Genetically modified cells for allogeneic cell therapy to reduce complement-mediated inflammatory responses - Patent Application 20070123633
Patent Information
- Application Number
- JP2024508657
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-06-17
- Filing Date
- 2022-08-11
- Publication Date
- 2025-08-15
AI Technical Summary
Recipient sensitization to donor alloantigens significantly reduces the effectiveness of clinical transplant therapies, including cell therapy, due to immune rejection of allogeneic material.
Engineered cells with increased expression of tolerogenic factors such as CD46, CD59, and CD47, and reduced expression of MHC class I and II molecules, achieved through genetic modifications using techniques like CRISPR-Cas, to reduce immunogenicity and evade immune recognition.
The engineered cells effectively reduce immune rejection, allowing for successful engraftment and function in MHC-mismatched allogeneic recipients, minimizing complement-dependent cytotoxicity and immune responses.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 232,164, filed August 11, 2021, and U.S. Provisional Patent Application No. 63 / 353,538, filed June 17, 2022, the contents of each of which are incorporated herein by reference in their entirety for all purposes.
[0002] Reference to the electronic sequence listing The contents of the electronic sequence listing (186152005240SEQLIST.xml, size: 41,567 bytes, and created on August 8, 2022) are incorporated herein by reference in their entirety.
[0003] Field In certain aspects, the present disclosure is directed to engineered cells containing one or more modifications, such as genetic modifications, for use in allogeneic cell therapy. In some embodiments, the engineered cells are hypoimmunogenic cells. Summary of the Invention
[0004] overview Sensitization of recipients to donor alloantigens is a problem facing clinical transplantation therapies, including cell therapy. For example, the tendency of the transplant recipient's immune system to reject allogeneic material significantly reduces the potential effectiveness of transplantation therapy and diminishes the possible positive effects associated with such therapy. There remains a need for improved allogeneic cells for the treatment of numerous disorders and conditions. Thus, there remains a need for novel approaches, compositions, and methods for generating allogeneic cell-based therapies that avoid detection by the recipient's immune system.
[0005] In some embodiments, (i) increasing the expression of one or more tolerogenic factors, (ii) increasing the expression of CD46, (iii) increasing the expression of CD59, and (iv) decreasing the expression of one or more MHC class I molecules and / or one or more MHC class II molecules. Provided herein are engineered cells comprising: (i) a nucleotide sequence encoding ...
[0006] In some embodiments, the modification in (iv) reduces expression of one or more MHC class I molecules. In some embodiments, the modification in (iv) reduces expression of one or more MHC class I molecules and one or more MHC class II molecules.
[0007] In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, and SERPINB9, and any combination thereof.
[0008] In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD47, PD-L1, HLA-E, HLA-G, CCL21, FASL, SERPINB9, CD200, MFGE8, and any combination thereof. In some embodiments, at least one of the one or more tolerogenic factors is CD47. In some embodiments, at least one of the one or more tolerogenic factors is PD-L1. In some embodiments, at least one of the one or more tolerogenic factors is HLA-E. In some embodiments, at least one of the one or more tolerogenic factors is HLA-G.
[0009] In some of any of the embodiments, the one or more tolerogenic factors are CD47; HLA-E; CD24; PD-L1; CD55; CR1; MANF; A20 / TNFAIP3; HLA-E and CD47; CD24, CD47, PD-L1, and any combination thereof; HLA-E, CD24, CD47, and PD-L1, and any combination thereof; CD55 and CR1, and any combination thereof; HLA-E, CD55, and CR1, and any combination thereof; HLA-E, CD24, CD47, PD-L1 HLA-E, PDL1, and A20 / TNFAIP, and any combination thereof; HLA-E, PDL1, and MANF, and any combination thereof; HLA-E, PDL1, and MANF, and any combination thereof; and CD47, PD-L1, HLA-E, HLA-G, CCL21, FASL, SERPINB9, CD200, MFGE8, and any combination thereof.
[0010] In some of any of the embodiments, the modification is selected from: a modification that reduces expression of MHC I and / or MHC II; increases expression of CD47, and optionally CD24 and PD-L1; and increases expression of CD46, CD55, CD59, and CR1.
[0011] In some of any of the embodiments, the modification is selected from a modification that reduces expression of an MHC class I molecule; increases expression of CD46 and CD59; increases expression of PD-L1 and HLA-E; and optionally increases expression of one or more of A20 / TNFAIP3, TXNIP, and MANF.
[0012] In some of any of the embodiments, the modification is selected from a modification that increases expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8; and a modification that increases expression of CD46 and CD59.
[0013] In some embodiments, the modification is selected from a modification that reduces expression of MHC I and / or MHC II; and a modification that increases expression of CD47.
[0014] In some embodiments, any of the above modifications are present in the provided engineered cells along with one or more additional edits that increase or decrease expression of a gene in the cell. In some embodiments, any one or more of the additional modifications can be modifications that reduce, e.g., disrupt, inactivate, or knock out, expression of B2M, TAP I, NLRC5, CIITA, HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, RFX5, RFXANK, RFXAP, NFY-A, NFY-B, NFY-C, CTLA-4, PD-1, IRF1, MIC-A, or MIC-B. In some embodiments, any one or more of the additional modifications can be modifications that reduce expression of proteins involved in oxidative or ER stress, such as TRAC, TRB, CD142, ABO, CD38, PCDH11Y, NLGN4Y, and / or RHD. In some embodiments, proteins involved in oxidative stress or ER stress include thioredoxin interacting protein (TXNIP), PKR-like ER kinase (PERK), inositol-requiring enzyme 1 alpha (IRE1α), and DJ-1 (PARK7).
[0015] In some embodiments, (i) increasing the expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8; (ii) increasing the expression of CD46; and (iii) increasing the expression of CD59.
[0013] Provided herein are engineered cells comprising: (a) a modified marker for CD55 expression, wherein the increased expression is relative to a cell of the same cell type that does not contain the modification; (b) a modified marker for CD55 expression, wherein the increased expression is relative to a cell of the same cell type that does not contain the modification; (c) a modified marker for CD55 expression, wherein the increased expression is relative to a cell of the same cell type that does not contain the modification; (d) a modified marker for CD55 expression, wherein the increased expression is relative to a cell of the same cell type that does not contain the modification; (e) a modified marker for CD55 expression, wherein the increased expression is relative to a cell of the same cell type that does not contain the modification; (f) a modified marker for CD55 expression, wherein the increased expression is relative to a cell of the same cell type that does not contain the modification; (g ...
[0016] In some embodiments, the modification(s) that increase expression include increased surface expression and / or the modification that reduces expression includes reduced surface expression. In some cases, reduced surface expression does not include any detectable surface expression.
[0017] In some embodiments, the one or more modifications that increase CD46 expression and increase CD59 expression comprise an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59.
[0018] In some embodiments, the modification that increases expression of CD55 comprises an exogenous polynucleotide encoding CD55.
[0019] In some embodiments, the exogenous polynucleotide encoding CD46 encodes a sequence of amino acids having at least 85% identity to the amino acid sequence of SEQ ID NO: 3 and exhibits complement inhibitory activity. In some embodiments, the exogenous polynucleotide encoding CD46 encodes the sequence set forth in SEQ ID NO: 3.
[0020] In some embodiments, the exogenous polynucleotide encoding CD59 encodes a sequence of amino acids having at least 85% identity to the amino acid sequence of SEQ ID NO: 5 and exhibits complement inhibitory activity. In some embodiments, the exogenous polynucleotide encoding CD59 encodes the sequence set forth in SEQ ID NO: 5.
[0021] In some embodiments, the exogenous polynucleotide encoding CD55 encodes a sequence of amino acids having at least 85% identity to the amino acid sequence of SEQ ID NO: 8 and exhibits complement inhibitory activity. In some embodiments, the exogenous polynucleotide encoding CD55 encodes the sequence set forth in SEQ ID NO: 8.
[0022] In some embodiments, the exogenous polynucleotide encoding CD46 and the exogenous polynucleotide encoding CD59 are each operably linked to a promoter.
[0023] In some embodiments, the exogenous polynucleotide encoding CD55 is operably linked to a promoter.
[0024] In some embodiments, the modification that increases expression of CD47 comprises an exogenous polynucleotide encoding a CD47 protein. In some embodiments, the exogenous polynucleotide encoding CD47 encodes a sequence of amino acids having at least 85% identity to the amino acid sequence of SEQ ID NO: 1 and reduces innate immune killing of the engineered cells. In some embodiments, the exogenous polynucleotide encoding CD47 encodes the sequence set forth in SEQ ID NO: 1. In some embodiments, the exogenous polynucleotide encoding CD47 is operably linked to a promoter.
[0025] In some embodiments, the engineered cells are A multicistronic vector comprising two or more exogenous polynucleotides selected from the group consisting of one or more exogenous polynucleotides encoding one or more tolerogenic factors, an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding a CD55 polypeptide. Includes.
[0026] In some embodiments, each of the polynucleotides is separated by an IRES or a self-cleaving peptide.
[0027] In some embodiments, the one or more tolerogenic factors is CD47.
[0028] In some embodiments, each polynucleotide of the multicistronic vector is operably linked to the same promoter.
[0029] In some embodiments, the multicistronic vector comprises an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59. In some embodiments, the multicistronic vector comprises an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding CD55.
[0030] In some embodiments, the multicistronic vector further comprises an exogenous polynucleotide encoding CD47. In some embodiments, the multicistronic vector is a first transgene and the engineered cell comprises a separate transgene comprising an exogenous polynucleotide encoding CD47.
[0031] In some embodiments, the engineered cell comprises a first transgene and a second transgene; wherein the first transgene and the second transgene each comprise one or more exogenous polynucleotides selected from the group consisting of an exogenous polynucleotide encoding CD47, an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding a CD55 polypeptide, and wherein the first transgene and the second transgene are monocistronic or multicistronic vectors.
[0032] In some embodiments, the promoter is a constitutive promoter.
[0033] In some embodiments, the promoter is selected from the group consisting of a CAG promoter, a cytomegalovirus (CMV) promoter, an EF1a promoter, a PGK promoter, an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, an HSV tk promoter, a mouse mammary tumor virus (MMTV) promoter, an HIV LTR promoter, a Moloney virus promoter, an Epstein-Barr virus (EBV) promoter, and a Rous sarcoma virus (RSV) promoter.
[0034] In some embodiments, the exogenous polynucleotide encoding CD46 and / or the exogenous polynucleotide encoding CD59 is integrated into the genome of the engineered cell.
[0035] In some embodiments, the exogenous polynucleotide encoding CD55 is integrated into the genome of the engineered cell.
[0036] In some embodiments, the exogenous polynucleotide encoding CD47 is integrated into the genome of the engineered cell.
[0037] In some embodiments, the integration is by non-targeted insertion into the genome of the engineered cell, optionally by introduction of an exogenous polynucleotide into the cell using a lentiviral vector, hi some embodiments, the integration is by targeted insertion into a target genomic locus of the cell.
[0038] In some embodiments, the target genomic locus is the B2M locus, the CIITA locus, the TRAC locus, or the TRBC locus.
[0039] In some embodiments, the target genomic locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.
[0040] In some embodiments, an exogenous polynucleotide encoding CD47 is integrated into a first target genomic locus, an exogenous polynucleotide encoding CD46 is integrated into a second target genomic locus, and a polynucleotide encoding CD59 is integrated into a third target genomic locus.
[0041] In some embodiments, the exogenous polynucleotide encoding CD55 is integrated into a fourth targeted genomic locus.
[0042] In some embodiments, at least two of the first target genome locus, the second target genome locus, and the third target genome locus are the same locus. In some embodiments, at least two of the first target genome locus, the second target genome locus, the third target genome locus, and the fourth target genome locus are the same locus. In some embodiments, the first target genome locus, the second target genome locus, and the third target genome locus are the same locus. In some embodiments, the first target genome locus, the second target genome locus, the third target genome locus, and the fourth target genome locus are the same locus.
[0043] In some embodiments, each of the first target genomic locus, the second target genomic locus, and the third target genomic locus is a different locus. In some embodiments, the first target genomic locus, the second target genomic locus, the third target genomic locus, and the fourth target genomic locus are different loci.
[0044] In some embodiments, the modification that reduces expression of one or more MHC class I molecules reduces protein expression of one or more MHC class I molecules. In some embodiments, the modification that reduces expression of one or more MHC class I molecules comprises reduced expression of B2M. In some embodiments, the modification that reduces expression of one or more MHC class I molecules comprises reduced protein expression of B2M. In some embodiments, the modification eliminates B2M gene activity. In some embodiments, the modification comprises inactivation or disruption of both alleles of the B2M gene. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the inactivation or disruption comprises an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation in the B2M gene or a deletion of a contiguous stretch of genomic DNA. In some embodiments, the B2M gene is knocked out.
[0045] In some embodiments, the modification is by nuclease-mediated gene editing. In some embodiments, the nuclease-mediated gene editing is by zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), or CRISPR-Cas combinations that target the B2M gene, optionally wherein the Cas is selected from Cas9 or Cas12. In some embodiments, the nuclease-mediated gene editing is by CRISPR-Cas combinations, wherein the CRISPR-Cas combinations include a guide RNA (gRNA) having a targeting domain that is complementary to at least one target site in the B2M gene. In some embodiments, the CRISPR-Cas combinations are ribonucleoprotein (RNP) complexes that include a gRNA and a Cas protein.
[0046] In some embodiments, the modification that reduces the expression of one or more MHC class II molecules reduces the protein expression of one or more MHC class II molecules. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises reduced expression of CIITA. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises reduced protein expression of CIITA. In some embodiments, the modification eliminates CIITA gene activity. In some embodiments, the modification comprises inactivation or disruption of both alleles of the CIITA gene.
[0047] In some embodiments, the modification comprises inactivation or disruption of all CIITA coding sequences in the cell. In some embodiments, the inactivation or disruption comprises an indel in the CIITA gene. In some embodiments, the modification is a frameshift mutation in the CIITA gene or a deletion of a continuous stretch of genomic DNA. In some embodiments, the CIITA gene is knocked out.
[0048] In some embodiments, the engineered cells are human or animal cells. In some embodiments, the engineered cells are human cells. In some embodiments, the engineered cells are porcine (porcine) cells, bovine (bovine) cells, or ovine (ovine) cells. In some embodiments, the engineered cells are differentiated cells derived from pluripotent stem cells or their progeny. In some embodiments, the pluripotent stem cells are induced pluripotent stem cells.
[0049] In some embodiments, the engineered cells are primary cells isolated from a donor subject, hi some embodiments, the donor subject is healthy or not suspected of having a disease or condition at the time the donor sample is obtained from the individual donor.
[0050] In some embodiments, the engineered cells are selected from beta islet cells, B cells, T cells, NK cells, retinal pigment epithelial cells, liver cells, thyroid cells, skin cells, glial progenitor cells, neuronal cells, cardiac cells, and blood cells.
[0051] In some embodiments, the engineered cells are endothelial cells. In some embodiments, the engineered cells are epithelial cells. In some embodiments, the engineered cells are T cells. In some embodiments, the engineered cells are NK cells. In some embodiments, the engineered cells comprise a chimeric antigen receptor (CAR).
[0052] In some embodiments, the engineered cells are pluripotent stem cells. In some embodiments, the engineered cells are induced pluripotent stem cells. In some embodiments, the engineered cells are embryonic stem cells.
[0053] In some embodiments, the cells are ABO blood type O. In some embodiments, the cells comprise a functional ABO A allele and / or a functional ABO B allele. In some embodiments, the cells are Rhesus factor negative (Rh-). In some embodiments, the cells are Rhesus factor positive (Rh+).
[0054] In some aspects, provided herein are methods of generating engineered cells, the methods comprising: a. reducing or eliminating expression of one or more MHC class I molecules and / or one or more MHC class II molecules in the cell; b. increasing expression of a tolerogenic factor in the cell; c. increasing expression of CD46 in the cell; and d. increasing expression of CD59 in the cell.
[0055] In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, and SERPINB9, and any combination thereof.
[0056] In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD47, PD-L1, HLA-E, HLA-G, CCL21, FASL, SERPINB9, CD200, MFGE8, and any combination thereof. In some embodiments, at least one of the one or more tolerogenic factors is CD47. In some embodiments, at least one of the one or more tolerogenic factors is PD-L1. In some embodiments, at least one of the one or more tolerogenic factors is HLA-E. In some embodiments, at least one of the one or more tolerogenic factors is HLA-G. In some embodiments, the method comprises reducing or eliminating expression of one or more MHC class I molecules and one or more MHC class II molecules.
[0057] In some aspects, provided herein are methods of generating engineered cells, the methods comprising: a. increasing expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8 in the cell; b. increasing expression of CD46 in the cell; and c. increasing expression of CD59 in the cell.
[0058] In some embodiments, the method further comprises increasing expression of CD55 in the cell.
[0059] In some embodiments of the methods of generating engineered cells, the reduced expression comprises reduced surface expression and / or the increased expression comprises increased surface expression, hi some embodiments, the reduced surface expression does not comprise any detectable surface expression.
[0060] In some embodiments of the methods of generating engineered cells, increasing expression of CD46 and CD59 comprises introducing into the cell an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59.
[0061] In some embodiments of the methods of generating an engineered cell, increasing expression of CD55 comprises introducing into the cell an exogenous polynucleotide encoding CD55.
[0062] In some embodiments of the methods of generating engineered cells, the exogenous polynucleotide encoding CD46 encodes a sequence of amino acids having at least 85% identity to the amino acid sequence of SEQ ID NO: 3 and exhibits complement inhibitory activity. In some embodiments, the exogenous polynucleotide encoding CD46 encodes the sequence set forth in SEQ ID NO: 3.
[0063] In some embodiments of the methods of generating engineered cells, the exogenous polynucleotide encoding CD59 encodes a sequence of amino acids having at least 85% identity to the amino acid sequence of SEQ ID NO: 5 and exhibits complement inhibitory activity. In some embodiments, the exogenous polynucleotide encoding CD59 encodes the sequence set forth in SEQ ID NO: 5.
[0064] In some embodiments of the methods of generating an engineered cell, the exogenous polynucleotide encoding CD55 encodes a sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 8 and exhibits complement inhibitory activity. In some embodiments, the exogenous polynucleotide encoding CD55 encodes the sequence set forth in SEQ ID NO: 8.
[0065] In some embodiments of the methods of generating an engineered cell, the exogenous polynucleotide encoding CD46 and the exogenous polynucleotide encoding CD59 are each operably linked to a promoter.
[0066] In some embodiments of the methods of generating an engineered cell, the exogenous polynucleotide encoding CD55 is operably linked to a promoter.
[0067] In some embodiments of the methods of generating engineered cells, the modification that increases expression of CD47 comprises an exogenous polynucleotide encoding a CD47 protein. In some embodiments, the exogenous polynucleotide encoding CD47 encodes a sequence having at least 85% identity to the amino acid sequence of SEQ ID NO: 1 and reduces innate immune killing of the engineered cells. In some embodiments, the exogenous polynucleotide encoding CD47 encodes the sequence set forth in SEQ ID NO: 1. In some embodiments, the exogenous polynucleotide encoding CD47 is operably linked to a promoter.
[0068] In some embodiments of the method of generating an engineered cell, the method comprises: Introducing a multicistronic vector containing two or more exogenous polynucleotides selected from the group consisting of an exogenous polynucleotide encoding CD47, an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding a CD55 polypeptide. In some embodiments, each of the polynucleotides is separated by an IRES or a self-cleaving peptide.
[0069] In some embodiments of the methods of generating an engineered cell, each polynucleotide of the multicistronic vector is operably linked to the same promoter.
[0070] In some embodiments of the methods of generating engineered cells, the multicistronic vector comprises an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59. In some embodiments, the multicistronic vector comprises an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding CD55.
[0071] In some embodiments of the methods of generating an engineered cell, the multicistronic vector further comprises an exogenous polynucleotide encoding CD47. In some embodiments of the methods of generating an engineered cell, the engineered cell comprises a separate transgene comprising a polynucleotide encoding CD47.
[0072] In some embodiments of the methods of generating an engineered cell, an exogenous polynucleotide encoding CD46 and / or an exogenous polynucleotide encoding CD59 is integrated into the genome of the engineered cell.
[0073] In some embodiments of the methods of generating an engineered cell, an exogenous polynucleotide encoding CD55 is integrated into the genome of the engineered cell.
[0074] In some embodiments of the methods of generating an engineered cell, an exogenous polynucleotide encoding CD47 is integrated into the genome of the engineered cell.
[0075] In some embodiments of the methods of generating engineered cells, the integration is by non-targeted insertion into the genome of the engineered cell, optionally by introducing an exogenous polynucleotide into the cell using a lentiviral vector. In some embodiments, the integration is by targeted insertion into a target genomic locus of the cell, optionally by nuclease-mediated gene editing using homology-directed repair.
[0076] In some embodiments of the methods of generating an engineered cell, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, a TRAC locus, or a TRBC locus.
[0077] In some embodiments of the methods of generating an engineered cell, the target genomic locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.
[0078] In some embodiments of the methods of generating engineered cells, the nuclease-mediated gene editing is by a zinc finger nuclease (ZFN), a TAL effector nuclease (TALEN), or a CRISPR-Cas combination targeted to a target genomic locus, optionally wherein the Cas is selected from Cas9 or Cas12. In some embodiments, the nuclease-mediated gene editing is by a CRISPR-Cas combination comprising a guide RNA (gRNA) having a targeting domain complementary to a target sequence in the target genomic locus, and a homology-directed repair template comprising an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and / or an exogenous polynucleotide encoding CD47.
[0079] In some embodiments of the methods of generating engineered cells, the CRISPR-Cas combination is a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas protein.
[0080] In some embodiments of the method of generating an engineered cell, reducing the expression of one or more MHC class I molecules comprises introducing a modification that reduces the protein expression of one or more MHC class I molecules. In some embodiments, the modification that reduces the protein expression of one or more MHC class I molecules comprises reduced expression of B2M. In some embodiments, the modification that reduces the protein expression of one or more MHC class I molecules comprises reduced protein expression of B2M. In some embodiments, the modification that reduces the protein expression of one or more MHC class I molecules reduces B2M gene activity. In some embodiments, the modification that reduces the expression of one or more MHC class I molecules comprises inactivation or disruption of both alleles of the B2M gene. In some embodiments, the modification that reduces the protein expression of one or more MHC class I molecules comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the inactivation or disruption comprises an indel in the B2M gene or a deletion of a contiguous stretch of genomic DNA in the B2M gene. In some embodiments, the indel is a frameshift mutation. In some embodiments, the B2M gene is knocked out.
[0081] In some embodiments of the methods of generating engineered cells, the modification that reduces protein expression of one or more MHC class I molecules is by nuclease-mediated gene editing. In some embodiments, the nuclease-mediated gene editing is by zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs), or CRISPR-Cas combinations that target the B2M gene, optionally with the Cas selected from Cas9 or Cas12. In some embodiments of the methods of generating engineered cells, the nuclease-mediated gene editing is by CRISPR-Cas combinations, the CRISPR-Cas combinations comprising a guide RNA (gRNA) having a targeting domain complementary to at least one target site in the B2M gene. In some embodiments, the CRISPR-Cas combinations are ribonucleoprotein (RNP) complexes comprising a gRNA and a Cas protein.
[0082] In some embodiments of the methods of generating engineered cells, reducing the expression of one or more MHC class II molecules comprises introducing a modification that reduces protein expression of one or more MHC class II molecules.
[0083] In some embodiments of the method for producing an engineered cell, the modification that reduces the protein expression of one or more MHC class II molecules comprises reduced expression of CIITA. In some embodiments, the modification that reduces the protein expression of one or more MHC class II molecules comprises reduced protein expression of CIITA. In some embodiments, the modification that reduces the protein expression of one or more MHC class II molecules reduces CIITA gene activity. In some embodiments, the modification that reduces the protein expression of one or more MHC class II molecules comprises inactivation or disruption of both alleles of the CIITA gene. In some embodiments, the modification comprises inactivation or disruption of all CIITA coding sequences in the cell. In some embodiments, the inactivation or disruption comprises an indel in the CIITA gene or a deletion of a contiguous stretch of genomic DNA in the CIITA gene. In some embodiments, the indel is a frameshift mutation. In some embodiments, the CIITA gene is knocked out.
[0084] In some embodiments of the methods of generating engineered cells, the cells are human or animal cells. In some embodiments, the engineered cells are human cells. In some embodiments, the cells are primary cells isolated from a donor subject. In some embodiments, the cells are pluripotent stem cells, wherein the engineered cells are differentiated cells derived from the pluripotent stem cells, and the method further comprises differentiating the pluripotent stem cells. In some embodiments, the pluripotent stem cells are induced pluripotent stem cells. In some embodiments, the engineered cells are selected from beta islet cells, B cells, T cells, NK cells, glial progenitor cells, neural cells, cardiac cells, retinal pigment epithelial cells, photoreceptor cells, hepatocytes, thyroid cells, skin cells, and blood cells.
[0085] In some aspects, provided herein are engineered cells produced according to any of the methods described herein.
[0086] In some embodiments, the engineered cells, or progeny or differentiated cells derived from the engineered cells, are able to avoid NK cell-mediated cytotoxicity upon administration to a patient, hi some embodiments, the engineered cells, or progeny or differentiated cells derived from the engineered cells, are protected from cytolysis by mature NK cells upon administration to a patient.
[0087] In some embodiments, the engineered cells, or progeny or differentiated cells derived from the engineered cells, do not induce an immune response against the cells when administered to a patient. In some embodiments, the engineered cells, or progeny or differentiated cells derived from the engineered cells, do not induce a systemic inflammatory response against the cells when administered to a patient. In some embodiments, the engineered cells, or progeny or differentiated cells derived from the engineered cells, do not induce a local inflammatory response against the cells when administered to a patient.
