Polynucleic acid molecules targeting PCSK9 and uses thereof

Abstract

Disclosed herein are siRNA duplexes, pharmaceutical compositions, and methods for inhibiting the expression of proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9). In some embodiments, the polynucleic acid molecule is a single-stranded nucleic acid molecule. In some examples, the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 contiguous nucleotides complementary to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, with no more than 1, 2, 3, 4 mismatches. In other examples, the single-stranded nucleic acid molecule comprises a sequence at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539.

Description

[Technical field]

[0001] cross reference This application claims the benefit of U.S. Provisional Application No. 63 / 247,677, filed September 23, 2021, and U.S. Provisional Application No. 63 / 337,958, filed May 3, 2022, which applications are incorporated by reference in their entireties herein. [Background technology]

[0002] The discovery of RNA interference (RNAi) as a cellular mechanism to selectively degrade mRNA allows both targeted manipulation of cell phenotype in cell culture and the potential development of directed therapeutics (Behlke, 2006, Mol. Ther. 13, 644-670; Xie et al., 2006, Drug Discov. Today 11, 67-73). As an alternative RNA therapeutic, antisense oligonucleotides (ASOs) are involved in RNA processing and modulate protein expression (Rinaldi & Wood, 2018, Nature Reviews Neurology volume 14, 9-21).

[0003] The proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene is the ninth member of the mammalian family of serine proteases. PCSK9 plays an important role in the metabolism of low-density lipoprotein (LDL) and in the development and progression of neurological diseases, including neuroinflammation, Alzheimer's disease, alcohol use disorder (AUD), stroke, etc. Thus, there is a need for the development of effective PCSK9 inhibitors that are non-cytotoxic. The polynucleic acid molecules, their conjugates, and the methods described herein meet this need and provide related advantages.

[0004] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was individually indicated to be incorporated by reference. Summary of the Invention

[0005] In certain aspects, disclosed herein is a polynucleic acid molecule for regulating expression of the PCSK9 gene, the polynucleic acid molecule comprising a nucleic acid sequence of Table 1, Table 2, and Table 3.

[0006] In some embodiments, the polynucleic acid molecule is a single-stranded nucleic acid molecule. In some examples, the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 contiguous nucleotides that are complementary to a sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 25-127, and 437-539, with no more than 1, 2, 3, 4 mismatches. In other examples, the single-stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95% complementary to a sequence selected from SEQ ID NO: 1, 3, 5, 7, 9, 25-127, and 437-539. In some examples, the single-stranded nucleic acid molecule comprises at least 14, 15, 16, 17, 18 contiguous nucleotides that are complementary to a sequence selected from SEQ ID NO: 1, 3, 5, 7, and 9, with no more than 1, 2, 3, 4 mismatches. In other examples, the single stranded nucleic acid molecule comprises a sequence that is at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, and 9.

[0007] In some embodiments, the polynucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand. In some examples, the sense strand comprises at least 80%, at least 85%, at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539. In some examples, the antisense strand comprises at least 80%, at least 85%, at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333. In some examples, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In some examples, the sense strand comprises one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and the antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333. In some examples, the sense strand comprises at least 80%, at least 85%, at least 90%, or at least 95% identity to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, and 9. In some examples, the antisense strand comprises at least 80%, at least 85%, at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 2, 4, 6, 8, and 10. In some examples, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, 3, or 4 mismatches.In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 2, 4, 6, 8, and 10 with no more than 1, 2, 3, or 4 mismatches. In some examples, the sense strand comprises one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and the antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, and 10.

[0008] In some examples, the sense strand comprises at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, and 9. In some examples, the antisense strand comprises at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 2, 4, 6, 8, and 10. In other examples, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9 with no more than 1, 2, 3, or 4 mismatches. In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 2, 4, 6, 8, and 10 with no more than 1, 2, 3, or 4 mismatches. In other examples, the sense strand comprises one of SEQ ID NOs: 1, 3, 5, 7, and 9, and the antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, and 10.

[0009] In some embodiments, the polynucleic acid molecule comprises (1) 2'-fluoro modified nucleotides, (2) 2'-O-methyl modified nucleotides, or (3) modified internucleotide linkages. In some examples, the polynucleic acid molecule comprises at least two consecutive modified internucleotide linkages at the 5' end. In some examples, the polynucleic acid molecule comprises at least two of the three internucleotide linkages at the 3' end replaced with modified internucleotide linkages.

[0010] In some examples, the sense strand comprises '5-NfsnsNfnNfnNfnNfnNfnNfnNfnNfnNfn-3' and the antisense strand comprises '5-nsNfsNfnNfnNfnNfnNfnNfnNfnNfnNfnNfn-3', where "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate. In other examples, the sense strand comprises '5-nsnsnnnNfnNfnNfnNfnNfnnnnn-3' and the antisense strand comprises '5-nsNfsnnnNfnNfnNfnnnnn-3', where "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate. In another example, the sense strand comprises '5-nsnsnnnnnnnnnn-3' and the antisense strand comprises '5-nsnsnnnnnnnnnn-3', where 'Nf' means 2'-fluoro modified nucleotides, 'n' means 2'-O-methyl modified nucleotides and 's' means 3'-phosphorothioate. In another example, the sense strand comprises '5-nsnsnnnnNfnNfnNfnnnnn-3' and the antisense strand comprises '5-nsnsnnnnnnnnnnnn-3', where 'Nf' means 2'-fluoro modified nucleotides, 'n' means 2'-O-methyl modified nucleotides and 's' means 3'-phosphorothioate.

[0011] In some instances, the modified internucleotide linkage is a phosphorothioate linkage. In some instances, the modified internucleotide linkage comprises a stereochemically enriched phosphorothioate internucleotide linkage. In some instances, the modified internucleotide linkage is an S PIn some examples, the polynucleic acid comprises a plurality of modified internucleotide bonds, and at least one, two, three, or four of the plurality of modified internucleotide bonds are stereochemically enriched phosphorothioate internucleotide bonds. In some examples, the stereochemically enriched phosphorothioate internucleotide bonds comprise both R and S isomers. In some examples, at least one stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 5' or 3' terminal nucleosides of the sense strand or antisense strand.

[0012] In some examples, the polynucleic acid molecule comprises a hypoxanthine nucleobase-containing nucleoside substitution. In some examples, the hypoxanthine nucleobase-containing nucleoside substitution is an inosine substitution. In some examples, the inosine substitution is in the seed region of the antisense strand. In some examples, the inosine substitution is within 7 nucleotides from the 5' end of the antisense strand. In some examples, the polynucleic acid molecule comprises an abasic substitution. In some examples, the abasic substitution is at the 5th or 7th nucleotide from the 5' end.

[0013] In some instances, the cytotoxicity of the polynucleic acid molecule is reduced as compared to the unmodified polynucleic acid.

[0014] In some examples, the sense strand comprises a nucleic acid sequence comprising at least 80%, at least 85%, at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 13, 15, 17, 19, 21, and 128-230. In some examples, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 13, 15, 17, 19, 21, and 128-230 with no more than 1, 2, 3, or 4 mismatches. In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 80%, at least 85%, at least 90%, at least 95% identity to a sequence selected from SEQ ID NOs: 14, 16, 18, 20, 22, and 334-436. In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 14, 16, 18, 20, 22, and 334-436 with no more than 1, 2, 3, or 4 mismatches. In some examples, the sense strand comprises a sequence selected from SEQ ID NOs: 13, 15, 17, 19, 21, and 128-230, and the antisense strand comprises a sequence selected from SEQ ID NOs: 14, 16, 18, 20, 22, and 334-436. In some examples, the sense strand comprises a nucleic acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% identity to a sequence selected from SEQ ID NOs: 13, 15, 17, 19, and 21. In some examples, the sense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 13, 15, 17, 19, and 21 with no more than 1, 2, 3, or 4 mismatches. In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 80%, at least 85%, at least 90%, or at least 95% identity to a sequence selected from SEQ ID NOs: 14, 16, 18, 20, and 22.In other examples, the antisense strand comprises a nucleic acid sequence comprising at least 14, 15, 16, 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 14, 16, 18, 20, and 22 with no more than 1, 2, 3, or 4 mismatches. In some examples, the sense strand comprises a sequence selected from the nucleic acid sequences of SEQ ID NOs: 13, 15, 17, 19, and 21, and the antisense strand comprises a sequence selected from the nucleic acid sequences of SEQ ID NOs: 14, 16, 18, 20, and 22.

[0015] In some examples, the polynucleic acid molecule is 19-25 base pairs in length. In some examples, the polynucleic acid molecule is 16-30 base pairs in length. In other examples, the polynucleic acid molecule is 21-23 base pairs in length. In other examples, the polynucleic acid molecule is 19-25 base pairs in length.

[0016] 1. A polynucleic acid molecule for regulating expression of the proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene, comprising: (a) an antisense strand comprising the nucleotide sequence of usUfsacaaaagcaAfaAfcAfggucusasg (SEQ ID NO: 14) and a sense strand comprising the nucleotide sequence of asgsaccuGfuUfuUfgcuuuuguaa (SEQ ID NO: 13); or (b) an antisense strand comprising the nucleotide sequence of usUfsucaaguuacAfaAfaGfcaaaascsa (SEQ ID NO: 16) and a sense strand comprising the nucleotide sequence of ususuugcUfuUfuGfuaacuugaaa (SEQ ID NO: 15), wherein lower case "n" refers to 2'-O-methyl modified nucleotides, upper case letter followed by "f" (i.e., "Nf") refers to 2'-fluoro modified nucleotides, and "s" refers to 3'-phosphorothioate.

[0017] In some embodiments, disclosed herein is a polynucleic acid molecule conjugate for regulating expression of the proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene, comprising a polynucleic acid molecule as described herein and an asialoglycoprotein receptor targeting moiety. In some examples, the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are linked by a linker. In some examples, the linker has the following formula (IV):

[0018] [ka] Including, wherein at least one of Y1 and Y2 is a nucleotide in the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule. In other examples, Y1 and Y2 are two consecutive nucleotides in the polynucleic acid molecule. In some examples, the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc). In some examples, the linker with the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are represented by the formula (V'):

[0019] [ka] As shown in wherein Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic, or the like.

[0020] In some aspects, provided herein is a pharmaceutical composition comprising a polynucleic acid molecule as described herein or a polynucleic acid molecule conjugate as described herein and a pharma- ceutically acceptable excipient.In some examples, the pharmaceutical composition is formulated as a nanoparticle formulation.In some examples, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, transdermal, intravenous, subcutaneous, or intrathecal administration.

[0021] In some aspects, provided herein is a method of modulating expression of the proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene in a subject, the method comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating expression of the PCSK9 gene in the subject.

[0022] In another aspect, provided herein is a method of regulating low density lipoprotein (LDL) in a subject in need of regulation, comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleic acid molecule described herein, the polynucleic acid molecule conjugate described herein, or the pharmaceutical composition described herein reduces the expression of the PCSK9 gene in the subject. In some examples, the subject in need of regulation suffers from hypercholesterolemia, familial hypercholesterolemia, or other high cholesterol-related disease.

[0023] In some embodiments, provided herein is a method of regulating cholesterol in a subject in need thereof, comprising administering to the subject a polynucleic acid molecule as described herein, a polynucleic acid molecule conjugate as described herein, or a pharmaceutical composition as described herein, wherein the polynucleic acid molecule as described herein, the polynucleic acid molecule conjugate as described herein, or the pharmaceutical composition as described herein reduces the expression of the PCSK9 gene in the subject. In some examples, the subject in need thereof suffers from hypercholesterolemia, familial hypercholesterolemia, or other high cholesterol-related disease. [Brief description of the drawings]

[0024] Various aspects of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments in which the principles of the disclosure are utilized, and the accompanying drawings, in which: [Figure 1A] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1B] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1C] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1D] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1E] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1F] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1G] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1H] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1I] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates. [Figure 1J] FIG. 1A-FIG. 1J show the effects of multiple siRNAs on PCSK9 levels, LDL-c levels, triglyceride (TG) levels, HDL-c levels, and total cholesterol (T-Chol) levels in non-human primates.

