, the dendrimer composition is capable of selectively targeting activated microglia in the absence of additional targeting moieties.

[0058] The term "extended residence time" refers to an increase in the time required for an agent to clear from a patient's body or from an organ or tissue of the patient. In certain embodiments, "extended residence time" refers to an agent that clears with a half-life that is 10%, 20%, 50% or 75% longer than a comparison standard, e.g., a comparison agent that is not conjugated to a delivery vehicle such as a dendrimer. In certain embodiments, "extended residence time" refers to an agent that clears with a half-life that is 2, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000 or 10000 times longer than a comparison standard, e.g., a comparison agent that does not contain a dendrimer that specifically targets a particular cell type.

[0059] The terms "incorporated" and "encapsulated" refer to incorporating, formulating, or otherwise including such an agent in and / or on a composition that permits release, e.g., sustained release, of the agent in the desired application. Agents or other materials may be incorporated into such dendrimers by binding to one or more surface functional groups of the dendrimer (by covalent, ionic, or other binding interactions), by physical mixing, by enveloping the agent within the dendritic structure, and / or by encapsulating the agent within the dendritic structure.

[0060] II. Composition Dendrimer complexes suitable for delivering one or more small molecule biologics, in particular one or more functional nucleic acids, for preventing, treating, or diagnosing one or more diseases or conditions have been developed.

[0061] The composition of the dendrimer complex comprises one or more prophylactic or therapeutic agents for treating or preventing one or more diseases or disorders, covalently conjugated to the dendrimer. Typically, the one or more active agents are conjugated to the dendrimer complex at a concentration of about 0.01% to about 50% by weight, preferably about 1% to about 30% by weight, more preferably about 5% to about 20% by weight of the total dendrimer / active agent complex. Preferably, the one or more agents are covalently conjugated to the dendrimer via one or more linkages, such as disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, and amide linkages, optionally via one or more spacers. Exemplary agents include small molecule biologics, such as functional nucleic acid molecules.

[0062] The presence of additional agents may affect the zeta potential or surface charge of the particle. In one embodiment, the zeta potential of the dendrimer is between about -100mV and about 100mV, between about -50mV and about 50mV, between about -25mV and about 25mV, between about -20mV and about 20mV, between about -10mV and about 10mV, between about -10mV and about 5mV, between about -5mV and about 5mV, between about -2mV and about 2mV, or between about -1mV and about 1mV, inclusive. In a preferred embodiment, the surface charge is neutral or near neutral. The above ranges include all values ​​from -100mV to 100mV.

[0063] A. Dendrimer Dendrimers are three-dimensional hyperbranched, monodisperse, spherical, multivalent macromolecules that contain a high density of surface end groups (Tomalia, DA, et al., Biochemical Society Transactions, 35, 61 (2007); and Sharma, A., et al., ACS Macro Letters, 3, 1079 (2014)). Due to their unique structural and physical features, dendrimers are useful as nanocarriers for various biomedical applications including targeted drug / gene delivery, imaging and diagnostics (Sharma, A., et al., RSC Advances, 4, 19242 (2014); Caminade, A.-M., et al., Journal of Materials Chemistry B, 2, 4055 (2014); Esfand, R., et al., Drug Discovery Today, 6, 427 (2001); and Kannan, RM, et al., Journal of Internal Medicine, 276, 579 (2014)).

[0064] Recent studies have shown that dendrimer surface groups significantly affect their biodistribution (Nance, E., et al., Biomaterials, 101, 96 (2016)). Hydroxyl-terminated fourth generation PAMAM dendrimers (approximately 4 nm size), without any targeting ligand, cross the impaired BBB significantly more (>20-fold) when administered systemically in a rabbit model of cerebral palsy (CP) compared to healthy controls, and selectively target activated microglia and astrocytes (Lesniak, WG, et al., Mol Pharm, 10 (2013)).

[0065] The term "dendrimer" includes, but is not limited to, a molecular configuration having an inner core and layers or "generations" of repeating units attached to and extending from the inner core, each layer having one or more branch points and an outer surface of terminal groups attached to the outermost generation. In some embodiments, the dendrimer has a standard dendrimer or a "starburst" molecular structure.

[0066] Typically, dendrimers have a diameter between about 1 nm and about 50 nm, more preferably between about 1 nm and about 20 nm, between about 1 nm and about 10 nm, or between about 1 nm and about 5 nm. In some embodiments, the diameter is between about 1 nm and about 2 nm. Conjugates generally fall within the same size range, although larger proteins, such as antibodies, may be as large as 5-15 nm in size. Typically, drugs are conjugated at an average drug to dendrimer ratio of between 0.1:1 and 4:1, inclusive. In preferred embodiments, the dendrimers have a diameter effective to pass through brain tissue and be retained in target cells for extended periods of time.

[0067] In some embodiments, the dendrimers have a molecular weight between about 500 and about 100,000 daltons, preferably between about 500 and about 50,000 daltons, and most preferably between about 1,000 and about 20,000 daltons.

[0068] Suitable dendrimer scaffolds that may be used include poly(amidoamine), also known as PAMAM, or STARBURST™ dendrimers, polypropylamine (POPAM), polyethyleneimine, polylysine, polyester, iptycene, aliphatic poly(ether), and / or aromatic polyether dendrimers. The dendrimers may be carboxyl, amine, and / or hydroxyl terminated. In a preferred embodiment, the dendrimers are hydroxyl terminated. Each dendrimer of the dendrimer complex may be the same or of similar or different chemical nature to the other dendrimers (e.g., a first dendrimer may comprise a PAMAM dendrimer, while a second dendrimer may be a POPAM dendrimer).

[0069] The term "PAMAM dendrimer" refers to a poly(amidoamine) dendrimer of any generation, including but not limited to a first generation PAMAM dendrimer, a second generation PAMAM dendrimer, a third generation PAMAM dendrimer, a fourth generation PAMAM dendrimer, a fifth generation PAMAM dendrimer, a sixth generation PAMAM dendrimer, a seventh generation PAMAM dendrimer, an eighth generation PAMAM dendrimer, a ninth generation PAMAM dendrimer, or a tenth generation PAMAM dendrimer, which may contain different cores and have amidoamine building blocks and may have carboxyl, amine, and hydroxyl termini. In a preferred embodiment, the dendrimer is soluble in the formulation and is a fourth, fifth, or sixth generation ("G") dendrimer. The dendrimer may have hydroxyl groups attached to its functional surface groups.

[0070] Methods for making dendrimers are known to those skilled in the art and generally involve a two-step repeating reaction sequence that produces concentric shells (generations) of dendritic β-alanine units around a central starting core (e.g., an ethylenediamine core). Each subsequent growth step represents a new "generation" of polymer with a larger molecular diameter, twice the number of reactive surface sites, and approximately twice the molecular weight of the previous generation. Dendrimer scaffolds suitable for use are commercially available in various generations. Preferably, the dendrimer composition is based on a 0th, 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, or 10th generation dendrimer scaffold. Such scaffolds have 4, 8, 16, 32, 64, 128, 256, 512, 1024, 2048, and 4096 reactive sites, respectively. Thus, dendrimer compounds based on these scaffolds may have a maximum of a corresponding number of combined targeting moieties and, if present, drugs.

[0071] 1. Hydroxyl-terminated dendrimers In some embodiments, the dendrimers contain multiple hydroxyl groups. Some exemplary high density hydroxyl group-containing dendrimers include commercially available polyester dendritic polymers, such as hyperbranched 2,2-bis(hydroxyl-methyl)propionic acid polyester polymers (e.g., hyperbranched bis-MPA polyester-64-hydroxyl, 4th generation), dendritic polyglycerols.

[0072] In some embodiments, the high-density hydroxyl-containing dendrimer is an oligoethylene glycol (OEG)-like dendrimer. For example, second generation OEG dendrimers ("D2-OH-60") can be synthesized using highly efficient, robust, and atom-economical chemical reactions, such as Cu(I)-catalyzed alkyne-azide click and photocatalyzed thiol-ene click chemistry. By using orthogonal hypermonomer and hypercore strategies, very low generation high-density polyol dendrimers can be achieved with minimal reaction steps, for example, as described in International Patent Publication WO2019 / 094952. In some embodiments, the dendrimer backbone has non-cleavable polyether bonds throughout the structure, avoiding the in vivo disintegration of the dendrimer and allowing such dendrimers to disappear from the body as a single entity (non-biodegradable).

[0073] In some embodiments, dendrimers specifically target specific tissue regions and / or cell types, preferably activated macrophages, such as activated microglia in the CNS. In preferred embodiments, dendrimers specifically target specific tissue regions and / or cell types that do not have a targeting moiety. For example, it has been established that hydroxyl (-OH)-terminated dendrimers can cross the blood-brain barrier (BBB) ​​and penetrate into / throughout brain tissue to selectively internalize into activated microglia in areas of inflammation in the brain.

[0074] Thus, in a preferred embodiment, the dendrimer has multiple hydroxyl (-OH) groups on the periphery of the dendrimer. The preferred hydroxyl (-OH) group surface density is at least 1 OH group / nm 2 (number of hydroxyl surface groups / nm surface area 2For example, in some embodiments, the hydroxyl group surface density is greater than 2, 3, 4, 5, 6, 7, 8, 9, 10; preferably at least 10, 15, 20, 25, 30, 35, 40, 45, 50, or greater than 50. In further embodiments, the hydroxyl (-OH) group surface density is between about 1 and about 50, preferably 5-20 OH groups / nm 2 (number of hydroxyl surface groups / nm surface area 2 ) and at the same time have a molecular weight between about 500 Da and about 10 kDa.

[0075] In some embodiments, dendrimers may have a fraction of hydroxyl groups exposed on the exterior surface, with another fraction in the interior core of the dendrimer. In preferred embodiments, dendrimers have at least 1 OH group / nm 3 (number of hydroxyl groups / volume nm 3 For example, in some embodiments, the hydroxyl group volume density is 2, 3, 4, 5, 6, 7, 8, 9, 10, or greater than 10, 15, 20, 25, 30, 35, 40, 45, and 50. In some embodiments, the hydroxyl group volume density is from about 4 to about 50 groups / nm 3 , preferably about 5 to about 30 groups / nm 3 , and more preferably about 10 to about 20 groups / nm 3 It is.

[0076] In some embodiments, the dendrimer specifically targets a particular tissue region and / or cell type after administration to the body. In a preferred embodiment, the dendrimer specifically targets a particular tissue region and / or cell type without a targeting moiety.

[0077] 2. Glucose-based dendrimers In some embodiments, the dendrimer has a hypercore (e.g., dipentaerythritol) and one or more monosaccharide branching units. In some embodiments, the monosaccharide branching units are conjugated to the core or to a prior layer of monomers via a linker, e.g., a polyethylene glycol chain. In a preferred embodiment, the hypercore is dipentaerythritol and the monosaccharide branching units are glucose-based branching units.

[0078] In a further embodiment, the spacer molecule is also alkyl(CH2). n -hydrocarbon-like units. The branching units are PEG or alkyl chain linkers between dendrimers of different generations, e.g., glucose layers are linked via PEG linkers and triazole rings.

[0079] Dendrimers synthesized using glucose building blocks, with surfaces made up mostly of glucose moieties, enable targeted delivery to selected cells, including damaged neurons, ganglion cells and other neuronal cells in the brain and eye.

[0080] In one embodiment, the glucose-based dendrimers are selectively targeted to or enriched within neurons, particularly neuronal nuclei. In a preferred embodiment, the glucose-based dendrimers are selectively targeted to or enriched within injured, diseased, and / or overactive neurons.

[0081] In a preferred embodiment, the dendrimer comprises an effective number of terminal glucose and / or hydroxyl groups for targeting one or more neurons of the CNS or eye. The hydroxyl groups on the dendrimer surface are part of glucose molecules. There are no extra hydroxyls other than the glucose molecules on the surface. The number of sugar molecules on the surface is determined by the number of generations. It is expected that every generation will target neurons.

[0082] In some embodiments, dendrimers are made from glucose and oligoethylene glycol building blocks. Exemplary glucose dendrimers are shown in the Examples, for example, a first generation dendrimer is shown in FIG. 22 and a second generation dendrimer is shown in FIG. 23. Some exemplary glucose dendrimers include a first generation glucose dendrimer with 24 hydroxyl (-OH) end groups, a second generation glucose dendrimer with 96 hydroxyl (-OH) end groups, a third generation glucose dendrimer with 396 hydroxyl (-OH) end groups, and a fourth generation glucose dendrimer with 1584 hydroxyl (-OH) end groups. In a preferred embodiment, the glucose dendrimer is a second generation glucose-based dendrimer with 24 glucose molecules at the periphery and 6 glucose molecules embedded in the backbone held by PEG segments.

[0083] In some embodiments, the glucose dendrimer is functionalized to conjugate to additional moieties, for example, via SPDP and one or more PEG segments as shown in Figure 24. In some embodiments, the glucose dendrimer is conjugated to an siRNA as shown in Figure 25.

[0084] Thus, in some embodiments, one or more functional nucleic acids are conjugated to glucose dendrimers to selectively target or enrich in damaged, diseased, and / or hyperactive neurons.Exemplary functional nucleic acids are antisense molecules, small interfering RNA (siRNA), microRNA (miRNA), aptamers, ribozymes, triplex-forming molecules, or external guide sequences.Preferred functional nucleic acids are siRNA or miRNA.In certain embodiments, miRNA is miR-126.

[0085] B. Coupling Agents and Spacers Dendrimer complexes are formed from small molecule biologics conjugated to dendrimers, dendritic polymers or hyperbranched polymers via one or more spacers / linkers. Typically, active agents are linked to dendrimers via one or more linkages, such as disulfide, ester, carbonate, carbamate, thioester, hydrazine, hydrazide, and amide linkages. In preferred embodiments, one or more spacers / linkers between the dendrimer and the drug are designed to provide an in vivo releasable or non-releasable form of the dendrimer-active complex. In some embodiments, the linkage occurs via a suitable spacer that provides an ester bond between the drug and the dendrimer. In some embodiments, the linkage occurs via a suitable spacer that provides an amide bond between the drug and the dendrimer. In preferred embodiments, one or more spacers / linkers between the dendrimer and the drug are added to achieve desired and effective release kinetics in vivo.

[0086] The term "spacer" includes compositions used to link active agents (e.g., functional nucleic acids) to dendrimers. Spacers can be either a single chemical entity or two or more chemical entities that are linked together to bridge the polymer and the therapeutic or imaging agent. Spacers can include any small chemical entity, peptide or polymer with sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone, and carbonate termini. Spacers can be selected from the classes of compounds terminated with sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone, and carbonate groups.

[0087] In a preferred embodiment, the spacer includes a thiopyridine terminated compound, such as dithiodipyridine, N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate LC-SPDP, or sulfo-LC-SPDP.

[0088] In some embodiments, the spacer can include linear or cyclic peptides substantially having sulfhydryl groups, such as glutathione, homocysteine, cysteine ​​and derivatives thereof, arg-gly-asp-cys (RGDC), cyclo(Arg-Gly-Asp-d-Phe-Cys) (c(RGDfC)), cyclo(Arg-Gly-Asp-D-Tyr-Cys), cyclo(Arg-Ala-Asp-d-Tyr-Cys). The spacer can be a mercapto acid derivative, such as 3-mercaptopropionic acid, mercaptoacetic acid, 4-mercaptobutyric acid, thiolan-2-one, 6-mercaptohexanoic acid, 5-mercaptovaleric acid, and other mercapto derivatives, such as 2-mercaptoethanol and 2-mercaptoethylamine. Spacers can be thiosalicylic acid and its derivatives, (4-succinimidyloxycarbonyl-methyl-alpha-2-pyridylthio)toluene, (3-[2-pyridylthio]propionylhydrazide. Spacers can be maleimide terminated, spacers include polymers or small chemical entities such as bis-maleimide diethylene glycol and bis-maleimide triethylene glycol, bis-maleimide ethane, bismaleimide hexane. Spacers can include vinyl sulfones such as 1,6-hexane-bis-vinyl sulfone. Spacers can include thioglycosides such as thioglucose. Spacers can be reduced proteins such as bovine serum albumin and human serum albumin, any thiol-terminated compound capable of forming a disulfide bond. Spacers can include sulfhydryls, thiopyridines, maleimides, succinimidyls, and thiol-terminated polyethylene glycols.

[0089] The active agent may be covalently bound, intramolecularly dispersed, or encapsulated. In a preferred embodiment, the active agent is covalently bound to the dendrimer. The dendrimer is preferably a PAMAM dendrimer of up to generation 10, and is carboxyl, hydroxyl, or amine terminated. In a preferred embodiment, the dendrimer is a hydroxyl terminated PAMAM dendrimer linked to the active agent via a spacer that terminates in a disulfide bond.

[0090] 1. In vivo releasable linker In a preferred embodiment, one or more small molecule active agents are covalently conjugated to the dendrimer via an in vivo releasable linker. Typically, the covalent binding to the dendrimer stabilizes the active agent, extends the serum half-life of the agent in vivo, prevents enzymatic degradation, and simultaneously maintains the active agent in a non-functional form. In some embodiments, the linker is designed and selected such that the active agent is released from the covalent bond to the dendrimer at a predetermined time or location in vivo, for example, within the intracellular environment. Thus, in some forms, the small molecule biologic, e.g., functional nucleic acid, is stably maintained in serum in a protected but functionally inactive form, but is released to function when internalized into a cell. Thus, in some embodiments, the dendrimer / small molecule biologic includes an in vivo releasable linker that releases the active agent from the dendrimer, for example, by splitting the disulfide bond between the dendrimer and the agent. In some embodiments, the in vivo releasable linker is sensitive to one or more of protease activity, pH, and glutathione concentration. The glutathione concentration release strategy takes advantage of intracellular glutathione concentrations that are higher than those in plasma. Thus, disulfide-containing linkers release cytotoxins after reduction by glutathione. Exemplary glutathione-sensitive linkers are N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), glutathione (GSH), and gamma-aminobutyric acid (GABA). Exemplary protease-sensitive strategies utilize the predominant proteases found in the lysosomes of tumor cells to recognize and cleave specific peptide sequences in the linker, e.g., valine-citrulline (VC) dipeptide, as an intracellular cleavage mechanism by cathepsin B. The acid-sensitive strategy uses endosomal (pH=5-6) and lysosomal (pH=4.8) compartments, which have a lower pH compared to the cytoplasm (pH=7.4), to trigger hydrolysis of acid-labile groups in the linker, e.g., hydrazone.

[0091] In a preferred embodiment, the linker releases the small molecule biologic from the dendrimer within the intracellular environment, such that the activity of the small molecule is restricted to the interior of the target cell. In an exemplary embodiment, the dendrimer complex comprises an OH-terminated PAMAM dendrimer covalently attached to one or more small molecule biologics, e.g., functional nucleic acids, via a glutathione-releasable linker, e.g., an SPDP linker.

[0092] C. Small Molecule Biologics The dendrimer is covalently linked to one or more small molecule biologics. The term biologic encompasses a diverse selection of compounds of biological origin, such as peptides, nucleic acid-based compounds, cytokines, alternative enzymes, various recombinant proteins, and monoclonal antibodies. In preferred embodiments, the small molecule biologics include siRNAs, oligonucleotides, microRNAs, and therapeutic proteins. The molecular weight of the small molecule biologic is less than 50,000 amu, preferably less than 20,000 amu, and more preferably 5,000-15,000 daltons. In some embodiments, the small molecule biologic associated with or conjugated to the dendrimer includes one or more functional nucleic acids.

[0093] 1.Functional nucleic acid Described herein are functional nucleic acids that inhibit the transcription, translation or function of target genes. Functional nucleic acids are nucleic acid molecules that have specific functions, such as binding to target molecules or catalysis of specific reactions. As discussed in more detail below, functional nucleic acid molecules can be divided into the following categories: antisense molecules, siRNAs, miRNAs, aptamers, ribozymes, triplex-forming molecules, RNAi, and external guide sequences. Functional nucleic acid molecules can act as effectors, inhibitors, modulators, or stimulators of the specific activity of target molecules, or they can have de novo activity independent of any other molecules.

[0094] A functional nucleic acid molecule can interact with any macromolecule, such as DNA, RNA, polypeptide, or carbohydrate chain. Thus, a functional nucleic acid can interact with the mRNA or genomic DNA of a target polypeptide, or can interact with the target polypeptide itself. Functional nucleic acids are often designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule. In other situations, the specific recognition between a functional nucleic acid molecule and a target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather on the formation of a tertiary structure that allows for specific recognition. Thus, a composition may include one or more functional nucleic acids designed to reduce the expression or function of a target protein.

[0095] The method of making and using vectors for expressing the described functional nucleic acids in vivo, such as antisense oligonucleotides, siRNAs, shRNAs, miRNAs, EGSs, gRNAs, sgRNAs, ribozymes and aptamers, is known in the art.Administering functional nucleic acid to a subject as dendrimer-functional nucleic acid complex typically enhances the serum half-life of functional nucleic acid compared to the serum half-life of functional nucleic acid administered alone.In some embodiments, conjugation with dendrimer shields functional nucleic acid from enzymatic or proteolytic degradation, and prevents non-specific cellular uptake and / or activity of functional nucleic acid.

[0096] Typically, conjugation with a dendrimer induces the in vivo distribution of the functional nucleic acid to one or more sites targeted by the dendrimer complex.For example, conjugation with an OH-terminated dendrimer induces the in vivo distribution of the functional nucleic acid to one or more sites of inflammation after systemic administration.In certain embodiments, conjugation with an OH-terminated dendrimer induces the in vivo distribution of the functional nucleic acid to one or more sites of neuroinflammation or neurological damage in the brain and / or CNS after systemic administration.

[0097] A. antisense oligonucleotide In some embodiments, the functional nucleic acid is an antisense oligonucleotide. Antisense oligonucleotides are designed to interact with target nucleic acid molecules by either standard or non-standard base pairing. The interaction between the antisense molecule and the target molecule is designed to promote the destruction of the target molecule, for example, by RNase H-mediated RNA-DNA hybrid degradation. Alternatively, the antisense molecule is designed to interfere with processing functions that would normally occur on the target molecule, such as transcription or replication. Antisense molecules may be designed based on the sequence of the target molecule. There are many methods to optimize antisense efficiency by finding the most accessible regions of the target molecule. Exemplary methods include in vitro selection experiments and DNA modification studies using DMS and DEPC. Antisense molecules are designed to interact with the target molecule for 10 minutes or more. -6 , 10 -8 , 10 -10 , or 10 -12 It is preferred that they bind with a dissociation constant (Kd) less than or equal to that of the corresponding nucleotide.

[0098] b. Silencing RNA (RNA interference) In some embodiments, the functional nucleic acid induces gene silencing by RNA interference (siRNA). The expression of target genes can be effectively silenced in a highly specific manner by RNA interference.

[0099] RNA polynucleotides with interference activity for a given gene will cause the degradation of specific messenger RNA (mRNA) with the corresponding complementary sequence, thus downregulating the gene by preventing protein production (see Sledz and Williams, Blood, 106(3):787-794 (2005)). When an RNA molecule forms a complementary Watson-Crick base pair with an mRNA, it induces mRNA cleavage by accessory proteins. The source of RNA can be viral infection, transcription, or introduction from an exogenous source.

[0100] Gene silencing was originally observed by the addition of double-stranded RNA (dsRNA) (Fire, et al. (1998) Nature, 391:806-11; Napoli, et al. (1990) Plant Cell 2:279-89; Hannon, (2002) Nature, 418:244-51). Once dsRNA enters a cell, it is cleaved by an RNase III-like enzyme called Dicer into 21-23 nucleotide long double-stranded small interfering RNAs (siRNAs) containing two nucleotide overhangs on the 3' end (Elbashir, et al., Genes Dev., 15:188-200 (2001); Bernstein, et al., Nature, 409:363-6 (2001); Hammond, et al., Nature, 404:293-6 (2000); Nykanen, et al., Cell, 107:309-21 (2001); Martinez, et al., Cell, 110:563-74 (2002)). The effect of iRNA or siRNA or their use is not limited to any type of mechanism.

[0101] In one embodiment, siRNAs cause specific degradation of homologous RNA molecules, such as mRNAs, within the region of sequence identity between both the siRNA and the target RNA. Sequence-specific gene silencing can be achieved in mammalian cells using short double-stranded synthetic RNAs that mimic the siRNAs produced by the Dicer enzyme (Elbashir, et al., Nature, 411:494-498 (2001)) (Ui-Tei, et al., FEBS Lett, 479:79-82 (2000)). siRNAs can be chemically or in vitro synthesized, or can be the result of short double-stranded hairpin-like RNAs (shRNAs) that are processed into siRNAs inside the cell. For example, WO02 / 44321 describes that siRNAs can sequence-specifically degrade target mRNAs when base-paired with 3' overhanging ends, and that application is specifically incorporated herein by reference for the methods of making those siRNAs. Synthetic siRNAs are typically designed using algorithms and conventional DNA / RNA synthesizers. Suppliers include Ambion (Austin, Texas), ChemGenes (Ashland, Massachusetts), Dharmacon (Lafayette, Colorado), Glen Research (Sterling, Virginia), MWB Biotech (Esbersberg, Germany), Proligo (Boulder, Colorado), and Qiagen (Vento, The Netherlands). siRNAs may also be synthesized in vitro using kits, such as Ambion's SILENCER® siRNA Construction kit.

[0102] Thus, in some embodiments, the dendrimer comprises one or more siRNAs, or one or more vectors expressing siRNAs. More commonly, siRNA production from vector is carried out by transcription of short hairpin RNA (shRNA). Kits for producing vectors containing shRNA are available, such as Imgenex's GENESUPPRESSOR™ Construction kit and Invitrogen's BLOCK-IT™ Inducible RNAi Plasmid and Lentiviral Vector. In some embodiments, the functional nucleic acid is siRNA, shRNA, or miRNA.

[0103] i. MicroRNA (miRNA) In some embodiments, the silencing RNA is microRNA (miRNA). MicroRNA (miRNA) is a type of non-coding RNA that plays an important role in regulating gene expression. miRNA binds to target sequences and reduces the expression of target genes. miRNA directly binds to DNA and blocks transcription, or directly binds to transcribed mRNA and blocks translation, directing mRNA to degradation.