[0088] In some embodiments, the engineered cells, or progeny or differentiated cells derived from the engineered cells, do not induce complement pathway activation upon administration to a patient.
[0089] In some embodiments, the cells retain the ability to engraft and function when administered to a patient.
[0090] In some aspects, provided herein is a population of engineered cells comprising a plurality of any of the engineered cells described herein.
[0091] In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise a modification, hi some embodiments, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise an exogenous polynucleotide encoding CD47.
[0092] In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise an exogenous polynucleotide encoding CD46.
[0093] In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise an exogenous polynucleotide encoding CD59.
[0094] In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise an exogenous polynucleotide encoding CD55.
[0095] In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise reduced expression of one or more MHC class I molecules and / or one or more MHC class II molecules compared to cells that do not contain the modification.
[0096] In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise reduced expression of B2M and / or CIITA compared to cells that do not comprise the modification. In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise reduced expression of B2M and CIITA compared to cells that do not comprise the modification. In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise one or more alterations that inactivate both alleles of the B2M gene. In some embodiments, at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of the cells in the population comprise one or more alterations that inactivate both alleles of the CIITA gene.
[0097] In some aspects, provided herein are compositions comprising a population of any of the engineered cells described herein.
[0098] In some embodiments of the composition comprising a population of engineered cells, the engineered cells are (i) an exogenous polynucleotide encoding CD47; (ii) an exogenous polynucleotide encoding CD46; (iii) an exogenous polynucleotide encoding CD59, and (iv) inactivation or disruption of both alleles of the B2M gene Includes.
[0099] In some embodiments of the composition, the engineered cell further comprises an inactivation or disruption of both alleles of the CIITA gene.
[0100] In some embodiments of the composition, the engineered cells further comprise an exogenous polynucleotide encoding CD55.
[0101] In some embodiments of the composition, the engineered cells comprise: A multicistronic vector comprising an exogenous polynucleotide encoding CD47, an exogenous polynucleotide encoding CD46, and an exogenous polynucleotide encoding CD59. In some embodiments, the engineered cells comprise: A multicistronic vector comprising a first transgene comprising an exogenous polynucleotide encoding CD47, as well as an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59. In some embodiments, the engineered cells comprise: A multicistronic vector comprising a first transgene comprising an exogenous polynucleotide encoding CD47, as well as an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding CD55. Includes.
[0102] In some embodiments of the composition, each polynucleotide of the multicistronic vector is separated by an IRES or a self-cleaving peptide.In some embodiments of the composition, transgene(s) are introduced at the target genome locus site by nuclease-mediated gene editing using homology-directed repair.In some embodiments, the inactivation or destruction is by nuclease-mediated gene editing.In some embodiments, the nuclease-mediated gene editing is by zinc finger nuclease (ZFN), TAL effector nuclease (TALEN) or CRISPR-Cas combination that targets the target genome locus, and optionally, the Cas is selected from Cas9 or Cas12.
[0103] In some embodiments of the composition, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutically acceptable excipient is a buffer solution such as saline.
[0104] In some embodiments of the composition, the composition is formulated in a serum-free cryopreservation medium containing a cryoprotectant. In some embodiments, the cryoprotectant is DMSO, and the cryopreservation medium is 5% to 10% DMSO (v / v). In some embodiments, the cryoprotectant is 10% DMSO (v / v) or about 10% DMSO (v / v).
[0105] In some embodiments of any of the compositions provided herein, the composition is a sterile composition.
[0106] In some embodiments of any of the compositions provided herein, the composition is contained in a container.
[0107] In some embodiments, a container comprises any of the compositions described herein. In some embodiments, the container is a sterile bag. In some embodiments, the bag is a cryopreservation-compatible bag.
[0108] In some aspects, provided herein are methods of treating a disease, condition, or cell in a patient in need thereof, the methods comprising administering to the patient an effective amount of a population or composition described herein.
[0109] In some embodiments of the methods of treating a disease, the population comprises endothelial cells.
[0110] In some embodiments of the methods of treating a disease, the condition or disease is selected from the group consisting of diabetes, cancer, angiogenic disorders, eye diseases, thyroid diseases, skin diseases, and liver diseases.
[0111] In some embodiments of the methods of treating a disease, the cell defect is associated with diabetes or the cell therapy is for the treatment of diabetes, optionally wherein the diabetes is type I diabetes.
[0112] In some embodiments of the methods of treating a disease, the population of cells is a population of islet cells, including beta islet cells, hi some embodiments, the islet cells are selected from the group consisting of islet progenitor cells, immature islet cells, and mature islet cells.
[0113] In some embodiments of the methods of treating a disease, the cell defect is associated with a vascular condition or disease, or the cell therapy is for the treatment of a vascular condition or disease, hi some embodiments, the population of cells is a population of endothelial cells.
[0114] In some embodiments of the methods of treating disease, the cell defect is associated with autoimmune thyroiditis or the cell therapy is for the treatment of autoimmune thyroiditis, hi some embodiments, the population of cells is a population of thyroid progenitor cells.
[0115] In some embodiments of the methods of treating disease, the cell defect is associated with liver disease or the cell therapy is for the treatment of liver disease. In some embodiments, the liver disease comprises cirrhosis. In some embodiments, the population of cells is a population of hepatocytes or hepatic progenitor cells.
[0116] In some embodiments of the method of treating a disease, the cell defect is associated with a corneal disease or the cell therapy is for the treatment of a corneal disease. In some embodiments, the corneal disease is Fuchs' dystrophy or a congenital hereditary endothelial dystrophy. In some embodiments, the population of cells is a population of corneal endothelial progenitor cells or corneal endothelial cells.
[0117] In some embodiments of the methods of treating disease, the cell defect is associated with a kidney disease or the cell therapy is for the treatment of a kidney disease, hi some embodiments, the population of cells is a population of renal progenitor cells or renal cells.
[0118] In some embodiments of the methods of treating a disease, the cell therapy is for the treatment of cancer, in some embodiments, the cancer is selected from the group consisting of B-cell acute lymphoblastic leukemia (B-ALL), diffuse large B-cell lymphoma, liver cancer, pancreatic cancer, breast cancer, ovarian cancer, colorectal cancer, lung cancer, non-small cell lung cancer, acute myeloid lymphocytic leukemia, multiple myeloma, gastric cancer, gastric adenocarcinoma, pancreatic adenocarcinoma, glioblastoma, neuroblastoma, squamous cell lung carcinoma, hepatocellular carcinoma, and bladder cancer.
[0119] In some embodiments of the methods of treating a disease, the population of cells is a population of T cells or NK cells.
[0120] In some embodiments of the methods of treating a disease, the cells are expanded and cryopreserved prior to administration.
[0121] In some embodiments of the methods of treating a disease, administering the population comprises intravenous injection, intramuscular injection, intravascular injection, or implantation of the population. In some embodiments of the methods of treating a disease, the population is implanted via intravascular or intramuscular injection.
[0122] In some embodiments of the methods of treating a disease, the population is derived from a donor subject, where the donor's HLA type does not match the patient's HLA type.
[0123] In some embodiments of the methods of treating a disease, the population is derived from a donor, wherein the donor's blood type does not match the patient's blood type, and the donor's blood type is not O. In some embodiments, the population is derived from a donor, wherein the donor's blood type is Rhesus factor (Rh) positive and the patient's blood type is Rh negative. In some embodiments, the patient's serum contains antibodies against Rh.
[0124] In some embodiments of the methods of treating a disease, the population is a human cell population and the patient is a human patient.
[0125] In some embodiments of the methods of treating disease, the population of cells comprises functional ABO A alleles and / or functional ABO B alleles. In some embodiments, the population of cells presents ABO type A antigens and the patient's serum comprises anti-A antibodies. In some embodiments, the population of cells presents ABO type B antigens and the patient's serum comprises anti-B antibodies. In some embodiments, the population of cells presents ABO type A and B antigens and the patient's serum comprises anti-A antibodies and / or anti-B antibodies. In some embodiments, the population of cells expresses the Rh factor and the patient's serum comprises anti-Rh antibodies.
[0126] In some embodiments of the method of treating a disease, the method further comprises administering one or more immunosuppressants to the patient. In some embodiments, the patient is receiving one or more immunosuppressants. In some embodiments, the one or more immunosuppressants are small molecules or antibodies. In some embodiments, the one or more immunosuppressants are selected from the group consisting of cyclosporine, azathioprine, mycophenolic acid, mycophenolate mofetil, corticosteroids, prednisone, methotrexate, gold salts, sulfasalazine, antimalarials, brequinar, leflunomide, mizoribine, 15-deoxyspergualin, 6-mercaptopurine, cyclophosphamide, rapamycin, tacrolimus (FK-506), OKT3, antithymocyte globulin, thymopentin (thymosin-α), and immunosuppressant antibodies. In some embodiments, the one or more immunosuppressants comprise cyclosporine. In some embodiments, the one or more immunosuppressants comprise mycophenolate mofetil. In some embodiments, the one or more immunosuppressants include a corticosteroid. In some embodiments, the one or more immunosuppressants include cyclophosphamide. In some embodiments, the one or more immunosuppressants include rapamycin. In some embodiments, the one or more immunosuppressants include tacrolimus (FK-506). In some embodiments, the one or more immunosuppressants include antithymocyte globulin. In some embodiments, the one or more immunosuppressants are one or more immunomodulatory agents.
[0127] In some embodiments of the methods of treating a disease, the one or more immunomodulatory agents are small molecules or antibodies. In some embodiments, the antibody binds to one or more of a receptor or ligand selected from the group consisting of p75 of the IL-2 receptor, MHC, CD2, CD3, CD4, CD7, CD28, B7, CD40, CD45, IFN-gamma, TNF-alpha, IL-4, IL-5, IL-6R, IL-6, IGF, IGFR1, IL-7, IL-8, IL-10, CD11a, CD58, and antibodies that bind to any of these ligands.
[0128] In some embodiments of the methods of treating a disease, one or more immunosuppressive agents are or have been administered to the patient prior to administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, or more after administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient on the same day as the first administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient after administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient after administration of the first and / or second administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient before administration of the first and / or second administration of the engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the first and / or second administration of engineered cells.In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, or more prior to administration of the first and / or second administration of engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the first and / or second administration of engineered cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the patient at least 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, or more after administration of the first and / or second administration of engineered cells. In some embodiments, the one or more immunosuppressants are administered at a lower dosage compared to the dosage of the one or more immunosuppressants administered to reduce immune rejection of immunogenic cells that do not contain the engineered cell modification.
[0129] In some embodiments of the methods of treating a disease, the engineered cells are capable of controlled killing of the engineered cells. In some embodiments, the engineered cells comprise a suicide gene or suicide switch. In some embodiments, the suicide gene or suicide switch induces controlled cell death in the presence of a drug or prodrug or upon activation by a selective exogenous compound. In some embodiments, the suicide gene or suicide switch is an inducible protein capable of inducing apoptosis of the engineered cells. In some embodiments, the inducible protein capable of inducing apoptosis of the engineered cells is a caspase protein. In some embodiments, the caspase protein is caspase 9. In some embodiments, the suicide gene or suicide switch is selected from the group consisting of cytosine deaminase (CyD), herpes virus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, following administration of one or more immunosuppressive agents to the patient, the suicide gene or suicide switch is activated to induce controlled cell death. In some embodiments, the suicide gene or suicide switch is activated to induce controlled cell death prior to administration of one or more immunosuppressive agents to the patient. In some embodiments, the suicide gene or suicide switch is activated to induce controlled cell death after administration of the engineered cells to the patient. In some embodiments, the suicide gene or suicide switch is activated to induce controlled cell death in the event of a cytotoxic event or other negative outcome in the patient.
[0130] In some embodiments of the methods of treating a disease, the method comprises administering an agent that allows for depletion of engineered cells from a population of engineered cells. In some embodiments, the agent that allows for depletion of engineered cells is an antibody that recognizes a protein expressed on the surface of the engineered cells. In some embodiments, the antibody is selected from the group consisting of antibodies that recognize CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8. In some embodiments, the antibody is selected from the group consisting of mogamulizumab, AFM13, MOR208, obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-RIIb, tomzotuximab, RO5083945 (GA201), cetuximab, Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-RIIc, and biosimilars thereof.
[0131] In some embodiments of the methods of treating a disease, the method comprises administering an agent that recognizes one or more tolerogenic factors on the surface of engineered cells. In some embodiments, the engineered cells are engineered to express one or more tolerogenic factors. In some embodiments, the one or more tolerogenic factors is CD47.
[0132] In some embodiments of the methods of treating a disease, the method further comprises administering one or more additional therapeutic agents to the patient. In some embodiments, the patient has been administered one or more additional therapeutic agents.
[0133] In some embodiments of the methods of treating a disease, the method further comprises monitoring the therapeutic effectiveness of the method. In some embodiments, the method further comprises monitoring the prophylactic effectiveness of the method. In some embodiments, the method is repeated until a desired suppression of one or more disease symptoms occurs.
[0134] In some embodiments of the engineered cell, the engineered cell comprises an exogenous polynucleotide encoding a suicide gene or suicide switch. In some embodiments, the suicide gene or suicide switch is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, the suicide gene or suicide switch and a gene associated with the suicide gene or safety switch are expressed from a bicistronic cassette integrated into the genome of the engineered cell. In some embodiments, the suicide gene or suicide switch and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the engineered cell. In some embodiments, the bicistronic cassette is integrated into the genome of the engineered cell by non-targeted insertion, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector. In some embodiments, the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the engineered cell, optionally by nuclease-mediated gene editing using homology-directed repair. In some embodiments, the one or more tolerogenic factors is CD47.
[0135] In some embodiments of the method for generating an engineered cell, the engineered cell comprises an exogenous polynucleotide encoding a suicide gene or suicide switch. In some embodiments, the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, the suicide gene or suicide switch and a gene associated with the suicide gene or safety switch are expressed from a bicistronic cassette integrated into the genome of the engineered cell. In some embodiments, the suicide gene or suicide switch and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the engineered cell. In some embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome of the engineered cell. In some embodiments, the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the engineered cell. In some embodiments, the one or more tolerogenic factors is CD47.
[0136] In some embodiments of the engineered cell composition, the engineered cells of the engineered cell population comprise an exogenous polynucleotide encoding a suicide gene or suicide switch. In some embodiments, the suicide gene or suicide switch is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, the suicide gene and the gene associated with the suicide gene or safety switch are expressed from a bicistronic cassette integrated into the genome of the engineered cells of the engineered cell population. In some embodiments, the suicide gene or suicide switch and exogenous CD47 are expressed from a bicistronic cassette integrated into the genome of the engineered cells. In some embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome, optionally by introduction of the exogenous polynucleotide into the engineered cells of the engineered cell population using a lentiviral vector. In some embodiments, the bicistronic cassette is integrated by targeted insertion into a target genomic locus of an engineered cell of the population of engineered cells, optionally wherein the targeted insertion is by nuclease-mediated gene editing using homology-directed repair. [Brief explanation of the drawings]
[0137] [Figure 1A] 1 shows the expression levels of HLA class I (HLA-I), HLA class II (HLA-II), and CD47 measured by flow cytometry for B2M indel / indel; CIITA indel / indel; CD47tg human induced pluripotent stem cells (hiPSCs), demonstrating that the cells lack expression of HLA-I and HLA-II and have increased expression of CD47. [Figure 1B]Figure 1 shows the expression levels of HLA class I (HLA-I), HLA class II (HLA-II), and CD47 measured by flow cytometry for endothelial cells (hiECs) differentiated from B2M indel / indel; CIITA indel / indel; CD47tg hiPSCs, demonstrating that the cells lack expression of HLA-I and HLA-II and have increased expression of CD47. [Figure 2] A-B show the surface expression levels of CD46, CD55, and CD59 in B2M indel / indel; CIITA indel / indel; CD47tg hiPSCs (Figure 2A) and the surface expression levels of CD46, CD55, and CD59 in B2M indel / indel; CIITA indel / indel; CD47tg hiECs (Figure 2B). [Figure 3] A-B show the killing of B2M indel / indel;CIITA indel / indel;CD47tg hiPSCs (Figure 3A) and B2M indel / indel;CIITA indel / indel;CD47tg hiECs (Figure 3B) in an ABO-incompatible complement-dependent cytotoxicity (CDC) assay. [Figure 4] A–D show the surface expression levels of CD46 in the CD46++ pool of B2M indel / indel; CIITA indel / indel; and CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 4A), and killing of the CD46+++ pool (Figure 4B) or individual hiPSC clones with CD46++ expression (Figure 4C) or individual hiPSC clones with CD46+++ expression (Figure 4D). [Figure 5] A–D show the surface expression levels of CD46 in the CD46++ pool of B2M indel / indel; CIITA indel / indel; and CD47tg hiECs in an ABO-incompatible CDC assay (Figure 5A), and killing of the CD46++ pool (Figure 5B) or individual hiEC clones with CD46+++ expression (Figures 5C–5D). [Figure 6]Figures 6A-6E show the surface expression levels of CD55 in the CD55+ pool of B2M indel / indel; CIITA indel / indel; and CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 6A), and the killing of the CD55+ pool (Figure 6B) or individual hiPSC clones with CD55++ expression (Figures 6C-6E). [Figure 7] A–E show the surface expression levels of CD55 in the CD55++ pool of B2M indel / indel; CIITA indel / indel; and CD47tg hiECs in an ABO-incompatible CDC assay (Figure 7A), and killing of the CD55++ pool (Figure 7B) or individual hiEC clones with CD55++ expression (Figures 7C–7E). [Figure 8] A–E show the surface expression levels of CD59 in the CD59+ pool of B2M indel / indel; CIITA indel / indel; and CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 8A), and killing of the CD59+ pool (Figure 8B) or individual hiPSC clones with CD59++ expression (Figures 8C–8D) or CD59+++ expression (Figure 8E). [Figure 9] A–C show the surface expression levels of CD59 in the CD59+++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiECs in an ABO-incompatible CDC assay (Figure 9A), and killing of the CD59+++ pool (Figure 9B) or individual hiEC clones with CD59++ expression (Figure 9C). [Figure 10] Figures 10A-10E show the surface expression levels of CD46 and CD55 in the CD46+++ / CD55++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 10A), as well as the killing of the CD46+++ / CD55++ pool (Figure 10B) or individual hiPSC clones with CD46++ / CD55++ expression (Figures 10C-10E). [Figure 11]A–E show the surface expression levels of CD46 and CD55 in the CD46++ / CD55++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiECs in an ABO-incompatible CDC assay (Figure 11A), as well as killing of the CD46++ / CD55++ pool (Figure 11B) or individual hiEC clones with CD46++ / CD55++ expression (Figures 11C–11E). [Figure 12] A–E show the surface expression levels of CD55 and CD59 in the CD55++ / CD59++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 12A), as well as killing of the CD55++ / CD59++ pool (Figure 12B) or individual hiPSC clones with CD55++ / CD59++ expression (Figures 12C–12D) or CD55++ / CD59+++ expression (Figure 12E). [Figure 13] A-E show the surface expression levels of CD55 and CD59 in the CD55++ / CD59+++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiECs in an ABO-incompatible CDC assay (Figure 13A), and killing of the CD55++ / CD59+++ pool (Figure 13B) or individual hiEC clones with CD55++ / CD59+++ expression (Figures 13C-13D) or individual hiEC clones with CD55++ / CD59+++ expression (Figure 13E). [Figure 14] Panels A–E show the surface expression levels of CD46 and CD59 in the CD46+++ / CD59++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 14A), as well as the survival of the CD46+++ / CD59++ pool (Figure 14B) or of individual hiPSC clones with CD46++ / CD59++ expression (Figures 14C–14D) or CD46++ / CD59+++ clones (Figure 14E). [Figure 15]A–E show the expression levels of CD46 and CD59 in the CD46super++ / CD59++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiECs in an ABO-incompatible CDC assay (Figure 15A), as well as the survival of the CD46++ / CD59++ pool (Figure 15B) or individual hiEC clones with CD46++ / CD59++ expression (Figures 15C–15E). [Figure 16] Figures 16A-E show the surface expression levels of CD46, CD55, and CD59 in the CD46++ / CD55++ / CD59+ pool of B2M indel / indel, CIITA indel / indel, and CD47tg hiPSCs in an ABO-incompatible CDC assay (Figure 16A), as well as the survival of the CD46++ / CD55++ / CD59+ pool (Figure 16B). Also shown are the survival of individual hiPSC clones with CD46++ / CD55++ / CD59++ expression in the CDC assay (Figures 16C and 16D) or CD46++ / CD55+ / CD59++ expression (Figure 16E). [Figure 17] Figures 17A-C show the surface expression levels of CD46, CD55, and CD59 in the CD46++ / CD55++ / CD59++ pool of B2M indel / indel; CIITA indel / indel; CD47tg hiECs in an ABO-incompatible CDC assay (Figure 17A), as well as the survival of the CD46++ / CD55++ / CD59++ pool (Figure 17B). The survival of individual hiEC clones with CD46++ / CD55++ / CD59++ expression in the CDC assay (Figure 17C) is also shown. [Figure 18] 1 shows the results of a CDC assay on endothelial cells derived from human iPSCs in the absence of ABO-incompatible serum (viability control). [Figure 19]A-C show the killing of B2M indel / indel, CIITA indel / indel, CD47tg mouse induced pluripotent stem cells (miPSCs; Figure 19A) in a CDC assay, and the survival of B2M indel / indel, CIITA indel / indel, CD47tg miPSCs transduced with CD46 and CD59 (CD46+ / CD59+ pool; Figure 19B) or B2M indel / indel, CIITA indel / indel, CD47tg miPSCs transduced with CD46, CD55, and CD59 (CD46+ / CD59+ / CD55+ pool; Figure 19C). [Figure 20] Panels A to D show results demonstrating that the protective effects of human CD46 and CD59, or human CD46, CD55, and CD59 against CDC induced by human ABO-incompatible serum, do not protect against CDC induced by ABO-incompatible rhesus monkey serum. DETAILED DESCRIPTION OF THE INVENTION
[0138] Detailed Description Provided herein are methods and compositions for mitigating and / or avoiding the effects of immune system responses to allogeneic transplants. To overcome the problem of immune rejection of cell-derived transplants and / or tissue transplants, engineered immune-evasive cells (e.g., engineered primary hypoimmunogenic cells), or populations or pharmaceutical compositions thereof, are disclosed herein, representing a viable source for any transplantable cell type. The engineered cells disclosed herein allow for reduced recognition by the recipient subject's immune system, regardless of the subject's genetic makeup or any pre-existing responses in the subject to one or more previous allogeneic transplants, previous rejection of autologous chimeric antigen receptor (CAR) T cells, and / or other autologous or allogeneic therapies in which the transgene is expressed. Engineered cells may include, but are not limited to, beta islet cells, B cells, T cells, NK cells, retinal pigment epithelial cells, glial progenitor cells, endothelial cells, hepatocytes, thyroid cells, skin cells, and blood cells (e.g., plasma cells or platelets).
[0139] In some aspects, engineered cells and populations thereof are provided herein that are further protected from complement-dependent cytotoxicity (CDC). The complement system consists of several soluble factors present in serum, which can be activated through different pathways. Complement is activated by the binding of IgM / IgG antibodies, such as anti-A and / or anti-B antibodies from ABO-incompatible serum, to antigens present on the cell surface. Once activated, the cascade leads to the formation of the membrane attack complex (MAC), which introduces holes in the cell membrane and causes cell killing (Nesargikar PN. Eur J Microbiol Immunol (Bp). 2012;2:103-11). In some embodiments, the engineered cells provided herein exhibit reduced activation of the complement cascade, including in the presence of antibodies against HLA-independent antibodies (e.g., in the presence of IgG or IgM antibodies, such as antibodies against ABO blood group antigen A and / or ABO blood group antigen A found in a patient's ABO-incompatible serum).
[0140] Cells, including hiPSCs and hECs, endogenously express inhibitors of complement-mediated cytotoxicity, including the membrane-bound complement inhibitors CD46, CD55, and CD59. However, the examples herein demonstrate that endogenous expression of CD46, CD55, and CD59 does not protect cells from CDC, even in the context of cells with increased expression of tolerogenic factors and reduced expression of one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, the present application provides combinations of complement inhibitors (CD46 and CD59) that can be overexpressed in certain engineered cells to avoid or reduce the effects of complement-dependent cytotoxicity. In some embodiments, the engineered cells provided herein have increased expression of CD46 and CD59. In some embodiments, the engineered cells provided herein have increased expression of CD46, CD59, and CD55. In some embodiments, the engineered cells provided herein have increased expression of any one or more tolerogenic factors described herein and / or reduced expression of one or more MHC class I molecules and / or one or more MHC class II molecules.
[0141] In some embodiments, the engineered cells described herein further comprise increased expression and / or overexpression of one or more complement inhibitors. In some embodiments, the one or more complement inhibitors are selected from CD46, CD59, and CD55. In some embodiments, the engineered cells comprise increased expression of two or more complement inhibitors in combination, e.g., increased expression of CD46 and CD59 or increased expression of CD46, CD59, and CD55.
[0142] The engineered cells provided herein can utilize expression of tolerogenic factors to modulate (e.g., reduce or eliminate) the expression (e.g., surface expression) of one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, genome editing techniques utilizing rare-cutting endonucleases (e.g., CRISPR / Cas, TALEN, zinc finger nucleases, meganucleases, and homing endonuclease systems) are also used to reduce or eliminate the expression of essential immune genes in human cells (e.g., by deleting the genomic DNA of the essential immune genes). In certain embodiments, genome editing or other gene regulation techniques are used to insert tolerance-inducing (tolerogenic) factors (e.g., CD47) in human cells, thereby producing engineered cells that can evade immune recognition upon transplantation into a recipient subject. Thus, the engineered cells provided herein exhibit regulated expression (e.g., reduced expression or elimination) of one or more genes and factors affecting one or more MHC class I molecules and / or one or more MHC class II molecules, regulated expression (e.g., reduced or and / or overexpression) of tolerogenic factors such as CD47, allowing for reduced recognition by the recipient subject's immune system. In some embodiments, the engineered cells provided herein exhibit regulated expression (e.g., reduced expression) of CD142. In some embodiments, the engineered cells provided herein exhibit regulated expression (e.g., increased expression) of one or more complement inhibitors selected from CD46, CD59, and CD55.