[0025] Detailed Description of the Invention PCSK9 is the ninth member of the mammalian family of serine proteinases, a group of protein convertases that cleave inactive secretory precursors into biologically active proteins and peptides. The human PCSK9 gene is located on chromosome 1p32.3 and is translated into an 82 kDa zymogen in the endoplasmic reticulum (see Abifadel et al., 2003, Nat. Genet. 34, 154-156; Piper et al., 2007, Structure 15, 545-552). PCSK9 is secreted primarily by hepatocytes into the bloodstream and is present in plasma.

[0026] PCSK9 has been shown to be involved in the breakdown of LDL-cholesterol (LDL-C) and the subsequent condition hypercholesterolemia (see Abifadel et al., 2003, Nat. Genet. 34, pp. 154-156). Hypercholesterolemia occurs as a result of a high-fat diet, inactivity, and is combined with certain genetic risk factors. High levels of LDL are a well-known risk factor. Exemplary genetic risk factors associated with hypercholesterolemia include mutations in genes that code for proteins that affect the level of LDL in the blood. For example, gain-of-function mutations in the gene that codes for PCSK9 are associated with hypercholesterolemia. When PCSK9 binds to LDLR, the LDLR undergoes degradation, resulting in reduced uptake of LDL-C from the bloodstream, thereby resulting in hypercholesterolemia. Thus, inhibition of PCSK9 is considered a potential therapeutic strategy for treating hypercholesterolemia, particularly familial hypercholesterolemia and other cholesterol-related diseases.

[0027] Besides the liver, PCSK9 is expressed in the small intestine, kidney, and brain. Specifically, PCSK9 is involved in neuroinflammation (see Apaijai et al., 2019, J. Am. Heart Assoc. 8:e010838). Furthermore, PCSK9 has been linked to the pathogenesis of Alzheimer's disease. Brain autopsies reveal elevated PCSK9 mRNA and protein levels in the frontal cortex of late-onset AD patients compared to controls (see Picard et al., 2019, PLoS One 14:e0220254). Furthermore, PCSK9 is involved in AUD, with the observation that PCSK9 levels in the CSF of patients with AUD are significantly higher compared to controls (see Chen et al., 2014, Lipids 49, 445-455). Furthermore, ischemic stroke is associated with several gain-of-function mutations in the PCSK9 gene that cause an increase in plasma LDL-C (see Rousselet et al., 2011, J. Lipid Res. 52, 1383-1391). Thus, the development of therapeutic agents targeting PCSK9 may be useful for the above-mentioned neurological disorders.

[0028] Described herein are polynucleic acid molecules for regulating the expression of the PCSK9 gene, comprising sense and antisense strands, and comprising the nucleic acid sequences of Table 1, Table 2, and Table 3. Thus, provided herein are various target regions of human PCSK9 mRNA to which the polynucleic acid molecules described herein hybridize. In some embodiments, provided herein are sequences of the polynucleic acid molecules described herein. In some embodiments, provided herein are possible modifications of the polynucleic acid molecules described herein. In some embodiments, provided herein are possible conjugates of the polynucleic acid molecules described herein.

[0029] Further described herein is a method for modulating expression of the proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene in a subject.Further described herein is a method for modulating LDL and / or cholesterol in a subject in need thereof.

[0030] Polynucleic acid molecule Target region of the polynucleic acid molecule The polynucleic acid molecule described herein is for regulating the expression of PCSK9 gene.In some embodiments, the polynucleic acid molecule is a single-stranded nucleic acid molecule that hybridizes with specific region of mRNA.In some embodiments, the polynucleic acid molecule is a double-stranded nucleic acid molecule.In some examples, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand hybridizes with specific region of PCSK9 mRNA.

[0031] In some embodiments, the polynucleic acid molecules described herein hybridize to a specific region of human PCSK9 mRNA. In some embodiments, the polynucleic acid molecules described herein hybridize to a specific region of non-human PCSK9 mRNA.

[0032] In some embodiments, the polynucleic acid molecules described herein hybridize to the 5'UTR region of human PCSK9 mRNA.In some embodiments, the polynucleic acid molecules described herein hybridize to the coding region of human PCSK9 mRNA.In some embodiments, the polynucleic acid molecules described herein hybridize to the 3'UTR region of human PCSK9 mRNA. In some specific embodiments, the polynucleic acid molecules described herein hybridize to a subset of the 3'UTR of human PCSK9 mRNA (NCBI Reference Sequence: NM_174936.3) within the range of the transcription start site at 2342-2441, 2442-2541, 2542-2641, 2642-2741, 2742-2841, 2842-2941, 2942-3041, 3042-3141, 3142-3241, 3242-3341, 3342-3441, 3442-3541, 3542-3641, 3642-3731.

[0033] In some aspects, the target region that the polynucleic acid molecules described herein hybridize to is determined by an algorithm that predicts maximum PCSK9 silencing efficacy and the lowest possible off-target effects.In some specific embodiments, the algorithm is disclosed in He et al., 2017, Scientific Reports, 7, 44836.In some specific embodiments, the algorithm is disclosed in Han et al., 2018, BMC Genomics 19, 669.In some specific embodiments, the algorithm is siRNArules, siRNA-Finder, siRNA Wizard, siDirect, siRNA Wizard, Dharmacon siRNA design tool, White head siRNA design tool, or Genscript siRNA software.

[0034] Structure of a single-stranded nucleic acid molecule Described herein are polynucleic acid molecules for modulating expression of the PCSK9 gene, wherein a single stranded nucleic acid molecule of the polynucleic acid molecule is reverse complementary to a target region of said PCSK9 mRNA.

[0035] In some embodiments, the polynucleic acid molecules described herein are not 100% complementary to the target region of PCSK9 mRNA. Thus, in some examples, the polynucleic acid molecules described herein are about 95% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the polynucleic acid molecules described herein are about 90% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the polynucleic acid molecules described herein are about 85% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the polynucleic acid molecules described herein are about 80% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the polynucleic acid molecules described herein are about 75% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the polynucleic acid molecules described herein are about 70% complementary to the target region of PCSK9 mRNA.

[0036] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence in Table 1, Table 2, and Table 3. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence in Table 1, Table 2, and Table 3. In some examples, the polynucleic acid molecules described herein are at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539. In some examples, the polynucleic acid molecules described herein are at least 80%, at least 85%, at least 90%, or at least 95% complementary to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, and 9.

[0037] In yet other embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 15 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than two, three, or four mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 15 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than two, three, or four mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 16 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than two, three, or four mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 16 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than two, three, or four mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 17 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than two, three, or four mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 17 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than two, three, or four mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 18 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than two, three, or four mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise nucleic acid sequences that are 18 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than two, three, or four mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 19 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than two, three, or four mismatches.In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 19 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 20 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 2, 3, or 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 21 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 2, 3, or 4 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 21 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 22 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 22 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 2, 3, or 4 mismatches.

[0038] In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 15 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 16 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 17 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 18 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 19 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 20 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 21 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 22 contiguous nucleotides complementary to the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches.

[0039] In some embodiments, the polynucleic acid molecules described herein comprise about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise about 15, 16, 17, 18, 19, 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise about 21, 22, 23, 24, 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise about 26, 27, 28, 29, 30 nucleotides in length. In some specific embodiments, the polynucleic acid molecules described herein comprise 19 nucleotides in length. In some specific embodiments, the polynucleic acid molecules described herein comprise 21 nucleotides in length. In some specific embodiments, the polynucleic acid molecules described herein comprise 23 nucleotides in length.

[0040] double stranded nucleic acid molecule Described herein are polynucleic acid molecules for regulating expression of the PCSK9 gene, which are double-stranded molecules comprising a sense strand and an antisense strand, wherein the antisense strand is reverse complementary to a target region of the PCSK9 mRNA.

[0041] In some embodiments, the antisense strand described herein is 100% complementary to the target region of PCSK9 mRNA. In some embodiments, the antisense strand described herein is not 100% complementary to the target region of PCSK9 mRNA. Thus, in some examples, the antisense strand described herein is about 95% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the antisense strand described herein is about 90% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the antisense strand described herein is about 85% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the antisense strand described herein is about 80% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the antisense strand described herein is about 75% complementary to the target region of PCSK9 mRNA. In some specific embodiments, the antisense strand described herein is about 70% complementary to the target region of PCSK9 mRNA.

[0042] In some embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence in Table 1, Table 2, and Table 3. In other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence in Table 1, Table 2, and Table 3. In some examples, the sense strand described herein is at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539. In some examples, the antisense strand described herein is at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence selected from SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333. In some examples, the sense strand described herein is at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence selected from SEQ ID NOs: 1, 3, 5, 7, and 9. In some examples, the antisense strand described herein is at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence selected from SEQ ID NOs: 2, 4, 6, 8, and 10.

[0043] In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 14 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 14 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 14 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In still other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 15 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 15 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 15 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 16 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 16 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strands described herein comprise a nucleic acid sequence that is 16 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 17 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches.In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 17 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 17 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 18 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 18 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 18 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 19 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 19 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 19 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 20 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches.In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 20 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 20 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 21 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 21 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 21 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches. In yet other embodiments, the polynucleic acid molecules described herein comprise a nucleic acid sequence that is 22 contiguous nucleotides of the sequences of Table 1, Table 2, and Table 3 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 22 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539 with no more than 1, 2, 3, or 4 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 22 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333 with no more than 1, 2, 3, or 4 mismatches.

[0044] In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 14 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 14 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 15 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 15 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 16 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 16 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 17 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 17 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 18 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 18 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 19 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches.In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 19 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 20 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 20 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 21 contiguous nucleotides of SEQ ID NO: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 21 contiguous nucleotides of SEQ ID NO: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches. In certain embodiments, the sense strand described herein comprises a nucleic acid sequence that is 22 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, and 9 with no more than 1, 2, or 3 mismatches. In certain embodiments, the antisense strand described herein comprises a nucleic acid sequence that is 22 contiguous nucleotides of SEQ ID NOs: 2, 4, 6, 8, and 10 with no more than 1, 2, or 3 mismatches.

[0045] In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands of about 15-30, 16-30, 17-30, 18-30, 18-27, 18-25, 18-23, 19-23, 20-23, or 21-23 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands of about 15, 16, 17, 18, 19, 20 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands of about 21, 22, 23, 24, 25 nucleotides in length. In some embodiments, the polynucleic acid molecules described herein comprise sense and antisense strands of about 26, 27, 28, 29, 30 nucleotides in length. In some specific embodiments, the polynucleic acid molecules described herein comprise a sense strand of 19 nucleotides in length and an antisense strand of about 21 nucleotides in length. In some specific embodiments, the polynucleic acid molecules described herein comprise a sense strand 21 nucleotides in length and an antisense strand approximately 23 nucleotides in length.

[0046] In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the antisense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the antisense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 3' overhang on the sense strand.In some embodiments, the sense strand and the antisense strand described herein are reverse complementary to each other and form a duplex with a 5' overhang on the sense strand.

[0047] Modification of polynucleic acid molecules In some embodiments, the polynucleic acid molecules described herein have modifications. In some embodiments, the modifications described herein occur in one or more different structures (e.g., sugar ring, backbone, base modifications) of the polynucleic acid molecules described herein. In some embodiments, the modifications described herein include substitutions of one or more nucleotides in the polynucleic acid molecules described herein. In some embodiments, different percentages of the polynucleic acid molecules described herein include modifications described herein. In some embodiments, different positions of the polynucleic acid molecules described herein include modifications described herein. WO / 2018 / 035380 is incorporated herein by reference in its entirety.

