DNA COMPOSITIONS AND RELATED METHODS

Abstract

The present disclosure provides, for example, single-stranded covalently closed circular DNA that does not form double-stranded structures longer than 100 base pairs. The ssDNA can code for effector sequences, for example therapeutic proteins. The ssDNA can include nuclear targeting sequences (NTS). In some embodiments, the ssDNA shows reduced activation of the innate immune system compared to otherwise similar dsDNA.

Description

[Technical field]

[0001] Related Applications This application claims priority to U.S. Patent Application No. 63 / 262,690, filed October 18, 2021, U.S. Patent Application No. 63 / 304,913, filed January 31, 2022, U.S. Patent Application No. 63 / 373,293, filed August 23, 2022, and U.S. Patent Application No. 63 / 402,772, filed August 31, 2022, the entire contents of each of which are incorporated herein by reference. [Background technology]

[0002] Novel therapies are needed to address unmet medical needs. Summary of the Invention [Means for solving the problem]

[0003] Described herein are pharmaceutical DNA compositions, constructs, formulations, methods of using such compositions, constructs and formulations, as well as methods of making the same.

[0004] In some aspects, the disclosure provides a pharmaceutical formulation comprising an LNP comprising single stranded DNA (ssDNA), wherein the ssDNA (a) encodes a therapeutic protein, (b) is covalently circularly closed, (c) does not form a double stranded structure longer than 100 base pairs, (d) is greater than 200 nucleotides in length, and (e) does not contain a protelomerase target sequence; wherein the pharmaceutical formulation is substantially free of linear DNA and proteins. In some embodiments, the ssDNA does not form a double stranded structure longer than 40 base pairs.

[0005] In some embodiments, the ssDNA comprises a promoter sequence operably linked to a sequence encoding a therapeutic polypeptide. In some embodiments, the therapeutic protein is selected from the group consisting of a transcription factor, a chromatin remodeling factor, an antigen, a peptide, a hormone, an enzyme, an antibody, a receptor ligand, a receptor, a clotting factor, and a membrane protein. In some embodiments, the ssDNA has a GC content of 30-40%, 40-50%, 50-60%, or 60-70%.

[0006] In some embodiments, the ssDNA lacks one or both of a bacteriophage packaging site and a bacteriophage origin of replication, or the ssDNA does not encode a bacteriophage capsid gene. In some embodiments, the ssDNA was not generated by rolling circle amplification. In some embodiments, the ssDNA was not generated by strand displacement amplification.

[0007] In some embodiments, the ssDNA further comprises a nuclear targeting sequence (NTS). In some embodiments, the ssDNA further comprises a maintenance sequence. In some embodiments, the ssDNA further comprises a second strand motif (SSM).

[0008] In some embodiments, the ssDNA comprises 200-3,000 nucleotides. In some embodiments, the ssDNA comprises 500-2,000 nucleotides. In some embodiments, the ssDNA is a sense ssDNA strand. In some embodiments, the ssDNA is an antisense ssDNA strand.

[0009] In some embodiments, the ssDNA comprises at least one nucleotide modification, hi some embodiments, the nucleotide modification is 5-formylcytosine.

[0010] In some embodiments, the pharmaceutical preparation is formulated for parenteral administration. In some embodiments, the pharmaceutical preparation is formulated for topical administration. In some embodiments, the pharmaceutical preparation is substantially free of one or more of endotoxins, mononucleotides, modified mononucleotides, and double-stranded DNA.

[0011] In some aspects, the present disclosure provides a method of delivering a therapeutic protein to a subject, comprising administering to the subject a pharmaceutical formulation as described herein. In some embodiments, the method does not result in substantial integration of ssDNA into the subject's genome.

[0012] In one aspect, the invention features a composition, e.g., a pharmaceutical composition, including a single-stranded DNA (ssDNA) that includes an effector sequence, where the single-stranded DNA has one, two, or three of the following properties: the ssDNA is covalently circularly closed; the ssDNA does not form a double-stranded structure longer than 100 base pairs; and the ssDNA includes at least one covalent modification.

[0013] In an embodiment, the ssDNA has an effector sequence and one, two or three of a nuclear targeting sequence (NTS), a maintenance sequence and a second strand motif (SSM). In an embodiment, the ssDNA has a DNA effector sequence. In an embodiment, the ssDNA has a DNA effector sequence and an NTS. In an embodiment, the ssDNA has a DNA effector sequence, an NTS and an SSM. In an embodiment, the ssDNA has a DNA effector sequence, an NTS, an SSM and a maintenance sequence. In an embodiment, the ssDNA has a DNA effector sequence, an NTS and a maintenance sequence. In an embodiment, the ssDNA has a DNA effector sequence, an SSM and a maintenance sequence. In an embodiment, the ssDNA has a promoter operably linked to a sequence encoding an RNA or protein (peptide or polypeptide) effector. In an embodiment, the ssDNA has a promoter operably linked to a sequence encoding an RNA or protein (peptide or polypeptide) effector and an NTS. In one embodiment, the ssDNA has a promoter operably linked to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an NTS, and an SSM. In one embodiment, the ssDNA has a promoter operably linked to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an NTS, an SSM, and a maintenance sequence. In one embodiment, the ssDNA has a promoter operably linked to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an NTS, and a maintenance sequence. In one embodiment, the ssDNA has a promoter operably linked to a sequence encoding an RNA or protein (peptide or polypeptide) effector, an SSM, and a maintenance sequence. In some embodiments, the ssDNA described herein includes an enhancer, for example, an SV40 enhancer. In some embodiments, the ssDNA includes two enhancers. In some embodiments, one or both of the enhancers are SV40 enhancers.In some embodiments, the ssDNA described herein comprises an NTS, e.g., an NTS that binds a transcription factor, e.g., an NTS that binds NF-κB, e.g., a 3NF sequence. In some embodiments, the ssDNA comprises 2, 3, or 4 NTSs. In some embodiments, 1, 2, 3, or 4 of the NTSs are 3NF sequences. In some embodiments, the ssDNA described herein comprises an SMM (e.g., an Anellovirus hairpin). In some embodiments, the ssDNA described herein comprises a polyA signal, e.g., a bGH polyA signal. In some embodiments, the ssDNA described herein comprises a promoter, e.g., an EF1a promoter.

