miRNA Combinations for Cancer Treatment and Prevention
Patent Information
- Application Number
- JP2024542234
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-09-28
- Filing Date
- 2022-09-27
- Publication Date
- 2025-10-06
AI Technical Summary
Current treatments for glioblastoma, a deadly malignant brain tumor, have not significantly improved overall survival rates, and there is a need for new therapeutic strategies targeting specific miRNAs to enhance precision medicine.
A combination of miR-17, miR-340, and miR-222 mimics and antagomirs is used to inhibit tumor growth in glioblastoma, with optional inclusion of miR-221 and miR-551b, targeting multiple pathways to regulate gene expression and inhibit tumor progression.
The combination effectively inhibits glioblastoma tumor growth, viability, clonogenicity, and migration in various subtypes, demonstrating significant therapeutic potential in both in vitro and in vivo models.
Smart Images

Figure 00000026_0000 
Figure 00000026_0001 
Figure 00000027_0000
Abstract
Description
[Technical field]
[0001] The present invention relates to a combination of a miR-17 mimic and a miR-340 mimic for use in the prevention and / or treatment of cancer, in particular for use in the treatment of glioblastoma, in particular said combination additionally comprising a miR-222 AntagomiR. [Background technology]
[0002] Glioblastoma (GBM) is a grade IV astrocytoma, a lethal malignant brain tumor, and one of the most common primary brain tumors in adults. Today, surgery, radiation therapy, and chemotherapy with temozolomide remain the standard of care for patients with GBM (Stupp, et al. (2005). Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352: 987-996). However, the median overall survival of patients with GBM (approximately 14 months) has not changed dramatically over the last 15 years. Major efforts in large-scale genetic and transcriptomic profiling have allowed the characterization and stratification of GBM patients into four subtypes: Classical, Mesenchymal, Proneural, and Neural (recently deleted) (Verhaak, RG et al. (2010). Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17: 98-110.; Brennan, CW, et al. (2013). The somatic genomic landscape of glioblastoma. Cell 155: 462-477.; Freije, WAet al. (2004). Gene expression profiling of gliomas strongly predicts survival. Cancer Res 64: 6503-6510). Nevertheless, these big data analyses have yet to illuminate new therapeutic strategies and new drug target molecules to achieve advances in precision medicine.
[0003] miRNAs are small non-coding RNAs consisting of 20-22 bases that are involved in the post-translational regulation of gene expression through the process of RNA interference (Bartel, DP, et al. (2004). Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs. Nat Rev Genet 5: 396-400.; Lee, Y, et al. (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J 21: 4663-4670.; Tomari, Y, et al. (2005). MicroRNA biogenesis: drosha can't cut it without a partner. Curr Biol 15: R61-64). miRNA genes are transcribed by RNA polymerase II to form transcripts pri-miRNAs. These pri-miRNAs are processed by Drosha, a class 2 RNase III enzyme, to produce precursor products pre-miRNAs consisting of approximately 70 bases. Finally, the pre-miRNA is transported to the cytoplasm where it is processed to generate a mature miRNA of about 20 bases. This miRNA is incorporated into the RISC complex (an endoribonuclease of the RNaseIII family) and forms a double-stranded RNA when bound to a complementary target mRNA. As a result, the 5p and 3p strands are generated by cleavage of the loop end of the miRNA structure. 5p and 3p represent whether these miRNAs are derived from the 5' or 3' end of the hairpin structure of the pre-miRNA, respectively. Based on genetic and functional experiments, miRNA activity in humans is mainly due to the 5p strand. In fact, the 3p strand is much less abundant and is quickly removed in RISC.Depending on the complementarity of the miRNA to the target mRNA, the RISC complex inhibits the translation of the mRNA or causes mRNA degradation (Tomari, Y, et al. (2005). MicroRNA biogenesis: drosha can't cut it without a partner. Curr Biol 15: R61-64.; Zhang, H, et al. (2004). Single processing center models for human Dicer and bacterial RNase III. Cell 118: 57-68). Consistent with recent computational predictions, each miRNA has the potential to regulate approximately 200 target genes. Thus, miRNA-mediated gene regulation is now believed to have an important role in biological processes (Lewis, BP, et al.(2005). Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120: 15-20).
[0004] miRNAs are aberrantly expressed during tumorigenesis, and genes encoding miRNAs are frequently located at fragile sites in regions of gain and loss in mammalian cancers (Calin, GA, et al. (2004). Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci USA 101: 2999-3004).
[0005] Because miRNAs play critical roles in a variety of vital cellular processes, their use in personalized cancer therapy is highly attractive.
[0006] However, further research is clearly needed to identify new drivers of GBM pathogenesis and clinically and biologically relevant miRNAs for GBM therapeutic strategies. Summary of the Invention
[0007] The present inventors have identified miR-17 and miR-340 as clinically relevant miRNAs that can be used for multi-target therapeutic strategies in GBM. The inventors have discovered that ectopic expression of miR-17 and miR-340 inhibits tumor pathogenesis in vitro and in vivo.
[0008] The inventors also discovered that the combination of miR-17, miR-340 and miR-222 showed regular and significant inhibition of tumor growth in all subtypes of GBM in vitro and in vivo. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0009] Thus, the present invention relates to a combination of a miR-17 mimic and a miR-340 mimic for use in the prevention and / or treatment of cancer.
[0010] In particular, said combination additionally comprises miR-222 antagomir.
[0011] More particularly, said combination additionally comprises a miR-221 antagomir and / or a miR-551b mimic.
[0012] As used herein, the term "combination" refers to a composition comprising multiple components. The use of the term "combination" does not limit the relative contents of the various components of the composition, and the components may be included in equal molar ratios, equal weight ratios, or different molar or weight ratios.
[0013] So the combination of: A combination of miR-17 mimic and miR-340 mimic; A combination of miR-17 mimic, miR-340 mimic and miR-222 antagomir; A combination of miR-17 mimic, miR-340 mimic and miR-221 antagomir; A combination of miR-17 mimic, miR-340 mimic, miR-222 antagomir and miR-221 antagomir; a combination of miR-17 mimic, miR-340 mimic and miR-551b mimic; A combination of miR-17 mimic, miR-340 mimic, miR-222 antagomir and miR-551b mimic; A combination of miR-17 mimic, miR-340 mimic, miR-221 antagomir and miR-551b mimic; Combination of miR-17 mimic, miR-340 mimic, miR-222 antagomir, miR-221 antagomir and miR-551b mimic is within the scope of the present invention.
[0014] As mentioned above, miRNAs are small non-coding RNAs consisting of 20-22 bases, and are involved in the post-translational regulation of gene expression through the process of RNA interference.
[0015] As used herein, the terms "microRNA" or "miRNA" or "miR" are used interchangeably to refer to small non-coding RNAs that function in the translational and / or post-translational regulation of gene expression. In various embodiments, miRNAs have a hairpin structure that includes a duplex that is processed into a guide strand and a passenger strand.
[0016] The term "miR" as used herein includes any isoform of the miRNA and includes all members of the miRNA family. Thus, the term "miRNA" includes star-sequences and family members. In particular, the miRNA of the present invention is a human miRNA, i.e., hsa-miRNA.
[0017] The nomenclature of miRNAs remains inconsistent. However, alphabetic suffixes are used to name genes encoding sister mRNAs (e.g., miR-17a and miR-17b). And, when identical mature miRNAs are produced from multiple different loci, a numeric suffix is used at the end of the miRNA (e.g., miR-17a-1 and miR-17a-2). Two mature miRNAs may be produced at each locus, one from the 5' strand and the other from the 3' strand (e.g., miR-17a-3p and miR-17a-5p). Of note, one strand (called the guide strand) is usually more dominant and biologically active than the other (called the passenger strand).
[0018] The RNA sequences of the miRs of the present invention are publicly available, for example, at miRBase (https: / / www.mirbase.org / index.shtml).
[0019] In particular, miR-17 includes miR-17-3p, miR-17-5p, and miR-17-*, and more particularly includes miR-17-3p, and miR-17 has the following RNA sequence: -SEQ ID NO: 1 (miR-17): GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC; - SEQ ID NO:2 (miR-17-3p): ACUGCAGUGAAGGCACUUGUAG; -SEQ ID NO: 3 (miR-17-5p): CAAAGUGCUUACAGUGCAGGUAG Includes.