[0048] Modification types In some embodiments, the polynucleotide acid molecules described herein comprise one or more sugar-modified nucleotides. In some embodiments, the sugar-modified nucleotide is a 2'-fluoro modified nucleotide. In some examples, the sugar-modified nucleotide comprises a modification at the 2' hydroxyl group of the ribose moiety. In some examples, the sugar-modified nucleotide comprises a modification with H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. In some embodiments, the sugar-modified nucleotide is a 2'-O-methyl modified nucleotide or a 2'-alkoxy modified nucleotide (e.g., a 2'-methoxy modified nucleotide). In some examples, the 2' hydroxyl group modification includes 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O-NMA). In some examples, the alkyl moiety includes a heterosubstitution. In some examples, a carbon of a heterocyclic group is replaced by a nitrogen, oxygen, or sulfur. In some embodiments, the sugar modified nucleotide is a 2'-amino modified nucleotide. In some embodiments, the sugar modified nucleotide is a 2'-azido modified nucleotide. In some embodiments, the sugar modified nucleotide is a 2'-deoxy modified nucleotide. In some embodiments, the sugar modified nucleotide is a 2'-O-methoxytyl (2'-MOE). In some embodiments, the sugar modified nucleotide is a locked nucleic acid (LNA). In some embodiments, the sugar modified nucleotide is an ethylene bridged nucleic acid (ENA). In some embodiments, the sugar modified nucleotide is (S) constrained ethyl (cEt). In some embodiments, the sugar modified nucleotide is a tricycloDNA (tcDNA). In some embodiments, the sugar modified nucleotide is a 2'-NH2 nucleic acid.

[0049] In some embodiments, the polynucleotide acid molecules described herein include one or more sugar phosphate modified nucleotides. In some embodiments, the modified sugar phosphate is a phosphorodiamidate morpholino (PMO). In some embodiments, the modified sugar phosphate is a phosphoramidate. In some examples, the heterocyclic substitutions include imidazole and pyrrolidino. In some embodiments, the modified sugar phosphate is a thiophosphoramidate. In some embodiments, the modified sugar phosphate is a peptide nucleic acid (PNA).

[0050] In some embodiments, the polynucleotide acid molecule described herein comprises one or more backbone modified nucleotides. In some particular embodiments, the modified backbone is methyl phosphonate. In some particular embodiments, the modified backbone is phosphorothioate. In some particular embodiments, the modified backbone is guanidinopropyl phosphoramidate. In some particular embodiments, the modified backbone is mesyl-phosphoramidate (MsPA) linkage. In some examples, the modified backbone comprises one or more of phosphorodithioate, methyl phosphonate, 5'-alkylene phosphonate, 5'-methyl phosphonate, 3'-alkylene phosphonate, boron trifluorodate, 3'-5' or 2'-5' linked boranophosphate and selenophosphate, phosphotriester, thionoalkylphosphotriester, hydrogen phosphonate linkage, alkyl phosphonate, alkyl phosphonothioate, aryl phosphonothioate, phosphoroselenoate, phosphoramidate.

[0051] In some embodiments, the modified nucleotides include one or more modified guanines (eg, inosine) or any type of non-naturally occurring nucleic acid.

[0052] In some particular embodiments, the modified backbone is a phosphorothioate, and the phosphorothioate is a stereochemically enriched phosphorothioate. In certain embodiments, the chain contains at least one stereochemically enriched phosphorothioate. In some embodiments, the chain contains at least one, two, three stereochemically enriched phosphorothioates. In some embodiments, the chain contains only one, two, three, or four stereochemically enriched phosphorothioates. In further embodiments, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 5'-terminal nucleosides of the chain. In yet further embodiments, at least one (e.g., one or two) stereochemically enriched phosphorothioate is disposed between two consecutive nucleosides that are two of the six 3'-terminal nucleosides of the chain. In still further embodiments, one stereochemically enriched phosphorothioate is covalently linked to the first nucleoside and the second nucleoside from the 5' end in the chain. In some embodiments, one stereochemically enriched phosphorothioate is covalently linked to 20 first nucleosides and 20 second nucleosides from the 5' end in the chain. In certain embodiments, one stereochemically enriched phosphorothioate is covalently linked to 20 second nucleosides and 20 third nucleosides from the 5' end in the chain. In certain embodiments, the stereochemically enriched phosphorothioate comprises RP stereochemical identity. In certain embodiments, the stereochemically enriched phosphorothioate comprises SP stereochemical identity.

[0053] In some embodiments, the polynucleotide molecules described herein include one or more (e.g., 1-20, 1-10, or 1-5) stereochemically enriched (e.g., internucleoside) phosphorothioates (e.g., having a diastereomeric excess of at least 10%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%, e.g., up to about 99%, about the P-stereogenic center). The polynucleotide molecules described herein include one or more (e.g., 1-20, 1-10, or 1-5, e.g., internucleoside linkages) phosphorodithioates. The phosphorodithioates can be non-P-stereogenic in the polynucleotide molecules described herein. Phosphorothioates and phosphorodithioates can enhance the stability of the polynucleotide molecules described herein against serum exonuclease activity. Non-P-stereogenic phosphorodithioates can simplify the synthesis of the polynucleotide molecules described herein by reducing the number of possible diastereomers. Typically, phosphorothioates or phosphorodithioates can connect two consecutive nucleosides within the six 3'-terminal nucleosides and six 5'-terminal nucleosides of the polynucleotide molecules described herein. In some embodiments, stereochemically enriched phosphorothioates (e.g., RP-enriched phosphorothioates) can be covalently linked to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) from the 5'-end of the antisense strand. Additionally or alternatively, stereochemically enriched phosphorothioates (e.g., SP-enriched phosphorothioates) can be covalently linked to the 21st nucleoside (e.g., the 3' carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5' carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand.Additionally or alternatively, stereochemically enriched phosphorothioates (e.g., SP-enriched phosphorothioates) can be covalently linked to the 22nd nucleoside (e.g., the 3' carbon atom of the 22nd nucleoside) and the 23rd nucleoside (e.g., the 5' carbon atom of the 23rd nucleoside) from the 5' end of the antisense strand. A combination of 5'RP-enriched phosphorothioates (e.g., RP-enriched phosphorothioates) covalently linked to the first nucleoside (e.g., the 3'-carbon atom of the first nucleoside) and the second nucleoside (e.g., the 5'-carbon atom of the second nucleoside) from the 5' end and 3'SP-enriched phosphorothioates (e.g., SP-enriched phosphorothioates covalently linked to the 21st nucleoside (e.g., the 3'-carbon atom of the 21st nucleoside) and the 22nd nucleoside (e.g., the 5'-carbon atom of the 22nd nucleoside) from the 5' end of the antisense strand can result in superior efficacy and / or duration of action. For example, as measured by a reduction in the activity of the target relative to a reference guide strand lacking the combination of 5'RP-enriched phosphorothioates and 3'SP-enriched phosphorothioates.

[0054] In some embodiments, the polynucleotide molecules described herein comprise one or more purine modifications. In some particular embodiments, the purine modification described herein is 2,6-diaminopurine. In some particular embodiments, the purine modification described herein is 3-deaza-adenine. In some particular embodiments, the purine modification described herein is 7-deaza-guanine. In some particular embodiments, the purine modification described herein is 8-azido-adenine.

[0055] In some embodiments, the polynucleotide molecules described herein comprise one or more pyrimidine modifications. In some specific embodiments, the pyrimidine modifications described herein are 2-thio-thymidine. In some specific embodiments, the pyrimidine modifications described herein are 5-carboxamido-uracil. In some specific embodiments, the pyrimidine modifications described herein are 5-methyl-cytosine. In some specific embodiments, the pyrimidine modifications described herein are 5-ethynyluracil.

[0056] In some embodiments, the polynucleic acid molecules described herein comprise abasic substitutions. When the hybridized polynucleotide construct is intended for use as an siRNA, it is desirable to reduce miRNA-like off-target effects. Since abasic substitutions lack a nucleic acid base that can participate in base pairing interactions and relieve steric hindrance, the inclusion of one or more (e.g., one or two) abasic substitutions in the hybridized polynucleotide construct can reduce or even eliminate miRNA-like off-target effects. Thus, the polynucleotide molecules disclosed herein can comprise one or more (e.g., one or two) abasic substitutions. In certain aspects, the abasic substitution is at the fifth nucleotide from the 5' end of the antisense strand described herein. In certain aspects, the abasic substitution is at the seventh nucleotide from the 5' end of the antisense strand described herein.

[0057] When the polynucleotide molecule disclosed herein contains two or more abasic substitutions, their structures may be the same or different. In some embodiments, the sense strand contains one abasic substitution (e.g., the antisense strand may not contain an abasic substitution). In other embodiments, the antisense strand contains one abasic substitution (e.g., the sense strand may not contain an abasic substitution). In still other embodiments, the antisense strand contains one abasic substitution and the sense strand contains one abasic substitution. In further embodiments, the sense strand contains an abasic substitution between the nucleoside number (x) and the nucleoside number (x+1), where x is an integer between 2 and 7. In still further embodiments, the antisense strand contains an abasic substitution between the nucleoside number (x) and the nucleoside number (x+1), where x is an integer between 2 and 7.

[0058] The abasic substitution is represented by the formula (III):

[0059] [ka]

[0023] During the ceremony, L is a sugar analogue or is heteroacyl substituted from A, U, C, G, or any other substituted nucleic acid (e.g., locked or unlocked nucleic acid, glycol nucleic acid, etc.); each X 4 are independently O or S; each X 5 are independently O, S, NH, or a bond; Each R 9 are independently H, optionally substituted C 1-6 Alkyl, optionally substituted C 2-6 Alkenyl, optionally substituted C 2-6 Alkynyl, optionally substituted (C 1-9 Heterocyclyl)-C 1-6 -alkyl, optionally substituted (C 6-10 Aryl)-C 1-6-alkyl, optionally substituted (C 3-8 Cycloalkyl)-C 1-6 -Alkyl, -LinkA(-T) p or a conjugation moiety, each LinkA is independently a polyvalent linker (e.g., comprising -C(O)-N(H)-); Each T is independently a subpart, R 10 is the bond to the 3'-carbon atom of the nucleoside (x) in the chain, R 11 is the bond to the 5'-oxygen atom of the nucleoside (x+1) in the chain, P is an integer from 1 to 6, and T is an integer from 1 to 6.

[0060] In some embodiments, the abasic substitution described herein is attached to the antisense strand of the polynucleic acid molecule described herein. In certain embodiments, the abasic substitution (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be included in the antisense strand described herein (e.g., in the seed region of the guide strand). In some embodiments, the abasic substitution (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be attached to the 3' carbon atom of the second, third, fourth, or fifth nucleoside from the 5' end of the antisense strand described herein. In certain embodiments, the abasic substitution (e.g., the internucleotide abasic spacer of formula (III) where t is 1) can be attached to the 3' carbon atom of the 13th, 14th, 15th, or 16th nucleoside from the 5' end of the antisense strand described herein. In some embodiments, the abasic substitution is the 4th, 5th, 6th, 7th, 8th, and / or 9th nucleoside from the 5' end of the antisense strand described herein.

[0061] The polynucleotide molecules described herein can contain a strand that includes a seed region that includes a hypoxanthine nucleobase-containing nucleoside (eg, inosine).

[0062] In certain embodiments, the hypoxanthine nucleobase-containing nucleoside is the second nucleoside from the 5' end of the chain. In a further embodiment, the hypoxanthine nucleobase-containing nucleoside is the third nucleoside from the 5' end of the chain. In yet a further embodiment, the hypoxanthine nucleobase-containing nucleoside is the fourth nucleoside from the 5' end of the chain. In yet a further embodiment, the hypoxanthine nucleobase-containing nucleoside is the fifth nucleoside from the 5' end of the chain. In certain embodiments, the hypoxanthine nucleobase-containing nucleoside is the sixth nucleoside in the chain. In certain embodiments, the hypoxanthine nucleobase-containing nucleoside is the seventh nucleoside in the chain.

[0063] Amount and position of modification In some embodiments, the polynucleotide molecules described herein include one or more types of modifications as described above. Thus, in some embodiments, about 10% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 20% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 30% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 40% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 50% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 60% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 70% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 80% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications as described above. In other embodiments, about 90% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above. In other embodiments, 100% of the nucleotides from the polynucleotide molecules described herein are modified with one or more types of modifications described above.

[0064] In some embodiments, one or more types of modifications described herein occur at different positions within the polynucleotide molecules described herein. In certain embodiments, one or more types of modifications described herein occur at the seed region within the polynucleotide molecules described herein. In certain embodiments, one or more types of modifications described herein occur at the 3' end of the polynucleotide molecules described herein. In certain embodiments, one or more types of modifications described herein occur at the 5' end of the polynucleotide molecules described herein. In certain embodiments, one or more types of modifications described herein occur dispersedly within the polynucleotide molecules described herein. In certain embodiments, one or more types of modifications described herein occur in clusters within the polynucleotide molecules described herein.