[0143] In some aspects, the engineered cells provided herein exhibit reduced innate immune cell rejection and / or adaptive immune cell rejection (e.g., hypoimmunogenic cells). For example, in some embodiments, the engineered cells exhibit reduced susceptibility to NK cell-mediated lysis and / or phagocytosis by macrophages. In some embodiments, the engineered cells are useful as a source of universally compatible cells or tissues (e.g., universal donor cells or tissues) that can be transplanted into a recipient subject with little to no need for immunosuppressive drugs. Such hypoimmunogenic cells retain cell-specific properties and characteristics upon transplantation.
[0144] Also provided herein are methods for treating disorders comprising administering engineered cells (e.g., engineered primary cells) that circumvent immune rejection in an MHC-mismatched allogeneic recipient. In some embodiments, the engineered cells produced by any one of the methods described herein circumvent immune rejection when repeatedly administered (e.g., transplanted or grafted) into an MHC-mismatched allogeneic recipient.
[0145] The practice of particular embodiments will employ, unless otherwise indicated to the contrary, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology, and cell biology, which are within the skill of those in the art, many of which are described below by way of illustration, and such techniques are explained more fully in the literature.For example, Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001), Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989), Maniatis et al., Molecular Cloning: A Laboratory Manual (1982), Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008), Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience, Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985), Anand, Techniques for the Analysis of Complex Genomes, (Academic Press, New York, 1992), Transcription and Translation(B.Hames & See research articles in publications such as S. Higgins, Eds., 1984), Perbal, A Practical Guide to Molecular Cloning (1984), Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998), Current Protocols in Immunology QE Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991), Annual Review of Immunology, and Advances in Immunology.
[0146] All publications referenced in this application, including patent documents, scientific articles, and databases, are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication was individually incorporated by reference. To the extent that a definition set forth herein contradicts or is otherwise inconsistent with a definition set forth in a patent, application, application publication, or other publication incorporated herein by reference, the definition set forth herein shall take precedence over the definition incorporated herein by reference.
[0147] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description is illustrative of the disclosure and, of course, should not be construed as in any way limiting the scope of the invention described herein.
[0148] I. Definition Unless otherwise defined, all terminology, notations, and other technical and scientific or terminology used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of the claimed invention belongs. In some instances, terms having a commonly understood meaning are defined herein for clarity and / or ease of reference, and the incorporation of such definitions herein should not necessarily be construed as representing a substantial difference from the meaning commonly understood in the art.
[0149] The term "about," as used herein when referring to a measurable value, such as an amount or concentration, is intended to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the stated amount. As used herein, including the appended claims, the singular forms "a," "or," and "the" include plural referents unless the context clearly dictates otherwise. For example, "a" or "an" means "at least one" or "one or more." Aspects and variations described herein are understood to include embodiments "consisting of" and / or "consisting essentially of" such aspects and variations.
[0150] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0151] As used herein, the term "exogenous" with respect to a polypeptide or polynucleotide is intended to mean that the referred molecule is introduced into a cell of interest. An exogenous molecule, such as an exogenous polynucleotide, can be introduced, for example, by introducing an exogenous encoding nucleic acid into the genetic material of a cell, such as by integration into a chromosome or as non-chromosomal genetic material such as a plasmid or expression vector. Thus, when used in reference to expression of an encoding nucleic acid, the term refers to the introduction of the encoding nucleic acid into the cell in an expressible form. In some cases, an "exogenous" molecule is a molecule, construct, factor, etc. that is not normally present in the cell but that can be introduced into the cell by one or more genetic, biochemical, or other methods.
[0152] The term "endogenous" refers to a referent molecule, e.g., a polynucleotide (e.g., a gene) or polypeptide, that is present in a natural or unmodified cell. For example, when used with reference to endogenous gene expression, the term refers to expression of a gene encoded by an endogenous, not exogenously introduced, nucleic acid contained within the cell.
[0153] A "gene" includes the DNA region that encodes a gene product, as well as all DNA regions that regulate the production of that gene product (whether or not such regulatory sequences flank the coding and / or transcribed sequence). Thus, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences, such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions. The sequence of a gene typically resides at a fixed chromosomal location within a cell or at a locus on a chromosome.
[0154] The term "locus" refers to a fixed location on a chromosome where a particular gene or genetic marker is located. Reference to a "target locus" refers to the specific locus of a desired gene at which one wishes to target a genetic modification, such as gene editing or integration of an exogenous polynucleotide.
[0155] The term "expression" or "gene expression," with respect to a gene, refers to the conversion of the information contained in a gene into a gene product. A gene product may be the direct transcription product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNAs that are modified by processes such as capping, polyadenylation, methylation, and editing, as well as proteins that are modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristoylation, and glycosylation. Thus, reference to expression or gene expression includes protein (or polypeptide) expression or expression of a transcribable product of a gene, such as mRNA. Protein expression can include intracellular or surface expression of a protein. Typically, expression of a gene product, such as mRNA, or protein is at a detectable level in a cell.
[0156] As used herein, a "detectable" expression level refers to a level that is detectable by standard techniques known to those of skill in the art, including, for example, differential display, RT (reverse transcriptase)-linked polymerase chain reaction (PCR), Northern blot, and / or RNase protection analysis, as well as immunoaffinity-based methods for protein detection such as flow cytometry, ELISA, or Western blot. The degree of expression level need only be great enough to be visualized or measured via standard characterization techniques.
[0157] As used herein, the terms "increased expression," "enhanced expression," or "overexpression" refer to any form of expression that is additional to expression in an original or source cell that does not contain a modification to regulate expression of a particular gene, e.g., wild-type expression levels (which may be absent or unmeasurable expression). References herein to "increased expression," "enhanced expression," or "overexpression" are interpreted to mean an increase in gene expression, and / or, insofar as a polypeptide is referred to, an increased polypeptide level and / or increased polypeptide activity, compared to levels in a cell that does not contain the modification, such as an original source cell prior to manipulation to introduce the modification, such as an unmodified cell or a wild-type cell. The increase in expression, polypeptide level, or polypeptide activity may be at least 5%, 10%, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 85%, 90%, or 100%, or even more. In some cases, the increase in expression, polypeptide level or polypeptide activity may be at least 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold or more.
[0158] The term "hypoimmunogenic" refers to cells that are less likely to be immune rejected by a subject into which they are transplanted. For example, compared to similar cells of the same cell type but containing no modification, such as unaltered or unmodified wild-type cells, such hypoimmunogenic cells may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or more less likely to be immune rejected by a subject into which they are transplanted. Typically, hypoimmunogenic cells are allogeneic to the subject, and hypoimmunogenic cells avoid immune rejection in an MHC-mismatched allogeneic recipient. In some embodiments, hypoimmunogenic cells are protected from T-cell-mediated adaptive immune rejection and / or innate immune cell rejection.
[0159] The low immunogenicity of a cell can be determined by assessing the immunogenicity of the cell, such as the ability of the cell to elicit adaptive and innate immune responses, which can be measured using assays recognized by those skilled in the art.
[0160] As used herein, the term "tolerogenic factor" includes immunosuppressive or immunomodulatory factors that modulate or affect the ability of cells to be recognized by the host or recipient subject's immune system upon administration, transplantation, or engraftment. Typically, a tolerogenic factor is a factor that induces immune tolerance to the engineered primary cells such that the engineered primary cells are not targeted, e.g., rejected, by the recipient's host immune system. Thus, a tolerogenic factor can be a hypoimmune factor. Examples of tolerogenic factors include inhibitory receptors on immune cells (e.g., CD47), proteins that bind to inhibitory receptors on immune cells, checkpoint inhibitors, and other molecules that reduce recognition by innate or adaptive immunity.
[0161] The terms "reduce," "reduced," "reduction," and "reduction" are all used herein to generally mean a statistically significant reduction. However, for the avoidance of doubt, "reduce," "reduced," "reduction," and "reduction" refer to a reduction of at least 10% compared to the reference level, for example, a reduction of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% compared to the reference level, or a reduction of up to and including 100% (i.e., a level absent compared to the reference sample), or any reduction between 10 and 100%.
[0162] The terms "increased," "increase," or "enhance" or "activate" are all used herein to generally mean an increase by a statistically significant amount. For the avoidance of doubt, the terms "increased," "increase," or "enhance" or "activate" mean an increase of at least 10% compared to a reference level, for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% compared to a reference level, or an increase of up to and including 100%, or any increase between 10 and 100%, or an increase of at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold, or any increase between 2-fold and more than 10-fold compared to a reference level.
[0163] As used herein, the term "modification" refers to any change or alteration in a cell that affects gene expression in the cell. In some embodiments, the modification is a genetic modification that directly changes the gene encoding a protein product or its regulatory elements in the cell, for example, by gene editing, mutagenesis, or by genetic manipulation of an exogenous polynucleotide or transgene.
[0164] As used herein, "indel" refers to a mutation caused by the insertion, deletion, or combination thereof of a nucleotide base in a genome. Thus, an indel typically inserts or deletes a nucleotide from a sequence. As will be understood by those skilled in the art, an indel in the coding region of a genome sequence will result in a frameshift mutation unless the length of the indel is a multiple of three. The CRISPR / Cas system of the present disclosure can be used to induce indels of any length in a target polynucleotide sequence.
[0165] In some embodiments, the change is point mutation.As used herein, " point mutation " refers to the substitution of one of nucleotides.The CRISPR / Cas system of the present disclosure can be used to induce any length of indel or point mutation in target polynucleotide sequence.
[0166] As used herein, "knockout" refers to the deletion of all or part of a target polynucleotide sequence, so as to disrupt the function of the target polynucleotide sequence.For example, knockout can be achieved by changing the target polynucleotide sequence by inducing an indel in the target polynucleotide sequence in the functional domain (e.g., DNA binding domain) of the target polynucleotide sequence.Based on the details described herein, those skilled in the art will easily understand how to use the CRISPR / Cas system of the present disclosure to knock out a target polynucleotide sequence or a part thereof.
[0167] In some embodiments, the alteration results in the knockout of the target polynucleotide sequence or a portion thereof. Knocking out the target polynucleotide sequence or a portion thereof using the CRISPR / Cas system of the present disclosure can be useful for various applications. For example, knocking out the target polynucleotide sequence in a cell can be performed in vitro for research purposes. For ex vivo purposes, knocking out the target polynucleotide sequence in a cell can be useful for treating or preventing disorders associated with the expression of the target polynucleotide sequence (for example, by knocking out a mutant allele in cells ex vivo and introducing those cells containing the knocked-out mutant allele into a subject).
[0168] "Knock-in" as used herein refers to the process of adding gene function to a host cell. This results in an increase in the level of the knocked-in gene product, such as RNA or the encoded protein. As will be understood by those skilled in the art, this can be accomplished in several ways, including adding one or more additional copies of the gene to the host cell, or changing the regulatory components of the endogenous gene to increase the expression of the protein produced. This can be accomplished by modifying the promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.
[0169] In some embodiments, the changes or modifications described herein result in reduced expression of a target or selected polynucleotide sequence. In some embodiments, the changes or modifications described herein result in reduced expression of a target or selected polypeptide sequence.
[0170] In some embodiments, the changes or modifications described herein result in increased expression of a target or selected polynucleotide sequence. In some embodiments, the changes or modifications described herein result in increased expression of a target or selected polypeptide sequence.
[0171] "Modulation" of gene expression refers to a change in the expression level of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Modulation can also be complete (i.e., gene expression is completely inactivated or activated to wild-type levels or above), or it can be partial (gene expression is partially reduced or partially activated to a fraction of wild-type levels).
[0172] The terms "operably linked" or "operably linked" are used interchangeably in reference to the juxtaposition of two or more components (such as sequence elements) that allow for the possibility that both components function normally and that at least one of the components may mediate a function on at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operably linked to a coding sequence in cis, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operably linked to a coding sequence, even if they are not contiguous.
[0173] As used herein, the terms "polypeptide" and "protein" may be used interchangeably to refer to a string of amino acid residues joined by peptide bonds (i.e., a polymer of amino acid residues) and are not limited to a minimum length. Such polymers may contain natural or unnatural amino acid residues, or combinations thereof, including, but not limited to, peptides, polypeptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Thus, proteins or polypeptides include those with modified amino acids (e.g., phosphorylation, glycation, glycosylation, etc.) and amino acid analogs. Full-length polypeptides or proteins, as well as fragments thereof, are encompassed by this definition. The term also includes modified species thereof, such as post-translational modifications of one or more residues, e.g., methylation, phosphorylation, glycosylation, sialylation, or acetylation.
[0174] Throughout this disclosure, various aspects of the claimed subject matter are presented in range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as a fixed limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to include all possible subranges specifically disclosed, as well as individual numerical values within that range. For example, when a range of values is provided, it is understood that, unless the context clearly dictates otherwise, each intervening value between the upper and lower limits of that range, to the tenth of the unit of the lower limit, and any other stated or intervening value in that stated range, is encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure. In some embodiments, two opposing open-ended ranges are provided for a feature, and in such descriptions, it is contemplated that combinations of those two ranges are provided herein. For example, in some embodiments, a feature may be described as being greater than about 10 units and (e.g., in separate sentences) as being less than about 20 units, and thus a range of about 10 units to about 20 units is described herein.
[0175] As used herein, a "subject" or "individual," the terms used interchangeably, is a mammal. In some embodiments, "mammal" includes humans, non-human primates, domestic and livestock animals, as well as zoo, sport, or pet animals, such as dogs, horses, rabbits, cows, pigs, hamsters, gerbils, mice, ferrets, rats, cats, monkeys, etc. In some embodiments, a subject or individual is a human. In some embodiments, a subject is a patient who is found to have or is suspected of having a disease, disorder, or condition.
[0176] As used herein, the terms "treating" and "treatment" include administering an effective amount of the cells described herein to a subject so that the subject experiences a reduction in at least one symptom of the disease or an improvement in the disease, e.g., a beneficial or desired clinical result. For purposes of the present technology, a beneficial or desired clinical result includes, but is not limited to, alleviation of one or more symptoms, whether detectable or undetectable, attenuation of the extent of the disease, a stabilized (i.e., not worsening) disease state, a delay or slowing of disease progression, an improvement or palliation of the disease state, and remission (whether partial or complete). Treating may refer to extending survival compared to the expected survival in the absence of treatment. Thus, those skilled in the art recognize that treatment may improve a condition but may not be a complete cure for the disease. In some embodiments, one or more symptoms of a disease or disorder are alleviated by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% upon treatment of the disease.
[0177] For purposes of the present technology, beneficial or desired clinical results of disease treatment include, but are not limited to, alleviation of one or more symptoms, whether detectable or undetectable, attenuation of the extent of the disease, a stabilized (i.e., not worsening) disease state, delay or slowing of disease progression, improvement or palliation of the disease state, and remission (whether partial or complete).
[0178] A "vector" or "construct" is capable of transferring a gene sequence into a target cell. Typically, the terms "vector construct," "expression vector," and "gene transfer vector" refer to any nucleic acid construct that can direct the expression of a gene of interest and transfer the gene sequence into a target cell. Thus, the term includes cloning and expression vehicles as well as integrating vectors. Methods for introducing a vector or construct into a cell are known to those skilled in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes containing neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran-mediated transfer, and viral vector-mediated transfer.
[0179] II. Engineered Cells and Methods of Engineering Cells Provided herein are engineered cells comprising one or more modification(s) that increase expression of CD46 and CD59. In some embodiments, the modification(s) also increase expression of CD55. In some embodiments, the modification(s) that increase expression of CD46, CD59, and / or CD55 increase protein expression of CD46, CD59, and / or CD55. In some embodiments, the modification(s) that increase expression comprise increased surface expression, and / or the modification that reduces expression comprise decreased surface expression. In some embodiments, the modification(s) that increase expression of one or more complement inhibitors comprise an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and / or an exogenous polynucleotide encoding CD55.
[0180] In some embodiments, the one or more complement inhibitors are CD46 and CD59, and optionally, the modification comprises an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59. In some embodiments, the one or more complement inhibitors are CD46, CD59, and CD55, and optionally, the modification comprises an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding CD55. In some embodiments, the engineered cells are A multicistronic vector comprising two or more exogenous polypeptides selected from the group consisting of one or more exogenous polynucleotides encoding one or more tolerogenic factors, an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding a CD55 polypeptide. In some embodiments, each of the polynucleotides is separated by an IRES or a self-cleaving peptide.
[0181] In some embodiments, the engineered cells provided also contain one or more target polynucleotide sequence modifications that regulate the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules.
[0182] In some embodiments, the provided engineered cells also comprise a modification to increase expression of one or more tolerogenic factors. In some embodiments, the tolerogenic factors are one or more of DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3, or any combination thereof. In some embodiments, the modification to increase expression of the one or more tolerogenic factors is or comprises increased expression of CD47. In some embodiments, the modification to increase expression of the one or more tolerogenic factors is or comprises increased expression of PD-L1. In some embodiments, the modification that increases the expression of one or more tolerogenic factors is or includes increased expression of HLA-E. In some embodiments, the modification that increases the expression of one or more tolerogenic factors is or includes increased expression of HLA-G. In some embodiments, the modification that increases the expression of one or more tolerogenic factors is or includes increased expression of CCL21, PD-L1, FasL, Serpinb9, H2-M3 (HLA-G), CD47, CD200, and Mfge8.
[0183] In some embodiments, the cells comprise one or more genomic modifications that reduce expression of one or more MHC class I molecules and a modification that increases expression of CD47. In other words, the engineered cells comprise exogenous CD47 protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells comprise one or more genomic modifications that reduce expression of one or more MHC class II molecules and a modification that increases expression of CD47. In some cases, the engineered cells comprise exogenous CD47 nucleic acid and protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells comprise one or more genomic modifications that reduce or eliminate expression of one or more MHC class II molecules, one or more genomic modifications that reduce or eliminate expression of one or more MHC class II molecules, and a modification that increases expression of CD47. In some embodiments, the engineered cells comprise exogenous CD47 protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules and reduced or absent surface expression of one or more MHC class II molecules. In many embodiments, the cells are B2M インデル / インデル , C.I.T.A. インデル / インデル , CD47tg cells.
[0184] In some embodiments, any of the gene editing techniques can be used to reduce the expression of one or more target polynucleotides or target proteins as described. In some embodiments, the gene editing technique can include systems involving nucleases, integrases, transposases, and recombinases. In some embodiments, the gene editing technique can be used to knock out or knock down genes. In some embodiments, the gene editing technique can be used to knock in or integrate DNA into a region of the genome. In some embodiments, the gene editing technique mediates single-strand breaks (SSBs). In some embodiments, the gene editing technique mediates double-strand breaks (DSBs), including those associated with non-homologous end joining (NHEJ) or homology-directed repair (HDR). In some embodiments, the gene editing technique can include DNA-based editing or primed editing. In some embodiments, the gene editing technique can include Programmable Addition via Site-specific Targeting Elements (PASTE).
[0185] In some embodiments, the gene editing technology relates to base editing. Base editors (BEs) are typically fusions of a Cas ("CRISPR-associated") domain and a nucleobase-modifying domain (e.g., a naturally occurring or evolved deaminase domain, such as cytidine deaminases including APOBEC1 ("apolipoprotein B mRNA-editing enzyme, catalytic polypeptide 1"), CDA ("cytidine deaminase"), and AID ("activation-induced cytidine deaminase"). In some cases, base editors may also include proteins or domains that alter cellular DNA repair processes to increase the efficiency and / or stability of the resulting single-base changes.
[0186] In some embodiments, currently available base editors include a cytidine base editor (e.g., BE4) that converts a targeted C·G to a T·A, and an adenine base editor (e.g., ABE7.10) that converts a targeted A·T to a G·C. In some embodiments, Cas9 targeted deamination was first demonstrated in the context of a base editor (BE) system designed to induce base changes without introducing double-stranded DNA breaks. Furthermore, rat deaminase APOBEC1 (rAPOBEC1) fused to an inactive Cas9 (dCas9) was used to successfully convert a cytidine to a thymidine upstream of the PAM of an sgRNA. In some embodiments, this initial BE system was optimized by modifying dCas9 with the "nickase" Cas9 D10A, which nicks the strand opposite the deaminated cytidine. Without being bound by theory, this is predicted to initiate long-patch base excision repair (BER), in which the deaminated strand is preferentially used as a repair template to generate a U:A base pair, which is then converted to a T:A during DNA replication.
[0187] In some embodiments, the base editor is a nucleic acid base editor that contains a catalytically inactive first DNA-binding protein domain, a domain with base-editing activity, and a second DNA-binding protein domain with nickase activity, where the DNA-binding protein domains are expressed on a single fusion protein or are expressed separately (e.g., on separate expression vectors). In some embodiments, the base editor is a fusion protein that includes a domain with base-editing activity (e.g., cytidine deaminase or adenosine deaminase) and two nucleic acid programmable DNA binding protein domains (napDNAbp), a first napDNAbp that includes nickase activity and a second napDNAbp that is catalytically inactive, where at least two napDNAbp are connected by a linker. In some embodiments, the base editor is a fusion protein comprising a DNA domain of CRISPR-Cas (e.g., Cas9) with nickase activity (nCas; nCas9), a catalytically inactive domain of a CRISPR-Cas protein (e.g., Cas9) with nucleic acid-programmable DNA-binding activity (dCas; e.g., dCas9), and a deaminase domain, where dCas is tethered to nCas by a linker such that dCas is directly adjacent to the deaminase domain. In some embodiments, the base editor is an adenine-to-thymine, or "ATBE," (or thymine-to-adenine, or "TABE") transversion base editor.Exemplary base editors and base editor systems include any of those described in Patent Publication Nos. US20220127622, US20210079366, US20200248169, US20210093667, US20210071163, WO2020181202, WO2021158921, WO2019126709, WO2020181178, WO2020181195, WO2020214842, and WO2020181193, which are incorporated by reference in their entireties.
[0188] In some embodiments, the gene editing technique is target-primed reverse transcription (TPRT) or "prime editing." In some embodiments, prime editing mediates targeted insertions, deletions, all 12 possible base-to-base conversions, and combinations thereof in human cells without the need for DSBs or donor DNA templates.
[0189] Prime editing is a genome editing method that uses a nucleic acid-programmable DNA-binding protein ("napDNAbp"), working in conjunction with a polymerase (i.e., in the form of a fusion protein or otherwise provided in trans to a napDNAbp), to directly write new genetic information into a designated DNA site. Here, the prime editing system is programmed with a prime editing (PE) guide RNA ("PEgRNA") that specifies the target site and serves as a template for synthesis of the desired edit in the form of a replacement DNA strand as an engineered extension (either DNA or RNA) introduced onto the guide RNA (e.g., at the 5' or 3' end of the guide RNA or within its internal portion). The replacement strand, containing the desired edit (e.g., a single nucleobase substitution), shares the same sequence (except that it contains the desired edit) as the endogenous strand at the target site to be edited. Through DNA repair and / or replication mechanisms, the endogenous strand at the target site is replaced by the newly synthesized replacement strand containing the desired edit. In some cases, prime editing can be considered a "search-and-replace" genome editing technique, as the prime editor searches for and locates the desired target site to be edited while simultaneously encoding a replacement strand containing the desired edit that is installed in place of the endogenous DNA strand at the corresponding target site. For example, prime editing can be adapted to perform high-precision CRISPR / Cas-based genome editing to bypass double-strand breaks. In some embodiments, the homologous protein is or encodes a Cas protein-reverse transcriptase fusion or related system that targets a specific DNA sequence with a guide RNA, generates a single-stranded nick at the target site, and uses the nick DNA as a primer for reverse transcription of an engineered reverse transcriptase template integrated with the guide RNA. In some embodiments, the prime editor protein pairs with two prime editing guide RNAs (pegRNAs) that template the synthesis of complementary DNA flaps on opposing strands of genomic DNA, resulting in the replacement of the endogenous DNA sequence between the sites of the PE-induced nick with the sequence encoded by the pegRNAs.
[0190] In some embodiments, the gene editing technology is associated with a prime editor, which is a reverse transcriptase or any DNA polymerase known in the art. Thus, in one aspect, the prime editor may comprise Cas9 (or equivalently napDNAbp), which is programmed to target a DNA sequence by associating with a specialized guide RNA (i.e., PEgRNA) that contains a spacer sequence that anneals to a complementary protospacer in the target DNA. Such methods include those disclosed in Anzalone et al., (doi.org / 10.1038 / s41586-019-1711-4), or PCT Publication No. WO2020191248, WO2021226558, or WO2022067130, which are incorporated herein by reference in their entirety.
[0191] In some embodiments, the gene editing technology is programmable addition of site-specific targeting elements (PASTE). In some aspects, PASTE is a platform in which genomic insertion is directed via a CRISPR-Cas9 nickase fused to both a reverse transcriptase and a serine integrase. As described by Ioannidi et al. (doi.org / 10.1101 / 2021.11.01.466786), PASTE does not generate double-strand breaks but allows for the integration of sequences as large as approximately 36 kb. In some embodiments, the serine integrase can be any known in the art. In some embodiments, the serine integrase has sufficient orthogonality so that PASTE can be used for multiplexed gene integration, simultaneously integrating at least two different genes at at least two genomic loci. In some embodiments, PASTE is active in non-dividing cells, has fewer detectable off-target events, and has editing efficiency comparable to or better than that of homology-directed repair or non-homologous end-joining-based integration.
