Nucleotide base substitutions in self-amplifying messenger ribonucleic acid.

Abstract

Provided herein is RNA that is collectively self-amplifying in an intracellular environment, comprises N1-methylpseudouridine and uridine, and has a certain molar percentage or molar ratio of N1-methylpseudouridine to the sum of uridine and N1-methylpseudouridine, or a certain molar ratio of N1-methylpseudouridine to uridine.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 240,502, filed September 3, 2021, the entire contents of which are incorporated herein by reference for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in computer-readable form in XML file format and is incorporated herein by reference in its entirety. The XML file, created on August 31, 2022, has the filename "70031WO01_SL.xml" and is 39,961 bytes in size. The information recorded in computer-readable form identified above is identical to the paper version of the Sequence Listing.

[0003] Provided herein is RNA that is collectively self-amplifying in an intracellular environment, comprises N1-methylpseudouridine and uridine, and has a certain molar percentage or molar ratio of N1-methylpseudouridine to the sum of uridine and N1-methylpseudouridine, or a certain molar ratio of N1-methylpseudouridine to uridine. [Background technology]

[0004] Self-amplifying messenger (SAM) ribonucleic acid (RNA) molecules and messenger RNAs (mRNAs) collectively having the properties of SAM RNA molecules (herein referred to as auto-amplifying messenger (AAM) RNAs) have the potential to provide transfected cells with extended exposure to exogenous or heterologous nucleic acids, including heterologous proteins encoded by them, such as antigens and antibodies. For example, SAM RNA platforms can induce antigen expression in vivo for approximately 30 days, whereas conventional (non-replicating) mRNAs can only induce expression for a few days at most. However, like all exogenous RNAs, SAM RNA and AAM RNAs have the potential to activate the innate immune system. Innate immune activation can potentially induce unexpected effects separate from those associated with the introduction of heterologous (or exogenous) nucleic acids. Innate immune activation can also suppress the activity of heterologous nucleic acids introduced by SAM RNA or AAM RNAs. For example, innate immune activation can suppress the expression of antigens encoded by heterologous nucleic acids of SAM RNA or multiple AAM RNAs.

[0005] Substitution of uridine with N1-methylpseudouridine has been used in conventional RNA, however conventional RNA does not require a replicase to amplify the molecule and conventional RNA does not result in sustained expression beyond the temporal maximum mentioned above. Summary of the Invention

[0006] The inventors have discovered that there are two independent thresholds of sensitivity to the mole percent substitution of uridine (U) with N1-methylpseudouridine (N1Ψ) for self-amplifying messenger (SAM) ribonucleic acid (RNA) or multiple auto-amplifying messenger (AAM) RNAs. Accordingly, the inventors have investigated and identified the following aspects and embodiments, including compositions, methods, or uses of matter:

[0007] A self-amplifying messenger (SAM) ribonucleic acid (RNA) comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0008] SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment; the SAM RNA is produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0009] A plurality of auto-amplifying messenger (AAM) RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0010] a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs is produced by a method comprising one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0011] A composition comprising a pharmaceutically acceptable delivery vehicle and a SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0012] 1. A composition comprising a pharmaceutically acceptable delivery vehicle and SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of the SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0013] A composition comprising a pharmaceutically acceptable delivery vehicle and a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, the one or more second RNAs encode one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0014] 1. A composition comprising a pharmaceutically acceptable delivery vehicle and a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs is produced by a method comprising one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0015] A method for inducing an immune response to an immunogen in a subject, comprising administering to the subject an effective amount of SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid encoding at least an immunogen or an antibody to the immunogen, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0016] 1. A method for inducing an immune response to an immunogen in a subject, the method comprising: administering to the subject an effective amount of SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid encoding at least the immunogen or an antibody to the immunogen, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0017] 1. A method for inducing an immune response to an immunogen in a subject, the method comprising: administering to the subject an effective amount of a plurality of AAM RNAs, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs; wherein the first RNA comprises a heterologous nucleic acid encoding at least the immunogen or an antibody to the immunogen, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0018] A method for inducing an immune response to an immunogen in a subject, wherein a plurality of auto-amplifying messenger (AAM) RNAs comprise N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid encoding at least an immunogen or an antibody to the immunogen, and the one or more second RNAs encode one or more proteins capable of replicating SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0019] A method for delivering inhibitory RNA to a subject, comprising administering to the subject an effective amount of SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid comprising the inhibitory RNA, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0020] 1. A method for delivering inhibitory RNA, comprising: administering to a subject an effective amount of SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid comprising the inhibitory RNA, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment; the SAM RNA is produced by a method comprising mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0021] A method for delivering inhibitory RNA, comprising administering to a subject an effective amount of a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid comprising the inhibitory RNA, the one or more second RNAs encode one or more proteins capable of replicating SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0022] 1. A method for delivering inhibitory RNA, comprising: administering to a subject an effective amount of a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid comprising the inhibitory RNA, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0023] A method for delivering a heterologous nucleic acid to a subject, comprising administering to the subject an effective amount of SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises the heterologous nucleic acid, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0024] 1. A method for delivering a heterologous nucleic acid to a subject, the method comprising: administering an effective amount of SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises the heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment; the SAM RNA is produced by a method comprising mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0025] A method for delivering heterologous nucleic acid to a subject, comprising administering an effective amount of a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises the heterologous nucleic acid, the one or more second RNAs encode one or more proteins capable of replicating SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0026] 1. A method for delivering heterologous nucleic acids to a subject, comprising: administering an effective amount of a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises the heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0027] 1. A method for producing SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the method comprising mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA to thereby obtain a mixture, the mixture having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0028] 1. A method for producing SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment; the method comprises mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0029] 1. A method for producing a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the method includes one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0030] A method for producing a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating a SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. The method also includes one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain a mixture, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs, the one or more mixtures having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, and the one or more mixing steps are performed by the RNA polymerase to synthesize the plurality of AAM RNAs from the one or more template nucleic acids. The method is under conditions that produce RNA.

[0031] A method for producing a composition comprising a pharmaceutically acceptable delivery vehicle and SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, the method comprising the step of mixing the pharmaceutically acceptable vehicle and the SAM RNA.

[0032] 1. A method for producing a composition comprising a pharmaceutically acceptable delivery vehicle and SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, and the production method comprising the step of mixing the pharmaceutically acceptable vehicle and the SAM RNA.

[0033] A method for producing a composition comprising a pharmaceutically acceptable delivery vehicle and a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, the one or more second RNAs encode one or more proteins capable of replicating a SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, the method comprising mixing the pharmaceutically acceptable vehicle and the plurality of AAM RNAs.

[0034] 1. A method for producing a composition comprising a pharmaceutically acceptable delivery vehicle and a plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs, the one or more mixtures having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine from 15% to 75%, and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids;

[0035] Use of SAM RNA for the manufacture of a pharmaceutical for delivering a heterologous nucleic acid to a subject in need thereof, wherein the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising the heterologous nucleic acid, the second RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0036] Use of SAM RNA for the manufacture of a pharmaceutical for delivering a heterologous nucleic acid to a subject in need thereof, wherein the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising the heterologous nucleic acid, the second RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, the use comprising the step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0037] Use of SAM RNA for the manufacture of a pharmaceutical for delivering a heterologous nucleic acid to a subject in need thereof, wherein the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising the heterologous nucleic acid, and the second RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0038] 1. Use of SAM RNA for the manufacture of a medicament for delivering a heterologous nucleic acid to a subject in need thereof, wherein the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising the heterologous nucleic acid, and the second RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, and the use comprising the step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0039] Use of a plurality of AAM RNAs for the manufacture of a pharmaceutical for delivering a heterologous nucleic acid to a subject in need thereof, wherein the plurality of AAM RNAs comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises the heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. Use of a plurality of AAM RNAs for the manufacture of a pharmaceutical for delivering a heterologous nucleic acid to a subject in need thereof, wherein the plurality of AAM RNAs comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises the heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, the use comprising the step of mixing the plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0040] Use of a plurality of AAM RNAs for the manufacture of a pharmaceutical for delivering a heterologous nucleic acid to a subject in need thereof, wherein the plurality of AAM RNAs comprise N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs, and the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. a method for producing a medicament for delivering heterologous nucleic acids to a subject in need thereof, the method comprising: producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; a method for producing a medicament for delivering a heterologous nucleic acid to a subject in need thereof; Use comprising a step of mixing RNA and a pharmaceutically acceptable delivery vehicle. Use of SAM RNA for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment. The invention provides a method for the preparation of a SAM RNA comprising the steps of: (a) preparing a SAM RNA comprising: a first RNA segment comprising a heterologous nucleic acid encoding at least a heterologous protein comprising an immunogen or an antibody against an immunogen; and (b) preparing a SAM RNA comprising at least one protein capable of replicating the SAM RNA in an intracellular environment; and (c) preparing a SAM RNA comprising at least one protein capable of replicating the SAM RNA in an intracellular environment; wherein the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0041] Use of SAM RNA for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the use comprises a step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0042] Use of SAM RNA for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0043] Use of SAM RNA for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the use comprises a step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0044] 1. Use of SAM RNA for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA is produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, and the use comprising the step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0045] 1. Use of SAM RNA for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA is produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, and the use comprising the step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0046] 1. Use of SAM RNA for the manufacture of a medicament for delivering inhibitory RNA, wherein the SAM comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising a heterologous nucleic acid comprising the inhibitory RNA, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, and the use comprising the step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0047] A use of SAM RNA for the manufacture of a pharmaceutical for delivering an inhibitory RNA, wherein the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprises a heterologous nucleic acid comprising the inhibitory RNA, the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the use comprises the step of mixing the SAM RNA and a pharmaceutically acceptable delivery vehicle.

[0048] Use of a plurality of AAM RNAs for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the plurality of AAM RNAs comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, the first RNA comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, the one or more second RNAs encode one or more proteins capable of replicating SAM RNA in an intracellular environment, the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the use comprises a step of mixing the plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0049] Use of a plurality of AAM RNAs for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the plurality of AAM RNAs comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, the first RNA comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen, the one or more second RNAs encode one or more proteins capable of replicating SAM RNA in an intracellular environment, the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the use comprises a step of mixing the plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0050] a method for producing a medicament for preventing a disease caused by a pathogen, the method comprising: producing a medicament for preventing a disease caused by a pathogen; and the medicament for preventing a disease caused by a pathogen, the medicament for preventing a disease caused by a pathogen comprising an immunogen; the medicament for preventing a disease caused by a pathogen comprising an immunogen; the medicament for preventing a disease caused by a pathogen comprising an immunogen; and the medicament for preventing a disease caused by a pathogen comprising an immunogen; ... The use is under conditions to produce RNA, and the use comprises mixing a plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0051] a method for producing a medicament for treating a disease caused by a pathogen, the method comprising: producing a medicament for treating a disease caused by a pathogen; and wherein the medicament for treating a disease caused by a pathogen comprises an immunogen; the medicament for treating a disease caused by a pathogen comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs; the first RNA comprises a heterologous nucleic acid encoding at least a heterologous protein comprising the immunogen or an antibody against the immunogen; and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%; and the one or more mixing steps are performed by the RNA polymerase to synthesize the plurality of AAM RNAs from the one or more template nucleic acids. The use is under conditions to produce RNA, and the use comprises mixing a plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0052] A use of a plurality of AAM RNAs for the manufacture of a pharmaceutical for delivering an inhibitory RNA, wherein the plurality of AAM RNAs comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid comprising the inhibitory RNA, and the one or more second RNAs encode one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, the use comprising a step of mixing the plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0053] 1. Use of a plurality of AAM RNAs for the manufacture of a pharmaceutical for delivering inhibitory RNA, wherein the plurality of AAM RNAs comprises N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid comprising an inhibitory RNA, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs, the one or more mixtures having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%; and the use comprises the step of mixing the plurality of AAM RNAs and a pharmaceutically acceptable delivery vehicle.

[0054] A SAM RNA for use in inducing an immune response to an antigen in a subject, the SAM RNA comprising an RNA segment encoding N1-methylpseudouridine, uridine, the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0055] A SAM RNA for use in preventing infection by a pathogen in a subject, the pathogen producing an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0056] A SAM RNA for use in treating infection by a pathogen in a subject, wherein the pathogen produces an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0057] A SAM RNA for use in delivering a heterologous nucleic acid to a subject, the SAM RNA comprising an RNA segment comprising N1-methylpseudouridine, uridine, the heterologous nucleic acid, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0058] SAM RNA for use in eliciting an immune response to an antigen in a subject, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0059] SAM RNA for use in preventing infection by a pathogen in a subject, the pathogen producing an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0060] SAM RNA for use in treating infection by a pathogen in a subject, the pathogen producing an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0061] SAM RNA for use in delivering a heterologous nucleic acid to a subject, the SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising the heterologous nucleic acid, the second RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

[0062] A plurality of AAM RNAs for use in inducing an immune response to an antigen in a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes an antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0063] A plurality of AAM RNAs for use in preventing infection by a pathogen in a subject, wherein the pathogen produces an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, the first RNA encoding the antigen, and the one or more second RNAs encoding one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, the plurality of AAM RNAs having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0064] A plurality of AAM RNAs for use in treating infection by a pathogen in a subject, wherein the pathogen produces an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0065] A plurality of AAM RNAs for use in delivering a heterologous nucleic acid to a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises the heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

[0066] 1. A method for producing a plurality of AAM RNAs for use in eliciting an immune response to an antigen in a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes an antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs is produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain one or more mixtures, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs, the one or more mixtures having a molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the template nucleic acid.

[0067] a plurality of AAM RNAs for use in preventing infection by a pathogen in a subject, the pathogen producing an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, the first RNA encoding the antigen and the one or more second RNAs encoding one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain one or more mixtures, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs, the one or more mixtures having a molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the one or more mixing steps being under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the template nucleic acid.

[0068] a plurality of AAM RNAs for use in treating infection by a pathogen in a subject, the pathogen producing an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, the first RNA encoding the antigen and the one or more second RNAs encoding one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain one or more mixtures, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs, the one or more mixtures having a molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the one or more mixing steps being under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the template nucleic acid.

[0069] a plurality of AAM RNAs for use in delivering heterologous nucleic acids to a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and a second RNA, wherein the first RNA comprises the heterologous nucleic acid and the second RNA encodes one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain one or more mixtures, the one or more template nucleic acids comprising sequences of the plurality of AAM RNAs, the one or more mixtures having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine from 15% to 75%, and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids.

[0070] BRIEF DESCRIPTION OF THE DRAWINGS The detailed description of the preferred embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, the drawings show certain, but not all, preferred embodiments. It is to be understood that embodiments of the present invention are not limited to the precise arrangements and instrumentalities shown in the drawings. [Brief explanation of the drawings]