[0065] Specific modification patterns In some embodiments, described herein are specific modification patterns of polynucleic acid molecules that are double-stranded nucleic acid molecules comprising a sense strand and an antisense strand, wherein the sense strand comprises about 12 2'-fluoro modified nucleotides and about 9 2'-O-methyl modified nucleotides, and the antisense strand comprises about 9 2'-fluoro modified nucleotides and about 14 2'-O-methyl modified nucleotides.

[0066] In some embodiments, the sense strand is fully modified and contains 12 2'-fluoro modified nucleotides, 9 2'-O-methyl modified nucleotides, and the antisense strand is fully modified and contains 9 2'-fluoro modified nucleotides, and 14 2'-O-methyl modified nucleotides, specific modification patterns as described herein.

[0067] In some embodiments, the specific modification patterns described herein include the sense strand comprising '5-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNf-3' and the antisense strand comprising '5-nNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNnn-3', where "Nf" refers to 2'-fluoro modified nucleotides and "n" refers to 2'-O-methyl modified nucleotides.

[0068] In some embodiments, the sense strand comprises '5-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNfn-3' and the antisense strand comprises '5-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfnNnn-3', and the sense strand and / or antisense strand comprise one or more phosphorothioate linkages, where "Nf" means 2'-fluoro modified nucleotides and "n" means 2'-O-methyl modified nucleotides, specific modification patterns described herein. In other embodiments, the specific modification patterns described herein include the sense strand comprising '5-NfnNfnNfnNfnNfnNfnNfnNfnNfnNfn-3' and the antisense strand comprising '5-NfnNfnNfnNfnNfnNfnNfnNfnNfn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" means 2'-fluoro modified nucleotides and "n" means 2'-O-methyl modified nucleotides.

[0069] In some embodiments, the specific modification patterns described herein are where the sense strand and / or the antisense strand are modified as Type I of Table 4.

[0070] [Table 1]

[0071] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand from one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and the antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand from one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and the antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333, and the sense and / or antisense strand is modified with a type I modification pattern as specified in Table 4. In some embodiments, the polynucleotide molecules provided herein comprise a sense strand from one of SEQ ID NOs: 1, 3, 5, 7, and 9, and the antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, and 10. In other aspects, the polynucleotide molecules provided herein comprise a sense strand from one of SEQ ID NOs: 1, 3, 5, 7, and 9, and an antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, and 10, and wherein the sense and / or antisense strands are modified with a Type I modification pattern as specified in Table 4.

[0072] In some embodiments, the specific modification patterns described herein include a sense strand that contains about 4 2'-fluoro modified nucleotides and about 17 2'-O-methyl modified nucleotides and an antisense strand that contains about 6 2'-fluoro modified nucleotides and about 17 2'-O-methyl modified nucleotides.

[0073] In some embodiments, specific modification patterns are described herein where the sense strand contains 4 2'-fluoro modified nucleotides, 17 2'-O-methyl modified nucleotides, and no other nucleotides, and the antisense strand contains 6 2'-fluoro modified nucleotides and 17 2'-O-methyl modified nucleotides, and no other nucleotides.

[0074] In some embodiments, the specific modification patterns described herein include the sense strand comprising '5-nnnnnNfnNfnnnnnnn-3' and the antisense strand comprising '5-nnnnnnnnnnnnnn-3', where 'Nf' represents 2'-fluoro modified nucleotides and 'n' represents 2'-O-methyl modified nucleotides.

[0075] In some embodiments, specific modification patterns are described herein where the sense strand comprises '5-nnnnnNfnNfNfnnnnnnn-3' and the antisense strand comprises '5-nnnnnNfnNfnnnnnnn-3', where the sense and / or antisense strand comprises one or more phosphorothioate linkages, where "Nf" refers to 2'-fluoro modified nucleotides and "n" refers to 2'-O-methyl modified nucleotides. In other embodiments, specific modification patterns are described herein where the sense strand comprises '5-nnnnnNfnNfnnnnnnn-3' and the antisense strand comprises '5-nnnnnnnnnnnnn-3', where the sense comprises two phosphorothioate linkages and the antisense comprises four phosphorothioate linkages, where "Nf" refers to 2'-fluoro modified nucleotides and "n" refers to 2'-O-methyl modified nucleotides.

[0076] In some embodiments, the specific modification patterns described herein are where the sense strand and / or the antisense strand are modified as Type II of Table 4.

[0077] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and / or an antisense strand comprising one of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333, wherein the sense strand and / or the antisense strand are modified with a type II modification pattern as specified in Table 4. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising one of SEQ ID NOs: 1, 3, 5, 7, and 9, and / or an antisense strand comprising one of SEQ ID NOs: 2, 4, 6, 8, and 10, wherein the sense strand and / or the antisense strand are modified with a type II modification pattern as specified in Table 4.

[0078] In some embodiments, the specific modification patterns described herein include a sense strand that contains about 2 2'-fluoro modified nucleotides and about 19 2'-O-methyl modified nucleotides and an antisense strand that contains about 3 2'-fluoro modified nucleotides and about 20 2'-O-methyl modified nucleotides.

[0079] In some embodiments, specific modification patterns are described herein where the sense strand contains 2 2'-fluoro modified nucleotides, 19 2'-O-methyl modified nucleotides, and no other nucleotides, and the antisense strand contains 3 2'-fluoro modified nucleotides and 20 2'-O-methyl modified nucleotides, and no other nucleotides.

[0080] In some embodiments, the specific modification patterns described herein include the sense strand comprising '5-nnnnnnnnnnn-3' and the antisense strand comprising '5-nnnnnnnnnnnnnn-3', where "Nf" refers to 2'-fluoro modified nucleotides and "n" refers to 2'-O-methyl modified nucleotides.

[0081] In some embodiments, specific modification patterns are described herein where the sense strand comprises '5-nnnnnnnnnnn-3' and the antisense strand comprises '5-nnnnnnnnnnnnnn-3', where the sense strand and / or the antisense strand comprises one or more phosphorothioate linkages, where "Nf" means 2'-fluoro modified nucleotides and "n" means 2'-O-methyl modified nucleotides. In other embodiments, specific modification patterns are described herein where the sense strand comprises '5-nnnnnnnnnnn-3' and the antisense strand comprises '5-nnnnnnnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" means 2'-fluoro modified nucleotides and "n" means 2'-O-methyl modified nucleotides.

[0082] In some embodiments, the specific modification patterns described herein are where the sense strand and / or the antisense strand are modified as Type III of Table 4.

[0083] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand from one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and an antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333, and the sense and / or antisense strand is modified with a type III modification pattern as specified in Table 4. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand from one of SEQ ID NOs: 1, 3, 5, 7, and 9, and an antisense strand comprises one of SEQ ID NOs: 2, 4, 6, 8, and 10, and the sense and / or antisense strand is modified with a type III modification pattern as specified in Table 4.

[0084] In some embodiments, the specific modification patterns described herein include a sense strand that contains about 3 2'-fluoro modified nucleotides and about 18 2'-O-methyl modified nucleotides and an antisense strand that contains about 4 2'-fluoro modified nucleotides and about 19 2'-O-methyl modified nucleotides.

[0085] In some embodiments, specific modification patterns are described herein where the sense strand contains 3 2'-fluoro modified nucleotides, 18 2'-O-methyl modified nucleotides and no other nucleotides, and the antisense strand contains 4 2'-fluoro modified nucleotides and 19 2'-O-methyl modified nucleotides and no other nucleotides.

[0086] In some embodiments, the sense strand comprises '5-nnnnnnnnnnnn-3' and the antisense strand comprises '5-nnnnnnnnnnnnnn-3', where "Nf" represents 2'-fluoro modified nucleotides and "n" represents 2'-O-methyl modified nucleotides, specific modification patterns as described herein.

[0087] In some embodiments, specific modification patterns are described herein where the sense strand comprises '5-nnnnnnnnnnnn-3' and the antisense strand comprises '5-nnnnnnnnnnnnnn-3', where the sense and / or antisense strand comprises one or more phosphorothioate linkages, where "Nf" means 2'-fluoro modified nucleotides and "n" means 2'-O-methyl modified nucleotides. In other embodiments, specific modification patterns are described herein where the sense strand comprises '5-nnnnnNfnNfnnnnnnn-3' and the antisense strand comprises '5-nnnnnnnnnnnnn-3', where the sense strand comprises two phosphorothioate linkages and the antisense strand comprises four phosphorothioate linkages, where "Nf" means 2'-fluoro modified nucleotides and "n" means 2'-O-methyl modified nucleotides.

[0088] In some embodiments, the specific modification patterns described herein are where the sense strand and / or the antisense strand are modified as Type IV of Table 4.

[0089] In some embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising one of SEQ ID NOs: 1, 3, 5, 7, 9, 25-127, and 437-539, and / or an antisense strand comprising one of SEQ ID NOs: 2, 4, 6, 8, 10, and 231-333, wherein the sense strand and / or the antisense strand are modified with a Type IV modification pattern as specified in Table 4. In other embodiments, the polynucleotide molecules provided herein comprise a sense strand comprising one of SEQ ID NOs: 1, 3, 5, 7, and 9, and / or an antisense strand comprising one of SEQ ID NOs: 2, 4, 6, 8, and 10, wherein the sense strand and / or the antisense strand are modified with a Type IV modification pattern as specified in Table 4.

[0090] 1. A polynucleic acid molecule for regulating expression of the PCSK9 gene, comprising an antisense strand comprising the nucleotide sequence of usUfsacaaaagcaAfaAfcAfgguusasg (SEQ ID NO: 14) and a sense strand comprising the nucleotide sequence of asgsaccuGfuUfuUfgcuuuuuaa (SEQ ID NO: 13), wherein "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate.

[0091] A polynucleic acid molecule for regulating expression of the PCSK9 gene, comprising an antisense strand comprising the nucleotide sequence of usUfsucaaguuacAfaAfaGfcaaaascsa (SEQ ID NO: 16) and a sense strand comprising the nucleotide sequence of ususuugcUfuUfuGfuaacuugaaa (SEQ ID NO: 15), wherein "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate.

[0092] A polynucleic acid molecule for regulating expression of the PCSK9 gene, comprising an antisense strand comprising the nucleotide sequence of asAfsuaucuucaaGfuUfaCfaaaaagscsa (SEQ ID NO: 18) and a sense strand comprising the nucleotide sequence of csuuuugUfaAfcUfugaagauauu (SEQ ID NO: 17), wherein "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate.

[0093] 1. A polynucleic acid molecule for regulating expression of the PCSK9 gene, comprising an antisense strand comprising the nucleotide sequence of asUfsuaauaaaaaUfgCfuAfuAfuaaaaascsc (SEQ ID NO: 20) and a sense strand comprising the nucleotide sequence of ususuuuuAfgCfaUfuuuuauuaau (SEQ ID NO: 19), wherein "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate.

[0094] 1. A polynucleic acid molecule for regulating expression of the PCSK9 gene, comprising an antisense strand comprising the nucleotide sequence of asUfsauuaauaaaaaaafaUfgCfuacaasa (SEQ ID NO: 22) and a sense strand comprising the nucleotide sequence of ususguagCfaUfuUfuuauuauauau (SEQ ID NO: 21), wherein "Nf" means 2'-fluoro modified nucleotides, "n" means 2'-O-methyl modified nucleotides, and "s" means 3'-phosphorothioate.

[0095] Conjugation joining part In certain embodiments, the polynucleotide molecules described herein are coupled or conjugated with one or more targeting moieties to form a polynucleotide-targeting moiety conjugate molecule. In some examples, the targeting moiety is selected based on its ability to selectively or preferably target the conjugate molecule described herein to a desired cell population, tissue, or organ. In some examples, the targeting moiety targets cells, tissues, or organs that express the targeting moiety's corresponding binding partner (e.g., either the corresponding receptor or ligand). For example, the polynucleotide molecules described herein can be targeted to hepatocytes that express asialoglycoprotein (ASGP-R) by selecting a targeting moiety that contains N-acetylgalactosamine (GalNAc) as the targeting moiety. Targeting moieties (i.e., intracellular targeting moieties) that target a desired site within a cell (e.g., the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) can be included in the hybridized polynucleotide constructs disclosed herein. Non-limiting examples of intracellular targeting moieties are provided in WO2015 / 069932 and WO2015 / 188197, the disclosures of intracellular targeting moieties in WO2015 / 069932 and WO2015 / 188197 are incorporated herein by reference.