[0192] In some embodiments, the populations of engineered cells described elicit reduced levels of immune activation or no immune activation upon administration to a recipient subject. In some embodiments, the cells elicit reduced levels of systemic TH1 activation or no systemic TH1 activation in the recipient subject. In some embodiments, the cells elicit reduced levels of peripheral blood mononuclear cell (PBMC) immune activation or no PBMC immune activation in the recipient subject. In some embodiments, the cells elicit reduced levels of donor-specific IgG antibodies against the cells or no donor-specific IgG antibodies against the cells upon administration to a recipient subject. In some embodiments, the cells elicit reduced levels of IgM and IgG antibody production against the cells or no IgM and IgG antibody production in the recipient subject. In some embodiments, the cells elicit reduced levels of cytotoxic T cell killing of the cells upon administration to a recipient subject.
[0193] In some embodiments, the engineered cells provided herein contain a "suicide gene" or "suicide switch." The suicide gene or suicide switch can be incorporated to function as a "safety switch" that can trigger the death of engineered cells (e.g., engineered primary cells or cells differentiated from engineered pluripotent stem cells) after the engineered cells are administered to a subject, as well as in situations where the cells grow and divide in an undesired manner. The "suicide gene" ablation approach involves a suicide gene in a gene transfer vector that encodes a protein that results in cell killing only when activated by a specific compound. The suicide gene can encode an enzyme that selectively converts non-toxic compounds into highly toxic metabolites, resulting in the specific elimination of cells expressing the enzyme. In some embodiments, the suicide gene is the herpes virus thymidine kinase (HSV-tk) gene and the trigger is ganciclovir. In other embodiments, the suicide gene is the Escherichia coli cytosine deaminase (EC-CD) gene and the trigger is 5-fluorocytosine (5-FC) (Barese et al, Mol. Therap. 20(10):1932-1943 (2012); Xu et al, Cell Res. 8:73-8 (1998) (both of which are incorporated by reference in their entireties).
[0194] In other embodiments, the suicide gene is an inducible caspase protein. The inducible caspase protein comprises at least a portion of a caspase protein capable of inducing apoptosis. In some embodiments, the inducible caspase protein is iCasp9. It comprises the sequence of the human FK506-binding protein FKBP12 with the F36V mutation connected to the gene encoding human caspase 9 via a stretch of amino acids. FKBP12-F36V binds with high affinity to API903, a small molecule dimerizer. Therefore, the suicide function of iCasp9 of the present invention is invoked by administration of a dimer-inducing compound (CID). In some embodiments, the CID is the small molecule drug API903. Dimerization leads to the rapid induction of apoptosis (see, e.g., WO2011146862; Stasi et al, N. Engl. J. Med 365;18 (2011); Tey et al, Biol. Blood Marrow Transplant. 13:913-924 (2007), each of which is incorporated herein by reference in its entirety).
[0195] The incorporation of a safety switch or suicide gene allows for controlled killing of cells in the event of a cytotoxic event or other negative outcome in the recipient, thus increasing the safety of cell-based therapies, including those that use tolerogenic factors.
[0196] In some embodiments, a safety switch can be incorporated into, e.g., introduced into, an engineered cell provided herein to provide the ability to induce death or apoptosis of the engineered cell containing the safety switch, e.g., if the cell grows and divides in an undesirable manner or causes excessive toxicity to the host. Thus, the use of a safety switch allows for the conditional elimination of abnormal cells in vivo, which may be an essential step for the application of cell therapy in a clinical setting. Safety switches and their uses are described, for example, in Duzgune §, Origins of Suicide Gene Therapy (2019), Duzgune § (eds), Suicide Gene Therapy. Methods in Molecular Biology, vol. 1895 (Humana Press, New York, NY) (for HSV-tk, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, and horseradish peroxidase), Zhou and Brenner, Exp Hematol 44(11):1013-1019 (2016) (for iCaspase9), Wang et al., Blood 18(5):1255-1263 (2001) (for huEGFR), U.S. Patent Application Publication No. 20180002397 (for HER1), and Philip et al. al., Blood 124(8):1277-1287 (2014) (for RQR8).
[0197] In some embodiments, the safety switch can cause cell death in a controlled manner, for example, in the presence of a drug or prodrug, or upon activation by a selective exogenous compound. In some embodiments, the safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.
[0198] In some embodiments, the safety switch may be a transgene encoding a product capable of killing a cell when activated by a drug or prodrug, for example, by converting a non-toxic prodrug into a toxic metabolite inside the cell. In these embodiments, cell killing is activated by contacting the engineered cell with the drug or prodrug. In some cases, the safety switch is HSV-tk, which converts ganciclovir (GCV) to GCV triphosphate, thereby disrupting DNA synthesis and killing dividing cells. In some cases, the safety switch is CyD or a variant thereof, which converts the antifungal drug 5-fluorocytosine (5-FC) to the cytotoxic 5-fluorouracil (5-FU) by catalyzing the hydrolytic deamination of cytosine to uracil. 5-FU is further converted by cellular enzymes to potent antimetabolites (5-FdUMP, 5-FdUTP, 5-FUTP). These compounds inhibit thymidylate synthase and the production of RNA and DNA, resulting in cell death. In some cases, the safety switch is NTR or a variant thereof, which can act on the prodrug CB 1954 via reduction of the nitro group to a reactive N-hydroxylamine intermediate that is toxic in proliferating and non-proliferating cells. In some cases, the safety switch is PNP or a variant thereof, which can convert the prodrug 6-methylpurine deoxyriboside or fludarabine to a metabolite that is toxic to both proliferating and non-proliferating cells. In some cases, the safety switch is horseradish peroxidase or a variant thereof, which can catalyze indole-3-acetic acid (IAA) to a potent cytotoxin, thereby achieving cell killing.
[0199] In some embodiments, the safety switch may be iCasp9. Caspase-9 is a component of the mitochondrial intrinsic apoptotic pathway that is activated by the release of cytochrome C from damaged mitochondria under physiological conditions. Activated caspase-9 then activates caspase-3, which triggers terminal effector molecules leading to apoptosis. iCasp9 can be generated by fusing a truncated caspase-9 (which does not contain its physiological dimerization domain or caspase activation domain) to FK506-binding protein (FKBP), FKBP12-F36V, via a peptide linker. iCasp9 has low basal activity that is dimer-independent and can be stably expressed in host cells (e.g., human T cells) without compromising their phenotype, function, or antigen specificity. However, in the presence of dimer-inducing compounds (CIDs) such as rimiduside (AP1903), AP20187, and rapamycin, iCasp9 can undergo inducible dimerization and activate downstream caspase molecules, leading to apoptosis of cells expressing iCasp9. See, e.g., PCT Publication No. WO 2011 / 146862; Stasi et al., N. Engl. J. Med. 365;18 (2011); Tey et al., Biol. Blood Marrow Transplant 13:913-924 (2007). In particular, the rapamycin-inducible caspase 9 variant is referred to as rapaCasp9. See, e.g., Stavrou et al., Mal. Ther. 26(5):1266-1276 (2018). Thus, iCasp9 can be used as a safety switch to achieve controlled killing of host cells.
[0200] In some embodiments, the safety switch may be a membrane-expressed protein, which allows cell depletion after administration of an antibody specific for that protein. This class of safety switch may include one or more transgenes encoding, for example, CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, or RQR8 for surface expression. These proteins may have surface epitopes that can be targeted by specific antibodies. In some embodiments, the safety switch includes CCR4, which can be recognized by an anti-CCR4 antibody. Non-limiting examples of suitable anti-CCR4 antibodies include mogamulizumab and its biosimilars. In some embodiments, the safety switch includes CD16 or CD30, which can be recognized by an anti-CD16 or anti-CD30 antibody. Non-limiting examples of such anti-CD16 or anti-CD30 antibodies include AFM13 and its biosimilars. In some embodiments, the safety switch includes CD19, which can be recognized by an anti-CD19 antibody. Non-limiting examples of such anti-CD19 antibodies include MOR208 and its biosimilars. In some embodiments, the safety switch comprises a CD20 that can be recognized by an anti-CD20 antibody. Non-limiting examples of such anti-CD20 antibodies include obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-RIIb, and their biosimilars. Thus, cells expressing the safety switch are CD20 positive and can be targeted for killing by administration of the described anti-CD20 antibodies. In some embodiments, the safety switch comprises an EGFR that can be recognized by an anti-EGFR antibody. Non-limiting examples of such anti-EGFR antibodies include tomzotuximab, RO5083945 (GA201), cetuximab, and their biosimilars. In some embodiments, the safety switch comprises GD2 that can be recognized by an anti-GD2 antibody. Non-limiting examples of such anti-GD2 antibodies include Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-RIIc, and their biosimilars.
[0201] In some embodiments, the safety switch may be an exogenously administered agent that recognizes one or more tolerogenic factors on the surface of the engineered cells. In some embodiments, the exogenously administered agent is an antibody directed against or specific for the tolerogenic agent, e.g., an anti-CD47 antibody. By recognizing and blocking the tolerogenic factor on the engineered cells, the exogenously administered antibody may block the immunosuppressive function of the tolerogenic factor, thereby resensitizing the immune system to the engineered cells. For example, in the case of engineered cells that overexpress CD47, an exogenously administered anti-CD47 antibody may be administered to a subject, resulting in blocking CD47 on the engineered cells and eliciting an immune response against the engineered cells.
[0202] In some embodiments, provided herein are methods of generating engineered cells, the methods comprising: (a) reducing or eliminating expression of one or more MHC class I molecules and / or one or more MHC class II molecules in the cell, (b) increasing expression of CD46 and CD59 in the cell, and (c) increasing expression of a tolerogenic factor in the cell. In some embodiments, the one or more tolerogenic factors are selected from DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3. In some embodiments, the one or more tolerogenic factors is CD47. In some embodiments, the method comprises reducing or eliminating expression of one or more MHC class I molecules and one or more MHC class II molecules. In some embodiments, reducing or increasing expression comprises performing one or more modifications to the cell using an inducible nuclease (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing into the cell an expression vector comprising an inducible suicide switch. In some embodiments, the method further comprises increasing expression of CD55 in the cell.
[0203] In some embodiments, provided herein are methods for generating engineered cells, the methods comprising: (a) increasing expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8 in the cells; and (b) increasing expression of CD46 and CD59 in the cells. In some embodiments, reducing or increasing expression comprises performing one or more modifications to the cells using an inducible nuclease (e.g., a CRISPR / Cas system). In some embodiments, the methods further comprise introducing into the cells an expression vector comprising an inducible suicide switch. In some embodiments, the methods further comprise increasing expression of CD55 in the cells.
[0204] In some embodiments, the tolerogenic factor is CD47 and the cell comprises an exogenous polynucleotide encoding a CD47 protein, hi some embodiments, the cell expresses an exogenous CD47 polypeptide.
[0205] In some embodiments, the methods disclosed herein comprise administering a CD47-SIRPα blocking agent to a subject in need thereof, wherein the subject has previously been administered a population of cells engineered to express an exogenous CD47 polypeptide. In some embodiments, the CD47-SIRPα blocking agent comprises a CD47 binding domain. In some embodiments, the CD47 binding domain comprises signal-regulatory protein alpha (SIRPα) or a fragment thereof. In some embodiments, the CD47-SIRPα blocking agent comprises an immunoglobulin G (IgG) Fc domain. In some embodiments, the IgG Fc domain comprises an IgG1 Fc domain. In some embodiments, the IgG1 Fc domain comprises a fragment of a human antibody. In some embodiments, the CD47-SIRPα blocking agent is selected from the group consisting of TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPα blocking agent is TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPα blocking agent is TTI-622. In some embodiments, the CD47-SIRPα blocking agent is ALX148. In some embodiments, the IgG Fc domain comprises an IgG4 Fc domain. In some embodiments, the CD47-SIRPα blocking agent is an antibody. In some embodiments, the antibody is selected from the group consisting of MIAP410, B6H12, and magrolimab. In some embodiments, the antibody is MIAP410. In some embodiments, the antibody is B6H12. In some embodiments, the antibody is magrolimab. In some embodiments, the antibody is selected from the group consisting of AO-176, IBI188 (letaplimab), STI-6643, and ZL-1201. In some embodiments, the antibody is AO-176 (Arch). In some embodiments, the antibody is IBI188 (letaplimab) (Innovent). In some embodiments, the antibody is STI-6643 (Sorrento). In some embodiments, the antibody is ZL-1201 (Zai).
[0206] In some embodiments, useful antibodies or fragments thereof that bind to CD47 include magrolimab ((Hu5F9-G4)) (Forty Seven, Inc.; Gilead Sciences, Inc.), urabrelimab, CC-90002 (Celgene; Bristol-Myers Squibb), IBI-188 (Innovent Biologics), IBI-322 (Innovent Biologics), TG-1801 (TG Therapeutics; also known as NI-1701, Novimmune SA), ALX148 (ALX Oncology), TJ011133 (also known as TJC4, I-Mab Biopharma), FA3M3, ZL-1201 (Zai Lab Co., Ltd), AK117 (Akesbio Australia Pty, Ltd.), AO-176 (Arch Oncology), SRF231 (Surface Oncology), GenSci-059 (GeneScience), C47B157 (Janssen Research and Development), C47B161 (Janssen Research and Development), C47B167 (Janssen Research and Development), C47B222 (Janssen Research and Development), C47B227 (Janssen Research and Development), Vx-1004 (Corvus Pharmaceuticals), HMBD004 (Hummingbird Bioscience Pte Ltd), SHR-1603 (Hengrui), AMMS4-G4 (Beijing Institute of Biotechnology), RTX-CD47 (University of Groningen), and IMC-002 (Samsung Biologics; ImmuneOncia Therapeutics).In some embodiments, the antibody or fragment thereof does not compete for CD47 binding with an antibody selected from the group including magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof competes for CD47 binding with an antibody selected from magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof that binds to CD47 is selected from the group comprising a single chain Fv fragment (scFv) against CD47, a Fab against CD47, a VHH nanobody against CD47, a DARPin against CD47, and variants thereof. In some embodiments, the scFv against CD47, Fab against CD47, and variants thereof are based on the antigen-binding domain of any of the antibodies selected from the group including magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002.
[0207] In some embodiments, the CD47 antagonist provides CD47 blockade. Methods and agents for CD47 blockade are described in PCT / US2021 / 054326, which is incorporated herein by reference in its entirety.
[0208] Once altered, the presence of expression of any of the molecules described herein can be assayed using known techniques such as Western blot, ELISA assay, FACS assay, and the like.
[0209] A. Reduced expression of target genes 1. Target Gene A. MHC class I molecules and / or MHC class II molecules In some embodiments, the engineered cells provided comprise modifications (e.g., genetic modifications) of one or more target polynucleotide or protein sequences (interchangeably referred to as target genes) that modulate (e.g., reduce or eliminate) the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In some embodiments, the cells to be modified or engineered are unmodified or unengineered cells into which one or more modifications have not previously been introduced. In some embodiments, a gene editing system is used to modify one or more target polynucleotide sequences that modulate (e.g., reduce or eliminate) the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules. In certain embodiments, the genome of the cell has been altered to reduce or delete components required for or involved in facilitating HLA expression, such as the expression of one or more MHC class I molecules and / or one or more MHC class II molecules on the surface of the cell. For example, in some embodiments, expression of beta-2-microglobulin (B2M), a component of MHC class I molecules, is reduced or eliminated in the cells, thereby reducing or eliminating protein expression (e.g., cell surface expression) of one or more MHC class I molecules by the engineered cells.
[0210] In some embodiments, any of the described modifications in engineered cells that modulate (e.g., reduce or eliminate) expression of one or more target polynucleotides or proteins in the engineered cells may be combined together with one or more modifications that overexpress a polynucleotide (e.g., a tolerogenic factor such as CD47) described in Section II.B.
[0211] In some embodiments, reducing the expression of one or more MHC class I molecules and / or one or more MHC class II molecules can be accomplished, for example, by one or more of the following: (1) directly targeting polymorphic HLA alleles (HLA-A, HLA-B, HLA-C) and MHC class II genes; (2) reducing surface trafficking of all MHC class I molecules by removal of B2M; and / or (3) deleting one or more components of the MHC enhanceosome, such as LRC5, RFX-5, RFXANK, RFXAP, IRF1, NF-Y (including NFY-A, NFY-B, NFY-C), and CIITA, which are essential for HLA expression.
[0212] In certain embodiments, HLA expression is disrupted. In some embodiments, HLA expression is disrupted by targeting individual HLA (e.g., knocking out expression of HLA-A, HLA-B, and / or HLA-C), targeting transcriptional regulators of HLA expression (e.g., knocking out expression of NLRC5, CIITA, RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, and / or IRF-1), blocking surface transport of MHC class I molecules (e.g., knocking out expression of B2M and / or TAP1), and / or targeting with HLA-Razor (see, e.g., WO2016183041).
[0213] The human leukocyte antigen (HLA) complex is synonymous with human MHC. In some embodiments, the engineered cells disclosed herein are human cells. In certain aspects, the engineered cells disclosed herein do not express one or more human leukocyte antigens (e.g., HLA-A, HLA-B, and / or HLA-C) corresponding to one or more MHC class I molecules and / or one or more MHC class II molecules, and are therefore characterized as being hypoimmunogenic. For example, in certain aspects, the engineered cells disclosed herein have been modified such that the cells, including any stem cells or differentiated stem cells prepared therefrom, do not express or exhibit reduced expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C. In some embodiments, one or more of HLA-A, HLA-B, and HLA-C can be "knocked out" from the cells. Cells in which the HLA-A, HLA-B, and / or HLA-C genes have been knocked out can exhibit reduced expression or elimination of the respective gene that has been knocked out.
[0214] In certain embodiments, expression of one or more MHC class I molecules and / or one or more MHC class II molecules is modulated by targeted deletion of a contiguous stretch of genomic DNA, thereby reducing or eliminating expression of a target gene selected from the group consisting of B2M, CIITA, and NLRC5.
[0215] In some embodiments, the engineered cells provided comprise modifications of one or more target polynucleotide sequences that regulate one or more MHC class I molecules. Exemplary methods for reducing the expression of one or more MHC class I molecules are described in the sections below. In some embodiments, the target polynucleotide sequence is one or both of B2M and NLRC5. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the B2M gene. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the NLRC5 gene. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the B2M and CIITA genes.
[0216] In some embodiments, the modification that reduces expression of one or more MHC class I molecules is a modification that reduces expression of B2M. In some embodiments, the modification that reduces B2M expression reduces B2M mRNA expression. In some embodiments, the reduced B2M mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, B2M mRNA expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, B2M mRNA expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, B2M mRNA expression is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, B2M mRNA expression is eliminated (e.g., 0% B2M mRNA expression). In some embodiments, a modification that reduces B2M mRNA expression eliminates B2M gene activity.
[0217] In some embodiments, the modification that reduces B2M expression reduces B2M protein expression. In some embodiments, the reduced protein expression of B2M is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, protein expression of B2M is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, protein expression of B2M is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, protein expression of B2M is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, protein expression of B2M is eliminated (e.g., 0% B2M protein expression). In some embodiments, a modification that reduces B2M protein expression eliminates B2M gene activity.
[0218] In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of one allele of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption, including inactivation or disruption of both alleles of the B2M gene.
[0219] In some embodiments, the modification comprises inactivation or disruption of one or more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the B2M gene. In some embodiments, the B2M gene is knocked out.
[0220] In some embodiments, the engineered cells provided comprise one or more target polynucleotide sequence modifications that regulate one or more MHC class II molecules. Exemplary methods for reducing the expression of one or more MHC class II molecules are described in the following sections. In some embodiments, the cells comprise gene editing modifications to the CIITA gene.
[0221] In some embodiments, the modification that reduces the expression of one or more MHC class II molecules is a modification that reduces the expression of CIITA. In some embodiments, the modification that reduces CIITA expression reduces CIITA mRNA expression. In some embodiments, the reduced CIITA mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, the CIITA mRNA expression is reduced by more than about 5%, for example, by more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, the CIITA mRNA expression is reduced by up to about 100%, for example, by up to about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, CIITA mRNA expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, CIITA mRNA expression is eliminated (e.g., 0% CIITA mRNA expression). In some embodiments, the modification that reduces CIITA mRNA expression eliminates CIITA gene activity.
[0222] In some embodiments, the modification that reduces CIITA expression reduces CIITA protein expression. In some embodiments, the reduced protein expression of CIITA is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, the protein expression of CIITA is reduced by more than about 5%, for example, by more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, the protein expression of CIITA is reduced by up to about 100%, for example, by up to about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, the protein expression of CIITA is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of CIITA is eliminated (e.g., 0% CIITA protein expression). In some embodiments, the modification that reduces CIITA protein expression eliminates CIITA gene activity.
[0223] In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption of one allele of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption, including inactivation or disruption of both alleles of the CIITA gene.
[0224] In some embodiments, the modification comprises inactivation or disruption of one or more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the B2M gene. In some embodiments, the CIITA gene is knocked out.
[0225] In some embodiments, the engineered cells provided comprise modifications of one or more target polynucleotide sequences that regulate one or more MHC class I molecules and / or one or more MHC class II molecules. Exemplary methods for reducing the expression of one or more MHC class I molecules and / or one or more MHC class II molecules are described in the sections below. In some embodiments, the cells comprise gene editing modifications to the B2M and NLRC5 genes. In some embodiments, the cells comprise gene editing modifications to the CIITA and NLRC5 genes. In certain embodiments, the cells comprise gene editing modifications to the B2M, CIITA, and NLRC5 genes.
[0226] In some embodiments, the cells comprise a reducing modification.
[0227] 2. Methods for reducing expression In some embodiments, the cells provided herein are modified (e.g., genetically modified) to reduce expression of one or more target polynucleotides or proteins as described. In some embodiments, the cells engineered with one or more modifications to reduce (e.g., eliminate) expression of a polynucleotide or protein are any of the source cells described herein. In some embodiments, the source cells are any of the cells described in Section II.C. In certain embodiments, the cells disclosed herein (e.g., stem cells, induced pluripotent stem cells, differentiated cells such as beta islet cells or hepatocytes, or primary cells) contain one or more modifications to reduce expression of one or more target polynucleotides. Non-limiting examples of one or more target polynucleotides include any of those described above, such as one or more of CIITA, B2M, NLRC5, HLA-A, HLA-B, HLA-C, LRC5, RFX-ANK, RFX5, RFX-AP, NFY-A, NFY-B, NFY-C, IRF1, and TAP1. In some embodiments, modifications that reduce expression of one or more target polynucleotides are combined with one or more modifications that increase expression of a desired transgene, such as any described in Section II.B. In some embodiments, the modifications create engineered cells that are immune privileged or hypoimmunogenic cells. By modulating (e.g., reducing or deleting) the expression of one or more target polynucleotides, such cells exhibit reduced immune activation when transplanted into a recipient subject. In some embodiments, the cells are considered, for example, hypoimmunogenic in the recipient subject or patient upon administration.
[0228] Any method for reducing expression of a target polynucleotide may be used. In some embodiments, the modification results in permanent elimination or reduction of expression of the target polynucleotide. For example, in some embodiments, the target polynucleotide or gene is destroyed by introducing a DNA break into the target polynucleotide, e.g., by using a targeting endonuclease. In other embodiments, the modification results in a transient reduction in expression of the target polynucleotide. For example, in some embodiments, gene silencing is achieved by selectively suppressing or repressing expression of a gene using an inhibitory nucleic acid complementary to the target polynucleotide, e.g., by antisense technology, e.g., RNA interference (RNAi), small interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes.
[0229] In some embodiments, the target polynucleotide sequence is a genomic sequence. In some embodiments, the target polynucleotide sequence is a human genomic sequence. In some embodiments, the target polynucleotide sequence is a mammalian genomic sequence. In some embodiments, the target polynucleotide sequence is a vertebrate genomic sequence.
[0230] In some embodiments, gene disruption is typically performed by inducing one or more double-strand breaks and / or one or more single-strand breaks in a gene in a targeted manner. In some embodiments, the double-strand or single-strand breaks are created by a nuclease, such as an endonuclease, for example, a gene-targeting nuclease. In some embodiments, the targeting nuclease is selected from RNA-guided nucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-associated nucleases (Cas), which are specifically designed to target the sequence of a gene or a portion thereof. In some embodiments, the targeting nuclease generates double-strand or single-strand breaks, which are then repaired via error-prone non-homologous end joining (NHEJ) or, in some cases, template-based, precise homology-directed repair (HDR). In some embodiments, the targeting nuclease generates a DNA double-strand break (DSB). In some embodiments, the break generation and repair process is typically error-prone, resulting in the insertion and deletion of DNA bases (indels) due to NHEJ repair. In some embodiments, the modification can induce deletion, insertion, or mutation of the nucleotide sequence of the target gene. In some cases, the modification can result in a frameshift mutation, which can lead to a premature stop codon. In the example of nuclease-mediated gene editing, targeted editing occurs on both alleles of a gene, resulting in the disruption or editing of both alleles of the gene. In some embodiments, all alleles of a gene are targeted by gene editing. In some embodiments, modification with targeted nucleases, for example, using the CRISPR / Cas system, leads to the complete knockout of the gene.
[0231] In some embodiments, a nuclease, such as a rare-cutting endonuclease, is introduced into a cell containing a target polynucleotide sequence. The nuclease may be introduced into the cell in the form of a nucleic acid encoding the nuclease. The process of introducing a nucleic acid into a cell may be accomplished by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid introduced into the cell is DNA. In some embodiments, the nuclease is introduced into the cell in the form of a protein. For example, in the case of a CRISPR / Cas system, a ribonucleoprotein (RNP) may be introduced into the cell.