[0104] miRNAs are small non-coding RNAs with an average length of 22 nucleotides. Most miRNAs are transcribed from DNA sequences into primary miRNAs (pri-miRNAs), which are then processed into precursor miRNAs (pre-miRNAs) and mature miRNAs. In most cases, miRNAs interact with the 3' untranslated region (3'UTR) of target mRNAs to induce mRNA degradation and translational repression. However, interactions of miRNAs with other regions, including 5'UTRs, coding sequences, and gene promoters, have also been reported. Under certain conditions, miRNAs may activate translation or regulate transcription. The interaction of miRNAs with their target genes is dynamic and depends on many factors, such as the intracellular location of the miRNA, the abundance of the miRNA and the target mRNA, and the affinity of the miRNA-mRNA interaction. miRNAs can be secreted into the extracellular fluid and transported to target cells by vesicles, such as exosomes, or by binding to proteins, including Argonaute. Extracellular miRNAs function as chemical messengers to mediate cell-cell communication (O'Brien et al, Front. Endocrinol., 9, pp.402 (2018)).

[0105] In most cases, miRNAs interact with the 3'UTR of target mRNAs to repress their expression or with other regions, including the 5'UTR, coding sequences, and gene promoters. miRNAs shuttle between different cellular compartments and control the rate of translation and even transcription.

[0106] Described herein are dendrimers that are covalently linked to miRNAs via one or more releasable linkers. In a preferred embodiment, the dendrimers are G2-G10 generation OH-terminated PAMAM dendrimers that are covalently linked to one or more miRNAs via releasable linkers for intracellular release of the miRNAs into target cells, e.g., activated macrophage or microglial cells.

[0107] (1)miR-126 In some embodiments, the microRNA (miRNA) is miR-126miRNA. miR-126 is a human microRNA that is expressed only in endothelial cells ranging from capillaries to large blood vessels, and acts on various transcripts to regulate angiogenesis. miR-126 is located in the 7th intron of the EGFL7 gene on human chromosome 9 (Meister et al., Scientific World Journal. 10: 2090-100. doi:10.1100 / tsw.2010.198 (2010)).

[0108] miR-126 is regulated by the binding of two transcription factors, ETS1 and ETS2, whose binding induces transcription of the miR-126 pre-miRNA, leading to the formation of a hairpin pri-miRNA, which is targeted and cleaved by Dicer to produce mature miR-126 and miR-126 * Epigenetic regulation of host genes through methylation and accumulation of gene silencing nucleosomes reduces expression of intronic miRNAs, as observed in cancers that benefit from silencing of both EGFL7 and miR-126, both of which are lost.

[0109] One of the main targets of miR-126 is the host gene EGFL7. Mature miR-126 binds to the complementary sequence in EGFL7, inhibits the translation of mRNA, and reduces EGFL7 protein levels. EGFL7 is known to be involved in cell migration and angiogenesis, and EGFL7 and miR-126 are favorable targets for diseases that require the continuous formation of blood vessels to feed tumors and cell migration pathways to mediate tissue invasion, such as cancer. Targets of miR-126 include CRK (a protein involved in intracellular signaling pathways involved in the regulation of cell adhesion, proliferation, migration, and invasion); TOM1 (a negative regulator of the IL-1 beta and TNF-alpha signaling pathways); CXCL12 (a chemokine regulated by miR-126); POU3F1 (a factor required for activation of the transcription factor PU.1); VEGF-α (protein production is decreased when miR-126 binds to the 3' untranslated region of VEGF-α mRNA); IRS-1 (inhibits progression from G0 / G1 to S phase of the cell cycle); and HOXA9 (miR-126 modulates HOXA9 expression in hematopoietic cells).

[0110] The nucleic acid sequence for the miR-126 miRNA is: 5'CAUUAUUACUUUUGGUACGCG-3' (SEQ ID NO: 1) It is.

[0111] C. Aptamer In some embodiments, the functional nucleic acid is an aptamer. An aptamer is a molecule that interacts with a target molecule, preferably in a specific manner. Typically, aptamers are small nucleic acids ranging from 15 to 50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets. Aptamers can bind small molecules, such as ATP and theophylline, as well as large molecules, such as reverse transcriptase and thrombin. Aptamers have a Kd value of 10 from the target molecule. -12 Aptamers can bind very strongly to target molecules with a molecular weight of less than 10 M. -6 , 10-8 , 10 -10 , or 10 -12 It is preferred that the aptamer binds with a Kd of less than 1 / 10,000. Aptamers can bind to target molecules with very high specificity. For example, aptamers have been isolated that have a binding affinity between the target molecule and another molecule that differs only at one position on the molecule that is more than 10,000 times different. It is preferred that the aptamer has a Kd with the target molecule that is at most 1 / 10, 1 / 1000, 1 / 10,000, or 1 / 100,000 of the Kd of background binding molecules. When comparing molecules such as polypeptides, it is preferred that the background molecule is a different polypeptide.

[0112] D ribozyme The functional nucleic acid may be a ribozyme. Ribozymes are nucleic acid molecules that can catalyze chemical reactions, either intramolecularly or intermolecularly. Ribozymes preferably catalyze intermolecular reactions. Different types of ribozymes that catalyze nuclease or nucleic acid polymerase type reactions based on ribozymes found in natural systems, such as hammerhead ribozymes, are described. Ribozymes that are not found in natural systems but are engineered to catalyze specific reactions de novo are also described. Preferred ribozymes cleave RNA or DNA substrates, more preferably RNA substrates. Ribozymes typically cleave nucleic acid substrates by recognizing, binding to and then cleaving the target substrate. This recognition is often based largely on standard or non-standard base pairing interactions. This property makes ribozymes particularly good candidates for targeting specific cleavage of nucleic acids, since recognition of the target substrate is based on the sequence of the target substrate.

[0113] e. Triplex-forming oligonucleotides The functional nucleic acid may be a triplex-forming oligonucleotide molecule. A triplex-forming functional nucleic acid molecule is a molecule that can interact with either double-stranded or single-stranded nucleic acid. When a triplex molecule interacts with a target region, a structure called a triplex is formed in which there are three strands of DNA that form a complex that relies on both Watson-Crick base pairing and Hoogsteen base pairing. Triplex molecules are preferred because they can bind to target regions with high affinity and specificity. Triplex-forming molecules bind to target molecules with a high affinity and specificity. -6 , 10 -8 , 10 -10 , or 10 -12 It is preferred that the binding occurs with a Kd of less than 0.05.

[0114] f. External guide sequence The functional nucleic acid may be an external guide sequence. An external guide sequence (EGS) is a molecule that binds to a target nucleic acid molecule and forms a complex that is recognized by RNase P, which then cleaves the target molecule. An EGS may be designed to specifically target a selected RNA molecule. RNase P aids in the processing of transfer RNA (tRNA) in cells. Bacterial RNase P can be recruited to cleave virtually any RNA sequence by using an EGS that allows the target RNA:EGS complex to mimic the natural tRNA substrate. Similarly, eukaryotic EGS / RNase P-directed RNA cleavage may be utilized to cleave a desired target in a eukaryotic cell. Representative examples of how to make and use EGS molecules to facilitate cleavage of a variety of different target molecules are known in the art.

[0115] D. Additional medication to be delivered The dendrimer-small biologic conjugates can be used to deliver one or more additional active agents, in particular one or more active agents for preventing or treating one or more symptoms of a target disease or disorder. Suitable therapeutic, diagnostic, and / or prophylactic agents may be biomolecules, such as peptides, proteins, carbohydrates, nucleotides, or oligonucleotides. The agents may be encapsulated within the dendrimer, dispersed within the dendrimer, and / or covalently or non-covalently associated with the dendrimer surface.

[0116] Dendrimers have the advantage that multiple therapeutic, preventive, and / or diagnostic agents can be delivered using the same dendrimer. One or more types of agents may be encapsulated, complexed, or conjugated to the dendrimer. In one embodiment, the dendrimer is complexed or conjugated to two or more different classes of agents to provide simultaneous delivery with different or independent release kinetics at the target site. In another embodiment, the dendrimer is covalently linked to at least one detectable moiety and at least one class of agent. In a further embodiment, dendrimer complexes each carrying a different class of agent are administered simultaneously for combination treatment.

[0117] 1. Therapeutic and preventive drugs In some embodiments, the dendrimer-small biologic conjugate comprises one or more additional therapeutic or prophylactic agents. Exemplary additional therapeutic or prophylactic agents include anti-inflammatory agents, chemotherapeutic agents, and anti-infective agents.

[0118] Anti-inflammatory agent In some embodiments, the composition comprises one or more anti-inflammatory agents that reduce inflammation, including steroidal and non-steroidal agents.

[0119] Preferred anti-inflammatory drugs are antioxidants, including N-acetylcysteine. Preferred nonsteroidal anti-inflammatory drugs ("NSAIDS") include mefenamic acid, aspirin, diflunisal, salsalate, ibuprofen, naproxen, fenoprofen, ketoprofen, deaketoprofen, flurbiprofen, oxaprozin, loxoprofen, indomethacin, sulindac, etodolac, ketorolac, diclofenac, nabumetone, piroxicam, meloxicam, tenoxicam, droxicam, lornoxicam, isoxicam, meclofenamic acid, flufenamic acid, tolfenamic acid, elecoxib, rofecoxib, valdecoxib, parecoxib, lumiracoxib, etoricoxib, firocoxib, sulfonanilides, nimesulide, niflumic acid, and licofelone.

[0120] Representative small molecules include steroids such as methylprednisone, dexamethasone, nonsteroidal anti-inflammatory agents including COX-2 inhibitors, corticosteroidal anti-inflammatory agents, gold compound anti-inflammatory agents, immunosuppressants, anti-inflammatory agents and anti-angiogenic agents, anti-excitotoxic agents such as valproic acid, D-aminophosphonovalerate, D-aminophosphonoheptanoate, glutamate formation / release inhibitors such as baclofen, NMDA receptor antagonists, salicylate anti-inflammatory agents, anti-VEGF agents including ranibizumab, aflibercept, and rapamycin. Other anti-inflammatory agents include nonsteroidal drugs such as indomethacin, aspirin, acetaminophen, diclofenac sodium, and ibuprofen. Corticosteroids may be fluocinolone acetonide and methylprednisolone.

[0121] Exemplary immune modulating agents include cyclosporine, tacrolimus and rapamycin. In some embodiments, the anti-inflammatory agent is a biologic drug that blocks the action of one or more immune cell types, such as T cells, or blocks proteins in the immune system, such as tumor necrosis factor-alpha (TNF-alpha), interleukin 17-A, interleukin 12 and 23.

[0122] In some embodiments, the anti-inflammatory drug is a synthetic or natural anti-inflammatory low molecular weight protein.An antibody specific to a selected immune component can be added to the immunosuppressive therapy.In some embodiments, the anti-inflammatory drug is a fragment of an anti-T cell antibody (e.g., anti-thymocyte globulin or anti-lymphocyte globulin), an anti-IL-2Rα receptor antibody (e.g., basiliximab or daclizumab), or an anti-CD20 antibody (e.g., rituximab).

[0123] Many inflammatory diseases may be linked to pathologically elevated signaling through Toll-like receptor 4 (TLR4), the receptor for lipopolysaccharide (LPS). Thus, there is great interest in discovering TLR4 inhibitors as potential anti-inflammatory agents. Recently, the structure of TLR4 bound to the inhibitor E5564 has been elucidated, allowing the design and synthesis of novel TLR4 inhibitors that target the E5564-binding domain. This is described in U.S. Pat. No. 8,889,101. Similarity searching algorithms used in combination with limited screening approaches of small molecule libraries have identified compounds that bind to the E5564 site and inhibit TLR4, as reported by Neal, et al., PLoS One. 2013; 8(6): e65779e. The lead compound, C34, has the formula C 17 H 272-acetamidopyranoside with NO9 (MW389) inhibits TLR4 in intestinal cells and macrophages in vitro and reduces systemic inflammation in mouse models of endotoxemia and necrotizing enterocolitis. Thus, in some embodiments, the active agent is one or more TLR4 inhibitors. In a preferred embodiment, the active agent is C34 and its derivatives and analogs.

[0124] In preferred embodiments, the one or more anti-inflammatory drugs are released in an amount effective to inhibit inflammation from the dendrimer nanoparticles for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, preferably at least 1 week, 2 weeks, or 3 weeks, more preferably at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months after administration to a mammalian subject.

[0125] B. Chemotherapeutic agents Chemotherapeutic agents generally include pharmacologic or therapeutically active compounds that act by interfering with DNA synthesis or function in cancer cells. Based on their chemical action at the cellular level, chemotherapeutic agents can be classified into cell cycle specific agents (effective during a certain phase of the cell cycle) and cell cycle non-specific agents (effective in all phases of the cell cycle). Examples of chemotherapeutic agents include alkylating agents, angiogenesis inhibitors, aromatase inhibitors, antimetabolites, anthracyclines, antitumor antibiotics, platinum drugs, topoisomerase inhibitors, radioisotopes, radiosensitizers, checkpoint inhibitors, PD1 inhibitors, plant alkaloids, glycolysis inhibitors and their prodrugs.

[0126] Examples of PD-1 inhibitors include, for example, MDX-1106, a genetically engineered fully human immunoglobulin G4 (IgG4) monoclonal antibody specific for human PD-1, and pembrolizumab, which was recently approved by the US FDA. The fragment may be conjugated to a dendrimer.

[0127] Representative chemotherapeutic agents include, but are not limited to, amsacrine, bleomycin, busulfan, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clofarabine, crisantaspase, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin, docetaxel, doxorubicin, epipodophyllotoxin, epirubicin, etoposide, etoposide phosphate, fludarabine, fluorouracil, gemcitabine, hydroxycarbamide, idarubicin, ifosfamide, irinotecan, leucovorin, liposomal doxorubicin, liposomal daunorubicin, lomustine, mechlorethamine, melpha oran, mercaptopurine, mesna, methotrexate, mitomycin, mitoxantrone, oxaliplatin, paclitaxel, pemetrexed, pentostatin, procarbazine, raltitrexed, satraplatin, streptozocin, teniposide, tegafur-uracil, temozolomide, teniposide, thiotepa, thioguanine, topotecan, treosulfan, vinblastine, vincristine, vindesine, vinorelbine, taxol and its derivatives, trastuzumab (HERCEPTIN®), cetuximab, and rituximab (RITUXAN® or MABTHERA®), bevacizumab (AVASTIN®), and combinations thereof. Representative pro-apoptotic agents include, but are not limited to, fludarabine taurosporine, cycloheximide, actinomycin D, lactosylceramide, 15d-PGJ(2)5, and combinations thereof.

[0128] Dendrimer complexes containing one or more chemotherapeutic agents may be used prior to or in conjunction with immunotherapy, adoptive T cell therapy, and / or cancer vaccines that inhibit checkpoint proteins, such as PD-1 or CTLA-4. Methods for priming and activating T cells in vitro for adaptive T cell cancer therapy are known in the art. See, for example, Wang, et al, Blood, 109(11):4865-4872 (2007) and Hervas-Stubbs, et al, J. Immunol., 189(7):3299-310 (2012). Examples of cancer vaccines include, for example, PROVENGE® (sipuleucel-T), a dendritic cell-based vaccine for treating prostate cancer (Ledford, et al., Nature, 519, 17-18 (05 March 2015)). Such vaccines, as well as other compositions and methods for immunotherapy, are reviewed in Palucka, et al., Nature Reviews Cancer, 12, 265-277 (April 2012).

[0129] In some embodiments, the dendrimer complex is effective for treating, imaging, and / or preventing brain microglial inflammation in neurodevelopmental disorders, including Rett syndrome. In a preferred embodiment, the dendrimer complex will be used to deliver anti-inflammatory agents (D-NAC) and anti-excitotoxic agents and D-antiglutamate agents. Preferred candidates are MK801, memantine, ketamine, 1-MT.

[0130] C. Neuroactive agents Several drugs have been developed and used in an attempt to interfere with, affect, or temporarily halt the glutamate excitotoxicity cascade toward neuronal damage. One strategy is an "upstream" attempt to reduce glutamate release. This category of drugs includes the sodium channel blockers riluzole, lamotrigine, and lifarizine. The commonly used nimodipine is a voltage-dependent channel (L-type) blocker. Attempts have also been made to affect various sites on the coupled glutamate receptor itself. Some of these drugs include felbamate, ifenprodil, magnesium, memantine, and nitroglycerin. These "downstream" drugs attempt to affect intracellular events, such as free radical formation, nitric oxide formation, protein degradation, endonuclease activity, and ICE-like protease formation (a key component in the process that triggers programmed cell death or apoptosis).

[0131] The active agent for treating neurodegenerative disease is well known in the art and can be changed based on the symptoms and disease to be treated.For example, the conventional treatment for Parkinson's disease can include levodopa (usually combined with dopa decarboxylase inhibitor or COMT inhibitor), dopamine agonist, or MAO-B inhibitor.

[0132] Treatments for Huntington's disease may include dopamine blockers to help reduce abnormal behavior and movement, or drugs to control movement, such as amantadine and tetrabenazine. Other drugs that help reduce chorea include neuroleptics and benzodiazepines. Compounds such as amantadine or remacemide have shown preliminary positive results. Hypokinesia and rigidity, especially in juvenile cases, may be treated with anti-Parkinson's drugs, and myoclonic hyperkinesia may be treated with valproic acid. Psychiatric symptoms may be treated with medications similar to those used in the general population. Selective serotonin reuptake inhibitors and mirtazapine are recommended for depression, while atypical antipsychotic drugs are recommended for psychosis and behavioral disorders.

[0133] The anti-excitotoxin riluzole (RILUTEK®) (2-amino-6-(trifluoromethoxy)benzothiazole) has improved survival in subjects with ALS. Other medications are mostly off-label and can intervene to reduce symptoms caused by ALS. Some treatments improve quality of life and some appear to extend lifespan. Common ALS-related therapies are reviewed in Gordon, Aging and Disease, 4(5):295-310 (2013), see, e.g., Table 1 therein. Several other drugs are being tested in one or more clinical trials, with efficacy ranging from ineffective to promising. Exemplary drugs are reviewed in Carlesi, et al., Archives Italiennes de Biologie, 149:151-167 (2011). For example, treatments include agents that reduce excitotoxicity, such as talampanel (8-methyl-7H-1,3-dioxolo(2,3)benzodiazepine), cephalosporins, such as ceftriaxone, or memantine; agents that reduce oxidative stress, such as coenzyme Q10, manganoporphyrin, KNS-760704 [(6R)-4,5,6,7-tetrahydro-N6-propyl-2,6-benzothiazole-diamine dihydrochloride, RPPX], or edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one, MCI-186). agents that reduce apoptosis, such as histone deacetylase (HDAC) inhibitors including valproic acid, TCH346 (dibenzo(b,f)oxepin-10-ylmethyl-methylprop-2-ynylamine), minocycline, or tauroursodeoxycholic acid (TUDCA); agents that reduce neuroinflammation, such as thalidomide and cerlastol; neurotropic agents, such as insulin-like growth factor 1 (IGF-1) or vascular endothelial growth factor (VEGF); heat shock protein inducers, such as arimoclomol; or autophagy inducers, such as rapamycin or lithium.

[0134] Treatments for Alzheimer's disease can include, for example, acetylcholinesterase inhibitors, such as tacrine, rivastigmine, galantamine, or donepezil; NMDA receptor antagonists, such as memantine; or antipsychotic drugs.

[0135] Treatments for Lewy body dementia can include, for example, acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, or donepezil; the N-methyl d-aspartate receptor antagonist memantine; dopamine therapy, for example, levodopa or selegiline; antipsychotics, for example, olanzapine or clozapine; REM disorder therapy, for example, clonazepam, melatonin, or quetiapine; antidepressant and anti-anxiety therapy, for example, selective serotonin reuptake inhibitors such as citalopram, escitalopram, sertraline, paroxetine, or serotonin and noradrenaline reuptake inhibitors such as venlafaxine, mirtazapine, and bupropion (see, for example, Macijauskiene, et al., Medicina (Kaunas), 48(1):1-8 (2012)).

[0136] Exemplary neuroprotective agents are also known in the art and include, for example, glutamate antagonists, antioxidants, and NMDA receptor agonists. Other neuroprotective agents and treatments include caspase inhibitors, trophic factors, anti-protein aggregation agents, therapeutic hypothermia, and erythropoietin.

[0137] Other common active agents for treating neurological dysfunction include amantadine and anticholinergics for treating motor symptoms, clozapine for treating psychosis, cholinesterase inhibitors for treating dementia, and modafinil for treating daytime sleepiness.

[0138] D. Anti-infective agents Antibiotics include beta-lactams such as penicillin and ampicillin, cephalosporins such as cefuroxime, cefaclor, cephalexin, cefadroxil, cepfodoxime and proxetil, tetracycline antibiotics such as doxycycline and minocycline, macrolide antibiotics such as azithromycin, erythromycin, rapamycin and clarithromycin, fluoroquinolones such as ciprofloxacin, enrofloxacin, ofloxacin, gatifloxacin, levofloxacin and norfloxacin, tobramycin, colistin, or aztreonam, and antibiotics known to have anti-inflammatory activity such as erythromycin, azithromycin, or clarithromycin.

[0139] 2. Diagnostic agents Dendrimer nanoparticles may contain diagnostic agents useful for determining the location of the administered particle. These agents may also be used prophylactically. Exemplary diagnostic materials include paramagnetic molecules, fluorescent compounds, magnetic molecules, and radionuclides. Suitable diagnostic agents include, but are not limited to, x-ray imaging agents and contrast agents. Radionuclides may also be used as imaging agents. Exemplary radiolabels include: 14 C. 36 Cl, 57 Co, 58 Co, 51 Cr, 125 I, 131 I, 111 Ln, 152 EU, 59 Fe, 67 Ga, 32 P, 186 Re, 35 S, 75 Se, 175Examples of other suitable contrast agents include radiopaque gases or gas-emitting compounds. In some embodiments, the imaging agent to be incorporated into the dendrimer nanoparticles is a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), or an element particle (e.g., gold particle).

[0140] In a further embodiment, a single dendrimer complex composition is capable of simultaneously treating and / or diagnosing a disease or condition at one or more locations in the body.

[0141] III. Pharmaceutical Preparations Pharmaceutical compositions comprising dendrimers covalently conjugated to one or more small molecule biological agents may be formulated in a conventional manner using one or more physiologically acceptable carriers, including excipients and auxiliary agents, which facilitate processing of the active compounds into pharma- ceutically usable preparations.

[0142] The appropriate formulation depends on the route of administration selected. In a preferred embodiment, the composition is formulated for parenteral delivery. In some embodiments, the composition is formulated for intravenous injection. Typically, the composition will be formulated in a sterile saline or buffer solution for injection into the tissue or cells to be treated. The composition may be stored lyophilized in a single-use vial for rehydration immediately before use. Other means for rehydration and administration are known to those skilled in the art.

[0143] The pharmaceutical formulation contains one or more dendrimers covalently conjugated to one or more small molecule biological agents in combination with one or more pharma- ceutically acceptable excipients. Representative excipients include solvents, diluents, pH modifiers, preservatives, antioxidants, suspending agents, wetting agents, viscosity modifiers, tonicity agents, stabilizers, and combinations thereof. Suitable pharma-ceutically acceptable excipients are preferably selected from materials that are generally recognized as safe (GRAS) and can be administered to an individual without causing undesired biological side effects or undesirable interactions.

[0144] In general, pharmaceutically acceptable salts may be prepared by reacting the free acid or free base form of the drug with a stoichiometric amount of a suitable base or acid in water or an organic solvent or a mixture of the two; generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Pharmaceutically acceptable salts include salts of drugs derived from inorganic acids, organic acids, alkali metal salts, and alkaline earth metal salts, as well as salts formed by reacting drugs with suitable organic ligands (e.g., quaternary ammonium salts). Lists of suitable salts can be found, for example, in Remington's Pharmaceutical Sciences, 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, p. 704. Examples of ophthalmic drugs that are sometimes administered in the form of pharmaceutically acceptable salts include timolol maleate, brimonidine tartrate, and diclofenac sodium.

[0145] The composition of dendrimers covalently conjugated to one or more small biologics is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The phrase "dosage unit form" refers to a physically discrete unit of the conjugate appropriate for the patient to be treated. However, it will be understood that the total single administration of the composition will be determined by the attending physician within the scope of sound medical judgment. The therapeutically effective dose may be estimated initially in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal models may be used to achieve a desired concentration range and route of administration. Such information should then be useful in determining useful doses and routes of administration in humans. The therapeutic efficacy and toxicity of the conjugates, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population), may be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of the toxic to therapeutic effect is the therapeutic index, and the LD 50 / ED 50 Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies can be used in formulating various dosages for use in humans.

[0146] In certain embodiments, the composition of the dendrimer covalently conjugated to one or more small biologics is administered locally, for example, by direct injection at the site to be treated. In some embodiments, the composition of the dendrimer covalently conjugated to one or more small biologics is injected, applied locally, or otherwise administered directly to the vasculature on vascular tissue at or near the site of injury, surgery, or implantation. For example, in embodiments, the composition of the dendrimer covalently conjugated to one or more small biologics is applied locally to vascular tissue exposed during surgery. Typically, local administration results in an increased local concentration of the composition, which is higher than can be achieved by systemic administration.

[0147] Pharmaceutical compositions formulated for parenteral (intramuscular, intraperitoneal, intravenous (IV) or subcutaneous injection) and enteral routes of administration are described.

[0148] A. Parenteral Administration In some embodiments, the dendrimer compositions covalently conjugated to one or more small molecule biologics are administered parenterally.

[0149] The phrases "parenteral administration" and "administered parenterally" are art-recognized terms and include modes of administration other than enteral and topical administration, such as injection, including, but not limited to, intravenous (iv), intramuscular (im), intrapleural, intravascular, intrapericardial, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intradennal, intraperitoneal (ip), transtracheal, subcutaneous (sc), subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion. Dendrimers can be administered parenterally by subdural, intravenous, intrathecal, intraventricular, intraarterial, intraamniotic, intraperitoneal, or subcutaneous routes.