[0071] [Figure 1] 1 shows interferon-β (IFN-β) levels from C2C12 cells electroporated with 100 ng of self-amplifying messenger (SAM) ribonucleic acid (RNA) in which 0%, 25%, 50%, 75%, or 100% of the uridines (U) were substituted with N1-methylpseudouridine (N1Ψ). IFN-β levels are reduced in C2C12 cells administered with SAM RNA containing 25% substitutions compared to levels from the same cells administered with SAM RNA containing 0% substitutions. Levels are further reduced with administration of SAM RNA containing 50%, 75%, or 100% substitutions compared to those administered with SAM RNA containing 25% substitutions. [Figure 2]Figure 1 shows the percentage of C2C12 cells, identified using fluorescence-activated cell sorting (FACS), that express firefly luciferase encoded by SAM RNA containing 0%, 15%, 25%, 50%, 75%, or 100% U to N1Ψ substitutions administered at masses of 1000 ng, 333.33 ng, 111.11 ng, 37.04 ng, 12.35 ng, 4.12 ng, 1.37 ng, or 0.46 ng. The percentage of C2C12 cells expressing firefly luciferase is slightly reduced for the 50% substitution compared to those containing 0%, 15%, or 25% substitutions, and is further reduced for the 75% substitution compared to those containing 50% substitutions. For the 100% substitution, an almost undetectable percentage of cells expresses firefly luciferase. When compared to IFN-β levels shown in Figure 1, the decrease in firefly luciferase expression with increasing substitution lags behind the decrease in IFN-β levels with increasing substitution: IFN-β levels decrease first for 25% substitution, and firefly luciferase expression decreases first and slightly for 50% substitution when 1000 ng of SAM RNA is administered. [Figure 3]This figure shows the intracellular signaling pathway in LEEPORTER™ luciferase reporter human embryonic kidney 293 (HEK293) cells, starting with activation of toll-like receptor 7 (TLR7; left) and toll-like receptor 8 (TLR8; right) by single-stranded ribonucleic acid (ssRNA), signaling through myeloid differentiation primary response 88 (MyD88), p50 and p65, and then nuclear factor kappa light chain-enhancer of activated B cells (NF-κB), resulting in Renilla luciferase expression. The Renilla luciferase signal is distinct from firefly luciferase signaling and is encoded by the ribonucleic acid (RNA) used to activate TLR7 or TLR8, depending on the assay. www.abeomics.com / tlr7-nf-kb-leeporter-luciferase-reporter-hek293-cell-line;www.abeomics.com / tlr8-nf-kb-leeporter-luciferase-reporter-hek293-cell-line. [Figure 4]Figure 1 shows the percentage of TLR7-positive human embryonic kidney 293 (HEK293) cells (TLR7 / NF-kB Leeporter™ Renilla Luciferase Reporter-HEK293 cell line) that express firefly luciferase upon transfection with self-amplifying messenger (SAM) ribonucleotides (RNA), SAM RNA lacking the self-amplifying element (non-replicating SAM RNA obtained using a mutation that abolishes replicase complex activity), or conventional RNA. SAM RNA, non-replicating SAM RNA, and conventional RNA encode firefly luciferase and have 0%, 25%, 50%, or 100% substitutions of U with N1Ψ and are capped with either cap 0 or cap 1. Increasing the amount of substitution from 0% to 25% or 50% increases the number of cells expressing firefly luciferase encoded by exogenous SAM RNA with cap 0 or cap 1. The percentage of firefly luciferase-positive cells is reduced for 50% substitutions compared to those with 25% substitutions. 100% substitutions in SAM RNA, in contrast to 100% substituted conventional RNA, result in nearly no detectable firefly luciferase-positive cells, regardless of whether the SAM RNA has Cap 0 or Cap 1. [Figure 5]Figure 4 shows total antigen expression (top, expression of firefly luciferase encoded by the RNA) and TLR7 expression (bottom, expression of TLR7, MyD88, p50, p65, and Renilla luciferase downstream of NF-κB) for the same SAM RNA, non-replicating SAM RNA, and conventional RNA as described above for Figure 4. The 25% U to N1Ψ substitution elevated total antigen expression above the level associated with 0% substitutions with cap 0 and cap 1 capping. Non-replicating SAM RNA contains an insertion in the nucleic acid encoding nonstructural protein 2, thereby causing missense translation. Increasing substitutions from 0% to 100% in non-replicating SAM RNA decreased TLR7 activation, regardless of capping, thereby indicating that, with initial administration, substitutions evade the innate immune response. For SAM RNA (self-replicating), 25% substitutions increased TLR7 activation compared to activation associated with 0% substitutions with cap 0 capping. Together with the results for non-replicating SAMs, this indicates that, within cells, self-replicating SAMs incorporate unmodified uridines and that these chains activate TLR7. [Figure 6-1] Dose-response curves of firefly luciferase luminescence in polyploid human foreskin fibroblast cell lines, BJ cell lines, transfected with SAM RNA capped with cap 0 or cap 1, conventional RNA, or non-replicating SAM RNA capped with cap 0 or cap 1. SAM RNA, non-replicating SAM RNA, or conventional RNA encodes firefly luciferase, with U replaced by N1Ψ at 0% (Figure 6A), 25% (Figure 6B), 50% (Figure 6C), or 100% (Figure 6D). Capping with cap 1 results in higher firefly luciferase luminescence and a leftward shift in the dose-response curve compared to cap 0 under all conditions of replacement with SAM RNA. Antigen expression is increased with 25% and 50% replacement of SAM RNA compared to 0% and 100% replacement of SAM RNA or conventional RNA, regardless of capping. [Figure 6-2] This is a continuation of Figure 6-1. [Figure 7-1] Dose-response curves for the percentage of BJ cells (% of dsRNA+ cells) expressing double-stranded RNA replicated from SAM RNA capped with cap 0 or cap 1, conventional RNA, or non-replicating SAM RNA capped with cap 0 or cap 1, with U substituted with N1Ψ at 0% (Figure 7A), 25% (Figure 7B), 50% (Figure 7C), or 100% (Figure 7D) (0% N1Ψ, 25% N1Ψ, 50% N1Ψ, and 100% N1Ψ, respectively). Capping with cap 1 results in a leftward shift of the dose-response curve compared to that for cap 0 under all conditions of substitution with SAM RNA. The percentage of BJ cells expressing double-stranded RNA plateaued at approximately the same level (75%-78%) for 0%, 25%, or 50% substitution of U with N1Ψ, with cap 1 capping. This indicates that regardless of the substitution percentage, capping with Cap1 can achieve the maximum response with the maximum dose (except for 100% substitution). Nevertheless, 25% substitution may have an effect on the percentage of cells with Cap1 capping when compared with 0% substitution. When comparing the 50% mark for the percentage of cells containing double-stranded RNA, there is a leftward shift for 25% substitution compared with 0% or 50% substitution. With respect to capping with Cap0, 25% and 50% substitution increased the maximum percentage of cells expressing double-stranded RNA compared with 0% or 100% substitution. Therefore, there is an effect of U to N1Ψ substitution on the self-amplification of SAM RNA substitution, whereby 25% or 50% substitution can increase the number of cells showing self-amplification compared with 0% substitution, and this effect occurs within capping with Cap0 or Cap1. [Figure 7-2] This is a continuation of Figure 7-1. [Figure 8-1]Three replicate dose-response curves of total luminescence from RNA encoding firefly luciferase are shown for SAM RNA with cap 1 and 0%, 25%, 50%, and 100% U-to-N1Ψ substitutions. In each replicate, there is a leftward shift for the 25% substitution compared to the 0% substitution, and the total amount of luciferase expressed from SAM RNA reaches a higher maximum for the 25% and 50% substitutions than for the 0% substitution. These results, together with those from Figures 7A-7D, indicate that the 25% and 50% substitutions increase expression of amino acids encoded by SAM RNA compared to the same measure for the 0% substitution. Even though as many cells express amino acids encoded by SAM RNA when there is a 25% or 50% substitution as when there is a 0% substitution, these cells still achieve increased expression of amino acids encoded by SAM RNA. Whether this effect is due to evasion of the innate immune system for the 25% or 50% substitution is determined in Figures 9A and 9B. [Figure 8-2] This is a continuation of Figure 8-1. [Figure 9-1]Dose-response curves for the percentage of baby hamster kidney (BHK) cells (% of dsRNA+ cells) expressing double-stranded RNA replicating from SAM RNA capped with cap 0 (Figure 8A) or cap 1 (Figure 8B), conventional RNA, or non-replicating SAM RNA capped with cap 0 or cap 1, where 0%, 25%, 50%, or 100% of the U in the RNA was replaced with NΨ, were shown. BHK cells, which are deficient in innate sensing and activation, were selected to determine whether a 25% or 50% substitution would circumvent the innate immune response (i.e., TLR7- or TLR8-activated immune response), thereby increasing the percentage of cells with self-amplifying RNA (Figures 7B and 7C) and the total amount of luminescence from firefly luciferase encoded by the SAM RNA (Figures 8A-8C), when compared to the same results for 0% or 100% substitution (Figures 7A, 7D, and 7A-7C). Increasing the U-to-N1Ψ substitution from 0% to 25%, then to 50%, then to 100% caused a rightward shift in the dose-response curve, regardless of whether the SAM RNA was capped with cap 0 or cap 1. Thus, evasion of the innate immune system increases the self-amplification of SAM RNA and the expression of amino acids encoded by SAM RNA observed in cells exhibiting an innate immune response with 25% or 50% substitutions, as measured by double-stranded RNA, compared with the same results observed with 0% substitutions. Because BHK cells are deficient in innate immune activation, these results cannot be used to infer whether the improved self-amplification with 25% or 50% substitutions is cell- or context-specific. [Figure 9-2] This is a continuation of Figure 9-1. [Figure 10]Figure 1 shows the percentage of BJ cells, identified using FACS, that express firefly luciferase encoded by SAM RNA containing 0%, 25%, 50%, or 100% U to N1Ψ substitutions administered at 15 ng, 5.4 ng, 1.9 ng, 0.68 ng, 0.24 ng, 0.09 ng, 0.03 ng, or 0 ng of the SAM RNA. Following administration of 15 ng, 5.4 ng, or 1.9 ng of replicative 25%-substituted SAM RNA, the percentage of firefly luciferase-positive BJ cells increases compared to administration of replicative SAM RNA lacking the substitution. Following administration of 15 ng or 5.4 ng of replicative 50%-substituted SAM RNA, the percentage of firefly luciferase-positive cells also increases compared to administration of replicative SAM RNA lacking the substitution. [Figure 11] Figure 1 shows interleukin 6 (IL-6) levels from BJ cells transfected with lipid nanoparticles encapsulating SAM RNA, non-replicating SAM RNA, or mRNA in which 0%, 25%, 50%, and 100% of Us were replaced with N1Ψ and the RNA was capped with Cap1. Administration of non-replicating SAM RNA containing 100% U-to-N1Ψ substitutions reduced IL-6 expression compared to that associated with administration of non-replicating SAM RNA with 0% substitutions. Thus, increasing substitutions lowers IL-6 levels. Non-replicating SAM RNA induces lower IL-6 expression than that associated with replicating SAM RNA. Self-replication of SAM RNA within cells is thought to incorporate uridines into newly synthesized strands, thereby increasing IL-6 levels regardless of initial substitution. Increasing substitutions within self-replicating SAM RNA from 0% to 25%, then to 50%, and then to 100% reduced IL-6 levels with each increase in substitution. [Figure 12]Figure 1 shows interferon-α (IFN-α) levels from a single donor in human peripheral blood mononuclear cells (PBMCs) transfected with lipid nanoparticles encapsulating SAM RNA, non-replicating SAM RNA, in which 0%, 25%, 50%, and 100% of U was replaced with N1Ψ and the RNA was capped with either Cap 0 or Cap 1. Increasing substitutions in self-replicating and non-replicating SAM RNA from 0% to 25%, then to 50%, and then to 100% reduced IFN-α levels at each increasing substitution. When hPBMC cells were exposed to 500 ng of RNA, capping with Cap 1 reduced IFN-α levels compared to capping with Cap 0. [Figure 13] Correlation between antigen and double-stranded RNA levels in BJ cells transfected with 25%, 50%, and 100% U-to-N1Ψ RNA across various lots of capped SAM RNA is shown. Antigen and double-stranded RNA levels obtained for each substitution were normalized to those for the 0% substitution, which represents 100% levels. [Figure 14] Figure 1 shows the levels of double-stranded RNA in BJ cells obtained by transfecting cells with SAM RNA containing 0%, 25%, 50%, or 100% U to N1Ψ substitutions and capped with Cap1. Results are normalized to the levels obtained from cells treated with 0% substituted SAM RNA, which represents the 100% level. Results for 25% and 100% substitutions were derived from capping four different lots of SAM RNA with Cap1, and results for 0% and 50% substitutions were derived from five different lots of SAM RNA. 25 percent substitution increases the amount of double-stranded RNA in BJ cells compared to the same scale for 0% and 50% substitution. 50 percent substitution slightly increases the amount of double-stranded RNA in BJ cells compared to the same scale for 0% substitution. 100 percent substitution results in the lowest expression of double-stranded RNA when compared to all other percent substitutions. [Figure 15]Similar to Figure 14, interleukin 6 (IL-6) levels from the same BJ cells transfected with SAM RNA containing cap1 or cap0 capping and 0, 25%, 50%, or 100% U to N1Ψ substitutions are shown. There is no interaction between substitution and capping on IL-6 levels from BJ cells. In both cap0 and cap1 conditions, IL-6 levels decrease significantly with increasing substitution. BJ cells release less IL-6 when treated with SAMs containing cap1 than when treated with SAMs containing cap0. [Figure 16]Figure 15 shows a negative correlation between IL-6 levels and double-stranded RNA levels in Figure 14 obtained from BJ cells transfected with SAM RNA containing 25% or 50% U-to-N1Ψ substitutions and different lots of cap1 capping. Within 25% or 50% substitution percentages, the amount of IL-6 correlates negatively with the amount of double-stranded RNA. Based on these results, there are two independent thresholds of sensitivity to the substitution percentage. The innate immune response inhibits SAM RNA self-amplification. The first, lower threshold for U-to-N1Ψ substitutions induces evasion of the innate immune response, thereby improving self-amplification. There is also a direct effect of substitution on the inhibition of self-amplification. A 50% substitution results in lower double-stranded RNA levels than those for a 25% substitution, but these levels are higher than those for a 0% substitution. A 100% substitution results in almost no double-stranded RNA formation. Thus, between 50% and 100% substitution, there is a second, higher threshold whereby the substitution directly inhibits self-amplification. In combination, some substitutions increase self-amplification by avoiding or reducing the innate immune response, but there is a balance where too many substitutions inhibit self-amplification of SAMs, thereby inhibiting the induction of antigens and thereby an immune response against pathogens. When administered, even if there is some inhibition of self-amplification and antigen expression from SAMs with more than 50% substitution, it will be sufficient to result in effective intracellular induction of heterologous proteins, such as heterologous nucleic acids that may encode antigens and thereby induce an immune response against pathogens or a protective immune response. [Figure 17]1 is a radar plot of interferon-alpha and gamma (IFN-α and IFN-γ); interleukin-6 (IL-6), -8 (IL-8), and -10 (IL-10); IFN-γ-inducible protein-10 (IP-10, also known as C-X-C motif chemokine ligand-10 or CXCL-10); monocyte chemotactic protein-1 (MCP-1); and macrophage inflammatory protein 1-beta (MIP-1β) levels obtained from peripheral blood mononuclear cells (PBMCs) of a single donor treated with non-replicating SAM RNA encoding firefly luciferase and containing 0% or 100% U to N1Ψ substitutions and capped with Cap1; or SAM RNA encoding firefly luciferase and containing 0%, 50%, or 100% U to N1Ψ substitutions and capped with Cap1. Fifty percent replacement, compared with 0% replacement, decreased IFN-α and IFN-γ and decreased MCP-1, IL-10, IP-10, and MIP-1β levels, but tended not to decrease IL-6 or IL-8 levels. One hundred percent replacement, compared with 0% replacement, decreased IFN-α, IFN-γ, IL-8, IP-10, MCP-1, and MIP-1β levels, but not IL-6 levels. The decrease in IP-10 confirms the decrease in IFN-γ, since the latter induces the former. Treatment with lipopolysaccharide (a toll-like receptor 4 agonist) and R848 (also known as resiquimod, a TLR-7 and TLR-8 agonist) and the levels of IL-1α, IL-1β, IL-12, IL-18, IL-22, and tumor necrosis factor-α are not shown. [Figure 18-1] 18 shows histograms of IFN-α, IFN-β, MCP-1, MIP-1β, and IP-10 levels from FIG. 17. [Figure 18-2] This is a continuation of Figure 18-1. [Figure 19]Figure 1 shows the percentage of human skeletal muscle cells (HSkM) positive upon transfection with mRNA or SAM RNA encoding firefly luciferase, containing 0%, 50%, or 100% U to N1Ψ substitutions, and capped with Cap 1. 0% and 50% substituted SAMs transfect cells with similar efficiency, whereas 100% modified SAMs are defective in self-amplification. [Figure 20] Figure 19 depicts a histogram of IFN-β levels derived from the cells, showing a decrease in IFN-β when 50% substituted SAM is used. Compared to the results in Figure 19, the decrease in IFN-β with increasing substitution precedes the decrease in gene expression encoded within SAM RNA with increasing substitution in hSkM, as in C2C12 cells. [Figure 21-1] Flow cytometry gating strategy for cytokine analysis of T cells from a representative sample obtained in vivo. Cytokines were gated on time / live / lymphocyte / singlet / CD3 CD4 / CD44, or CD8 / CD44. Phenotypic subsets were determined by Boolean combination gating tools. [Figure 21-2] This is a continuation of Figure 21-1. [Figure 21-3] This is a continuation of Figure 21-2. [Figure 21-4] This is a continuation of Figure 21-3. [Figure 22-1] Flow cytometry gating scheme from a representative sample obtained from in vivo to identify follicular helper T cells (Tfh) cells. To measure total Tfh, cells were gated on time / live / lymphocyte / singlet / CD3 / CD4 / CD44 / CXCR5+PD1+. [Figure 22-2] This is a continuation of Figure 22-1. [Figure 23-1]Flow cytometry gating scheme from a representative in vivo sample to identify SARS-CoV-2 spike protein-specific B cells and B cell phenotypes is shown. Cells were gated for time / live / lymphocyte / singlet / CD19 / IgM-IgD-. Gating for B cell phenotyping markers (CD273 (PD-L2), CD80, and CD73) was established after gating on IgM-IgD-. These gates were then applied to the spike-specific population to obtain spike-specific B cell phenotypes. Germinal center (CD95+GL7+CD38-) and non-germinal center (CD95low / -GL7-CD38+) cells were gated after gating on class-switched (IgM-IgD-) cells and then further differentiated by cells binding fluorescently labeled SARS-CoV-2 spike antigen (spike+). [Figure 23-2] Continuation of Figure 23-1 [Figure 23-3] Continuation of Figure 23-2 [Figure 24] Figure 1 shows that all treatments with each of the RNA designs (SAM RNA and non-replicating mRNA) induced SARS-CoV-2 spike protein-specific antibodies. Spike protein-specific antibodies were measured in serum on days 21 and 35; n=13 for saline, empty LNP, and 3 μg dose groups; n=10 for 0.15 μg dose group. Data were transformed to log10 GMT values, and error bars are displayed with 95% confidence intervals. The lower limit of quantification is defined as 0.004. [Figure 25-1](Figure 25A) On the left, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 4 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 3 is shown. On the right, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 10 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 9 is shown. Animals in Group 4 received 3 μg of unsubstituted SAM RNA with 5' capping of Cap 1 per unit dose. Animals in Group 3 received 3 μg of unsubstituted SAM RNA with 5' capping of Cap 0 per unit dose. Animals in Group 10 received 0.15 μg of unsubstituted SAM RNA with 5' capping of Cap 1 per unit dose. Animals in Group 9 received 0.15 μg of unsubstituted SAM RNA with 5' capping of Cap 0 per unit dose. Vertical dashed lines indicate a 3-fold change, while vertical bars indicate a 1:1 ratio. (Figure 25B) On the left, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 5 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 4 is shown. On the right, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 11 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 10 is shown. Animals in Group 5 received 3 μg of unsubstituted SAM RNA per unit dose, 5'-capped with Cap1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 4 received 3 μg of unsubstituted SAM RNA per unit dose, 5'-capped with Cap1, and not purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 11 received 0.15 μg per unit dose of unsubstituted SAM RNA with 5' capping with Cap 1 and purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 10 received 0.15 μg per unit dose of unsubstituted SAM RNA with 5' capping with Cap 1 and not purified on an oligo(dT)-cellulose column before LNP encapsulation.Vertical dashed lines indicate a 3-fold change, while vertical solid lines indicate a 1:1 ratio. (Figure 25C) On the left, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Groups 6 or 7 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 5 is shown. On the right, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Groups 12 or 13 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 11 is shown. Animals in Group 5 received 3 μg per unit dose of unsubstituted SAM RNA with 5'-capping by Cap1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 6 received 3 μg per unit dose of SAM RNA with 50 mol% N1-methylpseudouridine substitution and 5'-capping with Cap 1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 7 received 3 μg per unit dose of SAM RNA with 25 mol% N1-methylpseudouridine substitution and 5'-capping with Cap 1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 11 received 0.15 μg per unit dose of unsubstituted SAM RNA with 50 mol% N1-methylpseudouridine substitution and 5'-capping with Cap 1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 12 received 0.15 μg per unit dose of SAM RNA with 50 mol% N1-methylpseudouridine substitution and 5'-capping with Cap1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Animals in Group 13 received 0.15 μg per unit dose of SAM RNA with 25 mol% N1-methylpseudouridine substitution and 5'-capping with Cap1, purified on an oligo(dT)-cellulose column before LNP encapsulation. Vertical dashed lines indicate a 3-fold change, while vertical solid lines indicate a 1:1 ratio. Substitution with 25 mol% or 50 mol% N1-methylpseudouridine did not reduce total SARS-CoV-2 spike protein-specific antibodies. [Figure 25-2](Figure 25D) On the left, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Groups 3, 4, 5, 6, or 7 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 8 is shown. On the right, the geometric mean ratio of total SARS-CoV-2 spike protein-specific antibodies on day 35 in Groups 9, 10, 11, 12, or 13 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 14 is shown. Animals in Group 8 received 3 μg per unit dose of mRNA (non-replicating) with 100 mol% substitution with N1-methylpseudouridine and 5'-capping of Cap1, purified on an oligo(dT)-cellulose column prior to LNP encapsulation. Animals in Group 14 received 0.15 μg per unit dose of mRNA (non-replicating) with 100% N1-methylpseudouridine substitution and 5'-capping with Cap1, purified on an oligo(dT)-cellulose column prior to LNP encapsulation. The vertical dashed line indicates a 3-fold change, while the vertical solid line indicates a 1:1 ratio. For example, at the lower unit dose of 0.15 μg, SAM RNA can outnumber mRNA (non-replicating). [Figure 26] SARS-CoV-2 neutralizing antibody titers (NT50) from animals treated on days 0 and 21 with the indicated LNP-encapsulated RNA (n = 13 for saline, empty LNP, and 3 μg unit dose groups and n = 10 for the 0.15 μg unit dose group) are shown. Data were transformed to log NT50, and error bars are displayed with 95% confidence intervals. Lower limit of quantification = 25 (horizontal dashed line). 5'-capping with Cap1 increased neutralizing antibody titers compared to those with 5'-capping with Cap0. Oligo(dT)-cellulose purification did not increase neutralizing antibody titers. For example, at the lower unit dose of 0.15 μg, administration of SAM RNA with or without N1-methylpseudouridine substitutions can significantly increase neutralizing antibody titers when compared to those derived from administration of mRNA (non-replicating) containing N1-methylpseudouridine rather than uridine. [Figure 27-1](Figure 27A) On the left, the geometric mean ratio of neutralizing antibody titers (NT50) on day 35 in Group 4 to total SARS-CoV-2 spike protein-specific antibodies on day 35 in Group 3 is shown. On the right, the geometric mean ratio of neutralizing antibody titers (NT50) on day 35 in Group 10 to neutralizing antibody titers (NT50) on day 35 in Group 9 is shown. The vertical dashed line indicates a 3-fold change, while the solid vertical line indicates a 1:1 ratio. (Figure 27B) On the left, the geometric mean ratio of neutralizing antibody titers (NT50) on day 35 in Group 5 to neutralizing antibody titers (NT50) on day 35 in Group 4 is shown. On the right, the geometric mean ratio of neutralizing antibody titers (NT50) on day 35 in Group 11 to neutralizing antibody titers (NT50) on day 35 in Group 10 is shown. The vertical dashed line indicates a 3-fold change, while the solid vertical line indicates a 1:1 ratio. (Figure 27C) On the left, the geometric mean ratio of the neutralizing antibody titer (NT50) on day 35 in Groups 6 or 7 to the neutralizing antibody titer (NT50) on day 35 in Group 5 is shown, and on the right, the geometric mean ratio of the neutralizing antibody titer (NT50) on day 35 in Groups 12 or 13 to the neutralizing antibody titer (NT50) on day 35 in Group 11 is shown. The dashed vertical line indicates a 3-fold change, while the solid vertical line indicates a 1:1 ratio. Substitution with 25 mol% or 50 mol% N1-methylpseudouridine did not decrease the neutralizing antibody titer (NT50). [Figure 27-2] (Figure 27D) On the left, the geometric mean ratio of the neutralizing antibody titer (NT50) on day 35 in Groups 3, 4, 5, 6, or 7 to the neutralizing antibody titer (NT50) on day 35 in Group 8 is shown, and on the right, the geometric mean ratio of the neutralizing antibody titer (NT50) on day 35 in Groups 9, 10, 11, 12, or 13 to the neutralizing antibody titer (NT50) on day 35 in Group 14 is shown. Vertical dashed lines indicate a 3-fold change, while vertical solid lines indicate a 1:1 ratio. At a higher unit dose, e.g., 3 μg, and a lower unit dose, e.g., 0.15 μg, SAM RNA can exceed mRNA (non-replicating) except in Group 3. [Figure 28-1]Serum levels of IFN-β (FIG. 28A), IFN-γ (FIG. 28B), IL-1β (FIG. 28C), IL-6 (FIG. 28D), IP-10 (FIG. 28E), keratinocyte chemoattractant / human growth-regulatory oncogene (KC / GRO, FIG. 28F), MCP-1 (FIG. 28G), MIP-1β (FIG. 28H), macrophage inflammatory protein-2 (MIP-2, FIG. 28I), and TNF-α (FIG. 28J) measured 6 h (6, n=8) and 24 h (24, n=6) after the first (1) and second (2) immunizations are shown. Data were transformed to log10 pg / mL values, and error bars are displayed as geometric means with 95% confidence intervals. The lower limits of quantitation are designated as dotted lines with the following values: 3.02 pg / mL for IFNβ, 1.56 pg / mL for IFNγ, 7.72 pg / mL for IL-1β, and 10.4 pg / mL for IL-6. [Figure 28-2] This is a continuation of Figure 28-1. [Figure 28-3] This is a continuation of Figure 28-2. [Figure 28-4] This is a continuation of Figure 28-3. [Figure 28-5] This is a continuation of Figure 28-4. [Figure 29-1] Figures 28A-28J show the results recalculated as the geometric mean ratios of the results for Group 5 to Group 4 (G5 / G4), the results for Group 6 to Group 5 (G6 / G5), the results for Group 7 to Group 5 (G7 / G5), the results for Group 4 to Group 8 (G4 / G8), the results for Group 5 to Group 8 (G5 / G8), the results for Group 6 to Group 8 (G6 / G8), and the results for Group 7 to Group 8 (G7 / G8) for serum cytokine levels 6 h and 24 h after the first vaccination (V1-6h and V1-24h, respectively) in Figure 29A and 6 h and 24 h after the second vaccination (V2-6h and V2-24h, respectively) in Figure 29B. The dashed lines to the left indicate a 3-fold decrease. The dashed lines to the right indicate a 3-fold increase. The solid line indicates no change across groups (ie, a 1:1 ratio). [Figure 29-2] This is a continuation of Figure 29-1. [Figure 30]Figure 1 shows T cell responses specific to spike proteins from SARS-CoV-2. Spike-specific T cells were defined based on their Th0 / Tc0, Th1 / Tc1, Th2 / Tc2, or Th17 / Tc17 phenotype. Data are presented as standard error of the mean of frequencies of grandparents (CD4 or CD8), n=5. Cytokines were gated on time / live / lymphocyte / singlet / CD3 CD4 / CD44 or CD8 / CD44, and phenotypic subsets were determined by the Boolean Combination Gate Tool described in Example 10. Error bars represent median values ​​with interquartile ranges. [Figure 31] Figure 30 shows spike-specific CD4 Th0 cell responses as group ratios. Vertical dashed lines indicate 3-fold changes. [Figure 32] Figure 30 shows spike-specific CD4 Th1 cell responses as group ratios. Vertical dashed lines indicate 3-fold changes. [Figure 33] Figure 30 shows spike-specific CD8 Tc0 cell responses as group ratios. Vertical dashed lines indicate 3-fold changes. [Figure 34] Figure 30 shows spike-specific CD8 Tc1 cell responses as group ratios. Vertical dashed lines indicate 3-fold changes. [Figure 35] The percentage of follicular helper T cells (Tfh cells) obtained from splenocytes on day 35, as measured by flow cytometry, is shown. Treatment with SAM RNA containing 25 mol% N1-methylpseudouridine (N1Ψ) at a unit dose of 3 μg increased Tfh cells to levels equivalent to treatment with non-replicating mRNA containing N1Ψ rather than uridine at a unit dose of 3 μg. Total Tfh cells were gated on time / live / lymphocyte / singlet / CD3 / CD4 / CD44 / CXCR5+PD1+. Data are presented as standard error of the mean of frequencies for grandparents (CD4), n=5. Error bars represent the median with interquartile range. [Figure 36]SARS-CoV-2 spike protein-specific B cell responses in in vivo germinal centers extracted on day 35 are shown. Treatment with SAM RNA containing 25 mol% N1-methylpseudouridine (N1Ψ) at a unit dose of 3 μg or non-replicating mRNA containing N1Ψ rather than uridine at a unit dose of 3 μg induced the highest spike protein-specific germinal center B cells. Cells were gated on time / live / lymphocyte / singlet / CD19 / IgM-IgD- CD95+GL7+CD38-spike+. Data are presented as standard error of the mean of frequencies for grandparental (germinal center, CD95+GL7+), n=5. Error bars represent median with interquartile range. [Figure 37] Phenotypes, as a percentage of cells, for SARS-CoV-2 spike protein-specific B cells from mice treated as described in Example 10 are shown. Treatment with SAM RNA containing 25 mol% N1-methylpseudouridine (N1Ψ) at a unit dose of 3 μg or non-replicating mRNA containing N1Ψ rather than uridine at a unit dose of 3 μg induced the highest levels of spike protein-specific memory B cells on day 35 of the in vivo protocol. Cells were gated for time / live / lymphocyte / singlet / CD19 / IgM-IgD- CD95+GL7+CD38-Spike+. Gating for B cell phenotyping markers (CD273 (PD-L2), CD80, and CD73) was established after gating on IgM-IgD-. These gates were then applied to the spike-specific population to obtain spike-specific B cell phenotypes as determined by the Boolean Combination Gate Tool. Data are presented as standard error of the mean of frequencies of grandparents (germinal center, CD95+GL7+CD38- or non-germinal center CD95low / -GL7-CD38+), n = 5. Error bars represent median with interquartile range. DETAILED DESCRIPTION OF THE INVENTION

[0072] Detailed Description of the Invention Preferred materials and methods are described herein; any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.

[0073] The present inventors have studied and discovered two independent thresholds that are sensitive to the mole percent substitution of uridine (U) with N1-methylpseudouridine (N1Ψ). Although the innate immune response inhibits SAM RNA self-amplification, the innate immune response is less sensitive to the substitution than the replicase. That is, the present inventors have studied and discovered that there is a first, lower threshold at which the substitution of U with N1Ψ evades the innate immune response, thereby enhancing SAM RNA self-amplification or AAM RNA auto-amplification. The present inventors have also studied and discovered that there is a direct effect of substitution on inhibiting SAM RNA self-amplification or multiple AAM RNA auto-amplification. While 50 percent substitution results in lower double-stranded RNA levels than 25% substitution, these levels are higher than 0% substitution. 100 percent substitution results in almost no double-stranded RNA formation. Thus, there is a second, higher threshold between 50% and 100% substitution (from about 75% substitution to about 50% substitution) at which substitutions directly inhibit the self-amplification or auto-amplification. In combination, there is a balance where some substitutions increase self-amplification by evading or reducing the innate immune response, but too many substitutions inhibit self-amplification of SAMs, thereby inhibiting the induction of an immune response against antigens and thereby pathogens.