[0020] In particular, miR-340 includes miR-340-5p, miR-340-3p, and miR-340-*, and more particularly includes miR-340-5p, and miR-340 has the following RNA sequence: SEQ ID NO:4 (miR-340): UUGUACCUGGUGUGAUUAUAAAGCAAUGAGACUGAUUGUCAUAUGUCGUUUGUGGGAUCCGUCUCAGUUACUUUAUAGCCAUACCUGGUAUCUUA; SEQ ID NO:5 (miR-340-5p): UUAUAAAGCAAUGAGACUGAUU; SEQ ID NO:6 (miR-340-3p): UCCGUCUCAGUUACUUUAUAGC Includes.
[0021] In particular, miR-222 includes miR-222-5p, miR-222-3p, and miR-222-*. More specifically, miR-222 has the following RNA sequence: SEQ ID NO: 7 (miR-222): GCUGCUGGAAGGUGUAGGUACCCUCAAUGGCUCAGUAGCCAGUGUAGAUCCUGUCUUUCGUAAUCAGCAGCUACAUCUGGCUACUGGGUCUCUGAUGGCAUCUUCUAGCU; SEQ ID NO:8 (miR-222-5p): CUCAGUAGCCAGUGUAGAUCCU; SEQ ID NO: 9 (miR-222-3p): AGCUACAUCUGGCUACUGGGU Includes.
[0022] In particular, miR-221 includes miR-221-5p, miR-221-3p, and miR-221-*. More specifically, miR-221 has the following RNA sequence: SEQ ID NO: 10 (miR-221): UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUCGUUAGGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUACCUGGAAACAUGUUCUC; SEQ ID NO:11 (miR-221-5p):ACCUGGCAUACAAUGUAGAUUU; SEQ ID NO: 12 (miR-221-3p): AGCUACAUUGUCUGCUGGGUUUC Includes.
[0023] In particular, miR-551b includes miR-551b-5p, miR-551b-3p, and miR-551b-*. More specifically, miR-551b has the following RNA sequence: SEQ ID NO:13 (miR-551b): AGAUGUGCUCUCCUGGCCCAUGAAAUCAAGCGUGGGUGAGACCUGGUGCAGAACGGGAAGGCGACCCAUACUUGGUUUCAGAGGCUGUGAGAAUAA; SEQ ID NO:14 (miR-551b-5p): GAAAUCAAGCGUGGGUGAGACC; SEQ ID NO: 15 (miR-551b-3p): GCGACCCAUACUUGGUUUCAG Includes.
[0024] As previously described, overexpressed miRNAs have been reported to have "oncogenic" effects, whereas downregulated miRNAs have shown "tumor suppressive" effects. miRNA-specific alterations can be specifically targeted by using oligonucleotide sequences, designated "mimics" or "antagomirs," that induce upregulation or downregulation of the target miRNA, respectively. Thus, by identifying altered miRNAs in tumors, the inventors could develop targeted therapeutics for personalized medicine in cancer patients, especially GBM patients.
[0025] The inventors have now identified combinations of nucleic acids that act as mimics, and optionally also as antagomirs, for the prevention and / or treatment of cancer.
[0026] As used herein, "mimic" refers to a small, synthetic, double-stranded RNA molecule designed to mimic these miRNAs, and as described above, can cause the upregulation of target miRNAs. The mimic can enhance or replace the function of the miR in cells, and inhibit the expression of gene products whose expression is downregulated by the miRNA that the mimic mimics mimic. The technology of miRNA mimics belongs to the miRNA-gain-of-function strategy. This strategy is used to mimic endogenous miRNAs so that they can specifically bind to the target of the miRNA, thereby causing translation inhibition of the target gene.
[0027] Such molecules are known to those skilled in the art and are commercially available and may be purchased, for example, from companies such as Life technologies.
[0028] Examples may include DNA-based miRNA mimics, RNA-based miRNA mimics, polynucleotides encoding miRNAs or precursors thereof.
[0029] DNA-based miRNA mimics correspond to DNA oligonucleotides that contain a DNA version of the sequence of the mature miRNA or a functionally equivalent variant thereof.
[0030] An RNA-based miRNA mimic corresponds to an RNA-based mimic that is a double-stranded RNA in which the sequence of one strand comprises the sequence of a mature miRNA or the sequence of a functionally equivalent variant thereof.
[0031] In some embodiments, miRNA mimics are conjugated with one or more moieties that enhance the activity, intracellular distribution or intracellular uptake of antisense oligonucleotides.When miRNA mimics are DNA-based or RNA-based miRNA mimics, which comprise a single-stranded RNA polynucleotide stabilized by intrastrand base pairing, the moieties can be conjugated to the 5'-end or 3'-end.When miRNA is RNA-based and double-stranded, the moieties can be conjugated to the 5'-end of passenger strand, the 3'-end of guide strand, the 5'-end of guide strand and the 3'-end of guide strand.
[0032] As used herein, a "guide strand" refers to a single stranded nucleic acid molecule of an miRNA that has a sequence sufficiently complementary to that of a target mRNA to hybridize with the target mRNA (e.g., in the 5' untranslated region, coding region, or 3' untranslated region) and reduce or inhibit its translation. The passenger strand is also referred to as the "antisense strand."
[0033] As used herein, a "passenger strand" refers to an oligonucleotide strand of an miRNA that has a sequence complementary or substantially complementary to that of the guide strand. In certain embodiments, the passenger strand may target an mRNA by hybridizing to the target RNA (e.g., in the 5' untranslated region, the coding region, or the 3' untranslated region) and reduce or inhibit its translation. The passenger strand may also be referred to as the "sense strand."
[0034] In some such embodiments, the moiety is a cholesterol moiety or a lipid moiety. Additional moieties to be attached include carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dyes. In some embodiments, the attached group is directly attached to the oligonucleotide. In some embodiments, the attached group is attached to the oligonucleotide by a linker moiety selected from amino, hydroxy, carboxylic acid, thiol, unsaturated bond (e.g., double or triple bond), 8-amino-3,6-dioxaoctanoic acid (ADO), (N-maleimidomethyl)cyclohexane-1-carboxylic acid N-hydroxysuccinimide ester (SMCC), 6-aminohexanoic acid (AHEX or AHA), substituted CI-CIO alkyl, substituted or unsubstituted alkenyl with a 2-10 carbon backbone, and substituted or unsubstituted alkynyl with a 2-10 carbon backbone. In some such embodiments, the substituents are selected from hydroxy, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0035] In certain embodiments, the miRNA mimic is modified with a cap structure. This terminal modification can protect the oligonucleotide from exonucleolytic degradation and aid in intracellular transport and / or localization. The cap can be at the 5' end (5' cap) or 3' end (3' cap), or can be at both ends. Cap structures include, for example, inverted deoxy abasic caps. Suitable cap structures include 4',5'-methylene nucleotides, 1-(β-D-erythrofuranosyl) nucleotides, 4'-thio nucleotides, carbocyclic nucleotides, 4'-thio ... nucleotide), 1,5-anhydrohexitol nucleotide, L-nucleotide, α-nucleotide, base-modified nucleotide, thiophosphate bond, threopentofuranosyl nucleotide, acyclic 3',4'-seco-nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety, 3'-3'-inverted abasic moiety, 3'-T-inverted nucleotide moiety, 3'-T-inverted abasic moiety, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate , 3'-phosphorothioate, phosphorodithioate, bridged methylphosphonate moieties, and non-bridged methylphosphonate moieties, 5'-aminoalkyl phosphate, 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate, 6-aminohexyl phosphate, 1,2-aminododecyl phosphate, hydroxypropyl phosphate, 5'-5'-inverted nucleotide moieties, 5'-5'-inverted abasic moieties, 5'-phosphoramidate, 5'-phosphorothioate, 5'-amino, bridged 5'-phosphoramidate and / or non-bridged 5'-phosphoramidate, phosphorothioate, and 5'-mercapto moieties.
[0036] In a preferred embodiment, the mimic that forms part of the composition of the present invention mimics human miRNA.Human miRNA molecules are miRNA molecules found in human cells, tissues or organs.Human miRNA molecules may be miRNA that are derived from endogenous human miRNA molecules by nucleotide substitution, deletion and / or addition.