[0150] For liquid formulations, the pharma- ceutically acceptable carrier may be, for example, an aqueous or non-aqueous solution, suspension, emulsion, or oil. Parenteral vehicles (for subcutaneous, intravenous, intra-arterial, or intramuscular injection) include, for example, sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, and fixed oil. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters, such as ethyl oleate. Aqueous carriers include, for example, water, alcoholic / aqueous solutions, cyclodextrins, emulsions or suspensions, including saline and buffered media. Dendrimers can also be administered as emulsions, for example, water-in-oil. Examples of oils are those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, fish-liver oil, sesame oil, cottonseed oil, corn oil, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include, for example, oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0151] Formulations suitable for parenteral administration may include aqueous and non-aqueous sterile suspensions, which may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, as well as suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. Intravenous vehicles may include fluid and nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols, such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions.

[0152] Injectable pharmaceutical carriers for injectable compositions are well known to those of skill in the art (see, e.g., Pharmaceutics and Pharmacy Practice, JB Lippincott Company, Philadelphia, PA, Banker and Chalmers, eds., pages 238-250 (1982), and ASHP Handbook on Injectable Drugs, Trissel, 15th ed., pages 622-630 (2009)).

[0153] B. Enteral Administration In some embodiments, compositions of dendrimers covalently conjugated to one or more small biologics are administered enterally. The carrier or diluent may be a solid carrier or diluent, such as a capsule or tablet for solid formulations, a liquid carrier or diluent for liquid formulations, or a mixture thereof.

[0154] For liquid preparations, pharma- ceutically acceptable carriers can be, for example, aqueous or non-aqueous solutions, suspensions, emulsions or oils.Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, and injectable organic esters, such as ethyl oleate.Aqueous carriers include, for example, water, alcohol / aqueous solutions, cyclodextrins, emulsions or suspensions, including saline and buffered media.

[0155] Examples of oil are petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, mineral oil, olive oil, sunflower oil, fish-liver oil, sesame oil, cottonseed oil, corn oil, olive, petrolatum, and mineral.The fatty acid suitable for use in parenteral formulations includes, for example, oleic acid, stearic acid, and isostearic acid.Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

[0156] Vehicles include, for example, sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's and fixed oils. Formulations include aqueous and non-aqueous isotonic sterile injection solutions, which may contain, for example, antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. Vehicles may include, for example, liquid nutrient replenishers, electrolyte replenishers, such as those based on Ringer's dextrose. In general, water, saline, aqueous dextrose, and related sugar solutions are preferred liquid carriers. They may also be formulated with proteins, lipids, sugars, and other components of artificial feeding.

[0157] In a preferred embodiment, the composition of dendrimer covalently conjugated to one or more small biologics is formulated for oral administration. Oral formulations may be in the form of chewing gum, gel strips, tablets, capsules or lozenges, and particles. Encapsulating materials for preparing enteric coated oral formulations include cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropylmethylcellulose phthalate, and methacrylic acid ester copolymers. Solid oral formulations, such as capsules or tablets, are preferred. Elixirs and syrups are also well-known oral formulations.

[0158] IV. METHODS OF MAKING DENDRIMERS AND NUCLEIC ACID CONJUGATS THEREOF A. Methods for Making Dendrimers Dendrimers may be prepared through various chemical reaction steps. They are usually synthesized according to methods that allow control of their structure at all stages of construction. Dendritic structures are mostly synthesized by two main different approaches: divergent or convergent.

[0159] In some embodiments, dendrimers are prepared using a divergent method, in which dendrimers are assembled from a multifunctional core, which is extended outward by a series of reactions, usually Michael reactions. The strategy involves coupling monomer molecules bearing reactive and protecting groups to the multifunctional core moiety, which leads to the stepwise addition of generations around the core, followed by removal of the protecting groups. For example, PAMAM-NH2 dendrimers are first synthesized by coupling N-(2-aminoethyl)acrylamide monomers to the ammonia core.

[0160] In other embodiments, dendrimers are prepared using convergent methods, where the dendrimer is built up from small molecules that are ultimately located on the surface of a sphere, and the reaction proceeds inwards, building inwards and ultimately attaching to the core.

[0161] Many other synthetic routes exist for preparing dendrimers, e.g., the orthogonal approach, the accelerated approach, the two-step convergent or hypercore approach, the hypermonomer or branched monomer approach, the double exponential approach; the orthogonal coupling approach or the two-step approach, the two-monomer approach, the AB2-CD2 approach.

[0162] In some embodiments, the dendrimer core, one or more branching units, one or more linkers / spacers, and / or one or more surface groups may be modified to allow conjugation to additional functional groups (branching units, linkers / spacers, surface groups, etc.), monomers, and / or drugs via click chemistry using one or more of Copper-Assisted Azide-Alkyne Cycloaddition (CuAAC), Diels-Alder reactions, thiol-ene and thiol-yne reactions, and azide-alkyne reactions (Arseneault M et al., Molecules. 2015 May 20;20(5):9263-94). In some embodiments, prefabricated dendrons are clicked into high density hydroxyl polymers. "Click chemistry" involves the coupling of two different moieties (e.g., a core group and a branching unit; or a branching unit and a surface group) via a 1,3-dipolar cycloaddition reaction between, for example, an alkyne moiety (or equivalent) on the surface of a first moiety and an azide moiety on a second moiety (e.g., a primary amine end group, a hydroxyl end group, a carboxylic acid end group, a thiol end group, etc., present on a triazine composition or equivalent).

[0163] In some embodiments, the dendrimer synthesis is amenable to one or more reactions, such as thiol-ene click reaction, thiol-yne click reaction, CuAAC, Diels-Alder click reaction, azide-alkyne click reaction, Michael addition, epoxy ring opening, esterification, silane chemistry, and combinations thereof.

[0164] Any existing dendritic platform may be used to create dendrimers of desired functionality, i.e., high density of surface hydroxyl groups, by conjugating high hydroxyl-containing moieties, such as 1-thio-glycerol or pentaerythritol. Exemplary dendritic platforms may be synthesized and studied, such as polyamidoamine (PAMAM), poly(propyleneimine) (PPI), poly-L-lysine, melamine, poly(ether hydroxylamine) (PEHAM), poly(esteramine) (PEA), and polyglycerol.

[0165] Dendrimers may also be prepared by combining two or more dendrons. A dendron is a wedge-shaped section of a dendrimer that has a reactive focal functional group. Many dendron scaffolds are commercially available. They are sold as 1st, 2nd, 3rd, 4th, 5th, and 6th generation, with 2, 4, 8, 16, 32, and 64 reactive groups, respectively. In certain embodiments, one type of drug is linked to one type of dendron and a different type of drug is linked to another type of dendron. The two dendrons are then connected to form a dendrimer. The two dendrons may be linked via click chemistry, i.e., a 1,3-dipolar cycloaddition reaction between an azide moiety on one dendron and an alkyne moiety on the other dendron to form a triazole linker.

[0166] Exemplary methods for making dendrimers are detailed in International Patent Applications WO2009 / 046446, WO2015168347, WO2016025745, WO2016025741, WO2019094952, and U.S. Patent No. 8,889,101.

[0167] B. Dendrimer Complex The dendrimer complex may be formed from a therapeutic, prophylactic or diagnostic small molecule biologic, such as a functional nucleic acid, conjugated to a dendrimer, dendritic polymer or hyperbranched polymer. The conjugation of one or more agents to dendrimers is known in the art and is described in detail in US Patent Application Publications US2011 / 0034422, US2012 / 0003155 and US2013 / 0136697.

[0168] In some embodiments, one or more drugs are covalently attached to the dendrimer. In some embodiments, the drugs are attached to the dendrimer via a linking moiety designed to be cleaved in vivo. The linking moiety may be designed to be cleaved hydrolytically, enzymatically, or a combination thereof, thereby providing sustained release of the drug in vivo. Both the composition of the linking moiety and its attachment point to the drug are selected such that cleavage of the linking moiety releases either the active drug or a suitable prodrug thereof. The composition of the linking moiety may also be selected in consideration of the desired release rate of the drug.

[0169] In some embodiments, the bond is formed through one or more of disulfide, ester, ether, thioester, carbamate, carbonate, hydrazine, or amide bond. In preferred embodiments, the bond is formed through a suitable spacer that provides an ester bond or an amide bond between the drug and the dendrimer, depending on the desired release kinetics of the drug. In some cases, the ester bond is introduced for the releasable form of the drug. In other cases, the amide bond is introduced for the non-releasable form of the drug.

[0170] The linking moiety generally comprises one or more organic functional groups. Examples of suitable organic functional groups include secondary amide (-CONH-), tertiary amide (-CONR-), sulfonamide (-S(O)2-NR-), secondary carbamate (-OCONH-;-NHCOO-), tertiary carbamate (-OCONR-;-NRCOO-), carbonate (-OC(O)-O-), urea (-NHCONH-;-NRCONH-;-NHCONR-,-NRCONR-), carbinol (-CHOH-,-CROH-), disulfide group, hydrazone, hydrazide, ether (-O-), and ester (-COO-,-CH2O2C-,CHRO2C-), where R is an alkyl group, an aryl group, or a heterocyclic group. In general, the identity of one or more organic functional groups in the linking moiety is selected in consideration of the desired release rate of the drug. Additionally, the organic functional group or groups may be selected to facilitate covalent attachment of an agent to the dendrimer.

[0171] In certain embodiments, the linking moiety comprises one or more of the organic functional groups described above in combination with a spacer group. The spacer group may be composed of any assembly of atoms, including oligomers and polymer chains, but the total number of atoms in the spacer group is preferably between 3 and 200 atoms, more preferably between 3 and 150 atoms, more preferably between 3 and 100 atoms, and most preferably between 3 and 50 atoms. Examples of suitable spacer groups include alkyl groups, heteroalkyl groups, alkylaryl groups, oligo- and polyethylene glycol chains, and oligo- and poly(amino acid) chains. Variations in the spacer group further control the release of the drug in vivo. In embodiments in which the linking moiety comprises a spacer group, one or more organic functional groups will generally be used to connect the spacer group to both the nucleic acid and the dendrimer.

[0172] In a preferred embodiment, the binding may occur through a suitable spacer that provides a disulfide bridge between the drug and the dendrimer. The dendrimer complex allows for rapid release of the drug in vivo by thiol exchange reaction under reducing conditions found in the body. For example, the spacer may be selected from the classes of sulfhydryl, thiopyridine, succinimidyl, maleimide, vinylsulfone and carbonate terminated compounds. The spacer may be a thiopyridine terminated compound, such as dithiodipyridine, N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate LC-SPDP or sulfo-LC-SPDP.

[0173] In some embodiments, the 5' and 3' ends of sense strand or passenger strand and the 3' end of antisense strand are potential sites for conjugation with modification.In the preferred embodiment of sense strand or passenger strand, the 5' and / or 3' ends are functionalized for conjugation to dendrimer.In some embodiments, the hydroxyl surface group of dendrimer is functionalized with SPDP, and optionally functionalized with PEG linker for conjugation of nucleic acid.

[0174] In some embodiments, a disulfide thiol modifier is used to introduce a sense 5' thiol (-SH) linkage as shown in Figure 2. In further embodiments, the dithiol modified nucleic acid is treated with dithiothreitol (DTT) to quantitatively reduce the disulfide bond and provide a sulfhydryl group for further conjugation with a dendrimer. In other embodiments, the sulfhydryl group at the sense 5' end (e.g., siGFP) is then reacted with a SPDP-functionalized dendrimer and, optionally, with a PEG linker (e.g., dendrimer-PEG4-SPDP) to form a conjugate between the dendrimer and the antisense molecule via a sulfhydryl exchange reaction.

[0175] Reactions and strategies that are useful for covalently attaching drugs to dendrimers are known in the art. See, e.g., March, “Advanced Organic Chemistry,” 5 th Edition, 2001, Wiley-Interscience Publication, New York) and Hermanson, "Bioconjugate Techniques," 1996, Elsevier Academic Press, USA. An appropriate method for the covalent attachment of a given agent may be selected taking into consideration the desired linking moiety and the structures of the agent and dendrimer, and generally relates to functional group compatibility, protecting group strategies, and the presence of labile linkages.

[0176] In some embodiments, the covalent attachment of the functional nucleic acid to the dendrimer occurs via click chemistry. In a preferred embodiment, the covalent attachment of the functional nucleic acid to the dendrimer is via an inverse electron demand Diels-Alder (IEDDA) initiated ligation between 1,2,4,5-tetrazine (Tz) and trans-cyclooctene (TCO). In one embodiment, the antisense molecule is functionalized with a terminal tetrazine (Tz) and at the same time, the hydroxyl-terminated dendrimer is functionalized with trans-cyclooctene (TCO) for click reaction, for example, as shown in Figures 1 and 2.

[0177] Optimal drug loading will necessarily depend on many factors, including the choice of drug, the structure and size of the dendrimer, and the tissue to be treated. In some embodiments, one or more drugs are encapsulated, associated, and / or conjugated to the dendrimer at a concentration of about 0.01% to about 45% by weight, preferably about 0.1% to about 30% by weight, about 0.1% to about 20% by weight, about 0.1% to about 10% by weight, about 1% to about 10% by weight, about 1% to about 5% by weight, about 3% to about 20% by weight, and about 3% to about 10% by weight. However, the optimal drug loading for any given drug, dendrimer, and target site can be identified by routine methods, such as those described above.

[0178] In some embodiments, drug and / or linker conjugation occurs via one or more surface and / or internal groups. Thus, in some embodiments, drug / linker conjugation occurs via all available surface functional groups of the dendrimer prior to conjugation, preferably about 1%, 2%, 3%, 4%, or 5% of hydroxyl groups. In other embodiments, drug / linker conjugation occurs with less than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% of all available surface functional groups of the dendrimer prior to conjugation. In preferred embodiments, the dendrimer complex retains an effective amount of surface functional groups for targeting a specific cell type and at the same time conjugates to an effective amount of drug for treating, preventing, and / or imaging a disease or disorder.

[0179] V. Usage Methods of using the dendrimer complex compositions are also described. In preferred embodiments, the dendrimer complexes cross an impaired or damaged BBB and target activated microglia and astrocytes.

[0180] A. Treatment Compositions of dendrimers covalently conjugated with one or more small molecule biologics and formulations thereof may be administered to treat disorders associated with infection, inflammation, or cancer, particularly those with systemic inflammation that extends to the nervous system, particularly the CNS. The compositions may also be used to treat other diseases, disorders, and injuries, including gastrointestinal disorders, proliferative disorders, and to treat other tissues in which nerves play a role in the disease or disorder. The compositions and methods are also suitable for prophylactic use.

[0181] The method involves systemically administering one or more dendrimer-functional nucleic acid complexes in an amount effective to attenuate inflammatory cytokines and / or growth factors in a subject in need thereof at a site in need thereof. Typically, an effective amount of a dendrimer complex of a dendrimer covalently conjugated to one or more small molecule biologics, optionally including one or more additional therapeutic, prophylactic, and / or diagnostic active agents, is administered to an individual in need thereof. The dendrimer may also include a targeting agent, although as demonstrated by the examples, these are not required for delivery to activated macrophages, including those present at the site of damaged tissue in the spinal cord and brain.

[0182] In a preferred embodiment, the dendrimer complex comprises a drug attached or conjugated to a dendrimer that can preferentially release the drug intracellularly under reducing conditions found in vivo. The drug is covalently attached. The amount of dendrimer covalently conjugated to one or more small biologics administered to a subject is selected to deliver an effective amount to reduce, prevent, or otherwise alleviate one or more clinical or molecular symptoms of the disease or disorder to be treated, compared to a control, e.g., a subject treated with an active agent without a dendrimer.

[0183] B. Condition to be Treated The composition of dendrimers covalently conjugated with one or more small molecule biologics is suitable for treating one or more diseases, conditions, and injuries in the eye, brain, and nervous system, particularly those associated with pathological activation of microglia and astrocytes. The composition may also be used to treat other diseases, disorders, and injuries, including gastrointestinal disorders, cancer, and other tissues in which nerves play a role in the disease or disorder. The composition and method are also suitable for prophylactic use.

[0184] The dendrimer complex composition preferably has a diameter of less than 15 nm and a surface density of hydroxyl groups of at least 3 OH groups / nm 2 and preferably has a diameter below 10 nm and a surface density of hydroxyl groups of at least 4 OH groups / nm 2 and more preferably has a diameter of less than 5 nm and a surface density of hydroxyl groups of at least 5 OH groups / nm 2 and most preferably has a diameter between 1 and 2 nm and a surface density of hydroxyl groups of at least 4 OH groups / nm 2 and deliver therapeutic, preventive, or diagnostic agents that selectively target microglia and astrocytes, which play a key role in the pathogenesis of many disorders and conditions, including neurodevelopmental diseases, neurodegenerative diseases, necrotizing enterocolitis, and brain cancer. Thus, the dendrimer complexes are administered in dosage units effective to treat or alleviate conditions associated with pathological conditions of microglia and astrocytes. In general, by targeting these cells, the dendrimers specifically deliver agents for treating neuroinflammation.

[0185] Microglia Microglia are a type of neuroglial cell found throughout the brain and spinal cord. Microglia make up 10-15% of all cells found in the brain. As resident macrophage cells, they act as the first and primary form of active immune defense in the central nervous system (CNS). Microglia play an important role after CNS injury and can have both protective and detrimental effects based on the timing and type of injury (Kreutzberg, GW Trends in Neurosciences, 19, 312 (1996);Watanabe, H., et al., Neuroscience Letters, 289, 53 (2000);Polazzi, E., et al., Glia, 36, 271 (2001);Mallard, C., et al., Pediatric Research, 75, 234 (2014);Faustino, JV, et al., The Journal of Neuroscience : The Official Journal Of The Society For Neuroscience, 31, 12992 (2011);Tabas, I., et al., Science, 339, 166 (2013);and Aguzzi, A., et al., Science, 339, 156 (2013)).Alterations in microglial function also affect normal neuronal development and synaptic pruning (Lawson, LJ, et al., Neuroscience, 39, 151 (1990); Giulian, D., et al., The Journal Of Neuroscience : The Official Journal Of The Society For Neuroscience, 13, 29 (1993); Cunningham, TJ, et al., The Journal of Neuroscience : The Official Journal Of The Society For Neuroscience, 18, 7047 (1998); Zietlow, R., et al., The European Journal Of Neuroscience, 11, 1657 (1999); and Paolicelli, RC, et al., Science, 333, 1456 (2011)). Microglia undergo a dramatic change in morphology from branched to amoeboid structures and proliferate after injury. The resulting neuroinflammation disrupts the blood-brain barrier at the site of injury, leading to acute and chronic neuronal and oligodendrocyte death. Therefore, targeting pro-inflammatory microglia should be a powerful and effective therapeutic strategy. The damaged BBB in neuroinflammatory diseases can be exploited to transport drug-loaded nanoparticles to the brain.

[0186] In a preferred embodiment, the dendrimers are administered in an amount effective to treat a microglia-mediated pathology in a subject in need thereof without any associated toxicity.

[0187] In some embodiments, the subject to be treated is a human. In some embodiments, the subject to be treated is a child or infant. All methods may include a step of identifying and selecting a subject in need of treatment or who would benefit from administration of the described composition.

[0188] 1. Eye Diseases and Disorders The compositions and methods are suitable for the treatment of diseases and disorders associated with the eye.

[0189] Examples of eye disorders that can be treated include amebic keratitis, fungal keratitis, bacterial keratitis, viral keratitis, oncorcerca keratitis, bacterial keratoconjunctivitis, viral keratoconjunctivitis, corneal dystrophic diseases, Fuchs' endothelial dystrophy, meibomian gland dysfunction, anterior and posterior blepharitis, conjunctival hyperemia, conjunctival necrosis, cicatricial scarring and fibrosis, punctate epithelial keratopathy, filamentous keratitis, corneal erosion, thinning, ulceration and perforation, Sjogren's syndrome, Stevens-Johnson syndrome, autoimmune dry eye disease, environmental dry eye disease, and corneal keratopathy. These include corneal neovascular diseases, corneal neovascular diseases, prevention and treatment of corneal transplant rejection, autoimmune uveitis, infectious uveitis, anterior uveitis, posterior uveitis (including toxoplasmosis), panuveitis, vitreous or retinal inflammatory diseases, prevention and treatment of endophthalmitis, macular edema, macular degeneration, age-related macular degeneration, proliferative and non-proliferative diabetic retinopathy, hypertensive retinopathy, autoimmune diseases of the retina, primary and metastatic intraocular melanoma, other intraocular metastatic tumors, open-angle glaucoma, angle-closure glaucoma, pigmentary glaucoma, and combinations thereof. Other disorders include corneal injury, burns, or abrasions, cataracts, and associated age-related degeneration of the eye or vision.

[0190] In a preferred embodiment, the eye disorder to be treated is associated with choroidal neovascularization (CNV).The exemplary eye disorder associated with CNV is macular degeneration.Thus, in some embodiments, the method delivers the functional nucleic acid conjugated to dendrimer to treat or prevent macular degeneration in a subject.In some embodiments, the method treats or prevents age-related (AMD).

[0191] Age-related macular degeneration (AMD) is a neurodegenerative neuroinflammatory disease of the macula that is the cause of central vision loss. The pathogenesis of AMD involves chronic neuroinflammation in the choroid (the vascular layer beneath the retina), the retinal pigment epithelium (RPE), the cell layers beneath the neurosensory retina, Bruch's membrane, and the neurosensory retina itself.

[0192] In some embodiments, the method administers an OH-terminated dendrimer covalently conjugated to a functional nucleic acid specific for inhibition of angiogenesis and vascular integrity to treat or prevent CNV in a subject in need thereof. Typically, the method selectively inhibits CNV at the site of inflammation by about 10% to 90%, e.g., between 10% and 30%. Typically, the method systemically administers one or more dendrimer-functional nucleic acid complexes in an amount effective to attenuate VEGF production at the site in need thereof in a subject in need thereof. For example, in some embodiments, the method reduces VEGF production at the site in need thereof by between about 10% and about 90%, e.g., between 15% and 50%, between 20% and 30%, or 25%. In certain embodiments, the method reduces VEGF levels by about 25% in the eye of a subject having or at risk of having macular degeneration associated with CNV in the eye.

[0193] 2. Cancer In some embodiments, the dendrimer compositions and formulations thereof are used in a method for treating cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of a dendrimer composition to the subject.

[0194] Cancer in a patient refers to the presence of cells with typical characteristics of cells that lead to cancer, such as uncontrolled proliferation, loss of specialized functions, immortality, significant metastatic potential, significant increase in anti-apoptotic activity, rapid growth and proliferation rate, and certain characteristic morphology and cell markers. In some circumstances, cancer cells will be in the form of a tumor; such cells may be present locally in an animal body or circulate in the bloodstream as independent cells, e.g., leukemia cells. Tumor refers to the growth and proliferation of all neoplastic cells, whether malignant or benign, and all precancerous and cancerous cells and tissues. Solid tumors are generally abnormal masses of tissue that do not contain cysts or liquid areas. Solid tumors may be present in the brain, colon, breast, prostate, liver, lung, esophagus, head and neck, ovaries, cervix, stomach, colon, rectum, bladder, uterus, testes, and pancreas, as non-limiting examples. In some embodiments, after a solid tumor is treated with the methods disclosed herein, the solid tumor regresses or its growth slows or stops. In other embodiments, the solid tumor is malignant. In some embodiments, the cancer comprises stage 0 cancer. In some embodiments, the cancer comprises stage I cancer. In some embodiments, the cancer comprises stage II cancer. In some embodiments, the cancer comprises stage III cancer. In some embodiments, the cancer comprises stage IV cancer. In some embodiments, the cancer is refractory and / or metastatic. For example, the cancer may be resistant to radiation therapy, treatment with chemotherapy, or monotherapy with immunotherapy.Cancers include newly diagnosed or recurrent cancers including, but not limited to, acute lymphoblastic leukemia, acute myeloid leukemia, progressive soft tissue sarcoma, brain cancer, metastatic or invasive breast cancer, breast cancer, bronchogenic carcinoma, choriocarcinoma, chronic myeloid leukemia, colon cancer, colorectal cancer, Ewing's sarcoma, gastrointestinal cancer, glioma, glioblastoma multiforme, squamous cell carcinoma of the head and neck, hepatocellular carcinoma, Hodgkin's disease, intracranial ependymoblastoma, colorectal cancer, leukemia, liver cancer, lung cancer, Lewis lung carcinoma, lymphoma, malignant fibrous histiocytoma, breast tumor, melanoma, mesothelioma, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, pontine tumor, premenopausal breast cancer, prostate cancer, rhabdomyosarcoma, reticulum cell sarcoma, sarcoma, small cell lung cancer, solid tumors, gastric cancer, testicular cancer, and uterine cancer. In some embodiments, the cancer is acute leukemia. In some embodiments, the cancer is acute lymphoblastic leukemia. In some embodiments, the cancer is acute myeloid leukemia. In some embodiments, the cancer is progressive soft tissue sarcoma. In some embodiments, the cancer is brain cancer. In some embodiments, the cancer is breast cancer (e.g., metastatic or invasive breast cancer). In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is bronchogenic carcinoma. In some embodiments, the cancer is choriocarcinoma. In some embodiments, the cancer is chronic myeloid leukemia. In some embodiments, the cancer is colon cancer (e.g., adenocarcinoma). In some embodiments, the cancer is colorectal cancer (e.g., colorectal carcinoma). In some embodiments, the cancer is Ewing's sarcoma. In some embodiments, the cancer is gastrointestinal cancer. In some embodiments, the cancer is glioma. In some embodiments, the cancer is glioblastoma multiforme. In some embodiments, the cancer is head and neck squamous cell carcinoma. In some embodiments, the cancer is hepatocellular carcinoma. In some embodiments, the cancer is Hodgkin's disease. In some embodiments, the cancer is intracranial ependymoblastoma. In some embodiments, the cancer is colorectal cancer. In some embodiments, the cancer is leukemia. In some embodiments, the cancer is liver cancer. In some embodiments, the cancer is lung cancer (e.g., lung cancer). In some embodiments, the cancer is Lewis lung carcinoma. In some embodiments, the cancer is lymphoma. In some embodiments, the cancer is malignant fibrous histiocytoma. In some embodiments, the cancer includes breast tumors.In some embodiments, the cancer is a melanoma. In some embodiments, the cancer is a mesothelioma. In some embodiments, the cancer is a neuroblastoma. In some embodiments, the cancer is an osteosarcoma. In some embodiments, the cancer is an ovarian cancer. In some embodiments, the cancer is a pancreatic cancer. In some embodiments, the cancer includes pontine tumors. In some embodiments, the cancer is premenopausal breast cancer. In some embodiments, the cancer is prostate cancer. In some embodiments, the cancer is a rhabdomyosarcoma. In some embodiments, the cancer is a reticulum cell sarcoma. In some embodiments, the cancer is a sarcoma. In some embodiments, the cancer is a small cell lung cancer. In some embodiments, the cancer includes solid tumors. In some embodiments, the cancer is gastric cancer. In some embodiments, the cancer is testicular cancer. In some embodiments, the cancer is uterine cancer.