[0014] In some embodiments, the enhancer is located upstream of the promoter. The NTS can be located, for example, upstream of the promoter or downstream of the polyA signal. In some embodiments, the SMM (e.g., anellovirus hairpin) is located upstream of the promoter.

[0015] In some embodiments, the promoter is located between the enhancer and the effector sequence. In some embodiments, the NTS is located between the SMM (e.g., anellovirus hairpin) and the promoter. In some embodiments, the SMM (e.g., anellovirus hairpin) is located between the enhancer and the promoter. In some embodiments, the polyA signal is located between the effector sequence and the NTS. In some embodiments, the polyA signal is located between the effector sequence and the enhancer. In some embodiments, the polyA signal is located between the SMM (e.g., anellovirus hairpin) and the effector sequence. In some embodiments, the NTS is located between the SMM (e.g., anellovirus hairpin) and the polyA signal. In some embodiments, the first NTS sequence is immediately adjacent to the second NTS sequence. In some embodiments, the ssDNA described herein comprises a series of components arranged as shown in Table 5 herein.

[0016] In certain embodiments, the ssDNA has at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 10,000 nucleotides, at least 15,000 nucleotides, at least 20,000 nucleotides, at least 25,000 nucleotides, at least 30,000 nucleotides, at least 35,000 nucleotides, at least 40,000 nucleotides at least 45,000 nucleotides, at least 50,000 nucleotides, at least 60,000 nucleotides, or more.

[0017] In certain embodiments, the ssDNA may be 20 to 1000 nucleotides, 20 to 50 nucleotides, 100 to 500 nucleotides, 500 to 50,000 nucleotides, 1,000 to 50,000 nucleotides, 2,000 to 40,000 nucleotides, 5,000 to 50,000 nucleotides, 500 to 50,000 nucleotides, 500 to 25,000 nucleotides, 1,000 to 20,000 nucleotides, 1,000 to 10,000 nucleotides, 10,000 The ssDNA may have between 60,000 nucleotides, 1,000 and 20,000 nucleotides, 1,000 and 40,000 nucleotides, 200 and 1,000 nucleotides, 200 and 2,000 nucleotides, 200 and 3,000 nucleotides, 500 and 1,000 nucleotides, 500 and 2,000 nucleotides, 500 and 3,000 nucleotides, 1,000 and 2,000 nucleotides, 1,000 and 3,000 nucleotides, or 2,000 and 3,000 nucleotides. In some embodiments, the ssDNA comprises between 20 and 20,000 nucleotides. In some embodiments, the ssDNA comprises between 50 and 50,000 nucleotides.

[0018] In some embodiments, the ssDNA is a sense ssDNA strand. In some embodiments, the ssDNA is an antisense ssDNA strand.

[0019] In certain embodiments, the ssDNA comprises at least one nucleotide modification, e.g., a covalent nucleotide modification, selected from, e.g., N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5fC, f5C); 5-carboxylcytosine (ca5C, 5caC); 5-hydroxymethylcytosine (5hmC, hm5C); 5-methyldeoxycytosine (m5dC); 5-methylcytosine (5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioates; S and R phosphorothioate linkages; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); and tricyclo-DNA (tcDNA). In some embodiments, the ssDNA comprises at least one nucleotide modification, e.g., a covalent nucleotide modification, selected from, e.g., N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5fC, f5C); 5-carboxylcytosine (ca5C, 5caC); 5-hydroxymethylcytosine (5hmC, hm5C); 5-methyldeoxycytosine (m5dC); 5-methylcytosine (5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioates; S and R phosphorothioate linkages; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); and tricyclo-DNA (tcDNA). 6 In some embodiments, the majority of A positions in the ssDNA include N 6 -methyladenosine. In some embodiments, the nucleotide modification is a covalent modification selected from phosphothioate; boranophosphate; 1,5-disubstituted triazole; 2'-fluoro-2'deoxynucleoside 5'-triphosphate; and 7-methylguanine; 5-glucosylmethylcytosine.

[0020] In some embodiments, the nucleotide modification is a base modification. In some embodiments, the nucleotide modification is a backbone modification. In some embodiments, the nucleotide modification is a sugar modification. In some embodiments, the nucleotide modification comprises a peptide conjugate. In some embodiments, the nucleotide modification comprises a protein conjugate.

[0021] In certain embodiments, the effector sequence is a therapeutically functional sequence, for example a functional, structural DNA sequence, such as a DNA aptamer, DNAzyme, or allele-specific oligonucleotide (ASO).

[0022] In some embodiments, the effector sequence is a DNA sequence encoding a therapeutic (e.g., regulatory) RNA operably linked to a promoter. In some embodiments, the RNA can be, for example, a tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, exRNA, scaRNA, Y RNA, or hnRNA.

[0023] In some embodiments, the therapeutically functional sequence comprises a promoter sequence operably linked to a sequence encoding a therapeutic RNA or polypeptide. In certain embodiments, the effector sequence is a DNA sequence encoding a therapeutic peptide or polypeptide operably linked to a promoter. Therapeutic peptides or polypeptides can be, for example, DNA binding proteins; RNA binding proteins; transporters; transcription factors; translation factors; ribosomal proteins; chromatin remodeling factors; epigenetic modifiers; antigens; hormones; enzymes (nucleases, e.g., endonucleases, e.g., nuclease components of the CRISPR system, e.g., Cas9, dCas9, Cas9-nickase, Cpf / Cas12a, etc.); Crispr ligases, e.g., base editors or prime editors; mobile genetic element proteins (e.g., transposases, retrotransposases, recombinases, integrases); gene writers (gene writers; polymerases; methylases; demethylases; acetylases; deacetylases; kinases; phosphatases; ligases; deubiquitinases; proteases; integrases; recombinases; topoisomerases; gyrases; helicases; lysosomal acid hydrolases; antibodies (e.g., intact antibodies, fragments thereof, or nanobodies); signaling peptides; receptor ligands; receptors; clotting factors; coagulation factors; structural proteins; caspases; membrane proteins; mitochondrial proteins; nuclear proteins; protein scaffold binding agents, such as centrins, darpins, or adnectins.