[0074] The substitutions within the above ranges are sufficient to provide for efficient intracellular introduction of heterologous nucleic acid, which may encode a heterologous protein, e.g., an antigen, and thereby induce an immune response or a protective immune response against a pathogen. Accordingly, the inventors have investigated and identified the following aspects and embodiments, as listed: 1. A self-amplifying messenger (SAM) ribonucleic acid (RNA) comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 2. The SAM RNA according to number 1, wherein the first molar percentage is up to 70%. 3. The SAM RNA according to number 1, wherein the first molar percentage is up to 65%. 4. The SAM RNA according to number 1, wherein the first molar percentage is up to 60%. 5. The SAM RNA according to number 1, wherein the first molar percentage is up to 55%. 6. The SAM RNA according to number 1, wherein the first molar percentage is up to 50%. 7. The SAM RNA according to any one of numbers 1 to 6, wherein the first molar percentage is from 20%. 8. The SAM RNA according to any one of numbers 1 to 6, wherein the first molar percentage is from 25%. 9. The SAM RNA of any one of numbers 1 to 8, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 10. A SAM RNA according to any one of numbers 1 to 9, wherein the heterologous nucleic acid encodes a heterologous protein. 11. The SAM RNA of any one of numbers 1 to 10, wherein the heterologous nucleic acid comprises an inhibitory RNA. 12. The SAM RNA according to number 11, wherein the inhibitory RNA comprises an antisense RNA, a small interfering RNA, or a microRNA. 13. The SAM RNA according to any one of numbers 10 to 12, wherein the heterologous protein comprises an immunogen, an antibody, or an immunotherapeutic molecule. 14. A SAM RNA according to any one of numbers 10 to 13, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 15. The SAM RNA of any one of numbers 1 to 14, further comprising a polyadenosine monophosphate (poly(A)) tail. 16. The SAM RNA of any one of numbers 1 to 15, further comprising a 5' untranslated region (5'UTR), the 5'UTR being 5' to the first RNA segment and the second RNA segment. 17. The SAM RNA of any one of numbers 1 to 16, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA segment and the second RNA segment and optionally 5' to the poly(A) tail. 18. The SAM RNA of any one of numbers 1 to 17, further comprising a 5' cap. 19. The SAM RNA according to number 18, wherein the 5' cap is cap-0, cap-1, or cap-2. 20. The SAM RNA of number 18, wherein the 5' cap is cap-1. 21. The SAM RNA of number 18, wherein the 5' cap is cap-0. 22. A composition comprising a SAM RNA according to any one of numbers 1 to 21 and a pharmaceutically acceptable delivery vehicle. 23. The composition described in number 22, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 24. The composition according to number 23, wherein the LNP encapsulates SAM RNA. 25. A method for inducing an immune response to an immunogen in a subject, the method comprising administering to the subject an effective amount of a SAM RNA described in any one of numbers 13 to 21 or a composition described in any one of numbers 22 to 24. 26. The method of number 25, wherein the immune response is a protective immune response. 27. The method according to number 25, wherein the immune response is a therapeutic immune response. 28. The method of any one of numbers 25 to 27, wherein the immunogen comprises a venom, poison, allergen, cancer antigen, bacterial antigen, viral antigen, fungal antigen, parasitic antigen, or fragment thereof. 29. The method of any one of numbers 25 to 28, wherein the heterologous protein comprises an antibody against an immunogen. 30. The method of any one of numbers 25 to 28, wherein the heterologous protein comprises an immunogen. 31. A method for delivering an inhibitory RNA in a SAM RNA according to any one of numbers 11 to 21 to a subject, the method comprising the step of administering an effective amount of SAM RNA to the subject. 32. A method for delivering an inhibitory RNA in a composition described in any one of numbers 22 to 24 to a subject, the method comprising the step of administering an effective amount of the composition to the subject. 33. The method of number 31 or number 32, wherein the inhibitory RNA opposes an endogenous messenger RNA encoding an endogenous protein of the subject, and the administering step reduces expression of the endogenous protein in the subject compared to expression of the endogenous protein in the subject without administration. 34. A method for delivering a heterologous nucleic acid in a SAM RNA according to any one of numbers 1 to 21 to a subject, the method comprising the step of administering an effective amount of SAM RNA. 35. A method for delivering a heterologous nucleic acid in a composition according to any one of numbers 22 to 24 to a subject, the method comprising the step of administering an effective amount of the composition to the subject. 36. The method of any one of numbers 25 to 36, wherein the subject is a human. 37. A method for producing SAM RNA according to any one of numbers 1 to 17, comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture has a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 38. A method for producing a SAM RNA according to any one of numbers 18 to 21, comprising: a first mixing step of an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, the mixture having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, the first mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, thereby obtaining uncapped SAM RNA; and a second mixing step of uncapped SAM RNA, messenger RNA guanylyltransferase, guanosine triphosphate, (guanine-N7-)-methyltransferase, and S-adenosyl-L-methionine under conditions that result in 5' to 5' triphosphate cap ligation, optionally further comprising a 2'-O-methyltransferase, and optionally under conditions that form cap-1 or cap-2; A method comprising: 39. The method according to number 37 or number 38, wherein the RNA polymerase is T7 RNA polymerase. 40. A method for producing a composition described in any one of numbers 22 to 24, comprising the step of encapsulating SAM RNA in a pharmaceutically acceptable delivery vehicle or adsorbing SAM RNA to a pharmaceutically acceptable delivery vehicle. 41. Use of a SAM RNA according to any one of numbers 1 to 21 for the manufacture of a medicament for delivering a heterologous nucleic acid, comprising a step of mixing the SAM RNA with a pharmaceutically acceptable delivery vehicle. 42. Use of a SAM RNA according to any one of numbers 14 to 21 for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the SAM RNA with a pharmaceutically acceptable delivery vehicle. 43. Use of a SAM RNA according to any one of numbers 14 to 21 for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the SAM RNA with a pharmaceutically acceptable delivery vehicle. 44. The use according to any one of numbers 41 to 43, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 45. The use according to number 44, wherein the LNP encapsulates SAM RNA. 46. ​​The use according to any one of numbers 42 to 45, wherein the immunogen comprises a venom, poison, allergen, cancer antigen, bacterial antigen, viral antigen, fungal antigen, parasitic antigen, or fragment thereof. 47. The use according to any one of numbers 42 to 46, wherein the heterologous protein comprises an antibody against an immunogen. 48. The use according to any one of numbers 42 to 46, wherein the heterologous protein comprises an immunogen. 49. A SAM RNA for use in inducing an immune response to an antigen in a subject, the SAM RNA comprising an RNA segment encoding N1-methylpseudouridine, uridine, the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 50. A SAM RNA for use in preventing infection by a pathogen in a subject, the pathogen producing an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 51. A SAM RNA for use in treating infection by a pathogen in a subject, wherein the pathogen produces an antigen, and the SAM RNA comprises N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%. 52. The SAM RNA according to any one of numbers 49 to 51, wherein the subject is a human. 53. The SAM RNA according to any one of numbers 49 to 52, wherein the first molar percentage is up to 70%. 54. The SAM RNA according to any one of numbers 49 to 52, wherein the first molar percentage is up to 65%. 55. The SAM RNA according to any one of numbers 49 to 52, wherein the first molar percentage is up to 60%. 56. The SAM RNA according to any one of numbers 49 to 52, wherein the first molar percentage is up to 55%. 57. The SAM RNA according to any one of numbers 49 to 52, wherein the first molar percentage is up to 50%. 58. The SAM RNA according to any one of numbers 49 to 57, wherein the first molar percentage is from 20%. 59. The SAM RNA according to any one of numbers 49 to 57, wherein the first molar percentage is from 25%. 60. The SAM RNA described in any one of numbers 49 to 59, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 61. The SAM RNA of any one of numbers 49 to 60, further comprising a polyadenosine monophosphate (poly(A)) tail. 62. The SAM RNA of any one of numbers 49 to 61, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA segment and the second RNA segment. 63. The SAM RNA of any one of numbers 49 to 61, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA segment and the second RNA segment and optionally 5' to the poly(A) tail. 64. The SAM RNA of any one of numbers 49 to 63, further comprising a 5' cap. 65. The SAM RNA according to number 64, wherein the 5' cap is cap-0, cap-1, or cap-2. 66. The SAM RNA described in number 64, wherein the 5' cap is cap-1. 67. The SAM RNA described in number 64, wherein the 5' cap is cap-0. 68. A composition comprising the SAM RNA described in any one of numbers 49 to 67 and a pharmaceutically acceptable delivery vehicle. 69. The composition described in number 68, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 70. The composition of number 69, wherein the LNP encapsulates SAM RNA. 71. A method for producing SAM RNA according to any one of numbers 49 to 63, comprising a step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture comprises a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is the same as the first molar percentage, and the mixing step is performed under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 72. A method for producing a SAM RNA according to any one of numbers 64 to 67, comprising: a first mixing step of an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, the mixture having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, the first mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, thereby obtaining uncapped SAM RNA; and a second mixing step of uncapped SAM RNA, messenger RNA guanylyltransferase, guanosine triphosphate, (guanine-N7-)-methyltransferase, and S-adenosyl-L-methionine under conditions that result in 5' to 5' triphosphate cap ligation, optionally further comprising a 2'-O-methyltransferase, and optionally under conditions that form cap-1 or cap-2; A method comprising: 73. The method of number 71 or number 72, wherein the RNA polymerase is T7 RNA polymerase. 74. A method for producing a composition described in any one of numbers 68 to 70, comprising the step of encapsulating SAM RNA in a pharmaceutically acceptable delivery vehicle or adsorbing SAM RNA to a pharmaceutically acceptable delivery vehicle. 75. A SAM RNA for use in delivering a heterologous nucleic acid to a subject, the SAM RNA comprising an RNA segment comprising N1-methylpseudouridine, uridine, the heterologous nucleic acid, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 76. The SAM RNA described in number 75, wherein the subject is a human. 77. The SAM RNA according to number 75 or number 76, wherein the first molar percentage is up to 70%. 78. The SAM RNA according to number 75 or number 76, wherein the first molar percentage is up to 65%. 79. The SAM RNA according to number 75 or number 76, wherein the first molar percentage is up to 60%. 80. The SAM RNA according to number 75 or number 76, wherein the first molar percentage is up to 55%. 81. The SAM RNA according to number 75 or number 76, wherein the first molar percentage is up to 50%. 82. The SAM RNA according to any one of numbers 75 to 81, wherein the first molar percentage is from 20%. 83. The SAM RNA according to any one of numbers 75 to 81, wherein the first molar percentage is from 25%. 84. The SAM RNA of any one of numbers 75 to 83, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 85. The SAM RNA of any one of numbers 75 to 84, further comprising a polyadenosine monophosphate (poly(A)) tail. 86. The SAM RNA of any one of numbers 75 to 85, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA segment and the second RNA segment. 87. The SAM RNA of any one of numbers 75 to 86, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA segment and the second RNA segment and optionally 5' to the poly(A) tail. 88. The SAM RNA of any one of numbers 75 to 87, wherein the heterologous nucleic acid encodes a heterologous protein. 89. The SAM RNA of any one of numbers 75 to 88, wherein the heterologous nucleic acid comprises an inhibitory RNA. 90. The SAM RNA of number 89, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 91. The SAM RNA of any one of numbers 88 to 90, wherein the heterologous protein comprises an immunogen, an antibody, an antibody against an immunogen, an immunotherapeutic molecule, or an antibody against an immune signaling molecule. 92. The SAM RNA of any one of numbers 88 to 90, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 93. The SAM RNA of any one of numbers 75 to 92, further comprising a 5' cap. 94. The SAM RNA according to number 93, wherein the 5' cap is cap-0, cap-1, or cap-2. 95. The SAM RNA described in number 93, wherein the 5' cap is cap-1. 96. The SAM RNA described in number 93, wherein the 5' cap is cap-0. 97. A composition comprising the SAM RNA described in any one of numbers 75 to 96 and a pharmaceutically acceptable delivery vehicle. 98. The composition described in number 97, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 99. The composition of number 98, wherein the LNP encapsulates SAM RNA. 100. A SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment; the SAM RNA is produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 101. The SAM RNA according to number 100, wherein the first molar percentage is up to 70%. 102. The SAM RNA according to number 100, wherein the first molar percentage is up to 65%. 103. The SAM RNA according to number 100, wherein the first molar percentage is up to 60%. 104. The SAM RNA according to number 100, wherein the first molar percentage is up to 55%. 105. The SAM RNA according to number 100, wherein the first molar percentage is up to 50%. 106. The SAM RNA according to any one of numbers 100 to 105, wherein the first molar percentage is from 20%. 107. The SAM RNA according to any one of numbers 100 to 105, wherein the first molar percentage is from 25%. 108. The SAM RNA of any one of numbers 100 to 107, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 109. A SAM RNA according to any one of numbers 100 to 108, wherein the heterologous nucleic acid encodes a heterologous protein. 110. A SAM RNA according to any one of numbers 100 to 109, wherein the heterologous nucleic acid comprises an inhibitory RNA. 111. The SAM RNA of number 110, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 112. The SAM RNA of any one of numbers 109 to 111, wherein the heterologous protein comprises an immunogen, an antibody, an antibody against an immunogen, an immunotherapeutic molecule, or an antibody against an immune signaling molecule. 113. The SAM RNA of any one of numbers 109 to 112, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 114. The SAM RNA of any one of numbers 100 to 113, further comprising a polyadenosine monophosphate (poly(A)) tail. 115. The SAM RNA of any one of numbers 100 to 114, further comprising a 5' untranslated region (5'UTR), the 5'UTR being 5' to the first RNA segment and the second RNA segment. 116. The SAM RNA of any one of numbers 100 to 114, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA segment and the second RNA segment and optionally 5' to the poly(A) tail. 117. The SAM RNA of any one of numbers 100 to 116, further comprising a 5' cap. 118. The SAM RNA according to number 117, wherein the 5' cap is cap-0, cap-1, or cap-2. 119. The SAM RNA described in number 117, wherein the 5' cap is cap-1. 120. The SAM RNA of number 117, wherein the 5' cap is cap-0. 121. A composition comprising the SAM RNA of any one of numbers 100 to 120 and a pharmaceutically acceptable delivery vehicle. 122. The composition described in number 121, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 123. The composition of number 122, wherein the LNP encapsulates SAM RNA. 124. A method for inducing an immune response to an immunogen in a subject, the method comprising administering to the subject an effective amount of a SAM RNA described in any one of numbers 113 to 120 or a composition described in any one of numbers 121 to 123. 125. The method of number 124, wherein the immune response is a protective immune response. 126. The method of number 124, wherein the immune response is a therapeutic immune response. 127. The method of any one of numbers 124 to 126, wherein the immunogen comprises a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasitic antigen, or a fragment thereof. 128. The method of any one of numbers 124 to 127, wherein the heterologous protein comprises an antibody against an immunogen. 129. The method of any one of numbers 124 to 127, wherein the heterologous protein comprises an immunogen. 130. A method for delivering an inhibitory RNA in a SAM RNA according to any one of numbers 110 to 121 to a subject, comprising the step of administering an effective amount of SAM RNA to the subject. 131. A method for delivering an inhibitory RNA in a composition according to any one of numbers 121 to 123 to a subject, comprising administering an effective amount of the composition to the subject. 132. The method described in number 130 or number 131, wherein the inhibitory RNA opposes an endogenous messenger RNA encoding an endogenous protein of the subject, and the administering step reduces expression of the endogenous protein in the subject compared to expression of the endogenous protein in the subject without administration. 133. A method for delivering a heterologous nucleic acid in a SAM RNA according to any one of numbers 100 to 120 to a subject, the method comprising the step of administering an effective amount of SAM RNA. 134. A method for delivering a heterologous nucleic acid in a composition according to any one of numbers 121 to 123 to a subject, the method comprising the step of administering an effective amount of the composition to the subject. 135. A method for producing a composition described in any one of numbers 121 to 123, comprising the step of encapsulating SAM RNA in a pharmaceutically acceptable delivery vehicle or adsorbing SAM RNA to a pharmaceutically acceptable delivery vehicle. 136. Use of a SAM RNA according to any one of numbers 100 to 120 for the manufacture of a medicament for delivering a heterologous nucleic acid, comprising a step of mixing the SAM RNA with a pharmaceutically acceptable delivery vehicle. 137. Use of a SAM RNA according to any one of numbers 113 to 120 for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the SAM RNA with a pharmaceutically acceptable delivery vehicle. 138. Use of a SAM RNA according to any one of numbers 113 to 120 for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the SAM RNA with a pharmaceutically acceptable delivery vehicle. 139. The use according to any one of numbers 136 to 138, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 140. The use described in number 139, wherein the LNP encapsulates SAM RNA. 141. The use according to any one of numbers 137 to 140, wherein the immunogen comprises a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasitic antigen, or a fragment thereof. 142. The use according to any one of numbers 137 to 141, wherein the heterologous protein comprises an antibody against an immunogen. 143. The use according to any one of numbers 137 to 141, wherein the heterologous protein comprises an immunogen. 144. SAM RNA for use in eliciting an immune response to an antigen in a subject, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine from 15% to 75%, and the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 145. SAM RNA for use in preventing infection by a pathogen in a subject, the pathogen producing an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine from 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 146. SAM RNA for use in treating infection by a pathogen in a subject, the pathogen producing an antigen, the SAM RNA comprising N1-methylpseudouridine, uridine, an RNA segment encoding the antigen, and an RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine from 15% to 75%, the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 147. The SAM RNA of any one of numbers 144 to 146, wherein the subject is a human. 148. The SAM RNA according to any one of numbers 144 to 147, wherein the first molar percentage is up to 70%. 149. The SAM RNA according to any one of numbers 144 to 147, wherein the first molar percentage is up to 65%. 150. The SAM RNA according to any one of numbers 144 to 147, wherein the first molar percentage is up to 60%. 151. The SAM RNA according to any one of numbers 144 to 147, wherein the first molar percentage is up to 55%. 152. The SAM RNA according to any one of numbers 144 to 147, wherein the first molar percentage is up to 50%. 153. The SAM RNA according to any one of numbers 144 to 152, wherein the first molar percentage is from 20%. 154. The SAM RNA according to any one of numbers 144 to 152, wherein the first molar percentage is from 25%. 155. The SAM RNA of any one of numbers 144 to 154, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 156. The SAM RNA of any one of numbers 144 to 155, further comprising a polyadenosine monophosphate (poly(A)) tail. 157. The SAM RNA of any one of numbers 144 to 156, further comprising a 5' untranslated region (5'UTR), the 5'UTR being 5' to the first RNA segment and the second RNA segment. 158. The SAM RNA of any one of numbers 144 to 157, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA segment and the second RNA segment and optionally 5' to the poly(A) tail. 159. The SAM RNA of any one of numbers 144 to 154, further comprising a 5' cap. 160. The SAM RNA according to number 159, wherein the 5' cap is cap-0, cap-1, or cap-2. 161. The SAM RNA of number 159, wherein the 5' cap is cap-1. 162. The SAM RNA of number 159, wherein the 5' cap is cap-0. 163. The SAM RNA of any one of numbers 144 to 162, wherein the RNA polymerase is T7 RNA polymerase. 164. A composition comprising the SAM RNA of any one of numbers 144 to 163 and a pharmaceutically acceptable delivery vehicle. 165. The composition described in number 164, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 166. The composition of number 165, wherein the LNP encapsulates SAM RNA. 167. A method for producing a composition according to any one of numbers 164 to 166, comprising the step of encapsulating SAM RNA in a pharmaceutically acceptable delivery vehicle or adsorbing SAM RNA to a pharmaceutically acceptable delivery vehicle. 168. A SAM RNA for use in delivering a heterologous nucleic acid to a subject, the SAM RNA comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, the first RNA segment comprising the heterologous nucleic acid, and the second RNA segment encoding one or more proteins capable of replicating the SAM RNA in an intracellular environment, the SAM RNA being produced by a method comprising the step of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising the sequence of SAM RNA, thereby obtaining a mixture, the mixture having a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine from 15% to 75%, and the mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. 169. The SAM RNA of number 168, wherein the subject is a human. 170. The SAM RNA according to number 168 or number 169, wherein the first molar percentage is up to 70%. 171. The SAM RNA according to number 168 or number 169, wherein the first molar percentage is up to 65%. 172. The SAM RNA according to number 168 or number 169, wherein the first molar percentage is up to 60%. 173. The SAM RNA according to number 168 or number 169, wherein the first molar percentage is up to 55%. 174. The SAM RNA according to number 168 or number 169, wherein the first molar percentage is up to 50%. 175. The SAM RNA of any one of numbers 168 to 174, wherein the first molar percentage is from 20%. 176. The SAM RNA according to any one of numbers 168 to 174, wherein the first molar percentage is from 25%. 177. The SAM RNA of any one of numbers 166 to 176, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 178. The SAM RNA of any one of numbers 168 to 177, further comprising a polyadenosine monophosphate (poly(A)) tail. 179. The SAM RNA of any one of numbers 168 to 178, further comprising a 5' untranslated region (5'UTR), the 5'UTR being 5' to the first RNA segment and the second RNA segment. 180. The SAM RNA of any one of numbers 168 to 179, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA segment and the second RNA segment and optionally 5' to the poly(A) tail. 181. The SAM RNA of any one of numbers 168 to 180, wherein the heterologous nucleic acid encodes a heterologous protein. 182. The SAM RNA of any one of numbers 168 to 181, wherein the heterologous nucleic acid comprises an inhibitory RNA. 183. The SAM RNA of number 182, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 184. The SAM RNA of any one of numbers 181 to 183, wherein the heterologous protein comprises an immunogen, an antibody against an immunogen, an immunotherapeutic molecule, or an antibody against an immune signaling molecule. 185. The SAM RNA of any one of numbers 181 to 183, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 186. The SAM RNA of any one of numbers 168 to 185, further comprising a 5' cap. 187. The SAM RNA according to number 186, wherein the 5' cap is cap-0, cap-1, or cap-2. 188. The SAM RNA described in number 186, wherein the 5' cap is cap-1. 189. The SAM RNA described in number 186, wherein the 5' cap is cap-0. 190. A composition comprising the SAM RNA described in any one of numbers 168 to 189 and a pharmaceutically acceptable delivery vehicle. 191. The composition described in number 190, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 192. The composition of number 191, wherein the LNP encapsulates SAM RNA. 193. A plurality of auto-amplifying messenger (AAM) RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid and the one or more second RNAs encode one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the plurality of AAM RNAs have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 194. The plurality of AAM RNAs described in number 193, wherein the first RNA comprises N1-methylpseudouridine and uridine. 195. The plurality of AAM RNAs according to number 193 or number 194, wherein one or more second RNAs comprise N1-methylpseudouridine and uridine. 196. The plurality of AAM RNAs according to any one of numbers 193 to 195, wherein the first molar percentage is up to 70%. 197. The plurality of AAM RNAs according to any one of numbers 193 to 195, wherein the first molar percentage is up to 65%. 198. The plurality of AAM RNAs according to any one of numbers 193 to 195, wherein the first molar percentage is up to 60%. 199. The plurality of AAM RNAs according to any one of numbers 193 to 195, wherein the first molar percentage is up to 55%. 200. The plurality of AAM RNAs according to any one of numbers 193 to 195, wherein the first molar percentage is up to 50%. 201. The plurality of AAM RNAs according to any one of numbers 193 to 200, wherein the first molar percentage is from 20%. 202. The plurality of AAM RNAs according to any one of numbers 193 to 200, wherein the first molar percentage is from 25%. 203. The multiple AAM RNAs of any one of numbers 193 to 202, wherein the one or more proteins capable of cooperating to replicate the multiple AAM RNAs in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 204. The plurality of AAM RNAs of any one of numbers 193 to 203, wherein the heterologous nucleic acid encodes a heterologous protein. 205. The plurality of AAM RNAs of any one of numbers 193 to 204, wherein the heterologous nucleic acid comprises an inhibitory RNA. 206. The plurality of AAM RNAs described in number 205, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 207. The plurality of AAM RNAs of any one of numbers 193 to 206, wherein the heterologous protein comprises an immunogen, an antibody, or an immunotherapeutic molecule. 208. The plurality of AAM RNAs of any one of numbers 193 to 207, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 209. The plurality of AAM RNAs of any one of numbers 193 to 208, further comprising a polyadenosine monophosphate (poly(A)) tail. 210. The plurality of AAM RNAs of any one of numbers 193 to 209, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or the second RNA. 211. The plurality of AAM RNAs of any one of numbers 193 to 210, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA or the second RNA and optionally 5' to the poly(A) tail. 212. The plurality of AAM RNAs of any one of numbers 193 to 211, further comprising a 5' cap. 213. The plurality of AAM RNAs according to number 212, wherein the 5' cap is cap-0, cap-1, or cap-2. 214. The plurality of AAM RNAs described in number 212, wherein the 5' cap is cap-1. 