[0195] A brain tumor The effective blood-brain tumor barrier (BBTB) penetration and uniform solid tumor distribution of the disclosed dendrimers can significantly enhance therapeutic delivery to brain tumors. The small size and near-neutral surface charge of the high-density hydroxyl surface groups selectively localize in cells associated with inflammation, particularly neuroinflammation.

[0196] The compositions and methods are useful for treating a subject having a benign or malignant tumor by slowing or inhibiting tumor growth in the subject, reducing tumor growth or size, inhibiting or reducing tumor metastasis, and / or inhibiting or reducing symptoms associated with tumor development or growth.

[0197] Types of cancer that may be treated with the compositions and methods include, but are not limited to, brain tumors, including glioma, glioblastoma, gliosarcoma, astrocytoma, brain stem glioma, ependymoma, oligodendroglioma, non-glial tumors, acoustic neuroma, craniopharyngioma, medulloblastoma, meningioma, pinealoma, pineoblastoma, primary brain lymphoma, ganglioneuroma, neurinoma, chordoma, and pituitary tumor.

[0198] The dendrimer complexes may be administered in combination with one or more additional therapeutically active agents known to be capable of treating brain tumors or symptoms associated therewith.

[0199] For example, the dendrimers may be administered to the brain via intravenous administration or during surgery to remove all or part of a tumor. The dendrimers may be used to deliver chemotherapy agents, adjuvant therapies, such as agents that enhance those of subjects undergoing radiation therapy, and the hydroxyl-terminated dendrimers are covalently linked to at least one radiation sensitizing agent in an amount effective to suppress or inhibit DDX3 activity in proliferative diseases of the brain.

[0200] Those skilled in the art will understand that in addition to chemotherapy, surgical intervention and radiation therapy are also used in the treatment of cancer of the nervous system.Radiation therapy refers to administering ionizing radiation to the subject close to the location of the cancer in the subject.In some embodiments, the radiation sensitizer is administered in two or more doses, and then ionizing radiation is administered to the subject close to the location of the cancer in the subject.In further embodiments, the administration of the radiation sensitizer followed by ionizing radiation can be repeated for two or more cycles.

[0201] Typically, the dose of ionizing radiation will vary with the size and location of the tumor, but will range from 0.1 Gy to about 30 Gy, preferably from 5 Gy to about 25 Gy.

[0202] In some embodiments, the ionizing radiation is in the form of stereotactic ablative radiation therapy (SABR) or stereotactic body radiation therapy (SBRT).

[0203] 3. Neurological and neurodegenerative diseases The dendrimer composition and its formulations can be used to diagnose and / or treat one or more neurological and neurodegenerative diseases. The compositions and methods are particularly suitable for treating one or more neurological or neurodegenerative diseases associated with defective metabolism and function of sphingolipids, including sphingomyelin. In some embodiments, the disease or disorder is selected from, but is not limited to, some psychiatric (e.g., depression, schizophrenia (SZ), alcohol use disorder, and morphine antinociceptive tolerance) and neurological (e.g., Alzheimer's disease (AD), Parkinson's disease (PD)) disorders. In one embodiment, the dendrimer complex is used to treat Alzheimer's disease (AD) or dementia.

[0204] Neurodegenerative diseases are chronic progressive disorders of the nervous system that affect neurological and behavioral functions, with biochemical changes resulting in distinct histopathological and clinical syndromes (Hardy H, et al., Science. 1998;282:1075-9). Abnormal proteins that are resistant to cellular degradative mechanisms accumulate within cells. The pattern of neuronal loss is selective, meaning that one group is affected while the other remains intact. There is often no obvious precipitating event for the disease. Diseases classically described as neurodegenerative are Alzheimer's disease, Huntington's disease, and Parkinson's disease.

[0205] Neuroinflammation mediated by activated microglia and astrocytes is a key hallmark of various neurological disorders and represents a potential therapeutic target (Hagberg, H et al., Annals of Neurology 2012, 71, 444; Vargas, DL et al., Annals of Neurology 2005, 57, 67; and Pardo, CA et al., International Review of Psychiatry 2005, 17, 485). Several scientific reports suggest that mitigating neuroinflammation at an early stage by targeting these cells can delay the onset of the disease and thus provide a longer therapeutic window for treatment (Dommergues, MA et al., Neuroscience 2003, 121, 619; Perry, VH et al., Nat Rev Neurol 2010, 6, 193; Kannan, S et al., Sci. Transl. Med. 2012, 4, 130ra46; and Block, ML et al., Nat Rev Neurosci 2007, 8, 57). Delivering therapeutics across the blood-brain barrier is a difficult challenge. Neuroinflammation leads to the breakdown of the blood-brain barrier (BBB). The damaged BBB in neuroinflammatory disorders can be exploited to transport drug-loaded nanoparticles throughout the brain (Stolp, HB et al., Cardiovascular Psychiatry and Neurology 2011, 2011, 10; and Ahishali, B et al., International Journal of Neuroscience 2005, 115, 151).

[0206] The composition and method may also be used to deliver active agents for treating neurological or neurodegenerative diseases or disorders, or central nervous system disorders.In a preferred embodiment, the composition and method are effective in treating and / or alleviating the neuroinflammation associated with neurological or neurodegenerative diseases or disorders, or central nervous system disorders.The method typically comprises administering to a subject an effective amount of the composition for enhancing cognition or reducing cognitive decline, enhancing cognitive function or reducing cognitive decline, enhancing memory or reducing memory decline, enhancing learning capacity or capacity or reducing learning capacity or capacity decline, or a combination thereof.

[0207] Neurodegeneration refers to the progressive loss of neuronal structure or function, including neuronal death. For example, the compositions and methods can be used to treat diseases or disorders such as Parkinson's disease (PD) and PD-related diseases, Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD) and other dementias, prion diseases such as Creutzfeldt-Jakob disease, corticobasal degeneration, frontotemporal dementia, HIV-associated cognitive impairment, mild cognitive impairment, motor neuron disease (MND), spinocerebellar ataxia (SCA), spinal muscular atrophy (SMA), Friedreich's ataxia, Lewy body disease, Alpers' disease, Batten disease, cerebro-oculo-facial-skeletal syndrome, corticobasal degeneration, Gerstmann-Sträussler-Scheinker disease, kuru, Leigh's disease, monomelic muscular atrophy (Monomelic Amyotrophy, Multiple System Atrophy, Multiple System Atrophy with Orthostatic Hypotension (Shy-Drager Syndrome), Multiple Sclerosis (MS), Neurodegeneration with Brain Iron Accumulation, Opsoclonus-Myoclonus, Posterior Cortical Atrophy, Primary Progressive Aphasia, Progressive Supranuclear Palsy, Vascular Dementia, Progressive Multifocal Leukoencephalopathy, Dementia with Lewy Bodies (DLB), Lacunar syndrome, Hydrocephalus, Wernicke-Korsakoff syndrome, Post-encephalitic Dementia, Cancer- and Chemotherapy-Associated Cognitive Impairment and Dementia, and Depression-Induced Dementia and Pseudodementia.

[0208] In further embodiments, the disease or disorder is selected from, but not limited to, injection-limited amyloidosis, cerebral amyloid angiopathy, myopathy, neuropathy, brain trauma, frontotemporal dementia, Pick's disease, multiple sclerosis, prion disorder, type 2 diabetes, fatal familial insomnia, cardiac arrhythmia, isolated atrial amyloidosis, atherosclerosis, rheumatoid arthritis, familial amyloid polyneuropathy, hereditary non-neuropathic systemic amyloidosis, Finnish amyloidosis, lattice corneal dystrophy, systemic AL amyloidosis, and Down's syndrome. In a preferred embodiment, the disease or disorder is Alzheimer's disease or dementia.

[0209] Criteria for assessing improvement in a particular neurological factor include methods for assessing cognitive skills, motor skills, memory capacity, etc., as well as methods for assessing physical changes in selected areas of the central nervous system, such as magnetic resonance imaging (MRI) and computed tomography scans (CT) or other imaging methods. Such assessment methods are well known in the fields of medicine, neurology, psychology, etc., and can be appropriately selected to diagnose a particular neurological dysfunction state. A selected assessment or evaluation test, or test group, for assessing changes in Alzheimer's disease or associated neurological changes is performed prior to initiating administration of the dendrimer composition. After this initial assessment, a treatment regimen for administering the dendrimer composition is initiated and continued for various time intervals. At a selected time interval following the initial assessment of neurological deficit dysfunction, the same assessment or evaluation test is used again to reassess changes or improvements in the selected neurological criteria.

[0210] C. Dosage and Effective Amount Dosage and dosing regimens depend on the severity and location of the injury or damage and / or the method of administration and are known to those skilled in the art. A therapeutically effective amount of a dendrimer composition used in the treatment of a neurological or neurodegenerative disease is typically sufficient to reduce or alleviate one or more symptoms of the neurological or neurodegenerative disease.

[0211] Preferably, the active agent does not target or modulate the activity or amount of healthy cells that are not present in or associated with diseased or target tissues, or targets or modulates at a low level compared to target cells, including activated microglial cells in the CNS.In this way, the by-products and other side effects associated with the composition are reduced.

[0212] The administration of the composition results in improvement or enhancement of neurological function in individuals with neurological disease, neurological injury, or age-related neuronal decline or dysfunction. In some in vivo approaches, the dendrimer complex is administered to a subject in a therapeutically effective amount to stimulate or induce neuronal mitosis leading to the generation of new neurons and provide a neurogenic effect. Also provided is an effective amount of the composition to prevent, reduce, or terminate the deterioration, dysfunction, or death of neurons, neurites, and neural networks of an individual and provide a neuroprotective effect.

[0213] The actual effective amount of the dendrimer conjugate may vary according to factors including the particular agent administered, the particular composition formulated, the mode of administration, and the age, weight, condition, and route of administration of the subject to be treated, and the disease or disorder. The dose of the composition may be about 0.01 to about 100 mg / kg body weight, about 0.1 mg / kg to about 10 mg / kg, about 0.5 mg to about 5 mg / kg body weight. Generally, for intravenous injection or infusion, the dosage may be lower than that for oral administration.

[0214] Generally, the timing and frequency of administration will be adjusted to balance the effectiveness of a given treatment or diagnostic schedule and the side effects of a given delivery system. Exemplary dosing frequencies include continuous infusion, single and multiple doses, e.g., hourly, daily, weekly, monthly or yearly dosing.

[0215] The composition may be administered daily, twice weekly, weekly, biweekly, or less frequently, in an amount to provide a therapeutically effective increase in blood levels of the therapeutic agent. If administration is by other than an oral route, the composition may be delivered over more than an hour, for example, 3-10 hours, to produce a therapeutically effective dose within 24 hours. Alternatively, the composition may be formulated for controlled release, and the composition is administered as a single dose that is repeated on a weekly or less frequent regimen.

[0216] Dosage may vary and may be administered daily in single or multiple dose administrations for one or several days. Guidance can be found in the literature regarding appropriate dosages for a given class of pharmaceutical agent. Optimal dosing schedules can be calculated from measurements of drug accumulation in the subject's or patient's body. Those skilled in the art can easily determine optimal dosages, dosing methodologies, and repetition rates. Optimal dosages may vary depending on the relative potency of individual pharmaceutical compositions, and are generally determined by the EC50- ... 50 can be inferred based on

[0217] In some embodiments, the method comprises administering functional nucleic acid to a subject in an amount effective to reduce or prevent one or more diseases or disorders in the subject.Administering functional nucleic acid to a subject as a dendrimer-functional nucleic acid complex typically enhances the serum half-life of functional nucleic acid compared to the serum half-life of functional nucleic acid administered alone.In some embodiments, conjugation with dendrimer shields functional nucleic acid from enzymatic or proteolytic degradation, and prevents non-specific cellular uptake and / or activity of functional nucleic acid. For example, in some embodiments, the functional nucleic acid has a serum half-life that is 10% to 10,000% longer than the serum half-life of the same functional nucleic acid in the absence of conjugation to a dendrimer, for example, a serum half-life that is 50%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 500%, 700%, 1,000%, 5,000% or 10,000%, or more than 10,000% longer than the serum half-life of the same functional nucleic acid in the absence of conjugation to a dendrimer. As shown in the Examples, miRNA molecules with a serum half-life of 30 minutes in vivo functioned for up to 14 days after administration as a dendrimer conjugate. Thus, in some embodiments, functional nucleic acids generally provide therapeutic efficacy for more than 30 minutes after administration in vivo, for example, up to 1 hour (1 hr), 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month or more after administration in vivo.

[0218] In some embodiments, the regimen includes one or more cycles of a treatment round followed by a rest period (e.g., no drug). The rest period may be 1, 2, 3, 4, 5, 6, or 7 days, or 1, 2, 3, 4 weeks, or 1, 2, 3, 4, 5, or 6 months.

[0219] D. Control The effect of the dendrimer complex composition may be compared to a control. Suitable controls are known in the art and include, for example, untreated cells or untreated subjects. In some embodiments, the control is untreated tissue from a treated subject or untreated tissue from an untreated subject. Preferably, the control cell or tissue is from the same tissue as the treated cell or tissue. In some embodiments, the untreated control subject suffers from or is at risk of the same disease or condition as the treated subject.

[0220] VI. Kit The composition may be packaged as a kit. The kit may include a single or multiple doses of the composition comprising one or more functional nucleic acids encapsulated in, associated with, or conjugated with dendrimers, and instructions for administering the composition. In particular, the instructions indicate that an effective amount of the composition is administered to an individual with a particular disease or disorder indicated. The composition may be formulated as described above with reference to a particular treatment method, and may be packaged in any convenient manner.

[0221] The invention will be further understood by reference to the following non-limiting examples. EXAMPLES

[0222] Example 1 Synthesis and characterization of Cy-5-containing dendrimer-antisense-RNA conjugates material and method Unless otherwise noted, all reactions were carried out in flame-dried glassware under positive nitrogen pressure using dry solvents. After each reaction step, the products were purified via dialysis in DMF for 24 hours to remove small molecule impurities, followed by water dialysis to remove DMF. All enumerations of chemical structures (1)-(9) correspond to the chemical structures represented as (1)-(9) in Figures 1 and 2.

[0223] 1H NMR (in DMSO-d6) of intermediates and final conjugates were compared top to bottom, confirming product formation by appearance and disappearance of peaks, indicating a shift in retention time, respectively. The molecular weights of all intermediates and final building blocks were determined by analytical HPLC traces of PAMAM-G6-OH, Cy5-D, and Cy5-D-PEG4-TCO, and matrix-assisted laser desorption / ionization time-of-flight (MALDI-TOF) spectra of PAMAM-G6-OH, Cy5-D, and Cy5-D-PEG4-TCO. The extent of conjugation at each step of the synthesis was calculated based on the change in molecular weight measured by 1H-NMR and MALDI-TOF / MS.

[0224] Biomolecules, Chemicals, and Reagents Commercial grade reagents and anhydrous solvents were purchased from chemical supply companies and used without further purification. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC.HCl), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP) trifluoroacetic acid (TFA), γ-(Boc-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), and N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience-GE Healthcare. Trans-cyclooctene (TCO) was purchased from AAT bioquest, Inc. Tetrazine (Tz) precursor was purchased from BroadPharm. Deuterated solvents dimethylsulfoxide (DMSO-d6), water (D2O), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories Inc. (Andover, MA). Ethylenediamine-core polyamidoamine (PAMAM) dendrimer, generation 6.0, hydroxy surface (G6-OH; diagnostic grade; consisting of 256 hydroxyl end groups), methanol solution (13.75% w / w) was purchased from Dendritech Inc. (Midland, MI, USA). Dialysis membranes were purchased from Spectrum Laboratories Inc. (Rancho Dominguez, CA, USA).

[0225] Use of instruments for characterization of intermediates and products Proton nuclear magnetic resonance (1H NMR) spectra were recorded on a Bruker 500 MHz spectrometer at ambient temperature and analyzed using MestReNova software. 1 H NMR chemical shifts are reported as δ using residual solvent (DMSO-d6, 2.50) and (D2O, 4.79 ppm) as internal standards.

[0226] Synthesis of D-GABABoc(3) A solution of PAMAM G6-OH1 (1.00 g, 0.017 mmol) in DMF (12 mL) was treated with Boc-GABA-OH (0.069 g, 0.34 mmol), DMAP (0.0782 g, 0.408 mmol) and stirred at room temperature for 5 min. EDC.HCI (0.046 g, 0.374 mmol) was then added portionwise to the reaction mixture over 5 min. The reaction mixture was stirred at room temperature for 36 h. The crude product was transferred to 3 kD MW cutoff cellulose dialysis tubing and dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product 3 (0.973 g, 95%) as a hygroscopic white solid. 1H NMR (500 MHz, DMSO-d6) 8.10-7.70 (m, internal amide H), 6.60 (s, GABA amide H, 10H), 4.74 (s, surface OH, 213H), 3.99 (s, ester-linked H, 22H), 3.39 (t, J = 5.0 Hz, dendrimer-CH2), 3.40-3.35 (m, dendrimer-CH2), 3.11 (m, dendrimer-CH2), 2.89 (m, dendrimer-CH2), 2.73-2.65(m, dendrimer-CH2), 2.45(m, dendrimer-CH2), 2.21(m, dendrimer-CH2), 1.64-1.59 (m, GABA linker-CH2, 25H), 1.36 (s, Boc group, 85H).HPLC C18 retention time 19 minutes.

[0227] Synthesis of D-GABA-NH2(4) PAMAM G6-OH3 (250 mg, 0.004 mmol) containing Boc-protected GABA linker was treated with TFA / DCM (3:4) solvent mixture. The reaction was stirred at room temperature for 12 h, then diluted with methanol and concentrated in vacuo (this step is necessary to remove excess TFA and hydrolytically cleave the GABA linker). The crude product was used for the next step without any further purification. 1H NMR (500 MHz, DMSO-d6) δ 8.50-7.75 (m, internal amide H), 5.50-4.50 (broad s, surface -OH), 4.00 (s, ester-linked H), 3.50-2.25(m, dendrimer-CH2), 1.93-1.59 (m, GABA linker-CH2).

[0228] Synthesis of Cy5-D(5) A solution of compound 4 (287 mg, 0.0048 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (approximately 7.0-7.5). The reaction was then treated with Cy5-NHS ester (8.7 mg, 0.0115 mmol, 1.2 eq) and stirred at room temperature for 12 h. It was then dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product 5 as a blue solid (85% yield). 1H NMR (500 MHz, DMSO-d6) δ 8.25-7.75 (m, internal amide H), 7.30 (s, Cy5 H), 7.10 (s Cy5 H), 6.70 (s, GABA amide H), 6.50 (m Cy5 H), 6.25 (m Cy5 H), 4.75 (s, surface OH, 226H), 4.00 (m, ester CH2), 3.50-2.00 (m, dendrimer CH2), 1.64-1.59 (s, 31H), 1.25 (s, 66H), 0.8 (s, 21H). HPLC C18 retention time (acetonitrile in water with 0.1% TFA, linear gradient, 40 min). HPLC C18 retention time: 17.5 min.

[0229] Synthesis of Cy5-D-PEG4-TCO (6) A solution of compound 5 (48 mg, 0.0008 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (approximately 7.0-7.5). The reaction was treated with TCO-PEG4-NHS ester (4 mg, 0.0080 mmol) and the reaction mixture was stirred at room temperature for 12 h. It was then dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product as a blue solid (55% yield). 1H NMR (500 MHz, DMSO-d6) δ 8.14-7.73 (m, internal amide H), 7.35 (m, Cy5 H), 7.25 (m, Cy5 H), 7.05 (m, Cy5 H), 6.6 (m, Cy5 H), 6.3 (m, Cy5 H), 6.83 (s, GABAamide H), 5.65-5.50 (m, TCO H), 5.45-5.35 (m, TCO H), (4.74 (s, surface OH, H), 4.01-3.39 (t, J = 5.0 Hz, ester-CH2), 3.50-2.00 (m, dendrimer CH2), 1.9 (s, 24H), 1.6 (s, 80H), 1.2 (s, 126H), 0.8 (s, 80H).HPLC C18 retention time: 19.5 minutes.

[0230] Ultrafiltration and SEC chromatography After each step of the synthesis, exchange of excess small molecule reagents and by-products and buffers was performed by Amicon ultrafiltration using 15 mL for 10 kDa and 30 kDa MWCO units (samples ≥ 2 mg) or 0.5 mL for 10 kDa and 30 kDa MWCO units (samples ≤ 2 mg).

[0231] MALDI-TOF of PAMAM dendrimer conjugates MALDI matrix 2',4',6'-trihydroxyacetophenone monohydrate (THAP) (10 mg) was dissolved in 1 mL of acetonitrile in water (1:1) containing 0.1% trifluoroacetic acid. 2 μL of PAMAM dendrimer was then deposited onto the MALDI sample plate. Matrix (10 mg / mL, 2 μL) was deposited onto the air-dried sample and allowed to air dry for 10-20 min. MALDI-TOF MS analysis was performed in reflector positive mode.

[0232] result Synthesis and characterization of Cy5-D-PEG4-TCO Cy5-D-PEG4-TCO conjugates were synthesized using PAMAM-G6-OH (D6-OH) dendrimer, which contains 256 free hydroxyl groups (D6-OH) available on the surface for further conjugation. D6-OH (13.75% w / w) in methanol was dried under reduced pressure, subsequently dissolved in water and lyophilized for further conjugation. The lyophilized monofunctionalized D6-OH was functionalized with Boc-protected amines by treatment with 4-tert-butoxycarbonylamino)butyric acid (Boc-GABA-OH) under N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC.HCl) and 4-(dimethylamino)pyridine (4-DMAP) in DMF at room temperature for 36 h to obtain the Boc-protected bifunctional dendrimer product. The crude dendrimer was dialyzed against ultrapure water by a 3.5 kDa membrane for 24 h and subsequently lyophilized. The dendrimer (3) 1H NMR showed the appearance of the tert-butyl protons of the Boc group at δ 1.3 ppm and the GABA methylene protons at δ 1.6 ppm as singlets. The peak at δ 3.9 ppm was for the methylene protons of the dendrimer next to the hydroxyl group once converted to an ester, and the amide protons from the GABA linker also appeared at δ 6.8 ppm. The Boc groups were then deprotected under mildly acidic conditions using trifluoroacetic acid (TFA) in dichloromethane (DCM) (1:4) to give the bifunctionalized dendrimer. The excess TFA was removed by coevaporation with methanol, and the resulting crude product was used for the next step without further purification. The complete disappearance of the Boc protons was confirmed by NMR spectroscopy (NMR spectroscopy) (δ 3.9 ppm). 1 The dendrimer conjugates D-GABA-Boc, D-GABA-NH2, Cy5-D, and Cy5-D-PEG4-TCO (in DMSO-d6 and DO) were characterized by the appearance or disappearance of characteristic signals. The total number of amine groups remained at about 10. The bifunctional dendrimer was then treated with the fluorescent dye Cy5 to obtain dendrimer (4) with about 1-2 successful Cy5 conjugations on the dendrimer surface. 1 H NMR showed the appearance of Cy5 signals in the aromatic region and the HPLC retention time shifted from 19.0 to 17.5 min, confirming the formation of the product. After Cy5 conjugation, the remaining amine groups were reacted with a trans-cyclooctene-containing heterobifunctional (NHS-PEG4-TCO) linker. This heterobifunctional linker was used to form a chemical bond between the dendrimer and the antisense oligonucleotide (ASO).