[0024] In embodiments, the ssDNA may contain multiple effector sequences. The multiple may be of the same or different type, for example, the ssDNA may contain an effector sequence that is structural DNA and a second effector sequence that is a DNA sequence that codes for a functional RNA or polypeptide. In some embodiments, the ssDNA contains a second effector sequence that is the same or different from the first effector sequence. The ssDNA may contain an effector sequence that is a DNA sequence that codes for a functional RNA and a second effector sequence that is a DNA sequence that codes for a functional polypeptide. The multiple effector sequences may be the same or different sequences of the same type.

[0025] In some embodiments, when ssDNA is introduced into cells, the cells exhibit a smaller increase in cytokine mRNA levels (e.g., normalized to GAPDH mRNA levels) compared to control cells of the same type contacted with dsDNA having the same sequence as the ssDNA in the same molar amount. In some embodiments, the cytokine comprises the cytokines IFN-b, IL-6, IL-1b, TNF-a, or CXCL10. In some embodiments, the cytokine increase in the control cells is less than 50%, 40%, 30%, 20%, or 10% of the cytokine increase in the control cells.

[0026] In some embodiments, the ssDNA described herein has an A260 / A280 ratio of 1.6-1.7, 1.7-1.8, or 1.63-1.76. In some embodiments, the ssDNA described herein has an A230 / A260 ratio of 0.3-1, 1-1.5, 1.5-1.8, or 0.34-1.79.

[0027] In embodiments, the ssDNA is not disposed in a carrier, e.g., it is formulated for naked administration.

[0028] In embodiments, the ssDNA is formulated with a carrier, e.g., a lipid-based carrier, e.g., a lipid nanoparticle (LNP). In embodiments, the pharmaceutical composition further comprises a carrier, e.g., a lipid-based carrier, e.g., a LNP.

[0029] In some embodiments, the composition comprising ssDNA is substantially free (e.g., free) of LNP. In some embodiments, the composition comprising ssDNA is substantially free (e.g., free) of lipid-based carriers. In some embodiments, the composition comprising ssDNA is substantially free (e.g., free) of lipids.

[0030] In embodiments, the ssDNA is formulated with a pharmaceutical excipient.

[0031] In embodiments, the ssDNA is formulated for parenteral administration.

[0032] In embodiments, the pharmaceutical composition is formulated for topical administration.

[0033] In embodiments, the pharmaceutical composition is substantially free of impurities or process by-products, e.g., selected from the group consisting of endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or truncations, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). In the case of circular, e.g., covalently closed, ssDNA, the pharmaceutical composition is substantially free of linear DNA.

[0034] In any of the embodiments described herein, the ssDNA can be covalently closed, e.g., the ssDNA is circularized.

[0035] In another aspect, the invention includes a method of delivering an effector to a subject, e.g., a subject in need thereof. The method includes administering to the subject a composition described herein, e.g., any of the embodiments described above. In some embodiments, the subject has or has been diagnosed with a condition that can be treated with the effector.

[0036] In another aspect, the invention includes a method of modulating (e.g., increasing or decreasing) a biological parameter in a cell, tissue, or subject. The method includes administering to a subject a composition described herein, e.g., as described in any of the embodiments above. In embodiments, the biological parameter is an increase or decrease in gene expression of a gene of interest in a target cell, tissue, or subject, which increase or decrease is brought about by an effector sequence described herein. In certain embodiments, the subject has or has been diagnosed with a condition that can be treated with an effector.

[0037] In another aspect, the invention includes a method of treating a cell, tissue, or subject, comprising administering to a cell, tissue, or subject in need thereof an ssDNA or construct described herein, e.g., as described in any of the above embodiments. In one embodiment, the subject has or has been diagnosed with a condition that can be treated with an effector.

[0038] In another aspect, the invention features a method of making a pharmaceutical composition comprising ssDNA comprising an effector sequence, the method including: (a) providing or generating a plasmid comprising the effector sequence and, optionally, one or more (e.g., 2, 3, or 4) of a promoter, an NTS, an SSM, and a maintenance sequence operably linked to the effector sequence, (b) using the plasmid as a template to provide or generate ssDNA comprising the effector sequence and, optionally, one or more (e.g., 2, 3, or 4) of a promoter, an NTS, an SSM, and a maintenance sequence operably linked to the effector sequence, and (c) optionally, circularizing the ssDNA.

[0039] In one embodiment, the method includes circularizing the ssDNA (eg, ligating the ends of the ssDNA).

[0040] In embodiments, the ssDNA is any ssDNA described herein, e.g., any of the embodiments described above.

[0041] In one embodiment, step (a) comprises performing golden gate assembly of the sequence elements described.

[0042] In one embodiment, the method further comprises (d) concentrating or purifying the ssDNA produced in step (b) or the circularized, e.g., covalently closed, ssDNA produced in step (c).

[0043] In certain embodiments, step (d) comprises substantially removing one or more impurities from the ssDNA selected from endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or truncations, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). In the case of circular, e.g., covalently closed, ssDNA, linear DNA is removed.

[0044] In certain embodiments, the method further includes formulating the enriched or purified ssDNA or circularized ssDNA of step (d) for use as a pharmaceutical, e.g., formulating the enriched or purified ssDNA or circularized, e.g., covalently closed, ssDNA, with a pharma- ceutically acceptable excipient and / or with a carrier, e.g., an LNP.

[0045] In another aspect, the invention features a plasmid that includes an effector sequence described herein and one, two, three, or four of the following elements: a promoter, an NTS, an SSM, and a maintenance sequence.

[0046] In some embodiments, the disclosure provides a composition (e.g., a pharmaceutical composition) comprising covalently circularized single-stranded DNA (ssDNA) comprising an effector sequence, wherein a) at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, or 98%, or 99%, by weight of the total DNA in the composition, is covalently circularized ssDNA; b) at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, by weight of the total DNA in the composition, is covalently circularized ssDNA; %, or 99% by weight of the DNA in the composition is full length; c) less than 10%, 5%, 4%, 3%, 2%, or 1% by weight of the DNA in the composition is double-stranded DNA (dsDNA); d) less than 10%, 5%, 4%, 3%, 2%, or 1% by weight of the DNA in the composition is linear DNA; or e) less than 10%, 5%, 4%, 3%, 2%, or 1% by weight of the DNA in the composition is linear ssDNA.