[0232] In some embodiments, the modification occurs using a CRISPR / Cas system. Any CRISPR / Cas system capable of altering a target polynucleotide sequence in a cell can be used. Such CRISPR-Cas systems can use a variety of Cas proteins (Haft et al. PLoS Comput Biol. 2005;1(6)e60). The molecular machinery of such Cas proteins that enables CRISPR / Cas systems to alter a target polynucleotide sequence in a cell includes RNA-binding proteins, endonucleases and exonucleases, helicases, and polymerases. In some embodiments, the CRISPR / Cas system is a type I CRISPR system. In some embodiments, the CRISPR / Cas system is a type II CRISPR system. In some embodiments, the CRISPR / Cas system is a type V CRISPR system.
[0233] CRISPR / Cas systems include targeting systems that can be used to alter any target polynucleotide sequence in a cell. In some embodiments, the CRISPR / Cas systems provided herein include a Cas protein and one or more, e.g., at least one to two, ribonucleic acids (e.g., guide RNAs (gRNAs)) that guide the Cas protein to and can hybridize with a target motif in a target polynucleotide sequence.
[0234] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, the one or more amino acid substitutions comprise conservative amino acid substitutions. In some cases, the substitutions and / or modifications can prevent or reduce proteolysis in cells and / or extend the half-life of the polypeptide. In some embodiments, the Cas protein can comprise peptide bond replacements (e.g., urea, thiourea, carbamate, sulfonylurea, etc.). In some embodiments, the Cas protein can comprise naturally occurring amino acids. In some embodiments, the Cas protein can comprise alternative amino acids (e.g., D-amino acids, beta-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, the Cas protein can comprise modifications to include substructures (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.).
[0235] In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include, but are not limited to, Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises an E. coli subtype Cas protein (also known as CASS2). Exemplary E. coli subtype Cas proteins include, but are not limited to, Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Ypest subtype Cas protein (also known as CASS3). Exemplary Ypest subtype Cas proteins include, but are not limited to, Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises an Nmeni subtype Cas protein (also known as CASS4). Exemplary Nmeni subtype Cas proteins include, but are not limited to, Csn1 and Csn2. In some embodiments, the Cas protein comprises a Cas protein of the Dvulg subtype (also known as CASS1). Exemplary Cas proteins of the Dvulg subtype include Csd1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Cas protein of the Tneap subtype (also known as CASS7). Exemplary Cas proteins of the Tneap subtype include, but are not limited to, Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein comprises a Cas protein of the Hmari subtype. Exemplary Cas proteins of the Hmari subtype include, but are not limited to, Csh1, Csh2, and Cas5h. In some embodiments, the Cas protein comprises a Cas protein of the Apern subtype (also known as CASS5). Exemplary Cas proteins of the Apern subtype include, but are not limited to, Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein comprises a Cas protein of the Mtube subtype (also known as CASS6).Exemplary Cas proteins of the Mtube subtype include, but are not limited to, Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein comprises a RAMP module Cas protein. Exemplary RAMP module Cas proteins include, but are not limited to, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, e.g., Klompe et al., Nature 571, 219-225 (2019); Strecker et al., Science 365, 48-53 (2019).
[0236] In some embodiments, methods for genetically modifying cells to knock out, knock down, or otherwise modify one or more genes include using site-specific nucleases, including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems.
[0237] ZFNs are fusion proteins containing multiple site-specific DNA-binding domains adapted from zinc finger-containing transcription factors linked to the endonuclease domain of the bacterial FokI restriction enzyme. ZFNs may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) DNA-binding or zinc finger domains. See, for example, Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and typically recognizes a 3-4 bp DNA sequence. Tandem domains may therefore potentially bind to long nucleotide sequences unique within a cell's genome.
[0238] Various zinc fingers with known specificities can be combined to create multi-finger polypeptides that recognize sequences of approximately 6, 9, 12, 15, or 18 bp. Various selection and modular assembly techniques are available for generating zinc fingers (and combinations thereof) that recognize specific sequences, including fuzzy display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind to predetermined nucleic acid sequences. Criteria for engineering zinc fingers to bind to predetermined nucleic acid sequences are known in the art. See, for example, Sera et al., Biochemistry (2002) 41:7074-7081; Liu et al., Bioinformatics (2008) 24:1850-1857.
[0239] ZFNs containing a FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. Two individual ZFNs must bind to opposite strands of DNA with their nucleases appropriately spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs is designed to recognize two sequences located on either side of the site, one on the forward strand and the other on the reverse strand. When the ZFNs bind on each side of the site, the nuclease domains dimerize and cleave the DNA at the site, creating a DSB with a 5' overhang. HDR can then be used to induce a specific mutation with the aid of a repair template containing the desired mutation flanked by homologous arms. The repair template is usually an exogenous double-stranded DNA vector introduced into the cell. See Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734.
[0240] TALENs are another example of artificial nucleases that can be used to edit target genes. TALENs are derived from a DNA-binding domain called a TALE repeat, which typically contains a tandem array of 10–30 repeats that bind to and recognize long DNA sequences. Each repeat is 33–35 amino acids long, with two adjacent amino acids (called repetitive variable dimers, or RVDs) conferring specificity for one of four DNA base pairs. Thus, there is a one-to-one correspondence between repeats and base pairs in the target DNA sequence.
[0241] TALENs are artificially produced by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) to a nuclease domain, such as a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations to FokI have been made for use in TALENs, which improve, for example, cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39:e82; Miller et al., Nature Biotech. (2011) 29:143-148; Hockemeyer et al., Nature Biotech. (2011) 29:731-734; Wood et al., Science (2011) 333:307; Doyon et al., Nature Methods (2010) 8:74-79; Szczepek et al., Nature Biotech (2007) 25:786-793; Guo et al., J. Mol. Biol. (2010) 200:96. The FokI domain functions as a dimer, requiring two constructs with unique DNA-binding domains in the appropriate orientation and spacing for sites in the target genome. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain, and the number of bases between two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29:143-148.
[0242] By combining engineered TALE repeat with nuclease domain, it can produce site-specific nuclease that is specific to any desired DNA sequence.Similar to ZFN, TALEN can be introduced into cells to generate DSB at desired target site in genome, so that it can be used to knock out gene or knock in mutation through similar HDR-mediated pathway.See Boch, Nature Biotech.(2011)29:135-136; Boch et al., Science(2009)326:1509-1512; Moscou et al., Science(2009)326:3501.
[0243] Meganucleases are enzymes within the endonuclease family characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). Meganucleases are grouped into families based on their structural motifs that affect nuclease activity and / or DNA recognition. The most widespread and best-known meganucleases are proteins within the LAGLIDADG family, owing their name to a conserved amino acid sequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. On the other hand, GIY-YIG family members possess a GIY-YIG module, which is 70-100 residues long and contains four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. Meganucleases of the His-Cys family are characterized by a highly conserved series of histidines and cysteines over a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by a motif containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.
[0244] Because the high specificity requirements make it unlikely to identify a natural meganuclease for a particular target DNA sequence, various methods, including mutagenesis and high-throughput screening, have been used to create meganuclease variants that recognize unique sequences. For example, strategies for engineering meganucleases with altered DNA-binding specificities to bind to defined nucleic acid sequences are known in the art. For example, Chevalier et al., Mol. Cell. Cell. (2002) 10:895-905, Epinat et al., Nucleic Acids Res (2003) 31:2952-2962, Silva et al., J Mol. Biol. (2006) 361:744-754, Seligman et al., Nucleic Acids Res(2002)30:3870-3879, Sussman et al.,J Mol Biol(2004)342:31-41, Doyon et al.,J Am Chem Soc(2006)128:2477-2484, Chen et al.,Protein Eng Des Sel(2009)22:249-256, Arnould et al.,J Mol See Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.
[0245] Similar to ZFN and TALEN, meganucleases can create DSBs in genomic DNA, which can create frameshift mutations when improperly repaired, for example, via NHEJ, leading to reduced expression of target genes in cells. Alternatively, foreign DNA can be introduced into cells together with meganucleases. Depending on the sequence of foreign DNA and chromosomal sequence, this process can be used to modify target genes. See Silva et al., Current Gene Therapy (2011) 11:11-27.
[0246] Transposases are enzymes that bind to the ends of transposons and catalyze their transfer to another part of the genome by a cut-and-paste mechanism or replicative transposition mechanism. By linking transposases with other systems, such as the CRISPER / Cas system, new gene editing tools can be developed that enable site-specific insertion or manipulation of genomic DNA. There are two known transposon-based DNA integration methods: one that uses catalytically inactive Cas effector proteins and Tn7-like transposons. Transposase-dependent DNA integration does not induce DSBs in the genome, which may ensure safer and more specific DNA integration.
[0247] The CRISPR system was originally discovered in prokaryotes (e.g., bacteria and archaea) as a system involved in defense against invading phages and plasmids, providing a form of adaptive immunity. It has now been adapted and used as a widespread gene editing tool in research and clinical applications.
[0248] CRISPR / Cas systems generally contain at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces a DSB at the target site. CRISPR-Cas systems fall into two major classes: Class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids, while Class 2 systems use a single large Cas protein for the same purpose. Class 1 systems are divided into types I, III, and IV, while Class 2 systems are divided into types II, V, and VI. Different Cas proteins adapted for gene editing applications include Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas proteins include, but are not limited to, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. The most widely used Cas protein, Cas9, is a type II Cas protein and is described herein as an illustrative example. These Cas proteins can originate from different species. For example, Cas9 can be derived from S. pyogenes or S. aureus.
[0249] Within the original microbial genome, the type II CRISPR system integrates sequences from the invading DNA between CRISPR repeat sequences encoded as an array within the host genome. Transcripts from the CRISPR repeat array are processed into CRISPR RNAs (crRNAs), each of which contains not only a portion of the CRISPR repeat but also a variable sequence transcribed from the invading DNA known as a "protospacer" sequence. Each crRNA hybridizes to a second trans-activating CRISPR RNA (tracrRNA), and these two RNAs form a complex with the Cas9 nuclease. The protospacer-encoded portion of the crRNA guides the Cas9 complex to cleave complementary target DNA sequences, provided they are flanked by a short sequence known as a "protospacer adjacent motif" (PAM).
[0250] Since its discovery, the CRISPR system has been adapted to induce sequence-specific DSBs and targeted genome editing in a wide range of cells and organisms, from bacteria to eukaryotic cells, including human cells. In its use in gene editing applications, an artificially designed synthetic gRNA replaces the original crRNA:tracrRNA complex. For example, the gRNA can be a single guide RNA (sgRNA) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA typically contains a user-designed complementary region (also known as a spacer, typically approximately 20 nucleotides long) to recognize the desired target DNA. The tracrRNA sequence contains a scaffold region for Cas nuclease binding. The crRNA and tracrRNA sequences are connected by a tetraloop, each with a short repeat sequence for hybridization with the other, thus generating a chimeric sgRNA. The genome target of the Cas nuclease can be altered by simply changing the sequence of the spacer or complementary region present in the gRNA. The complementary region guides the Cas nuclease to the target DNA site by standard RNA-DNA complementary base-pairing rules.
[0251] For Cas nucleases to function, a PAM must be present immediately downstream of the target sequence in genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease, derived from S. pyogenes, recognizes a PAM sequence of 5'-NGG-3', or less efficiently, 5'-NAG-3' (where "N" can be any nucleotide). Other Cas nuclease variants using alternative PAMs have also been characterized and successfully used for genome editing. These are summarized in Table 1a below.
[0252] [Table 1a]
[0253] In some embodiments, Cas nucleases may contain one or more mutations to alter their activity, specificity, recognition, and / or other properties. For example, a Cas nuclease may have one or more mutations that alter its fidelity to mitigate off-target effects (e.g., eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 are high-fidelity variants of SpCas9). As another example, a Cas nuclease may have one or more mutations that alter its PAM specificity.
[0254] In some embodiments, the Cas protein comprises any one of the Cas proteins described herein, or a functional portion thereof. As used herein, "functional portion" refers to a portion of a peptide that retains its ability to complex with at least one ribonucleic acid (e.g., a guide RNA (gRNA)) and cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of functional domains of an operably linked Cas9 protein selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of functional domains of an operably linked Cas12a (also known as Cpfl) protein selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of an HNH nuclease domain. In some embodiments, the functional portion of a Cas12a protein comprises a functional portion of a RuvC-like domain.
[0255] In some embodiments, suitable Cas proteins include, but are not limited to, Cas0, Cas12a (i.e., Cpf1), Cas12b, Cas12i, CasX, and Mad7.
[0256] In some embodiments, exogenous Cas proteins can be introduced into cells in the form of a polypeptide. In certain embodiments, Cas proteins can be conjugated or fused to a cell-penetrating polypeptide or cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refer to a polypeptide or peptide, respectively, that facilitates the uptake of a molecule into a cell. The cell-penetrating polypeptide can contain a detectable label.
[0257] In certain embodiments, the Cas protein may be conjugated or fused to a charged protein (e.g., carrying a positive, negative, or overall neutral charge). Such linkages may be covalent. In some embodiments, the Cas protein may be fused to a superpositively charged GFP to significantly increase the ability of the Cas protein to penetrate cells (Cronican et al. ACS Chem Biol. 2010;5(8):747-52). In certain embodiments, the Cas protein may be fused to a protein transduction domain (PTD) to facilitate its entry into cells. Exemplary PTDs include Tat, oligoarginines, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a tat domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a penetratin domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a superpositive GFP. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a PTD. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a tat domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to an oligoarginine domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a penetratin domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a superpositive GFP.
[0258] In some embodiments, the Cas protein may be introduced into a cell containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acid into the cell may be accomplished by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises modified DNA as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises modified mRNA as described herein (e.g., synthetic modified mRNA).
[0259] In provided embodiments, CRISPR / Cas systems generally include two components: one or more guide RNAs (gRNAs) and a Cas protein. In some embodiments, the Cas protein is complexed with one or more, e.g., one to two, ribonucleic acids (e.g., guide RNAs (gRNAs)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., a synthetic, modified mRNA) as described herein.
[0260] In some embodiments, the gRNA is a short synthetic RNA composed of a scaffold sequence for Cas binding and a custom-designed spacer or complementary portion called the crRNA. The cRNA is composed of a crRNA targeting sequence (hereinafter also referred to as the gRNA targeting sequence; typically about 20 nucleotides in length) that defines the genomic target to be modified and a region of crRNA repeats (e.g., GUUUUAGAGCUA; SEQ ID NO: 19). The genomic target of the Cas protein can be changed simply by changing the sequence of the complementary portion present in the gRNA (e.g., the gRNA targeting sequence). In some embodiments, the scaffold sequence for Cas binding consists of a tracrRNA sequence (e.g., UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU; SEQ ID NO: 20) that hybridizes to the crRNA via its anti-repeat sequence. The crRNA:tracrRNA complex recruits a Cas nuclease (e.g., Cas9) that cleaves upstream of a protospacer adjacent motif (PAM). For the Cas protein to function, the PAM must be located immediately downstream of the target sequence in the genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease, derived from S. pyogenes (S. pyogenes), recognizes a PAM sequence of NGG. Other Cas9 variants and other nucleases with alternative PAMs have also been characterized and successfully used for genome editing. Thus, the CRISPR / Cas system can be used to create targeted DSBs at designated genomic loci that are complementary to a gRNA designed against the target locus. The crRNA and tracrRNA can be linked together by a loop sequence (e.g., a tetraloop; GAAA) to generate a gRNA that is a chimeric single guide RNA (sgRNA; Hsu et al. 2013). The sgRNA can be generated for DNA-based expression or by chemical synthesis.
[0261] In some embodiments, the sequence of the complementary portion of the gRNA (e.g., gRNA targeting sequence) will vary depending on the target site of interest. In some embodiments, the gRNA comprises a complementary portion specific to the sequence of a gene listed in Table 1a. In some embodiments, the genomic locus targeted by the gRNA is located within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of any of the listed loci.
[0262] The methods disclosed herein contemplate the use of any ribonucleic acid that can guide and hybridize a Cas protein to a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises
[0263] In some embodiments, the Cas protein is complexed with one to two ribonucleic acids (e.g., guide RNAs (gRNAs)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., a synthetic, modified mRNA) as described herein.
[0264] The methods disclosed herein contemplate the use of any ribonucleic acid that can guide a Cas protein to and hybridize with a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises a tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises a CRISPR RNA (crRNA). In some embodiments, a single ribonucleic acid comprises a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids comprises a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. In some embodiments, both of the one or two ribonucleic acids comprise a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. As will be appreciated by those of skill in the art, the ribonucleic acids provided herein can be selected to hybridize with a variety of different target motifs and target polynucleotide sequences depending on the particular CRISPR / Cas system used. The one to two ribonucleic acids may also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least two mismatches when compared to all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least one mismatch when compared to all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids are designed to hybridize to a target motif that is immediately adjacent to a deoxyribonucleic acid motif recognized by a Cas protein. In some embodiments, each of the one to two ribonucleic acids is designed to hybridize to a target motif that is immediately adjacent to a deoxyribonucleic acid motif recognized by a Cas protein, flanking a mutant allele located between the target motifs.
[0265] In some embodiments, each of the one to two ribonucleic acids comprises a guide RNA that guides the Cas protein to and hybridizes with a target motif in a target polynucleotide sequence within a cell.
[0266] In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on the same strand of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on opposite strands of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are not complementary to and / or hybridize to sequences on opposite strands of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to overlapping target motifs of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to offset target motifs of a target polynucleotide sequence.
[0267] In some embodiments, the nucleic acid encoding the Cas protein and the nucleic acid encoding at least one or two ribonucleic acids are introduced into the cell via viral transduction (e.g., lentiviral transduction). In some embodiments, the Cas protein is complexed with one or two ribonucleic acids. In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid (e.g., a synthetic, modified mRNA) as described herein.
[0268] Exemplary gRNA targeting sequences useful for CRISPR / Cas-based targeting of the genes described herein are provided in Table 1. These sequences can be found in WO2016183041, filed May 9, 2016, the disclosure of which, including tables, appendices, and sequence listings, is incorporated herein by reference in its entirety.
[0269] [Table 1]
[0270] Additional exemplary Cas9 guide RNA sequences useful for CRISPR / Cas-based targeting of genes described herein are provided in Table 2A.
[0271] [Table 2A]
[0272] In some embodiments, it is within the skill of one of ordinary skill in the art to identify new loci and / or gRNA targeting sequences for use in gene disruption methods to reduce or eliminate gene expression as described. For example, with respect to CRISPR / Cas systems, if an existing gRNA targeting sequence for a particular locus (e.g., within a target gene, e.g., listed in Table 1) is known, an "inchworming" approach can be used to identify additional loci for targeted insertion of a transgene by scanning the flanking regions on each side of that locus for PAM sequences, which are typically present approximately every 100 base pairs (bp) across the genome. Typically, different nucleases have different corresponding PAM sequences, so the PAM sequence will depend on the particular Cas nuclease used. The flanking regions on each side of the locus can be approximately 500-4000 bp in length, e.g., approximately 500 bp, approximately 1000 bp, approximately 1500 bp, approximately 2000 bp, approximately 2500 bp, approximately 3000 bp, approximately 3500 bp, or approximately 4000 bp in length. If a PAM sequence is identified within the search range, new guides can be designed for use in gene disruption methods according to the sequence of that locus. Although the CRISPR / Cas system is described as an illustrative example, any of the gene editing approaches described, including those using ZFNs, TALENs, meganucleases, and transposases, can be used in this method to identify new loci.
[0273] In some embodiments, the cells described herein are generated using the Transcription Activator-Like Effector Nuclease (TALEN) approach. By "TALE-nuclease" (TALEN) is intended a fusion protein consisting of a nucleic acid binding domain, typically derived from a Transcription Activator-Like Effector (TALE), and a single nuclease catalytic domain for cleaving a nucleic acid target sequence. The catalytic domain is preferably a nuclease domain, more preferably a domain with endonuclease activity, such as I-TevI, ColE7, NucA, and Fok-I. In certain embodiments, the TALE domain can be fused to a meganuclease, such as I-CreI and I-Onul, or functional variants thereof. In some embodiments, the nuclease is a monomeric TALE-nuclease. Monomeric TALE-nucleases are TALE-nucleases that do not require dimerization for specific recognition and cleavage, such as the fusion of engineered TAL repeats with the catalytic domain of I-TevI described in WO2012138927. Transcription activator-like effectors (TALEs) are proteins from the bacterial species Xanthomonas that contain multiple repeats, each containing a dinucleotide variant (RVD) at positions 12 and 13 that is specific for each nucleotide base of a nucleic acid target sequence. Similar modular base-pair-base nucleic acid binding properties (MBBBDs) may also be derived from a new modular protein in a different bacterial species recently discovered by the applicant. This new modular protein has the advantage of exhibiting greater sequence variability than TAL repeats.Preferably, the RVDs involved in the recognition of the different nucleotides are HD for recognizing C, NG for recognizing T, NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G, or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A, and YG for recognizing T, TL for recognizing A, VT for recognizing A or G, and SW for recognizing A. In another embodiment, the essential amino acids 12 and 13 can be mutated towards other amino acid residues to modulate their specificity for the nucleotides A, T, C, and G, and in particular to enhance this specificity. TALEN kits are commercially available.
[0274] In some embodiments, the cells are engineered using zinc finger nucleases (ZFNs). A "zinc finger binding protein" is a protein or polypeptide that binds to DNA, RNA, and / or proteins, preferably in a sequence-specific manner, as a result of stabilization of the protein structure by the coordination of zinc ions. The term zinc finger binding protein is often abbreviated as zinc finger protein or ZFP. Individual DNA-binding domains are typically referred to as "fingers." ZFPs have at least one finger, typically two, three, or six fingers. Each finger binds to two to four base pairs of DNA, typically three or four base pairs. ZFPs bind to nucleic acid sequences called target sites or target segments. Each finger typically contains a zinc-chelating DNA-binding subdomain of approximately 30 amino acids. Studies have demonstrated that this class of single zinc finger consists of an alpha helix containing two invariant histidine residues coordinated with zinc along with two cysteine residues in a single beta turn (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).
[0275] In some embodiments, the cells described herein are generated using a homing endonuclease. Such homing endonucleases are well known in the art (Stoddard 2005). Homing endonucleases recognize DNA target sequences and generate single- or double-strand breaks. Homing endonucleases are highly specific and recognize DNA target sites ranging from 12 to 45 base pairs (bp) in length, typically ranging from 14 to 40 bp in length. The homing endonuclease can correspond to, for example, LAGLIDADG endonuclease, HNH endonuclease, or GIY-YIG endonuclease. In some embodiments, the homing endonuclease can be an I-CreI variant.
[0276] In some embodiments, the cells described herein are produced using meganucleases, which by definition are sequence-specific endonucleases that recognize large sequences (Chevalier, BS and BL Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). They cleave unique sites in living cells, thereby enhancing gene targeting by over 1000-fold in the vicinity of the cleavage site (Puchta et al., Nucleic Acids Res., 1993, 21, 5034-5040; Rouet et al., Mol. Cell. Biol., 1994, 14, 8096-8106; Choulika et al., Mol. Cell. Biol., 1995, 15, 1968-1973; Puchta et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-5060; Sargent et al., Mol. Cell. Biol., 1997, 17, 267-77; Donoho et al., Mol. Cell. Biol., 1998, 18, 4070-4078; Elliott et al., Mol. Cell. Biol., 1998, 18, 93-101, Cohen-Tannoudji et al., Mol. Cell. Biol., 1998, 18, 1444-1448).
[0277] In some embodiments, the cells provided herein are generated using RNA silencing or RNA interference (RNAi) to knock down (e.g., reduce, eliminate, or inhibit) the expression of a polypeptide. Useful RNAi methods include those utilizing synthetic RNAi molecules, small interfering RNAs (siRNAs), PIWI-interacting RNAs (piRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNAs), and other transient knockdown methods recognized by those skilled in the art. Reagents for RNAi, including sequence-specific shRNAs, siRNAs, miRNAs, etc., are commercially available. For example, a target polynucleotide such as any of the above, e.g., CIITA, B2M, or NLRC5, can be knocked down in a cell by RNA interference by introducing an inhibitory nucleic acid, such as an siRNA, complementary to a target motif of the target polynucleotide into the cell. In some embodiments, a target polynucleotide such as any of the above, e.g., CIITA, B2M, or NLRC5, can be knocked down in a cell by transducing an shRNA-expressing virus into the cell. In some embodiments, RNA interference is used to reduce or inhibit the expression of at least one selected from the group consisting of CIITA, B2M, and NLRC5.
[0278] 3. Exemplary Target Polynucleotides and Methods for Reducing Expression A. MHC class I molecules In certain embodiments, the modification reduces or eliminates, e.g., knocks out, the expression of one or more MHC class I molecules (e.g., one or more MHC class I genes encoding one or more MHC class I molecules) by targeting the accessory chain B2M. In some embodiments, the modification occurs using a CRISPR / Cas system. By reducing or eliminating, e.g., knocking out, the expression of B2M, surface transport of one or more MHC class I molecules is blocked, and such cells exhibit immune tolerance when transplanted into a recipient subject. In some embodiments, the cells are considered, for example, to be hypoimmunogenic in the recipient subject or patient upon administration.
[0279] In some embodiments, the target polynucleotide sequence provided herein is a variant of B2M. In some embodiments, the target polynucleotide sequence is a homolog of B2M. In some embodiments, the target polynucleotide sequence is an ortholog of B2M.
[0280] In some embodiments, reducing or eliminating the expression of B2M reduces or eliminates the expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C.
[0281] In some embodiments, the engineered cells comprise a modification that targets the B2M gene. In some embodiments, the modification that targets the B2M gene is by using a targeted nuclease system comprising a Cas protein or a polynucleotide encoding the Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the B2M gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the B2M gene (e.g., a gRNA targeting sequence) is selected from the group consisting of SEQ ID NOs: 81240-85644 in Appendix 2 or Table 15 of WO2016 / 183041, the disclosure of which is incorporated herein by reference in its entirety.
[0282] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted at the B2M gene. Exemplary transgenes for targeted insertion at the B2M locus include any of those described in Section II.B.