[0037] "Antagomirs" as used in the present invention for miR-222 antagomir and miR-221 antagomir refer to small, synthetic, single-stranded RNA molecules designed to specifically bind to and inhibit the function of these miRNAs, and as described above, can cause downregulation of target miRNAs. Antagomir represents an antisense inhibition of miRNA approach. By binding to target miRNAs, antagomir inhibits the function of target miRNAs. Chemical modifications can be used to improve the stability, efficacy and performance of antagomir.
[0038] Such molecules are known to those skilled in the art and are commercially available and purchased, for example, from companies such as Life technologies.
[0039] Antagomir may be a chemically synthesized cholesterol-conjugated single-stranded RNA analogue that is an efficient and specific silencer of endogenous microRNA in vitro and in vivo. Inhibition of miRNA may be achieved by antisense 2'-O-methyl (2'-OMe) oligoribonucleotides or by using antagomir expressed by lentivirus or adenovirus. In addition, MOE (2'-O methoxyethyl phosphorothioate) or LNA (locked nucleic acid (LNA) phosphorothioate chemistry) modifications of single-stranded RNA analogues may be used to inhibit miRNA activity.
[0040] In addition, endogenous miRNAs may be silenced using miRNA sponges. In this case, a single RNA is assembled that contains multiple tandem binding sites for the miRNA seed sequence family of interest. A potential advantage of this approach is that different members of the miRNA seed sequence family can be targeted, thus more effectively affecting diseases universally controlled by this family. In principle, it is possible to interfere with the function of miRNAs by removing them and thereby preventing their binding to the target mRNA.
[0041] Binding of miRNAs to specific target mRNAs can be prevented using oligonucleotides that are perfectly complementary to the miRNA target sequence in the 3' untranslated region of the mRNA, thereby masking the binding site and preventing interaction with the miRNA. A further approach to inhibiting miRNA function can be achieved by "erasers," a technique that inhibits endogenous miRNA function by expression of tandem repeats of sequences perfectly complementary to the target miRNA. Finally, substances, molecules, and drugs can be used to inhibit the expression and biogenesis of miRNAs.
[0042] Synthetic RNA duplex miRNA, one strand of which is identical to the native miRNA, can be used to increase the effective concentration of the reduced miRNA by providing a single-stranded oligonucleotide equivalent to the mature miRNA. In this case, a short double-stranded oligonucleotide is designed in which one strand (the guide strand) is the sequence of the mature miRNA and a complementary or partially complementary strand (the passenger strand) is conjugated to the sequence of the mature miRNA. Finally, substances, molecules, and drugs can be used to increase the expression and biogenesis of miRNA.
[0043] In a preferred embodiment, the antagomir forming part of the composition of the invention targets a human miRNA.
[0044] The terms "treat", "treating", "treated" or "treatment" as used in the context of the present invention refer to therapeutic procedures aimed at eliminating or alleviating symptoms. Beneficial or desired clinical results include, but are not limited to, elimination of symptoms, alleviation of symptoms, reduction in the severity of a disease condition, stabilization of a disease condition (i.e., not worsening), or delay or slowing of the progression of a disease condition.
[0045] The terms "prevent", "prevention", "preventing" or "prevented" as used in the context of the present invention refer to the prevention of the occurrence, recurrence or spread of a disease or disorder or one or more of its symptoms. In certain embodiments, the terms refer to the treatment or administration of the compositions provided herein to a patient at risk of a disease or condition, particularly as described herein, prior to the onset of symptoms. The terms include suppressing or attenuating symptoms of a particular disease. Subjects with a family history of a disease are particularly candidates for a preventative regimen in certain embodiments. In addition, subjects with a personal history of recurrent symptoms are also potential candidates for prevention. In this regard, the term "prevention" may be used interchangeably with the term "prophylactic treatment".
[0046] As used herein, and unless otherwise specified, "cancer" refers to abnormal cell growth, division or proliferation in the body. The term refers to any type of malignant (i.e., non-benign) tumor. A malignant tumor may correspond to a primary tumor or a secondary tumor (i.e., metastasis). Furthermore, the tumor may correspond to a cancer selected from brain tumor, medulloblastoma, retinoblastoma, schwannoma, neuroblastoma, melanoma, non-small cell lung cancer, pancreatic cancer, breast cancer, hepatocellular carcinoma and nephroblastoma.
[0047] In particular, the present invention relates to a combination as described herein for use in the prevention and / or treatment of brain tumors, medulloblastoma, retinoblastoma, schwannoma, neuroblastoma, melanoma, non-small cell lung cancer, pancreatic cancer, breast cancer, hepatocellular carcinoma and nephroblastoma.
[0048] More particularly, the brain tumor is selected from astrocytoma, oligodendroglioma, meningioma, glioma and glioblastoma, and even more particularly, the cancer to be prevented and / or treated is glioblastoma.
[0049] As previously described, glioblastoma (GBM) is a grade IV astrocytoma, a lethal malignant brain tumor, and one of the most common primary brain tumors in adults.
[0050] In particular, GBM is characterized into different subtypes: mesenchymal, proneural, neural, and classical.
[0051] Thus, in certain embodiments, the combinations of the present invention may be used for the prevention and / or treatment of one or more of these subtypes of glioblastoma.
[0052] Most importantly, in certain embodiments, the combinations of the present invention are effective in preventing or treating all of these subtypes.
[0053] The present invention also relates to a method for the prevention and / or treatment of cancer, particularly GBM, which method comprises administering to a subject in need of such prevention and / or treatment an effective amount of a combination of the present invention.
[0054] In particular, subjects in need of treatment for cancer are subjects suffering from such diseases.
[0055] In the context of the present invention, the identification of those subjects in need of treatment for the diseases and conditions described herein is suitably performed as described above and within the ability and knowledge of one of ordinary skill in the art. A clinician of ordinary skill in the art can readily identify subjects in need of such treatment in the manner described above.
[0056] The therapeutically effective amount can be easily determined by the attending diagnostician, who is one of ordinary skill in the art, using routine techniques and observations made under similar circumstances. In determining the therapeutically effective amount, the attending diagnostician will take into account several factors, including, but not limited to, the race, size, age, and overall health of the subject, the specific disease involved, the degree of disease involvement or severity, the response in the individual subject, the specific compound administered, the mode of administration, the bioavailability of the administered drug, the selected administration regimen, the use of concomitant medications, and other relevant conditions.
[0057] As used herein, an "effective amount" refers to an amount that is effective to attenuate, eliminate, treat or control the symptoms of the diseases and conditions described herein. The term "control" is intended to refer to any process that may slow, hinder, arrest, or stop the progression of the diseases and conditions described herein. However, it does not necessarily indicate a complete elimination of all of the symptoms of the disease or condition, and the term is intended to include preventative treatments and clinical uses.
[0058] The term "patient" or "subject" refers to any warm-blooded animal such as a mammal, particularly a human being, male or female, who, unless otherwise indicated, suffers from or is susceptible to one or more of the diseases and disorders described herein.
[0059] The amount of each mimic or antagomir required to achieve the desired biological effect will vary depending on several factors, including the dose of drug administered, the chemical properties of the compound employed (e.g., hydrophobicity, etc.), the potency of the compound, the type of disease, the condition of the patient, and the route of administration.
[0060] The combinations provided herein may be formulated into pharmaceutical compositions, optionally in admixture with one or more pharma- cologically acceptable excipients.
[0061] Such compositions may be prepared for oral administration, in particular in the form of tablets or capsules, in particular orally disintegrating (lyophilized wafers) tablets, or for parenteral administration, in particular in the form of solutions, suspensions or emulsions.
[0062] The compositions may be prepared in any manner known in the pharmaceutical art, such as those described by Remington: The Science and Practice of Pharmacy, 20th ed.; Gennaro, AR, Ed.; Lippincott Williams & Wilkins: Philadelphia, PA, 2000. Pharmacologically compatible binders and / or adjuvants may be included as part of the composition. Oral compositions generally include an inert diluent carrier or an edible carrier. The compositions may be administered in unit dosage form, where "unit dosage" refers to one dose that can be administered to a patient. This unit dosage form may also be easily handled and packaged while maintaining a physically and chemically stable unit dosage containing either the active compound itself or a pharmacologically acceptable composition.