[0233] Synthesis and characterization of dendrimer-ASO conjugates ASO was functionalized with terminal tetrazine (Tz) and simultaneously D6-OH was functionalized with trans-cyclooctene (TCO) for click reaction (Figures 1-2). ASO (2 mg, in 500 μL PBS) was treated with methyltetrazine-PEG4-SS-NHS ester (5 mol equiv., in 10-20 μL anhydrous DMSO) and incubated for 1 h. Excess Me-Tz-PEG4-SS-NHS and by-products were removed by ultrafiltration. TCO-PEG4-linked dendrimer 6 (17 mg, in 500 μL PBS) was reacted with 8 via trans-cyclooctene-tetrazine (TCO-Tz) to give crude product 9. The resulting crude product was purified by ultrafiltration, and the product was further purified on a GE Healthcare SEPHADEX® G-25 column and concentrated by ultrafiltration. The molecular weight was determined by MALDI-TOF (MALDI-TOF spectrum of Cy5-D-ASO showed a peak at a mass of 66009 Da for D-ASO; gel retardation assay was performed to confirm the formation of D-ASO conjugates, whereby RNA ladder (NEB, Ipswich, MA), free siRNA, and D-siGFP were mixed with GELRED® stain for 2 μg nucleic acid loading, 1 μL glycerol, and ultrapure water; gel electrophoresis was performed in 3% TBE-urea gel with TBE buffer (Bio-Rad, Hercules, CA) at 120 V for 20 minutes, and then the gel was imaged in a CHEMIDOC® imaging system (Bio-Rad, Hercules)). In addition, the successful synthesis of D-siGFP was confirmed by gel electrophoresis. The TCO-Tz click reaction used herein is fast and quantitative, and does not release toxic by-products. At low biomolecule concentrations (<5 μM), TCO-Tz works better compared to strain-promoted alkyne-azide cycloaddition (SPAAC) and Cu(I)-catalyzed azide-alkyne cycloaddition (CuAcc). The TCO-Tz "click" reaction proceeds via an inverse electron-demand Diels-Alder reaction (IEDDA) between TCO and Tz, followed by a retro-Diels-Alder reaction to eliminate N2 and form a dihydropyridazine bond.In contrast to the usual Diels-Alder reaction, where an electron-rich dienophile reacts with an electron-deficient diene, in the inverse electron-demand Diels-Alder reaction, an electron-rich dienophile reacts with an electron-deficient diene. TCO as a precursor gave extremely high rate differentials compared to cis-cyclooctene and other cyclic alkenes. The high reactivity is associated with the crown conformation adopted by TCO, which is lower in energy than the cis "half-chair" conformation. The chemoselective TCO-Tz ligation exhibits ultrafast kinetics (>800 M) unmatched by any other bioorthogonal ligation pair. -1 s -1 ). Click ligation was performed at near-neutral pH, aqueous conditions, and room temperature. The ultrafast kinetics, selectivity, and long-term aqueous stability make TCO-Tz an ideal pair for low-concentration dendrimer-ASO coupling reactions.

[0234] Example 2 Development of Hydroxyl PAMAM Dendrimer- and siRNA-Based Nanoconjugates as Targeted Therapeutics for CNS Disorders material and method Biomolecules, Chemicals, and Reagents Unless otherwise noted, reactions were carried out in flame-dried glassware under positive nitrogen pressure using dry solvents. All listings of chemical structures (1)-(9) correspond to the chemical structures represented as (1)-(9) in Figures 3 and 4.

[0235] Commercial grade reagents and anhydrous solvents were purchased from chemical supply companies and used without further purification. 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC.HCl), N,N-diisopropylethylamine (DIPEA), 4-(dimethylamino)pyridine (DMAP) trifluoroacetic acid (TFA), γ-(Boc-amino)butyric acid (Boc-GABA-OH), anhydrous dichloromethane (DCM), and N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Cyanine 5 (Cy5)-mono-NHS ester was purchased from Amersham Bioscience-GE Healthcare. Deuterated solvents dimethyl sulfoxide (DMSO-d6), water (D2O), and chloroform (CDCl3) were purchased from Cambridge Isotope Laboratories Inc. (Andover, MA). Ethylenediamine core polyamidoamine (PAMAM) dendrimer, generation 6.0, hydroxy surface (G6-OH; diagnostic grade; consisting of 256 hydroxyl end groups), methanol solution (13.75% w / w) was purchased from Dendritech Inc. (Midland, MI, USA). Dialysis membrane was purchased from Spectrum Laboratories Inc. (Rancho Dominguez, CA, USA). GFP siRNA targeting sequence 5'-SS-GCAAGCTGACCCTGACCCTGAAGTTC-3' (SEQ ID NO: 2), GFP siRNA Cy3 5'-SS-GCAAGCTGACCCTGACCCTGAAGTTC-Cy3-3' (SEQ ID NO: 3), and scrambled RNA (scRNA) were purchased from Dharmacon (Lafayette, CO). Dulbecco's Modified Eagle's Medium (DMEM, low glucose with L-glutamine), LIPOFECTAMINE® 2000, and streptomycin (10 mg / mL) were purchased from Life Technologies. All primers were purchased from IDT. RNase III was purchased from Thermo Scientific (Rockford, IL, USA).Magnesium chloride (MgCl2) and 1,4-dithiothreitol (DTT) were purchased from Sigma-Aldrich (St Louis, MO, USA).

[0236] device Proton nuclear magnetic resonance (1H NMR) spectra were recorded on a Bruker 500 MHz spectrometer at ambient temperature and analyzed using software. 1 H NMR chemical shifts are reported as δ using residual solvent (DMSO-d6, 2.50) and (DO, 4.79 ppm) as internal standards. Analytical high-performance liquid chromatography (HPLC) was performed using a Shimadzu LC-AD HPLC system equipped with a variable wavelength absorbance detector and a C18 reversed-phase column (Waters, BEH300 5 μm, 19 × 250 mm). The eluent was monitored at 210 nm using a photodiode array (PDA) detector, and the fluorescently labeled conjugate was monitored at both 650 nm and 210 nm using fluorescence and PDI detectors, respectively. HPLC elution was performed with a 40 min linear gradient of 0% to 90% HPLC grade acetonitrile (CH3CN) in water (containing 0.1% TFA) and maintained at a flow rate of 1.0 mL / min.

[0237] Synthesis of D-GABABoc(3) A solution of PAMAM G6-OH1 (1.00 g, 0.017 mmol) in DMF (12 mL) was treated with Boc-GABA-OH (0.069 g, 0.34 mmol), DMAP (0.0782 g, 0.408 mmol) and stirred at room temperature for 5 min. EDC.HCI (0.046 g, 0.374 mmol) was then added portionwise to the reaction mixture over 5 min. The reaction mixture was stirred at room temperature for 36 h. The crude product was transferred to 3 kD MW cutoff cellulose dialysis tubing and dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product 3 (0.973 g, 95%) as a hygroscopic white solid. 1HNMR (500 MHz, DMSO-d6) 8.10-7.70 (m, internal amide H), 6.60 (s, GABA amide H, 10H), 4.74 (s, surface OH, 213H), 3.99 (s, ester-linked H, 22H), 3.39 (t, J = 5.0 Hz, dendrimer-CH2), 3.40-3.35 (m, dendrimer-CH2), 3.11 (m, dendrimer-CH2), 2.89 (m, dendrimer-CH2), 2.73-2.65(m, dendrimer-CH2), 2.45(m, dendrimer-CH2), 2.21(m, dendrimer-CH2), 1.64-1.59 (m, GABA linker-CH2, 25H), 1.36 (s, Boc group, 85H).HPLC C18 retention time 19 minutes.

[0238] Synthesis of D-GABA-NH2(4) PAMAM G6-OH3 (250 mg, 0.004 mmol) containing Boc-protected GABA linker was treated with TFA / DCM (3:4) solvent mixture. The reaction was stirred at room temperature for 12 h, then diluted with methanol and concentrated in vacuo (this step is necessary to remove excess TFA and hydrolytically cleave the GABA linker). The crude product was used for the next step without any further purification. 1H NMR (500 MHz, DMSO-d6) δ 8.50-7.75 (m, internal amide H), 5.50-4.50 (broad s, surface -OH), 4.00 (s, ester-linked H), 3.50-2.25(m, dendrimer-CH2), 1.93-1.59 (m, GABA linker-CH2).

[0239] Synthesis of Cy5-D(5) A solution of compound 4 (287 mg, 0.0048 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (approximately 7.0-7.5). The reaction was then treated with Cy5-NHS ester (8.7 mg, 0.0115 mmol, 1.2 eq) and stirred at room temperature for 12 h. It was then dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product 5 as a blue solid (85% yield). 1H NMR (500 MHz, DMSO-d6) δ 8.25-7.75 (m, internal amide H), 7.30 (s, Cy5 H), 7.10 (s Cy5 H), 6.70 (s, GABA amide H), 6.50 (m Cy5 H), 6.25 (m Cy5 H), 4.75 (s, surface OH, 226H), 4.00 (m, ester CH2), 3.50-2.00 (m, dendrimer CH2), 1.64-1.59 (s, 31H), 1.25 (s, 66H), 0.8 (s, 21H). HPLC C18 retention time (acetonitrile in water with 0.1% TFA, linear gradient, 40 min). HPLC C18 retention time: 17.5 min.

[0240] Synthesis of Cy5-D-PEG4-SPDP(6) A solution of compound 5 (250 mg, 0.0041 mmol) in DMF (5 mL) was treated with DIPEA to adjust the pH of the reaction mixture (approximately 7.0-7.5). The reaction was treated with SPDP-PEG4-NHS ester (11 mg, 0.0020 mmol) and the reaction mixture was stirred at room temperature for 12 h. It was then dialyzed against DMF for 12 h followed by water for 24 h. The aqueous layer was frozen and lyophilized to give the desired product as a blue solid (80% yield). 1H NMR (500 MHz, DMSO-d6) δ 8.25-7.75 (m, internal amide H), 7.35 (m, Cy5 H), 7.25 (m, Cy5 H), 7.05 (m, Cy5 H), 6.6 (m, Cy5 H), 6.3 (m, Cy5 H), 6.83 (s, GABA amide H), 4.74 (s, surface OH, H), 4.01-3.39 (t, J = 5.0 Hz, ester-CH2), 3.50-2.00 (m, dendrimer CH2), 1.9 (s, 24H), 1.6 (s, 80H), 1.2 (s, 126H), 0.8 (s, 80H).HPLC C18 retention time: 19.5 minutes.

[0241] Reduction of thiol-modified siRNA A 100 mM solution of DTT in 100 mM sodium phosphate buffer, pH 8.3-8.5, was prepared by dissolving 77.13 mg of DTT in 5 mL of buffer. Thiol-modified siRNA7 was dissolved in 125 μL of DTT solution and incubated at room temperature for 1 h. Removal of by-products was performed using a GE Healthcare NAP-10 column SEPHADEX® G-25 DNA grade (CAS number 2682-20-4). The NAP-10 column was equilibrated with approximately 15 mL of 100 mM sodium phosphate buffer, pH 6.0. Thiol-modified siRNA was eluted into an Amicon Ultra-centrifuge, ULTRACEL® 10K filter (UFC501024) using 0.5 mL of sodium phosphate buffer.

[0242] Synthesis of D-siRNA conjugates A solution of compound 6 (2.4 mg, 37.5 nmol, 0.5 eq) in 200 μL was treated with siGFP-SH 8 (75 nmol, 1.0 eq) in 200 μL and the reaction mixture was stirred at room temperature. After 12 h, the mixture was passed through a GE Healthcare SEPHADEX® G-25 column and the D-siGFP 9 product was collected. The product was concentrated and buffer exchanged against PBS by centrifugal ultrafiltration using a 30 KDa MWCO filter unit with a volume of 0.5 mL. HPLC C18 retention time 18.5 min.

[0243] Ultrafiltration and SEC chromatography Removal of excess reagents and by-products after each step of synthesis and buffer exchange was performed by ultracentrifugal filtration using 0.5 mL AMICON® filtration units with MWCO 30 kDa or 100 kDa. Products and intermediates were further purified by size exclusion column (SEC) chromatography using PBS as the mobile phase.

[0244] PAMAM dendrimer conjugates MALDI matrix 2',4',6'-trihydroxyacetophenone monohydrate (THAP) (10 mg) was dissolved in 1 mL of acetonitrile in water (1:1) containing 0.1% trifluoroacetic acid. 2 μL of PAMAM dendrimer was then deposited onto the MALDI sample plate. Matrix (10 mg / mL, 2 μL) was deposited onto the air-dried sample and allowed to air dry for 10-20 min. MALDI-TOF MS analysis was performed in reflector positive mode.

[0245] Oligonucleotide Conjugates Oligonucleotide analysis was performed using a matrix containing 3-hydroxypicolinic acid (3-HPA) and diammonium hydrogen citrate (DAHC). A solution of 3-HPA (50 mg / mL, in 50% acetonitrile / water) was mixed with DAHC solution (100 mg / mL) in a 9:1 ratio (225 μL 3-HPA:25 μL DAHC) to obtain a final DAHC concentration of 10 mg / mL. The siRNA solution was desalted and then mixed with the matrix, and 2 μL of siRNA was deposited on the plate and allowed to air dry for 10–20 min. The HPA / DAHC matrix was then deposited on the air-dried oligonucleotides and allowed to air dry. MALDI-TOF MS analysis was performed on a Bruker Voyager DE-STR MALDI-TOF (Mass Spectrometric and Proteomics core, Johns Hopkins University, School of Medicine) operating in linear positive ion mode.

[0246] Gel electrophoresis A gel retardation assay was performed to confirm the formation of D-siRNA conjugates. RNA ladder (NEB, Ipswich, MA), free siRNA, and D-siGFP were mixed with GelRed stain for 2 μg nucleic acid loading, 1 μL glycerol, and ultrapure water. Gel electrophoresis was performed in a 10% TBE-urea gel with TBE buffer (Bio-Rad, Hercules, CA) at 120 V for 20 min, after which the gel was imaged in a ChemiDoc imaging system (Bio-Rad, Hercules, CA). A separate retardation assay to visualize the dendrimers was performed in a 4-15% TGX stain-free gel (Bio-Rad).

[0247] Serum stability of dendrimer-siRNA conjugates Stability studies were performed under reducing conditions using RNase III according to the manufacturer's protocol. Studies using non-reducing conditions were performed with RNase III obtained by solvent exchange. 100 units of RNase III were diluted with an equal volume of reaction buffer (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2) without DTT and extracted with a 10 kDa centrifugal filter. The process was repeated three times to ensure complete removal of residual DTT.

[0248] In reduced and non-reduced stability studies, 10 μg of free siGFP and D-siGFP were treated with 20 units of RNase III and stored at 37° C. Samples were taken at set time points, immediately frozen, and stored at −20° C. until further analysis. Gel retardation assays were performed in 10% TBE-urea gels to determine RNA stability.

[0249] cell line The GFPd2-expressing human embryonic kidney 293T (HEK293T) cell line was generously provided by Green Lab (Institute for NanoBio Technology, and Translational Tissue Engineering Center, Johns Hopkins University). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM, ATCC, Manassas, VA) supplemented with 10% (v / v) heat-inactivated fetal bovine serum (FBS, Invitrogen Corp., Carlsbad, CA), 1% penicillin / streptomycin (P / S, Invitrogen Corp., Carlsbad CA). Transfection studies were performed by replacing the cell medium with Opti-MEM (Thermo Scientific, Rockford, IL). Cells were maintained in a humidified atmosphere at 37°C and 5% CO2.

[0250] The GL261 murine glioma cell line used for in vivo tumor inoculation was cultured in RPMI 1640 medium (Thermo Scientific, Rockford, IL) supplemented with 10% heat-inactivated fetal bovine serum, 1% penicillin / streptomycin, and 1% L-glutamine (Sigma-Aldrich, St. Louis, MO).

[0251] In vitro evaluation of delivery strategies Time-dependent uptake studies GFP-expressing HEK-293T cells were seeded in glass-bottom culture dishes and grown for 24–48 h to 70–80% confluency. Cells were treated with Cy5 fluorescently labeled dendrimer (Cy5-D) and siGFP-conjugated Cy5-labeled dendrimer (Cy5-D-siGFP, 9) in DMEM supplemented with 1% P / S (serum-free medium). Cells were then washed with PBS (×3) and fixed in 5% formalin solution. Cells were incubated and confocal microscopy images were taken by a ZEISS AXIOVERT® 200 system equipped with an LSM 510-Meta confocal module. Image acquisition parameters were kept constant during imaging. Images were processed by Zen 2011 software (Zeiss).

[0252] Image Analysis Live cell images were taken at set time points with a ZEISS AXIOVERT® 200 phase contrast microscope (Carl Zeiss). Image thresholding was automated with the embedded Triangle method in ImageJ, and mean fluorescence and background were calculated using a threshold object. Automated cell counting was performed using the "Analyze Particles" function on a threshold mask, and cell confluency was estimated with the PHANTAST-FIJI® plugin.

[0253] HEK293T cell transfection Cells were plated at 5 x 10 per well. 4Cells were seeded in 24-well tissue culture plates at a density of 100x and grown for 24 hours. The different RNA delivery platforms (LIPOFECTAMINE® 2000, LIPOFECTAMINE® 3000, RNAi Max) were prepared according to the manufacturer's protocol. Prior to treatment, cell culture medium was replaced with Opti-MEM reduced serum medium. To optimize conditions for each delivery vehicle, combinations of siGFP payload concentrations (0.6-30 pMol) and LIPOFECTAMINE® or RNAi Max concentrations (0.5-1.5 μL) were tested. The set with the highest knockdown was used for comparison with the dendrimer platform.

[0254] For dose-dependent studies, cells were treated with different concentrations of D-siGFP for 48 h. Knockdown of GFPd2 fluorescence was assessed by live cell images taken at 0, 24, and 48 h after treatment. Cellular proteins were also extracted at 48 h and stored at -80°C for Western blot.

[0255] Western blot assay of HEK293T cells Cellular protein concentrations were determined using a BCA protein assay kit (Thermo Scientific, Rockford, IL), and equal amounts of protein were denatured with 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO) following standard Western blot protocols. Proteins were separated on 4-15% TGX gels (Bio-Rad, Hercules, CA) and transferred to nitrocellulose membranes. Membranes were blocked with 3% BSA for 1 h and probed for cyclophilin B and GFP overnight at 4 °C. Membranes were washed three times and then incubated with HRP-conjugated secondary antibodies for 1.5 h. Protein bands were visualized by immersing the stained membrane in a chemiluminescent substrate (Thermo Scientific, Rockford, IL) and imaging using a ChemiDoc system.

[0256] In vivo evaluation of delivery strategies Orthotopic GL261 glioblastoma mouse model All animal procedures were performed as approved by the Johns Hopkins Animal Care and Use Committee. CX3CR-1GFP mice were housed at constant temperature and humidity (20 ± 1 °C, 50 ± 5% humidity). For all procedures, animals were anesthetized by intraperitoneal injection containing a cocktail of 2.5% xylazine (VetOne, Boise, MO), 25% ketamine (Henry Schein, Melville, NY), and 14.2% ethanol (Sigma Aldrich, St. Louis, MO) in saline. GL261 cells were inoculated immediately after collection at a concentration of 50,000 cells / μL and kept on ice during surgery. The scalp was incised and a hole was drilled in the skull 1 mm posterior to the bregma and 1.5 mm lateral to the midline using a microdrill (Braintree Scientific, Braintree, MA). GL261 cells were inoculated through the opening using a 2 μL syringe (Hamilton, Reno, NV) at a rate of 0.2 μL / min for 2 μL of cell suspension per animal. The incision was closed with sutures (Ethicon) and antibiotic ointment was applied.

[0257] Administration of D-scRNA and D-siGFP conjugates Two weeks after inoculation, the incision was reopened and animals were injected intratumorally with 2 μg of nucleic acid-based D-scRNA, D-siGFP, or free siGFP. To determine uptake and efficacy, animals were anesthetized with isoflurane and euthanized by cardiac perfusion with PBS at 24 and 48 hours.

[0258] Immunohistochemistry and optical imaging The excised brains were immediately fixed in 4% paraformaldehyde, stored overnight at 4°C, and subjected to a sucrose gradient before cryosectioning. Organs were processed on a Leica CM 1905 cryostat to obtain 30 mm thick axial sections. Each slide was stained with DAPI (nuclei) and imaged on a confocal LSM 710 microscope (Carl Zeiss; Hertfordshire, UK). Unstained and untreated control brains were used in calibration to avoid background fluorescence, and settings were used unchanged throughout the study. Both the tumor and the corresponding contralateral hemisphere were imaged and analyzed, with the contralateral hemisphere serving as an internal control.

[0259] statistical analysis Data are expressed as mean ± SEM and analyses were performed in Excel 2013 and GraphPad Prism (version 6: La Jolla, CA). Treatment groups were analyzed by two-way analysis of variance (ANOVA) tests across time points or doses. Significant differences between single groups were determined by Student's t-test: * P < 0.05, ** P < 0.01 and *** P<0.001.

[0260] result Synthesis and characterization of Cy5-D-PEG4-SPDP: Cy5-D-PEG4-SPDP conjugates were synthesized using PAMAM-G6-OH (D6-OH) dendrimer composed of 256 terminal hydroxyl groups (Figure 3). After each synthesis step, the products were purified via dialysis in DMF for 24 h to remove small molecule impurities, followed by water dialysis to remove DMF. 1H NMR (in DMSO-d6) of intermediates and final conjugates from top to bottom were compared, and analytical HPLC traces confirmed the formation of products by the appearance and disappearance of peaks, indicating a shift in retention time, respectively. The molecular weights of all intermediates and final building blocks were determined by MALDI-spectra of PAMAM-G6-OH, Cy5-D, and Cy5-D-PEG4-SPDP; the degree of conjugation at each step of the synthesis was calculated based on 1H-NMR, and the change in molecular weight was measured by MALDI-TOF. The synthesis of compound 1 was carried out starting from commercially available D6-OH (13.75% w / w) in methanol, dried under reduced pressure, followed by dissolving in water and lyophilization. Traces of methanol and water in the dendrimer were completely removed as they interfered with the coupling step. The lyophilized monofunctional D6-OH was first functionalized with Boc-protected amines by treating with Boc-GABA-OH under EDC.HCl and 4-DMAP in DMF at room temperature for 36 h to give the product Boc-protected bifunctional dendrimer. The completion of the reaction was monitored by HPLC and the residue was dialyzed against ultrapure water through a 3.5 kDa membrane for 24 h to remove low molecular weight impurities via selective diffusion through the semipermeable dialysis membrane. The synthesis of dendrimer (3) was carried out by HPLC. 1H NMR showed the appearance of the tert-butyl protons of the Boc group at δ 1.3 ppm and the GABA methylene protons at δ 1.6 ppm as singlets. The peak at δ 3.9 ppm was for the methylene protons of the dendrimer next to the hydroxyl group once converted to an ester, and the amide protons from the GABA linker also appeared at δ 6.8 ppm. The Boc groups were then deprotected under mildly acidic conditions using trifluoroacetic acid (TFA) in dichloromethane (DCM) (1:4) to give the bifunctional dendrimer (4). The excess TFA was removed by coevaporation with methanol, and the resulting crude product was used for the next step without further purification. The complete disappearance of the Boc protons was confirmed by NMR (δ 3.9 ppm). 1The total number of amine groups was maintained at about 10. The bifunctional dendrimer was then treated with the fluorescent dye Cy5 to give dendrimer 4 with about 1-2 successful Cy5 conjugations on the dendrimer surface. 1H NMR showed the appearance of Cy5 signals in the aromatic region (1H NMR (DMSO-d6, 500 MHz) characterized the dendrimer conjugates, D-GABA-Boc, D-GABA-NH2, Cy5-D, Cy5-D-PEG4-SPDP (in DMSO-d6 and DO) showing the appearance or disappearance of characteristic signals) and the HPLC retention time shifted from 19.0 to 17.5 min, confirming the formation of the product. After Cy5 conjugation, the remainder of the amine groups were reacted with a heterobifunctional 3-(2-pyridyldithio)propionamide-PEG4-NHS ester (NHS-PEG4-SPDP) linker. This heterobifunctional linker was used to form a disulfide reduction-sensitive linker between dendrimers and siRNAs via classical thiol-disulfide exchange with siRNA-SH. This bond is relatively stable in serum and cleavable in the reducing cytoplasmic environment. Analytical reversed-phase high-performance liquid chromatography (HPLC) was performed to determine the purity of the products. The size of the components was measured by dynamic light scattering (DLS) using a Zetasizer. The average hydrodynamic diameter of both D-OH and D-siRNA in water was about 6 nm and showed no significant change after modification.

[0261] Synthesis and characterization of dendrimer-siRNA conjugate 1 The synthesis of dendrimer-siGFP (D-siGFP) is shown in Figure 4. The delivery efficiency of siRNA bioconjugates depends on the site of conjugation, the cleavability of the linker, the length of the spacer arm, and the biophysical properties of the conjugated molecule. siRNA is a duplex consisting of two complementary strands, sense and antisense, with a terminal phosphate group that can be used for chemical conjugation. There are four terminal ends that can be used as conjugation sites. Upon cellular uptake, the antisense strand, which has a complementary sequence to the target mRNA, is incorporated into RISC. The 5' of the antisense strand is particularly important in initiating the RNAi mechanism. Thus, the 5' and 3' ends of the sense or passenger strand and the 3' end of the antisense strand are potential sites for conjugation, with modifications to the sense strand being more favorable to minimize changes in silencing efficacy. Consequently, a disulfide thiol modifier to introduce a sense 5' thiol (-SH) linkage was used in this study. The SH-modified siGFP can be used to form reversible disulfide bonds, ligand-SS-siGFP, or irreversible bonds with various activated acceptor groups. The protected form of thiol-modified siGFP used herein prevents the formation of dimers. Prior to use, the thiol-modified (SS) siGFP was reduced to sulfhydryl (-SH) for further conjugation. The dithiol-modified siGFP was treated with 100 mM dithiothreitol (DTT) to quantitatively reduce the disulfide bonds, resulting in sulfhydryl groups for further conjugation with dendrimers. HPLC analysis showed that the dithiol groups were nearly quantitatively reduced and excess DTT was removed before the next reaction step. The resulting sulfhydryl group at the sense 5' end of siGFP was then reacted with dendrimer-PEG4-SPDP (5) to form the desired D-siGFP (1) conjugate via a sulfhydryl exchange reaction.The 2-pyridylthio group reacts with sulfhydryls under neutral pH by replacing the electron-stabilized 2-pyridyl group with a thiol compound. This thiol exchange reaction is usually used in many cross-linking and conjugation reactions, where SPDP readily exchanges with sulfhydryl groups to obtain a single disulfide product. The newly formed disulfide bond between the dendrimer and the siRNA is sensitive to reduction under acidic conditions. The resulting D-siGFP was passed through a GE Healthcare SEPHADEX® G-25 column and concentrated by ultrafiltration. The molecular weight was determined by the MALDI-TOF TOF spectrum of Cy5-D-siGFP, which showed a peak at a mass of 72908 Da and an HPLC trace. The purity of the product was confirmed by HPLC of Cy5-D-siGFP at 210, 260, and 650 nm. Furthermore, the successful synthesis of D-siGFP was confirmed by gel retardation. A clear single band from D-siGFP was retained at a distance corresponding to the 150 bp marker on a 10% TBE-urea gel, with an estimated size of 90 kDa as determined by gel retardation of naked siGFP and D-siGFP.