[0283] Assays for testing whether the B2M gene is inactivated are known and described herein. In one embodiment, the resulting B2M gene modification can be assayed by PCR, and the reduction in HLA-I expression can be assayed by flow cytometry, e.g., FACS analysis. In another embodiment, B2M protein expression is detected using Western blots of cell lysates probed with an antibody against the B2M protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of the inactivating modification.
[0284] In some embodiments, the reduction in expression or function of one or more MHC class I molecules (HLA I if the cells are derived from human cells) in the engineered cells can be measured using techniques known in the art, such as FACS techniques using labeled antibodies that bind to HLA complexes, for example, commercially available HLA-A, B, C antibodies that bind to the alpha chain of human major histocompatibility HLA class I antigens. Additionally, the cells can be tested to ensure that HLA I complexes are not expressed on the cell surface. This can be assayed by FACS analysis using antibodies against one or more components of the HLA cell surface, as discussed above. In addition to the reduction of HLA I (or MHC class I), the engineered cells provided herein have reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods for assaying for a hypoimmunogenic phenotype of engineered cells are further described below.
[0285] B. MHC class II molecules In certain aspects, the modification reduces or eliminates, e.g., knocks out, the expression of one or more MHC class II molecules by targeting the expression of class II transactivator (CIITA). In some embodiments, the modification occurs using a CRISPR / Cas system. CIITA is a member of the LR, or nucleotide-binding domain (NBD) leucine-rich repeat (LRR) family of proteins, and regulates the transcription of one or more MHC class II genes by associating with the MHC enhanceosome. By reducing or eliminating, e.g., knocking out, the expression of CIITA reduces the expression of one or more MHC class II molecules, thereby also reducing their surface expression. In some cases, such cells exhibit immune tolerance when transplanted into a recipient subject. In some embodiments, the cells are considered, for example, to be less immunogenic in the recipient subject or patient upon administration.
[0286] In some embodiments, the target polynucleotide sequence is a variant of CIITA. In some embodiments, the target polynucleotide sequence is a homolog of CIITA. In some embodiments, the target polynucleotide sequence is an ortholog of CIITA.
[0287] In some embodiments, the reduced expression or elimination of CIITA reduces or eliminates the expression of one or more of the following MHC class II molecules: HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.
[0288] In some embodiments, the engineered cells comprise a modification that targets the CIITA gene. In some embodiments, the modification that targets the CIITA gene is via a targeting nuclease system comprising a Cas protein or a polynucleotide encoding the Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene (e.g., a gRNA targeting sequence) is selected from the group consisting of SEQ ID NOs: 5184-36352 in Appendix 1 or Table 12 of WO2016183041, the disclosure of which is incorporated herein by reference in its entirety.
[0289] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted at the CIITA gene. Exemplary transgenes for targeted insertion at the B2M locus include any of those described in Section II.B.
[0290] Assays for testing whether the CIITA gene is inactivated are known and are described herein. In one embodiment, the resulting CIITA gene alteration can be assayed by PCR, and the reduction in HLA-II expression can be assayed by flow cytometry, e.g., FACS analysis. In another embodiment, CIITA protein expression is detected using Western blot of cell lysate probed with an antibody against CIITA protein. In another embodiment, the presence of the inactivating alteration is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0291] In some embodiments, the reduction in expression or function of one or more MHC class II molecules (HLA II if the cells are derived from human cells) in the engineered cells can be measured using techniques known in the art, such as Western blotting using antibodies against the protein, FACS techniques, RT-PCR techniques, etc. In some embodiments, the engineered cells can be tested to confirm that HLA II complexes are not expressed on the cell surface. Methods for assessing surface expression include those known in the art (see, for example, Figure 21 of WO2018132783) and are generally performed using either Western blot or FACS analysis based on commercially available antibodies that bind to human HLA class II HLA-DR, DP, and most DQ antigens. In addition to the reduction in HLA II (or MHC class II), the engineered cells provided herein have reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods for assaying for a hypoimmunogenic phenotype of engineered cells are further described below.
[0292] B. Polynucleotide Overexpression In some embodiments, the engineered cells provided herein are genetically modified or engineered by introducing one or more modifications into the cells, e.g., to overexpress a desired polynucleotide in the cells. In some embodiments, the cells to be modified or engineered are unmodified or unengineered cells that have not previously been introduced with one or more modifications. In some embodiments, the engineered cells provided herein are genetically modified to include one or more exogenous polynucleotides (also used interchangeably with the term "transgene") encoding exogenous proteins. As noted, in some embodiments, the cells are modified to increase the expression of certain genes that are tolerogenic (e.g., immune) factors that affect immune recognition and tolerance in the recipient. In some embodiments, the provided engineered cells, such as T cells or NK cells, also express a chimeric antigen receptor (CAR). The one or more polynucleotides, e.g., exogenous polynucleotides, may be expressed (e.g., overexpressed) in the engineered cells together with one or more genetic modifications that reduce the expression of target polynucleotides, e.g., MHC class I and / or MHC class II molecules, as described in Section IA above. In some embodiments, the engineered cells provided do not elicit or activate an immune response upon administration to a recipient subject.
[0293] In some embodiments, the engineered cells comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different overexpressed polynucleotides. In some embodiments, the engineered cells comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different overexpressed polynucleotides. In some embodiments, the overexpressed polynucleotides are exogenous polynucleotides. In some embodiments, the engineered cells comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different exogenous polynucleotides. In some embodiments, the engineered cells comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different exogenous polynucleotides. In some embodiments, the overexpressed polynucleotides are exogenous polynucleotides that are expressed episomally in the cell. In some embodiments, the overexpressed polynucleotides are exogenous polynucleotides that are inserted or integrated into one or more genomic loci of the engineered cell.
[0294] In some embodiments, a fusion protein containing a DNA targeting domain and a transcriptional activator is used to increase expression of a polynucleotide, i.e., to overexpress the polynucleotide. Targeting methods for increasing expression using transactivator domains are known to those of skill in the art.
[0295] In some embodiments, the engineered cell contains one or more exogenous polynucleotides, wherein the one or more exogenous polynucleotides are inserted or integrated into the cell's genome locus by a non-targeted insertion method, for example, by transduction with a lentiviral vector. In some embodiments, the one or more exogenous polynucleotides are inserted or integrated into the cell's genome by a targeted insertion method, for example, by using homology-directed repair (HDR). Any suitable method can be used to insert the exogenous polynucleotide into the engineered cell's genome locus by HDR, including the gene editing methods described herein (e.g., the CRISPR / Cas system). In some embodiments, the one or more exogenous polynucleotides are inserted into one or more genomic loci, such as any of the genomic loci described herein (e.g., Table 2). In some embodiments, the exogenous polynucleotides are inserted into the same genomic locus. In some embodiments, the exogenous polynucleotides are inserted into different genomic loci. In some embodiments, two or more of the exogenous polynucleotides are inserted within the same genomic locus, such as any of the genomic loci described herein (e.g., in Table 2). In some embodiments, two or more of the exogenous polynucleotides are inserted within different genomic loci, such as two or more of the genomic loci described herein (e.g., in Table 2).
[0296] In some embodiments, any of the gene editing techniques can be used to increase the expression of one or more target polynucleotides or target proteins as described. In some embodiments, the gene editing technique can include systems involving nucleases, integrases, transposases, and recombinases. In some embodiments, the gene editing technique can be used to modify an endogenous gene to increase its activity (e.g., by modifying or activating a promoter or enhancer operably linked to the gene). In some embodiments, the gene editing technique can be used for DNA knock-in or integration into a region of the genome (e.g., to introduce a construct encoding a target polynucleotide or target protein, such as a tolerogenic factor, CD55, CD46, CD59, or any of the other molecules described herein, for increased expression in the engineered cell). In some embodiments, the gene editing technique mediates a single-strand break (SSB). In some embodiments, the gene editing technique mediates a double-strand break (DSB), including in cases associated with non-homologous end joining (NHEJ) or homology-directed repair (HDR). In some embodiments, the gene editing technique may include DNA-based editing or prime editing. In some embodiments, the gene editing technique may include programmable addition of site-specific targeting elements (PASTE). Exemplary polynucleotides or overexpression and methods for overexpressing them are described in the following subsections.
[0297] 1. Complement inhibitors In some embodiments, the expression of one or more complement inhibitors is increased in the cells. In some embodiments, the one or more complement inhibitors are one or more membrane-bound complement inhibitors. In some embodiments, at least one of the exogenous polynucleotides comprises a polynucleotide encoding a complement inhibitor. In some embodiments, the one or more complement inhibitors are CD46, CD59, CD55, or any combination thereof. For example, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide encoding one or more complement inhibitors, such as CD46. In some embodiments, the one or more complement inhibitors are CD46 and CD59, or CD46, CD59, and CD55. In some embodiments, expression of CD46 and CD59, or CD46, CD59, and CD55, protects a cell or population thereof from complement-dependent cytotoxicity, including in the presence of antibodies against cell surface antigens expressed by the cells.
[0298] In some embodiments, the present disclosure provides cells or populations thereof that have been modified to express one or more complement inhibitors, such as CD46, CD59, CD55, or any combination thereof. In some embodiments, the one or more complement inhibitors are CD46 and CD59. In some embodiments, the one or more complement inhibitors are CD46, CD59, and CD55. In some embodiments, the present disclosure provides methods for altering the genome of a cell to express one or more complement inhibitors. In some embodiments, the engineered cell expresses one or more exogenous complement inhibitors, such as exogenous CD46 and CD59, or CD46, CD59, and CD55. In some cases, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD46 polypeptide. In some cases, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD59 polypeptide. In some cases, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD55 polypeptide. In some embodiments, the expression vector comprises nucleotide sequences encoding two or more complement inhibitors in any combination. In some embodiments, the expression vector comprises nucleotide sequences encoding CD46 and CD59. In some embodiments, the expression vector comprises nucleotide sequences encoding CD46, CD59, and CD55.
[0299] C.CD46 In some embodiments, the engineered cells contain an overexpressed polynucleotide encoding CD46, e.g., human CD46. In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD46, e.g., human CD46. In some embodiments, CD46 is overexpressed in the cells. In some embodiments, CD46 expression is increased in the engineered cells compared to similar reference or unmodified cells (including those with any other modifications) except that the reference or unmodified cells do not contain an exogenous polynucleotide encoding CD46. CD46 is a membrane-bound complement inhibitor. It acts as a cofactor for complement factor I, a serine protease that protects autologous cells against complement-mediated damage by cleaving C3b and C4b. Useful genome, polynucleotide, and polypeptide information for human CD46 can be found, for example, in GeneCard identifier GCO1P207752, HGNC number 6953, NCBI Gene ID 4179, Uniprot number P15529, and NCBI Ref Seq numbers NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2, NP_758860.1, NM_172353.2, NM_172359.2, NM_172361.2, NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1 are provided.
[0300] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD46 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD46 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD46 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequences set forth in NCBI reference numbers NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2, NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD46 set forth in NCBI reference sequence numbers NM_001777.3 and NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2, NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2.
[0301] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD46 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD46 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD46 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequences set forth in NCBI reference numbers NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2, NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD46 set forth in NCBI reference sequence numbers NM_001777.3 and NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2, NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2.
[0302] In some embodiments, the cells comprise an overexpressed CD46 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference sequence numbers NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells comprise an exogenous CD46 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells outlined herein comprise an overexpressed CD46 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cells outlined herein comprise an exogenous CD46 polypeptide having the amino acid sequence set forth in NCBI reference sequence numbers NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1.
[0303] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD46 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO:4. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD46 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO:4. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD46 polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD46 polypeptide comprising the amino acid sequence set forth in SEQ ID NO:4.
[0304] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD46 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD46 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 3. In some embodiments, the exogenous nucleotide sequence encoding the CD46 polypeptide is operably linked to a sequence encoding a heterologous signal peptide.
[0305] In some embodiments, all or a functional portion of CD46 can be linked to other components, such as a signal peptide, a leader sequence, a secretion signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding the signal peptide of CD46 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony-stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRα), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as an IgG heavy chain or an IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2) or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, luciferase, trypsinogen (e.g., chymotrypsinogen or trypsinogen), or other signal peptide that enables efficient expression of a protein by or on a cell.
[0306] In certain embodiments, the exogenous polynucleotide encoding CD46 is operably linked to a promoter.
[0307] In some embodiments, the polynucleotide encoding CD46 is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding CD46 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding CD46 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CD46 is inserted into the B2M locus, the CIITA locus, or the TRAC locus. In some embodiments, the engineered cell is a T cell, and the polynucleotide encoding CD46 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CD46 into the genomic locus of the cell.
[0308] In some embodiments, CD46 protein expression is detected using Western blots of cell lysates probed with an antibody against CD46 protein, hi another embodiment, the presence of exogenous CD46 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0309] D.CD59 In some embodiments, the engineered cells contain an overexpressed polynucleotide encoding CD59, e.g., human CD59. In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD59, e.g., human CD59. In some embodiments, CD59 is overexpressed in the cells. In some embodiments, CD59 expression is increased in the engineered cells compared to similar reference or unmodified cells (including those with any other modifications) except that the reference or unmodified cells do not contain an exogenous polynucleotide encoding CD59. CD59 is a membrane-bound complement inhibitor. More specifically, CD59 is an inhibitor of the membrane attack complex (MAC) activity of complement. CD59 acts by binding to the C8 and / or C9 complement of the assembling MAC, thereby preventing the incorporation of multiple copies of C9 required for complete osmotic pore formation. Useful genome, polynucleotide, and polypeptide information for human CD59 is available, for example, under GeneCard identifier GC11M033704, HGNC number 1689, NCBI gene ID 966, Uniprot number P13987, and NCBI The sequences are provided in RefSeq numbers NP_000602.1, NM_000611.5, NP_001120695.1, NM_001127223.1, NP_001120697.1, NM_001127225.1, NP_001120698.1, NM_001127226.1, NP_001120699.1, NM_001127227.1, NP_976074.1, NM_203329.2, NP_976075.1, NM_203330.2, NP_976076.1, and NM_203331.2.
[0310] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD59 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequences set forth in NCBI reference numbers NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD59 set forth in NCBI Reference SEQ ID NOs: NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2.
[0311] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD59 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD59 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1.In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD59 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequences set forth in NCBI reference numbers NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD59 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequences set forth in NCBI reference numbers NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD59 set forth in NCBI Reference SEQ ID NOs: NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD59 set forth in NCBI reference sequence numbers NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2.
[0312] In some embodiments, the cells comprise an overexpressed CD59 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells comprise an exogenous CD59 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells outlined herein comprise overexpressed CD59 polypeptides having the amino acid sequences set forth in NCBI reference sequence numbers NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cells outlined herein comprise an exogenous CD59 polypeptide having the amino acid sequence set forth in NCBI reference sequence numbers NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1.
[0313] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD59 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide comprising the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD59 polypeptide comprising the amino acid sequence set forth in SEQ ID NO:6.
[0314] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD59 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD59 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD59 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 5. In some embodiments, the exogenous nucleotide sequence encoding a CD59 polypeptide is operably linked to a sequence encoding a heterologous signal peptide.
[0315] In some embodiments, all or a functional portion of CD59 can be linked to other components, such as a signal peptide, a leader sequence, a secretion signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding the signal peptide of CD59 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony-stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRα), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as an IgG heavy chain or an IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2) or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, luciferase, trypsinogen (e.g., chymotrypsinogen or trypsinogen), or other signal peptide that enables efficient expression of a protein by or on a cell.
[0316] In certain embodiments, the exogenous polynucleotide encoding CD59 is operably linked to a promoter.
[0317] In some embodiments, the polynucleotide encoding CD59 is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding CD59 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding CD59 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CD59 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the polynucleotide encoding CD59 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CD59 into the genomic locus of the cell.
[0318] In some embodiments, CD59 protein expression is detected using Western blots of cell lysates probed with an antibody against CD59 protein, hi another embodiment, the presence of exogenous CD59 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0319] E.CD55 In some embodiments, the engineered cells contain an overexpressed polynucleotide encoding CD55, e.g., human CD55. In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD55, e.g., human CD55. In some embodiments, CD55 is overexpressed in the cells. In some embodiments, CD55 expression is increased in the engineered cells compared to similar reference or unmodified cells (including those with any other modifications) except that the reference or unmodified cells do not contain an exogenous polynucleotide encoding CD55. CD55 is a membrane-bound complement inhibitor. In some embodiments, the interaction of CD55 with cell-bound C4b and C3b polypeptides interferes with their ability to catalyze the conversion of C2 and factor B to enzymatically active C2a and Bb, thereby preventing the formation of C4b2a and C3bBb, the amplifying convertases of the complement cascade. In some embodiments, CD55 inhibits complement activation by destabilizing and preventing the formation of C3 and C5 convertases. Useful genomic, polynucleotide, and polypeptide information for human CD55 (also known as complement decay-accelerating factor) is provided, for example, under GeneCard identifier GC01P207321, HGNC number 2665, NCBI Gene ID 1604, Uniprot number P08174, and NCBI RefSeq numbers NM_000574.4, NM_001114752.2, NM_001300903.1, NM_001300904.1, NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1.
[0320] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD55 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD55 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD55 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the sequences set forth in NCBI Reference Nos. NM_001777.3 and NM_198793.2. In some embodiments, the cells comprise an overexpressed nucleotide sequence for CD55 set forth in NCBI Reference SEQ ID NOs: NM_000574.4, NM_001114752.2, NM_001300903.1, and NM_001300904.1.
[0321] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD55 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD55 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD55 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the sequence set forth in NCBI Reference Nos. NM_001777.3 and NM_198793.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD55 set forth in NCBI Reference SEQ ID NOs: NM_000574.4, NM_001114752.2, NM_001300903.1, and NM_001300904.1.
[0322] In some embodiments, the cells comprise an overexpressed CD55 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells comprise an exogenous CD55 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99% or more) to the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells outlined herein comprise an overexpressed CD55 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cells outlined herein comprise an exogenous CD55 polypeptide having the amino acid sequence set forth in NCBI Reference SEQ ID NOs: NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1.
[0323] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD55 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD55 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD55 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD55 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 9.
[0324] In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD55 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD55 polypeptide having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the cells outlined herein comprise an overexpressed nucleotide sequence encoding a CD55 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD55 polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 8. In some embodiments, the exogenous nucleotide sequence encoding a CD55 polypeptide is operably linked to a sequence encoding a heterologous signal peptide.
[0325] In some embodiments, all or a functional portion of CD55 can be linked to other components, such as a signal peptide, a leader sequence, a secretion signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding the signal peptide of CD55 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony-stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRα), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as an IgG heavy chain or an IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2) or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, luciferase, trypsinogen (e.g., chymotrypsinogen or trypsinogen), or other signal peptide that enables efficient expression of a protein by or on a cell.
[0326] In certain embodiments, the exogenous polynucleotide encoding CD55 is operably linked to a promoter.
[0327] In some embodiments, the polynucleotide encoding CD55 is inserted into any one of the loci shown in Table 2. Optionally, the polynucleotide encoding CD55 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding CD55 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CD55 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the polynucleotide encoding CD55 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CD55 into the genomic locus of the cell.
[0328] In some embodiments, CD55 protein expression is detected using Western blots of cell lysates probed with antibodies against CD55 protein, hi another embodiment, the presence of exogenous CD55 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0329] F. Complement inhibitor combinations In some embodiments, the cells comprise increased expression of two or more complement inhibitors selected from the group consisting of CD46, CD59, and CD55 in any combination.
[0330] In some embodiments, the engineered cells contain an overexpressed polynucleotide encoding CD46, e.g., any of those mentioned above, and an overexpressed polynucleotide encoding CD59, e.g., any of those mentioned above.
[0331] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD46, e.g., any of those mentioned above, and an exogenous polynucleotide encoding CD59, e.g., any of those mentioned above.
[0332] In some embodiments, engineered cells (containing one or more modifications that increase expression of CD46 and CD59) comprise increased expression of CD46 and CD59 relative to cells that do not contain the modifications (e.g., relative to endogenous expression of CD46 and CD59). In some embodiments, engineered cells comprise 1.5-fold to 2-fold, 2-fold to 3-fold, 3-fold to 4-fold, 4-fold to 5-fold, 5-fold to 10-fold, 10-fold to 15-fold, 15-fold to 20-fold, 20-fold to 40-fold, 40-fold to 60-fold, 60-fold to 80-fold, 80-fold to 100-fold, or 100-fold to 200-fold increased expression of CD46 and CD59 relative to cells that do not have the modifications (e.g., relative to endogenous expression of CD46 and CD59). In some embodiments, cells that do not have the modification(s) do not have endogenous expression of CD46 and CD59 or do not have detectable expression of CD46 and CD59. In some embodiments, the fold increase in expression compared to cells lacking the modification is greater than 200-fold.
[0333] In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46 and CD59) comprise a 2-fold to 200-fold, 2-fold to 100-fold, 2-fold to 50-fold, or 2-fold to 20-fold increased expression of CD46 and CD59 compared to cells without the modifications (e.g., compared to endogenous expression of CD46 and CD59). In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46 and CD59) comprise a 5-fold to 200-fold, 5-fold to 100-fold, 5-fold to 50-fold, or 5-fold to 20-fold increased expression of CD46 and CD59 compared to cells without the modifications (e.g., compared to endogenous expression of CD46 and CD59).
[0334] In some embodiments, engineered cells (containing one or more modifications that increase expression of CD46 and CD59) comprise increased expression of CD46 and CD59 compared to cells that do not contain the modifications (e.g., compared to endogenous expression of CD46 and CD59). In some embodiments, engineered cells comprise increased expression of CD46 and CD59 compared to cells that do not have the modifications (e.g., compared to endogenous expression of CD46 and CD59) by at least or about 2-fold, at least or about 4-fold, at least or about 6-fold, at least 10-fold, at least or about 15-fold, at least 20-fold, at least 30-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 100-fold, or any value between any of the foregoing values.
[0335] In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46 and CD59) comprise increased expression of CD46 and CD59 compared to cells that do not comprise the modifications (e.g., compared to endogenous expression of CD46 and CD59). In some embodiments, engineered cells comprise increased expression of CD46 and CD59 compared to cells that do not comprise the modifications (e.g., compared to endogenous expression of CD46 and CD59) by at or about 2-fold, 4-fold, 6-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 60-fold, 70-fold, 80-fold, 100-fold, or any value between any of the foregoing values.
[0336] In some embodiments, the cells comprise one or more transgenes encoding CD46 and CD59. In some embodiments, the transgenes are monocistronic or multicistronic vectors, as described in Section II.B.4, below. In some embodiments, CD46 and CD59 are comprised in the same multicistronic vector, optionally in combination with one or more tolerogenic factors, such as CD47. In some embodiments, CD46 and CD59 are comprised in different transgenes, optionally in combination with one or more tolerogenic factors, such as CD47.
[0337] In some embodiments, the engineered cells contain an overexpressed polynucleotide encoding CD46, e.g., any of those mentioned above, an overexpressed polynucleotide encoding CD59, e.g., any of those mentioned above, and an overexpressed polynucleotide encoding CD55, e.g., any of those mentioned above.
[0338] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD46, e.g., any of those mentioned above, an exogenous polynucleotide encoding CD59, e.g., any of those mentioned above, and an exogenous polynucleotide encoding CD55, e.g., any of those mentioned above.
[0339] In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46, CD59, and CD55) comprise increased expression of CD46, CD59, and CD55 compared to cells that do not comprise the modifications (e.g., compared to endogenous expression of CD46, CD59, and CD55). In some embodiments, engineered cells comprise 1.5-fold to 2-fold, 2-fold to 3-fold, 3-fold to 4-fold, 4-fold to 5-fold, 5-fold to 10-fold, 10-fold to 15-fold, 15-fold to 20-fold, 20-fold to 40-fold, 40-fold to 60-fold, 60-fold to 80-fold, 80-fold to 100-fold, or 100-fold to 200-fold increased expression of CD46, CD59, and CD55 compared to cells that do not have the modifications (e.g., compared to endogenous expression of CD46, CD59, and CD55). In some embodiments, cells that do not have the modification(s) have no endogenous expression of CD46, CD59, and CD55, or no detectable expression of CD46, CD59, and CD55. In some embodiments, the fold increase in expression compared to cells lacking the modification is greater than 200-fold.
[0340] In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46, CD59, and CD55) comprise a 2-fold to 200-fold, 2-fold to 100-fold, 2-fold to 50-fold, or 2-fold to 20-fold increased expression of CD46, CD59, and CD55 compared to cells without the modifications (e.g., compared to endogenous expression of CD46, CD59, and CD55). In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46, CD59, and CD55) comprise a 5-fold to 200-fold, 5-fold to 100-fold, 5-fold to 50-fold, or 5-fold to 20-fold increased expression of CD46, CD59, and CD55 compared to cells without the modifications (e.g., compared to endogenous expression of CD46, CD59, and CD55).
[0341] In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46, CD59, and CD55) comprise increased expression of CD46, CD59, and CD55 compared to cells that do not comprise the modification (e.g., compared to endogenous expression of CD46 and CD59). In some embodiments, engineered cells comprise increased expression of CD46, CD59, and CD55 by at least or about 2-fold, at least or about 4-fold, at least or about 6-fold, at least 10-fold, at least or about 15-fold, at least 20-fold, at least 30-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 100-fold, or any value between any of the foregoing values, compared to cells that do not have the modification (e.g., compared to endogenous expression of CD46, CD59, and CD55).
[0342] In some embodiments, engineered cells (comprising one or more modifications that increase expression of CD46, CD59, and CD55) comprise increased expression of CD46, CD59, and CD55 compared to cells that do not comprise the modification (e.g., compared to endogenous expression of CD46, CD59, and CD55). In some embodiments, engineered cells comprise increased expression of CD46, CD59, and CD55 by at or about 2-fold, 4-fold or about 4-fold, 6-fold or about 6-fold, 10-fold or about 10-fold, 15-fold or about 15-fold, 20-fold or about 20-fold, 30-fold or about 30-fold, 50-fold or about 50-fold, 60-fold or about 60-fold, 70-fold or about 70-fold, 80-fold or about 80-fold, 100-fold or about 100-fold, or any value between any of the foregoing values, compared to cells that do not have the modification (e.g., compared to endogenous expression of CD46, CD59, and CD55).