215. The plurality of AAM RNAs according to number 212, wherein the 5' cap is cap-0. 216. A composition comprising a plurality of AAM RNAs according to any one of numbers 193 to 215 and a pharmaceutically acceptable delivery vehicle. 217. The composition according to number 216, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 218. The composition according to number 217, wherein the LNP encapsulates at least one of the one or more first RNAs. 219. A method for inducing an immune response to an immunogen in a subject, comprising administering to the subject an effective amount of a plurality of AAM RNAs described in any one of numbers 208 to 215 or a composition described in any one of numbers 216 to 218. 220. The method of number 219, wherein the immune response is a protective immune response. 221. The method of number 219, wherein the immune response is a therapeutic immune response. 222. The method of any one of numbers 219 to 221, wherein the immunogen comprises a venom, poison, allergen, cancer antigen, bacterial antigen, viral antigen, fungal antigen, parasitic antigen, or fragment thereof. 223. The method of any one of numbers 219 to 222, wherein the heterologous protein comprises an antibody against an immunogen. 224. The method of any one of numbers 219 to 222, wherein the heterologous protein comprises an immunogen. 225. A method for delivering inhibitory RNAs in a plurality of AAM RNAs according to any one of numbers 205 to 215 to a subject, comprising administering to the subject an effective amount of the plurality of AAM RNAs. 226. A method for delivering an inhibitory RNA in a composition according to any one of numbers 216 to 218 to a subject, comprising administering an effective amount of the composition to the subject. 227. The method of number 225 or number 226, wherein the inhibitory RNA opposes an endogenous messenger RNA encoding an endogenous protein of the subject, and the administering step reduces expression of the endogenous protein in the subject compared to expression of the endogenous protein in the subject without administration. 228. A method for delivering heterologous nucleic acids in a plurality of AAM RNAs according to any one of numbers 193 to 215 to a subject, the method comprising the step of administering an effective amount of the plurality of AAM RNAs. 229. A method for delivering a heterologous nucleic acid in a composition according to any one of numbers 216 to 218 to a subject, comprising administering to the subject an effective amount of the composition. 230. The method of any one of numbers 219 to 228, wherein the subject is a human. 231. A method for producing a plurality of AAM RNAs according to any one of numerals 193 to 211, comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining a mixture, wherein the one or more template nucleic acids comprise sequences of a plurality of AAM RNAs, wherein the one or more mixtures have a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, and wherein the one or more mixing steps are under conditions in which the RNA polymerase produces a plurality of AAM RNAs from the one or more template nucleic acids. 232. A method for producing a plurality of AAM RNAs according to any one of numbers 212 to 215, comprising: one or more first mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more first mixtures, the one or more template nucleic acids comprising the sequences of a plurality of AAM RNAs, the one or more first mixtures having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, the one or more first mixing steps being under conditions in which the RNA polymerase produces a plurality of uncapped AAM RNAs from the one or more template nucleic acids, the plurality of uncapped AAM RNAs having the sequences of the plurality of AAM RNAs; and one or more second mixing steps of a plurality of uncapped AAM RNAs, a messenger RNA guanylyltransferase, guanosine triphosphate, a (guanine-N7-)-methyltransferase, and S-adenosyl-L-methionine under conditions that result in 5' to 5' triphosphate cap ligation, optionally further comprising a 2'-O-methyltransferase, and optionally under conditions that form cap-1 or cap-2. A method comprising: 233. The method according to number 232 or number 233, wherein the RNA polymerase is T7 RNA polymerase. 234. A method for producing a composition described in any one of numbers 216 to 218, comprising the step of encapsulating a plurality of AAM RNAs in a pharmaceutically acceptable delivery vehicle or adsorbing a plurality of AAM RNAs to a pharmaceutically acceptable delivery vehicle. 235. Use of a plurality of AAM RNAs according to any one of numbers 193 to 215 for the manufacture of a medicament for delivering a heterologous nucleic acid, the use comprising a step of mixing the plurality of AAM RNAs with a pharmaceutically acceptable delivery vehicle. 236. Use of a plurality of AAM RNAs according to any one of numbers 208 to 215 for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the plurality of AAM RNAs with a pharmaceutically acceptable delivery vehicle. 237. Use of a plurality of AAM RNAs according to any one of numbers 208 to 215 for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, the use comprising a step of mixing the plurality of AAM RNAs with a pharmaceutically acceptable delivery vehicle. 238. The use of any one of numbers 235 to 237, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 239. The use of number 238, wherein the LNP encapsulates multiple AAM RNAs. 240. The use according to any one of numbers 236 to 239, wherein the immunogen comprises a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasitic antigen, or a fragment thereof. 241. The use according to any one of numbers 236 to 240, wherein the heterologous protein comprises an antibody against an immunogen. 242. The use according to any one of numbers 236 to 240, wherein the heterologous protein comprises an immunogen. 243. A plurality of AAM RNAs for use in inducing an immune response to an antigen in a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 244. A plurality of AAM RNAs for use in preventing infection by a pathogen in a subject, wherein the pathogen produces an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%. 245. A plurality of AAM RNAs for use in treating infection by a pathogen in a subject, wherein the pathogen produces an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%. 246. A plurality of AAM RNAs according to any one of numbers 243 to 245, wherein the subject is a human. 247. The plurality of AAM RNAs according to any one of numbers 243 to 246, wherein the first RNA comprises N1-methylpseudouridine and uridine. 248. The plurality of AAM RNAs of any one of numbers 243 to 247, wherein one or more second RNAs comprise N1-methylpseudouridine and uridine. 249. The plurality of AAM RNAs according to any one of numbers 243 to 248, wherein the first molar percentage is up to 70%. 250. The plurality of AAM RNAs according to any one of numbers 243 to 248, wherein the first molar percentage is up to 65%. 251. The plurality of AAM RNAs according to any one of numbers 243 to 248, wherein the first molar percentage is up to 60%. 252. The plurality of AAM RNAs according to any one of numbers 243 to 248, wherein the first molar percentage is up to 55%. 253. The plurality of AAM RNAs according to any one of numbers 243 to 248, wherein the first molar percentage is up to 50%. 254. The plurality of AAM RNAs according to any one of numbers 243 to 253, wherein the first molar percentage is from 20%. 255. The plurality of AAM RNAs according to any one of numbers 243 to 253, wherein the first molar percentage is from 25%. 256. The multiple AAM RNAs described in any one of numbers 243 to 255, wherein the one or more proteins capable of replicating the multiple AAM RNAs in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 257. The plurality of AAM RNAs of any one of numbers 243 to 256, further comprising a polyadenosine monophosphate (poly(A)) tail. 258. The plurality of AAM RNAs of any one of numbers 243 to 257, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or the second RNA. 259. The plurality of AAM RNAs of any one of numbers 243 to 258, further comprising a 3' untranslated region (3'UTR), wherein the 3'UTR is 3' to the first RNA or the second RNA and optionally 5' to the poly(A) tail. 260. The plurality of AAM RNAs of any one of numbers 243 to 259, further comprising a 5' cap. 261. The multiple AAM RNAs according to number 260, wherein the 5' cap is cap-0, cap-1, or cap-2. 262. The multiple AAM RNAs described in number 260, wherein the 5' cap is cap-1. 263. The plurality of AAM RNAs described in number 260, wherein the 5' cap is cap-0. 264. A composition comprising a plurality of AAM RNAs according to any one of numbers 243 to 263 and a pharmaceutically acceptable delivery vehicle. 265. The composition according to number 264, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 266. The composition of number 264, wherein the LNP encapsulates multiple AAM RNAs. 267. A method for producing a plurality of AAM RNAs according to any one of numerals 243 to 260, comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of a plurality of AAM RNAs, wherein the one or more mixtures have a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, and wherein the one or more mixing steps are under conditions in which the RNA polymerase produces a plurality of AAM RNAs from the one or more template nucleic acids. 268. A method for producing a plurality of AAM RNAs according to any one of numbers 260 to 263, comprising: one or more first mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more first mixtures, the one or more template nucleic acids comprising the sequences of a plurality of AAM RNAs, the one or more first mixtures having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, the one or more first mixing steps being under conditions in which the RNA polymerase produces a plurality of uncapped AAM RNAs from the one or more template nucleic acids, the plurality of uncapped AAM RNAs having the sequences of the plurality of AAM RNAs; and one or more second mixing steps of a plurality of uncapped AAM RNAs, a messenger RNA guanylyltransferase, guanosine triphosphate, a (guanine-N7-)-methyltransferase, and S-adenosyl-L-methionine under conditions that result in 5' to 5' triphosphate cap ligation, optionally further comprising a 2'-O-methyltransferase, and optionally under conditions that form cap-1 or cap-2. A method comprising: 269. The method according to number 267 or number 268, wherein the RNA polymerase is T7 RNA polymerase. 270. A method for producing a composition described in any one of numbers 264 to 267, comprising the step of encapsulating a plurality of AAM RNAs in a pharmaceutically acceptable delivery vehicle or adsorbing a plurality of AAM RNAs to a pharmaceutically acceptable delivery vehicle. 271. A plurality of AAM RNAs for use in delivering a heterologous nucleic acid to a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises the heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, and the plurality of AAM RNAs has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%. 272. The plurality of AAM RNAs described in number 271, wherein the subject is a human. 273. The plurality of AAM RNAs described in number 271 or number 272, wherein the first RNA comprises N1-methylpseudouridine and uridine. 274. The plurality of AAM RNAs of any one of numbers 271 to 273, wherein one or more second RNAs comprise N1-methylpseudouridine and uridine. 275. The plurality of AAM RNAs according to any one of numbers 271 to 274, wherein the first molar percentage is up to 70%. 276. The plurality of AAM RNAs according to any one of numbers 271 to 274, wherein the first molar percentage is up to 65%. 277. The plurality of AAM RNAs according to any one of numbers 271 to 274, wherein the first molar percentage is up to 60%. 278. The plurality of AAM RNAs according to any one of numbers 271 to 274, wherein the first molar percentage is up to 55%. 279. The plurality of AAM RNAs according to any one of numbers 271 to 274, wherein the first molar percentage is up to 50%. 280. The plurality of AAM RNAs according to any one of numbers 271 to 279, wherein the first molar percentage is from 20%. 281. The plurality of AAM RNAs according to any one of numbers 271 to 279, wherein the first molar percentage is from 25%. 282. The multiple AAM RNAs described in any one of numbers 271 to 281, wherein the one or more proteins capable of replicating the multiple AAM RNAs in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 283. The plurality of AAM RNAs of any one of numbers 271 to 282, further comprising a polyadenosine monophosphate (poly(A)) tail. 284. The plurality of AAM RNAs of any one of numbers 271 to 283, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or the second RNA. 285. The plurality of AAM RNAs of any one of numbers 271 to 284, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA or the second RNA and optionally 5' to the poly(A) tail. 286. The plurality of AAM RNAs of any one of numbers 271 to 285, wherein the heterologous nucleic acid encodes a heterologous protein. 287. The plurality of AAM RNAs of any one of numbers 271 to 286, wherein the heterologous nucleic acid comprises an inhibitory RNA. 288. The plurality of AAM RNAs described in number 287, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 289. The plurality of AAM RNAs of any one of numbers 286 to 288, wherein the heterologous protein comprises an immunogen, an antibody, an antibody against an immunogen, an immunotherapeutic molecule, or an antibody against an immune signaling molecule. 290. The plurality of AAM RNAs according to any one of numbers 286 to 288, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 291. The plurality of AAM RNAs of any one of numbers 271 to 290, further comprising a 5' cap. 292. The multiple AAM RNAs according to number 291, wherein the 5' cap is cap-0, cap-1, or cap-2. 293. The multiple AAM RNA of number 291, wherein the 5' cap is cap-1. 294. The multiple AAM RNA described in number 291, wherein the 5' cap is cap-0. 295. A composition comprising a plurality of AAM RNAs according to any one of numbers 271 to 294 and a pharmaceutically acceptable delivery vehicle. 296. The composition according to number 295, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 297. The composition of number 296, wherein the LNP encapsulates multiple AAM RNAs. 298. A plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA comprises a heterologous nucleic acid, and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids. 299. The plurality of AAM RNAs of number 298, wherein the first RNA comprises N1-methylpseudouridine and uridine. 300. The plurality of AAM RNAs described in number 298 or number 299, wherein one or more second RNAs comprise N1-methylpseudouridine and uridine. 301. The plurality of AAM RNAs of any one of numbers 298 to 300, wherein the first molar percentage is up to 70%. 302. The plurality of AAM RNAs according to any one of numbers 298 to 300, wherein the first molar percentage is up to 65%. 303. The plurality of AAM RNAs according to any one of numbers 298 to 300, wherein the first molar percentage is up to 60%. 304. The plurality of AAM RNAs according to any one of numbers 298 to 300, wherein the first molar percentage is up to 55%. 305. The plurality of AAM RNAs according to any one of numbers 298 to 300, wherein the first molar percentage is up to 50%. 306. The plurality of AAM RNAs according to any one of numbers 298 to 305, wherein the first molar percentage is from 20%. 307. The plurality of AAM RNAs according to any one of numbers 298 to 305, wherein the first molar percentage is from 25%. 308. The multiple AAM RNAs described in any one of numbers 298 to 307, wherein the one or more proteins capable of replicating the multiple AAM RNAs in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 309. The plurality of AAM RNAs of any one of numbers 298 to 308, wherein the heterologous nucleic acid encodes a heterologous protein. 310. The plurality of AAM RNAs of any one of numbers 298 to 309, wherein the heterologous nucleic acid comprises an inhibitory RNA. 311. The plurality of AAM RNAs described in number 310, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 312. The plurality of AAM RNAs of any one of numbers 309 to 311, wherein the heterologous protein comprises an immunogen, an antibody, an antibody against an immunogen, an immunotherapeutic molecule, or an antibody against an immune signaling molecule. 313. The plurality of AAM RNAs according to any one of numbers 309 to 311, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 314. The plurality of AAM RNAs of any one of numbers 298 to 313, further comprising a polyadenosine monophosphate (poly(A)) tail. 315. The plurality of AAM RNAs of any one of numbers 298 to 314, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or the second RNA. 316. The plurality of AAM RNAs of any one of numbers 298 to 315, further comprising a 3' untranslated region (3'UTR), the 3'UTR being 3' to the first RNA or the second RNA and optionally 5' to the poly(A) tail. 317. The multiple AAM RNA of any one of numbers 298 to 316, further comprising a 5' cap. 318. The multiple AAM RNAs according to number 317, wherein the 5' cap is cap-0, cap-1, or cap-2. 319. The multiple AAM RNA of number 317, wherein the 5' cap is cap-1. 320. The multiple AAM RNA of number 317, wherein the 5' cap is cap-0. 321. A composition comprising a plurality of AAM RNAs according to any one of numbers 298 to 320 and a pharmaceutically acceptable delivery vehicle. 322. The composition of number 321, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 323. The composition of number 322, wherein the LNP encapsulates multiple AAM RNAs. 324. A method for inducing an immune response to an immunogen in a subject, comprising administering to the subject an effective amount of a plurality of AAM RNAs described in any one of numbers 298 to 320 or a composition described in any one of numbers 321 to 323. 325. The method of number 324, wherein the immune response is a protective immune response. 326. The method of number 324, wherein the immune response is a therapeutic immune response. 327. The method of any one of numbers 324 to 326, wherein the immunogen comprises a venom, poison, allergen, cancer antigen, bacterial antigen, viral antigen, fungal antigen, parasitic antigen, or fragment thereof. 328. The method of any one of numbers 324 to 327, wherein the heterologous protein comprises an antibody against an immunogen. 329. The method of any one of numbers 324 to 327, wherein the heterologous protein comprises an immunogen. 330. A method for delivering inhibitory RNAs in a plurality of AAM RNAs according to any one of numbers 310 to 320 to a subject, comprising administering to the subject an effective amount of the plurality of AAM RNAs. 331. A method for delivering an inhibitory RNA in a composition according to any one of numbers 321 to 323 to a subject, comprising administering an effective amount of the composition to the subject. 332. The method of number 330 or number 331, wherein the inhibitory RNA opposes an endogenous messenger RNA encoding an endogenous protein of the subject, and the administering step reduces expression of the endogenous protein in the subject compared to expression of the endogenous protein in the subject without administration. 333. A method for delivering heterologous nucleic acids in a plurality of AAM RNAs according to any one of numbers 298 to 320 to a subject, comprising administering an effective amount of the plurality of AAM RNAs. 334. A method for delivering a heterologous nucleic acid in a composition according to any one of numbers 321 to 323 to a subject, comprising administering to the subject an effective amount of the composition. 335. A method for producing a composition described in any one of numbers 321 to 323, comprising the step of encapsulating a plurality of AAM RNAs in a pharmaceutically acceptable delivery vehicle or adsorbing a plurality of AAM RNAs to a pharmaceutically acceptable delivery vehicle. 336. Use of a plurality of AAM RNAs according to any one of numbers 298 to 320 for the manufacture of a medicament for delivering a heterologous nucleic acid, the use comprising a step of mixing the plurality of AAM RNAs with a pharmaceutically acceptable delivery vehicle. 337. Use of a plurality of AAM RNAs according to any one of numbers 313 to 320 for the manufacture of a medicament for preventing a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the plurality of AAM RNAs with a pharmaceutically acceptable delivery vehicle. 338. Use of a plurality of AAM RNAs according to any one of numbers 313 to 320 for the manufacture of a medicament for treating a disease caused by a pathogen, wherein the pathogen comprises an immunogen, and the use comprises a step of mixing the plurality of AAM RNAs with a pharmaceutically acceptable delivery vehicle. 339. The use of any one of numbers 336 to 338, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 340. The use described in number 339, wherein the LNP encapsulates multiple AAM RNAs. 341. The use according to any one of numbers 337 to 340, wherein the immunogen comprises a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasitic antigen, or a fragment thereof. 342. The use according to any one of numbers 337 to 341, wherein the heterologous protein comprises an antibody against an immunogen. 343. The use according to any one of numbers 337 to 341, wherein the heterologous protein comprises an immunogen. 344. A plurality of AAM RNAs for use in eliciting an immune response to an antigen in a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the template nucleic acid. 345. A plurality of AAM RNAs for use in preventing infection by a pathogen in a subject, wherein the pathogen produces an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, the plurality of AAM RNAs produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids to obtain one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs, the one or more mixtures having a molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the template nucleic acid. 346. A plurality of AAM RNAs for use in treating infection by a pathogen in a subject, wherein the pathogen produces an antigen, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and one or more second RNAs, wherein the first RNA encodes the antigen and the one or more second RNAs encode one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment, the plurality of AAM RNAs produced by a method comprising one or more steps of mixing an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs, the one or more mixtures having a molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine of from 15% to 75%, and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the template nucleic acid. 347. The plurality of AAM RNAs of any one of numbers 344 to 346, wherein the first RNA comprises N1-methylpseudouridine and uridine. 348. The plurality of AAM RNAs of any one of numbers 344 to 347, wherein one or more second RNAs comprise N1-methylpseudouridine and uridine. 349. The plurality of AAM RNAs according to any one of numbers 344 to 348, wherein the subject is a human. 350. The plurality of AAM RNAs of any one of numbers 344 to 349, wherein the first molar percentage is up to 70%. 351. The plurality of AAM RNAs according to any one of numbers 344 to 349, wherein the first molar percentage is up to 65%. 352. The plurality of AAM RNAs according to any one of numbers 344 to 349, wherein the first molar percentage is up to 60%. 353. The plurality of AAM RNAs according to any one of numbers 344 to 349, wherein the first molar percentage is up to 55%. 354. The plurality of AAM RNAs according to any one of numbers 344 to 349, wherein the first molar percentage is up to 50%. 355. The plurality of AAM RNAs according to any one of numbers 344 to 354, wherein the first molar percentage is from 20%. 356. The plurality of AAM RNAs according to any one of numbers 344 to 354, wherein the first molar percentage is from 25%. 357. The multiple AAM RNAs described in any one of numbers 344 to 356, wherein the one or more proteins capable of replicating the multiple AAM RNAs in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 358. The plurality of AAM RNAs of any one of numbers 344 to 357, further comprising a polyadenosine monophosphate (poly(A)) tail. 359. The plurality of AAM RNAs of any one of numbers 344 to 358, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or the second RNA. 360. The plurality of AAM RNAs of any one of numbers 344 to 359, further comprising a 3' untranslated region (3'UTR), wherein the 3'UTR is 3' to the first RNA or the second RNA and optionally 5' to the poly(A) tail. 361. The plurality of AAM RNAs of any one of numbers 344 to 360, further comprising a 5' cap. 362. The plurality of AAM RNAs according to number 361, wherein the 5' cap is cap-0, cap-1, or cap-2. 363. The multiple AAM RNA described in number 361, wherein the 5' cap is cap-1. 364. The multiple AAM RNA described in number 361, wherein the 5' cap is cap-0. 365. The plurality of AAM RNAs according to any one of numbers 344 to 364, wherein the RNA polymerase is T7 RNA polymerase. 366. A composition comprising a plurality of AAM RNAs according to any one of numbers 344 to 365 and a pharmaceutically acceptable delivery vehicle. 367. The composition of number 366, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 368. The composition of number 367, wherein the LNP encapsulates multiple AAM RNAs. 369. A method for producing a composition described in any one of numbers 344 to 365, comprising the step of encapsulating a plurality of AAM RNAs in a pharmaceutically acceptable delivery vehicle or adsorbing a plurality of AAM RNAs to a pharmaceutically acceptable delivery vehicle. 370. A plurality of AAM RNAs for use in delivering heterologous nucleic acids to a subject, the plurality of AAM RNAs comprising N1-methylpseudouridine, uridine, a first RNA, and a second RNA, wherein the first RNA comprises the heterologous nucleic acid, and the second RNA encodes one or more proteins capable of replicating the plurality of AAM RNAs in an intracellular environment; the plurality of AAM RNAs are produced by a method comprising one or more mixing steps of an RNA polymerase, N1-methylpseudouridine, uridine, and one or more template nucleic acids, thereby obtaining one or more mixtures, wherein the one or more template nucleic acids comprise sequences of the plurality of AAM RNAs; the one or more mixtures have a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine that is from 15% to 75%; and the one or more mixing steps are under conditions in which the RNA polymerase produces the plurality of AAM RNAs from the one or more template nucleic acids. 371. The plurality of AAM RNAs described in number 370, wherein the subject is a human. 372. The plurality of AAM RNAs of number 370 or number 371, wherein the first molar percentage is up to 70%. 373. The plurality of AAM RNAs of number 370 or number 371, wherein the first molar percentage is up to 65%. 374. The plurality of AAM RNAs according to number 370 or number 371, wherein the first molar percentage is up to 60%. 375. The plurality of AAM RNAs of number 370 or number 371, wherein the first molar percentage is up to 55%. 376. The plurality of AAM RNAs according to number 370 or number 371, wherein the first molar percentage is up to 50%. 377. The plurality of AAM RNAs according to any one of numbers 370 to 376, wherein the first molar percentage is from 20%. 378. The plurality of AAM RNAs according to any one of numbers 370 to 376, wherein the first molar percentage is from 25%. 379. The multiple AAM RNAs described in any one of numbers 370 to 378, wherein the one or more proteins capable of replicating the multiple AAM RNAs in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4. 380. The plurality of AAM RNAs of any one of numbers 370 to 379, further comprising a polyadenosine monophosphate (poly(A)) tail. 381. The plurality of AAM RNAs of any one of numbers 370 to 380, further comprising a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or one or more second RNAs. 382. The plurality of AAM RNAs of any one of numbers 370 to 381, further comprising a 3' untranslated region (3'UTR), wherein the 3'UTR is 3' to the first RNA or the second RNA and optionally 5' to the poly(A) tail. 383. The plurality of AAM RNAs of any one of numbers 370 to 382, ​​wherein the heterologous nucleic acid encodes a heterologous protein. 384. The plurality of AAM RNAs of any one of numbers 370 to 383, wherein the heterologous nucleic acid comprises an inhibitory RNA. 385. The plurality of AAM RNAs described in number 384, wherein the inhibitory RNA includes antisense RNA, small interfering RNA, or microRNA. 386. The plurality of AAM RNAs of any one of numbers 383 to 385, wherein the heterologous protein comprises an immunogen, an antibody to an immunogen, an immunotherapeutic molecule, or an antibody to an immune signaling molecule. 387. The plurality of AAM RNAs according to any one of numbers 383 to 385, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen. 388. The plurality of AAM RNAs of any one of numbers 370 to 387, further comprising a 5' cap. 389. The multiple AAM RNAs according to number 388, wherein the 5' cap is cap-0, cap-1, or cap-2. 390. The multiple AAM RNA described in number 388, wherein the 5' cap is cap-1. 391. The multiple AAM RNA described in number 388, wherein the 5' cap is cap-0. 392. A composition comprising a plurality of AAM RNAs according to any one of numbers 370 to 391 and a pharmaceutically acceptable delivery vehicle. 393. The composition of number 392, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). 394. The composition of number 393, wherein the LNP encapsulates multiple AAM RNAs.