[0047] In some aspects, the disclosure provides a composition (e.g., a pharmaceutical composition) comprising a covalently circularly closed single stranded DNA (ssDNA) comprising an effector sequence, wherein one or more of: a) the composition is substantially free, e.g., free, of chloroform; b) the composition is substantially free, e.g., free, of phenol; c) the composition is substantially free, e.g., free, of phenol and chloroform; d) the composition is substantially free, e.g., free, of organic solvents; or e) the composition is substantially free, e.g., free, of aromatic organic solvents.

[0048] In some aspects, the disclosure provides compositions (e.g., pharmaceutical compositions) comprising covalently circularly closed single-stranded DNA (ssDNA) comprising an effector sequence, where the ssDNA is produced by a method that does not include a phenol-chloroform extraction step.

[0049] In some aspects, the disclosure provides compositions (e.g., pharmaceutical compositions) comprising a covalently circularized single-stranded DNA (ssDNA) comprising an effector sequence, wherein one or more of: a) the composition is substantially free (e.g., free) of exonuclease III; b) the composition is substantially free (e.g., free) of T7 exonuclease; or c) the composition is substantially free (e.g., free) of T5 exonuclease.

[0050] In some aspects, the disclosure provides a composition (e.g., a pharmaceutical composition) comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg of covalently circularly closed single-stranded DNA (ssDNA) comprising an effector sequence.

[0051] In some aspects, the disclosure provides a composition (e.g., a pharmaceutical composition or manufacturing intermediate) comprising a circular double-stranded DNA that includes an effector sequence and that includes at least one modified nucleotide, and Nb.BsrDI or Nt.BspQI.

[0052] In some embodiments, the ssDNA is not disposed in a carrier. In some embodiments, the composition further comprises a carrier. In some embodiments, the carrier is a lipid-based carrier. In some embodiments, the lipid-based carrier is a lipid nanoparticle (LNP). In some embodiments, the composition is formulated for naked administration. In some embodiments, the composition is formulated for parenteral administration. In some embodiments, the composition is formulated for topical administration. In some embodiments, the composition is substantially free of impurities or by-products selected from the group consisting of endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, DNA fragments or breaks, proteins (e.g., enzymes, e.g., ligases, restriction enzymes).

[0053] In some aspects, the disclosure provides a method of making a circular ssDNA, comprising: a) providing (e.g., generating or obtaining) a circular dsDNA, wherein the circular dsDNA i) lacks a plasmid backbone; ii) lacks a bacterial origin of replication; iii) lacks a selectable marker, e.g., an antibiotic resistance marker; and / or iv) comprises a chemical modification, e.g., a chemical modification to a sugar, a chemical modification to a base, or a chemical modification to a nucleic acid backbone; b) introducing a discontinuity into one strand of the circular dsDNA (e.g., by nicking the dsDNA into the dsDNA); a) contacting the dsDNA having the discontinuity with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow for resolution (e.g., complete degradation) of the nicked strand, thereby generating a circular ssDNA.

[0054] In some aspects, the disclosure provides methods of making circular ssDNA, the methods including: a) providing (e.g., generating or obtaining) a circular dsDNA; b) contacting the circular dsDNA with a nicking endonuclease selected from Nb.BsrDI or Nt.BspQI, which recognizes a nicking recognition site in the dsDNA, under conditions that allow the nicking endonuclease to nick the site in the dsDNA, thereby generating a nicked dsDNA; and c) contacting the nicked dsDNA with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow resolution (e.g., complete degradation) of the nicked strand, thereby generating a circular ssDNA.

[0055] In some aspects, the disclosure provides methods of making circular ssDNA, the methods including: a) providing (e.g., generating or obtaining) a circular dsDNA; b) introducing a discontinuity into one strand of the circular dsDNA (e.g., contacting the circular dsDNA with a nicking endonuclease (e.g., Nb.BsrDI or Nb.Bp10I or Nt.BspQI) that recognizes a nicking recognition site in the dsDNA under conditions that allow the nicking endonuclease to nick the site in the dsDNA), thereby generating a nicked dsDNA having a discontinuity; c) contacting the nicked dsDNA with T7 exonuclease under conditions that allow for degradation (e.g., complete degradation) of the nicked strand, thereby generating a circular ssDNA.

[0056] In some aspects, the disclosure provides methods of making circular ssDNA, the methods including: a) providing (e.g., generating or obtaining) a circular dsDNA; b) introducing a discontinuity into one strand of the circular dsDNA (e.g., contacting the circular dsDNA with a nicking endonuclease (e.g., Nb.BsrDI or Nb.Bp10I or Nt.BspQI) that recognizes a nicking recognition site in the dsDNA under conditions that allow the nicking endonuclease to nick the site in the dsDNA), thereby generating a nicked dsDNA having a discontinuity; c) contacting the nicked dsDNA with an exonuclease (e.g., T7 exonuclease or exonuclease III) under conditions that allow resolution (e.g., complete resolution) of the nicked strand, thereby generating a circular ssDNA, and d) performing gel purification on the circular ssDNA.

[0057] In some embodiments, the circular dsDNA i) lacks a plasmid backbone; ii) lacks a bacterial origin of replication; iii) lacks a selectable marker, e.g., an antibiotic resistance marker; and / or iv) comprises a chemical modification, e.g., a chemical modification to the sugar, a chemical modification to the base, or a chemical modification to the nucleic acid backbone.

[0058] In some embodiments, the method includes contacting the circular dsDNA with a nicking endonuclease selected from Nb.BsrDI or Nt.BspQI that recognizes a nicking recognition site in the dsDNA under conditions that allow the nicking endonuclease to nick the site in the dsDNA, thereby generating a nicked dsDNA. In some embodiments, the method includes contacting the nicked dsDNA with T7 exonuclease under conditions that allow for resolution (e.g., complete resolution) of the nicked strand. In some embodiments, the method includes performing gel purification on the circular ssDNA.

[0059] In some embodiments, the method includes generating a circular dsDNA, the generating of the circular dsDNA comprising: (i) providing a nucleic acid (e.g., a plasmid) comprising an effector sequence; (ii) performing PCR to amplify a region of the nucleic acid (e.g., the plasmid) comprising the effector sequence, wherein performing PCR comprises contacting the plasmid with a first primer comprising a first endonuclease recognition site and a second primer comprising a second endonuclease recognition site and a nicking recognition site, wherein the first primer and the second primer are positioned at locations in the plasmid suitable for amplifying the effector sequence (and optionally not amplifying the backbone of the plasmid), and contacting the plasmid with a DNA-dependent DNA polymerase (e.g., a high-fidelity polymerase (iii) digesting the linear dsDNA with an endonuclease (e.g., BsaI, KpnI, or NheI) that cleaves the endonuclease recognition site, thereby generating digested linear DNA; (iv) circularizing the digested linear dsDNA (e.g., by contacting the linear, digested dsDNA with a ligase, e.g., T4 ligase); and (v) digesting the remaining linear DNA by contacting a composition comprising the digested linear dsDNA with an exonuclease (e.g., T5 exonuclease).