[0262] Serum stability of chemically conjugated D-siRNA Protection of nucleic acid payloads against nucleases is crucial for successful RNAi therapy. Therefore, the ability of D-siGFP to deliver an intact payload was validated against the endonuclease RNase III under reducing (1 mM DTT) and non-reducing (0 mM DTT) conditions. Under non-reducing conditions, naked siGFP was degraded by RNase III in less than 2 hours, while D-siGFP still remained stable for up to 48 hours; D-siGFP and siGFP were incubated with RNase III nuclease under non-reducing and reducing conditions. Under non-reducing conditions, naked siGFP was degraded in 30 minutes, while D-siGFP remained stable for up to 48 hours. Under reducing conditions, both siGFP and D-siGFP nucleic acid payloads were rapidly released from the dendrimer platform, and both naked siGFP and D-siGFP were rapidly degraded in 15 minutes. Furthermore, siGFP and D-siGFP were incubated in human plasma to mimic in vivo serum stability. The band for D-siGFP remained at 150 bp, indicating no plasma protein binding, while the siGFP band shifted dramatically from 20 bp to 150 bp in as little as 1 hour, with significant protein binding. Significant plasma protein binding to free siGFP occurred as early as 1 hour at 37°C in human plasma, and the amount of protein binding increased after 48 hours of incubation. No significant protein adsorption was observed for D-siGFP.

[0263] In vitro GFP knockdown in HEK-293T cells Cellular delivery of siRNA using chemically conjugated dendrimer-based platforms was evaluated in vitro using a GFP-expressing HEK293T cell line. HEK293T cells express a destabilized form of GFP (GFPd2) with a half-life of approximately 2 hours, which is comparable to many proteins in an in vivo environment. For time-dependent uptake studies, HEK293T cells were treated with Cy5-D-siGFP-Cy3 and the cells were incubated for 48 hours. Cells were washed and then imaged at each time point, and treatment medium was reapplied after each imaging session. As early as 6 hours, D-siGFP showed intracellular accumulation; cellular uptake of Cy5-D-siGFP and dose-dependent gene knockdown were observed by confocal microscopy images of Cy5-D-siGFP-Cy3 cellular uptake into HEK293T cells. At 24 hours after treatment, a diffuse Cy3-siRNA signal is detected, while the Cy5-dendrimer signal is punctate; the Cy5-dendrimer and Cy3-siRNA signals are co-localized.

[0264] Naked siGFP did not accumulate to any obvious extent in HEK293T cells. Confocal microscopy images showed that dendrimer Cy5 was distributed in the cytoplasm of HEK293T cells, and at the same time, the dendrimer Cy5 signal was colocalized with the siRNA Cy3 signal 24 hours after treatment. The colocalization of Cy5 and Cy3 signals was confirmed by the integrated (pink) signal when merging channels.

[0265] To evaluate GFP knockdown, HEK293T cells were seeded 24 hours prior to treatment and the culture medium was replaced with OPTIMEM® immediately prior to treatment. Cells were treated with five different concentrations of D-siGFP, including 10, 50, 100, 200, and 500 nM. GFPd2 expression was estimated by relative fluorescence intensity using background-corrected intensity in the GFP channel and normalized to the internal control at 0 hours. Optimal knockdown was reported 24 hours after transfection. Viable cell images reported significant time-dependent knockdown of GFP protein at concentrations above 50 nM, with a peak of approximately 40% knockdown at 24 hours. GFP concentrations returned to normal over 72 hours. After 48 hours, cells were harvested, lysed, and Western blotted. IC50 values ​​were estimated using the dose-response curve of D-siGFP 24 hours after transfection (Figures 5 and 6).

[0266] Delivery of siRNA using commercially available transfection reagents The effects of commercial transfection reagents, LIPOFECTAMINE® 2000, LIPOFECTAMINE® 3000 and RNAi Max, were evaluated as comparative controls. In image analysis of GFP fluorescence, all commercial platforms yielded some degree of knockdown of GFPd2 expression (Figures 7A-7C), and conditions and nucleic acid loading were optimized for each vehicle. Live cell images were also analyzed for confluency as an indirect measure of cytotoxicity; no significant toxicity was observed across all systems. Although direct measurement of relative GFP expression by Western blot did not yield any statistically significant differences between the delivery systems, a trend could be observed in which the LIPOFECTAMINE® system and naked siGFP yielded more inconsistent effects on GFP production. The discrepancy between GFP fluorescence detected from image analysis and actual GFP protein production suggests that the LIPOFECTAMINE® system may release its payload in a burst release, achieving the knockdown observed in image analysis and the subsequent increase in GFP protein when siGFP undergoes degradation. In contrast, RNAi Max and D-siGFP exhibit slow release profiles and may result in long-term knockdown of GFP production.

[0267] In vivo study of Cy5-D-siGFP in GL261 glioma To validate the D-siGFP conjugates as effective siRNA transfection agents, D-siGFP was injected intratumorally into an orthotopic glioblastoma mouse model. Intratumoral injection was chosen because it is popular in gene therapy applications and demonstrates the efficacy and uptake of D-siGFP without waste. CX3CR-1GFP mice were injected with 2 × 10 siRNA 2 weeks prior to intratumoral injection of the dendrimer conjugates. 5 GL261 cells were initially inoculated and tumors were allowed to grow to full size.

[0268] For uptake studies, the dual-labeled conjugate, Cy5-D-siGFP-Cy3, was administered intratumorally and organs were extracted 24 hours after injection. Confocal images of the tumor, tumor border, and contralateral side were obtained and analyzed by Zen 2011 software. Dual-labeled D-siRNA was diffusely distributed within the tumor and was only observed within the tumor parenchyma and absent from the contralateral brain hemisphere. Cy5-D-siRNA-Cy3 selectively targets TAMs and knocks down genes in a GFP transgenic GL261 mouse model; D-siGFP was retained in the tumor after intratumoral administration, and uptake of D-siGFP was concentrated around tumor-associated macrophages (TAMs). Some Cy5 (dendrimer) and Cy3 (siGFP) signals colocalized with each other, suggesting delivery of intact D-siGFP conjugate. In addition, Cy3 signals were also present and colocalized with the GFP signal expressed by TAMs, indicating uptake of siGFP. Interestingly, only a portion of the Cy3 signal was colocalized with both GFP and Cy5, indicating that only a small portion of the D-siGFP conjugate remains intact after cellular uptake, whereas the majority of the Cy3 and Cy5 signals dissociated from each other, indicating that the siGFP sequence was released from the dendrimer vehicle after cellular uptake.

[0269] Next, knockdown of GFP expression was investigated. Tumor-bearing animals were injected with D-siGFP, D-scRNA or free siGFP, and organs were collected 24 and 48 hours after injection. The contralateral hemisphere was used as an internal control, and D-scRNA was used as a vehicle control. There was 50% knockdown in tumors administered GFP fluorescent D-siRNA compared to the contralateral hemisphere as an internal control (Figure 8). In untreated animals, GFP fluorescence was reduced by 20% with tumor inoculation.

[0270] summary siRNAs play a key functional role in the gene silencing process by pairing with specific mRNA sequences and degrading them via the RISC complex, resulting in knockdown of specific protein expression. Therefore, delivery of intact siRNA sequences to target cells is crucial for successful RNAi therapy. A facile dendrimer-siRNA conjugation strategy was developed based on biocompatible hydroxyl-terminated PAMAM dendrimers that generate environmentally responsive nanoparticle conjugates with precise nucleic acid loading and specific targeting to inflamed areas.

[0271] The synthesis was carried out under mild reaction conditions by an adjustable synthetic route using affordable synthetic materials and simple purification techniques.The stimuli-responsive linker chemistry used herein plays an important role in the specific release of payload into the intracellular environment, while dendrimer conjugation improves nuclease resistance and delivery efficiency.The reported half-life of naked siRNA in serum ranges from a few minutes to an hour, and the results suggest that chemically conjugated D-siRNA improves stability without compromising knockdown efficiency by delaying serum degradation from 30 minutes to 48 hours.

[0272] This is a breakthrough in the in vivo efficacy of RNA interference. Moreover, D-siRNA undergoes immediate disulfide bond reduction in an in vitro reducing agent, suggesting that the cytosolic environment can trigger the release of siRNA. The study herein also emphasizes that chemical conjugation of siRNA to dendrimers does not impair gene knockdown activity. In an in vitro environment, it has been shown that covalently conjugated D-siRNA can generate sustained knockdown by delaying the release of nucleic acid payload.

[0273] In vivo proof-of-principle results demonstrated that covalently conjugated D-siGFP can generate targeted gene knockdown effects. Relatively moderate knockdown was reported (approximately 50%) in both in vitro HEK293T cells and in vivo brain tumor models. Confocal analysis demonstrated that D-siGFP localized within tumor-associated macrophages and released its payload intracellularly, with virtually no uptake in other cell populations or the contralateral brain hemisphere. Chemically conjugated siRNA is capable of generating high gene knockdown compared to free siGFP without affecting the inherent properties of PAMAM dendrimers in achieving high tumor specificity in the orthopedic GL261 mouse model.

[0274] Covalent conjugation of siRNA to dendrimers significantly enhanced serum half-life and bioavailability, and protected the payload from protein adsorption and enzymatic degradation. D-siRNA conjugates effectively delivered siRNA to cells both in vitro and in vivo, while efficiently knocking down targeted genes. In in vitro studies, D-siGFP achieved a similar degree of knockdown as RNAi Max and LIPOFECTAMINE® systems. In in vivo studies, D-siGFP preferentially localized within the tumor parenchyma, released its payload intracellularly, and achieved gene silencing effects in GFP-expressing tumor-associated macrophages. These results demonstrate that a facile dendrimer-based covalent conjugation strategy provides an efficient and safe approach to the clinical translation of siRNA therapeutics.

[0275] Example 3 Dendrimer-miR126 conjugates for targeted inhibition of choroidal neovascularization material and method Chemicals and Reagents Hydroxyl-terminated ethylenediamine core PAMAM dendrimers (6th generation, pharmaceutical grade) in methanol solution were purchased from Dendritech (Midland, MI, USA). Before use, the dendrimer solutions were evaporated on a rotary evaporator. Dialysis membranes (MWCO 1 kDa) were purchased from Spectrum Chemicals (New Brunswick, NJ, USA). Thiol-modified miR-126: Sense: 5'-UCGUACCGUGAGUAAUAAUGCG-3' (SEQ ID NO: 4); Antisense: 5'-CGCAUUAUUACUCACGGUACGA-[thiolC6S-S]-3' (SEQ ID NO: 5), and Cy3-labeled equivalent were purchased from Bio-Synthesis (Lewisville, TX, USA). Bio-Spin P-30 gel columns and 15% TBE-urea precast gels were purchased from Bio-Rad (Hercules, CA, USA). Amicon ultracentrifugal filters (MWCO 10 kDa), GelRed nucleic acid dye, and anhydrous N,N'-dimethylformamide (DMF) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Deuterated solvents (DMSO-d6), methanol (CD3OD), and water (D2O) were also purchased from Sigma-Aldrich. dsRNA ladder was purchased from New England BioLabs (Ipswich, MA, USA). Dulbecco's modified Eagle's medium (DMEM, low glucose with L-glutamine) was purchased from Thermo Fisher (Waltham, MA, USA). Human microvascular endothelial cells and the necessary media kit were purchased from Lonza (Basel, Switzerland). Phenol red-free Matrigel was purchased from Corning (Tewksberry, MA, USA).

[0276] Use of equipment The structure of the intermediate was confirmed by proton nuclear magnetic resonance (NMR) analysis using a Bruker 500 MHz spectrometer (Bruker Corporation, Billerica, MA, USA). 1The compounds were analyzed at ambient temperature using H NMR spectroscopy. Chemical shifts are relative to an internal standard of tetramethylsilane and are reported in ppm. Residual protic solvent DO ( 1 H, δ 4.79 ppm) and DMSO-d6 ( 1 H, δ 2.50 ppm) was used for chemical shift calibration.

[0277] The purity of intermediates and dendrimer-miR126 conjugates was analyzed using high performance liquid chromatography (HPLC). The HPLC instrument (Waters Corporation, Milford, MA, USA) was equipped with a 1525 binary pump and an in-line degasser AF. The instrument was equipped with a 717plus autosampler and had two detectors: a 2998 photodiode array detector and a 2475 multi-lambda fluorescence detector. The instrument was interfaced with Waters Empower software. HPLC samples were run on a Waters C18 Symmetry 300, 5 μm, 4.6 × 250 mm column. Chromatograms were recorded at 210 nm (dendrimer absorption) and 260 nm (nucleic acid absorption). A gradient flow HPLC method was used, starting at 90:10 (solvent A: 0.1% TFA and 5% ACN in water; solvent B: 0.1% TFA in ACN), gradually increasing to 50:50 (A:B) in 30 min, and finally returning to 90:10 (A:B) in 40 min, at a constant flow rate of 1 mL / min.

[0278] Synthesis of dendrimer conjugates Synthesis of dendrimer-PDP, 1 Succinimidyl 3-(2-pyridyldithio)propionate (SPDP, 14 mg, 0.068 mmol) was added to a stirred solution of D-OH (200 mg, 0.0034 mmol) in anhydrous DMF. The reaction was allowed to continue for 24 h at room temperature. The mixture was diluted with DMF and dialyzed using a 1 kDa cut-off dialysis membrane against DMF. The DMF was changed every 4 h for 12 h, followed by dialysis against water for 12 h with frequent water changes. The resulting aqueous solution was lyophilized to give D-PDP as an off-white powder (80% yield).

[0279] 1 H NMR (500 MHz, DMSO) δ 8.30 (d, aromatic 4H), 8.06-7.79 (m, internal amide 510H), 7.01 (m, aromatic 5H), 4.73 (s, surface OH, 235H), 4.06 (s, ester linked, 12H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 2.43 (s, dendrimer-CH2), 2.20 (s, dendrimer-CH2). Retention time: 18.00 min.

[0280] Synthesis of Boc-GABA-dendrimer-PDP, 2 Compound 1 (100 mg, 0.0016 mmol) was dissolved in 3 mL of DMF followed by the addition of Boc-GABA-OH (1 mg, 0.005 mmol) and DMAP (1 mg, 0.008 mmol). The solution was stirred at room temperature for 10 min before the addition of EDC.HCL (2 mg, 0.013 mmol). The reaction mixture was left at room temperature under constant stirring for 24 h before the crude product was transferred to 3 kD cut-off cellulose dialysis tubing and dialyzed against DMF for 12 h. The product was then dialyzed against water for an additional 24 h. The resulting aqueous solution was frozen and lyophilized to give product 2 as a hygroscopic white solid (95 mg, 94%). 1H NMR (500 MHz, DMSO-d6) 8.12-7.78 (m, internal amide H), 7.01 (m, aromatic 5H), 6.59 (s, GABA amide H, 10H), 4.73 (s, surface OH, 233H), 4.06 (s, ester linkage, 16H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 1.64-1.59 (m, GABA linker -CH2, 6H), 1.36 (s, Boc group, 20H).

[0281] Synthesis of NH2-GABA-D-PDP, 3 Deprotection was carried out by adding compound 2 (95 mg, 0.0015 mmol) to a mixture of TFA / DCM (3:4) and stirring vigorously for 12 h. The suspension was diluted with methanol and concentrated in vacuo, and the process was repeated three times to remove excess TFA. The crude product was used without further purification.

[0282] Synthesis of Cy5-D-PDP, 4 Compound 3 (108 mg, 0.0018 mmol) was dissolved in DMF and treated with DIPEA, and the pH of the mixture was adjusted (pH approx. 7.0-7.5). Cy5-NHS ester (2.8 mg, 0.0027 mmol, 1.5 eq.) was added and stirred at room temperature for 12 h. The crude mixture was dialyzed against DMF for 12 h and against water for 24 h. The aqueous solution was frozen and lyophilized to give product 4 as a blue powder (86% yield). 1 H NMR (500 MHz, DMSO-d6) 8.12-7.78 (m, internal amide H), 7.30 (s, Cy5 H), 7.01 (m, aromatic 5H), 4.73 (s, surface OH, 168H), 4.06 (s, ester linked, 16H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 1.64-1.59 (m, GABA linker -CH2). Retention time: 18.07 min.

[0283] Synthesis of dendrimer-miR126, 5 Thiol-modified miR-126 and its Cy3-labeled counterpart were deprotected according to the manufacturer's protocol. Briefly, lyophilized miR-126 was resuspended in an aqueous solution of triethylamine (TEA, 2%) and dithiothreitol (DTT, 50 mM). The solution was kept at room temperature for 10 min and extracted four times with ethyl acetate to remove DTT.

[0284] To a stirred solution of 1 (1 mg, 0.00017 mmol) in diethylpyrocarbonate-treated (DEPC-treated) water (Invitrogen, Rockland, IL, USA), deprotected miR-126 (0.5 mg, 0.00034 mmol) was added. The solution was stirred for 48 h and transferred to a 3 kDa cutoff AMICON® centrifugal filter. The solution was washed and concentrated three times by centrifugation with DEPC-treated water. The concentrated solution was passed through a P-30 gel column to remove unreacted miR-126. Retention time: 17.33 min.

[0285] Synthesis of Cy5-D-miR126-Cy3, 6 Cy3-labeled thiol-modified miR-126 was deprotected according to the steps above and then added to an aqueous solution of 4. The solution was stirred for 48 h and transferred to a 3 kDa cutoff Amicon centrifugal filter. The solution was washed and concentrated three times and then passed through a P-30 gel column to remove unreacted nucleic acids.

[0286] Gel electrophoresis Purified D-miR126, thiol-modified miR-126, and dsRNA ladder were mixed with GELRED® nucleic acid stain and glycerol (10% v / v) and loaded onto a 15% TBE-urea gel. The gel was subjected to constant voltage (120 V) and visualized with a CHEMIDOC® imaging system (Bio-Rad, Hercules, CA).

[0287] MALDI-TOF analysis The matrix 2'-4'6'-trihydroxyacetophenone monohydrate (THAP) was dissolved in an acetonitrile:water mixture (1:1) containing 0.1% trifluoroacetic acid at a concentration of 10 mg / mL. 5 μL of D-miR126 was deposited on the MALDI sample plate at a concentration of 1 μg / μL, followed by 2 μL of the matrix mixture. 2 μL of D-PDP was deposited on the sample plate at a concentration of 1 μg / μL, followed by 2 μL of the matrix mixture. The samples were air-dried overnight and analyzed by MALDI-TOF MS in reflectance positive mode.

[0288] cell line Human microvascular endothelial cells (HMECs) were obtained from Lonza and cultured in EGMTM-2 endothelial cell growth medium (Lonza). BV-2 murine macrophages were provided by the Children's Hospital of Michigan Cell Culture Facility and cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco Laboratories) supplemented with 10% FBS and 1% penicillin / streptomycin. All cell lines were maintained in a humidified atmosphere at 37°C and 5% CO2.

[0289] In vitro evaluation of D-miR126 efficacy HMEC angiogenesis assay HMECs, 1 x 10 5 Cells were seeded in 12-well plates at a density of 1000000 cells / mL and grown to confluency. The cells were then incubated simultaneously with D-miR126 and miR-126 and full serum medium for 24 hours. After 24 hours of treatment, the cells were harvested by detaching them with trypsin, and the resulting cell suspension was collected and centrifuged at 300g for 5 minutes. Tube formation assay was performed according to the protocol provided by Lonza.

[0290] Briefly, on the day of the assay, 96-well plates were coated with 75 μL of phenol-free Matrigel® and polymerized for 20 min at 37°C. Cell pellets were resuspended in 300 μL of medium and 75 μL of the solution (400,000 cells / mL) was seeded into each Matrigel®-coated well. After 7 h, the resulting cell networks were imaged with a Zeiss Axiovert 200 phase contrast microscope (Carl Zeiss, Oberkochen, Germany) and analyzed by the Angiogenesis Analyzer-ImageJ plugin (Carpentier, G. et al., Sci. Rep. 10, 11568 (2020)).

[0291] PCR analysis of proinflammatory and proangiogenic mRNA expression HMECs were incubated with D-miR126 or miR-126 in full serum conditions for 24 h before samples were collected. To induce a proinflammatory phenotype, BV2 murine macrophages were first stimulated with LPS (100 ng / mL, Sigma-Aldrich) in serum-free medium for 3 h and then treated simultaneously with LPS (100 ng / mL) and D-miR126 or miR-126 for 24 h.

[0292] HMEC and BV2 samples were then collected using TRIzol for polymerase chain reaction (PCR) analysis. Briefly, samples were subjected to a freeze-thaw cycle with TRIzol followed by the addition of 200 μL of chloroform (Thermo Fisher Scientific). Samples were shaken and placed in ice for 15 min. To aid in separation of the aqueous and organic layers, samples were centrifuged at 15,000 g for 15 min. The aqueous solutions were collected and isopropanol was added to each sample (500 μL; Thermo Fisher Scientific). Samples were centrifuged again at 15,000 g for 15 min and then washed with 75% ethanol in DEPC-treated water.

[0293] RNA content was determined by Nanodrop, and equivalent amounts of RNA from each sample were converted to complementary DNA (Applied Biosystems, Foster City, CA). PCR analysis was performed with Fast SYBR Green reagents on a STEP ONE PLUS® Real-Time PCR System (Applied Biosystems). PCR primers for VEGF-α, GAPDH, and IL-1β were obtained from Bio-Rad Laboratories (Hercules, CA). Primers were purchased from Integrated DNA Technologies (Coralville, IA).

[0294] Primers for TNFα are: Forward: CCAGTGTGGGAAGCTGTCTT (SEQ ID NO: 6); and Reverse: AAGCAAAAGAGGGAGGCAACA (SEQ ID NO: 7) It was.

[0295] In vivo evaluation of D-miR126 in a mouse model of laser-induced choroidal neovascularization (CNV) Laser-induced CNV mouse model All animal procedures were approved by the Johns Hopkins Animal Care and Use Committee. C57BL / 6J mice were obtained at 5–7 weeks of age through Jackson Laboratory (Bar Harbor, ME, USA) and housed at constant temperature and humidity (20 ± 1 °C, 50 ± 5% humidity). Prior to laser induction of CNV, animals were anesthetized with an intraperitoneal injection of a ketamine / xylazine / acepromazine cocktail (100 mg / kg ketamine, 20 mg / kg xylazine, and 3 mg / kg acepromazine). Animals were then treated with one drop of topical 2.5% phenylephrine hydrochloride ophthalmic solution followed by 0.5% tetracaine hydrochloride ophthalmic solution to dilate the pupils. Fundi were imaged using a Micron III SLO (Phoenix Research Labs, Pleasanton, CA) and focused with an attached laser system (Phoenix Research Labs). Laser burns were generated at four equidistant locations on Bruch's membrane with a laser power setting of 240 mW and duration of 70 ms.

[0296] Administration of D-miR126 and miR-126 Immediately after CNV induction, animals were administered D-miR126, miR-126, or saline sham. Briefly, an injection opening was created in the sclera using a 30G insulin syringe. Treatments were then administered directly into the vitreous cavity using a 10μL Hamilton syringe. After treatment, animals were given topical ocular antibiotics (gentamicin and prednisolone acetate ophthalmic ointment) to prevent infection. Animals were then sacrificed at set time points (7 and 14 days) after treatment for imaging and biochemical analysis.

[0297] For biodistribution studies, animals were administered 1 μg of nucleic acid-based Cy5-D-miR126-Cy3 or miR-126-Cy3 (at a concentration of 1 μg / μL) according to the steps above, and tissues were extracted at the designated time points (1, 3, 5, 7, and 14 days after treatment).

[0298] Immunohistochemistry and imaging At the set time points, animals were sacrificed and the enucleated eyes were fixed in 4% paraformaldehyde for 1 h. The choroids and retinas were then dissected out. The tissues were blocked and permeabilized by incubating with a solution of 5% normal goat serum, 0.3% Triton® X-100, and 1% bovine serum albumin for 2 h at room temperature under constant agitation. To visualize macrophages, the tissues were stained with anti-Iba1 antibody (1:100; FUJIFILM® Wako Chemicals, Osaka, Japan), followed by ALEXA FLUOR® 405-labeled goat anti-rabbit secondary antibody (1:200; Abcam, MA, USA). Blood vessels were stained with FITC-labeled isolectin (GSIB4) (1:100; Life Technologies, Eugene, OR, USA).

[0299] Flat mounts were generated by making four radial incisions in the tissue and mounting the loose tissue on a coverslip. CNV formation was imaged with a Confocal 710 microscope (Carl Zeiss, Oberkochen, Germany) for biodistribution and with an Axiovert phase contrast microscope for area calculation.

[0300] PCR and ELISA assays Eyes were dissected immediately after enucleation and were not fixed. Choroids were collected and stored at -80°C prior to analysis. For ELISA analysis, choroids were submerged in T-PER protein extraction buffer (Thermo Fisher Scientific) and homogenized with 0.9–2.0 mm stainless steel beads in a Bullet Blender Storm tissue homogenizer (Next Advantage Inc., Averill Park, NY). The supernatant was centrifuged to collect the aqueous solution. Samples were stored at -80°C and used without further processing for ELISA detection of VEGF-α levels.

[0301] For PCR, the choroids were soaked in TRIzol, homogenized with steel beads, and filtered through a Corning COSTAR SPIN-X® centrifuge tube filter (Sigma-Aldrich) to remove tissue solids. RNA was isolated according to the protocol described above, and RNA concentrations were determined by Nanodrop. Equivalent amounts of RNA were converted to complementary DNA (cDNA) and analyzed by the STEP ONE PCR® system using Fast SYBR Green reagent.

[0302] statistical analysis Data are expressed as mean ± SEM and analysis was performed in GraphPad Prism (version 9; La Jolla, CA). Treatment groups were analyzed by analysis of variance (ANOVA) test across time points or doses. Significant differences between single groups were determined by Student's t test: * P < 0.05, ** P < 0.01 and*** P<0.001.