[0063] Tablets, pills, powders, capsules, troches, etc. may contain one or more of the following additives: binders such as microcrystalline cellulose or gum tragacanth, excipients such as starch or lactose, disintegrants such as starch or cellulose derivatives, lubricants such as magnesium stearate, flow agents such as colloidal silicon dioxide, sweeteners such as sucrose or saccharin, flavorings such as peppermint or methyl salicylate, or compounds of a similar nature. Capsules may be in the form of hard or soft capsules, generally made from gelatin mixtures, sometimes mixed with plasticizers, or may be starch capsules. In addition, dosage unit forms may contain various other substances that modify the physical form of the dosage unit, for example, sugar coatings, shellac resins, enteric agents, etc. Other oral dosage forms, such as syrups or elixirs, may contain sweeteners, preservatives, dyes, colorings, and flavorings. In addition, the active compounds may be incorporated into fast dissolving, slow release or extended release preparations and formulations, where such extended release formulations are preferably biphasic.
[0064] Liquid preparations for administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Liquid compositions may include binders, buffers, preservatives, chelating agents, sweeteners, flavorings, and colorants, etc. Non-aqueous solvents include alcohols, propylene glycol, polyethylene glycol, acrylate copolymers, vegetable oils such as olive oil, and organic esters such as ethyl oleate. Aqueous carriers include mixtures of alcohol and water, hydrogels, buffers, and saline. In particular, biocompatible, biodegradable lactic acid polymers, lactic acid / glycolic acid copolymers, or polyoxyethylene-polyoxypropylene copolymers may be useful excipients for controlling the release of active compounds. Intravenous solvents may be fluid and nutritional solutions, electrolyte solutions, those based on dextrose Ringer's solution, and the like.
[0065] Examples of modes of administration include parenteral administration, such as subcutaneous, intramuscular, intravenous, intradermal administration, and oral administration, in particular oral, intravenous or subcutaneous administration.
[0066] The invention is further illustrated by the following figures and examples. [Brief description of the drawings]
[0067] [Figure 1]miR-17-3p, miR-340, and miR-222 alter GBM cell viability, clonogenicity, and migration. (A): miRNA expression was quantified by qPCR in Ge518 cells transfected with non-targeting scrambled control miRNA or miR-17-3p mimic, miR-340 mimic, miR-551b mimic, and miR-222 antagomir (n=5-6). (B): Cell viability was assessed using CellTiter-Glo in Ge518, Ge738, Ge904, and Ge970.2 cells transiently transfected with non-targeting scrambled control or miR-340 mimic, miR-17-3p mimic, miR-551b mimic, and miR-222 antagomir after 3 or 4 days. Histograms represent the fold-change in cell viability in miR-Combo vs. miR-Ctrl groups (n=4-5). (C): The clone-forming ability of Ge518, Ge738, Ge904 and Ge970.2 cells transiently transfected with non-targeting scrambled control or miR-340 mimic, miR-17-3p mimic and miR-222 antagomir was quantified using a clonogenic assay. Representative images of 3-4 independent experiments. Histograms represent the fold-change in clones formed in miR-Combo vs. miR-Ctrl groups. Scale bar=10 μm. (D): Migration of Ge518, Ge738, Ge904, and Ge970.2 cells transiently transfected with non-targeting scrambled control or miR-340 mimic, miR-17-3p mimic, and miR-222 antagomir was quantified in Transwell® plates. Representative images of three independent experiments. Histograms represent the fold change in migratory cells quantified by Transwell in miR-Combo vs. miR-Ctrl groups. Scale bar = 10 μm. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns = not significant). [Diagram 2](AE): miRNA expression was quantified by qPCR in Ge518 cells transfected with (A) non-targeting scrambled control or (B) miR-17-3p mimic, (C) miR-340 mimic, (D) miR-551b mimic, and (E) miR-222 antagomir (n=5-6). Histograms show the expression of each miRNA in each group normalized to housekeeping genes. (FI): Cell viability was assessed using CellTiter-Glo in Ge518, Ge738, Ge904, and Ge970.2 cells transiently transfected with (F) non-targeting scrambled control or (G) miR-17-3p mimic, (G) miR-340 mimic, (H) miR-551b mimic, and (I) miR-222 antagomir after 3 or 4 days. Histograms represent the fold change in cell viability in miR-Combo group vs. miR-Ctrl group (n=4-5). Data are expressed as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns=not significant). [Diagram 3] (A-D): The clone-forming ability of Ge518, Ge738, Ge904, and Ge970.2 cells transiently transfected with non-targeting scrambled control or (A) miR-17-3p mimic, (B) miR-340 mimic, (C) miR-551b mimic, and (D) miR-222 antagomir was quantified by clonogenic assay. Histograms represent the fold change in formed clones in each group vs. miR-Ctrl group. (E): Representative images from 3-4 independent experiments. Scale bar = 1 μm. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns = not significant). [Figure 4]Migration of Ge518, Ge738, Ge904, and Ge970.2 cells transiently transfected with non-targeting scrambled control or (A) miR-17-3p mimic, (B) miR-340 mimic, (C) miR-551b mimic, and (D) miR-222 antagomir was quantified using Transwell. Histograms represent the fold change in migratory cells quantified with Transwell in each group vs. the miR-Ctrl group. Representative images of three independent experiments. Scale bar = 1 μm. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns = not significant). [Diagram 5]Combinatorial regulation of miR-340, miR-17-3 and miR-222 regulates genes involved in multiple biological processes and metabolic pathways. (A): Functional annotation clustering in gene set enrichment analysis showing Ge518 and Ge970.2 cells transfected with non-targeting scrambled control or combinatorial regulation of miR-340, miR-17-3p and miR-222. Histograms show the number of enriched queries for each gene family from g:Profiler analysis. (B): Venn diagram comparing Ge518 and Ge970.2 cells transfected with non-targeting scrambled control or combinatorial regulation of miR-340, miR-17-3p and miR-222. (C): Hierarchical clustering of miR-Ctrl vs. miR-Combo in Ge518 and Ge970.2 cells based on differentially expressed genes. (D): Functional annotation clustering in gene set enrichment analysis comparing Ge518 and Ge970.2 cells transfected with non-targeting scrambled control or combinatorial regulation of miR-340, miR-17-3p and miR-222. Histograms show the number of enriched queries for each gene family from g:Profiler analysis. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001). [Figure 6]Regulation of miR-340, miR-17-3p, and miR-222 modulates genes involved in multiple signaling pathways. (A): Functional annotation clustering in gene set enrichment analysis comparing Ge518 cells transfected with non-targeting scrambled control to Ge518 cells transfected with miR-17-3p mimic, miR-340 mimic, and miR-222-3 / 5p antagomir. Histograms represent the enrichment index for each gene family. (B-D): Hierarchical clustering based on differentially expressed genes in Ge518 cells transiently transfected with non-targeting scrambled control or (B) miR-340 mimic, (C) miR-17-3p mimic, and (D) miR-222-3 / 5p antagomir for 24 h. (E) mRNA was quantified by qPCR in Ge518 cells transfected with non-targeting scrambled control or miR-17-3p mimic, miR-340 mimic, and miR-222-3 / 5p antagomir (n=3). (F) Protein was quantified by Western blotting in Ge518 cells transfected with non-targeting scrambled control or miR-17-3p mimic, miR-340 mimic, and miR-222-3 / 5p antagomir (n=5). Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns=not significant). [Figure 7](A): Venn diagram comparing potential miRNA target genes identified by RNASeq or TargetScan across miRNAs. Ge518 and Ge970.2 cells transfected with non-targeting scrambled control or combinatorial regulation of miR-340, miR-17-3p and miR-222. (B): Functional annotation clustering in gene set enrichment analysis comparing differentially expressed genes identified in RNASeq of miR-Combo vs. miR-Ctrl, and RNASeq of miR-17-3p mimic, miR-340 mimic and miR-222 antagomir. Histograms show enrichment index for each gene family. (C): Ge904 PDC (patient-derived cells) were co-transfected with 3'UTR reporter construct and either miR-17-3p or miR340, and luciferase activity was normalized to the respective control groups. [Figure 8] Combinatorial regulation of miR-340, miR-17-3p and miR-222 leads to activation of AKT in PDCs of GBM. (A): Human phosphokinase array showed relative expression of phosphorylation profiles of multiple kinases and their substrate proteins. Representative images from three independent experiments. Histograms represented the fold change of each kinase in miR-Combo vs. miR-Ctrl groups. (B): Human phosphokinase array showed relative expression of phosphorylation profiles of multiple kinases and their substrate proteins. Representative images from three independent experiments. (C): Immunoblotting showed expression of the indicated proteins in Ge518 cells transfected with non-targeting scrambled control or combinatorial regulation of miR-340, miR-17-3p and miR-222. Histograms represented the fold change of protein expression quantified by densitometry analysis. [Figure 9]Invasion of GBM PDCs in neural organoids was reduced by combinatorial regulation of miR-17-3p, miR-222, and miR-340. (A-D): Illustrative illustration of PSC (pluripotent stem cell) differentiation into neural organoids. PSCs were (A) cultured on Matrigel, (B) collected in microwell plates, and (C) cultured for 3 weeks. (D) Culture principle of neural organoids. (E): Immunofluorescence showed immunoreactive cells for NeuN, β3-tubulin, GFAP, and MAP2 present in neural organoids. (F): mRNA expression of GAD67, Musashi, Nestin (NES), OLIG2, PSD95, S100B, SOX2, and β3-tubulin (TUBB3) was quantified by qPCR in neural organoids before co-culture with GSC (GBM stem cell) Ge904. Data were normalized to housekeeping genes and presented as mean ± SEM (n=4). (G): Immunofluorescence showed GFAP and β3-tubulin immunoreactive cells present in the co-culture of GSC Ge904 and neural organoids. Scale bar=100 μm. Histograms represented the invasion scores of GBM cells in neural organoids. (H): Immunofluorescence showed Ki-67 and β3-tubulin immunoreactive cells present in neural organoids. Scale bar=100 μm. Histograms represented the proliferation scores of GBM cells in neural organoids. Data were presented as mean ± SEM (*p<0.05, **p<0.01) [Figure 10] Repeated administration of miR-Combo delayed tumor growth in nude mice. (A): Effect of combinatorial regulation of miR-17-3p, miR-222, and miR-340 on Ge518 tumor growth in vivo (n=5 mice / group). (B): Histological analysis of Ge518 tumors treated with miR-Combo. Tumors were stained for specific proteins and counterstained with hematocyclin. Scale bar=50 μm. (C): Histograms represent fold changes in protein expression quantified using ImageJ (n=3). Data are presented as mean ± SEM (**p<0.01, ns=not significant). [Figure 11] GSCs with stable doxycycline-inducible lentiviral vector system expressing miR-17-3p, miR-222, and miR-340 caused a decrease in cell viability and delayed tumor growth in vivo. (A): Cell viability of Ge518, Ge738, and Ge970.2 PDCs expressing miRGE was evaluated using CellTiter-Glo after 3 days. Histograms represent the fold change in cell viability in doxycycline-treated (Dox) vs. doxycycline-untreated miRGE-expressing groups. (B): Cell viability of Ge518, Ge738, and Ge970.2 GSCs expressing miRGE was evaluated using CellTiter-Glo after 3 days. Histograms represent the fold change in cell viability in miRGE-expressing GSCs treated with doxycycline (Dox) versus untreated groups. (C): Representative images from 3-7 independent experiments. Bar graphs represent the fold change in miRGE-expressing GSCs treated with doxycycline (Dox) versus untreated groups. Data are presented as mean ± SEM (*p<0.05, **p<0.01, ***p<0.001). (D): Effect of miRGE expression by doxycycline administration on tumor growth in vivo. A mixture of Ge518, Ge738, and Ge970.2 GSCs with the inducible Tet-On system was injected intracranially into the brains of nude mice (n=8 mice treated, n=7 mice untreated). Log-rank (Cox-Mantel) test was used to calculate significance. [Figure 12] Cell viability of A375 (melanoma cell line), MCF-7 (breast cancer cell line), A549 (lung cancer cell line) and Ge360 (ependymoma cell line) transiently transfected with non-targeting scrambled control or miR-340 mimic, miR-17-3p mimic and miR-222 antagomir was assessed using CellTiter-Glo after 3 or 4 days. Histograms represent the fold change in cell viability in miR-Combo group vs. miR-Ctrl group (n=3). Example 1
[0068] material and method GBM cell lines and patient-derived models Eight glioblastoma stem cells (GSCs) of different subtypes, Ge269, Ge518, Ge835 (mesenchymal subtype), Ge738, Ge898 (proneural subtype), Ge885 (neural subtype), Ge904, and Ge970.2 (classical subtype), were cultured in DMEM / F12 with GlutaMax supplemented with B27 supplement and 10 ng / mL b-FGF, 10 ng / mL EGF, and 1% penicillin / streptomycin, as previously described (Cosset, E, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87). To generate GBM patient-derived cells (PDCs), the GSCs were transplanted into and maintained in 10% Dulbecco's modified Eagle's medium (DMEM) containing high glucose / GlutaMax, 10% fetal bovine serum (FBS), and 1% penicillin / streptomycin (GDC medium).
[0069] chemicals Actinomycin D and doxycycline were purchased from Sigma and used at concentrations of 5 μm and 1 mg / mL, respectively, for 24 h.
[0070] Cell transfection miR-17-3p mimic, miR-340-5p mimic, and miR-551b mimic, and miR-222-3p antagomir were transfected at a final concentration of 5 nM using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer's protocol. Non-targeting scrambled miRNA (Life Technologies) was used as a control.
[0071] Cell viability assay Cell viability assays were performed using the CellTiter-Glo Assay Kit (Promega) as previously described (Cosset, E, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87; Cosset, E, et al. (2017). Glut3 Addiction Is a Druggable Vulnerability for a Molecularly Defined Subpopulation of Glioblastoma. Cancer Cell 32: 856-868 e855).
[0072] cell migration Cells (2 × 10 ) were plated in serum-free (0% FBS) GDC medium on the filters of Transwell polycarbonate membrane inserts (24 wells, 8 μm pore size, Corning). 4 ) and the lower compartment was filled with GDC medium containing 10% FBS. For migration assessment, after 24 h of incubation at 37°C, adherent cells present on the lower surface were stained with 0.1% crystal violet and quantified and / or counted. Images were taken with an EVOS microscope (Life Technologies) and counted manually.
[0073] miRGE lentiviral vector miRGE constructs carrying miR-17-3p, miR-340-5p, and miR-222-3p were generated using Vector Lab (Dr. Patrick Salmon, University of Geneva) as previously described (Myburgh, R, et al. (2014). Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction. Mol Ther Nucleic Acids 3: e207).
[0074] Luciferase assay Ge904 pDCs, selected for lack of expression of miR-340 and miR-17-3p, were seeded at 80,000 cells per well in 24-well plates on day 0 (D0). 24 hours later, on D1, cells were transfected with the corresponding miRNAs and plasmids using Lipofectamine 3000 (L3000-008 Invitrogen) according to the manufacturer's protocol. 24 hours later, on D2, cells were lysed using Dual Luciferase Reporter Assay (E1910 Promega) according to the manufacturer's protocol, followed by luminescence measurement. Results were normalized to Renilla control.
[0075] Neural Organoids To generate neural organoids, human induced pluripotent stem cell lines (iPSCs) and embryonic stem cells (ESCs) were used as previously described with minor modifications (Cosset, E, et al. (2019). Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J Vis Exp.). iPSCs were kindly provided by Dr. Youssef Hibaoui and generated as previously described (Hibaoui, Y, et al. (2014). Modelling and rescuing neurodevelopmental defect of Down syndrome using induced pluripotent stem cells from monozygotic twins discordant for trisomy 21. EMBO Mol Med 6: 259-277.). Human ESCs HS420 were kindly provided by Prof. Karl-Heinz Krause.