[0075] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The following terminology is used: It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0076] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0077] "Or" supports, contemplates, and, when recited in the claims, asserts "one or a combination of," as in "one or a combination of A, B, or C." By way of example, "A, B, or C" means A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination, and A, B, and C in combination, unless otherwise specifically illustrated. That is, "or" supports and contemplates "and," as in "and / or," which includes any combination in the list of alternatives, rather than being limited solely to combinations of all alternatives in the list (i.e., "A, B, or C" includes "A and B," but is not limited to "A, B, and C").

[0078] Additionally, the recitation of a list of alternatives further contemplates and supports all combinations within the list of alternatives, although the alternatives may be conjoined by "and" to select at least one alternative from them. For example, "X is selected from the group of A, B, and C" contemplates and supports "X is selected from the group of A, B, C, and combinations thereof," "X is selected from at least one of the group of A, B, and C," and "X is selected from one or more of the group of A, B, and C." As a further example, "X is selected from the group consisting of A, B, and C" contemplates and supports "X is selected from the group consisting of A, B, C, and combinations thereof," "X is selected from at least one of the group consisting of A, B, and C," or "X is selected from one or more of the group consisting of A, B, and C."

[0079] Each of the following contemplates and supports any of the others: "comprises," "consisting," "consisting essentially of," "is / are / being," "selected from," "selected from at least," "selected from the group of," "selected from the group consisting of," "at least selected from the group consisting of," "from at least one of the group consisting of," and "from one or more of the group consisting of." By way of example, and in view of the above regarding combinations of listed elements, the recitation herein of "X comprises one A, one B, or one C" is also interpreted as "X consists of one A, one B, or one C," "X consists of one A, one B, one C, or a combination thereof," "X consists of one or more of one A, one B, or one C," "X is one or more of one A, one B, or one C," "X is one or more of one A, one B, or one C," or "X is one A, one B, one C, or any combination thereof." "X is selected from one A, one B, or one C," "X is selected from one A, one B, one C, or combinations thereof," "X is selected from the group consisting of one A, one B, one C, and combinations thereof," "X is selected from at least one of the group consisting of one A, one B, and one C," or "X is selected from one or more of the group consisting of one A, one B, and one C."

[0080] Where particular components of an embodiment are recited - e.g., "X comprises A, B, or C" - then any embodiment that specifically excludes any individual or combination of components is also supported and contemplated - e.g., "X comprises A, but not B or C," or "X comprises A but does not comprise B or C."

[0081] As used herein, "about" when referring to a measurable value, such as a measurement amount, duration, quantity, etc., is intended to encompass a variation of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and even more preferably ±0.1% from the specified value, as such variations are reasonable for practicing the disclosed methods.

[0082] By way of example, and not by way of limitation, "alphavirus" includes viruses such as Venezuelan equine encephalitis virus (VEE; e.g., Trinidad donkey, TC83CR, etc.), Semliki Forest virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, SA AR86 virus, Everglades virus, Mucambo virus, Barmah Forest virus, Middelburg virus, Pixuna virus, O'nyong-nyong virus, Getah virus, and others. virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, Whataroa virus, Banbanki virus, Kyzylagach virus, Highlands J virus, Fort Morgan virus, Ndumu virus, and Buggy Creek virus. In some embodiments, the term alphavirus includes chimeric alphaviruses that contain genomic sequences from more than one alphavirus (e.g., as described by Perri et al. (2003) J. Virol. 77(19):10394-403).

[0083] An "RNA replicon" or "self-amplifying messenger RNA" is an RNA molecule that can direct its own amplification once it is introduced into an intracellular environment. The RNA replicon or self-amplifying RNA encodes one or more proteins (e.g., nonstructural protein 1 (nsP1, also known as nonstructural alphavirus protein 1), nsP2, nsP3, and nsP4, e.g., additional alphavirus nsP1-4) that are competent to amplify the RNA replicon or self-amplifying RNA in the intracellular environment. "Competent" is used to refer to the ability of these proteins to select intracellular proteins, thereby amplifying the RNA replicon or self-amplifying RNA, once the RNA replicon or self-amplifying RNA is introduced into a cell, and the cell's transcription and translation machinery causes expression of said proteins. "Competent" is also used to refer to the requirement for the cell to supply the nucleotides necessary to produce new strands of the self-amplifying RNA or RNA replicon. The one or more proteins that amplify the RNA replicon or self-amplifying RNA are encoded together or separately on one or more segments of the self-amplifying RNA or RNA replicon. The one or more RNA segments that together encode the one or more proteins that amplify the RNA are, as RNA segments, cis-acting RNA segments. The one or more proteins that amplify the RNA replicon or self-amplifying RNA are cis-acting proteins.

[0084] "Auto-amplifying messenger RNAs" are a collection of RNA molecules that can cooperate to direct their own amplification once the auto-amplifying messenger RNAs are introduced into an intracellular environment. "Auto-amplifying messenger RNAs" recognize that those encoded in individual segments of a self-amplifying messenger RNA or RNA replicon can be split into separate molecules and introduced together into a cell, and that together, these RNAs encode one or more proteins capable of amplifying in the intracellular environment.

[0085] In some embodiments, a "self-amplifying messenger RNA" (SAM RNA) is provided, and in other embodiments, a "multiple auto-amplifying messenger RNAs" (AAM) are provided. In this regard, an RNA replicon that is a SAM RNA or a standalone RNA molecule (i.e., a SAM RNA) is contemplated. Also contemplated are multiple auto-amplifying messenger (AAM) RNA molecules. It is contemplated that both the SAM RNA and the multiple AAM RNAs deliver a heterologous nucleic acid to a cell (i.e., a first RNA or a first RNA segment) and also deliver one or more nucleic acids encoding one or more proteins that can replicate or amplify the SAM RNA or multiple AAM RNAs in the intracellular environment. By delivering one or more nucleic acids encoding one or more proteins that can replicate or amplify the SAM RNA or multiple AAM RNAs, it is contemplated that the one or more nucleic acids encoding one or more proteins that can replicate or amplify the SAM RNA or multiple AAM RNAs are amplified in the cell by the proteins, and the heterologous nucleic acid is amplified in the cell by the proteins. In this regard, the SAM RNA is self-amplifying. As a collection of RNA, the plurality of AAM RNAs are also self-amplifying.However, in some embodiments of the plurality of AAM RNAs, heterologous nucleic acid is separated from one or more nucleic acids that code for one or more proteins that can amplify the plurality of AAM RNAs in intracellular environment on independent nucleic acid molecules.In this embodiment, even if the whole composition of the plurality of AAM RNAs is self-amplifying, it is understood that the heterologous nucleic acid is not self-amplifying by itself.Thus, "multiple auto-amplifying messenger RNAs" is used to refer to multiple RNA molecules that together have all the components (i.e., segments, regions, etc.) of "stand-alone" self-amplifying messenger RNAs (i.e., a first RNA or first RNA segment and one or more second RNAs or one or more second RNA segments, where the first RNA or first RNA segment comprises a heterologous nucleic acid and the one or more second RNAs or one second RNA segment encodes one or more proteins capable of replicating the SAM RNA or multiple AAM RNAs in an intracellular environment), while also avoiding the misconception that each and every RNA in the multiple AAM RNAs must be self-amplifying.

[0086] "One or more proteins capable of replicating" an RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs "in an intracellular environment" refers to the above proteins, at least collectively, capable of causing such self-amplification or auto-amplification. Examples of alphavirus nonstructural protein-1 (nsP1), nsP2, nsP3, and nsP4 are examples of such assemblies. Nonstructural protein 1 is an mRNA capping enzyme with both guanine-7-methyltransferase (MTase) and guanylyltransferase (GTase) activities, which direct the methylation and capping of newly synthesized viral genomic and subgenomic RNAs. These enzymes synthesize a 5' cap on the newly synthesized strand of SAM RNA or multiple auto-amplifying messenger (AAM) RNAs. This 5' cap protects the mRNA from degradation by cellular 5' exonucleases, thereby promoting the retention of the newly synthesized strand. The 5' cap may be essential for transcription and / or translation of heterologous nucleic acids. However, nsP1 itself does not synthesize new strands of nucleic acid. Nonstructural protein 2 contains a helicase for new strand synthesis. Nonstructural protein 2 provides RNA triphosphatase activity for 5'-capping. Nonstructural protein 2 also contains a papain-like cysteine ​​protease that can process the preprotein containing nsP1-4. However, nsP2 itself cannot replicate new strands of nucleic acid. Nonstructural protein 3 does not replicate new strands of nucleic acid, even though it may be important for regulating transcription from messenger RNA. Nonstructural protein 4 is a highly conserved RNA-dependent RNA polymerase. However, it must be isolated from other proteins in the preprotein containing nsP1-4 (i.e., by the papain-like domain of nsP2). Its enzymatic activity may require, in part, some helicase or protease activity from nsP2 or the capping activity of nsP1.Thus, nsP1-4 collectively can replicate SAM RNA or multiple autoamplifying messenger RNAs in the intracellular environment.

[0087] In some embodiments, at least one of the one or more proteins that amplify or replicate the RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs in an intracellular environment, or the one or more proteins that can amplify or replicate the RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs once the RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs enter the intracellular environment, is derived from an alphavirus. In some embodiments, one of the one or more proteins that amplify the RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs is derived from an alphavirus. In other embodiments, at least one of the one or more proteins that amplify the RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs is derived from a virus other than an alphavirus. In other embodiments, the one or more proteins that amplify the RNA replicon, self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs is derived from a virus other than an alphavirus. In some embodiments, the non-alphavirus virus comprises a positive-strand RNA virus. In some embodiments, the non-alphavirus virus that is a positive-strand RNA virus comprises a picornavirus, flavivirus, rubivirus, pestivirus, hepacivirus, calicivirus, or coronavirus.

[0088] In some embodiments, the one or more proteins capable of replicating an RNA replicon, a self-amplifying messenger RNA, or multiple auto-amplifying messenger RNAs in an intracellular environment comprise a viral-derived cis-acting element that effects said self-amplification, self-replication, or auto-amplification in an intracellular environment.

[0089] Suitable wild-type cis-acting alphavirus sequences are well known and available from sequence depositories such as the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia, USA.Representative examples of suitable alphaviruses include (by ATCC deposit number): Aura virus (ATCC VR-368), Bebaru virus (ATCC VR-600, ATCC VR-1240), Cabassou virus (ATCC VR-922), Chikungunya virus (ATCC VR-64, ATCC VR-1241), Eastern equine encephalitis virus (ATCC VR-65, ATCC VR-1242), Fort Morgan virus (ATCC VR-924), Getah virus (ATCC VR-369, ATCC VR-1243), Kyzylagach virus (ATCC VR-927), Mayaro virus (ATCC VR-66; ATCC VR-928), and others. VR-1277), Middleburg virus (ATCC VR-370), Mucambo virus (ATCC VR-580, ATCC VR-1244), Ndumu virus (ATCC VR-371), Pixuna virus (ATCC VR-372, ATCC VR-1245), Ross River virus (ATCC VR-373, ATCC VR-1246), Semliki Forest virus (ATCC VR-67, ATCC VR-1247), Sindbis virus (ATCC VR-68, ATCC VR-1248), Tonate virus (ATCC VR-925), Triniti virus (ATCC VR-469), Una virus (ATCC VR-374), Venezuelan equine encephalitis virus (ATCC VR-69, ATCC VR-923, ATCC VR-1250, ATCC VR-1249, ATCC VR-532), Western equine encephalitis virus (ATCC VR-70, ATCC VR-1251, ATCC VR-622, ATCC VR-1252), Whataroa virus (ATCC VR-926), and Y-62-33 (ATCC VR-375).

[0090] The term "conservative sequence modifications" in the context of amino acid sequences refers to amino acid modifications that do not significantly affect or alter the binding characteristics of the antigen, immunogen, protein, antibody, or antibody fragment containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. For example, modifications can be introduced into antigens, immunogens, proteins, antibodies, or antibody fragments by site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are those in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Similar side chains include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chain (e.g., tyrosine, phenylalanine, tryptophan, histidine) substitutions and classifications thereof.

[0091] When used within the context of nucleic acids, a "sequence," "segment," "nucleic acid," or "region" includes sense (i.e., plus) and antisense (i.e., minus, e.g., reverse complement) sequences of the same nucleic acid. A "segment," "sequence," "nucleic acid," or "region" that "encodes" a coding sequence includes sense and antisense (e.g., reverse complement) sequences of the same nucleic acid when the coding sequence is transcribed and / or translated. In some embodiments, a coding sequence encodes a heterologous protein. In some embodiments, a heterologous protein comprises an immunogen (also known as an antigen). In some embodiments, a coding sequence encodes an antibody. In some embodiments, the antibody is an antibody against an immunogen or antigen. In some embodiments, an immunogen or antigen comprises a venom, toxin, allergen, cancer antigen, bacterial antigen, viral antigen, fungal antigen, parasitic antigen, or fragment thereof. That is, in some embodiments, an antibody against an immunogen or antigen is an antibody against a venom, toxin, allergen, cancer antigen, bacterial antigen, viral antigen, fungal antigen, parasitic antigen, or fragment thereof. And in some embodiments, the coding sequence encodes an immunogen or antigen that is a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasitic antigen, or a fragment thereof.

[0092] In some embodiments, the coding sequence encodes a heterologous protein. In some embodiments, the heterologous protein may comprise an immunotherapeutic molecule or an enzyme. In some embodiments, the enzyme comprises galactose-1-phosphate uridylyltransferase (GALT) or acid sphingomyelinase and is administered to a subject with reduced or deficient activity for the native enzyme, i.e., those with galactosemia or Nyman-Pick disease, respectively. In some embodiments, the heterologous protein is a clotting factor. In some embodiments, the coagulation factor is protein C thrombomodulin, protein S, activated protein C, factor I, factor IA, prothrombin, thrombin, antithrombin, tissue factor, factor VII, factor VIIa, factor X, factor Xa, factor XI, factor XIa, factor XII, factor XIIa, factor XIII, factor XIIIa, factor IX, factor IXa, factor VIII, factor VIIIa, factor XII, factor XIIa, factor FV, or factor FVa.

[0093] In some embodiments, a "segment," "sequence," "nucleic acid," or "region" encoding a coding sequence is a segment, sequence, or region that encodes an immunogen (also known as an antigen) or encodes a protein. In some embodiments, the protein comprises an antibody. Similarly, a "segment," "sequence," "nucleic acid," or "region" that "encodes" a non-coding sequence, such as an miRNA or promoter, also comprises sense and antisense (e.g., reverse complement) sequences of the same nucleic acid. This inclusion of both sense and antisense strands in a segment, sequence, nucleic acid, or region results from the property of nucleic acids undergoing semi-conservative replication, thereby preserving genetic information. In semi-conservative replication, the two strands of a double-stranded nucleic acid are separated (i.e., melted or separated by a helicase), and each of the two strands is used as a template from which a newly synthesized reverse complement strand is formed. That is, in semi-conservative replication, genetic information is preserved regardless of sense or antisense; for example, a protein, immunogen, miRNA, or promoter may be produced from an initial strand or a strand synthesized therefrom, regardless of whether the initial strand is sense or antisense. Within the context of self-amplifying RNA, semi-conservative replication results in, for example, the amplification of a protein, immunogen, miRNA, or promoter, regardless of whether the segment encoding the protein, immunogen, miRNA, or promoter was sense or antisense. In this regard, it is understood that a SAM RNA may contain one or more segments or sequences encoding one or more proteins necessary for replicating the SAM RNA in an intracellular environment, and that these segments or sequences encoding one or more proteins necessary for replicating the SAM RNA in an intracellular environment are encoded in the sense or plus-strand orientation. It is further understood that the SAM RNA comprises a heterologous nucleic acid, where the first RNA may, in some embodiments, encode a heterologous protein, and that the heterologous nucleic acid may further comprise a first RNA, in some overlapping embodiments, comprising an inhibitory RNA, and that the heterologous nucleic acid may be transcribed and translated from the antisense or minus strand of the SAM RNA.

[0094] To illustrate how "sequence," "segment," "nucleic acid," or "region," when used within the context of nucleic acids, includes sense (i.e., positive) and antisense, if a particular sequence designated "A" is recited as having a sequence of 5'-ATGG-3' in the sense strand (i.e., positive strand), it is contemplated, supported, and claimed, if recited, that A also has a sequence of 3'-TACC-5' in the antisense strand (i.e., negative strand) or the complementary strand (i.e., A is 5'-ATGG-3' or 3'-TACC-5').

[0095] As used herein, unless otherwise specified, "sequence," "region," or "segment" also contemplates and supports the same information in different forms of nucleic acid, i.e., sequences comprising RNA and DNA, or sequences comprising different nucleotides found in different forms of nucleic acid (i.e., uridine in RNA and thymidine in DNA), as well as sense and antisense (e.g., reverse complement) information therein. For example, self-amplifying RNA can be produced from a DNA plasmid, whereby the sequence of the plasmid contemplates and supports the sequence of the self-amplifying RNA, and vice versa. Since substitution of uridine with N1-methylpseudouridine is contemplated herein, the sequences, regions, or segments herein also contemplate and support sequences comprising analogs of uridine herein. By way of example, if A (sense) in RNA is 5'-AUGG-3', A also encompasses 5'-ATGG-3', which is sense DNA, and 3'-TACC-5', which is antisense DNA, and 3'-UACC-5', which is antisense RNA. By way of example, 5'-AUGG-3' also supports and contemplates the sequences 5'-A(N1Ψ)GG-3', as well as 3'-(N1Ψ)ACC-5'. A dash (') may be used to distinguish between sense and antisense (e.g., complementary) sequences, i.e., to facilitate tracking of the original genomic material, transcript, first-strand synthesis, second-strand synthesis, sense, and antisense strands. By way of further example, if the first single-stranded region comprises SEQ ID NO:4, 5'-AATGATACGGCGACCACCGA-3', then that first single-stranded region also supports and includes 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO:8).

[0096] In some embodiments, a "first RNA segment" and a "second RNA segment" are provided. It should be understood that the second RNA segment is not necessarily downstream (3') of the first RNA segment, nor is it necessarily upstream (5') of the first RNA segment. Rather, "first" or "second" with respect to an "RNA segment" is not meant to include an order along a standalone molecule; rather, "first" and "second" are used for nominative convenience. In this regard, it should be understood that "first" or "second," or any numbered entity, uses such numbering to distinguish between the foregoing. For example, the first and second molar percentages can be used to distinguish between the molar percentage of something in a molecule (i.e., the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine in a SAM RNA molecule) and the molar percentage of something in a mixture (i.e., the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine in an in vitro transcription reaction).

[0097] As used herein, "nucleic acid," "polynucleotide," and "oligonucleotide" all have the same meaning and are essentially composed of a sequence of nucleotides, each nucleotide comprising a phosphate and a nucleoside, the nucleoside comprising a pentose sugar (e.g., deoxyribose and ribose) and a nucleobase (e.g., purines including adenine or guanine and pyrimidines including cytosine, uracil, N1-methyluracil, and thymine). In one embodiment, the sugar and nucleobase are selected from the group consisting of cytidine, thymidine, guanosine, adenosine, uridine, pseudouridine (also known as 5-(β-D-ribofuranosyl)pyrimidine-2,4(1H,3H)-dione or 5-[(2S,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidine-2,4(1H,3H)-dione, CAS No. 1445-07-4, PubChem CID 15047), N1-methyluridine, N1-methylpseudouridine (also known as 5-[(2S,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1-methylpyrimidine-2,4-dione, CAS No. 13860-38-3, PubChem CID 15047). 99543), or deoxyribose- or ribose-containing forms thereof. "Nucleic acids," "polynucleotides," and "oligonucleotides" may be standalone molecules (i.e., RNA molecules) or they may be "regions," "sequences," or "segments" therein, and in this regard, the use of "region," "sequence," or "segment" is used to distinguish between such molecules and standalone molecules.

[0098] The term "immunogen" or "antigen" (Ag), also known as "Ag," refers to a molecule that elicits an immune response and can be bound by a protein containing a complementarity-determining region, such as an antibody or a T-cell receptor. An antibody includes a B-cell receptor (i.e., an antibody complexed with CD79A and CD79B). This immune response may include antibody production against the antigen (i.e., antibody-antigen binding), or activation of specific immunocompetent cells against the antigen (i.e., T-cell receptor binding to the antigen), or both. Any macromolecule can serve as an antigen, including substantially all proteins or peptides, and further including all proteins and peptides containing post-translational modifications, such as the addition of sugars, lipids, and combinations thereof. Antigens may be derived from recombinant or genomic nucleic acids. Any nucleic acid containing a nucleotide sequence or a partial nucleotide sequence encoding a protein that elicits an immune response thereby encodes an "antigen" or "immunogen." In some embodiments, an antigen or immunogen is encoded by the full-length nucleotide sequence of a gene. In some embodiments, an antigen or immunogen is encoded by partial nucleotide sequences and partial nucleotide sequences of more than one gene. In this regard, in some embodiments, the antigen or immunogen is a full-length, naturally occurring protein or proteins; in some embodiments, the antigen or immunogen is a truncated portion of a full-length, naturally occurring protein or proteins. In some embodiments, these nucleotide sequences are arranged in various combinations to encode a polypeptide that elicits a desired immune response. In this regard, an antigen need not be encoded by a "gene" at all. Antigens can be generated, synthesized, or derived from a biological sample, and the amino acid sequence of a protein antigen can be reverse-translated or codon-optimized to generate a polynucleotide sequence that subsequently encodes the antigen. With respect to antigens that are full-length or truncated proteins, and with respect to antigens that activate T cells, it is understood that cells expressing SAM RNA or multiple AAM RNAs express and process the antigen in the intracellular environment by truncating the antigen to a length that can be expressed by a major histocompatibility receptor so that the T cell receptor can recognize the antigen presented on an MHC.

[0099] Such biological samples may include, but are not limited to, pathogens, tissue samples, tumor samples, cells, or fluids containing other biological components. Pathogens may include bacteria or viruses. In some embodiments, immunogens or antigens include venoms, toxins, allergens, cancer antigens, bacterial antigens, viral antigens, fungal antigens, parasitic antigens, or fragments thereof.

[0100] As used herein, the term "antibody" refers to an immunoglobulin molecule that contains three heavy chain complementarity determining regions and three light chain complementarity determining regions (collectively, antigen determining regions), from which it specifically binds to an antigen. Antibodies may include a typical "Y" shaped immunoglobulin molecule that contains two arms and one stem, and that contains two heavy chains and two light chains. Each arm contains a variable region that includes the light and heavy chain complementarity determining regions, and each arm contains a light chain and a portion of a heavy chain (C H 1 region). Each stem contains two portions of a heavy chain, each of which is C H Area 2 and C HAn antibody comprises three regions. That is, an antibody may be an intact immunoglobulin derived from a natural source or a recombinant source, or may be an immunoreactive portion of an intact immunoglobulin. An antibody may also be a fragment of said intact antibody, wherein the fragment comprises the three heavy chain complementarity-determining regions and the three light chain complementarity-determining regions (i.e., the antigenic determining regions) and thereby specifically binds to an antigen. Antibodies may exist in various forms, including, for example, Fv, Fab, F(ab)2, linear antibodies, and single-chain antibodies (scFv). Antibodies may include polyclonal antibodies, monoclonal antibodies, humanized antibodies, human antibodies, bispecific antibodies, and multispecific antibodies (Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, Antibodies: A Laboratory Manual, Cold Spring Harbor, NY; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0101] The terms "protein," "polypeptide," and "peptide" are used interchangeably herein and refer to any peptide-linked chain of amino acids, regardless of length or post-translational modification (e.g., phosphorylation or addition of sugars, lipids, or combinations thereof).

[0102] The term "post-translational" as used herein refers to events that occur after the translation of a nucleotide triplet into an amino acid and the formation of a peptide bond to the preceding amino acid in the sequence. Such post-translational events may occur after the entire polypeptide is formed or already during the translation process on a portion of the polypeptide that has already been translated. Post-translational events typically change or modify the chemical or structural properties of the resulting polypeptide. Examples of post-translational events include the addition of sugars, lipids, phosphogroups, peptide chain cleavage, or refolding, for example, by heat shock proteins.

[0103] As used herein, the term "co-translation" refers to events that occur during the translation process of nucleotide triplets into amino acid chains. These events typically change or modify the chemical or structural properties of the resulting amino acid chain. Examples of co-translation events include, but are not limited to, events that disrupt peptide bond formation, which can completely halt the translation process or result in two different translation products.

[0104] As used herein, the term "polyprotein" or "artificial polyprotein" refers to an amino acid chain comprising, consisting essentially of, or consisting of two amino acid chains that are not naturally connected to each other. A polyprotein may contain one or more additional amino acid chains. Each amino acid chain is preferably a complete protein, i.e., spanning an entire ORF, or a fragment, domain, or epitope thereof. Individual portions of a polyprotein may be permanently or transiently connected to each other. Permanently connected polyprotein portions are translated from a single ORF and are not subsequently separated co-translationally or post-translationally. Transiently connected polyprotein portions may originate from a single ORF but are split co-translationally due to separation during the translation process or post-translationally due to, for example, cleavage of the peptide chains by endopeptidases. Additionally or alternatively, polyprotein portions may originate from two different ORFs and are joined post-translationally, for example, by a covalent bond.