[0096] Thus, the polynucleotide molecules described herein may comprise one or more targeting moieties selected from the group consisting of intracellular targeting moieties, extracellular targeting moieties, and combinations thereof.Thus, the inclusion of one or more targeting moieties (e.g., an extracellular targeting moiety comprising a targeting moiety independently selected from the group consisting of folic acid, mannose, N-acetylgalactosamine, and prostate-specific membrane antigen) and one or more intracellular targeting moieties (e.g., a moiety that targets the endoplasmic reticulum, Golgi apparatus, nucleus, or mitochondria) in the polynucleotide molecules described herein can facilitate the delivery of polynucleotides to specific sites within specific cell populations.In some embodiments, the targeting moiety contains one or more mannose carbohydrates.Mannose targets the mannose receptor, which is a 175KDa membrane-associated receptor expressed on sinusoidal hepatocytes and antigen-presenting cells (e.g., macrophages and dendritic cells). It is a highly efficient endocytosis / recycling receptor that binds and internalizes mannosylated pathogens and proteins (Lennartz et al., J. Biol. Chem. 262:9942-9944, 1987 1; J. Biol. Chem. 265:12156-62, 1990).

[0097] Some of the targeting moieties are described herein. In some embodiments, the targeting moiety is a target of insulin, insulin-like growth factor receptor 1 (IGF1R), IGF2R, insulin-like growth factor (IGF, e.g., IGF1 or IGF2), mesenchymal epithelial transition factor receptor (c-met, also known as hepatocyte growth factor receptor (HGFR)), hepatocyte growth factor (HGF), epidermal growth factor receptor (EGFR), epidermal growth factor (EGF), heregulin, fibroblast growth factor receptor (FGFR), platelet-derived growth factor receptor (PDGFR), platelet-derived growth factor (PDGF) , vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor (VEGF), tumor necrosis factor receptor (TNFR), tumor necrosis factor alpha (TNF-α), TNF-β, folate receptor (FOLR), folate, transferrin, transferrin receptor (TfR), mesothelin, Fc receptor, c-kit receptor, c-kit, integrins (e.g., α4 integrin or β-1 integrin), P-selectin, sphingosine-1-phosphate receptor-1 (S1PR), hyaluronan receptor, leukocyte function antigen-1 (LF A-1), CD4, CD11, CD18, CD20, CD25, CD27, CD52, CD70, CD80, CD85, CD95 (Fas receptor), CD106 (vascular cell adhesion molecule 1 (VCAM1)), CD166 (activated leukocyte cell adhesion molecule (ALCAM)), CD178 (Fas ligand), CD253 (TNF-related apoptosis-inducing ligand (TRAIL)), ICOS ligand, CCR2, CXCR3, CCR5, CXCL12 (stromal cell-derived factor 1 (SDF-1)), interleukin 1 (IL-1), The antibody comprises or specifically binds to a protein selected from the group consisting of IL-1ra, IL-2, IL-3, IL-4, IL-6, IL-7, IL-8, CTLA-4, MART-1, gp100, MAGE-1, ephrin (Eph) receptor, mucosal addressing cell adhesion molecule 1 (MAdCAM-1), carcinoembryonic antigen (CEA), LewisY, MUC-1, epithelial cell adhesion molecule (EpCAM), cancer antigen 125 (CA125), prostate specific membrane antigen (PSMA), TAG-72 antigen, and fragments thereof.In further embodiments, the targeting moiety comprises an erythroblastic leukemia viral oncogene homolog (ErbB) receptor (e.g., ErbB1 receptor, ErbB2 receptor, ErbB3 receptor, and ErbB4 receptor). In some embodiments, the targeting moiety contains one or more (e.g., 1-6) N-acetylgalactosamine (GalNAc). In certain embodiments, the targeting moiety contains one or more (e.g., 1-6) mannose. In other embodiments, the targeting moiety contains a folate ligand. The folate ligand has the following structure:

[0098] [ka] Certain targeting moieties may include bombesin, gastrin, gastrin releasing peptide, and tumor peptidyl targeting moieties may also be used in the targeting moiety, including, for example, steroids, carbohydrates, vitamins, and lectins. Some targeting moieties may include polypeptides, such as somatostatin or somatostatin analogs (e.g., octreotide or lanreotide), bombesin, or antibodies or antigen-binding fragments thereof. The antibodies may be of any recognized class or subclass, such as IgG, IgA, IgM, IgD, or IgE. Typical are antibodies that fall into the IgG class. The antibodies may be derived from any species according to techniques known in the art. However, typically, the antibodies are of human, murine, or rabbit origin. Furthermore, the antibodies may be polyclonal or monoclonal, but are typically monoclonal. Human or chimeric (e.g., humanized) antibodies may be used in the targeting moiety. The targeting moiety may include an antigen-binding fragment of an antibody. Such antibody fragments can include, for example, Fab', F(ab')2, Fv, or Fab fragments, single domain antibodies, ScFv, or other antigen-binding fragments. Fc fragments can also be used in targeting moieties. Such antibody fragments can be prepared, for example, by proteolytic enzyme digestion, for example, pepsin or papain digestion, reductive alkylation, or recombinant techniques. Materials and methods for preparing antibody fragments are well known to those skilled in the art. See, for example, Parham, J. Immunology, 131:2895, 1983; Lamoyi et al., J. Immunological Methods, 56:235, 1983.

[0099] Other peptides for use as targeting auxiliary moieties in the polynucleotide molecules described herein include KiSS peptides and analogs, urotensin II peptides and analogs, GnRH I and II peptides and analogs, depreotide, vapreotide, vasoactive intestinal peptide (VIP), cholecystokinin (CCK), RGD-containing peptides, melanocyte stimulating hormone (MSH) peptides, neurotensin, calcitonin, glutathione, YIGSR (leukocyte reactive peptide containing the heparin-binding domain of platelet factor-4 (PF-4) and a lysine-rich sequence, e.g., P483H), atrial natriuretic peptide (ANP), β-amyloid peptide, δ-opioid antagonists (such as ITIPP (psi)), annexin-V, endothelin, leukotriene B4 (LTB4), chemotactic peptides (e.g., N-formyl-methionyl-leucyl-phenylalanine-lysine (fMLFK)), GP They can be selected from IIb / IIIa receptor antagonists (e.g., DMP444), human neutrophil elastase inhibitors (EPI-HNE-2 and EPI-HNE-4), plasmin inhibitors, antimicrobial peptides, aptides (P280 and P274), thrombospondin receptors (including analogs such as TP-1300), bitistatin, pituitary adenylyl cyclase type I receptor (PAC1), fibrin alpha chain, peptides derived from phage display libraries, and conservative substitutions thereof.

[0100] One or more (eg, 1 to 6) targeting moieties can be linked to MOIETY or X2 in formula (V', V'', or V''') via -LinkA-.

[0101] In some embodiments, the targeting moiety comprises one or more (e.g., 1-6 or 1-3) asialoglycoprotein receptor ligands (e.g., GalNAc). In some embodiments, the asialoglycoprotein receptor ligand (e.g., GalNAc) ligand is attached to -LinkA- via an anomeric carbon (e.g., where the anomeric carbon is a carbon atom in an acetal or hemiaminal). In some embodiments, the asialoglycoprotein receptor ligand (e.g., GalNAc) comprises an anomeric carbon attached to a trivalent, tetravalent, pentavalent, or hexavalent linker, and the anomeric carbon is part of a hemiaminal group. An asialoglycoprotein receptor ligand (e.g., GalNAc) attached to a linker via a hemiaminal may produce a hybridized polynucleotide construct with superior efficacy in gene silencing compared to a hybridized polynucleotide construct having an asialoglycoprotein receptor ligand (e.g., GalNAc) attached to a linker via an acetal.

[0102] In some embodiments, the linker and the three asialoglycoprotein receptor targeting moieties (each containing GalNAc) are as shown in formula (V). In some cases, the conjugates described herein contain only one asialoglycoprotein receptor targeting moiety, and thus the conjugates contain the structure of formula (V) with any two targeting moieties removed. In some cases, the conjugates described herein contain only two asialoglycoprotein receptor targeting moieties, and thus the conjugates described herein contain the structure of formula (V) with any one of the targeting moieties removed.

[0103] [ka] wherein one of Y1 and Y2 is a nucleotide, or both Y1 and Y2 are nucleotides, and Y1 and Y2 are consecutive or adjacent nucleotides from a polynucleic acid molecule described herein.

[0104] In some embodiments, the linker and targeting moiety described herein are conjugated to the 3'-end of the sense strand (e.g., formula (V')). In some embodiments, the linker and targeting moiety described herein are conjugated to the 5'-end of the sense strand (e.g., as shown in formula (V'') or (V''')). In some embodiments, the linker and targeting moiety described herein are conjugated to the 3'-end of the antisense strand (e.g., formula (V')). In some embodiments, the linker and targeting moiety described herein are conjugated to the 5'-end of the antisense strand (e.g., as shown in formula (V'') or (V''').

[0105] [ka] During the ceremony, Z in formula (V') corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0106] [ka] During the ceremony, Z in formula (V'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V'') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0107] [ka] During the ceremony, Z in formula (V''') is a moiety that corresponds to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (V''') is adenine, uracil, guanine, cytosine, thymine, abasic, or others.

[0108] In some examples, the 3' end of the passenger / sense strand from Table 1, Table 2, or Table 3 is conjugated with X2-GalNAc (see formula (V) or (V')). In some examples, the 5' end of the passenger / sense strand from Table 1, Table 2, or Table 3 is conjugated with X2-GalNAc (see formula (V), (V''), or (V'')). In some examples, a nucleic acid within the passenger / sense strand (not the 5' or 3' end) of Table 1, Table 2, or Table 3 is conjugated with X2-GalNAc (see formula (V)). In some examples, the 3' end of the guide / antisense strand from Table 1, Table 2, or Table 3 is conjugated with X2-GalNAc (see formula (V) or (V')). In some examples, the 5' end of the guide / antisense strand from Table 1, Table 2, or Table 3 is conjugated with X2-GalNAc (see formula (V), (V''), or (V'')). In some examples, a nucleic acid within the guide / antisense strand (not the 5' or 3' end) of Table 1, Table 2, or Table 3 is conjugated with X2-GalNAc (see formula (V)).

[0109] One or more (e.g., 1-6 or 1-3) endosomal escape moieties can be attached to the polynucleotide constructs or hybridized polynucleotide constructs disclosed herein as auxiliary moieties. Exemplary endosomal escape moieties include chemotherapeutic agents (e.g., quinolones such as chloroquine); fusogenic lipids (e.g., dioleoylphosphatidyl-ethanolamine (DOPE)); and polymers such as polyethyleneimine (PEI); poly(β-amino esters); polypeptides such as polyarginine (e.g., octaarginine) and polylysine (e.g., octalysine); proton sponges, viral capsids, and peptide transduction domains described herein. For example, fusion peptides may be derived from the M2 protein of influenza A virus; peptide analogs of influenza virus hemagglutinin; HEF protein of influenza C virus; filovirus transmembrane glycoproteins; rabies virus transmembrane glycoproteins; vesicular stomatitis virus transmembrane glycoprotein (G); Sendai virus fusion protein; Semliki forest virus transmembrane glycoprotein; human respiratory syncytial virus (RSV) fusion protein; measles virus fusion protein; Newcastle disease virus fusion protein; Visna virus fusion protein; murine leukemia virus fusion protein; HTL virus fusion protein; and simian immunodeficiency virus (SIV) fusion protein, etc. Other moieties that can be used to promote endosomal escape are described by Dominska et al., Journal of Cell Science, 123(8):1183-1189, 2010. Specific examples of endosomal escape moieties, including moieties suitable for conjugation to the hybridized polynucleotide constructs disclosed herein, are provided, for example, in WO2015 / 188197, the disclosures of which are incorporated herein by reference.