[0060] In some embodiments, the method includes one or more purification steps, such as gel purification or the use of a DNA purification column. In some embodiments, the purification steps are performed on linear dsDNA; digested linear dsDNA; circular dsDNA; or circular ssDNA. In some embodiments, the method does not include an organic extraction step (e.g., a phenol-chloroform extraction step).

[0061] In some embodiments, the method includes contacting the nicked dsDNA with an exonuclease (e.g., T7 exonuclease) for 15 to 120 minutes, e.g., 20 to 60 minutes, e.g., about 30 minutes. In some embodiments, introducing a discontinuity into one strand of the circular dsDNA includes introducing a nick between two adjacent nucleotides. In some embodiments, introducing a discontinuity into one strand of the circular dsDNA includes removing a nucleotide, e.g., where the nucleotide is uracil.

[0062] In some aspects, the disclosure provides a method of evaluating a sample of a composition comprising ssDNA, comprising determining whether a condition is met, wherein the condition is: a) at least 70%, 80%, 85%, 90%, 95%, 97%, or 98%, or 99%, by weight of the total DNA in the composition, is covalently circular closed ssDNA; b) at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%, by weight of the total DNA in the composition, is full length; c) less than 10%, 5%, 4%, 3%, 2%, or 1%, by weight of the DNA in the composition, is double-stranded DNA (dsDNA); d) less than 10%, 5%, 4%, 3%, 2%, or 1%, by weight of the DNA in the composition, is linear DNA; e) less than 10%, 5%, 4%, 3%, 2%, or 1%, by weight of the DNA in the composition, is linear DNA; less than 10%, 5%, 4%, 3%, 2%, or 1% by weight is linear ssDNA; f) the composition is substantially free, e.g., free of chloroform; g) the composition is substantially free, e.g., free of phenol; h) the composition is substantially free, e.g., free of phenol and chloroform; i) the composition is substantially free, e.g., free of organic solvents; j) the composition is substantially free, e.g., free of aromatic organic solvents; k) the composition is substantially free (e.g., free) of exonuclease III; l) the composition is substantially free (e.g., free) of T7 exonuclease; and / or m) the composition is substantially free (e.g., free) of T5 exonuclease. In some embodiments, if the condition is met, the method includes performing a downstream processing step on the composition, optionally the downstream processing step being selected from dividing the composition into portions, packaging the composition, labeling the composition, transporting the composition, distributing the composition, storing the composition, or selling the composition. In some embodiments, the method includes evaluating a sample of the composition disclosed herein. In some embodiments, the method includes evaluating a sample of the composition made by the method disclosed herein.

[0063] In some embodiments, the ssDNA comprises a chemical modification, e.g., a chemical modification to a sugar, a chemical modification to a base, or a chemical modification to a nucleic acid backbone. In some embodiments, the ssDNA is not a bacteriophage genome. In some embodiments, the ssDNA lacks a bacteriophage packaging site. In some embodiments, the ssDNA lacks a bacteriophage origin of replication. In some embodiments, the ssDNA does not encode a bacteriophage capsid gene. In some embodiments, the ssDNA was not generated by rolling circle amplification. In some embodiments, the ssDNA was not generated by strand displacement amplification. In some embodiments, the ssDNA does not comprise a protelomerase target sequence. In some embodiments, the ssDNA does not comprise a hairpin structure. In some embodiments, the ssDNA does not comprise a first sequence that hybridizes with a second sequence, wherein the first sequence and the second sequence are at least 5 nt in length and the first sequence and the second sequence are positioned less than 6 nucleotides apart from each other. In some embodiments, the ssDNA does not contain a double stranded origin (DSO).

[0064] In some embodiments, the chemical modification is a covalent modification selected from 5-formylcytosine; phosphorothioate; 7-methylguanine; and 5-glucosylmethylcytosine.

[0065] definition As used herein, the term "antibody" refers to a molecule that specifically binds to or is immunologically reactive with a particular antigen and contains at least the variable domain of a heavy chain, usually at least the variable domains of an immunoglobulin heavy and light chains. Antibodies and antigen-binding fragments, variants, or derivatives thereof include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, primatized, or chimeric antibodies, heteroconjugate antibodies (e.g., bispecific, trispecific, and tetraspecific antibodies, diabodies, triabodies, and tetrabodies), single domain antibodies (sdAbs), epitope-binding fragments such as Fab, Fab', and F(ab')2, Fd, Fvs, single chain Fvs (scFv), rlgG, single chain antibodies, disulfide-linked Fvs (sdFv), fragments containing either the VL or VH domain, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies. The antibody molecules of the present invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule. Furthermore, unless otherwise specified, the term "monoclonal antibody" (mAb) is meant to include both intact molecules as well as antibody fragments (such as, for example, Fab and F(ab')2 fragments) that are capable of specifically binding to a target protein. Fab and F(ab')2 fragments lack the Fc fragment of an intact antibody.

[0066] As used herein, the term "bacteriophage packaging site" refers to a nucleic acid sequence in a bacteriophage genome sufficient to direct packaging into a virion. The bacteriophage packaging site can be derived, for example, from bacteriophage P1, T4, T7, or λ.

[0067] As used herein, the term "carrier" refers to a compound, composition, reagent, or molecule that facilitates or promotes the transport or delivery of a composition (e.g., ssDNA as described herein) into a cell. For example, a carrier can be a partial or complete encapsulating agent.

[0068] As used herein, the term "circular" in relation to ssDNA described herein means ssDNA lacking free ends. Circular ssDNA may be covalently closed or may form a closed circular structure without free DNA ends by non-covalent interactions, for example, ssDNA may be closed through a splint, e.g., a nucleic acid (e.g., DNA or RNA) splint, through a moiety such as a protein that binds and holds together both ends of the linear ssDNA, or through the binding of multiple proteins (two of which each bind to a different ssDNA end and then bind to each other or to a third moiety) to close the DNA structure. The term circular does not imply a ssDNA structure lacking a circular physical form or intramolecular structure; circular ssDNA may have regions of intramolecular double-stranded or other structures.