[0105] An "epitope," also known as an antigenic determinant, is a segment of a macromolecule that is recognized by the immune system, specifically by an antibody or TCR (e.g., by B cells or T cells). Such an epitope is a portion or segment of a macromolecule that can bind to an antibody or an antigen-binding fragment thereof. In this context, the term "binding" preferably relates to specific binding. In the context of the present invention, the term "epitope" preferably refers to a segment of a protein or polyprotein that is recognized by the immune system. Epitopes usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.

[0106] "Protecting" or "protection," in the context of protecting against infection, disease, or condition caused by a pathogen in a subject, means producing or eliciting, either directly (i.e., by encoding an antibody) or indirectly (i.e., by encoding an antigen to which the immune system responds by producing anti-antigen antibodies or by an anti-antigen TCR-mediated immune response), an immune response that: 1) reduces the likelihood that the host's body is a reservoir for replication of the pathogen and / or the level of such replication that it can pass from one host to another; or 2) reduces the likelihood or severity or number of symptoms of infection by said pathogen. In some embodiments, protection reduces the occurrence of infection, disease, or condition caused by the pathogen (i.e., whether or not symptoms are present), possibly resulting in control of disease associated with said pathogen (i.e., sudden acute respiratory syndrome coronavirus-2 (SARS-CoV-2)) that causes the disease known as coronavirus disease 2019 (COVID-19) and / or control of associated adverse health outcomes caused by the pathogen.

[0107] "Treating" or "treatment" in the context of an infection, disease, or condition caused by a pathogen means treating the symptoms, effects, or phenotype caused by the pathogen after infection by administration. Treatment may mean reducing the severity or frequency of symptoms of a condition or disease in a subject, slowing or eliminating the progression of a condition, completely or partially eliminating symptoms of a disease or condition in a subject, or reducing or eliminating the number of pathogens in a subject. Treating an infection, disease, or condition caused by a pathogen includes ameliorating, stabilizing, reducing, or eliminating the symptoms, effects, or phenotype caused by the pathogen.

[0108] In different aspects, a self-amplifying messenger (SAM) ribonucleic acid (RNA) and a plurality of auto-amplifying messenger (AAM) RNAs are provided. In each aspect, these RNAs each have a molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine. In other aspects, these RNAs are produced from a mixture each having a molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine. In embodiments thereof, these RNAs may each comprise a heterologous nucleic acid and RNA segment or RNA encoding one or more proteins capable of replicating the RNA in an intracellular environment. In embodiments thereof, these RNAs may each comprise additional structures, such as a subgenomic promoter, a polyadenosine monophosphate tail, a 5' cap, a 5' upstream terminal repeat, a 3' terminal repeat, and additional embodiments further specifying each of these components, such as a cap, a heterologous nucleic acid encoding a heterologous protein, a heterologous protein comprising an antigen, etc. In some aspects, the SAM RNA or multiple AAM RNAs may have uses in the manufacture of a medicament, such as for delivering a heterologous nucleic acid, preventing a disease, treating a disease, delivering a heterologous protein, or delivering an inhibitory RNA. Or, in some aspects, the SAM RNA or multiple AAM RNAs may have uses in eliciting an immune response, preventing an infection, treating an infection, or delivering a heterologous protein, heterologous nucleic acid, or inhibitory RNA. Or, in some aspects, the SAM RNA or multiple AAM RNAs can be combined in a composition, manufactured, or administered in a method having the above uses. Throughout all of the above aspects and embodiments therein, it should be understood that disclosure of an embodiment supporting one aspect is intended to support, and supports, embodiments of other aspects. This statement is not limited to support across SAM RNA and multiple AAM RNAs, but can be used to support and contemplate compositions of matter, uses of the material, manufacture of the material, methods of administering the material, etc.For example, a 5' cap on a SAM RNA can be used to support embodiments for 5' caps on multiple AAM RNAs, or, for example, a method for producing 5' capped RNA can be used to support embodiments for 5' capped RNA, or a method for making SAM RNA or AAM RNA can be used to support the use of SAM RNA or AAM RNA for the manufacture of a drug.

[0109] Self-amplifying RNA In one aspect, a self-amplifying messenger (SAM) ribonucleic acid (RNA) is provided. In some embodiments, the SAM RNA comprises N1-methylpseudouridine, uridine, a first RNA, and a second RNA. In some embodiments, the first RNA comprises a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid encodes a heterologous protein. In some embodiments, the heterologous nucleic acid comprises an inhibitory RNA. In some embodiments, the heterologous nucleic acid comprises an inhibitory RNA and encodes a heterologous protein. In some embodiments, the inhibitory RNA comprises an antisense RNA, a small interfering RNA, or a microRNA. In some embodiments, the heterologous protein comprises an immunogen, an antibody, or an immunotherapeutic molecule. In some embodiments, the heterologous protein comprises an immunogen or an antibody against an immunogen and encodes an immunogen or antibody. In some embodiments, the heterologous protein comprises an antigen or an antibody against an antigen.

[0110] In some embodiments, the SAM RNA comprises SEQ ID NO:1.

[0111] In some embodiments, the first RNA or first RNA segment comprises two or more heterologous nucleic acids. In some embodiments, the heterologous protein is prolonged pharmacokinetic (PK) interleukin (IL)-2 or prolonged pharmacokinetic (PK) interleukin (IL)-7. In some embodiments, the heterologous protein is a peptide or protein comprising an epitope for inducing an immune response to an antigen in a subject. In some embodiments, the first RNA or first RNA segment encodes a heterologous protein that is a peptide or protein comprising an epitope for inducing an immune response to an antigen in a subject, and a heterologous protein that is prolonged pharmacokinetic (PK) interleukin (IL)-2 or prolonged pharmacokinetic (PK) interleukin (IL)-7. In some embodiments, the heterologous protein is a first fusion protein comprising prolonged PK-IL-2 or prolonged PK IL-7. In some embodiments, the first fusion protein comprises an IL2 portion and a portion selected from serum albumin, an immunoglobulin fragment, transferrin, Fn3, variants thereof, and combinations thereof.

[0112] In some embodiments, the heterologous protein comprises interleukin-12sc (IL-12sc), IL-15sushi, IFNα, or GM-CSF. In some embodiments, the heterologous protein comprises octamer-binding transcription factor-3 / 4 (OCT3 / 4), (sex determining region Y)-box-2 (SOX-2), Kruppel-like factor-4 (KLF-4), cellular myelocytomatosis oncogene (c-MYC), LIN-28, or NANOG. In some embodiments, the heterologous protein further comprises a differentiation factor that differentiates the pluripotent cells into at least one of muscle cells, neural cells, pancreatic cells, liver cells, splenocytes, bone marrow cells, or skin cells.

[0113] In some embodiments, the heterologous protein comprises an antibody. In some embodiments, the antibody is tocilizumab or etanercept. In some embodiments, the antibody is anti-IL6, anti-IL6R, anti-TNF-α, or anti-TNF receptor.

[0114] In some embodiments, the heterologous protein comprises an immunotherapeutic molecule or an enzyme. In some embodiments, the enzyme comprises galactose-1-phosphate uridylyltransferase (GALT) or acid sphingomyelinase and is administered to a subject with reduced or deficient activity for the native enzyme, i.e., those with galactosemia or Nyman-Pick disease, respectively. In some embodiments, the heterologous protein is a clotting factor. In some embodiments, the clotting factor is protein C thrombomodulin, protein S, activated protein C, factor I, factor IA, prothrombin, thrombin, antithrombin, tissue factor, factor VII, factor VIIa, factor X, factor Xa, factor XI, factor XIa, factor XII, factor XIIa, factor XIII, factor XIIIa, factor IX, factor IXa, factor VIII, factor VIIIa, factor XII, factor XIIa, factor FV, or factor FVa. In some embodiments, the second RNA encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment. In some embodiments, the one or more proteins capable of replicating the SAM RNA in an intracellular environment comprise alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, or alphavirus nsP4. In some embodiments, the one or more proteins capable of replicating the SAM RNA in an intracellular environment comprise alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4.

[0115] In another embodiment, a SAM RNA is provided that includes N1-methylpseudouridine, uridine, and a second RNA, but lacks nucleic acids encoding viral structural proteins. In these embodiments, the SAM RNA differs from the self-amplifying subgenomic RNA of the virus in that it may lack, for example, capsid proteins necessary for virion packaging and cell entry.

[0116] In certain embodiments, the one or more proteins capable of replicating SAM RNA in an intracellular environment include an enzyme capable of synthesizing a 5' cap (e.g., 7-methylguanosine) in the intracellular environment. This cap can enhance cellular retention of SAM RNA and enhance transcription and translation therefrom. In some embodiments, the one or more proteins capable of replicating SAM RNA in an intracellular environment include a helicase or protease. A helicase can enhance replicase activity (i.e., by removing secondary structure / hybridization, thereby providing greater RNA-dependent RNA polymerase activity).

[0117] In some embodiments, the alphavirus comprises Venezuelan equine encephalitis virus (VEE; e.g., Trinidad donkey, TC83CR, etc.), Semliki Forest virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, SAAR86 virus, Everglades virus, Mucambo virus, Barmah Forest virus, Middleburg virus, Pixuna virus, O'nyong-nyong virus, Getah virus, Sagiyama virus, Bebaru virus, Mayaro virus, Una virus, Aura virus, Wataroa virus, Bambanki virus, Kiziragachi virus, Highland J virus, Fort Morgan virus, Ndum virus, or Buggy Creek virus.

[0118] In some embodiments, the nucleic acid encoding one or more proteins capable of amplifying SAM RNA in an intracellular environment is derived from a positive-strand virus, thereby deriving from a positive-strand nucleic acid. Thus, in some embodiments, proteins and nucleic acids encoding the proteins are provided that are positive-strand (positive-sense) RNAs that result in translation of a replicase (or replicase-transcriptase) after delivery to a cell. In some embodiments, the replicase is translated as a polyprotein. In some embodiments, the replicase in the polyprotein results in a replication complex that self-cleaves to generate genomic copies of the positive-strand delivered RNA. These copies are negative-sense (negative-strand) transcripts that can be transcribed to provide additional copies of the positive-strand parent RNA and can also provide subgenomic transcripts that are translated to yield heterologous proteins (i.e., antigens, antibodies, etc.). Translation of the subgenomic transcripts thus results in in situ expression of the antigen by the infected cell. Suitable alphavirus replicons may use replicases from Sindbis virus, Semliki Forest virus, Western equine encephalitis virus, Venezuelan equine encephalitis virus, etc. Mutant or wild-type viral sequences may be used, for example, the attenuated TC83 mutant of VEEV has been used in replicons. See the following reference: WO2005 / 113782, the contents of which are incorporated by reference.

[0119] In some embodiments, the one or more proteins capable of replicating the SAM RNA in an intracellular environment comprise a protein from a positive-strand virus, hi some embodiments, the positive-strand virus comprises a picornavirus, a flavivirus, a rubivirus, a pestivirus, a hepacivirus, a calicivirus, or a coronavirus.

[0120] In some embodiments, the SAM RNA is a plurality of SAM RNAs, and the first RNA and the second RNA are on different molecules of the SAM RNA. In some embodiments, the first RNA is a first RNA segment and the second RNA is a second RNA segment, and the first and second RNA segments are on the same strand of the SAM RNA.

[0121] In some embodiments, the SAM RNA further comprises a polyadenosine monophosphate (poly(A)) tail. In some embodiments, the poly(A) tail is at the 3' end of the SAM RNA. In some embodiments, the SAM RNA further comprises a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA segment and the second RNA segment. In some embodiments, the SAM RNA further comprises a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA and the second RNA. In some embodiments, the SAM RNA further comprises a 5' untranslated region (5'UTR), wherein the 5'UTR is 5' to the first RNA or the second RNA. In some embodiments, the SAM RNA further comprises a 3' untranslated region (3'UTR), wherein the 3'UTR is 3' to the first RNA and the second RNA, and optionally 5' to the poly(A) tail. In some embodiments, the SAM RNA further comprises a 3' untranslated region (3'UTR), which is 3' to the first RNA or the second RNA, and optionally 5' to the poly(A) tail. In some embodiments, the SAM RNA further comprises a 3' untranslated region (3'UTR), which is 3' to the first RNA segment and the second RNA segment, and optionally 5' to the poly(A) tail. In some embodiments, the second RNA segment is 5' to the first RNA segment.

[0122] In some embodiments, the SAM RNA may have two open reading frames: a first (5') open reading frame encodes one or more proteins capable of amplifying the SAM RNA in an intracellular environment; and a second (3') open reading frame provides for transcription (and possibly translation) of a heterologous nucleic acid. In some embodiments, the RNA may have additional (e.g., downstream) open reading frames, for example, encoding additional antigens or encoding accessory polypeptides.

[0123] 5' Capping In some embodiments, the SAM RNA further comprises a 5' cap. The 5' cap comprises a guanosine attached to the SAM RNA by a 5'-5' triphosphate bond by an mRNA guanylyltransferase, wherein the guanine of the guanosine is methylated at its 7-position. In this context, a 5'-5' triphosphate bond occurs when the 5' end of the ribose of the guanosine is linked to the 5' end of the ribose of the SAM RNA via a triphosphate group by an mRNA guanylyltransferase. The guanine of the guanosine is then methylated at its 7-position by a (guanine-N7-)-methyltransferase. Without further methylation, this cap is known as Cap 0 and is represented by a 5'(m7Gp)(ppN)[pN] N (wherein the former "N" represents the first (5') nucleobase of the SAM RNA, "pN" represents an additional nucleotide in the SAM RNA, and "[pN] N " in "[..] N The addition of " indicates the repeating polymer structure of the SAM RNA, thereby collectively indicating each consecutive adjacent nucleotide within the SAM RNA).

[0124] Further oxygen-linked methylation by 2'-O-methyltransferase to the 2' carbon of the ribose of the nucleotide of SAM RNA immediately adjacent to the guanosine results in the Cap 1 structure, 5'(m7Gp)(ppm2N)[pN] N(where the addition of "m2" indicates oxygen-linked methylation of the 2' carbon of the ribose of the nucleotide immediately adjacent (via a triphosphate linkage) to the guanosine). Further methylation of the next (3') nucleotide of the SAM RNA immediately adjacent to the nucleotide methylated in Cap 1 results in a Cap 2 structure, designated 5'(m7Gp)(ppm2N)(m2pN)[pN]n, where the latter addition of "m2" indicates methylation of the nucleotide immediately adjacent to the nucleotide methylated in Cap 1. This Cap 2 methylation is also to the 2' carbon of the ribose of the immediately adjacent nucleotide. In some embodiments, the 5' cap is Cap 0, Cap 1, or Cap 2. In some embodiments, the 5' cap is Cap 0. In some embodiments, the 5' cap is Cap 1. In some embodiments, the 5' cap is Cap 2.

[0125] Kits that provide all of the materials for 5' capping, whether the 5' cap is Cap 1 or Cap 2, can be used, as well as supplemental kits that add Cap 1 and Cap 2 capabilities to the Cap 0 kit. Methods for 5' capping can be carried out according to the manufacturer's instructions.

[0126] Subgenomic promoter In some embodiments, the SAM RNA comprises one or more viral subgenomic "junction region" promoters or subgenomic promoters that direct expression of heterologous nucleotide sequences, which in certain embodiments may be modified to increase or decrease viral transcription of the subgenomic fragments and heterologous sequences to be expressed. Other control elements, as described below, can be used. Subgenomic promoters, also known as junction region promoters, can be used to regulate protein expression. Alphavirus subgenomic promoters regulate the expression of alphavirus structural proteins. See Strauss and Strauss, "The alphaviruses: gene expression, replication, and evolution," Microbiol Rev. 1994 September; 58(3):491-562. A polycistronic polynucleotide may comprise a subgenomic promoter from any alphavirus. When two or more subgenomic promoters are present in a polycistronic polynucleotide, the promoters may be the same or different. For example, a subgenomic promoter may have the sequence CTCTCTACGGCTAACCTGAATGGA (SEQ ID NO: 3). In certain embodiments, the subgenomic promoter can be modified to increase or decrease viral transcription of proteins. See U.S. Patent No. 6,592,874.

[0127] Ingredient Order In some embodiments, the SAM RNA comprises any of the following: a 5' cap, a 5' UTR, a first subgenomic promoter, a second RNA segment, a second subgenomic promoter, a first RNA segment, a 3' UTR, and a poly(A) tail. In some embodiments, the SAM RNA comprises all of the following: a 5' cap, a 5' UTR, a first subgenomic promoter, a second RNA segment, a second subgenomic promoter, a first RNA segment, a 3' UTR, and a poly(A) tail. In some embodiments, the SAM RNA comprises all of the following in the following order: a 5'-5' cap, a 5' UTR, a first subgenomic promoter, a second RNA segment, a second subgenomic promoter, a first RNA segment, a 3' UTR, and a poly(A) tail-3'.

[0128] Percentage of uridine substitution with N1-methylpseudouridine in SAM RNA In some embodiments, the SAM RNA has a molar percentage of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine (i.e., the first molar percentage within the context of the SAM RNA) of 15% to 75%. In some embodiments, the SAM RNA has a molar ratio of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine (i.e., the first molar ratio within the context of the SAM RNA) of 0.15% to 0.75. In some embodiments, the SAM RNA has a molar ratio of N1-methylpseudouridine to uridine (i.e., the first molar ratio within the context of the SAM RNA) of 15:85 to 75:25.

[0129] As described above, the SAM RNA contains uridine and N1-methylpseudouridine. Thus, the SAM RNA contains a molar ratio or molar percentage of N1-methylpseudouridine relative to the sum of uridine and N1-methylpseudouridine. For example, the SAM RNA may essentially contain a first molar ratio of N1-methylpseudouridine relative to the sum of uridine and N1-methylpseudouridine, or the SAM RNA may essentially contain a first molar percentage of N1-methylpseudouridine relative to the sum of uridine and N1-methylpseudouridine. Alternatively, the SAM RNA may essentially contain a molar ratio of N1-methylpseudouridine to uridine. For example, the SAM RNA may essentially contain a first molar ratio, which is the molar ratio of N1-methylpseudouridine to uridine.

[0130] In another overlapping embodiment, SAM RNA is produced by a method comprising: obtaining a mixture by mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA; the mixture has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of 15% to 75%; and the mixing is performed under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid. That is, whatever the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine in the SAM RNA is, it is determined by the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine in the mixture from which the SAM RNA is obtained. In some embodiments, the mixture has a molar ratio of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine (i.e., the first molar ratio within the context of SAM RNA) of 0.15% to 0.75. In some embodiments, the mixture has a molar ratio of N1-methylpseudouridine to uridine (i.e., the first molar ratio within the context of the SAM RNA) of 15:85 to 75:25.

[0131] In some embodiments, the first molar percentage of N1-methylpseudouridine relative to the sum of uridine and N1-methylpseudouridine, whether in the SAM RNA or in the mixture used to obtain the SAM RNA, is 15% to 75%, or about 15% to about 75%, and in some embodiments, the first molar percentage is from about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, or about 40%. In some embodiments therein, the first mole percentage is from 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, or 40%. In some embodiments therein, the first mole percentage is about 74%, about 73%, about 72%, about 71%, about 70%, about 69%, about 68%, about 67%, about 66%, about 65%, about 64%, about 63%, about 62%, about 61%, about 60%, about 59%, about 58%, about 57%, about 56%, about 55%, about 54%, about 53%, about 52%, about 51%, or up to about 50%. In some embodiments therein, the first mole percentage is up to 74%, 73%, 72%, 71%, 70%, 69%, 68%, 67%, 66%, 65%, 64%, 63%, 62%, 61%, 60%, 59%, 58%, 57%, 56%, 55%, 54%, 53%, 52%, 51%, or 50%. It is contemplated and supported that any of the above first mole percentages preceded by "from" can be combined with any of the above first mole percentages preceded by "up to" (i.e., from about 18% to 73%, or from 25% to about 50%).

[0132] In one embodiment, the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine (i.e., the first molar percentage) is 15% to 70%. In one embodiment, the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine (i.e., the first molar percentage) is 15% to 65%. In one embodiment, the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine (i.e., the first molar percentage) is 15% to 60%. In one embodiment, the molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine (i.e., the first molar percentage) is 15% to 55%. In one embodiment, the molar percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine (ie, the first molar percentage) is 15% to 50%.

[0133] In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 20% to 75%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 25% to 75%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 20% to 70%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 25% to 70%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 20% to 65%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 25% to 65%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 20% to 60%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 25% to 60%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 20% to 55%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 25% to 55%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 20% to 50%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 25% to 50%.

[0134] In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 30% to 55%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 35% to 55%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 40% to 55%. In one embodiment, the percentage of N1-methylpseudouridine relative to the total of N1-methylpseudouridine and uridine is 40% to 55%.

[0135] The above percentages of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine support and contemplate the ratios of N1-methylpseudouridine to the sum of N1-methylpseudouridine and uridine and the ratios of N1-methylpseudouridine to uridine provided in Table 1.

[0136] [Table 1] TIFF2024534915000002.tif124162

[0137] Compositions containing SAM RNA In some embodiments, a composition is provided comprising any of the above-described SAM RNAs and a pharmaceutically acceptable delivery vehicle. In some embodiments, the pharmaceutically acceptable delivery vehicle can be selected for the route of administration, including formulations for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration. In some embodiments, the cell population is administered parenterally. The term "parenteral" includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, the cells are administered to a subject using peripheral systemic delivery via intravenous, intraperitoneal, or subcutaneous injection. In some embodiments, the composition is provided as a sterile liquid preparation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which in some aspects may be buffered to a selected pH (i.e., acidic). In some embodiments, the pharmaceutically acceptable delivery vehicle can be selected based on the rule of five for parenteral routes (i.e., intraocular, inhalation, or transdermal administration).

[0138] In some embodiments, a composition is provided comprising any of the above SAM RNAs and a polyalkyleneimine. In some embodiments, the molar ratio of the number of nitrogen atoms (N) in the polyalkyleneimine to the number of phosphorus atoms in the single-stranded RNA (N:P ratio) is 2.0 to 15.0. In some embodiments, the composition has an ionic strength of 50 mM or less.

[0139] In some embodiments, the composition comprises a construct, nucleic acid sequence, and / or polypeptide sequence described elsewhere herein in plain water (e.g., "wfi" or "water for injection") or a buffer solution, such as phosphate buffer, Tris buffer, borate buffer, succinate buffer, histidine buffer, or citrate buffer. Buffer salts will typically be present in the range of 5-20 mM. In some embodiments, the composition has a pH of 5.0-9.5, e.g., 6.0-8.0. In some embodiments, the composition may contain a sodium salt (e.g., sodium chloride) to achieve isotonicity. A concentration of 10 mg / mL ± 0.2 mg / mL NaCl, e.g., about 9 mg / mL, is typical. In some embodiments, the composition contains a metal ion chelator, which can extend RNA stability by removing ions that can promote phosphodiester hydrolysis. Thus, in some embodiments, the composition contains EDTA, EGTA, BAPTA, or pentetic acid. Such chelating agents are typically present at 10-500 μM, e.g., 0.1 mM. Citrate salts, e.g., sodium citrate, can also act as chelating agents but advantageously provide buffering activity. In some embodiments, the composition has an osmolality of 200 mOsm / kg-400 mOsm / kg, e.g., 240-360 mOsm / kg, or 290-310 mOsm / kg. In some embodiments, the composition includes a preservative, e.g., thiomersal or 2-phenoxyethanol. In some embodiments, the preservative is mercury-free. In some embodiments, the composition is preservative-free. In some embodiments, the composition is aseptic or sterile. In some embodiments, the composition is non-pyrogenic, e.g., containing less than 1 EU (endotoxin unit, standard unit) per dose, preferably less than 0.1 EU per dose. In some embodiments, the composition is gluten-free. In some embodiments, the composition is in unit dose form. In some embodiments, the unit dose can be formulated to provide an effective amount in a volume of 0.1 mL to 1.0 mL, for example, about 0.5 mL.

[0140] In some embodiments, the compositions disclosed herein are immunogenic compositions that, when administered to a subject, induce a humoral and / or cellular antigen-specific immune response (i.e., an immune response that specifically recognizes a naturally occurring antigen from a pathogen). For example, an immunogenic composition can induce memory T and / or B cell populations that respond to an antigen or immunogen, and thereby a pathogen, to neutralize the antigen, immunogen, or pathogen, or to inhibit T H1 Or T H2 In some embodiments, the compositions can be formulated as vaccines (i.e., to induce an immune response where the immune response is a protective immune response), and in other embodiments, the compositions can be formulated as therapeutics (i.e., to induce an immune response where the immune response is a therapeutic immune response, i.e., to prevent the re-emergence of latent virus).