[0110] One or more endosomal escape moieties (e.g., 1 to 6 or 1 to 3) can be attached to MOIETY or X2 in Formula (V', V'', or V'') via -LinkA- as described herein.

[0111] One or more (e.g., 1-6 or 1-3) cell penetrating peptides (CPPs) can be attached to the polynucleotide constructs or hybridized polynucleotide constructs disclosed herein as auxiliary moieties. The CPPs can be bioreversibly linked to the hybridized polynucleotides via disulfide bonds as disclosed herein. Thus, upon delivery to a cell, the CPPs can be cleaved intracellularly, for example, by intracellular enzymes (e.g., protein disulfide isomerase, thioredoxin, or thioesterase), thereby releasing the polynucleotides.

[0112] CPPs are known in the art (e.g., TAT or Arg8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, pp. 43-51). Specific examples of CPPs that include moieties suitable for conjugation to the hybridized polynucleotide constructs disclosed herein are provided, for example, in WO2015 / 188197, the disclosures of which are incorporated herein by reference.

[0113] CPPs are positively charged peptides that can facilitate the delivery of biological cargo into cells. The cationic charge of CPPs is thought to be essential for their function. Furthermore, transduction of these proteins does not appear to be affected by cell type, and they can efficiently transduce nearly all cells in culture without apparent toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998). In addition to full-length proteins, CPPs have also been shown to be effective in transducing DNA (Abu-Amer, supra), antisense polynucleotides (Astriab-Fisher et al., Pharm. Res. 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11:762-71, 2000), and inorganic 40 nm iron particles (Dodd et al., J. Immunol. Methods 1999). 256:89-105, 2001; Wunderbaldinger et al., Bioconjug. Chem. 13:264-8, 2002; Lewin et al., Nat. Biotechnol. 18:410-4, 2000; Josephson et al., Bioconjug. Chem. 10:186-91, 1999) have been used successfully to induce cellular uptake of various proteins, suggesting considerable flexibility in particle size in this process.

[0114] In one embodiment, the CPP useful in the methods and compositions described herein comprises a peptide characterized by substantial alpha helicity. It has been discovered that gene transfer is optimized when the CPP exhibits significant alpha helicity. In another embodiment, the CPP comprises a sequence that comprises basic amino acid residues that are substantially aligned along at least one face of the peptide. The CPP described herein can be a naturally occurring peptide or a synthetic peptide.

[0115] One or more (e.g., 1 to 6 or 1 to 3) cell penetrating peptides can be attached to MOIETY or X2 in Formula (V', V'', or V'') via -LinkA- as described herein.

[0116] The polynucleotide constructs and hybridized polynucleotide constructs disclosed herein may also include covalently attached neutral polymer-based auxiliary moieties, including poly(C1-6 alkylene oxides), such as poly(ethylene glycol) and poly(propylene glycol), and copolymers thereof, such as diblock and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinylpyrrolidone), poly(ethyloxazoline), poly(alkyl acrylates), poly(acrylamide), poly(N-alkylacrylamide), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymer, and poly(N,N-dialkylacrylamide). Exemplary polymeric auxiliary moieties can have molecular weights of less than (e.g., greater than) 100 Da, 300 Da, 500 Da, 1000 Da, or 5000 Da. Other polymers are known in the art.

[0117] One or more (e.g., 1 to 6 or 1 to 3) polymers can be attached to MOIETY or X2 in formula (V', V'', or V'') via -LinkA- as described herein.

[0118] Conjugation Linker In some embodiments, the polynucleic acid molecules described herein have the formula (I):

[0119] [ka] or a salt or stereoisomer thereof, During the ceremony, each X 1 are independently O or S; each X 2 are independently O, S, NH, or a bond; MOIETY is an optionally substituted C 2-10 Alkane-tetrayl, or -M 1 -M 2 -M 3 -, where each M 1 and each M 3 are independently absent or optionally substituted C 1-6 alkylene, M 2 is optionally replaced by C 3-9 Heterocycle-tetrayl, optionally substituted C 6-10 Arene-tetrayl or optionally substituted C 3-8 is a cycloalkane-tetrayl; Each R 1 and each R 2 independently, at least one R 1 or at least one R 2 is the conjugation moiety or -LinkA(-T) p if so, H, optionally substituted C 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, a conjugation moiety, or -LinkA(-T) p and Each R 3 are independently H, optionally substituted C 1-16 Alkyl, optionally substituted C 2-16 Heteroalkyl, optionally substituted C 2-16 Alkenyl, optionally substituted C 2-16 Alkynyl, optionally substituted (C 1-9 Heterocyclyl)-C 1-6 -alkyl optionally substituted (C 6-10 Aryl)-C1-6 -alkyl, optionally substituted (C 3-8 Cycloalkyl)-C 1-6 -Alkyl, a conjugation moiety, or -LinkA(-T) p and R 4 is H, optionally substituted C 1-6 Alkyl, -LinkA(-T) p , or -Sol, each LinkA is independently a polyvalent linker (e.g., comprising -C(O)-N(H)- (e.g., at least one polyvalent linker comprising -C(O)-N(H)- attached to T)); Each T is independently an auxiliary part Sol is the solid support; m is an integer from 1 to 6; each n is independently 0 or 1; Each p is independently an integer from 1 to 6; q is an integer from 0 to 3; At least one group of formula (I) can be linked to the 5' terminus, 3' terminus, internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate of the polynucleotide. When at least one group of formula (I) is linked to the internucleoside phosphate, internucleoside phosphorothioate, or internucleoside phosphorodithioate, q is 0. The polynucleotide construct contains no more than one Sol.

[0120] The group -LinkA- can include 0 to 3 polyvalent monomers (e.g., optionally substituted C1-6 alkane-triyl, optionally substituted C1-6 alkane-tetrayl, or a trivalent nitrogen atom) and one or more (e.g., 1 to 40) divalent monomers, each of which is independently an optionally substituted C1-6 alkylene, optionally substituted C2-6 alkenylene, optionally substituted C2-6 alkynylene, optionally substituted C optionally substituted C1-9 heteroarylene having 1 to 4 heteroatoms selected from N, O and S; optionally substituted C1-9 heterocyclylene having 1 to 4 heteroatoms selected from N, O and S; imino; optionally substituted N, O, or S(O)m (wherein m is 0, 1, or 2). In some embodiments, each monomer is independently an optionally substituted C1-6 alkylene, optionally substituted C3-8 cycloalkylene, optionally substituted C3-8 cycloalkenylene, optionally substituted C6-14 arylene, optionally substituted C1-9 heteroarylene having 1-4 heteroatoms selected from N, O, and S, optionally substituted C1-9 heterocyclylene having 1-4 heteroatoms selected from N, O, and S, imino, optionally substituted N, O, or S(O)m, where m is 0, 1, or 2 (e.g., m is 2). In certain embodiments, each monomer is independently an optionally substituted C1-6 alkylene, an optionally substituted C3-8 cycloalkylene, an optionally substituted C3-8 cycloalkenylene, an optionally substituted C6-14 arylene, an optionally substituted C1-9 heteroarylene having 1-4 heteroatoms selected from N, O, and S, an optionally substituted C1-9 heterocyclylene having 1-4 heteroatoms selected from N, O, and S, an optionally substituted N, O, or S(O)m, where m is 0, 1, or 2 (e.g., m is 2).The non-bioreversible linker connecting the auxiliary moiety to the conjugate moiety or its reaction product can comprise 2 to 500 (e.g., 2 to 300 or 2 to 200) such monomers. The group -LinkA- can comprise a poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene oxide), polybutylene oxide, poly(tetramethylene oxide), and diblock or triblock copolymers thereof). In some embodiments, the non-bioreversible linker comprises a polyethylene oxide (e.g., a poly(ethylene oxide) having a molecular weight of less than 1 kDa).

[0121] The group -LinkA(-T)p in formula (I) can be prepared by the processes described in the following section. In some examples, -LinkA(-T)p is a group of formula (II):

[0122] [ka] and During the ceremony, Each s is independently an integer from 0 to 20 (e.g., 0 to 10), where the repeat units are the same or different; Q 1 is a conjugation linker (e.g., [-Q 3 -Q 4 -Q 5 ] s -Q C -, where Q C is optionally replaced by C 2-12 Heteroalkylene (e.g., heteroalkylene containing -C(O)-N(H)-, -N(H)-C(O)-, -S(O)-N(H)-, or -N(H)-S(O)-), optionally substituted C 1-12 Thioheterocyclylenes (e.g.

[0123] [ka] ), optionally replaced by C 1-12Heterocyclylene (e.g., 1,2,3-triazole-1,4-diyl or

[0124] [ka] ), cyclobut-3-ene-1,2-dione-3,4-diyl, or pyrid-2-yl hydrazone; Q 2 When p is 1, the linear base (e.g., [-Q 3 -Q 4 -Q 5 ] s -), and when p is an integer of 2 to 6, a branched group (e.g., [-Q 3 -Q 4 -Q 5 ] s -Q 7 ([-Q 3 -Q 4 -Q 5 ] s -(Q 7 ) p1 ) p2 where p1 is 0 or 1, and p2 is 0, 1, 2, or 3; Each Q 3 and each Q 6 are independently absent, -CO-, -NH-, -O-, -S-, -SO2-, -OC(O)-, -COO-, -NHC(O)-, -C(O)NH-, -CH2-, -CH2NH-, -NHCH2-, -CH2O-, or -OCH2-; Each Q 4 are independently absent or optionally substituted C 1-12 Alkylene, optionally substituted C 2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 Heteroalkylene, optionally substituted C 6-10 Arylene, optionally substituted C 1-9 Heteroarylene or optionally substituted C 1-9 is a heterocyclylene, Each Q5 are independently absent, -CO-, -NH-, -O-, -S-, -SO2-, -CH2-, -C(O)O-, -OC(O)-, -C(O)NH-, -NH-C(O)-, -NH-CH(R a )-C(O)-, or -C(O)-CH(R a )-NH-, Each Q 7 are independently optionally substituted C 1-6 Alkane-triyl, optionally substituted C 1-6 Alkane-tetrayl, optionally substituted C 2-6 Heteroalkane-triyl, or optionally substituted C 2-6 Heteroalkane-tetrayl, and Each R a is independent, Q 3 , Q 4 , and Q 5 At least one of, if present, is H or an amino acid side chain.

[0125] In some embodiments, each Q 4 are independently absent or optionally substituted C 1-12 Alkylene, optionally substituted C 2-12 Alkenylene, optionally substituted C 2-12 Alkynylene, optionally substituted C 2-12 Heteroalkylene, or optionally substituted C 1-9 In certain embodiments, s is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0126] Thus, in formula (II), LinkA may contain a single branch point when each p1 is 0, or multiple branch points when at least one p1 is 1.

[0127] In formula (II), Q 1 may be -O-QL-QC-, where Q L is optionally replaced by C 2-12Heteroalkylene, optionally substituted C 1-12 Alkylene, or -(optionally substituted C 1-6 alkylene)-(optionally substituted C 6-10 In some embodiments, Q is L is optionally replaced by C 2-12 Heteroalkylene or optionally substituted C 1-12 In formula (II), Q is an alkylene. C teeth,

[0128] [ka] may be also possible.

[0129] In formula (II), Q 2 is expressed as [-Q 3 -Q 4 -Q 5 ] s -, where Q 3 , Q 4 , and Q 5 is as defined for formula (II). Alternatively, Q 2 is [-Q 3 -Q 4 -Q 5 ] s -Q 7 ([-Q 3 -Q 4 -Q 5 ] s -(Q 7 ) p1 ) p2 wherein each Q 7 are independently optionally substituted C 1-6 Alkane-triyl, optionally substituted C 1-6 Alkane-tetrayl, optionally substituted C 2-6 Heteroalkane-triyl, or optionally substituted C 2-6 Heterialcane-tetrayl, During the ceremony, p1 is 0 or 1, p2 is 0, 1, 2, or 3 wherein when p1 is 0, LinkA is a trivalent or tetravalent linker, and when p1 is 1, LinkA is a tetravalent, pentavalent or hexavalent linker. In certain embodiments, p1 is 0. In some embodiments, Q7 is

[0130] [ka] It is.