[0069] As used herein, the term "covalently closed" in reference to ssDNA means that the ssDNA is a continuous strand lacking free 5' or 3' ends.

[0070] As used herein, the term "exonuclease III" refers to the protein exonuclease III, or a fragment or variant thereof, encoded by the E. coli genome, which catalyzes the removal of nucleotides from the 3' end of DNA, e.g., at an end or nick in the DNA. In some embodiments, exonuclease III has an amino acid sequence represented in NCBI reference sequence NP_416263.1 (incorporated herein by reference in its entirety), or a sequence having at least 75%, 80%, 85%, 90%, 95% or 98% identity thereto.

[0071] As used herein, the term "T5 exonuclease" refers to a protein encoded by the D15 gene of T5 bacteriophage, or a fragment or variant thereof, that catalyzes the removal of nucleotides from the 5' end of DNA, e.g., at an end or a nick in the DNA. In some embodiments, the T5 exonuclease has an amino acid sequence represented in NCBI reference sequence YP_006958.1, or a sequence having at least 75%, 80%, 85%, 90%, 95%, or 98% identity thereto.

[0072] As used herein, the term "T7 exonuclease" refers to a protein encoded by gene 6 of the T7 bacteriophage, or a fragment or variant thereof, that catalyzes the removal of nucleotides from the 5' end of DNA, e.g., at an end or a nick in the DNA. In some embodiments, the T7 exonuclease has an amino acid sequence represented in the NCBI reference sequence NP_041988.1, or a sequence having at least 75%, 80%, 85%, 90%, 95% or 98% identity thereto.

[0073] As used herein, the term "heterologous" when used to describe a first element in relation to a second element means that the first element and the second element are not naturally occurring in the arrangement as described. For example, a heterologous polypeptide, nucleic acid molecule, construct or sequence refers to (a) a polypeptide, nucleic acid molecule, or a portion of a polypeptide or nucleic acid molecule sequence that is not native to the cell in which it is expressed, (b) a polypeptide or nucleic acid molecule, or a portion of a polypeptide or nucleic acid molecule that is modified or mutated compared to its native state, or (c) a polypeptide or nucleic acid molecule that has an altered expression compared to the native expression level under similar conditions. For example, a heterologous regulatory sequence (e.g., promoter, enhancer) can be used to regulate a gene or nucleic acid molecule in a manner different from how the gene or nucleic acid molecule is normally expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., a DNA-binding domain of a polypeptide or a nucleic acid encoding a DNA-binding domain of a polypeptide) can be arranged relative to other domains or can be of a different sequence or derived from a different source compared to other domains or portions of the polypeptide or its encoding nucleic acid. In certain embodiments, a heterologous nucleic acid molecule may be present in the native host cell genome, but may have an altered expression level or a different sequence, or both. In other embodiments, a heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but may instead be introduced into the host cell by transformation (e.g., transfection, electroporation), where the added molecule may integrate into the host genome, or may exist as extrachromosomal genetic material, either transiently (e.g., mRNA) or semi-stable for two or more generations (e.g., episomal viral vectors, plasmids, or other self-replicating vectors).

[0074] As used herein, the terms "increase" and "decrease" refer to modulation that results in an increase or decrease in the amount of an indicator of function, expression, or activity, respectively, compared to a reference. For example, after administration of ssDNA in the methods described herein, the amount of an indicator described herein (e.g., a level of gene expression, or a marker of innate immunity) can be increased or decreased in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more compared to the amount of the marker before administration, such as modified ssDNA compared to unmodified sDNA, or compared to administration of a control ssDNA. In general, the indicator is measured after administration, at a time when administration has had the recited effect, for example, at least 1 day, 1 week, 1 month, 3 months, or 6 months after the treatment regimen has begun.

[0075] As used herein, the term "intramolecular complementarity" refers to the ability of two regions within a single DNA strand to hybridize through complementary base pairing and / or form a double-stranded structure. Depending on how close the portions of the sequence that are self-complementary are, the ssDNA may form, for example, hairpin loops, junctions, bulges, or internal loops.

[0076] As used herein, the term "linear" when used to describe DNA means DNA that contains two free ends. Linear DNA can be single-stranded or double-stranded.

[0077] As used herein, the term "maintenance sequence" refers to a DNA sequence or motif that allows or facilitates the retention of a DNA molecule in the nucleus through cell division. Maintenance sequences typically allow the replication and / or transcription of DNA in the nucleus by interacting with proteins that facilitate chromatin looping. An example of a maintenance sequence is a scaffold / matrix attachment region (S / MAR element).

[0078] As used herein, a "nuclear targeting sequence" is a DNA sequence that enables or facilitates DNA entry into the nucleus of a target cell.

[0079] As used herein, a "nicking recognition site" refers to a DNA sequence that is specifically recognized and nicked by a nicking endonuclease.

[0080] As used herein, a "pharmaceutical composition" or "pharmaceutical formulation" is a composition or formulation adapted for human pharmaceutical use, e.g., prophylactic, diagnostic or therapeutic use in humans. A pharmaceutical formulation contains an active agent that has a biological effect on a cell or tissue of a subject, e.g., has pharmacological activity or effect in the alleviation, treatment or prevention of a disease, in combination with a pharmaceutical acceptable excipient or diluent. A pharmaceutical composition also refers to a finished dosage form or formulation of a prophylactic, diagnostic or therapeutic composition.

[0081] As used herein, the term "second strand motif" or SSM is a sequence or structural motif in ssDNA that promotes or enables second strand synthesis. SSMs may contain binding sites for proteins that initiate second strand DNA synthesis and / or position the DNA in the proper orientation for DNA polymerase binding.

[0082] As used herein, a "sense strand" ssDNA sequence is a ssDNA that has the same sequence as an mRNA encoding a functional protein and does not function as a template for transcription. An "antisense strand" ssDNA sequence has a sequence complementary to an mRNA encoding a functional protein and / or can function as a template for transcription.