[0141] In some embodiments, the composition can be formulated as a vaccine composition. The vaccine will contain an immunologically effective amount of a first nucleic acid encoding an antigen or an antibody to the antigen. By "immunologically effective amount," it is intended that administration of that amount to a subject, either in a single dose or as part of a series, is effective to induce a measurable immune response against the antigen and thereby the pathogen producing the antigen. This amount will vary depending on the health and physical condition of the individual being treated, their age, the taxonomic group of the individual being treated (e.g., human, non-human primate, etc.), the capacity of the individual's immune system to synthesize antibodies, the degree of protection desired, the composition or vaccine formulation, the treating physician's assessment of the medical condition, the severity of the disease, the potency of the administered compound, the mode of administration, and other relevant factors. The amount will fall within a relatively broad range that can be determined by testing. In one embodiment, an immunologically effective amount of a first RNA encoding an immunogen or antigen is an amount sufficient to prevent or treat infection by a pathogen producing the antigen or immunogen. The vaccines disclosed herein may be prophylactic (i.e., induce a protective immune response against a pathogen) or therapeutic (i.e., treat an infection). In some embodiments, the vaccine compositions disclosed herein may induce an effective immune response against a pathogen, i.e., a response sufficient to treat infection by the pathogen or sufficient to elicit a protective immune response against the infection.

[0142] In some embodiments, the composition further comprises an additional antigen, a nucleic acid encoding the antigen, or a nucleic acid encoding an antibody to the antigen, hi some embodiments, the composition is administered to the subject along with an additional composition comprising the additional antigen, a nucleic acid encoding the antigen, or a nucleic acid encoding an antibody to the antigen.

[0143] In some embodiments, the composition comprises or is administered with one or more adjuvants (e.g., vaccine adjuvants). By "adjuvant" it is meant that the immune response to an antigen can be increased compared to administration of the antigen alone or a nucleic acid encoding the antigen alone. In some embodiments, the composition further comprises one or more immunostimulants, such as a saponin, such as QS21. In some embodiments, the addition of cholesterol to the composition (i.e., LNP) can be used to reduce hemolytic activity or toxicity resulting from saponins.

[0144] Adjuvants include, but are not limited to: (A) mineral-containing compositions, such as aluminum and calcium salts, such as aluminum phosphate; (B) oil emulsions, such as squalene-in-water emulsions, e.g., MF59, AS03, complete Freund's adjuvant (CFA), and incomplete Freund's adjuvant (IF). (A); (C) saponin formulations; (D) virosomes and virus-like particles (VLPs); (E) bacterial or microbial derivatives, such as non-toxic derivatives of enterobacterial lipopolysaccharide (LPS), lipid A derivatives, immunostimulatory oligonucleotides, and ADP-ribosylating toxins and their detoxified derivatives; (F) human immune modulators, such as cytokines, e.g., interleukins, interferons, macrophage colony-stimulating factors, and tumor necrosis factors; (G) bioadhesives and mucoadhesives, such as esterified hyaluronic acid microspheres, cross-linked derivatives of poly(acrylic acid), polyvinyl alcohol, polyvinylpyrrolidone, polysaccharides, and carboxymethylcellulose; (H) biodegradable and non-toxic materials (e.g., poly(α-hydroxy acid), polyhydrogenase, etc.). (I) liposomes and / or lipid nanoparticles (LNPs); (J) polyoxyethylene ether and polyoxyethylene ester formulations; (K) polyphosphazene (PCPP); (L) muramyl peptides; or (M) imidazoquinolone compounds, such as imiquimod and its homologs. In this regard, the adjuvant may have additional qualities, such as acting as a pharmaceutically acceptable delivery vehicle and enabling entry of RNA into cells.

[0145] In some embodiments, the pharmaceutically acceptable delivery vehicle comprises a liposome or lipid nanoparticle (LNP). In some embodiments, the liposome or LNP encapsulates the SAM RNA. In some embodiments, the LNP may comprise a multilamellar vesicle (MLV); a small uniflagellar vesicle (SUV); or a large unilamellar vesicle (LUV). MLVs have multiple bilayers within each vesicle, forming several separate aqueous compartments. SUVs and LUVs have a single bilayer encapsulating an aqueous core. SUVs typically have a diameter less than or equal to 50 nm, while LUVs have a diameter greater than 50 nm. The liposomal particles of the present invention are ideally LUVs with diameters ranging from 50 to 220 nm. For compositions containing a population of LUVs with different diameters, (i) at least 80% by number should have a diameter in the range of 20-220 nm, (ii) the mean diameter of the population (Zav, by intensity) is ideally in the range of 40-200 nm, and / or (iii) the diameters should have a polydispersity index of less than 0.2. The liposome / RNA complexes of Reference 1 are expected to have diameters in the range of 600-800 nm and high polydispersity. In some embodiments, the LNPs contain cholesterol. In some embodiments, the LNPs have a solid core (i.e., lack an aqueous core). In some embodiments, the LNPs contain an aqueous core.

[0146] Various amphipathic lipids can form bilayers in aqueous environments to encapsulate RNA-containing LNPs. These lipids can be anionic, cationic, or zwitterionic. These lipids can have anionic, cationic, or zwitterionic hydrophilic head groups. Some lipids are anionic, while others are zwitterionic, and others are cationic. Suitable classes of phospholipids include, but are not limited to, phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, and phosphatidylglycerol. Useful cationic lipids include, but are not limited to, dioleoyltrimethylammoniumpropane (DOTAP), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DODMA), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), and 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane (DLenDMA). Zwitterionic lipids include, but are not limited to, acylzwitterionic lipids and etherzwitterionic lipids. Examples of useful zwitterionic lipids are 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dodecylphosphocholine. The lipids may be saturated or unsaturated. The use of at least one unsaturated lipid to prepare liposomes is preferred. If the unsaturated lipid has two tails, both tails may be unsaturated, or it may have one saturated tail and one unsaturated tail.

[0147] The liposomal nanoparticles of the present invention can be formed from a single lipid or a mixture of lipids. The mixture may include (i) a mixture of anionic lipids, (ii) a mixture of cationic lipids, (iii) a mixture of zwitterionic lipids, (iv) a mixture of anionic and cationic lipids, (v) a mixture of anionic and zwitterionic lipids, (vi) a mixture of zwitterionic and cationic lipids, or (vii) a mixture of anionic, cationic, and zwitterionic lipids. Similarly, the mixture may include both saturated and unsaturated lipids. For example, the mixture may include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) (zwitterionic, saturated), DlinDMA (cationic, unsaturated), and / or 1,2-dimyristoyl-rac-glycerol (DMG) (anionic, saturated). When a mixture of lipids is used, not all of the component lipids in the mixture need be amphipathic; for example, one or more amphipathic lipids may be mixed with cholesterol.

[0148] The hydrophilic portion of the lipid may be PEGylated (i.e., modified by the covalent attachment of polyethylene glycol). This modification can increase the stability of the liposome and prevent nonspecific adsorption. PEGs of various lengths, e.g., 0.5 to 8 kDa, can be used. One example of a combination of PEG and the above lipids is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000). Others include 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (ammonium salt) and distearoyl-rac-glycerol-PEG2K. In some embodiments, the LNP comprises DSPC, DlinDMA, PEG-DMG, and cholesterol. In some embodiments, the LNPs comprise, by molar, 10% DSPC (zwitterionic), 40% DlinDMA (cationic), 48% cholesterol, and 2% PEG-conjugated DMG (2 kDa PEG).

[0149] Other useful LNPs are described in the following references: WO2012 / 006376; ​​WO2012 / 030901; WO2012 / 031046; WO2012 / 031043; WO2012 / 006378; WO2011 / 076807; WO2013 / 033563; WO2013 / 006825; WO2014 / 136086; WO2015 / 095340; WO2015 / 095346; WO2016 / 037053. In some embodiments, the LNP is an RV01 liposome, see the following references: WO2012 / 006376 and Geall et al. (2012) PNAS USA. September 4; 109(36): 14604-9.

[0150] As mentioned above, liposomes and LNPs are listed as adjuvants, but in this regard, they also provide other functions that, in some embodiments, exist simultaneously with adjuvant properties and, in some embodiments, are unrelated to adjuvant properties. That is, RNA can be degraded by target RNAses on its own and, if unprotected, by target RNAses. LNPs provide a means of protecting RNA by encapsulating or containing the amount of RNA throughout a composition or formulation. The effect of LNPs, which in some cases are adjuvants, in other cases are delivery vehicles, and in other cases are both, may be cell-dependent. For example, without being bound by theory, LNPs can provide adjuvant properties for peripheral blood mononuclear cells in that the RNA activates the cells but is not expressed therein, whereas LNPs can provide a delivery vehicle, rather than adjuvant properties, for other somatic cell types, such as skeletal muscle cells.

[0151] In some embodiments, the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP). In some embodiments, the LNP has a solubility of at least 85.0%, 85.1%, 85.2%, 85.3%, 85.4%, 85.5%, 85.6%, 85.7%, 85.8%, 85.9%, 86.0%, 86.1%, 86.2%, 86.3%, 86.4%, 86.5%, 86.6%, 86.7%, 86.8%, 86.9%, 87.0%, 87.1%, 87.2%, 87.3%, 87.4%, 87.5%, 87.6%, 87.7%, 87.8%, 87.9%, 88.0%, 88.1%, 88.2%, 88.3%, 88.4% ,88.5%,88.6%,88.7%,88.8%,88.9%,89.0%,89.1%,89.2%,89.3%,89.4%,89.5%,89.6%,89.7%,89.8%,89.9%,90.0%,90.1%,90.2%,90.3%,90.4%,90.5%,90.6%,90.7%,90.8%,90.9%,91.0%,91.1%,91.2%,91.3%,91.4%,91.5%,91.6%,91.7%,91.8%,91.9%,92.0%,92.1%,92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9 ... 6.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.In some embodiments, the LNPs encapsulate, comprise, consist of, consist essentially of, or have 85.0% or less, 85.1% or less, 85.2% or less, 85.3% or less, 85.4% or less, 85.5% or less, 85.6% or less, 85.7% or less, 85.8% or less, 85.9% or less, 86.0% or less, 86.1% or less, 86.2% or less, 86.3% or less, 86.4% or less, 86.5% or less, 86.6% or less, 86.7% or less, 86.8% or less, 86.9% or less, 87.0% or less, 87.1% or less, 87.2% or less, 87.3% or less, 87.4% or less, 87.5% or less, 87.6% or less, 87.7% or less, 87.8% or less, 87.9 ...1% or less, 87.2% or less, 87.3% or less, 8 Below, 87.8% or less, 87.9% or less, 88.0% or less, 88.1% or less, 88.2% or less, 88.3% or less, 88.4% or less, 88.5% or less, 88.6% or less, 88.7% or less, 88.8% or less, 88.9% or less, 89.0% or less, 89.1% or less, 89. 2% or less, 89.3% or less, 89.4% or less, 89.5% or less, 89.6% or less, 89.7% or less, 89.8% or less, 89.9% or less, 90.0% or less, 90.1% or less, 90.2% or less, 90.3% or less, 90.4% or less, 90.5% or less, 90.6% or less, 90 .7% or less, 90.8% or less, 90.9% or less, 91.0% or less, 91.1% or less, 91.2% or less, 91.3% or less, 91.4% or less, 91.5% or less, 91.6% or less, 91.7% or less, 91.8% or less, 91.9% or less, 92.0% or less, 92.1% or less, 92.2% or less, 92.3% or less, 92.4% or less, 92.5% or less, 92.6% or less, 92.7% or less, 92.8% or less, 92.9% or less, 93.0% or less, 93.1% or less, 93.2% or less, 93.3% or less, 93.4% or less, 93.5% or less, 93.6% or less Lower, 93.7% or less, 93.8% or less, 93.9% or less, 94.0% or less, 94.1% or less, 94.2% or less, 94.3% or less, 94.4% or less, 94.5% or less, 94.6% or less, 94.7% or less, 94.8% or less, 94.9% or less, 95.0% or less, 95.1 % or less, 95.2% or less, 95.3% or less, 95.4% or less, 95.5% or less, 95.6% or less, 95.7% or less, 95.8% or less, 95.9% or less, 96.0% or less, 96.1% or less, 96.2% or less, 96.3% or less, 96.4% or less, 96.5% or less, 96.6% or less, 96.7% or less, 96.8% or less, 96.9% or less, 97.0% or less, 97.1% or less, 97.2% or less, 97.3% or less, 97.4% or less, 97.5% or less, 97. 6% or less, 97.7% or less, 97.8% or less, 97.9% or less, 98.0% or less, 98.1% or less, 98.2% or less, 98.3% or less, 98.4% or less, 98.5% or less, 98. Encapsulating, comprising, consisting of, consisting essentially of, or having 6% or less, 98.7% or less, 98.8% or less, 98.9% or less, 99.0% or less, 99.1% or less, 99.2% or less, 99.3% or less, 99.4% or less, 99.5% or less, 99.6% or less, 99.7% or less, 99.8% or less, 99.9% or less, or 100% or less RNA. In some embodiments, the LNP is 85% to 86.0%, 86.1%, 86.2%, 86.3%, 86.4%, 86.5%, 86.6%, 86.7%, 86.8%, 86.9%, 87.0%, 87.1%, 87.2%, 87.3%, 87.4%, 87.5%, 87.6%, 87.7%, 87.8%, 87.9%, 88.0%, 88.1%, 88.2%, 88.3%, 88.4%, 88.5%, 88.6%, 88.7%, 88.8%, 88.9%, 89.0%, 89.1%, 89.2%, 89.3%, 89.4%, 89.5%, 89.6%, 89.7%, 89.8%, 89.9%, 90.0%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91.0%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 91.10%, 91.11%, 91.12%, 91.13%, 91.14%, 91.15%, 91.16%, 91.17%, 91.18%, 91.19 ... 1.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1% .1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 9 9.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 86% to 87.0%, 87.1%, 87.2%, 87.3%, 87.4%, 87.5%, 87.6%, 87.7%, 87.8% ,87.9%,88.0%,88.1%,88.2%,88.3%,88.4%,88.5%,88.6%,88.7%,88.8%,88.9%,89.0%,89.1%,89.2%,89.3%,89.4%,89.5%,89.6%,89.7%,89.8%,89.9 %, 90.0%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91.0%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92. 0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 9 4.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2% , 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 87% to 88.0%, 88.1%, 88.2%, 88.3%, 88.4%, 88.5%, 88.6%, 88.7%, 88.8%, 88.9%, 89.0%, 89.1%, 89.2%, 89.3%, 89.4%, 89.5%, 89.6%, 89.7%, 89.8%, 89.9%, 90.0%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9 ... 0.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91.0%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3 %, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0%, 96.1%, 96.2%, 96.3%, 96. 4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 9 8.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 88% to 89.0%, 89.1%, 89.2%, 89.3% ,89.4%,89.5%,89.6%,89.7%,89.8%,89.9%,90.0%,90.1%,90.2%,90.3%,90.4%,90.5%,90.6%,90.7%,90.8%,90.9%,91.0%,91.1%,91.2%,91.3%,91.4 %, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 9 5.6%, 95.7%, 95.8%, 95.9%, 96.0%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7 %, 99.8%, 99.9%, or 100%; 89% to 90.0%, 90.1%, 90.2%, 90.3%, 90.4%, 90.5%, 90.6%, 90.7%, 90.8%, 90.9%, 91.0%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91 .6%, 91.7%, 91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7% ,95.8%,95.9%,96.0%,96.1%,96.2%,96.3%,96.4%,96.5%,96.6%,96.7%,96.8%,96.9%,97.0%,97.1%,97.2%,97.3%,97.4%,97.5%,97.6%,97.7%,97.8 %, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100%; 90% to 91.0%, 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, 91.6%, 91.7%, 91.8%, 91.9%, 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8% ,94.9%,95.0%,95.1%,95.2%,95.3%,95.4%,95.5%,95.6%,95.7%,95.8%,95.9%,96.0%,96.1%,96.2%,96.3%,96.4%,96.5%,96.6%,96.7%,96.8%,96.9 %, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99. 0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 91% to 92.0%, 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, 92.6%, 92.7%, 92.8%, 92.9%, 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9% ,95.0%,95.1%,95.2%,95.3%,95.4%,95.5%,95.6%,95.7%,95.8%,95.9%,96.0%,96.1%,96.2%,96.3%,96.4%,96.5%,96.6%,96.7%,96.8%,96.9%,97.0 %, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 92% to 93.0%, 93.1%, 93.2%, 93.3%, 93.4%, 93.5%, 93.6%, 93.7%, 93.8%, 93.9%, 94.0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0% ,96.1%,96.2%,96.3%,96.4%,96.5%,96.6%,96.7%,96.8%,96.9%,97.0%,97.1%,97.2%,97.3%,97.4%,97.5%,97.6%,97.7%,97.8%,97.9%,98.0%,98.1 %, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 93% to 94 .0%, 94.1%, 94.2%, 94.3%, 94.4%, 94.5%, 94.6%, 94.7%, 94.8%, 94.9%, 95.0%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0%, 9 6.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 94% to 95.0 %, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96.0%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 95% to 96.0%, 96.1%, 96.2%, 96.3%, 96.4 %, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%,. or 100%; 96% to 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99. 9% or 100%; 97.0% to 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 97.5% to 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98 .6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; 98.0% to 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99. 8%, 99.9%, or 100%; 98.5% to 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100%; or 99.0% to 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% SAM RNA or AAM RNA. In this regard, the percentage refers to the number of RNA molecules encapsulated or contained within the LNP compared to the total number of RNA molecules in the composition, and not to the percentage of the length of any one RNA molecule that is inside and outside the LNP.Combinations of the above percentages of "at least" and "less than or equal to" with the encapsulation percentages provided in the Examples section of this document are also contemplated and supported. Combinations of the encapsulation percentages of this document to provide a range (i.e., LNP encapsulates, comprises, consists of, consists essentially of, or has [the encapsulation percentage of LNP formulation X1 in the Examples] to [the encapsulation percentage of LNP formulation X2 in the Examples] (where X1 and X2 represent any two exemplary LNP formulations in the Examples) are also contemplated and supported.

[0152] In some embodiments, 80% of the LNPs are at least 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm, 51 nm, 52 nm, 53 nm, 54 nm, 55 nm, 56 nm, 57 nm, 58 nm, 59 nm, 60 nm, 61 nm, 62 nm, 63 nm, 64 nm, 65 nm, 66 nm, 67 nm, 68 nm, 69 nm, 70 nm, 71 nm, 72 nm, 73 nm, 74 nm, 75 nm, 76 nm, 77 nm, 78 nm, 79 nm, 80 nm, 81 nm, 82 nm, 83 nm, 84 nm, 85 nm, 86 nm, 87 nm, 88 nm, 89 nm, 90 nm, 91 nm, 92 nm, 93 nm, 94 nm, 95 nm, 96 nm, 97 nm, 98 nm, 99 nm, 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm, 107 nm, 108 nm, 109 nm, 110 nm, 111 nm, 112 nm, 113 nm, 114 nm, 115 nm 5nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77n m, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 9 0nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 1 02nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112n m, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133 nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm , 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 15 4nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164n m, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 1 75nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185 nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm,It has a diameter of 196 nm, 197 nm, 198 nm, 199 nm, 200 nm, 201 nm, 202 nm, 203 nm, 204 nm, 205 nm, 206 nm, 207 nm, 208 nm, 209 nm, 210 nm, 211 nm, 212 nm, 213 nm, 214 nm, 215 nm, 216 nm, 217 nm, 218 nm, 219 nm, or 220 nm. In some embodiments, 80% of the LNPs are 20 nm or less, 21 nm or less, 22 nm or less, 23 nm or less, 24 nm or less, 25 nm or less, 26 nm or less, 27 nm or less, 28 nm or less, 29 nm or less, 30 nm or less, 31 nm or less, 32 nm or less, 33 nm or less, 34 nm or less, 35 nm or less, 36 nm or less, 37 nm or less, 38 nm or less, 39 nm or less, 40 nm or less, 41 nm or less, 42 nm or less, 43 nm or less, 44 nm or less, 45 nm or less, 46 nm or less, 47 nm or less, 48 nm or less, 49 nm or less, 50 nm or less, 51 nm or less, 52 nm or less, 53 nm or less, 54 nm or less, 55 nm or less, 56 nm or less, 57 nm or less, 58 nm or less, 59 nm or less, 60 nm or less, 61 nm or less, 62 nm or less, 63 nm or less, 64 nm or less, 65 nm or less, 66 nm or less, 67 nm or less, 68 nm or less, 69 nm or less, 70 nm or less, 71 nm or less, 72 nm or less, 73 nm or less, 74 nm or less, 75 nm or less, 76 nm or less, 77 nm or less, 78 nm or less, 79 nm or less, 80 nm or less, 81 nm or less, 82 nm or less, 83 nm or less, 84 nm or less, 85 nm or less, 86 nm or less, 87 nm or less, 88 nm or less, 89 nm or less, 9o nm or less, 91 nm or less, 92 nm or less, 93 nm or less, 94 nm or less, 95 nm or less, 96 nm or less, 97 nm or less, 98 nm or less, 99 nm or less, 100 nm or less, 101 nm or less, 102 nm or less, 103 nm or less, 104 nm or less, 105 nm or less, 106 nm or less, 107 nm or less, 108 nm or less, 109 nm or less, 110 nm or less, 111 nm or less, 112 nm or less, 113 nm or less, 114 nm or less, 115 nm or less, 116 nm or less, 117 nm or less, 118 nm or less, 119 nm or less, 120 nm or less, 121 nm or less, 122 nm or less, 123 nm or less, 124 nm or less, 125 nm or less, 126 nm or less, 127 nm or less, 128 nm or less, 129 nm or less, 130 nm or less, 131 nm or less,132nm or less, 133nm or less, 134nm or less, 135nm or less, 136nm or less, 137nm or less, 138nm or less, 139nm or less, 140nm or less, 141nm or less, 142nm or less, 14 3nm or less, 144nm or less, 145nm or less, 146nm or less, 147nm or less, 148nm or less, 149nm or less, 150nm or less, 151nm or less, 152nm or less, 153nm or less, 154n m or less, 155nm or less, 156nm or less, 157nm or less, 158nm or less, 159nm or less, 160nm or less, 161nm or less, 162nm or less, 163nm or less, 164nm or less, 165nm or less Bottom, 166 nm or less, 167 nm or less, 168 nm or less, 169 nm or less, 170 nm or less, 171 nm or less, 172 nm or less, 173 nm or less, 174 nm or less, 175 nm or less, 176 nm or less, 177nm or less, 178nm or less, 179nm or less, 180nm or less, 181nm or less, 182nm or less, 183nm or less, 184nm or less, 185nm or less, 186nm or less, 187nm or less, 18 8nm or less, 189nm or less, 190nm or less, 191nm or less, 192nm or less, 193nm or less, 194nm or less, 195nm or less, 196nm or less, 197nm or less, 198nm or less, 199n 200 nm or less, 201 nm or less, 202 nm or less, 203 nm or less, 204 nm or less, 205 nm or less, 206 nm or less, 207 nm or less, 208 nm or less, 209 nm or less, 210 nm or less, 211 nm or less, 212 nm or less, 213 nm or less, 214 nm or less, 215 nm or less, 216 nm or less, 217 nm or less, 218 nm or less, 219 nm or less, or 220 nm or less.