[0076] Human phosphokinase assay Kinase phosphorylation profiling was performed using a Human Phosphokinase Array Kit (R&D Systems) according to the manufacturer's recommendations. For quantification, dots were analyzed using the analyze gels and plot lane commands in ImageJ software. All dots were normalized to the negative control. Combo group was normalized to the control group.
[0077] Immunoblotting Proteins were extracted in IP-MS cell lysis buffer (Life Technologies) and quantified using the Pierce BCA kit (Thermo Fisher) as previously described (Cosset, E, et al. (2017). Glut3 Addiction Is a Druggable Vulnerability for a Molecularly Defined Subpopulation of Glioblastoma. Cancer Cell 32: 856-868 e855). For immunoblotting, the following antibodies were used: vimentin (Millipore), p-P70 S6 kinase (Cell Signaling), p70 S6 kinase (Cell Signaling), pAKT (Cell Signaling), AKT (Cell Signaling), GAPDH (Cell Signaling), and β-actin HRP (Sigma-Aldrich) as a loading control. For protein expression analysis, expression levels were normalized to β-actin and compared to their respective controls.
[0078] Immunohistochemistry (IHC) and Immunofluorescence (IF) IHC and IF staining of formalin-fixed paraffin-embedded tissues was performed as previously described (Cosset, E, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87; Cosset, E, et al. (2017). Glut3 Addiction Is a Druggable Vulnerability for a Molecularly Defined Subpopulation of Glioblastoma. Cancer Cell 32: 856-868 e855). Sections were incubated overnight at 4°C in the presence of pAKT (Cell Signaling), AKT (Cell Signaling), Ki-67 (Chemicon), and CD31 (Abcam) primary antibodies, followed by treatment with biotin-conjugated anti-rabbit IgG and avidin-biotin peroxidase detection system and 3,3'-diaminobenzidine substrate (Vector) for IHC, and counterstained with hematocyclin (Sigma). For IF, sections were incubated overnight at 4°C in the presence of β3-tubulin (Covance), GFAP (Dako), MAP-2 (Millipore), NeuN (Millipore), and Ki-67 (Chemicon) primary antibodies, followed by secondary antibodies labeled with fluorochromes: Alexa Fluor (555 and / or 488)-labeled anti-mouse, anti-goat, or anti-rabbit antibodies from goat or donkey (Molecular Probes).
[0079] Reverse transcription quantitative PCR (RT-qPCR) Total RNA isolation was performed using the Qiagen RNeasy kit according to the manufacturer's instructions and as previously described (Cosset, E, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87). Primer sequences are listed in Tables 1 and 2.
[0080] [Table 1]
[0081] [Table 2]
[0082] Prior to use, all primers were validated by validity testing. At least two housekeeping genes (EEF1A1 and ALAS1) were used for normalization. RT-PCR reactions were performed in at least three technical triplicates and biological triplicates to determine the average cycle threshold (CT) values. For miRNAs, miR-16-5p and miR-191-5p were validated and used as housekeeping genes.
[0083] Analysis of RNAseq data Total RNA was extracted using the Trizol method as previously described (Cosset, E, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87). After checking the RNA quality, sequencing quality control was performed with FastQC v.0.11.5 using SR100 libraries prepared by Illumina HiSeq 4000 and TruSeqHT Stranded. Then, hierarchical clustering was performed using Morpheus (https: / / software.broadinstitute.org / morpheus).
[0084] In silico data analysis Gliovis (http: / / gliovis.bioinfo.cnio.es / ) was used to obtain p-values for Kaplan-Meier / log-rank test analysis of target genes in the TCGA dataset. Gene enrichment analysis was performed using g:Profiler and DAVID Bioinformatics resources (Raudvere, U, et al. (2019). g:Profiler: a web server for functional enrichment analysis and conversions of gene lists (2019 update). Nucleic Acids Res 47: W191-W198; Huang da, W, et al. (2009). Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37: 1-13.; Huang da, et al.(2009). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4: 44-57).
[0085] TCGA analysis miRNA expression data and corresponding clinical data for GBM samples were downloaded from the TCGA data portal (http: / / cancergenome.nih.gov / ) and analyzed as previously described (Cosset, E, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87).
[0086] subcutaneous injection All procedures involving animals were performed in accordance with the Geneva Ethics Committee for Animal Experimentation, with the approved protocol GE / 38 / 20, which conforms to the standards set by the Animal Care and Use Committee. Ge518 and Ge738 GSCs (5 × 10 in 200 mL PBS) were cultured in 100 mL of PBS. 6 Tumor cells) were injected subcutaneously into the right flank of the mice. Tumor size was measured three times a week using a caliper until the tumor size reached 150 mm 3 Recording was continued until the
[0087] Administration Mimic-Invivofectamine complexes and Antagomir-Invivofectamine complexes were prepared according to the manufacturer's protocol. The final concentration of mimic / antagomir was 1.75 mg / mL (equivalent to 5 nmol) in 200 μL per mouse. For the first pulse, mice were injected twice with said concentrations, and every other day, mice were injected with 200 μL of 0.875 mg / mL (equivalent to 2.5 nmol) solution. The solution was kept at room temperature until injection. mirVana® negative control mimics were used in the control group. For mimics, mirVana miR-17-3p (MC12246), mirVana miR-340-5p (MC12670) were used, and for antagomir, mirVana miR-222 (MH11376) was used.
[0088] Orthotopic brain tumor injection Ge518, Ge738, and Ge970.2 carrying miRGE were orthotopically implanted into 6-10 week old female nu / nu immunodeficient mice after washing and resuspension in PBS.
[0089] Quantitative and statistical analysis Sample size and statistics for each experiment are described in the results section and in the figure briefs. As noted in the figure briefs, the data shown are representative of results from multiple experiments. All statistical analyses were performed using one-way analysis of variance (ANOVA) and Student's t-test, with p<0.05 considered significant. All statistical analyses were performed using GraphPad's Prism software. Chi-square or t-tests were used to calculate statistical significance.
[0090] result Combinatorial regulation of miR-17-3p, miR-222, and miR-340 inhibits the viability, clonogenicity, and migration of GBM cells First, we selected PDCs that did not express or expressed low levels of miR-17-3p, miR-340, and miR-551b, and expressed miR-222. In fact, we aimed to increase the expression of miR-17-3p, miR-340, and miR-551b, and decrease the expression of miR-222. After screening nine patient-derived GBM cells and two established cell lines (U87MG and U251) using quantitative RT-PCR (RT-qPCR), the results revealed that Ge518 was the optimal patient-derived cell (PDC) model for miRNA expression modulation (Table 3).
[0091] [Table 3]
[0092] It was believed that miRNA-based multi-target therapy would be more beneficial for GBM patients. To test this hypothesis, we used combined mimics and antagomirs (miR-Combo) to either ectopically express or inhibit expression, respectively, in Ge518 PDC. After confirming the regulation of miRNAs by quantitative stem-loop qPCR (Figure 1A), cell viability was measured 3 days after transfection (Figure 1B), and miR-Combo significantly reduced cell viability compared to the non-targeting scrambled control (miR-Ctrl). As previously reported, Ge518 showed a mesenchymal phenotype (Cosset, et al. (2017). Glut3 Addiction Is a Druggable Vulnerability for a Molecularly Defined Subpopulation of Glioblastoma. Cancer Cell 32: 856-868.e855). To confirm the inhibitory effect of miR-Combo in other patient-derived models of proneural and classical phenotypes, we also tested cell viability after transfection with Ge738 (proneural subtype), Ge904, and Ge970.2 (classical subtype) (Cosset, et al. (2017). Glut3 Addiction Is a Druggable Vulnerability for a Molecularly Defined Subpopulation of Glioblastoma. Cancer Cell 32: 856-868.e855) (Figure 2B). The results revealed that cell viability was significantly inhibited in all PDCs, suggesting that GBM cells of any subtype that differentially express specific miRNAs could be targeted therapeutically by miR-Combo. We next sought to understand which miRNAs were responsible for this inhibition. To do so, we transfected each miRNA separately and confirmed their regulation (Figure 2A-D) and analyzed PDC viability.As shown in Figure 2F-I, miR-17-3p and miR-340 significantly decreased the cell viability of multiple PDCs. miR-222 showed a tendency to inhibit cell viability in Ge970.2 and was significantly inhibited in Ge518 (Figure 2I).