[0083] As used herein, the term "single-stranded DNA" or ssDNA refers to a DNA molecule that consists of a single strand of deoxyribonucleotides. ssDNA may have paired self-complementary regions that form intramolecular / intrastrand double-stranded motifs in a folded structure. Depending on how close the self-complementary portions of the sequence are, ssDNA may form, for example, hairpin loops, junctions, bulges, or internal loops.

[0084] As used herein, "treatment" and "treating" refer to the medical treatment of a subject intended to improve, ameliorate, stabilize (i.e., not worsen), prevent, or cure a disease, condition, or disorder. This term includes active treatment (treatment aimed at improving the disease, condition, or disorder), causal treatment (treatment directed at the cause of the associated disease, condition, or disorder), palliative care (treatment directed at the relief of symptoms), preventive treatment (treatment aimed at minimizing or partially or completely suppressing the occurrence of the associated disease, condition, or disorder); and supportive care (treatment used to complement another therapy). Treatment also includes the reduction of the extent of a disease or condition, whether detectable or undetectable; the prevention of the spread of a disease or condition; the delay or slowing of the progression of a disease or condition; the amelioration or palliation of a disease or condition; and remission (whether partial or complete). "Ameliorating" or "alleviating" a disease or condition means reducing the severity and / or undesirable clinical symptoms of the disease, disorder, or condition and / or slowing or prolonging the time course of progression compared to the severity or time course in the absence of treatment. "Treatment" can also mean prolonging survival compared to expected survival in the absence of treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to the condition or disorder or those in whom the condition or disorder is to be prevented. [Brief description of the drawings]

[0085] [Figure 1-1]

[0023] Figure 1A is a series of line diagrams showing exemplary ssDNA designs described herein. (Figure 1A) An ssDNA construct containing multiple effector DNA sequence types, in this case miRNA and a model protein (mCherry), operably linked to the EF1a promoter. (Figure 1B) An ssDNA construct containing a promoter and a sequence encoding a polypeptide effector (in this case the model protein mCherry). [Figure 1-2] A series of line diagrams showing exemplary ssDNA designs described herein. (FIG. 1C) An ssDNA construct comprising a nuclear targeting sequence, a promoter, and a sequence encoding an RNA effector. (FIG. 1D) An ssDNA construct comprising a promoter, a sequence encoding a polypeptide, and a second strand motif. (FIG. 1E) An ssDNA construct comprising a nuclear targeting sequence, a promoter operably linked to a sequence encoding a polypeptide, a maintenance sequence, and a second strand motif. [Diagram 2] FIG. 1 is a schematic diagram of an exemplary production process for circular ssDNA described herein. [Diagram 3] A series of traces obtained using a Fragment Analyzer for blank wells (Figure 3) and preparations of Construct 029 circular ssDNA (Figure 4), Construct 029 circular dsDNA (Figure 5), Construct 001 circular dsDNA (Figure 6), Construct 001 circular ssDNA prep #1 (Figure 7), and Construct 001 circular ssDNA prep #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 4] A series of traces obtained using a Fragment Analyzer for blank wells (Figure 3) and preparations of Construct 029 circular ssDNA (Figure 4), Construct 029 circular dsDNA (Figure 5), Construct 001 circular dsDNA (Figure 6), Construct 001 circular ssDNA prep #1 (Figure 7), and Construct 001 circular ssDNA prep #2 (Figure 8). LM: lower marker, UM: upper marker. [Diagram 5]A series of traces obtained using a Fragment Analyzer for blank wells (Figure 3) and preparations of Construct 029 circular ssDNA (Figure 4), Construct 029 circular dsDNA (Figure 5), Construct 001 circular dsDNA (Figure 6), Construct 001 circular ssDNA prep #1 (Figure 7), and Construct 001 circular ssDNA prep #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 6] A series of traces obtained using a Fragment Analyzer for blank wells (Figure 3) and preparations of Construct 029 circular ssDNA (Figure 4), Construct 029 circular dsDNA (Figure 5), Construct 001 circular dsDNA (Figure 6), Construct 001 circular ssDNA prep #1 (Figure 7), and Construct 001 circular ssDNA prep #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 7] A series of traces obtained using a Fragment Analyzer for blank wells (Figure 3) and preparations of Construct 029 circular ssDNA (Figure 4), Construct 029 circular dsDNA (Figure 5), Construct 001 circular dsDNA (Figure 6), Construct 001 circular ssDNA prep #1 (Figure 7), and Construct 001 circular ssDNA prep #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 8] A series of traces obtained using a Fragment Analyzer for blank wells (Figure 3) and preparations of Construct 029 circular ssDNA (Figure 4), Construct 029 circular dsDNA (Figure 5), Construct 001 circular dsDNA (Figure 6), Construct 001 circular ssDNA prep #1 (Figure 7), and Construct 001 circular ssDNA prep #2 (Figure 8). LM: lower marker, UM: upper marker. [Figure 9] The trace was obtained by adding 7.8 pg of Construct 001 circular dsDNA per 1 ng of Construct 001 circular ssDNA. The peak corresponding to the circular dsDNA is indicated by an arrow. [Figure 10]A series of DNA gel electrophoresis images are shown. Figure 10A is an image of a DNA gel containing a DNA ladder (lane 1) and nicked DNA (lane 2). The sizes of the nicked DNA constructs are indicated by arrows. Figure 10B is an image of a DNA gel containing a DNA ladder (lane 1) and nicked DNA incubated with T7 exonuclease at 25°C for 16 hours (lane 2), 1 hour (lane 3), and 30 minutes (lane 4). The sizes of the ssDNA constructs are indicated by arrows. [Figure 11] 1 is a DNA gel electrophoresis image showing circular and linear ssDNA incubated in the absence (-) and presence (+) of Exonuclease I. Circular ssDNA preparations were resistant to degradation by Exonuclease I, while linear ssDNA was degraded in the presence of Exonuclease I. [Figure 12A] FIG. 12 is a series of graphs showing expression of circular ssDNA constructs in HEK293 (FIG. 12A), HepG2 (FIG. 12B), U2OS (FIG. 12C), and HEKa cells (FIG. 12D). Details of the circular ssDNA constructs can be found in Table 5. The x-axis shows the percentage of reporter (mCherry) positive cells, and the y-axis shows the fluorescence intensity of cells normalized to the expression of Construct 001 plasmid. "C1" corresponds to Construct 001, "C2" corresponds to Construct 002, etc. [Figure 12B] Same as above [Figure 12C] Same as above [Figure 12D] Same as above [Figure 13]