[0153] In some embodiments, the LNPs are at least 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm, 51 nm, 52 nm, 53 nm, 54 nm, 55 nm, 56 nm, 57 nm, 58 nm, 59 nm, 60 nm, 61 nm, 62 nm, 63 nm, 64 nm, 65 nm , 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 7 8nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90n m, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102 nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 12 3nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133n m, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154 nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm , 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 1 75nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185 nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm,It has a diameter of 196 nm, 197 nm, 198 nm, 199 nm, 200 nm, 201 nm, 202 nm, 203 nm, 204 nm, 205 nm, 206 nm, 207 nm, 208 nm, 209 nm, 210 nm, 211 nm, 212 nm, 213 nm, 214 nm, 215 nm, 216 nm, 217 nm, 218 nm, 219 nm, or 220 nm. In some embodiments, the LNP is 20 nm or less, 21 nm or less, 22 nm or less, 23 nm or less, 24 nm or less, 25 nm or less, 26 nm or less, 27 nm or less, 28 nm or less, 29 nm or less, 30 nm or less, 31 nm or less, 32 nm or less, 33 nm or less, 34 nm or less, 35 nm or less, 36 nm or less, 37 nm or less, 38 nm or less, 39 nm or less, 40 nm or less, 41 nm or less, 42 nm or less, 43 nm or less, 44 nm or less, 45 nm or less, 46 nm or less, 47 nm or less, 48 nm or less, 49 nm or less, 50 nm or less, 51 nm or less, 52 nm or less, 53 nm or less, 54 nm or less, 55 nm or less, 56 nm or less, 57 nm or less, 58 nm or less, 59 nm or less, 60 nm or less, 61 nm or less, 62 nm or less, 63 nm or less, 64 nm or less, 65 nm or less, 66 nm or less, 67 nm or less, 68 nm or less, 69 nm or less, 70 nm or less, 71 nm or less, 72 nm or less, 73 nm or less, 74 nm or less, 75 nm or less, 76 nm or less, 77 nm or less, 78 nm or less, 79 nm or less, 80 nm or less, 81 nm or less, 82 nm or less, 83 nm or less, 84 nm or less, 85 nm or less, 86 nm or less, 87 nm or less, 88 nm or less, 89 nm or less, 90 nm or less, 91 nm or less, 92 nm or less, 93 nm or less, 94 nm or less, 95 nm or less, 96 nm or less, 97 nm or less, 98 nm or less, 99 nm or less, 100 nm or less, 101 nm or less, 102 nm or less, 103 nm or less, 104 nm or less, 105 nm or less, 106 nm or less, 107 nm or less, 108 nm or less, 109 nm or less, 110 nm or less, 111 nm or less, 112 nm or less, 113 nm or less, 114 nm or less, 115 nm or less, 116 nm or less, 117 nm or less, 118 nm or less, 119 nm or less, 120 nm or less, 121 nm or less, 122 nm or less, 123 nm or less, 124 nm or less, 125 nm or less, 126 nm or less, 127 nm or less, 128 nm or less, 129 nm or less, 130 nm or less, 131 nm or less, 132 nm or less,133nm or less, 134nm or less, 135nm or less, 136nm or less, 137nm or less, 138nm or less, 139nm or less, 140nm or less, 141nm or less, 142nm or less, 143nm or less, 1 44nm or less, 145nm or less, 146nm or less, 147nm or less, 148nm or less, 149nm or less, 150nm or less, 151nm or less, 152nm or less, 153nm or less, 154nm or less, 15 5nm or less, 156nm or less, 157nm or less, 158nm or less, 159nm or less, 160nm or less, 161nm or less, 162nm or less, 163nm or less, 164nm or less, 165nm or less, 166 nm or less, 167nm or less, 168nm or less, 169nm or less, 170nm or less, 171nm or less, 172nm or less, 173nm or less, 174nm or less, 175nm or less, 176nm or less, 177n m or less, 178nm or less, 179nm or less, 180nm or less, 181nm or less, 182nm or less, 183nm or less, 184nm or less, 185nm or less, 186nm or less, 187nm or less, 188nm Below, 189nm or less, 190nm or less, 191nm or less, 192nm or less, 193nm or less, 194nm or less, 195nm or less, 196nm or less, 197nm or less, 198nm or less, 199nm or less or less, 200 nm or less, 201 nm or less, 202 nm or less, 203 nm or less, 204 nm or less, 205 nm or less, 206 nm or less, 207 nm or less, 208 nm or less, 209 nm or less, 210 nm or less, 211 nm or less, 212 nm or less, 213 nm or less, 214 nm or less, 215 nm or less, 216 nm or less, 217 nm or less, 218 nm or less, 219 nm or less, or 220 nm or less.

[0154] In some embodiments, 80% of the LNPs are between 20 nm and 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm, 51 nm, 52 nm, 53 nm, 54 nm, 55 nm, 56 nm, 57 nm, 58 nm, 59 nm, 60 nm, 61 nm, 62 nm, 63 nm, 64 nm, 65 nm, 66 nm, 67 nm, 68 nm, 69 nm, 70 nm, 71 nm, 72 nm, 73 nm, 74 nm, 75 nm, 76 nm, 77 nm, 78 nm, 79 nm, 80 nm, 81 nm, 82 nm, 83 nm, 84 nm, 85 nm, 86 nm, 87 nm, 88 nm, 89 nm, 90 nm, 91 nm, 92 nm, 93 nm, 94 nm, 95 nm, 96 nm, 97 nm, 98 nm, 99 nm, 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm, 107 nm, 108 nm, 109 nm, 110 nm, 111 nm, 112 nm, 113 nm, 114 nm, 115 nm, 6nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78n m, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 9 1nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113 nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm , 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 13 4nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144n m, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 1 55nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165 nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186 nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm,197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 25nm to 26nm, 27nm, 28nm, 29nm, 30nm, 31nm, 32nm, 33nm, 34nm, 35nm, 36nm, 37nm, 38nm, 39nm, 40nm, 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 5nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57n m, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82 nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 1 06nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116 nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm , 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 13 7nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147n m, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 1 58nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168 nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm,179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 30nm~31nm, 32nm, 33nm, 34nm, 35nm, 36nm, 37nm, 38nm, 39nm, 40nm, 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm , 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102n m, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123 nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm , 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 1 44nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154 nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm,165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm , 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm , 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;35nm~36nm、37nm、38nm、39nm、40nm、41nm、42nm、43nm、44nm、45nm、46nm、47nm、48nm、49nm、50nm、51nm、52nm、53nm、54nm、55nm、56nm、57nm、58nm、59nm、60nm、61nm、62nm、63nm、64nm、65nm、66nm、67nm、68nm、69nm、70nm、71nm、72nm、73nm、74nm、75nm、76nm、77nm、78nm、79nm、80nm、81nm、82nm、83nm、84nm、85nm、86nm、87nm、88nm、89nm、90nm、91nm、92nm、93nm、94nm、95nm、96nm、97nm、98nm、99nm、100nm、101nm、102nm、103nm、104nm、105nm、106nm、107nm、108nm、109nm、110nm、111nm、112nm、113nm、114nm、115nm、116nm、117nm、118nm、119nm、120nm、121nm、122nm、123nm、124nm、125nm、126nm、127nm、128nm、129nm、130nm、131nm、132nm、133nm、134nm、135nm、136nm、137nm、138nm、139nm、140nm、141nm、142nm、143nm、144nm、145nm、146nm、147nm、148nm、149nm、150nm、151nm、152nm、153nm、154nm、155nm、156nm、157nm、158nm、159nm、160nm、161nm、162nm、163nm、164nm、165nm、166nm、167nm、168nm、169nm、170nm、171nm、172nm、173nm、174nm、175nm、176nm、177nm、178nm、179nm、180nm、181nm、182nm、183nm、184nm、185nm、186nm、187nm、188nm、189nm、190nm、191nm、192nm、193nm、194nm、195nm、196nm、197nm、198nm、199nm、200nm、201nm、202nm、203nm、204nm、205nm、206nm、207nm、208nm、209nm、210nm、211nm、212nm、213nm、214nm、215nm、216nm、217nm、218nm、219nm、 or 220nm; 40nm to 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 10 0nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm , 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 1 21nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131n m, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152 nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm , 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 17 3nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183n m, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 1 94nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204 nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm,215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 45nm to 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm , 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 9 9nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm , 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 1 20nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130n m, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151 nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm , 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 17 2nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182n m, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 1 93nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203 nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm,214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 50nm to 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm m, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102 nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 12 3nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm , 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 1 44nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154 nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm , 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 17 5nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185n m, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 1 96nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206 nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm,217nm, 218nm, 219nm, or 220nm; 55nm to 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 9 9nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109n m, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 1 20nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130 nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 15 1nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161n m, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182 nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm , 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 20 3nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213n m, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 60nm~61nm, 62nm,63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75 nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 10 0nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm , 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 1 21nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131n m, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152 nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm , 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 17 3nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183n m, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 1 94nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 65nm to 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm,82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94 nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm , 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 1 16nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126n m, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147 nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm , 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 16 8nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178n m, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 1 89nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199 nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 70nm to 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm,105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 11 5nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125n m, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146 nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm , 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 16 7nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177n m, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 1 88nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm m, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 1 07nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117 nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm,128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 13 8nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148n m, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169 nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm , 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 19 0nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200n m, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 2 11nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 80nm to 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 11 4nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124n m, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 1 35nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145 nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm,156nm、157nm、158nm、159nm、160nm、161nm、162nm、163nm、164nm、165nm、166nm、167nm、168nm、169nm、170nm、171nm、172nm、173nm、174nm、175nm、176nm、177nm、178nm、179nm、180nm、181nm、182nm、183nm、184nm、185nm、186nm、187nm、188nm、189nm、190nm、191nm、192nm、193nm、194nm、195nm、196nm、197nm、198nm、199nm、200nm、201nm、202nm、203nm、204nm、205nm、206nm、207nm、208nm、209nm、210nm、211nm、212nm、213nm、214nm、215nm、216nm、217nm、218nm、219nm、 or 220nm; or 85nm to 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm , 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 1 54nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 17 1nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188 nm, 189 nm, 190 nm, 191 nm, 192 nm, 193 nm, 194 nm, 195 nm, 196 nm, 197 nm, 198 nm, 199 nm, 200 nm, 201 nm, 202 nm, 203 nm, 204 nm, 205 nm, 206 nm, 207 nm, 208 nm, 209 nm, 210 nm, 211 nm, 212 nm, 213 nm, 214 nm, 215 nm, 216 nm, 217 nm, 218 nm, 219 nm, or 220 nm in diameter.

[0155] In some embodiments, the LNPs are sized to be between 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, 50 nm, 51 nm, 52 nm, 53 nm, 54 nm, 55 nm, 56 nm, 57 nm, 58 nm, 59 nm, 60 nm, 61 nm, 62 nm, 63 nm, 64 nm, 65 nm, 66 nm , 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 7 9nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91n m, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 10 3nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm , 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 1 24nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134 nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm , 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 15 5nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165n m, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 1 76nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186 nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm,197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 25nm to 26nm, 27nm, 28nm, 29nm, 30nm, 31nm, 32nm, 33nm, 34nm, 35nm, 36nm, 37nm, 38nm, 39nm, 40nm, 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 5nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57n m, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82 nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 1 06nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116 nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm , 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 13 7nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147n m, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 1 58nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168 nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm,179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 30nm~31nm, 32nm, 33nm, 34nm, 35nm, 36nm, 37nm, 38nm, 39nm, 40nm, 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm , 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102n m, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123 nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm , 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 1 44nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154 nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm,165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 17 5nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm , 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 1 96nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206n m, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm; 35nm~36nm, 37nm, 38nm, 39nm, 40nm, 41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48nm, 49nm, 50nm, 51nm, 52nm, 53nm, 54 nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79 nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103n m, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 1 14nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124 nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145 nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm,156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 16 6nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm , 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 1 87nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197n m, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218 nm, 219nm, or 220nm; 40nm~41nm, 42nm, 43nm, 44nm, 45nm, 46nm, 47nm, 48n m, 49nm, 50nm, 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 6 1nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73n m, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 8 6nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98n m, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 10 9nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119n m, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 1 30nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140 nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm,151nm、152nm、153nm、154nm、155nm、156nm、157nm、158nm、159nm、160nm、161nm、162nm、163nm、164nm、165nm、166nm、167nm、168nm、169nm、170nm、171nm、172nm、173nm、174nm、175nm、176nm、177nm、178nm、179nm、180nm、181nm、182nm、183nm、184nm、185nm、186nm、187nm、188nm、189nm、190nm、191nm、192nm、193nm、194nm、195nm、196nm、197nm、198nm、199nm、200nm、201nm、202nm、203nm、204nm、205nm、206nm、207nm、208nm、209nm、210nm、211nm、212nm、213nm、214nm、215nm、216nm、217nm、218nm、219nm、 or 220 nm;45nm~46nm、47nm、48nm、49nm、50nm、51nm、52nm、53nm、54nm、55nm、56nm、57nm、58nm、59nm、60nm、61nm、62nm、63nm、64nm、65nm、66nm、67nm、68nm、69nm、70nm、71nm、72nm、73nm、74nm、75nm、76nm、77nm、78nm、79nm、80nm、81nm、82nm、83nm、84nm、85nm、86nm、87nm、88nm、89nm、90nm、91nm、92nm、93nm、94nm、95nm、96nm、97nm、98nm、99nm、100nm、101nm、102nm、103nm、104nm、105nm、106nm、107nm、108nm、109nm、110nm、111nm、112nm、113nm、114nm、115nm、116nm、117nm、118nm、119nm、120nm、121nm、122nm、123nm、124nm、125nm、126nm、127nm、128nm、129nm、130nm、131nm、132nm、133nm、134nm、135nm、136nm、137nm、138nm、139nm、140nm、141nm、142nm、143nm、144nm、145nm、146nm、147nm、148nm、149nm、150nm、151nm、152nm、153nm、154nm、155nm、156nm、157nm、158nm、159nm、160nm、161nm、162nm、163nm、164nm、165nm、166nm、167nm、168nm、169nm、170nm、171nm、172nm、173nm、174nm、175nm、176nm、177nm、178nm、179nm、180nm、181nm、182nm、183nm、184nm、185nm、186nm、187nm、188nm、189nm、190nm、191nm、192nm、193nm、194nm、195nm、196nm、197nm、198nm、199nm、200nm、201nm、202nm、203nm、204nm、205nm、206nm、207nm、208nm、209nm、210nm、211nm、212nm、213nm、214nm、215nm、216nm、217nm、218nm、219nm、;or 220nm; 50nm to 51nm, 52nm, 53nm, 54nm, 55nm, 56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 1 08nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118 nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm , 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 1 39nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 14 9nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159n m, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 18 0nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;55nm~56nm, 57nm, 58nm, 59nm, 60nm, 61nm, 62nm, 63nm, 64nm, 65nm, 66nm , 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm , 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90n m, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 1 02nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm , 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm , 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm , 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm , 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;60nm~61nm, 62nm, 63nm, 64nm, 65nm, 66nm, 67nm, 68nm, 69nm, 70nm, 71n m, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 8 3nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm , 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 10 5nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124n m, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 13 4nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 1 44nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm , 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163 nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm , 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;65nm~66nm, 67nm, 68nm, 69nm, 70nm, 71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87n m, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108 nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 12 7nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 1 46nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm , 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;70nm~71nm, 72nm, 73nm, 74nm, 75nm, 76nm, 77nm, 78nm, 79nm, 80nm, 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111n m, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 14 8nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166n m, 167nm, 168nm, 169nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;75nm~75nm、76nm、77nm、78nm、79nm、80nm、81nm、82nm、83nm、84nm、85nm、86nm、87nm、88nm、89nm、90nm、91nm、92nm、93nm、94nm、95nm、96nm、97nm、98nm、99nm、100nm、101nm、102nm、103nm、104nm、105nm、106nm、107nm、108nm、109nm、110nm、111nm、112nm、113nm、114nm、115nm、116nm、117nm、118nm、119nm、120nm、121nm、122nm、123nm、124nm、125nm、126nm、127nm、128nm、129nm、130nm、131nm、132nm、133nm、134nm、135nm、136nm、137nm、138nm、139nm、140nm、141nm、142nm、143nm、144nm、145nm、146nm、147nm、148nm、149nm、150nm、151nm、152nm、153nm、154nm、155nm、156nm、157nm、158nm、159nm、160nm、161nm、162nm、163nm、164nm、165nm、166nm、167nm、168nm、169nm、170nm、171nm、172nm、173nm、174nm、175nm、176nm、177nm、178nm、179nm、180nm、181nm、182nm、183nm、184nm、185nm、186nm、187nm、188nm、189nm、190nm、191nm、192nm、193nm、194nm、195nm、196nm、197nm、198nm、199nm、200nm、201nm、202nm、203nm、204nm、205nm、206nm、207nm、208nm、209nm、210nm、211nm、212nm、213nm、214nm、215nm、216nm、217nm、218nm、219nm、; or 220nm; 80nm to 81nm, 82nm, 83nm, 84nm, 85nm, 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm m, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 1 34nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151n m, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 1 69nm, 170nm, 171nm, 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186n m, 187nm, 188nm, 189nm, 190nm, 191nm, 192nm, 193nm, 194nm, 195nm, 196nm, 197nm, 198nm, 199nm, 200nm, 201nm, 202nm, 203nm, 204nm, 205nm, 206nm, 207nm, 208nm, 209nm, 210nm, 211nm, 212nm, 213nm, 214nm, 215nm, 216nm, 217nm, 218nm, 219nm, or 220nm;or 85nm to 86nm, 87nm, 88nm, 89nm, 90nm, 91nm, 92nm, 93nm, 94nm, 95nm, 96nm, 97nm, 98nm, 99nm, 100nm, 101nm, 102nm, 103nm, 104nm, 105nm, 106nm, 107nm, 108nm, 109nm, 110nm, 111nm, 112nm, 113nm, 114nm, 115nm, 116nm, 117nm, 118nm, 119nm, 120nm, 121nm, 122nm, 123nm, 124nm, 125nm, 126nm, 127nm, 128nm, 129nm, 130nm, 131nm, 132nm, 133nm, 134nm, 135nm, 136nm, 137nm, 138nm, 139nm, 140nm, 141nm, 142nm, 143nm, 144nm, 145nm, 146nm, 147nm, 148nm, 149nm, 150nm, 151nm, 152nm, 153nm, 154nm, 155nm, 156nm, 157nm, 158nm, 159nm, 160nm, 161nm, 162nm, 163nm, 164nm, 165nm, 166nm, 167nm, 168nm, 169nm, 170nm, 171nm , 172nm, 173nm, 174nm, 175nm, 176nm, 177nm, 178nm, 179nm, 180nm, 181nm, 182nm, 183nm, 184nm, 185nm, 186nm, 187nm, 188nm , 189 nm, 190 nm, 191 nm, 192 nm, 193 nm, 194 nm, 195 nm, 196 nm, 197 nm, 198 nm, 199 nm, 200 nm, 201 nm, 202 nm, 203 nm, 204 nm, 205 nm, 206 nm, 207 nm, 208 nm, 209 nm, 210 nm, 211 nm, 212 nm, 213 nm, 214 nm, 215 nm, 216 nm, 217 nm, 218 nm, 219 nm, or 220 nm;

[0156] In consideration of the above embodiments, it is contemplated and supported that any of the above "diameter of less than" and "diameter of at least" can be combined to provide an encompassing range (i.e., 80% of the LNPs have a diameter of 50 nm to 80 nm). Combinations of the above "diameter of less than" or "diameter of at least" with the diameters of the LNP formulations provided in the Examples section of this document are also contemplated and supported. Combinations of diameters in the LNP formulations section of this document to provide a range (i.e., cation-ionized lipids having a diameter ranging from [the diameter of LNP formulation X1 in the Examples] to [LNP formulation X2 in the Examples] (where X1 and X2 represent any two exemplary LNP formulations in the Examples)) are also contemplated and supported.

[0157] In some embodiments, the LNPs have a pKa of at least 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or 10. In embodiments, the LNPs have a pKa of less than or equal to 10, 9.9, 9.8, 9.7, 9.6, 9.5, 9.4, 9.3, 9.2, 9.1, 9.0, 8.9, 8.8, 8.7, 8.6, 8.5, 8.4, 8.3, 8.2, 8.1, 8.0, 7.9, 7.8, 7.7, 7.6, 7.5, 7.4, 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, 5.5, 5.4, 5.3, 5.2, 5.1, or 5.0. In some embodiments, the LNP is selected from the group consisting of 5.0 to 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or 10; 5.1-5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6 , 9.7, 9.8, 9.9, or 10;5.3 to 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1,8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or 10; 5.4-5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5 , 9.6, 9.7, 9.8, 9.9, or 10; 5.5 to 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or 10; 5.6 to 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6...

Claims

1. A self-amplifying messenger (SAM) ribonucleic acid (RNA) comprising N1-methylpseudouridine, uridine, a first RNA segment, and a second RNA segment, wherein the first RNA segment comprises a heterologous nucleic acid, and the second RNA segment encodes one or more proteins capable of replicating the SAM RNA in an intracellular environment, and the SAM RNA has a first molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine of from 15% to 75%.

2. 2. The SAM RNA of claim 1, wherein the first molar percentage is up to 70%.

3. 2. The SAM RNA of claim 1, wherein the first molar percentage is up to 65%.

4. 2. The SAM RNA of claim 1, wherein the first molar percentage is up to 60%.

5. 2. The SAM RNA of claim 1, wherein the first molar percentage is up to 55%.

6. 2. The SAM RNA of claim 1, wherein the first molar percentage is up to 50%.

7. 7. The SAM RNA of claim 1, wherein the first molar percentage is from 20%.

8. 7. The SAM RNA of claim 1, wherein the first molar percentage is from 25%.

9. The SAM RNA of any one of claims 1 to 6, wherein the one or more proteins capable of replicating the SAM RNA in an intracellular environment include alphavirus nonstructural protein-1 (nsP1), alphavirus nsP2, alphavirus nsP3, and alphavirus nsP4.

10. 7. The SAM RNA of claim 1, wherein the heterologous nucleic acid encodes a heterologous protein.

11. 11. The SAM RNA of claim 10, wherein the heterologous protein comprises an immunogen, an antibody, or an immunotherapeutic molecule.

12. The SAM RNA of claim 10, wherein the heterologous protein comprises an immunogen or an antibody against an immunogen.

13. 7. The SAM RNA of claim 1, further comprising a polyadenosine monophosphate (poly(A)) tail.

14. 7. The SAM RNA of claim 1, further comprising a 5' untranslated region (5'UTR), the 5'UTR being 5' to the first RNA segment and the second RNA segment.

15. 7. The SAM RNA of any one of claims 1 to 6, further comprising a 3' untranslated region (3'UTR), the 3'UTR being located 3' to the first RNA segment and the second RNA segment, and optionally 5' to the poly(A) tail.

16. 7. The SAM RNA of claim 1, further comprising a 5' cap.

17. 17. The SAM RNA of claim 16, wherein the 5' cap is cap-0, cap-1, or cap-2.

18. 17. The SAM RNA of claim 16, wherein the 5' cap is cap-1.

19. 17. The SAM RNA of claim 16, wherein the 5' cap is cap-0.

20. A composition comprising the SAM RNA of any one of claims 1 to 6 and a pharmaceutically acceptable delivery vehicle.

21. 21. The composition of claim 20, wherein the pharmaceutically acceptable delivery vehicle comprises a lipid nanoparticle (LNP).

22. 22. The composition of claim 21, wherein the LNPs encapsulate SAM RNA.

23. 21. A method of inducing an immune response to an immunogen in a subject, comprising administering to the subject an effective amount of the composition of claim 20.

24. 24. The method of claim 23, wherein the immune response is a protective immune response.

25. 24. The method of claim 23, wherein the immune response is a therapeutic immune response.

26. 24. The method of claim 23, wherein the immunogen comprises a venom, a poison, an allergen, a cancer antigen, a bacterial antigen, a viral antigen, a fungal antigen, a parasitic antigen, or a fragment thereof.

27. 24. The method of claim 23, wherein the heterologous protein comprises an antibody against an immunogen.

28. 24. The method of claim 23, wherein the heterologous protein comprises an immunogen.

29. 24. The method of claim 23, wherein the subject is a human.

30. 7. A method for producing the SAM RNA of claim 1, comprising: mixing an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, wherein the mixture has a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, and the mixing step is under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid.

31. 17. A method for producing the SAM RNA of claim 16, comprising: a first mixing step of an RNA polymerase, N1-methylpseudouridine, uridine, and a template nucleic acid comprising a sequence of SAM RNA, thereby obtaining a mixture, the mixture having a second molar percentage of N1-methylpseudouridine relative to the sum of N1-methylpseudouridine and uridine, the second molar percentage being the same as the first molar percentage, the first mixing step being under conditions in which the RNA polymerase produces SAM RNA from the template nucleic acid, thereby obtaining uncapped SAM RNA; and a second mixing step of uncapped SAM RNA, messenger RNA guanylyltransferase, guanosine triphosphate, (guanine-N7-)-methyltransferase, and S-adenosyl-L-methionine under conditions that result in 5' to 5' triphosphate cap ligation, optionally further comprising a 2'-O-methyltransferase, and optionally under conditions that form cap-1 or cap-2; A method comprising:

32. 31. The method of claim 30, wherein the RNA polymerase is T7 RNA polymerase.

Images