[0343] In some embodiments, the cells comprise one or more transgenes encoding CD46, CD59, and CD55. In some embodiments, the transgenes are monocistronic or multicistronic vectors, as described in Section II.B.4, below. In some embodiments, CD46, CD59, and CD55 are comprised in the same multicistronic vector, optionally in combination with one or more tolerogenic factors, such as CD47. In some embodiments, CD46, CD59, and CD55 are comprised in different transgenes, optionally in combination with one or more tolerogenic factors, such as CD47.
[0344] 2. Tolerogenic factors In some embodiments, the expression of a tolerogenic factor is overexpressed or increased in the cells. In some embodiments, the engineered cells comprise increased expression, i.e., overexpression, of at least one tolerogenic factor. In some embodiments, the tolerogenic factor is any factor that promotes or contributes to the promotion or induction of tolerance of the engineered cells by the immune system (e.g., the innate or adaptive immune system). In some embodiments, the tolerogenic factor is DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factor is CD47, PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200, or Mfge8, or any combination thereof. In some embodiments, the cells comprise at least one exogenous polynucleotide, including a polynucleotide encoding a tolerogenic factor. For example, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide encoding CD47. Provided herein are cells that do not elicit or activate an immune response upon administration to a recipient subject. As described above, in some embodiments, the cells are modified to increase expression of genes and tolerogenic (e.g., immune) factors that affect immune recognition and tolerance in the recipient.
[0345] In some embodiments, the present disclosure provides cells or populations thereof that have been modified to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the disclosure provides methods for altering the genome of a cell to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the engineered cell expresses an exogenous tolerogenic factor (e.g., an immunomodulatory polypeptide), such as exogenous CD47. In some cases, overexpression or increased expression of an exogenous polynucleotide is achieved by introducing into the cell (e.g., transducing the cell) an expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide. In some embodiments, the expression vector may be a viral vector, such as a lentiviral vector, or a non-viral vector. In some embodiments, the cell is engineered to contain one or more exogenous polynucleotides, wherein at least one of the exogenous polynucleotides comprises a polynucleotide encoding a tolerogenic factor. In some of any of the embodiments, the tolerogenic factor is DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factor is selected from CD47, PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200, or Mfge8, or any combination thereof. For example, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide encoding CD47.
[0346] In some embodiments, the tolerogenic factor is CD47. In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD47, e.g., human CD47. In some embodiments, CD47 is overexpressed in the cells. In some embodiments, CD47 expression is overexpressed or increased in the engineered cells compared to a similar cell of the same cell type that has not been engineered by the modification, such as a reference or unmodified cell, e.g., a cell that has not been engineered with an exogenous polynucleotide encoding CD47. CD47 is a leukocyte surface antigen that plays a role in cell adhesion and regulation of integrins. It is normally expressed on the surface of cells and signals circulating macrophages to prevent phagocytosis of the cells. Useful genome, polynucleotide, and polypeptide information for human CD47 is provided, for example, in NP_001768.1, NP_942088.1, NM_001777.3, and NM_198793.2.
[0347] In some embodiments, the engineered cells comprise increased expression, i.e., overexpression, of at least one tolerogenic factor. In some embodiments, the cells comprise at least one exogenous polynucleotide comprising a polynucleotide encoding a tolerogenic factor. In some embodiments, the tolerogenic factors include DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, C1-inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3, or any combination thereof. For example, in some embodiments, at least one of the overexpressed (e.g., exogenous) polynucleotides is a polynucleotide encoding CD47.
[0348] In some embodiments, the present disclosure provides cells or populations thereof that have been modified to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the present disclosure provides methods for altering the genome of a cell to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the engineered cell expresses an exogenous tolerogenic factor (e.g., an immunomodulatory polypeptide), such as exogenous CD47. In some cases, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide.
[0349] In some embodiments, the engineered cells contain an overexpressed polynucleotide encoding CD47, e.g., human CD47. In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD47, e.g., human CD47. In some embodiments, CD47 is overexpressed in the cells. In some embodiments, CD47 expression is increased in the engineered cells compared to similar reference or unmodified cells (including those with any other modifications) except that the reference or unmodified cells do not contain an exogenous polynucleotide encoding CD47. CD47 is a leukocyte surface antigen that plays a role in cell adhesion and regulation of integrins. It is normally expressed on the surface of cells and signals circulating macrophages to prevent phagocytosis of the cells. Useful genome, polynucleotide, and polypeptide information for human CD47 is provided, for example, in NP_001768.1, NP_942088.1, NM_001777.3, and NM_198793.2.
[0350] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 that has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the sequence set forth in NCBI reference numbers NM_001777.3 and NM_198793.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 set forth in NCBI reference numbers NM_001777.3 and NM_198793.2.
[0351] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 that has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the sequence set forth in NCBI reference numbers NM_001777.3 and NM_198793.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 set forth in NCBI reference numbers NM_001777.3 and NM_198793.2.
[0352] In some embodiments, the cells comprise an exogenous CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells outlined herein comprise an exogenous CD47 polypeptide having the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1.
[0353] In some embodiments, the cell comprises an overexpressed polynucleotide encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an exogenous polynucleotide encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an overexpressed polynucleotide encoding a CD47 polypeptide having the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an exogenous polynucleotide encoding a CD47 polypeptide having the amino acid sequence set forth in SEQ ID NO: 1.
[0354] In some embodiments, the cell comprises an overexpressed CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an exogenous CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an overexpressed CD47 polypeptide having the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an exogenous CD47 polypeptide having the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the exogenous nucleotide sequence encoding a CD59 polypeptide is operably linked to a sequence encoding a heterologous signal peptide. In some embodiments, the exogenous polynucleotide encoding CD47 is integrated into the genome of the cell by targeted or non-targeted insertion methods, such as those further described below. In some embodiments, the targeted insertion is by homology-dependent insertion into the target locus, e.g., insertion into any one of the loci shown in Table 2, e.g., the B2M gene, the CIITA gene, the TRAC gene, or the TRBC gene. In some embodiments, the targeted insertion is by homology-independent insertion, e.g., insertion into a safe harbor locus. In some cases, the polynucleotide encoding CD47 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In certain embodiments, the polynucleotide encoding CD47 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus.
[0355] In some embodiments, all or a functional portion of CD47 can be linked to other components, such as a signal peptide, a leader sequence, a secretion signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding the signal peptide of CD47 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony-stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRα), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as an IgG heavy chain or an IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2) or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, luciferase, trypsinogen (e.g., chymotrypsinogen or trypsinogen), or other signal peptide that enables efficient expression of a protein by or on a cell.
[0356] In certain embodiments, the exogenous polynucleotide encoding CD47 is operably linked to a promoter.
[0357] In some embodiments, the exogenous polynucleotide encoding CD47 is inserted into any one of the loci shown in Table 2. In some cases, the exogenous polynucleotide encoding CD47 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the exogenous polynucleotide encoding CD47 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the exogenous polynucleotide encoding CD47 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the exogenous polynucleotide encoding CD47 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CD47 into the genomic locus of the cell.
[0358] In some embodiments, CD47 protein expression is detected using Western blots of cell lysates probed with an antibody against CD47 protein, hi another embodiment, the presence of exogenous CD47 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0359] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CD200, e.g., human CD200. In some embodiments, CD200 is overexpressed in the cells. In some embodiments, expression of CD200 is increased in the engineered cells compared to similar reference or unmodified cells (including those with any other modifications) except that the reference or unmodified cells do not contain an exogenous polynucleotide encoding CD200. Useful genome, polynucleotide, and polypeptide information for human CD200 is provided, for example, at GeneCard identifier GC03P112332, HGNC number 7203, NCBI Gene ID 4345, Uniprot number P41217, and NCBI RefSeq numbers NP_001004196.2, NM_001004196.3, NP_001305757.1, NM_001318828.1, NP_005935.4, NM_005944.6, XP_005247539.1, and XM_005247482.2. In certain embodiments, the polynucleotide encoding CD200 is operably linked to a promoter.
[0360] In some embodiments, the polynucleotide encoding CD200 is inserted into any one of the loci shown in Table 2. Optionally, the polynucleotide encoding CD200 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding CD200 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CD200 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the polynucleotide encoding CD200 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CD200 into the genomic locus of the cell.
[0361] In some embodiments, CD200 protein expression is detected using Western blots of cell lysates probed with antibodies against CD200 protein, hi another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous CD200 mRNA.
[0362] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding HLA-E, e.g., human HLA-E. In some embodiments, HLA-E is overexpressed in the cells. In some embodiments, expression of HLA-E is increased in the engineered cells compared to a similar reference or unmodified cell (including one with any other modification) except that the reference or unmodified cell does not contain an exogenous polynucleotide encoding HLA-E. Useful genome, polynucleotide, and polypeptide information for human HLA-E is provided, for example, at GeneCard identifier GC06P047281, HGNC number 4962, NCBI gene ID 3133, Uniprot number P13747, and NCBI RefSeq numbers NP_005507.3 and NM_005516.5. In certain embodiments, the polynucleotide encoding HLA-E is operably linked to a promoter.
[0363] In some embodiments, the polynucleotide encoding HLA-E is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding HLA-E is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In certain embodiments, the polynucleotide encoding HLA-E is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding HLA-E is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell, and the polynucleotide encoding HLA-E is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding HLA-E into the genomic locus of the cell.
[0364] In some embodiments, HLA-E protein expression is detected using Western blots of cell lysates probed with antibodies against HLA-E protein, hi another embodiment, the presence of exogenous HLA-E mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0365] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding HLA-G, e.g., human HLA-G. In some embodiments, HLA-G is overexpressed in the cells. In some embodiments, expression of HLA-G is increased in the engineered cells compared to similar reference or unmodified cells (including those with any other modifications) except that the reference or unmodified cells do not contain an exogenous polynucleotide encoding HLA-G. Useful genome, polynucleotide, and polypeptide information for human HLA-G is provided, for example, at GeneCard identifier GC06P047256, HGNC number 4964, NCBI gene ID 3135, Uniprot number P17693, and NCBI RefSeq numbers NP_002118.1 and NM_002127.5. In certain embodiments, the polynucleotide encoding HLA-G is operably linked to a promoter.
[0366] In some embodiments, the polynucleotide encoding HLA-G is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding HLA-G is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In certain embodiments, the polynucleotide encoding HLA-G is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding HLA-G is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell, and the polynucleotide encoding HLA-G is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding HLA-G into the genomic locus of the cell.
[0367] In some embodiments, HLA-G protein expression is detected using Western blots of cell lysates probed with antibodies against HLA-G protein, hi another embodiment, the presence of exogenous HLA-G mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0368] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding PD-L1, e.g., human PD-L1. In some embodiments, PD-L1 is overexpressed in the cells. In some embodiments, PD-L1 expression is increased in the engineered cells compared to a reference or unmodified cell (including one with any other modification) that is similar except that the reference or unmodified cell does not contain the exogenous polynucleotide encoding PD-L1. Useful genomic, polynucleotide, and polypeptide information for human PD-L1 or CD274 is provided, for example, at GeneCard identifier GC09P005450, HGNC number 17635, NCBI Gene ID 29126, Uniprot number Q9NZQ7, and NCBI RefSeq numbers NP_001254635.1, NM_001267706.1, NP_054862.1, and NM_014143.3. In certain embodiments, the polynucleotide encoding PD-L1 is operably linked to a promoter.
[0369] In some embodiments, the polynucleotide encoding PD-L1 is inserted into any one of the loci shown in Table 2. Optionally, the polynucleotide encoding PD-L1 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding PD-L1 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding PD-L1 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the polynucleotide encoding PD-L1 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding PD-L1 into a genomic locus of the cell.
[0370] In some embodiments, PD-L1 protein expression is detected using Western blots of cell lysates probed with an antibody against PD-L1 protein, hi another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous PD-L1 mRNA.
[0371] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding FasL, e.g., human FasL. In some embodiments, FasL is overexpressed in the cells. In some embodiments, expression of FasL is increased in the engineered cells compared to a similar reference or unmodified cell (including one with any other modification) except that the reference or unmodified cell does not contain the exogenous polynucleotide encoding FasL. Useful genomic, polynucleotide, and polypeptide information for human Fas ligand (also known as FasL, FASLG, CD178, TNFSF6, etc.) is provided, for example, at GeneCard identifier GCO1P172628, HGNC number 11936, NCBI gene ID 356, Uniprot number P48023, and NCBI RefSeq numbers NP_000630.1, NM_000639.2, NP_001289675.1, and NM_001302746.1. In certain embodiments, the polynucleotide encoding Fas-L is operably linked to a promoter.
[0372] In some embodiments, the polynucleotide encoding Fas-L is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding Fas-L is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding Fas-L is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding Fas-L is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the polynucleotide encoding Fas-L is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding Fas-L into a genomic locus of the cell.
[0373] In some embodiments, Fas-L protein expression is detected using Western blots of cell lysates probed with an antibody against Fas-L protein, hi another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous Fas-L mRNA.
[0374] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CCL21, e.g., human CCL21. In some embodiments, CCL21 is overexpressed in the cells. In some embodiments, expression of CCL21 is increased in the engineered cells compared to a similar reference or unmodified cell (including one with any other modification) except that the reference or unmodified cell does not contain an exogenous polynucleotide encoding CCL21. Useful genome, polynucleotide, and polypeptide information for human CCL21 is provided, for example, at GeneCard identifier GC09M034709, HGNC number 10620, NCBI gene ID 6366, Uniprot number O00585, and NCBI RefSeq numbers NP_002980.1 and NM_002989.3. In certain embodiments, the polynucleotide encoding CCL21 is operably linked to a promoter.
[0375] In some embodiments, the polynucleotide encoding CCL21 is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding CCL21 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In certain embodiments, the polynucleotide encoding CCL21 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CCL21 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and the polynucleotide encoding CCL21 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CCL21 into a genomic locus of the cell.
[0376] In some embodiments, CCL21 protein expression is detected using Western blots of cell lysates probed with antibodies against CCL21 protein, hi another embodiment, the presence of exogenous CCL21 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0377] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding CCL22, e.g., human CCL22. In some embodiments, CCL22 is overexpressed in the cells. In some embodiments, expression of CCL22 is increased in the engineered cells compared to a similar reference or unmodified cell (including one with any other modification) except that the reference or unmodified cell does not contain an exogenous polynucleotide encoding CCL22. Useful genome, polynucleotide, and polypeptide information for human CCL22 is provided, for example, at GeneCard identifier GC16P057359, HGNC number 10621, NCBI gene ID 6367, Uniprot number O00626, and NCBI RefSeq numbers NP_002981.2, NM_002990.4, XP_016879020.1, and XM_017023531.1. In certain embodiments, the polynucleotide encoding CCL22 is operably linked to a promoter.
[0378] In some embodiments, the polynucleotide encoding CCL22 is inserted into any one of the loci shown in Table 2. Optionally, the polynucleotide encoding CCL22 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In certain embodiments, the polynucleotide encoding CCL22 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CCL22 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell, and the polynucleotide encoding CCL22 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CCL22 into a genomic locus of the cell.
[0379] In some embodiments, CCL22 protein expression is detected using Western blots of cell lysates probed with antibodies against CCL22 protein, hi another embodiment, the presence of exogenous CCL22 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0380] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding Mfge8, e.g., human Mfge8. In some embodiments, Mfge8 is overexpressed in the cells. In some embodiments, expression of Mfge8 is increased in the engineered cells compared to a similar reference or unmodified cell (including one with any other modification) except that the reference or unmodified cell does not contain the exogenous polynucleotide encoding Mfge8. Useful genome, polynucleotide, and polypeptide information for human Mfge8 is provided, for example, at GeneCard identifier GC15M088898, HGNC number 7036, NCBI Gene ID 4240, Uniprot number Q08431, and NCBI RefSeq numbers NP_001108086.1, NM_001114614.2, NP_001297248.1, NM_001310319.1, NP_001297249.1, NM_001310320.1, NP_001297250.1, NM_001310321.1, NP_005919.2, and NM_005928.3. In certain embodiments, the polynucleotide encoding Mfge8 is operably linked to a promoter.
[0381] In some embodiments, a polynucleotide encoding Mfge8 is inserted into any one of the loci shown in Table 2. In some cases, a polynucleotide encoding Mfge8 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, a polynucleotide encoding Mfge8 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, a polynucleotide encoding Mfge8 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell and a polynucleotide encoding Mfge8 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate insertion of a polynucleotide encoding Mfge8 into a genomic locus of the cell.
[0382] In some embodiments, Mfge8 protein expression is detected using Western blots of cell lysates probed with an antibody against Mfge8 protein, hi another embodiment, the presence of exogenous Mfge8 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0383] In some embodiments, the engineered cells contain an exogenous polynucleotide encoding SerpinB9, e.g., human SerpinB9. In some embodiments, SerpinB9 is overexpressed in the cells. In some embodiments, expression of SerpinB9 is increased in the engineered cells compared to a similar reference or unmodified cell (including one with any other modification) except that the reference or unmodified cell does not contain an exogenous polynucleotide encoding SerpinB9. Useful genome, polynucleotide, and polypeptide information for human SerpinB9 is provided, for example, at GeneCard identifier GC06M002887, HGNC number 8955, NCBI gene ID 5272, Uniprot number P50453, and NCBI RefSeq numbers NP_004146.1, NM_004155.5, XP_005249241.1, and XM_005249184.4. In certain embodiments, the polynucleotide encoding SerpinB9 is operably linked to a promoter.
[0384] In some embodiments, the polynucleotide encoding SerpinB9 is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding SerpinB9 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In certain embodiments, the polynucleotide encoding SerpinB9 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding SerpinB9 is inserted into the B2M locus or the CIITA locus. In some embodiments, the engineered cell is a T cell, and the polynucleotide encoding SerpinB9 is inserted into the TRAC locus or the TRBC locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system, or any of the gene editing systems described herein) is used to facilitate the insertion of the polynucleotide encoding SerpinB9 into a genomic locus of the cell.
[0385] In some embodiments, SerpinB9 protein expression is detected using Western blot of cell lysates probed with an antibody against SerpinB9 protein. In another embodiment, the presence of exogenous SerpinB9 mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).
[0386] 3. Chimeric Antigen Receptor In some embodiments, the engineered cells provided are further modified to express a chimeric antigen receptor (CAR). In some embodiments, the provided cells contain genetic modifications of one or more target polynucleotide sequences that regulate the expression of one or more MHC class I molecules, one or more MHC class II molecules, or one or more MHC class I molecules and one or more MHC class II molecules, reduce complement pathway activation, overexpress a tolerogenic factor (e.g., CD47) described herein, and express a CAR. In some embodiments, the cells are those in which B2M is reduced or eliminated (e.g., knocked out), CIITA is reduced or eliminated (e.g., knocked out), CD46 is overexpressed, CD59 is overexpressed, CD47 is overexpressed, and a CAR is expressed. In some embodiments, the cells are those in which B2M is reduced or eliminated (e.g., knocked out), CD46 is overexpressed, CD59 is overexpressed, CD47 is overexpressed, and a CAR is expressed. - / - , C.I.T.A. - / - , CD46tg, CD59tg, CD47tg, CAR+. In some embodiments, the cells (e.g., T cells) may further have reduced or eliminated (e.g., knocked out) TRAC. In some embodiments, the cells are B2 - / - , C.I.T.A. - / - , CD46tg, CD59tg, CD47tg, TRAC - / - It's CAR+.
[0387] In some embodiments, the polynucleotide encoding CAR is introduced into cells.In some embodiments, the cell is T cell, for example, primary T cell or T cell differentiated from pluripotent cell (for example, iPSC).In some embodiments, the cell is natural killer (NK) cell, for example, primary NK cell or NK cell differentiated from pluripotent cell (for example, iPSC).
[0388] In some embodiments, the CAR is selected from the group consisting of a first-generation CAR, a second-generation CAR, a third-generation CAR, and a fourth-generation CAR. In some embodiments, the CAR is or comprises a first-generation CAR comprising an antigen-binding domain, a transmembrane domain, and at least one signaling domain (e.g., 1, 2, or 3 signaling domains). In some embodiments, the CAR comprises a second-generation CAR comprising an antigen-binding domain, a transmembrane domain, and at least two signaling domains. In some embodiments, the CAR comprises a third-generation CAR comprising an antigen-binding domain, a transmembrane domain, and at least three signaling domains. In some embodiments, the CAR is a fourth-generation CAR comprising an antigen-binding domain, a transmembrane domain, three or four signaling domains, and a domain that induces cytokine gene expression upon successful CAR signaling. In some embodiments, the antigen-binding domain is or comprises an antibody, antibody fragment, scFv, or Fab.
[0389] In some embodiments, any one of the cells described herein comprises a nucleic acid encoding a CAR or a first-generation CAR. In some embodiments, the first-generation CAR comprises an antigen-binding domain, a transmembrane domain, and a signaling domain. In some embodiments, the signaling domain mediates downstream signaling during T cell activation.
[0390] In some embodiments, any one of the cells described herein comprises a nucleic acid encoding a CAR or a second-generation CAR. In some embodiments, the second-generation CAR comprises an antigen-binding domain, a transmembrane domain, and two signaling domains. In some embodiments, the signaling domain mediates downstream signaling during T cell activation. In some embodiments, the signaling domain is a costimulatory domain. In some embodiments, the costimulatory domain enhances cytokine production, CAR T cell proliferation, and / or CAR T cell persistence during T cell activation.
[0391] In some embodiments, any one of the cells described herein comprises a nucleic acid encoding a CAR or a third-generation CAR. In some embodiments, the third-generation CAR comprises an antigen-binding domain, a transmembrane domain, and at least three signaling domains. In some embodiments, the signaling domain mediates downstream signaling during T cell activation. In some embodiments, the signaling domain is a costimulatory domain. In some embodiments, the costimulatory domain enhances cytokine production, CAR T cell proliferation, and / or CAR T cell persistence during T cell activation. In some embodiments, the third-generation CAR comprises at least two costimulatory domains. In some embodiments, the at least two costimulatory domains are not the same.
[0392] In some embodiments, any one of the cells described herein comprises a nucleic acid encoding a CAR or a fourth-generation CAR. In some embodiments, the fourth-generation CAR comprises an antigen-binding domain, a transmembrane domain, and at least two, three, or four signaling domains. In some embodiments, the signaling domain mediates downstream signaling during T cell activation. In some embodiments, the signaling domain is a costimulatory domain. In some embodiments, the costimulatory domain enhances cytokine production, CAR T cell proliferation, and / or CAR T cell persistence during T cell activation.
[0393] In some embodiments, the engineered cells provided herein (e.g., primary T cells or iPSC-derived T cells, or primary NK cells or iPSC-derived NK cells) comprise a polynucleotide encoding a CAR, wherein the polynucleotide is inserted into a genomic locus. In some embodiments, the polynucleotide is inserted into a safe harbor locus, such as, but not limited to, the AAVS1, CCR5, CLYBL, ROSA26, SHS231, F3 (also known as CD142), MICA, MICB, LRP1 (also known as CD91), HMGB1, ABO, RHD, FUT1, or KDM5D locus. In some embodiments, the polynucleotide is inserted into the B2M, CIITA, TRAC, TRB, PD1, or CTLA4 gene. Any suitable method can be used to insert the CAR into the genomic locus of a hypoimmunogenic cell, including gene editing methods described herein (e.g., CRISPR / Cas systems).
[0394] In some embodiments, the first, second, third, or fourth generation CAR further comprises a domain that induces expression of a cytokine gene upon successful CAR signaling. In some embodiments, the cytokine gene is endogenous or exogenous to the target cell comprising the CAR, which comprises a domain that induces expression of a cytokine gene upon successful CAR signaling. In some embodiments, the cytokine gene encodes a pro-inflammatory cytokine. In some embodiments, the cytokine gene encodes IL-1, IL-2, IL-9, IL-12, IL-18, TNF, or IFN-gamma, or a functional fragment thereof. In some embodiments, the domain that induces expression of a cytokine gene upon successful CAR signaling is or comprises a transcription factor, or a functional domain or fragment thereof. In some embodiments, the domain that induces expression of a cytokine gene upon successful CAR signaling is or comprises a transcription factor, or a functional domain or fragment thereof. In some embodiments, the transcription factor, or a functional domain or fragment thereof, is or comprises nuclear factor of activated T cells (NFAT), NF-kB, or a functional domain or fragment thereof. See, for example, Zhang, C. et al., Engineering CAR-T cells. Biomarker Research. 5:22 (2017), WO2016126608, Sha, H. et al. Chimaeric antigen receptor T-cell therapy for tumor immunotherapy. Bioscience Reports Jan 27, 2017, 37(1).
[0395] Those skilled in the art are familiar with CARs and their different components and configurations. Any known CAR can be used in connection with the provided embodiments. In addition to the CARs described herein, various CARs and their encoding nucleotide sequences are known in the art and would be suitable for the cell engineering described herein. See, for example, WO2013040557, WO2012079000, WO2016030414, Smith T, et al., Nature Nanotechnology. 2017. DOI: 10.1038 / NNANO.2017.57, the disclosures of which are incorporated herein by reference. Exemplary features and components of CARs are described in the following subsections.
[0396] G. Antigen-binding domain In some embodiments, the antigen binding domain (ABD) of the CAR is or comprises an antibody or antigen-binding portion thereof, hi some embodiments, the antigen binding domain of the CAR is or comprises an scFv or Fab.