[0093] Next, to better characterize the biological effects of miR-Combo, we also analyzed the migration and clonogenicity of GBM PDCs. In all PDCs, combinatorial regulation of miRNAs caused a significant decrease in cell clonogenicity and migration (Figure 1C-D). Similarly, after transfection of each miRNA separately, most of the observed biological effects were mediated by miR-17-3p, miR-340, and miR-222, which also showed different effects in different PDCs, highlighting the need to use all of them in a combinatorial strategy (Figure 3 and Figure 4). Collectively, these data demonstrated that miR-17-3p, miR-340, and miR-222 inhibit GBM pathogenesis by affecting GBM viability, clonogenicity, and migration.
[0094] Regulation of miR-17-3p, miR-340 and miR-222 regulates genes involved in cell viability To understand the effect of miR-Como at the level of gene regulation, we performed whole transcriptome analysis in both miR-Combo transfected Ge518 and Ge970.2 PDCs compared to a non-targeting scrambled control (Figure 5A). After bulk mRNA extraction, RNAseq analysis was performed in three biological replicates for each cell line. In Ge518 PDCs, gene ontology enrichment analysis revealed expression of genes involved in three main families: cellular and biological processes (MT2A, CDKL5, CXCR4, MAPK14, PLXNA4, RAB21, TGFBR3, VGLL4), cation transport and homeostasis (CHRNB2, RRAD, CACNA1H, GPR35, P2RX5, ATP2A1), and regulation of proliferation (MAPK11, NRCAM, SHTN1, SMURF1, CDKN1B, TNKS2, GDF5, VGLL4) (Figure 5A). Analysis of the miRTarBase database of miRNA-target interactions via g:Profiler 22 showed enrichment of miR-340 target genes (ROCK1, LIMS1, ANKRD40, SKP2, FRS2) and miR-9-5p target genes (SFT2D2, DICER1, IGF2BP3, SPON2, CXCR4, SERPINH1, RAP2A). Strong and significant enrichment of genes involved in antiviral response and type I interferon signaling was observed in Ge970.2 PDC (OAS-1, -2, -3, -L, MX-1, -2, IFI44L) (Figure 5A). Furthermore, we found enrichment of genes involved in metabolic reprogramming and pentose phosphate processes and pathways (TKT, G6PD, PGD, TALDO1), as well as genes involved in the NRF2 pathway (NFE2L2, GCLC, NQO1, YES1), and oxidative stress. Overall, this analysis revealed distinct cellular responses to miR-Combo in the two models. To identify common hits, we compared the transcriptome profiles of both Ge518 and Ge970.2 PDCs and found 54 common genes (Figure 5B).Hierarchical clustering data first grouped samples by cell line, confirming a significant level of heterogeneity in GBM cell lines (Figure 5C), as previously reported by us and other groups (Calvo Tardon et al. (2020). An Experimentally Defined Hypoxia Gene Signature in Glioblastoma and Its Modulation by Metformin. Biology (Basel) 9 ; Sottoriva, A, et al. (2013). Intratumor heterogeneity in human glioblastoma reflects cancer evolutionary dynamics. Proc Natl Acad Sci USA 110: 4009-4014 ; Patel, et al. (2014). Singlecell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma. Science 344: 1396- 1401). Data were then grouped by condition, miR-Combo vs. miR-Ctrl. For both PDCs, ROCK1. 18、26 , LIMS1 18 , SKP2 27 , NFE2L2 28 , RAB21 29 In contrast, ELAVL2, RAD9B, and CNOT3, genes previously identified as tumor suppressors (Nord, H, et al. (2009). Characterization of novel and complex genomic aberrations in glioblastoma using a 32K BAC array. Neuro Oncol 11: 803-818) and cell cycle progression inhibitors, respectively, were significantly downregulated. 31The expression of was upregulated in the miR-Combo group (Figure 5C). Finally, gene ontology enrichment analysis revealed enrichment for multiple miRNAs (KLHL15, LRRC58, OTUD4, SEC23A, SUCO), including miR-340-5p and miR-4255 (Figure 5D). Collectively, these data highlighted a subset of significant genes regulated in PDC of GBM following miR-Combo transfection.
[0095] Next, to examine the effects of each miRNA separately, we performed whole-transcriptome analysis in Ge518 cell lines transfected with miR-17-3p mimics, and miR-340 mimics and miR-222 antagomir. Gene ontology enrichment analysis revealed the expression of genes involved in cellular stress response as a common pathway for miR-17-3p and miR-222 (Figure 6A). Furthermore, we found genes involved in signal transduction as common genes for miR-340 and miR-222. As previously reported (Cosset et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87; Fiore, D, et al. (2016). miR-340 predicts glioblastoma survival and modulates key cancer hallmarks through down-regulation of NRAS. Oncotarget 7: 19531-19547), we confirmed that ROCK1 and LIMS1 are target genes of miR-340 in different cell backgrounds (Fig. 6A-B). Furthermore, we detected genes involved in neural development and differentiation, signal transduction by small GTPases, as well as genes involved in cell surface receptor signaling pathways. For miR-17-3p, we found three gene families involved in morphogenesis and embryonic development, cell stress response, and response to organic nitrogen compounds (Fig. 6A, C). For miR-222, we found that numerous gene families were dysregulated, including those involved in oxidative stress / reactive oxygen species / drug response, hematopoietic and immune system development, and transcriptional regulation by RNA polymerase (Fig. 6A, D). To confirm these findings, we selected a representative set of genes from each functional family and examined them by quantitative RT-PCR and / or Western blot (Fig. 6E-F).Furthermore, expression of some of these genes, such as NFE2L2, COL5A3 and BDKRB2 for miR-340, ZFP36, NFKBIZ and NTN1 for miR-222, and LITAF and F2RL2 for miR-17-3p, correlates with poor survival (Table 4).
[0096] [Table 4]
[0097] Notably, when comparing our RNASeq analysis with predicted miRNA target genes, the number of common hits found was relatively low (Figure 7A). RNASeq of miR-Combo vs. miR-Control (miR-Ctrl), with RNASeq performed separately for each miRNA, demonstrated the contribution of each miRNA to gene regulation brought about by the combinatorial strategy (Figure 7B).
[0098] To investigate miRNA targeting to 3'UTR, luciferase reporter constructs with full-length E2F-3'UTR and TNFRSF-3'UTR were transiently transfected with miR-Ctrl vs. miR-17-3p and miR-Ctrl vs. miR-340, respectively, in the Ge904 model (Figure 7C). Ectopic expression of miR-17-3p and miR-340 reduced the luciferase activity of cells containing the reporter constructs by 1.5-fold compared to the respective controls, demonstrating that the identified miRNAs act as active miRNAs.
[0099] To identify and understand the mechanism by which miR-Combo may regulate downstream signaling, we analyzed phosphokinase activity in human phosphoproteome arrays (Figure 8A-B). After transfection, Ge518 PDCs were subjected to Proteome Profiler arrays to detect phosphorylated proteins in cell lysates. We confirmed significant activation of p70 S6 kinase, as well as significant inhibition of AKT and PRAS40 activity (Figure 8A). p70 S6 kinase, a ribosomal protein S6 kinase and downstream substrate of mTOR, is known for its role in controlling cell cycle progression and cell survival. In addition, PRAS40 is known to inhibit the activity of mammalian target of rapamycin C1 (mTORC1). Indeed, by binding to Raptor, PRAS40 competes with mTOR substrates 4E-BP1 and p70S6K. These data are consistent with the inhibition of cell survival observed in miR-Combo-transfected cells. To confirm these results, the expression and activation of AKT and p70 S6 kinase were analyzed by immunoblotting (Figure 8C). Although there was a tendency for increased p70 S6 phosphorylation, there was no significant regulation of its activity. Interestingly, there was a tendency for the pool of p70 S6 kinase to increase in the miR-Combo group compared to the miR-Ctrl group (Figure 8C).
[0100] On the other hand, no change was observed in total AKT between miR-Combo and miR-Ctrl, and a significant increase in AKT activity was observed in miR-Combo, confirming the results of human phosphoproteome analysis.