[0303] result Synthesis and characterization of D-miR126 intermediates and conjugates A reproducible, environmentally sensitive conjugation strategy is essential to effectively deliver miRNA to the intracellular environment without compromising its efficacy. This conjugation strategy utilized a demonstrated glutathione-sensitive linker to attach miRNA to dendrimer nanoparticles. The dendrimer surface was first modified with succinimidyl 3-(2-pyridyldithio)propionate, a reactive linker that readily forms reducible disulfide bonds with sulfhydryl groups. Successful modification indicates the presence of five aromatic protons at 7.01 ppm and 12 ester-linked protons at 4.06 ppm. 1 The results were confirmed by HNMR spectroscopy. Deprotected and thiolated miR-126 was reacted with the modified dendrimer and the reaction was monitored by gel electrophoresis. The formation of the dendrimer-miR126 conjugate was confirmed by its increased retention time in TBE-urea gel at 150 bp compared to free miR-126 at 27 bp. Gel electrophoresis of D-miR126 showed a prolonged retention time corresponding to 150-300 RNA bp (approximately 90-180 kDa). The presence of a single band in D-miR126 suggested the absence of free nucleic acid. In contrast, the band associated with miR126 migrated further and showed a smaller bp size. The HPLC chromatograph of D-miR126 consisted of a single peak with a retention time of 14.972 min, indicating a pure product.

[0304] The purified D-miR126 was also subjected to HPLC analysis, and the resulting chromatogram consisted of one single peak with a retention time of 14.972 min, suggesting that the analyte was pure. Furthermore, the UV profile of the analyte showed two absorption peaks at 200 nm and 260 nm, corresponding to the absorption wavelengths of the dendrimer and nucleic acid, respectively, suggesting that the incorporation of nucleic acid into the dendrimer platform was successful.

[0305] MALDI-TOF analysis was used to further confirm conjugate formation and determine nucleic acid loading. The masses of the D-PDP precursor and D-miR126 conjugate were determined to be 60 kDa and 66 kDa, respectively. All other intermediates and products were 1 The dual-labeled conjugates were characterized using H NMR, HPLC, or gel electrophoresis. To determine whether the dual-labeled conjugates were capable of fluorescence resonance energy transfer (FRET), samples were excited at 540 nm and the resulting fluorescence intensity was measured over the range of 550-720 nm using an RF5301PC fluorescence spectrophotometer running PANORAMA® 3 software (Shimadzu Scientific Instruments, Columbia, MD). Cy3 emission was determined as the intensity from 565-575 nm and Cy5 emission was determined as the intensity from 665-675 nm. No excitation of the Cy5 fluorophore was observed in the resulting spectra, suggesting that fluorescence due to FRET was unlikely in subsequent imaging experiments.

[0306] In vitro D-miR126 activity in HMEC and BV2 cells BV2 murine macrophages and human microvascular endothelial cell lines were selected to test the efficacy of D-miR126 in reducing pro-inflammatory and pro-angiogenic markers, respectively. LPS-stimulated macrophages produced higher levels of TNFα and IL-1β compared to untreated controls, and the production of these pro-inflammatory cytokines was reduced when treated simultaneously with D-miR126 and miR-126. Although the two treatments resulted in similar (approximately 50%) knockdown of TNFα (Figure 10A), there appeared to be a dose-dependent knockdown of IL-1β for cells treated with D-miR126 and an inverse dose response for cells treated with miR-126 (Figure 10B). The TNFα response appears to be dose-independent.

[0307] The antiangiogenic effect in HMECs was tested in two complementary ways. First, the mRNA levels of VEGF-α, a key angiogenic cytokine, were assessed by cells treated with miR-126 and D-miR126 as well as untreated controls. Compared to controls, HMECs treated with either D-miR126 or free miR-126 resulted in lower production of VEGF-α (approximately 20% knockdown), suggesting inhibition of angiogenic activity (Figure 10C). VEGF-α suppression in HMECs was reduced with extremely high or low doses of D-miR126, with the optimal dosage being 5–10 nM. High doses of miR-126 (10–100 nM) suppressed VEGF-α expression at the same level as lower doses of D-miR126.

[0308] Next, the angiogenic activity of HMEC was evaluated by tube formation assay. Treated and untreated cells were exposed to angiogenic conditions on Matrigel® matrix and allowed to naturally form cell networks. The networks were then analyzed by Angiogenesis Analyzer, a plug-in for Image J. At all measures, cells treated with D-miR126 or miR-126 showed disrupted network formation, including an increase in isolated fragments, a decrease in the area surrounded by blood vessels, and a decrease in the length of the network (Figures 11A-11D). Pretreatment with lower doses of D-miR126 inhibited the ability of HMEC to form networks on Matrigel matrix. In contrast, higher doses of free miR-126 were required to inhibit network formation.

[0309] Antiangiogenic activity of D-miR126 in vivo A laser-induced CNV mouse model was used to evaluate the efficacy of the D-miR126 conjugate in reducing CNV formation in vivo. 2 and approximately 9,000 μm on the 14th day. 2 Mice treated with a single dose of D-miR126 or miR-126 on the day of CNV induction generated smaller CNV regions. At day 7, the CNV region in D-miR126-treated animals was approximately 7,000 μm 2 At the same time, the area of ​​the miR-126-treated animals was approximately 8,000 μm 2 On day 14, the CNV region was reduced by approximately 30% (approximately 6,000 μm) in the D-miR126 treatment compared to the control. 2 ) and at the same time, miR-126 treatment reduced the CNV region by approximately 10% (approximately 8,000 μm 2 ) (Figures 12A-12B). Thus, a single dose of D-miR126 treatment suppresses CNV formation up to 14 days after administration.

[0310] To determine the antiangiogenic mechanism of D-miR126, VEGF-α levels were measured by PCR and ELISA assays, and proinflammatory cytokines (TNFα and IL-1β) were measured by PCR. Mice treated with miR-126 and D-miR126 had a significant reduction in VEGF-α protein at day 7 as measured by ELISA. Furthermore, D-miR126 significantly reduced VEGF-α protein levels compared to miR-126 treatment. However, by day 14, there was no difference in VEGF levels in treated and untreated animals (Figure 13A). A trend toward a reduction in VEGF at day 7 was demonstrated by mRNA levels measured by PCR, but the trend was not significant due to large variance. Interestingly, although VEGF protein levels appeared to be similar at day 14, VEGF-α mRNA levels still remained reduced in D-miR126 and miR-126 treated animals (Figure 13B). D-miR126 appeared to be more effective in reducing VEGF-α mRNA.

[0311] Animals treated with D-miR126 and miR-126 resulted in attenuation of inflammatory mRNA. On day 7, animals treated with D-miR126 resulted in lower levels of IL-1β, but the reduction was not sustained at day 14 (Figure 13D). Conversely, D-miR126 and miR-126 treatment appeared to exert their effect on TNFα production only at later time points, as measured at day 14 (Figure 13C). TNFα mRNA was elevated at early time points (day 7) with either D-miR126 or miR-126 treatment, but this was not statistically significant. Both treatments then suppressed TNFα at day 14.

[0312] in vivo distribution To assess uptake and distribution, Cy3-labeled miR-126 and dual-labeled Cy5-D-miR126-Cy3 were injected into a laser CNV mouse model and choroids were collected 1, 3, 5, 7, and 14 days after injection. Iba1 staining was used to visualize the intracellular environment of macrophages, and isolectin GS-IB4 was used to stain both blood vessels and macrophages. Intravitreally injected D-miR126 localized to the CNV region within 1 day of injection, as noted by colocalization of Cy3 (miR-126), Cy5 (dendrimer), isolectin (CNV blood vessels) and Iba1 (macrophages). The pattern of colocalization was maintained for up to 14 days. miR-126 also appeared to localize to CNV target regions for up to 7 days, but the uptake pattern was more intermittent and appeared to correlate more with macrophage staining, whereas there was widespread uptake of D-miR126. Furthermore, D-miR126 remained in the target area for up to 14 days as detected by confocal microscopy, while the majority of miR-126 was cleared by 7 days.

[0313] D-miR126 uptake was restricted to and around the CNV region at 24 hours, similar to the distribution of free miR-126. However, D-miR126 conjugates were retained in the target area for up to 14 days. At later time points, D-miR126 appeared to be preferentially localized in macrophages, with most of the dendrimer Cy5 signal and miR-126 Cy3 signal colocalizing with the Iba1 antibody. miR-126 uptake was isolated to and immediately surrounding the CNV region 24 hours after intravitreal injection. As imaged by fluorescence microscopy, most free miRNA was cleared by day 7. At day 14, very little miRNA remained in the target area. The absence of Cy5 fluorescence corresponds to the lack of dendrimer in the free miRNA-treated group.

[0314] The percentage of colocalized signals in the two stained cell populations was also analyzed (Figure 14). Free miR-126 was gradually taken up by macrophages and endothelial cells over a 5-day period. At 24 hours after injection, approximately 2% of miR-126 was detected in macrophages, as indicated by the percentage colocalized with Iba1 signal, and approximately 3% of miR-126 was detected in the combined macrophage and endothelial cell population (stained with isolectin GS-IB4). The signal reached a peak at 5 days, with approximately 10% of the signal colocalized in macrophages and approximately 15% in the combined macrophage / endothelial cell population.

[0315] In contrast, D-miR126 was rapidly taken up by resident macrophages within the CNV region, with approximately 8% of the signal colocalizing with macrophage staining. Interestingly, only 2% of the signal was observed in the combined macrophage / endothelial cell population. However, by day 3, the signal distribution from Cy3-labeled miR-126 appeared to shift to a more even distribution among the different cell populations. Approximately 6% of the signal localized with Iba-1, and a similar percentage with isolectin GS-IB4. The ratio of signal in Iba-1-positive and isolectin-stained cells remained similar for the remaining time points. Furthermore, the levels of colocalized miR-126 in the two cell populations remained relatively stable (approximately 10%) over time, except for a drop at day 7. Colocalization signals between the dendrimer (Cy5) and miR-126 (Cy3) were also investigated as a measure of payload release in vivo. At 24 h post-injection, approximately 50% of miR-126 was released from the dendrimer platform, and the total release of miR-126 increased to approximately 80% by the 14th day.

[0316] Consideration MicroRNAs are a powerful treatment option due to their ability to bind and degrade multiple targets involved in the progression of certain diseases. However, this also means that delivery of miRNAs to the correct cells is crucial to avoid off-target effects and optimize their efficacy. Dendrimer platforms have been demonstrated to selectively target areas of inflammation and angiogenesis and effectively deliver miRNAs to treat choroidal neovascularization.

[0317] This platform utilizes sixth generation PAMAM dendrimers that have been shown to be biocompatible and have long circulation times. The surface is modified with an environmentally sensitive disulfide linker that can be used to bind nucleic acids and selectively release the payload in intracellular compartments. The number of PDP linker moieties attached to the surface was greater than the 1:1 stoichiometric ratio of dendrimer to miRNA in the final compound due to steric hindrance considerations. As the dendrimer-miRNA conjugation chemistry involves two large biomolecules, low conjugation efficiency was expected, and therefore many binding sites were included to increase conjugate formation. Additionally, miR-126 was added in excess to promote binding to the dendrimer platform. After purification, conjugate formation and removal of unreacted nucleic acid were confirmed by gel electrophoresis and HPLC. Nucleic acid loading at 1:1 (dendrimer:miRNA) was estimated by a combination of MALDI-TOF and gel electrophoresis.

[0318] In vitro sink conditions allowed cells to freely take up compounds without complex protein interactions, competing cell populations, and elimination mechanisms, so similar performance was expected for D-miR126 and miR-126. In HMECs, no significant difference was observed between the performance of D-miR126 and miR-126 in reducing VEGF-α production. Similarly, consistent with such expectations, the reduction in TNFα mRNA levels was similar for D-miR126 and miR-126 treated BV2 cells. Interestingly, however, IL-1β levels appear to show different dose responses depending on the platform. For D-miR126 treated cells, a strong dose response was observed, with higher knockdown effects observed at 100 nM. In contrast, miR-126 treated cells showed the opposite response, with higher knockdown effects observed at 10 nM, which is lower than the most effective D-miR126 concentration.

[0319] This effect may be due to both the complex dose-dependent effect of miRNA and the slow release of D-miR126. First, theoretical models attempted to decipher the complex interactions between miRNA and its target pool and signaling pathways. In particular, miRNAs may preferentially affect different targets depending on their concentration, affinity for other targets, and feedback from signaling pathways. Consequently, depending on the desired target, different doses of miRNA may be required to optimize its efficacy. This may partially explain the inverse relationship observed with IL-1β mRNA production in BV2 cells.

[0320] Moreover, dendrimer-conjugates have been shown to exhibit slow release profiles, limiting RISC access to bound miRNA. In the case of D-miR126, the release of miRNA payload may be slow enough that only a portion of the miRNA can show its effect over the assay period. As a result, increasing the treatment concentration of D-miR126 only partially increased the amount of released miR-126 in the cytosol, maintaining the optimal therapeutic concentration range. Because the available concentration of cytosolic miR-126 was within the optimal concentration range, the efficacy showed a dose-dependent response rather than an inverse response.

[0321] In tube formation assays, HMECs treated with D-miR126 and miR-126 showed cell network perturbation at low doses of D-miR126 and showed high efficacy in inhibiting network formation. The increase in efficacy of D-miR126 compared to free miR-126 may be due to a slow release mechanism that allows HMECs to maintain a more stable intracellular concentration of miR-126 when stimulated by Matrigel® without miR-126 treatment.

[0322] Due to the complex interplay between miRNA concentration and target selectivity, the compounds were evaluated in a laser-induced CNV mouse model. First, the distribution of D-miR126 and miR-126 was determined by confocal microscopy, and it was noted that D-miR126 not only remained longer within the targeted CNV region, but also appeared to be distributed in both macrophages and endothelial cells, two cell subpopulations important for angiogenesis. This indicates that D-miR126 may affect both the angiogenic and inflammatory responses of CNV formation and can be given over a longer period, reducing the need for additional doses.

[0323] To evaluate the efficacy of CNV attenuation, the choroids of treated and untreated mice were examined on days 7 and 14. The area of ​​D-miR126-treated mice had significantly reduced CNV reduction at day 14, while miR-126-treated mice produced a non-significant reduction in area. The reduction in area correlated well with the reduction in VEGF-α, TNFα, and IL-1β levels, as measured by either PCR or ELISA assays. Furthermore, colocalization measurements of fluorescently labeled miR-126 and dendrimers, as well as stained macrophages and endothelial cells, revealed differences in the uptake kinetics and distribution characteristics between free miR-126 and D-miR126. D-miR126 achieved higher intracellular concentrations at early time points compared to free miR-126, and the payload appeared to be released gradually over time. This difference in uptake may enhance the therapeutic efficacy of miR-126 at early stages and extend its efficacy at later time points.

[0324] conclusion The flexibility of miRNAs to target multiple proteins and pathways can make them a powerful tool in the treatment of previously untreatable diseases. However, harnessing their efficacy depends on effective delivery and dosing. A dendrimer platform for targeted delivery of miRNAs to selected cell populations has been established. Furthermore, the effect of dendrimers on miRNA dosing has been characterized, and the efficacy of dendrimer-miRNA conjugates in treating clinically relevant models has also been verified. This work represents a major step toward the development of clinically translatable miRNA therapy.

[0325] Example 4 Dendrimer conjugates for treating macular degeneration - Patent Application 20070229633 In developed countries, millions of elderly patients face the risk of vision loss due to age-related macular degeneration (AMD), and approximately 10% of these patients will develop wet AMD. Wet AMD is a complex process in which choroidal neovascularization pushes blood vessels out of the choroid through Bruch's membrane, displacing or destroying the retinal pigment epithelium (RPE). A major factor in the disease progression of wet AMD is the increased expression of vascular endothelial growth factor (VEGF) in the eye, which promotes the growth of new blood vessels. As a result, most current standard of care for wet AMD is to directly target VEGF by intravitreal injection of anti-VEGF antibodies, such as aflibercept. However, a significant portion of patients (approximately one-third) do not respond to these therapies and may experience further loss of vision despite optimal patient adherence to the treatment regimen (D. Vogt, V. Deiters, TR Herold, SR Guenther, KU Kortuem, SG Priglinger, A. Wolf, and RG Schumann, Curr Eye Res, 2022, 1-8).

[0326] Other therapeutic modalities, such as integrin-binding peptides, have been developed to halt the progression of wet AMD in patients. These peptide antagonists tightly bind to cell surface integrins, such as αVβ3, α5β1, and α5β3, and inhibit downstream signaling of these integrins. In particular, these integrin antagonists reduce activation of the ERK and PI3K / Akt pathways, which in turn attenuate the expression of various pro-inflammatory and pro-angiogenic cytokines, such as VEGF-α, TNF-α, and IL1β. Luminate (or ALG-1001) is one such integrin-binding peptide that has demonstrated success in halting angiogenesis and is currently undergoing clinical trials for applications in AMD and diabetic macular edema (DME). However, peptide-based antagonists suffer from a wide range of delivery challenges, including rapid enzymatic degradation and renal clearance. Therefore, these treatments are currently limited to intravitreal injections, which not only limit availability to patients in less developed countries but also carry the risks of endophthalmitis, elevated intraocular pressure (IOP), and irritation.

[0327] material and method: Chemicals and Reagents Hydroxyl-terminated ethylenediamine core PAMAM dendrimers (6th generation, pharmaceutical grade) in methanol solution were purchased from Dendritech (Midland, MI, USA). Before use, the dendrimer solutions were evaporated on a rotary evaporator. Dialysis membranes (MWCO 1 kDa) were purchased from Spectrum Chemicals (New Brunswick, NJ, USA). ALG-1001 and ALG-1001 modified with an azide linker were purchased from Bio-Synthesis (Lewisville, TX, USA). Deuterated solvents (DMSO-d6), methanol (CD3OD), and water (D2O) were purchased from Sigma-Aldrich. Proteinase K stock solution and Dulbecco's modified Eagle's medium (DMEM, low glucose with L-glutamine) were purchased from Thermo Fisher (Waltham, MA, USA). Human umbilical vein endothelial cells and the necessary media kit were purchased from Lonza (Basel, Switzerland). Phenol red-free Matrigel was purchased from Corning (Tewksberry, MA, USA).

[0328] Use of equipment Nuclear magnetic resonance at ambient temperature using a Bruker 500-MHz spectrometer 1 H NMR spectra were obtained. Chemical shifts are reported in parts per million relative to tetramethylsilane, which was used as an internal standard, and the residual protic solvent peaks were used to calibrate the chemical shifts. DMSO-d6 (δ=2.50 ppm). Resonance multiplicities in the spectra are indicated as "s" (singlet), "d" (doublet), "t" (triplet), and "m" (multiplet). Broad resonances are indicated by "b".

[0329] High-performance liquid chromatography Compound purity was determined using a Waters HPLC (Milford, MA) equipped with a 1525 binary pump and an in-line degasser AF, a 717 plus autosampler, and a 2998 photodiode array detector interfaced with Waters Empower software. The column was a Waters Symmetry C18 reversed-phase column with a particle size of 5 μm, length of 25 cm, and internal diameter of 4.6 mm. Chromatograms were monitored at 210, 650, and 530 nm using a photodiode array (PDA) detector. The analysis was performed at a flow rate of 1 ml / min with a gradient flow starting at 95:5 (HO / ACN), increasing to 50:50 (HO / ACN) in 30 min, and returning to 95:5 (HO / ACN) in 10 min.

[0330] Synthesis of dendrimer conjugates Synthesis of dendrimer-hexyne 5-Hexynoic acid and DMAP were added to a solution of D-OH in anhydrous DMF and stirred for 15 min at room temperature. EDC·HCl was added in three equal portions to the resulting clear solution and the solution was stirred at room temperature overnight. The reaction mixture was purified by dialysis through a 2 kDa MW cutoff cellulose dialysis membrane against DMF with solvent changes at 8-h intervals. After 24 h, the mixture was dialyzed against water for 24 h with solvent changes at 12-h intervals. The final aqueous solution was lyophilized to give the product as a white solid.

[0331] 1 H NMR (500 MHz, DMSO) δ 8.06-7.79 (m, internal amide 510H), 4.73 (s, surface OH, 232H), 4.06 (s, ester linkage, 22H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 2.43 (s, dendrimer-CH2), 2.20 (s, dendrimer-CH2), 1.68 (t, acetylene, 30H). Retention time: 19.58 min.

[0332] Synthesis of BOC-GABA-D-hexyne D-Hexyne was dissolved in anhydrous DMF and BOC-GABA-OH and DMAP were added. The solution was stirred for 15 min before EDC·HCl was added in three equal portions. The solution was stirred overnight, purified by dialysis, and lyophilized to give the product as a white solid.

[0333] 1 H NMR (500 MHz, DMSO-d6) δ 8.06-7.79 (m, internal amide 510H), 4.73 (s, surface OH, 199H), 4.06 (s, ester linkage, 40H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 2.43 (s, dendrimer-CH2), 2.20 (s, dendrimer-CH2), 1.68 (t, acetylene, 27H), 1.36 (s, BOC, 68H).

[0334] Synthesis of GABA-D-hexyne Deprotection of BOC-GABA-D-hexyne was carried out under anhydrous conditions. The compound was placed in a round bottom flask and anhydrous DCM was added under nitrogen atmosphere. The solution was constantly stirred and sonicated to form a cloudy, sticky suspension. TFA was then added to the suspension in a 4:1 ratio (DCM:TFA) and the solution was stirred overnight. The DCM was then evaporated using a rotary evaporator. TFA was removed by repeatedly diluting the reaction mixture with methanol and evaporating the resulting solution. The product was then placed under high vacuum for 3 hours and used without further purification.

[0335] Synthesis of Cy5-D-hexyne GABA-D-hexyne was dissolved in anhydrous DMF, followed by DIPEA, and finally Cy5 NHS ester was added. The reaction was stirred overnight and the reaction mixture was dialyzed against DMF for 24 hours using a 2 kDa membrane. The mixture was then dialyzed against water for an additional 24 hours and lyophilized to give a solid blue product.

[0336] 1 H NMR (500 MHz, DMSO-d6) δ 8.06-7.79 (m, internal amide 510H), 7.35 (m, Cy5 H), 7.25 (m, Cy5 H), 7.05 (m, Cy5 H), 6.6 (m, Cy5 H), 6.3 (m, Cy5 H), 4.73 (s, surface OH, 199H), 4.06 (s, ester linkage, 40H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 2.43 (s, dendrimer-CH2), 2.20 (s, dendrimer-CH2), 1.68 (t, Acetylene, 27H). Retention time: 18.01 min.

[0337] Synthesis of D-ALG1001 and Cy5-D-ALG1001 ALG-1001 was dissolved in ultrapure water and added to an aqueous solution of D-hexyne for the unlabeled conjugate. ALG-1001-Cy3 was dissolved in ultrapure water and added to an aqueous solution of Cy5-D-hexyne for the dual-labeled conjugate. Copper sulfate solution was added and the solution was stirred at room temperature for 10 minutes before sodium ascorbate was added. For purification, both reactions were left at room temperature overnight and then dialyzed against water for 24 hours. Each solution was lyophilized to obtain a powder product.

[0338] D-ALG 1H NMR (500 MHz, DMSO-d6): 8.12-7.78 (m, internal amide H), 4.45-4.06 (m, peptide α carbon), 4.00 (s, ester linkage, 37H), 3.78 (m, polyethylene glycol H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 1.64-1.59 (m, GABA linker -CH2 and peptide side chain). Retention time: 16.60 min.

[0339] Cy5-D-ALG-Cy3 1 H NMR (500 MHz, DMSO-d6): 8.12-7.78 (m, internal amide H), 7.01 (m, aromatic 5H), 6.59 (s, GABA amide H, 10H), 4.73 (s, surface OH, 233H), 4.06 (s, ester linkage, 16H), 3.40 (d, dendrimer-CH2), 3.33 (d, dendrimer-CH2), 3.18-3.11 (m, dendrimer-CH2), 2.64 (s, dendrimer-CH2), 1.64-1.59 (m, GABA linker -CH2, 6H), 1.36 (s, Boc group, 20H). Retention time: 17.99 min.

[0340] In vitro stability under enzymatic degradation Proteinase K stock solutions were purchased from Thermo Fisher and used as received. ALG-1001 and D-ALG solutions were prepared at a concentration of 2 mg / mL, and proteinase K was added to each solution to give a final proteinase K concentration of 2 mg / mL. The mixtures were incubated at 37°C, and at set time points 100 μL of the mixture was removed and analyzed by HPLC. To determine compound degradation, the integrals of the peaks at elution times associated with ALG-1001 and D-ALG were used and normalized to the peak of the analyte injected at time 0.

[0341] cell culture HUVEC cells were obtained from Lonza and cultured in EGM-2 endothelial cell growth medium (Lonza). Murine macrophages (RAW264.7) between passages 5 and 9 were cultured in Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Grand Island, NY) supplemented with 10% fetal bovine serum (Invitrogen Corp., Carlsbad, CA) and 1% penicillin / streptomycin (Invitrogen Corp., Carlsbad, CA). All cells were maintained in a humidified incubator at 37°C and 5% CO2.

[0342] In vitro evaluation of D-ALG efficacy Angiogenesis assay 96-well plates were coated with 75 μL of Matrigel® and left at room temperature for 15 min before being placed in a 37° C. incubator for an additional 30 min. D-ALG1001 was dissolved at twice the desired concentration and 50 μL of drug solution was added to the wells. HUVEC cells were then plated in each well at 70,000 cells / cm. 2 Viable cell images were taken and analyzed at 12 hours.

[0343] Wound healing assay HUVEC cells were cultured at 5 × 10 per well in a 24-well plate. 4 Cells were seeded at a density of 100x and left for at least 72 hours to form a uniform monolayer of cells. Cells were treated with D-ALG1001 and ALG-1001 for 24 hours. A 1 cm long scratch was made in the cell monolayer using the end of a 200 μL pipette tip. Images were taken with a Nikon.

[0344] Western blot and PCR for VEGF activation HUVEC cells were grown at 5 × 10 per well in a 24-well plate. 4Cells were seeded at a density of 100x for 24 hours before treatment. Cells were treated with D-ALG1001 and ALG-1001 for 24 hours before activation with VEGF for 5 minutes. Cells were harvested, lysed and Western blotted using T-Per buffer (Thermo Fisher) supplemented with PHOSSTOP® and a cocktail of proteinase inhibitors. Cells were lysed with TRIZOL® and processed as described above for qPCR analysis.