[0397] In some embodiments, the antigen binding domain binds to a cell surface antigen of a cell. In some embodiments, the cell surface antigen is unique to (e.g., expressed by) a particular or specific cell type. In some embodiments, the cell surface antigen is unique to more than one type of cell.
[0398] In some embodiments, the antigen may be an antigen that is expressed exclusively or preferentially on tumor cells, or an antigen specific to an autoimmune or inflammatory disease. In some embodiments, the antigen-binding domain (ABD) targets an antigen specific to neoplastic cells. For example, the antigen-binding domain targets an antigen expressed by neoplastic cells or cancer cells. In some embodiments, the ABD binds to a tumor-associated antigen. In some embodiments, the neoplastic cell-specific antigen (e.g., an antigen associated with neoplastic cells or cancer cells) or tumor-associated antigen is selected from a cell surface receptor, an ion channel-linked receptor, an enzyme-linked receptor, a G protein-coupled receptor, a receptor tyrosine kinase, a tyrosine kinase-associated receptor, a receptor-like tyrosine phosphatase, a receptor serine / threonine kinase, a receptor guanylyl cyclase, or a histidine kinase-associated receptor.
[0399] In some embodiments, the target antigen is an antigen selected from the group consisting of epidermal growth factor receptor (EGFR) (including ErbB1 / EGFR, ErbB2 / HER2, ErbB3 / HER3, and ErbB4 / HER4), fibroblast growth factor receptor (FGFR) (including FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF18, and FGF21), vascular endothelial growth factor receptor (VEGFR) (including VEGF-A, VEGF-B, VEGF-C, VEGF-D, and PIGF), RET receptor, and the Eph receptor family (EphA1, EphA2, EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphA9, EphA10, EphB1, EphB2). including EphB3, EphB4, and EphB6), CXCR1, CXCR2, CXCR3, CXCR4, CXCR6, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR8, CFTR, CIC-1, CIC-2, CIC-4, CIC-5, CIC-7, CIC-Ka, CIC-Kb, bestrophin, TMEM16A, GABA receptors, glycine receptors, ABC transporters, NAV1.1, NAV1.2, NAV1.3, NAV1.4, NAV1.5, NAV1.6, NAV1.7, NAV1.8, NAV1.9, sphingosine- 1-phosphate receptor (S1P1R), NMDA channel, transmembrane protein, multispanning transmembrane protein, T-cell receptor motif; T-cell alpha chain; T-cell beta chain; T-cell gamma chain; T-cell delta chain, CCR7, CD3, CD4, CD5, CD7, CD8, CD11b, CD11c, CD16, CD19, CD20, CD21, CD22, CD25, CD28, CD34, CD35, CD40, CD45RA, CD45RO, CD52, CD56, CD62L, CD68, CD80, CD95, CD117, CD127, CD133, CD137 (4-1 BB), CD163, F4 / 80, IL-4Ra, Sca-1, CTLA-4, GITR, GARP, LAP, Granzyme B, LFA-1, Transferrin Receptor, NKp46, Perforin, CD4+, Th1, Th2, Th17, Th40, Th22, Th9, Tfh, Classical Treg, FoxP3+, Tr1, Th3, Treg17, T REG, CDCP, NT5E, EpCAM, CEA, gpA33, mucin, TAG-72, carbonic anhydrase IX, PSMA, folate-binding protein, gangliosides (e.g., CD2, CD3, GM2), Lewis-γ 2, VEGF, VEGFR1 / 2 / 3, αVβ3, α5β1, ErbB1 / EGFR, ErbB1 / HER2, ErB3, c-MET, IGF1R, EphA3, TRAIL-R1, TRAIL-R2, RANKL, FAP, tenascin, PD L-1, BAFF, HDAC, ABL, FLT3, KIT, MET, RET, IL-1β, ALK, RANKL, mTOR, CTLA-4, IL-6, IL-6R, JAK3, BRAF, PTCH, Smoothened, PIGF, ANPEP, T IMP1, PLAUR, PTPRJ, LTBR, or ANTXR1, folate receptor alpha (FRa), ERBB2 (Her2 / neu), EphA2, IL-13Ra2, epidermal growth factor receptor (EGFR), mesothelin, TSHR, CD19, CD123, CD22, CD30, CD171, CS-1, CLL-1, CD33, EGFRvIII, GD2, GD3, BCMA, MUC16 (CA125), L1CAM, LeY, MSLN, IL13Rα1, L1-CAM, Tn Ag, prostate-specific membrane antigen (PSMA), ROR1, FLT3, FAP, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3, KIT, interleukin-11 receptor a (IL-11Ra), PSCA, PRSS21, VEGFR2, Lewis Y, CD24, platelet-derived growth factor receptor-beta (PDGFR-beta), SSEA-4, CD20, MUC1, NCAM, prostate, PAP, ELF2M, ephrin B2, IGF-1 receptor, CAIX, LMP2, gplOO, bcr-a bl, tyrosinase, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, CLDN6, GPRC5D, CXORF61, CD97, CD179a, ALK, polysialic acid, PLACl, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-1a, MAGE-A1, legumain, HPVE6, E7, ETV6-AML, sperm protein 17, XAGE1, Tie2, MAD-CT-1, MAD-CT-2, major histocompatibility complex class I-related gene protein (MR1), urokinase-type plasminogen activator receptor (uPAR), Fos-related antigen 1, p53, p53 mutant, prostein, survivin, telomerase, PCTA-1 / galectin 8, MelanA / MART1, Ras mutant, hTERT, sarcoma translocation breakpoint, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3, androgen receptor, cyclin B1, MYCN, RhoC, TRP-2, CYPIB I, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxylesterase, mut Antigens include, but are not limited to, hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, neoantigens, CD133, CD15, CD184, CD24, CD56, CD26, CD29, CD44, HLA-A, HLA-B, HLA-C (HLA-A, B, C), CD49f, CD151, CD340, CD200, tkrA, trkB, or trkC, or antigenic fragments or portions thereof.
[0400] In some embodiments, exemplary target antigens include, but are not limited to, CDS, CD19, CD20, CD22, CD23, CD30, CD70, kappa, lambda, and B-cell maturation factor (BCMA) (associated with leukemia); CS1 / SLAMF7, CD38, CD138, GPRC5D, TACI, and BCMA (associated with myeloma); GD2, HER2, EGFR, EGFRvIII, B7H3, PSMA, PSCA, CAIX, CD171, CEA, CSPG4, EPHA2, FAP, FRa, IL-13Ra, mesothelin, MUC1, MUC16, and ROR1 (associated with solid tumors).
[0401] In some embodiments, the CAR is a CD19 CAR. In some embodiments, the extracellular binding domain of the CD19 CAR comprises an antibody that specifically binds to CD19, e.g., human CD19. In some embodiments, the extracellular binding domain of the CD19 CAR comprises an scFv antibody fragment derived from the FMC63 monoclonal antibody (FMC63), which comprises the heavy chain variable region (VH) and light chain variable region (VL) of FMC63 connected by a linker peptide. In some embodiments, the linker peptide is a "Whitlow" linker peptide. FMC63 and derived scFvs are described in Nicholson et al., Mal. Immun. 34(16-17):1157-1165 (1997) and PCT Application Publication No. WO2018 / 213337A1, the entire contents of each of which are incorporated herein by reference.
[0402] In some embodiments, the extracellular binding domain of the CD19 CAR is selected from the group consisting of, for example, (Bejcek et al., Cancer Res. 55:2346-2351 (1995)), HD37 (Pezutto et al., J. Immunol. 138(9):2793-2799 (1987)), 4G7 (Meeker et al., Hybridoma 3:305-320 (1984)), B43 (Bejcek (1995)), BLY3 (Bejcek (1995)), B4 (Freedman et al., 70:418-427 (1987)), B4 HB12b (Kansas & Tedder, J. Immunol. 147:4094-4102 (1991), Yazawa et al. al., Proc. Natl. Acad. Sci. USA 102:15178-15183(2005), Herbst et al., J. Pharmacol. Exp. Ther. 335:213-222(2010)), BU12 (Gallard et al., J. Immunology, 148(10):2983-2987(1992)), and CLB-CD19 (De Rie Cell. Immunol. 118:368-381(1989)).
[0403] In some embodiments, the CAR is a CD22 CAR. CD22 is a transmembrane protein found primarily on the surface of mature B cells, where it functions as an inhibitory receptor for B cell receptor (BCR) signaling. CD22 is expressed in 60-70% of B cell lymphomas and leukemias (e.g., B chronic lymphocytic leukemia, hairy cell leukemia, acute lymphocytic leukemia (ALL), and Burkitt's lymphoma) and is not present on the cell surface or on stem cells in early stages of B cell development. In some embodiments, the CD22 CAR comprises an extracellular binding domain that specifically binds to CD22, a transmembrane domain, an intracellular signaling domain, and / or an intracellular costimulatory domain. In some embodiments, the extracellular binding domain of the CD22 CAR comprises an scFv antibody fragment derived from the m971 monoclonal antibody (m971), which comprises the heavy chain variable region (VH) and light chain variable region (VL) of m971 connected by a linker. In some embodiments, the extracellular binding domain of the CD22 CAR comprises an scFv antibody fragment derived from m971-L7, an affinity-matured variant of m971 that has significantly improved CD22 binding affinity compared to the parent antibody m971 (improved from approximately 2 nM to less than 50 pM). In some embodiments, the scFv antibody fragment derived from m971-L7 comprises the VH and VL of m971-L7 connected by a 3×G4S linker. In some embodiments, the extracellular binding domain of the CD22 CAR comprises the immunotoxin HA22 or BL22. The immunotoxins BL22 and HA22 are therapeutic agents that comprise an scFv specific for CD22 fused to a bacterial toxin and can therefore bind to the surface of and kill cancer cells that express CD22. BL22 contains a dsFv of the anti-CD22 antibody RFB4 fused to a 38 kDa truncated form of Pseudomonas exotoxin A (Bang et al., Clin. Cancer Res., 11:1545-50 (2005)). HA22 (CAT8015, moxetumomab passudotox) is a mutated, higher-affinity version of BL22 (Ho et al., J. Biol. Chem., 280(1):607-17 (2005)).Suitable sequences of the antigen-binding domains of HA22 and BL22 specific for CD22 are disclosed, for example, in U.S. Pat. Nos. 7,541,034, 7,355,012, and 7,982,011, which are incorporated herein by reference in their entireties.
[0404] In some embodiments, the CAR is a BCMA CAR. BCMA is a member of the tumor necrosis family of receptors (TNFRs) expressed on cells of the B-cell lineage and is most highly expressed on terminally differentiated B cells or mature B lymphocytes. BCMA is involved in mediating the survival of plasma cells to maintain long-term humoral immunity. BCMA expression has recently been associated with several cancers, such as multiple myeloma, Hodgkin's and non-Hodgkin's lymphomas, various leukemias, and glioblastoma. In some embodiments, the BCMA CAR comprises an extracellular binding domain that specifically binds to BCMA, a transmembrane domain, an intracellular signaling domain, and / or an intracellular costimulatory domain. In some embodiments, the extracellular binding domain of the BCMA CAR comprises an antibody that specifically binds to BCMA, e.g., human BCMA. BCMA-directed CARs are described in PCT Application Publication Nos. WO2016 / 014789, WO2016 / 014565, WO2013 / 154760, and WO2015 / 128653. BCMA-binding antibodies are also disclosed in PCT Application Publication Nos. WO2015 / 166073 and WO2014 / 068079. In some embodiments, the extracellular binding domain of the BCMA CAR comprises an scFv antibody fragment derived from a murine monoclonal antibody such as that described in Carpenter et al., Clin. Cancer Res. 19(8):2048-2060 (2013). In some embodiments, the scFv antibody fragment is a humanized version of the murine monoclonal antibody (Sommermeyer et al., Leukemia 31:2191-2199 (2017)). In some embodiments, the extracellular binding domain of a BCMA CAR comprises a single variable fragment made of two heavy chains (VHH) capable of binding to two epitopes of BCMA, as described in Zhao et al., J. Hematol. Oneal. 11(1):141 (2018). In some embodiments, the extracellular binding domain of a BCMA CAR comprises a fully human heavy chain variable domain (FHVH) as described in Lam et al., Nat. Commun. 11(1):283 (2020).
[0405] In some embodiments, the antigen binding domain targets an antigen unique to an autoimmune or inflammatory disorder. In some embodiments, the ABD binds to an antigen associated with an autoimmune or inflammatory disorder. In some cases, the antigen is expressed by a cell associated with the autoimmune or inflammatory disorder. In some embodiments, the autoimmune or inflammatory disorder is chronic graft-versus-host disease (GVHD), lupus, arthritis, immune complex glomerulonephritis, Goodpasture's disease, uveitis, hepatitis, systemic sclerosis or scleroderma, type 1 diabetes, multiple sclerosis, cold agglutinin disease, pemphigus vulgaris, Graves' disease, autoimmune hemolytic anemia, hemophilia A, primary Sjogren's syndrome, thrombotic thrombocytopenic purpura, neuromyelitis optica, or Evans' syndrome. , IgM-mediated neuropathy, cryoglobulinemia, dermatomyositis, idiopathic thrombocytopenia, ankylosing spondylitis, bullous pemphigoid, acquired angioedema, chronic urticaria, antiphospholipid demyelinating polyneuropathy, and autoimmune thrombocytopenia or neutropenia or pure red cell aplasia, while exemplary non-limiting examples of alloimmune diseases include sensitization to foreign antigens such as may occur with hematopoietic or solid organ transplantation, allosensitization (see, e.g., Blazar et al., 2015, Am. J. Transplant, 15(4):931-41) or xenosensitization due to blood transfusion, pregnancy with fetal allosensitization, alloimmune thrombocytopenia of the newborn, hemolytic disease of the newborn, enzyme or protein replacement therapy, blood products, and replacement of inherited or acquired deficiency disorders treated with gene therapy. Allosensitization refers, in some cases, to the development of an immune response (such as circulating antibodies) against a human leukocyte antigen that the recipient subject's or pregnant subject's immune system views as a non-self antigen. In some embodiments, the antigen characteristic of an autoimmune or inflammatory disorder is selected from a cell surface receptor, an ion channel-linked receptor, an enzyme-linked receptor, a G protein-coupled receptor, a receptor tyrosine kinase, a tyrosine kinase-associated receptor, a receptor-like tyrosine phosphatase, a receptor serine / threonine kinase, a receptor guanylyl cyclase, or a histidine kinase-associated receptor.
[0406] In some embodiments, the antigen-binding domain of the CAR binds to a ligand expressed on B cells, plasma cells, or plasmablasts. In some embodiments, the antigen-binding domain of the CAR binds to CD10, CD19, CD20, CD22, CD24, CD27, CD38, CD45R, CD138, CD319, BCMA, CD28, TNF, interferon receptor, GM-CSF, ZAP-70, LFA-1, CD3 gamma, CD5, or CD2. See US2003 / 0077249, WO2017 / 058753, and WO2017 / 058850, the contents of which are incorporated herein by reference. In some embodiments, the CAR is an anti-CD19 CAR. In some embodiments, the CAR is an anti-BCMA CAR.
[0407] In some embodiments, the antigen-binding domain targets an antigen unique to senescent cells, such as urokinase-type plasminogen activator receptor (uPAR). In some embodiments, the ABD binds to an antigen associated with senescent cells. In some cases, the antigen is expressed by senescent cells. In some embodiments, the CAR may be used to treat or prevent disorders characterized by the abnormal accumulation of senescent cells, such as liver and lung fibrosis, atherosclerosis, diabetes, and osteoarthritis.
[0408] In some embodiments, the antigen binding domain targets an antigen specific to an infectious disease. In some embodiments, the ABD binds to an antigen associated with an infectious disease. In some cases, the antigen is expressed by a cell affected by the infectious disease. In some embodiments, the infectious disease is selected from HIV, hepatitis B virus, hepatitis C virus, human herpesvirus, human herpesvirus 8 (HHV-8, Kaposi's sarcoma-associated herpesvirus (KSHV)), human T-lymphotropic virus-1 (HTLV-1), Merkel cell polyomavirus (MCV), simian virus 40 (SV40), Epstein-Barr virus, CMV, and human papillomavirus. In some embodiments, the infectious disease specific antigen is selected from a cell surface receptor, an ion channel-linked receptor, an enzyme-linked receptor, a G protein-coupled receptor, a receptor tyrosine kinase, a tyrosine kinase-associated receptor, a receptor-like tyrosine phosphatase, a receptor serine / threonine kinase, a receptor guanylyl cyclase, a histidine kinase-associated receptor, HIV Env, gp120 on HIV-1 Env, or a CD4-inducible epitope.
[0409] In any of these embodiments, the extracellular binding domain of the CAR can be codon-optimized for expression in a host cell or to have a variant sequence to increase the function of the extracellular binding domain.
[0410] In some embodiments, the CAR is bispecific for two target antigens. In some embodiments, the target antigens are different target antigens. In some of any such embodiments, the two different target antigens are any two different antigens described above. In some embodiments, the extracellular binding domains are different and bind to two different antigens: (i) CD19 and CD20, (ii) CD20 and L1-CAM, (iii) L1-CAM and GD2, (iv) EGFR and L1-CAM, (v) CD19 and CD22, (vi) EGFR and c-MET, (vii) EGFR and HER2, (viii) c-MET and HER2, or (ix) EGFR and ROR1. In some embodiments, each of the two different antigen-binding domains is an scFv. In some embodiments, the C-terminus of one variable domain (VH or VL) of a first scFv is connected to the N-terminus of a second scFv (VL or VH, respectively) via a polypeptide linker. In some embodiments, a linker connects the N-terminus of the VH to the C-terminus of the VL, or the C-terminus of the VH to the N-terminus of the VL. These scFvs lack the constant regions (Fc) present in the heavy and light chains of native antibodies. These scFvs, specific for at least two different antigens, are arranged in tandem and linked to a costimulatory domain and an intracellular signaling domain via a transmembrane domain. In some embodiments, an extracellular spacer domain may be linked between the antigen-specific binding region and the transmembrane domain.
[0411] In further embodiments, each antigen-specific targeting region of the CAR comprises a divalent (or bivalent) single-chain variable fragment (di-scFv, bi-scFv). In di-scFv-containing CARs, two scFvs specific for each antigen are linked together by generating a single peptide chain with two VH and two VL regions, resulting in a tandem scFv (Xiong, Cheng-Yi, Natarajan, A, Shi, XB, Denardo, GL, Denardo, SJ (2006). "Development of tumor-targeting anti-MUC-1 multimers: effects of di-scFv unpaired cysteine location on PEGylation and tumor binding". Protein Engineering Design and Selection 19(8):359-367; Kufer, Peter, Lutterbuse, Ralf, Baeuerle, Patrick A. (2004). "A revival of bispecific antibodies". Trends in Biotechnology 22(5):238-244). A CAR comprising at least two antigen-specific targeting regions will express two scFvs, each specific for one of the two antigens. The resulting antigen-specific targeting regions specific for at least two different antigens are linked to a costimulatory domain and an intracellular signaling domain via a transmembrane domain. In some embodiments, an extracellular spacer domain may be linked between the antigen-specific binding domain and the transmembrane domain.
[0412] In another embodiment, each antigen-specific targeting region of the CAR comprises a diabody. In diabodies, scFvs are created using linker peptides that are too short to allow the two variable regions to fold together, thereby forcing the dimerization of scFvs. Even shorter linkers (one or two amino acids) lead to the formation of trimers, so-called triabodies or tribodies. Tetrabodies may also be used.
[0413] In some embodiments, the cells are engineered to express more than one CAR, e.g., two different CARs, each with an antigen-binding domain directed to a different target antigen. In some of any such embodiments, the two different target antigens are any two different antigens described above. In some embodiments, the extracellular binding domains are different and bind to two different antigens from: (i) CD19 and CD20, (ii) CD20 and L1-CAM, (iii) L1-CAM and GD2, (iv) EGFR and L1-CAM, (v) CD19 and CD22, (vi) EGFR and c-MET, (vii) EGFR and HER2, (viii) c-MET and HER2, or (ix) EGFR and ROR1.
[0414] In some embodiments, two different engineered cells containing the provided modifications are prepared, each engineered with a different CAR. In some embodiments, the two different CARs each have antigen-binding domains directed to different target antigens. In some of these embodiments, the two different target antigens are any two different antigens described above. In some embodiments, the extracellular binding domains are different and bind to two different antigens from: (i) CD19 and CD20, (ii) CD20 and L1-CAM, (iii) L1-CAM and GD2, (iv) EGFR and L1-CAM, (v) CD19 and CD22, (vi) EGFR and c-MET, (vii) EGFR and HER2, (viii) c-MET and HER2, or (ix) EGFR and ROR1. In some embodiments, a population of engineered cells expressing a first CAR directed against a first target antigen (e.g., low immunogenicity) and a population of engineered cells expressing a second CAR directed against a second target antigen (e.g., low immunogenicity) are administered separately to a subject. In some embodiments, the first population of cells and the second population of cells are administered sequentially in any order. For example, the population of cells expressing the second CAR is administered after the population of cells expressing the first CAR.
[0415] H.Spacer In some embodiments, the CAR further comprises one or more spacers, for example, where the spacer is a first spacer between the antigen-binding domain and the transmembrane domain. In some embodiments, the first spacer comprises at least a portion of an immunoglobulin constant region or a variant or modified version thereof. In some embodiments, the spacer is a second spacer between the transmembrane domain and the signaling domain. In some embodiments, the second spacer is an oligopeptide, for example, where the oligopeptide comprises glycine and serine residues, such as, but not limited to, a glycine-serine doublet. In some embodiments, the CAR comprises two or more spacers, for example, a spacer between the antigen-binding domain and the transmembrane domain and a spacer between the transmembrane domain and the signaling domain.
[0416] I. Transmembrane Domain In some embodiments, the transmembrane domain of the CAR comprises at least the transmembrane region of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD28, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, or a functional variant thereof. In some embodiments, the transmembrane domain comprises at least the transmembrane region(s) of CD8α, CD8β, 4-1BB / CD137, CD28, CD34, CD4, FcεRIγ, CD16, OX40 / CD134, CD3ζ, CD3ε, CD3γ, CD3δ, TCRα, TCRβ, TCRζ, CD32, CD64, CD64, CD45, CD5, CD9, CD22, CD37, CD80, CD86, CD40, CD40L / CD154, VEGFR2, FAS, and FGFR2B, or functional variants thereof.
[0417] J. Signaling Domain(s) In some embodiments, the CARs described herein are selected from the group consisting of B7-1 / CD80; B7-2 / CD86; B7-H1 / PD-L1; B7-H2; B7-H3; B7-H4; B7-H6; B7-H7; BTLA / CD272; CD28; CTLA-4; Gi24 / VISTA / B7-H5; ICOS / CD278; PD-1; PD-L2 / B7-DC; PDCD6; 4-1BB / TNFSF9 / CD137; 4-1BB ligand / TNFSF9; BAFF / BLyS / TNFSF13B; BAFF R / TNFRSF13C;CD27 / TNFRSF7;CD27 ligand / TNFSF7;CD30 / TNFRSF8;CD30 ligand / TNFSF8;CD40 / TNFRSF5;CD40 / TNFSF5;CD40 ligand / TNFSF5;DR3 / TNFRSF25;GITR / TNFRSF18;GITR ligand / TNFSF18;HVEM / TNFRSF14;LIGHT / TNFSF14;lymphotoxin-alpha / TNF-beta;OX40 / TNFRSF4;OX40 ligand / TNFSF4;RELT / TNFRSF19L;TACI / TNFRSF13B;TL1A / TNFSF15;TNF-alpha;TNF RII / TNFRSF1B);2B4 / CD244 / SLAMF4;BLAME / SLAMF8;CD2;CD2F-10 / SLAMF9;CD48 / SLAMF2;CD58 / LFA-3;CD84 / SLAMF 5;CD229 / SLAMF3;CRACC / SLAMF7;NTB-A / SLAMF6;SLAM / CD150);CD2;CD7;CD53;CD82 / Kai-1;CD90 / Thy1;CD96;CD160 ;CD200;CD300a / LMIR1;HLA class I;HLA-DR;Ikaros;integrin alpha4 / CD49d;integrin alpha4beta1;integrin alpha4beta7 / LPAM-1;LAG-3;TCL1A;TCL1B;CRTAM;DAP12;Dectin-1 / CLEC7A;DPPIV / CD26;EphB6;TIM-1 / KIM-1 / HAVCR;TIM-4;TSLP;TSLP R;lymphocyte function-associated antigen-1 (LFA-1);comprising one or at least one signaling domain selected from one or more of NKG2C, CD3 zeta domain, immunoreceptor tyrosine-based activation motif (ITAM), CD27, CD28, 4-1BB, CD134 / OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, or a functional fragment thereof;
[0418] In some embodiments, at least one signaling domain comprises a CD3 zeta domain or an immunoreceptor tyrosine-based activation motif (ITAM), or a functional variant thereof.
[0419] In some embodiments, the CAR comprises a signaling domain that is a costimulatory domain. In some embodiments, the CAR comprises a second costimulatory domain. In some embodiments, the CAR comprises at least two costimulatory domains. In some embodiments, the CAR comprises at least three costimulatory domains. In some embodiments, the CAR comprises a costimulatory domain selected from one or more of CD27, CD28, 4-1BB, CD134 / OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83. In some embodiments, when the CAR comprises two or more costimulatory domains, the two costimulatory domains are different. In some embodiments, when the CAR comprises two or more costimulatory domains, the two costimulatory domains are the same.
[0420] In other embodiments, at least one signaling domain comprises (i) a CD3 zeta domain or an immunoreceptor tyrosine-based activation motif (ITAM), or a functional variant thereof, and (ii) a CD28 domain or a 4-1BB domain, or a functional variant thereof. In yet other embodiments, at least one signaling domain comprises (i) a CD3 zeta domain or an immunoreceptor tyrosine-based act...
Claims
[Claim 1] The invention described in the specification.