[0131] Compounds that can be used to prepare the group -LinkA(-T)p in formula (I) are described herein, as well as in WO2015 / 188197. Non-limiting examples of -LinkA are:

[0132] [ka]

[0133] [ka]

[0134] [ka] During the ceremony, R 18 is the bond to the MOIETY, Each R 19 is independently a bond to an auxiliary moiety, Each m5 is independently an integer from 1 to 20; Each m6 is independently an integer from 1 to 10; m7 is an integer from 1 to 6, and each X 6 is independently O or S. In formula (II), the formula [-Q 3 -Q 4 -Q 5 ] s -Q C -,-Q 2 ([-Q 3 -Q 4 -Q 5 ] s -Q 6 -T) p The conjugation linker is

[0135] [ka]

[0136] [ka] During the ceremony, R 20 Q 1 Q in C is a bond to Each R 19is independently a bond to an auxiliary moiety, Each m5 is independently an integer from 1 to 20; Each m6 is independently an integer from 1 to 10; m7 is an integer from 1 to 6, and each X 6 is independently O or S.

[0137] In some aspects, the linkers described herein are cleavable. In some aspects, the linkers described herein are non-cleavable.

[0138] In some embodiments, the polynucleic acid molecules described herein have the formula (IV):

[0139] [ka] and wherein the sense strand or the antisense strand is bound to at least one group of During the ceremony, At least one of Y1 or Y2 is a nucleotide from this polynucleic acid molecule.

[0140] In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of one of the strands of the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule. In some examples, Y1 is the last nucleotide on the 3' end or the first nucleotide on the 5' end of the sense strand of the polynucleic acid molecule, and Y2 is a 3-hydroxy-propoxy group. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of one of the strands of the polynucleic acid molecule. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule. In some examples, Y2 is the first nucleotide on the 5' end or the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule, and Y1 is a 3-hydroxy-propoxy group. In other examples, Y1 and Y2 are two consecutive nucleotides in one of the strands of the polynucleic acid molecule.

[0141] In some embodiments, a targeting moiety described herein is conjugated to the 3' end of the sense strand (e.g., Formula (IV')). In some embodiments, a targeting moiety described herein is conjugated to the 5' end of the sense strand (e.g., Formula (IV'') or Formula (IV''')). In some embodiments, a targeting moiety described herein is conjugated to the 3' end of the antisense strand (e.g., Formula (IV')). In some embodiments, a targeting moiety described herein is conjugated to the 5' end of the antisense strand (e.g., Formula (IV'') or Formula (IV''')).

[0142] [ka] During the ceremony, Z in formula (IV') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV') is adenine, uracil, guanine, cytosine, thymine, abasic, or other.

[0143] [ka] During the ceremony, Z in formula (IV'') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV'') is adenine, uracil, guanine, cytosine, thymine, abasic, or other.

[0144] [ka] During the ceremony, Z in formula (IV''') is a moiety corresponding to one of the sugar modifications described herein (e.g., -H, -OH, -O-methyl, -F, or -O-methoxyethyl), and R in formula (IV''') is adenine, uracil, guanine, cytosine, thymine, abasic, or other.

[0145] Pharmaceutical Compositions Delivery of the polynucleotide molecules described herein can be accomplished by contacting cells with constructs using a variety of methods. In certain aspects, the polynucleotide molecules described herein are formulated with various excipients, vehicles, and carriers, as described more fully elsewhere herein.

[0146] The pharmaceutical compositions described herein can be prepared to contain the hybridized polynucleotide constructs disclosed herein in a suitable form for administration to a subject using carriers, excipients, and vehicles. Frequently used excipients include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk proteins, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycol, and solvents such as sterile water, alcohol, glycerol, and polyhydric alcohols. Intravenous vehicles include fluid and nutrient replenishers. Preservatives include antibacterial agents, antioxidants, chelating agents, and inert gases. Other pharmaceutically acceptable vehicles include non-toxic excipients, including aqueous solutions, salts, preservatives, buffers, etc., as described, for example, in Remington: The Science and Practice of Pharmacy, 21st Ed., Gennaro, Ed., Lippencott Williams & Wilkins (2005), and The United States Pharmacopeia: The National Formulary (USP 36 NF31), 2013. The pH and exact concentration of various components of the pharmaceutical composition are adjusted according to routine skills in the art. See The Pharmacological Basis for Therapeutics, by Goodman and Gilman et al.

[0147] The pharmaceutical composition described herein can be administered locally or systemically.The therapeutically effective amount varies according to factors such as the degree of infection in the subject, the age, sex and weight of the individual.The administration regimen can be adjusted to provide optimal therapeutic response.For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the exigencies of the treatment situation.

[0148] The pharmaceutical composition can be administered in any convenient manner, such as by injection (e.g., subcutaneous, intravenous, intraorbital, etc.), oral administration, ocular application, inhalation, topical application, or rectal administration. Depending on the route of administration, the pharmaceutical composition can be coated with a material to protect the pharmaceutical composition from the action of enzymes, acids, and other natural conditions that may inactivate the pharmaceutical composition. The pharmaceutical composition can also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations can contain a preservative to prevent the growth of microorganisms.

[0149] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The compositions are typically sterile and fluid to the extent that easy injectability exists. Typically, the compositions are stable under the conditions of manufacture and storage and are preserved against the contaminating action of microorganisms such as bacteria and fungi. The vehicle can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride, are used in the compositions. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0150] Sterile injectable solutions can be prepared by incorporating the required amount of the pharmaceutical composition in a suitable solvent with one or a combination of the above listed ingredients as required, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the pharmaceutical composition into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those listed above.

[0151] For ease of administration and uniformity of dosage, it is particularly advantageous to formulate parenteral compositions in dosage unit form.As used herein, dosage unit refers to a physically separate unit suitable as a unitary dosage for the subject to be treated, and each unit containing a given amount of pharmaceutical composition is calculated to produce a desired therapeutic effect in association with a required pharmaceutical vehicle.The specification of dosage unit is related to the characteristics of the pharmaceutical composition and the specific therapeutic effect to be achieved.The main pharmaceutical composition is formulated into an acceptable dosage unit together with a suitable pharmaceutically acceptable vehicle for convenient and effective administration in an effective amount.For a composition containing a supplementary active ingredient, the dosage is determined with reference to the usual dosage and mode of administration of the ingredient.

[0152] The pharmaceutical composition can be orally administered, for example, in a carrier, in a unit dosage form, for example, enteric coated. The pharmaceutical composition and other ingredients can also be enclosed in a hard or soft shell gelatin capsule or compressed into a tablet. For oral therapeutic administration, the pharmaceutical composition can be incorporated with excipients and used in the form of ingestible tablets, troches, capsules, pills, wafers, and the like. Such compositions and preparations should contain at least 1% by weight of the active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be about 5% to about 80% of the weight of the unit. Tablets, troches, pills, capsules, etc. may also contain: binders such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; disintegrating agents such as corn starch, potato starch, alginic acid; lubricants such as magnesium stearate; and sweeteners such as sucrose, lactose, or saccharin, or flavoring agents such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, the dosage unit form may contain a liquid carrier in addition to the above types of materials. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both. Syrup or elixir may contain the drug, sucrose as a sweetener, methyl and propylparabens as preservatives, a dye, and flavoring agents such as cherry or orange flavoring. Any material used in preparing any dosage unit form should be of pharma- ceutically acceptable purity and substantially non-toxic in the amounts used.In addition, pharmaceutical compositions can be incorporated into sustained-release preparations and formulations.

[0153] The pharmaceutical compositions described herein may include one or more permeation enhancers that enhance the bioavailability of the polynucleotide molecules described herein. WO2000 / 67798, Muranishi, 1990, Crit. Rev. Ther. Drug Carrier Systems, 7, 1, Lee et al., 1991, Crit. Rev. Ther. Drug Carrier Systems, 8, 91 are incorporated herein by reference in their entirety. In some embodiments, the permeation enhancer is for enteral administration. In some embodiments, the permeation enhancer is for transdermal administration. In some embodiments, the permeation enhancer is one that promotes crossing the blood-brain barrier. In some embodiments, the permeation enhancer improves permeability in oral, nasal, buccal, pulmonary, vaginal, or corneal delivery models. In some embodiments, the permeation enhancer is a fatty acid or a derivative thereof. In some embodiments, the permeation enhancer is a surfactant or a derivative thereof. In some embodiments, the permeation enhancer is a bile salt or a derivative thereof. In some embodiments, the permeation enhancer is a chelating agent or a derivative thereof. In some embodiments, the permeation enhancer is a non-chelating non-surfactant or derivative thereof. In some embodiments, the permeation enhancer is an ester or derivative thereof. In some embodiments, the permeation enhancer is an ether or derivative thereof. In some specific embodiments, the permeation enhancer is arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicapric acid, tricapric acid, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or monoglyceride, diglyceride, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the permeation enhancer is sodium caprate (C10).In some particular embodiments, the permeation enhancer is chenodeoxycholic acid (CDCA), ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glycolic acid, glycolic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, or sodium glycodihydrofusidate. In some particular embodiments, the permeation enhancer is polyoxyethylene-9-lauryl ether or polyoxyethylene-20-cetyl ether.

[0154] For the polynucleotide molecules described herein, suitable pharma- ceutically acceptable salts include: (i) salts formed with cations, such as sodium, potassium, ammonium, magnesium, calcium, and the like, and polyamines, such as spermine and spermidine; (ii) acid addition salts formed with inorganic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like; (iii) salts formed with organic acids, such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like.

[0155] The hybridized polynucleotide constructs described herein may not require the use of excipients for delivery to target cells, but the use of excipients may be advantageous in some embodiments. Thus, for delivery to target cells, the hybridized polynucleotide molecules described herein can be non-covalently bound to an excipient to form a complex. Excipients can be used to change biodistribution after delivery, to enhance uptake, to increase the half-life or stability of the strands in the hybridized polynucleotide constructs (e.g., to improve nuclease resistance), and / or to increase targeting to specific cell or tissue types.

[0156] Standards include, for example, condensing agents (e.g., agents capable of attracting or binding nucleic acids via ionic or electrostatic interactions); fusogenic agents (e.g., agents capable of fusing and / or transporting cell membranes); proteins that target specific cell or tissue types (e.g., thyrotropin, melanotropin, lectins, glycoproteins, surfactant protein A, or any other protein); lipids; lipopolysaccharides; lipid micelles or liposomes (e.g., formed from phospholipids such as phosphotidylcholine, fatty acids, glycolipids, ceramides, glycerides, cholesterol, or any combination thereof); nanoparticles (e.g., silica, lipid, carbohydrate, or other pharma- ceutically acceptable polymer nanoparticles); polyplexes formed from cationic polymers and anionic agents (e.g., CROs), where exemplary cationic polymers include polyamines (e.g., polylysine, polyarginine, polyamidoamine, and polyethyleneimine); cholesterol; a dendrimers (e.g., polyamidoamine (PAMAM) dendrimers); serum proteins (e.g., human carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); lipids; synthetic polymers (e.g., polylysine (PLL), polyethyleneimine, poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolic acid) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HM poly(PA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, pseudopeptide-polyamine, peptidomimetic polyamine, or polyamine; cationic moieties (e.g., cationic lipids, cationic porphyrins, quaternary salts of polyamines, or α-helical peptides); polyvalent sugars (e.g., polyvalent lactose, polyvalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine, polyvalent mannose, or polyvalent fucose);a vitamin (e.g., vitamin A, vitamin E, vitamin K, vitamin B, folic acid, vitamin B12, riboflavin, biotin, or pyridoxal); cofactors; or drugs that disrupt the cytoskeleton and increase uptake (e.g., taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin);

[0157] Other therapeutic agents described herein may be included in the pharmaceutical compositions described herein in combination with the polynucleotide molecules described herein.

[0158] Treatment In some aspects, methods of modulating expression of the PCSK9 gene in a subject are described herein, the methods comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, thereby modulating expression of the PCSK9 gene in the subject.

[0159] In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 10% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 20% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 30% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 40% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 50% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 60% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 70% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 80% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about or at least 90% compared to a negative control. In some specific embodiments, the methods described herein reduce the expression of the PCSK9 gene in a subject by about 100% compared to a negative control.