[0101] Combinatorial regulation of miR-17-3p, miR-222, and miR-340 inhibits PDC invasion of GBM in neural organoids The inventors recently developed an in vitro tissue engineering approach to generate 3D human brain-like tissue from pluripotent stem cells (PSCs) that differentiate into astrocytes and neurons (Cosset, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87; Cosset, et al. (2019). Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J Vis Exp.). We have previously demonstrated that GBM cells differentiate and develop into brain-like tissues, where we generated mixed tissues that mimic some of the critical and important features of host / tumor interactions in vivo (Cosset, et al. (2016). Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials 107: 74-87; Nayernia, et al. (2013). The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials 34: 8279-8290.). Therefore, we used this neural organoid generation protocol to investigate the inhibitory effect of miRNA Combo (miR-Combo) in three dimensions (Figure 9A-D). Characterization of neural organoids demonstrated expression of neural markers (β3 tubulin (TUBB3), MAP2, and NeuN), astrocyte markers (GFAP, S100B), and oligodendrocyte marker (OKIG2) at the mRNA and protein levels, confirming neural maturation (Figure 9E-F).GBM stem cells (GSCs) are the most pathogenic and drug-resistant cells in tumors, and because they have self-renewal and tumor-initiating properties, we decided to use these stem cells as a model to validate the miRNA multi-targeting strategy (Singh, et al. (2004). Identification of human brain tumour initiating cells. Nature 432: 396-401; Baoet al. (2006). Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444: 756-760). GSCs Ge904 were co-cultured with neural organoids for 24 h and then transfected with miR-Combo (Figure 9G-H). Four days after transfection, GSCs Ge904 were assessed for cell invasion and proliferation using the respective markers GFAP and Ki-67, and β3-tubulin was used as a marker for neural organoids (Figure 9G-H). The miR-Ctrl group showed invasion of GSCs into neural organoids, whereas miR-Combo transfected cells remained confluent and less invasive (Figure 9G). In the miR-Control group, GSCs appeared to be larger and proliferating, whereas in the miR-Combo group, GSCs appeared to be smaller and growth-arrested (Figure 9H). Correspondingly, stronger Ki-67 signals were observed in single invading cells far from their initial location. Collectively, these data suggested that miRNAs could penetrate 3D co-culture tissues and affect GBM cell behavior by inhibiting their proliferation and invasion abilities.
[0102] Tumor growth of GBM xenografts is reduced by combined treatment with miR-17-3p, miR-222, and miR-340 To translate this finding into clinical practice, we sought to examine the effect of combination treatment on Ge518 tumor growth in vivo. For this purpose, Ge518 cells were injected subcutaneously into the flanks of nude mice (Figure 10A). When tumors reached 150 mm2 After reaching a mean age of 10 years, mice were treated with miR-Combo. Tumor growth was significantly delayed, suggesting that miR-Combo effectively affected GBM growth and tumorigenicity, as shown in vitro (Figure 10A). There was also a significant decrease in proliferation marker Ki-67 in the miR-Combo group compared to the miR-Ctrl group, confirming the effect of the combination strategy on GBM cell proliferation (Figure 10B-C). Examination of tumor angiogenesis, assessed by CD31 staining, showed no significant difference, although there was a trend toward decreased CD31 expression and small blood vessels (Figure 10B-C). To confirm these results, another PDC model, Ge738, was used, and tumor growth showed a similar delay (Figure 10D). Overall, we demonstrated that a combined targeted therapy consisting of the modulation of miR-17-3p, miR-340, and miR-222 was effective in inhibiting GBM growth and tumorigenicity in vivo.
[0103] Using the well-known miRGE lentiviral vector system (Myburgh, et al. (2014). Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Singlecopy Transduction. Mol Ther Nucleic Acids 3: e207.), we simultaneously expressed miR-17-3p mimic, miR-340 mimic and miR-222 antagomir in PDC of GBM.
[0104] We then used the Tet-On system to activate miRNA regulation by treating GBM cells with doxycycline, which caused a significant decrease in cell viability in all Ge518, Ge738, and Ge970.2 PDCs, as shown in Figure 11A.
[0105] Next, we sought to examine the effect of miRGE on GSCs, a highly pathogenic subset of GBM tumors. Consistent with the results in miR-Combo-transfected PDCs, we found a significant decrease in the viability of miRGE-bearing PDCs under doxycycline treatment (Figure 11A). Similarly, we found an effect of doxycycline treatment on the viability of miRGE-transfected GSCs after 3 days, suggesting the effectiveness of this combination strategy in both differentiated and stem cells (Figure 11B). Consistent with these results, we found a significant decrease in the tumorsphere-forming ability of these cells under doxycycline treatment (Figure 11C). More importantly, to evaluate the effect of these miRNAs on the tumorigenicity of GSCs in vivo, a mixture (1:1:1) of mesenchymal (Ge518), proneural (Ge738), and classical (Ge970.2) GSCs transduced with the miRGE lentiviral vector system was intracranially transplanted into the brains of immunodeficient mice (Figure 11D). In fact, the mixture of GSCs of multiple subtypes mimics the in vivo background of multiple subtypes. To translate these findings into clinical practice, doxycycline was administered via drinking water 13 days later, when mice began to show neurological symptoms. In this experiment, the doxycycline-treated group showed a significant delay in tumor growth compared to the untreated group (Figure 11D). Collectively, these results highlight the clinical utility of the combination strategy of the present invention not only as a suitable prognostic biomarker for GBM, a disease that still represents a significant unmet medical need for treatment, but also as a drug discovery target for GBM treatment. Example 2
[0106] material and method Cell transfection miR-17-3p mimic, miR-340-5p mimic, and miR-222-5p antagomir were transfected at a final concentration of 5 nM using Lipofectamine RNAiMax (Invitrogen) according to the manufacturer's protocol. Non-targeting scrambled mRNA (Life Technologies) was used as a control.
[0107] Cell viability assay Cell viability assays were performed using the CellTiter-Glo assay kit (Promega) according to the manufacturer's protocol.
[0108] result The results are shown in Figure 12.
Claims
1. A pharmaceutical composition comprising a miR-17 mimic and / or a miR-340 mimic for use in the prevention and / or treatment of cancer, said pharmaceutical composition comprising: Contains a miR-17 mimic and is used in combination with a miR-340 mimic; comprising a miR-340 mimic and used in combination with a miR-17 mimic; or A pharmaceutical composition comprising a miR-17 mimic and a miR-340 mimic.
2. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition additionally comprises or is used in combination with miR-222 antagomir.
3. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition additionally comprises or is used in combination with miR-221 antagomir and / or miR-551b mimic.
4. The pharmaceutical composition of claim 1, wherein the miR-17 mimic is a miR-17-3p mimic.
5. The pharmaceutical composition according to claim 1, wherein the miR-340 mimic is a miR-340-5p mimic.
6. 3. The pharmaceutical composition of claim 2, wherein the miR-222 antagomir is selected from miR-222-5p antagomir and miR-222-3p antagomir.
7. 4. The pharmaceutical composition of claim 3, wherein the miR-221 antagomir is selected from miR-221-3p antagomir and miR-221-5p antagomir, and / or the miR-551b mimic is a miR-551b-5p mimic.
8. The pharmaceutical composition according to claim 1 for the prevention and / or treatment of cancer selected from brain tumor, medulloblastoma, retinoblastoma, schwannoma, neuroblastoma, melanoma, non-small cell lung cancer, pancreatic cancer, breast cancer, hepatocellular carcinoma and nephroblastoma.
9. 9. The pharmaceutical composition of claim 8, wherein the brain tumor is selected from astrocytoma, oligodendroglioma, meningioma, glioma, and glioblastoma.
10. The pharmaceutical composition according to claim 1 for the prevention and / or treatment of glioblastoma.
11. The pharmaceutical composition according to claim 10 for the prevention and / or treatment of glioblastoma of one or more subtypes of mesenchymal, proneural, neural, and classical.
12. The pharmaceutical composition of claim 1, wherein the miR-17 mimic and the miR-340 mimic are administered sequentially.
13. The pharmaceutical composition of claim 1, wherein the miR-17 mimic and the miR-340 mimic are administered simultaneously.
14. The pharmaceutical composition according to any one of claims 1 to 14, wherein the pharmaceutical composition is administered intravenously, orally, or subcutaneously.