[0345] In vitro inflammation model RAW264.7 cells were cultured in a 12-well plate at 1 × 10 per well. 5 Cells were seeded at a density of 100x for 48 hours prior to treatment. Cells were incubated with D-ALG1001 and ALG-1001 for 24 hours, the treatment medium was aspirated, and LPS was then added at a concentration of 10,000 endotoxin units / mL to stimulate an inflammatory response. Three hours after LPS stimulation, samples were collected and subjected to qPCR analysis.

[0346] In vivo evaluation of D-ALG in attenuating choroidal neovascularization In vivo laser CNV rat model All animal procedures were approved by the Johns Hopkins Animal Care and Use Committee. Brown Norway rats between 8 and 12 weeks of age were obtained and housed at constant temperature and humidity (20 ± 1 °C, 50 ± 5% humidity). Animals were anesthetized by intraperitoneal injection of a ketamine / xylazine cocktail (ketamine 50 mg / kg and xylazine 10 mg / kg). Pupils were dilated with topical 2.5% phenylephrine hydrochloride solution followed by 0.5% tetracaine hydrochloride solution. To induce CNV formation, four equally spaced lesions will be created in Bruch's membrane with a Micron III SLO integrated laser system. The laser power was set at 240-250 W and duration at 70 ms. Gonio ophthalmic solution was applied postoperatively to prevent ocular dryness and cataract formation.

[0347] On the day of CNV induction (day 0), D-ALG1001 and ALG1001 were administered intraperitoneally at a dose of 150 μg peptide-based. Subsequent doses were administered every 4 days. On days 7 and 14, mice were sacrificed and eyes were enucleated. Eyes used for CNV imaging were fixed in 10% formalin for 1 hour. Eyes used for qPCR, ELISA, and Western blot were immediately stored at -80°C until use.

[0348] Preparation of tissue for Western and qPCR Briefly, 500 μL of T-Per supplemented with PHOSSTOP® and proteinase inhibitor cocktail was added to the tube containing the dissected choroid. One scoop of 1.6 mm steel homogenization beads was added to each sample, which was then placed in a TISSUELYSER® LT (Qiagen) at a frequency of 50 / s for 15 minutes. For qPCR, 200 μL of TRIZOL® was added to the tube containing the choroid, and one scoop of 1.6 mm steel homogenization beads was added. The samples were placed in a TISSUELYSER® LT at a frequency of 50 / s for 15 minutes.

[0349] Pathway activation analysis using Western blot and ELISA Protein concentrations were determined using a BCA protein assay kit (Thermo Scientific, Rockford, IL). Equal amounts of protein were denatured and separated on 4-15% TGX gels (Bio-Rad, Hercules, CA). Gels were transferred to nitrocellulose membranes, blocked with 3% bovine serum albumin ("BSA") for 1 h at room temperature, and probed overnight at 4 °C for GAPDH, FAK, pFAK, MAPK, and pMAPK. Membranes were washed three times and then incubated with HRP-conjugated secondary antibodies, followed by visualization by incubation with a chemiluminescent substrate.

[0350] For proteins extracted from tissues, protein expression levels were quantified using total FAK and FAK(phospho)[pY397] ELISA kits (Invitrogen), and measured protein expression was normalized to the total protein amount of each sample determined from the BCA assay.

[0351] qPCR analysis 100 μL of chloroform was added to the Trizol suspension and the aqueous phase was separated by centrifugation at 10K RPM for 15 minutes at 4° C. 400 μL of 2-propanol was added to the aqueous solution and spun again to pellet the RNA. The RNA was washed with a 70% ethanol solution, pelleted again, and resuspended in DEPC (ultrapure water treated to inactivate enzymes) water.

[0352] To convert RNA to complementary DNA, 2 μg of RNA was converted using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Samples were analyzed using a STEPONE PLUS® Real-Time PCR System (Applied Biosystems) with SYBR Green reagent (Thermo Fisher Scientific). Relative expression was quantified using ΔΔCt calculations normalized to controls. Primers for GAPDH were obtained from Bio-Rad Laboratories (Hercules, CA). Primers were purchased from Integrated DNA Technologies (Coralville, IA). Primers for TNFα were: Forward: CCAGTGTGGGAAGCTGTCTT (SEQ ID NO: 6); and Reverse: AAGCAAAAGAGGGAGGCAACA (SEQ ID NO: 7) It was. Primers for IL1β are: Forward: AGCTTCAAATCTCGAAGCAG (SEQ ID NO: 8); and Reverse: TGTCCTCATCCTGGAAGGTC (SEQ ID NO: 9) It was.

[0353] Biodistribution For biodistribution studies, Cy5-D-ALG1001-Cy3 and ALG-1001-Cy3 were administered intraperitoneally to each animal at a dose of 150 μg / 100 μL on the day of CNV induction (day 0). Animals were sacrificed and enucleated on days 1, 2, 3, and 4.

[0354] Imaging After fixation, the posterior segment was dissected out and the retina was separated from the choroid. For blood vessels and monocytes, tissues were stained with FITC-labeled isolectin (GS IB4) (Life Technologies, Eugene, OR). Eyes were mounted by introducing four radial relieving incisions. Samples for biodistribution were imaged under a confocal 710 microscope (Carl Zeiss, Oberkochen, Germany). Samples for CNV quantification were imaged with an Axiovert phase contrast microscope. All images were processed with ImageJ.

[0355] statistical analysis Data are expressed as mean ± SEM and analysis was performed in GraphPad Prism (version 9; La Jolla, CA). Treatment groups were analyzed by analysis of variance (ANOVA) test across time points or doses. Significant differences between single groups were determined by Student's t test: * P < 0.05, ** P < 0.01 and *** P<0.001.

[0356] result Synthesis and characterization of D-ALG1001 intermediates and conjugates A high-yield click reaction was used to efficiently attach the ALG-1001 peptide to the dendrimer platform under mild conditions suitable for preserving the integrity and activity of the peptide (Figure 15). The dendrimer surface was first modified with a hexynoic acid linker, 1The modification was confirmed by H NMR, which showed the presence of 20 protons at 4.0 ppm and 1.7 ppm. The dendrimer surface was minimally modified to preserve its near neutral charge and its inherent ability to penetrate tissues.

[0357] For biodistribution studies, the dendrimer surface was further modified with a GABA-Boc linker, as evidenced by the presence of additional protons at 4.0 ppm, 1.7 ppm, and 1.2 ppm. The resulting intermediate was deprotected and the free amine was used for coupling with Cy5 ester to give the fluorescently labeled dendrimer.

[0358] The ALG-1001 peptide was purchased with a short polyethylene glycol (PEG) azide linker attached to the C-terminus and was used without further preparation. For biodistribution studies, the N-terminus of the peptide was also modified with a Cy3 fluorophore for tracking. ALG-1001 was conjugated to the dendrimer using a copper(I)-catalyzed alkyne-azide click (CuAAC) reaction. 1 1 H NMR spectroscopy showed the presence of peptide protons, confirming the binding of ALG-1001.

[0359] In vitro stability under enzymatic degradation Co-incubation of ALG-1001 with proteinase K, a broad-acting protease, resulted in rapid degradation of ALG-1001, with approximately 50% degraded in 30 minutes and 90% degraded in 90 minutes. HPLC chromatographs of D-ALG and ALG-1001 after co-incubation with proteinase K show a decrease in the AUC of the peak associated with the free ALG-1001 peptide. The trace of D-ALG shows only a slight decrease in AUC. A plot of the amount degraded is shown by normalizing the analyte peaks obtained at set time points to the starting peak obtained at 0 minutes. Approximately 90% of ALG-1001 was degraded by 90 minutes, while only 10% of D-ALG was degraded. On the other hand, dendrimer conjugation of the ALG-1001 peptide resulted in resistance to enzymatic degradation, possibly due to steric hindrance from the dendrimer carrier. Only approximately 10% of D-ALG was degraded in 90 min. This resistance to enzymatic degradation, even at exceptionally high enzyme concentrations, suggests that dendrimer conjugation can increase the in vivo circulation time of the intact peptide by helping it escape the degradative pathway.

[0360] In vitro angiogenesis assay To find effective doses in a physiologically relevant model, an in vitro model of angiogenesis was utilized. HUVEC cells were treated with gradient concentrations of D-ALG and ALG-1001 at three different size doses for 24 hours. The cells were then seeded on Matrigel®, after which the cells spontaneously migrated to form vessel-like tubule structures. Images were analyzed with the Angiogenesis Analyzer plugin in ImageJ to extract appropriate metrics measuring the connectivity and integrity of the tubular network (Figure 16).

[0361] Cells treated with 1 mM D-ALG and ALG-1001 show increased disruption in tube formation, increased isolated segments, and decreased areas or meshes surrounded by tubes. The data show that dendrimer conjugation enhances the effectiveness of ALG-1001 in disrupting network formation. HUVECs treated with 1 mM D-ALG show decreased junctions between blood vessels, decreased connected segments, and increased isolated segments compared to those treated with 1 mM ALG-1001.

[0362] Wound healing assay In addition to the cell morphology and motility changes measured by tube formation assay, the proliferative activity of HUVECs treated with D-ALG and ALG-1001 was evaluated in a wound healing assay. HUVEC monolayers were pretreated with D-ALG and ALG-1001, followed by scratching the monolayer with the tip of a pipette. Images were taken at the time of wounding and 24 hours after injury. Untreated cells had healed up to 80% of the initial injury after 24 hours, while cells treated with D-ALG and ALG-1001 had healed up to 50% of the initial wound area. Furthermore, cells treated with a high dose of 1 mM D-ALG only recovered 20% of the initial injury, suggesting a reduced regenerative capacity of HUVECs. The trend indicates that treatment with D-ALG is more effective than the free peptide.

[0363] Western blot for endothelial cell activation To elucidate the mechanism by which D-ALG and ALG-1001 affect angiogenesis function, cells were pretreated with D-ALG and ALG-1001 for 24 hours. Cells were then stimulated with high doses of exogenous VEGF for 5 minutes, after which samples were collected and Western blotted. Samples were probed for expression of total FAK, phospho-FAK(Y397), ERK1 / 2, phospho-ERK1 / 2, and cyclophilin B (CycB), with CycB acting as an internal control.

[0364] Compared to untreated VEGF-stimulated controls, the results show that cells treated with D-ALG and ALG-1001 expressed lower levels of total FAK and phospho-FAK. At a high dose of 1 mM on a peptide basis, D-ALG and ALG-1001 reduced phosphorylation of phospho-ERK1 / 2 by approximately 60% and phospho-FAK by 20% compared to VEGF-stimulated controls. Both the ERK1 / 2 and FAK pathways play important roles in angiogenesis, and their activation promotes endothelial cell proliferation and migration (Figure 17). The trend for a decrease in phosphorylated proteins suggests an attenuation in the activation of these networks in response to VEGF.

[0365] In addition to investigating pathway activation, the effects of D-ALG and ALG-1001 on VEGF-α expression by endothelial cells were also studied. Cells treated with VEGF-α had a significantly increased production of VEGF-α compared to unstimulated controls. Cells incubated simultaneously with VEGF-α and either ALG-1001 or D-ALG did not have a statistically significant increase in VEGF production compared to controls, suggesting a slight attenuation in endothelial activation in response to VEGF.

[0366] Attenuation of inflammatory responses in murine microglia Another important factor in angiogenesis is macrophages and microglia, which produce pro-inflammatory and pro-angiogenic cytokines during the angiogenesis process. To elucidate the effect of D-ALG and ALG-1001 on macrophage activation, RAW264.7 cells were pretreated with high and low doses of D-ALG and ALG-1001 24 hours prior to LPS stimulation. Treatment medium was first aspirated to simulate the transient nature of in vivo delivery, and cells were activated with LPS for 3 hours.

[0367] LPS-activated cells showed a robust increase in the expression of the pro-inflammatory cytokines IL1β and TNFα as detected by qPCR when compared to unstimulated controls (Figures 18A-18B). D-ALG treatment was associated with a 90% reduction in IL1β expression and an 80% reduction in TNFα expression at both low (100 μm) and high (1 mM) doses. Surprisingly, treatment with D-ALG resulted in levels of TNFα that were not statistically different from untreated controls. In comparison, ALG-1001 reduced TNFα expression by only 20% at the highest dose, and no effect on IL1β production was observed with ALG-1001 treatment alone. This difference may be due to two potential differences: (1) the dendrimer platform demonstrates much more efficiency in delivering therapeutic agents to activated macrophages compared to free drugs; (2) conjugation of multiple ligands onto the dendrimer surface allows for multivalent effects, increasing the interaction of peptides with surface integrins.

[0368] Biodistribution of systemically administered ALG-1001 and D-ALG Fluorescently labeled Cy3-ALG-1001 peptide and dual-labeled Cy5-dendrimer-ALG-Cy3 were injected systemically on day 0 (the same day as CNV induction), and choroidal tissues were collected at set time points. Confocal microscopy was used to monitor the presence of ALG-1001 peptide (Cy3), dendrimer carrier (Cy5), CNV formation (isolectin), and macrophages (Iba1). Within the first 24 hours of systemic administration, free ALG-1001 peptide reached the CNV region and remained for up to 2 days as seen by the detected Cy3 signal. In comparison, D-ALG could not only reach the CNV region within 24 hours after systemic injection, but also remain in the target region for up to 4 days after administration, as seen by the colocalized presence of both Cy5 and Cy3 signals. The long residence time indicates that dendrimer conjugation allows the target region itself to act as a drug depot, prolonging the efficacy of peptide therapeutics.

[0369] Attenuation of CNV formation in vivo CNV formation was induced in mice using a Micron III SLO scope and a laser attachment. The laser CNV model was chosen due to its consistency in CNV generation and progression of the CNV process. Whether dendrimer conjugation prevented peptides from attenuating CNV was evaluated by first injecting ALG-1001 and D-ALG intravitreally after CNV induction. Eyes were then harvested on day 7 and CNV area was quantified. Both D-ALG and ALG-1001 significantly inhibited the formation of CNV when administered intravitreally.

[0370] The protection and targeting of D-ALG allowed for a less invasive route of administration. CNV was induced using a laser on day 0, and the first dose (150 μg peptide-based) of ALG-1001 and D-ALG was administered intraperitoneally. Animals were dosed once every 4 days with 150 μg peptide-based. Choroidal flat mounts were imaged on days 7 and 14, and CNV areas were calculated using ImageJ.

[0371] In untreated control animals, after CNV induction, the CNV area had grown to approximately 13,000 μm by 7 days. 2 On the 14th day, the size of the 2 (Figures 19A-19B). Systemic injection of ALG-1001 robustly attenuated CNV formation (reduction by approximately 60%) at day 7, but restored CNV regions by day 14. In comparison, systemic administration of D-ALG inhibited CNV formation by approximately 50% at days 7 and 14, reaching statistical significance at day 14. This improvement in CNV reduction and its sustained effect are likely due to the ability of D-ALG to protect the peptide payload and prolong its residence time at the targeted CNV region.

[0372] Systemically administered D-ALG attenuates FAK and ERK activation To evaluate activation of the FAK and ERK pathways, eyes were enucleated at set time points and choroidal tissue was dissected out. Tissues were soaked in a mixture of T-per, proteinase inhibitors, and PhosStop with stainless steel homogenization beads and homogenized to generate protein extracts. Total FAK, total ERK, p-FAK(Y397), and p-44 / 42ERK ELISA kits were used to quantify the amount of total and phosphorylated proteins in the FAK and ERK pathways. In animals treated with D-ALG, a trend towards decreased total FAK and p-FAK proteins was observed at both 7 and 14 days compared to untreated controls, suggesting a long-term attenuation of the FAK pathway (Figures 20A-20B). Treatment with ALG-1001 also resulted in a decrease in p-FAK across both time points. However, the levels of total FAK protein in ALG-1001-treated animals were elevated at 14 days. Both D-ALG and ALG-1001 treated animals produced similar trends in the reduction of p44 / 42 ERK production, while total ERK remained relatively constant across treatment groups at day 7 (Figures 20C-20D). At day 14, a slight decrease in total ERK was observed in D-ALG and ALG-1001 treated animals compared to untreated animals.

[0373] To compare the expression of pro-inflammatory and pro-angiogenic cytokines, RNA was extracted and qPCR was performed to determine the relative expression of VEGF-α, TNFα, and IL1β (Figures 21A-21C). In D-ALG treated animals, VEGF-α production was decreased over both 7 and 14 days, while ALG-1001 treated animals showed reduced VEGF-α production only on day 14. Comparing the trends in inflammatory cytokines, D-ALG had lower TNFα levels only on day 7, while ALG-1001 treated animals had lower TNFα levels over both time points. The trend for IL1β expression was decreased only on day 14 for ALG-1001 and D-ALG treated animals.

[0374] Consideration Dendrimer conjugation of ALG-1001 peptide was achieved by a highly efficient copper-assisted click reaction under mild conditions and characterized by HPLC and NMR. By integration of the NMR peaks, it was calculated that 6-7 peptides were conjugated per dendrimer carrier. Increased resistance to enzymatic degradation was observed in vitro for dendrimer conjugations after incubation with broad-acting proteinases.

[0375] At comparable high doses, the D-ALG conjugate inhibited angiogenesis an order of magnitude better than the free peptide. Furthermore, D-ALG1001 attenuated the expression of proinflammatory cytokines in LPS-stimulated murine macrophages as well as the activation of the FAK pathway in endothelial cells. It was hypothesized that by attaching multiple peptide moieties to a single dendrimer, integrin clusters could be more effectively engaged and that this multivalent effect may enhance the antiangiogenic and anti-inflammatory activities of ALG-1001.

[0376] When administered systemically in vivo, the differences in distribution and bioavailability of D-ALG and free ALG-1001 peptides can be better elucidated. Fluorescently labeled D-ALG was detectable in the CNV region up to 4 days after intraperitoneal injection; whereas ALG-1001 signal was undetectable from day 2 onwards. The increased residence time in the target region allowed for less frequent injections for D-ALG. Intraperitoneal injection of 150 μg (peptide-based) of D-ALG every 4 days resulted in a 50% reduction in the CNV region, whereas free ALG-1001 peptide reduced CNV formation by 40% at day 7 and lost efficacy at later time points (20% CNV reduction at day 14). In comparison, continuous systemic delivery of the small molecule α5β1 antagonist JSM6427 using an implantable pump resulted in a 40% reduction in CNV area (N. Umeda, et al., Mol. Pharmacol., 2006, 69, 1820-1828). Similarly, in separate studies by Das et al. and Toriyama et al. investigating the Å6 and CGRP peptides, respectively, daily injections were required to reduce CNV area by 30% (HJ Koh, et al., Invest. Ophthalmol. Vis. Sci., 2004, 45, 635-640; Y. Toriyama, et al., Am. J. Pathol., 2015, 185, 1783-1794).

[0377] The data demonstrated that dendrimer conjugation can not only deliver intact biologics to target areas after systemic administration, but also increase their residence time and efficacy. As a result, less stringent dosing schedules are required to effectively control CNV formation. The inherent ability of dendrimers to be selectively taken up by reactive macrophages and microglia allows for higher local concentrations to be achieved, while rapid clearance of dendrimer conjugates from the blood reduces unnecessary exposure in non-targeted cells and tissues. Dendrimer conjugation to ALG-1001 peptide preserves the peptide's activity, increases its stability, extends its residence time in target tissues, and provides systemic administration as an alternative route to intravitreal injection, thus expanding the availability of the therapy globally.

[0378] Example 5 Synthesis of glutamine dendrimer conjugates Figure 22 shows the synthesis of G1-glucose. Stepwise synthesis of G1-glucose; hexapropagylated core 1 was treated with AB4 building block (β-glucose-PEG4-azide), 2, under classical click reagent (CuAAC click reaction), catalytic amount of copper sulfate pentahydrate (CuSO4.5H2O) and sodium ascorbate in DMF:H2O (1:1) to generate G1-glucose-24-OAc, 3. Compound 3 was then treated under typical Zemplen conditions (to remove acetate group) to give the desired product 4 (G1-glucose).

[0379] Figure 23 shows the synthesis of Glu-G2 dendrimer. Stepwise synthesis of G2-glucose; G1-glucose dendrimer, 4, was treated with sodium hydride (60% dispersion in mineral oil) at 0°C for 15 min, followed by propargyl bromide (80% w / w solution in toluene). The reaction was stirred at room temperature for 8 h to form compound 5. Compound 5 was then treated with AB4 building block (β-glucose-PEG4-azide), 2, under classical click reagent (CuAAC click reaction) in DMF:H2O (1:1), catalytic amount of copper sulfate pentahydrate (CuSO4.5H2O) and sodium ascorbate to generate G2-glucose-96-OAc, 6. Compound 6 was then reacted under typical Zemplen conditions to give the desired product 7 (G2-glucose).

[0380] Figure 24 shows the synthesis of Cy5-Glu-G2-PEG4-SPDP. Glu-G2 dendrimer was treated with NaH and propargyl bromide, and the resulting product 2 was further reacted with N3-PEG3-amine, 3, using CUAAC click conditions to form compound 4. Product 4 was labeled with Cy5 fluorophore, and the resulting intermediate 5 was conjugated with SPDP to give functionalized Cy5-Glu-G2-PEG4-SPDP, 6. The subscript numbers in the formula indicate the number of attachments per dendrimer.

[0381] Figure 25 shows the synthesis of Cy5-Glu-G2-siRNA conjugate. siRNA, 7, was activated by reducing the dithiol group using DTT, and the resulting product, 8, was reacted with activated Cy5-Glu-G2-PEG4-SPDP, 6, to give the final product, Cy5-Glu-G2-siRNA, 9.

[0382] The uptake of Cy5-Glu-G2-siGFP into neuronal cells was confirmed by confocal microscopy images of Cy5-Glu-G2-siGFP cells colocalized in the cells 24 hours after treatment.

[0383] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed invention belongs. Publications cited herein and the material cited therein are specifically incorporated by reference.

[0384] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein which equivalents are intended to be encompassed by the following claims.

Claims

1. 1. A composition comprising a second, third, fourth, fifth, sixth, or seventh generation dendrimer covalently conjugated, optionally via one or more spacers, to one or more functional nucleic acids, A composition wherein the functional nucleic acid is conjugated to less than 50% of all end groups on the surface of the dendrimer prior to conjugation.

2. The composition of claim 1 , wherein the one or more functional nucleic acids inhibit the transcription, translation, or function of a target gene.

3. 3. The composition of claim 2, wherein the one or more functional nucleic acids are selected from the group consisting of antisense molecules, small interfering RNA (siRNA), microRNA (miRNA), aptamers, ribozymes, triplex-forming molecules, and external guide sequences.

4. The composition of claim 3, wherein the functional nucleic acid is miR-126.

5. 10. The composition of claim 1, wherein the dendrimer is a poly(amidoamine) (PAMAM) dendrimer or a glucose dendrimer, and between greater than 40% and 100% of the surface groups are hydroxylated or conjugated to glucose monosaccharides.

6. The composition of claim 1 , wherein the dendrimer is a hydroxyl-terminated PAMAM dendrimer.

7. 2. The composition of claim 1, wherein the dendrimer is a glucose dendrimer made from glucose and ethylene glycol building blocks and has more than 10 surface glucose moieties.

8. The composition of claim 1 , wherein the dendrimer is covalently conjugated to the one or more functional nucleic acids via one or more spacers.

9. 9. The composition of claim 8, wherein the one or more spacers are selected from the group consisting of N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), glutathione, gamma-aminobutyric acid (GABA), polyethylene glycol (PEG), and combinations thereof.

10. The composition of claim 1 , wherein the dendrimer is covalently conjugated to the one or more functional nucleic acids via a disulfide bond.

11. The composition of claim 1 , wherein the dendrimer is further conjugated to one or more additional therapeutic, prophylactic, and / or diagnostic agents.

12. A pharmaceutical composition for parenteral or oral administration comprising the composition of claim 1 and one or more pharmaceutically acceptable excipients.

13. 13. The pharmaceutical composition of claim 12, formulated in a form selected from the group consisting of a hydrogel, nanoparticles or microparticles, a suspension, a powder, a tablet, a capsule, and a solution.

14. 13. The composition of claim 12, formulated for treating one or more symptoms of cancer, an infectious disease, a proliferative disease, or inflammation in a subject in need thereof.

15. 15. The composition of claim 14, wherein the inflammation is associated with one or more diseases, conditions, and / or injuries of the eye, brain, and / or nervous system (CNS).

16. 16. The composition of claim 15, wherein the one or more diseases, conditions, and / or injuries of the eye, the brain, and / or the CNS are diseases, conditions, and injuries associated with activated microglia and astrocytes, or damaged, diseased, and / or overactive neurons, ganglion cells, and other neuronal cells in the brain and the eye.

17. 16. The composition of claim 15, wherein the one or more diseases, conditions, and / or injuries of the eye are choroidal neovascularization and the functional nucleic acid is a miRNA specific for vascular endothelial growth factor (VEGF).

18. The composition of claim 17, wherein the miRNA is miR-126.

19. 16. The composition of claim 15, wherein the one or more diseases, conditions, and / or injuries of the eye are macular degeneration.

20. 16. The composition of claim 15, wherein the composition is administered directly into the eye or by intravitreal injection.

21. The composition of claim 12 formulated for the treatment of a cancer selected from the group consisting of breast cancer, cervical cancer, ovarian cancer, uterine cancer, pancreatic cancer, skin cancer, multiple myeloma, prostate cancer, testicular germ cell tumor, brain cancer, oral cancer, esophageal cancer, lung cancer, liver cancer, renal cell cancer, colorectal cancer, duodenal cancer, gastric cancer, and colon cancer.

22. 13. The pharmaceutical composition of claim 12, wherein the amount of said functional nucleic acid effective to treat said disease or disorder is 50% or less of the amount of the same functional nucleic acid required to treat said disease or disorder in the absence of said dendrimer.

Images