[0160] In some particular embodiments, the methods described herein achieve an IC50 value of about 5 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 10 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 15 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 20 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 25 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 30 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 35 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 40 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 45 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 50 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 55 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 60 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 65 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 70 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 75 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 80 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 85 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 90 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 95 nM. In some particular embodiments, the methods described herein achieve an IC50 value of about 100 nM.

[0161] In some aspects, described herein are methods of modulating LDL in a subject in need thereof, the methods comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleic acid molecule described herein, the polynucleic acid molecule conjugate described herein, or the pharmaceutical composition described herein reduces expression of the PCSK9 gene in the subject.

[0162] In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 10% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 20% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 30% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 40% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 50% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 60% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 70% compared to a negative control. In some specific embodiments, the methods described herein reduce the LDL level in a subject by about or at least 80% compared to a negative control. In some specific embodiments, the methods described herein reduce LDL levels in a subject by about or at least 90% compared to a negative control. In some specific embodiments, the methods described herein reduce LDL levels in a subject by about 100% compared to a negative control.

[0163] In some aspects, the subject undergoing the methods described herein suffers from hypercholesterolemia. In some specific embodiments, the subject undergoing the methods described herein suffers from familial hypercholesterolemia. In other aspects, the subject undergoing the methods described herein suffers from other high cholesterol-related diseases. In other aspects, the subject undergoing the methods described herein suffers from neuroinflammation. In other aspects, the subject undergoing the methods described herein suffers from Alzheimer's disease. In other aspects, the subject undergoing the methods described herein suffers from AUD. In other aspects, the subject undergoing the methods described herein suffers from stroke.

[0164] In some aspects, described herein are methods of modulating cholesterol in a subject in need thereof, the methods comprising administering to the subject a polynucleic acid molecule described herein, a polynucleic acid molecule conjugate described herein, or a pharmaceutical composition described herein, wherein the polynucleic acid molecule described herein, the polynucleic acid molecule conjugate described herein, or the pharmaceutical composition described herein reduces expression of the PCSK9 gene in the subject.

[0165] In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 10% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 20% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 30% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 40% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 50% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 60% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 70% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 80% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about or at least 90% compared to a negative control. In some specific embodiments, the methods described herein reduce cholesterol levels in a subject by about 100% as compared to a negative control.

[0166] In some aspects, the subject undergoing the methods described herein suffers from hypercholesterolemia. In some specific embodiments, the subject undergoing the methods described herein suffers from familial hypercholesterolemia. In other aspects, the subject undergoing the methods described herein suffers from other high cholesterol-related diseases. In other aspects, the subject undergoing the methods described herein suffers from neuroinflammation. In other aspects, the subject undergoing the methods described herein suffers from Alzheimer's disease. In other aspects, the subject undergoing the methods described herein suffers from AUD. In other aspects, the subject undergoing the methods described herein suffers from stroke. EXAMPLES

[0167] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the claims provided herein.

[0168] Example 1 - Testing of PCSK9 siRNA in non-human primates In non-human primate studies, five PCSK9 siRNAs (shown as "SRS-001" through "SRS-005" from Table 1) were tested using a known siRNA targeting PCSK9 (shown as "SRS-006" in Table 1) as a benchmark.

[0169] [Table 2]

[0170] As shown in Figure 1A-1J, SRS-001-SRS-005 were tested with SRS-006 as a control, and serum PCSK9 expression levels, LDL-c levels, total cholesterol levels, triglyceride levels, and HDL-c levels were monitored and quantified compared to pre-treatment levels. Other clinical markers (e.g., body weight, food intake, total energy intake, clinical chemistry, complete blood count (CBC), animal training, cageside observation, and clinical behavior review) were also monitored. Specifically, clinical chemistry was profiled using the following parameters: GLU, INS, Cr, BUN, AST, ALT, ALB, BIL, Ca, PHOS, ALP, GGT, TP, CO2, CK, Na, K, CL, GLB, and A / G. CBC was performed for WBC, RBC, HGB, HCT, MCV, MCH, MCHC, PLT, RDW-CV, MPV, NEUT, NEUT%, LYMP, LYMP%, MONO, MONO%, EO, EO%, BASO, and BASO%. Exemplary items in the clinical behavior review included general appearance, respiratory condition, urinary condition, dental condition, eye condition, digestive system condition, pubic and perineal condition, skin and hair condition, behavior and neurological signs, oral condition, mouth condition, ear condition, nose condition, feeding condition, muscle condition, back condition, joint condition, bone condition, and limb condition. Reductions in serum PCSK9 protein levels, LDL-c levels, and total cholesterol levels were observed. Specifically, SRS-001 and SRS-002 effectively reduced PCSK9 protein levels, LDL-c levels, and total cholesterol levels.

[0171] Example 2 - In vitro efficacy of siRNA targeting PCSK9 Thaw primary non-human hepatocytes from BioreclamationIVT and plate them onto collagen-coated 96-well plates at 5.4 x 10 cells per well. 5Hepatocytes were plated at a density of 100 / ml cells. Conjugated siRNA was used to treat hepatocytes in the absence of transfection reagent (free uptake). Cells were treated with siRNA at concentrations of 10 nM, 100 nM, or 500 nM. Cells were incubated at 37° C., 5% CO2 for 48 hours. At the end of the incubation period, cells were lysed, mRNA was isolated, and expression of target genes was measured using qPCR and normalized to housekeeping genes using standard protocols.

[0172] The sense and antisense strand modifications of the siRNAs tested are listed in Table 2. The in-vitro potencies of the siRNAs are listed in Table 3.

[0173] [Table 3-1]

[0174] [Table 3-2]

[0175] [Table 3-3]

[0176] [Table 3-4]

[0177]

Table 3-5

[0178]

Table 3-6

[0179]

Table 3-7

[0180]

Table 3-8

[0181]

Table 3-9

[0182]

Table 4-1

[0183]

Table 4-2

[0184]

Table 4-3

[0185] Although preferred embodiments of the present disclosure have been described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein may be used in carrying out the present disclosure. The following claims define the scope of the present disclosure, and it is intended that methods and configurations within the scope of these claims and their equivalents be covered thereby.

Claims

1. A polynucleic acid molecule for regulating expression of the proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene, the polynucleic acid molecule comprising: (a) an antisense strand of UUACAAAGCAAAACAGGUCUAG (SEQ ID NO: 2) and a sense strand of AGACCUGUUUUGCUUUUGUAA (SEQ ID NO: 1); (b) an antisense strand of UUUCAAGUUACAAAAGCAAAACA (SEQ ID NO: 4) and a sense strand of UUUUGCUUUUGUAACUUGAAA (SEQ ID NO: 3); (c) an antisense strand of AAUAUCUUCAAGUUACAAAGCA (SEQ ID NO: 6) and a sense strand of CUUUUGUAACUUGAAGAUAUU (SEQ ID NO: 5); (d) an antisense strand of AUUAAUAAAAAAUGCUACAAAACC (SEQ ID NO: 8) and a sense strand of UUUUGUAGCAUUUUUAUUAAU (SEQ ID NO: 7); or (e) A polynucleic acid molecule comprising an antisense strand of AUAUUAAUAAAAAAUGCUACAAAA (SEQ ID NO: 10) and a sense strand of UUGUAGCAUUUUUAUUAAUAUAU (SEQ ID NO: 9).

2. A polynucleic acid molecule as described in claim 1, wherein the sense strand comprises '5-nsnsnnnnnNfnNfnNfnnnnnnnnnnnn-3' and the antisense strand comprises '5-nsNfsnnnnnnnnnnnNfnNfnNfnnnnnnnsnsn-3', wherein 'Nf' means 2'-fluoro modified nucleotide, 'n' means 2'-O-methyl modified nucleotide, and 's' means 3'-phosphorothioate.

3. The polynucleic acid molecule described in claim 2, wherein the sense strand comprises SEQ ID NO: 13, 15, 17, 19, or 21.

4. The polynucleic acid molecule described in claim 3, wherein the antisense strand comprises SEQ ID NO: 14, 16, 18, 20, or 22.

5. The polynucleic acid molecule (a) the antisense strand of usUfsacaaaagcaAfaAfcAfggucusasg (SEQ ID NO: 14) and the sense strand of asgsaccuGfuUfuUfgcuuuuguaa (SEQ ID NO: 13); (b) the antisense strand of usUfsucaaguuacAfaAfaGfcaaaascsa (SEQ ID NO: 16) and the sense strand of ususuugcUfuUfuGfuaacuugaaa (SEQ ID NO: 15); (c) the antisense strand of asAfsuaucuucaaGfuUfaCfaaaagscsa (SEQ ID NO: 18) and the sense strand of csusuuuugUfaAfcUfugaagauauu (SEQ ID NO: 17); (d) the antisense strand of asUfsuaauaaaaaUfgCfuAfcaaaascsc (SEQ ID NO: 20) and the sense strand of ususuuguAfgCfaUfuuuuauuaau (SEQ ID NO: 19); or (e) the polynucleic acid molecule of claim 4, comprising an antisense strand of asUfsauuaauaaaAfaUfgCfuacaasasa (SEQ ID NO: 22) and a sense strand of ususguagCfaUfuUfuuauuaauauau (SEQ ID NO: 21).

6. The polynucleic acid molecule (a) the antisense strand of usUfsacaaaagcaAfaAfcAfggucusasg (SEQ ID NO: 14) and the sense strand of asgsaccuGfuUfuUfgcuuuuguaa (SEQ ID NO: 13); (b) the antisense strand of usUfsucaaguuacAfaAfaGfcaaaascsa (SEQ ID NO: 16) and the sense strand of ususuugcUfuUfuGfuaacuugaaa (SEQ ID NO: 15); (c) the antisense strand of asAfsuaucuucaaGfuUfaCfaaaagscsa (SEQ ID NO: 18) and the sense strand of csusuuugUfaAfcUfugaagauauu (SEQ ID NO: 17); (d) the antisense strand of asUfsuaauaaaaaUfgCfuAfcaaaascsc (SEQ ID NO: 20) and the sense strand of ususuuguAfgCfaUfuuuuauuaau (SEQ ID NO: 19); or (e) a polynucleic acid molecule according to claim 4, consisting of an antisense strand of asUfsauuaauaaaAfaUfgCfuacaasasa (SEQ ID NO: 22) and a sense strand of ususguagCfaUfuUfuuauuaauauau (SEQ ID NO: 21).

7. A polynucleic acid molecule conjugate for regulating expression of the proprotein convertase subtilisin / kexin type 9 serine protease (PCSK9) gene, comprising a polynucleic acid molecule described in any one of claims 1 to 6 and an asialoglycoprotein receptor targeting moiety.

8. The polynucleic acid molecule conjugate of claim 7, wherein the polynucleic acid molecule and the asialoglycoprotein receptor targeting moiety are linked by a linker.

9. The linker has the following formula (IV): 【Chemical 1】 Including, wherein at least one of Y1 and Y2 is a nucleotide in said polynucleic acid molecule. The polynucleic acid molecule conjugate of claim 8.

10. The polynucleic acid molecule conjugate of claim 9, wherein Y1 is the last nucleotide on the 3' end of the sense strand of the polynucleic acid molecule.

11. The polynucleic acid molecule conjugate of claim 7, wherein the asialoglycoprotein receptor targeting moiety comprises N-acetylgalactosamine (GalNAc).

12. The polynucleic acid molecule of claim 1, wherein the linker and the asialoglycoprotein receptor targeting moiety having the last nucleotide on the 3′-terminus of the sense strand are represented by the formula (V′): 【Chemistry 2】 As shown in The polynucleic acid molecule conjugate of claim 8, wherein Z in formula (V') is -H, -OH, -O-methyl, -F, or -O-methoxyethyl, and R in formula (V') is adenine, uracil, guanine, cytosine, thymine, an abasic group, or another group.

13. A pharmaceutical composition comprising a polynucleic acid molecule or a polynucleic acid molecule conjugate for use in regulating low density lipoprotein (LDL) or cholesterol in a subject in need of such regulation, wherein the use comprises administering to the subject a polynucleic acid molecule described in any one of claims 1 to 6 or a polynucleic acid molecule conjugate described in any one of claims 8 to 12.

14. The pharmaceutical composition described in claim 13, wherein the subject in need of said modulation is suffering from hypercholesterolemia, familial hypercholesterolemia, or other high cholesterol-related disease.

Images