[0036] Figure 13 is a series of graphs showing the percentage of HEKa cells expressing mCherry after lipofection with construct 001. Construct 001 was produced as circular ssDNA and circular dsDNA, and the relative molar concentrations of ssDNA or dsDNA are indicated (e.g., 1x, 2x, or 4x). Figure 13A shows the percentage of HEKa cells expressing mCherry at 3 days post-lipofection, and Figure 13B shows the average percentage of mCherry+ cells at 6 hours, 1 day, and 3 days post-transfection. [Figure 14]14A-E are a series of graphs showing mRNA levels of IFNβ (FIG. 14A), IL-6 (FIG. 14B), CXCL10 (FIG. 14C), TNFα (FIG. 14D), and IL1B (FIG. 14E) in HEKa cells following lipofection with construct 001. Construct 001 was produced as circular ssDNA and circular dsDNA, and the relative molar concentrations of ssDNA or dsDNA are shown (e.g., 1x, 2x, or 4x). mRNA levels were normalized to a lipofectamine only control, and mRNA levels relative to GAPDH are shown. [Figure 15] FIG. 13 is a graph showing the percentage of mCherry+ cells following transfection with two forms of construct 001: unmodified single-stranded circular DNA, and single-stranded circular with m6A (N6-methyladenosine) DNA modification. [Figure 16] 1 shows the secondary structure prediction of the circular single stranded DNA form of construct 001. Construct 001 has the following sequence: [ka] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0086] The present disclosure relates to compositions and methods for providing an effector, e.g., a therapeutic effector, to a cell, tissue or subject, e.g., in vivo or in vitro. The effector can be a DNA sequence, a polypeptide, e.g., a therapeutic protein; or RNA, e.g., a regulatory RNA or mRNA.

[0087] Elements of DNA constructs The ssDNA constructs described herein contain sufficient elements to deliver the effector sequence to a target cell, tissue, or subject. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the ssDNA drives expression of the effector, for example, includes a promoter and a sequence encoding an RNA or polypeptide, for example, a therapeutic RNA or polypeptide. In some embodiments, the DNA constructs described herein further contain one or more of a nuclear targeting sequence, a maintenance sequence, and a second strand motif.

[0088] promoter The ssDNA constructs described herein may contain a promoter (a DNA sequence to which RNA polymerase and transcription factors bind, directly or indirectly, to initiate transcription) operably linked to an effector sequence. The promoter may be one found in nature operably linked to the effector sequence or may be heterologous to the effector sequence. The promoters described herein may be native to the target cell or tissue or may be heterologous to the target cell or tissue. The promoter may be constitutive, inducible and / or tissue specific.

[0089] Examples of constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al, Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter.

[0090] Inducible promoters allow for the regulation of expression and may be regulated by exogenously supplied compounds, environmental factors such as temperature, or by the presence of certain physiological conditions, e.g., acute phase, a particular differentiation state of the cell, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of sources. Examples of inducible promoters regulated by an exogenously supplied promoter include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline-repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268:1766-1769 (1995), Harvey et al., Science, 268:1766-1769 (1995), and the like. al, Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)).

[0091] In some embodiments, the native promoter of the effector-encoding sequence may be used. Other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used.

[0092] In some embodiments, the regulatory sequence confers tissue-specific gene expression capability. In some cases, the tissue-specific regulatory sequence binds to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synapsin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, alpha-myosin heavy chain (a-MHC) promoter, or cardiac troponin T (cTnT) promoter. Other exemplary promoters include the β-actin promoter, the Hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); the α-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), the bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); the bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), the CD2 promoter (Hansal et al., J. Bone Miner. Res., 11:654-64 (1996)), among others known to those of skill in the art. al., J. Immunol., 161:1063-8 (1998); immunoglobulin heavy chain promoters; T cell receptor α-chain promoters, neuronal cells, such as the neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), the neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)).

[0093] Examples of tissue / cell specific promoters are listed in Table 1:

[0094] [Table 1-1]

[0095] [Table 1-2]

[0096] Effector Array The effector sequences of the ssDNA constructs described herein can be, for example, functional DNA sequences, e.g., therapeutically functional DNA sequences, used in combination with, e.g., gene editors, base editors, prime editors, gene writers, mobile genetic element proteins; DNA sequences encoding therapeutic peptides, polypeptides or proteins; DNA sequences encoding therapeutic RNAs (e.g., non-coding RNAs); or DNA templates for genome engineering.

[0097] DNA effectors: The therapeutically functional DNA sequence may be a DNA sequence that forms a functional structure, such as a DNA sequence that includes a DNA aptamer, a DNAzyme, or an allele-specific oligonucleotide (DNA ASO). The therapeutically functional DNA sequence may not have a promoter operably linked to it. In embodiments, the ssDNA constructs or sequences described herein may include one or more functional DNA sequences, such as 2, 3, 4, 5, 6, or more sequences, which may be the same or different.

[0098] Polypeptide effectors: The DNA sequence encoding a therapeutic polypeptide may be a DNA sequence encoding one or more effectors that are peptides, proteins, or combinations thereof. For example, the DNA sequence encodes an mRNA. The peptide or protein can be a transcription factor; a chromatin remodeling factor; an antigen; a hormone; an enzyme (a nuclease, e.g., an endonuclease, e.g., a nuclease component of the CRISPR system, e.g., Cas9, dCas9, Cas9-nickase, Cpf / Cas12a, etc.); a Crispr ligase, e.g., a base editor or a prime editor; a mobile genetic element protein (e.g., a transposase, a retrotransposase, a recombinase, an integrase); a gene writer; a polymerase; a methylase; a demethylase; an acetylase; a deacetylase; a kinase; a phosphatase; a ligase; a deubiquitinase; an integrase; a recombinase; a topoisomerase; a gyrase; a helicase; a lysosomal acid hydrolase); an antibody; a receptor ligand; a receptor; a coagulation factor; a membrane protein; a mitochondrial protein; a nuclear protein; an antibody or other protein scaffold binding agent, such as a sentinelin, a darpin, or an adnectin. See, e.g., Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60:1, 391-415.

[0099] In embodiments, the ssDNA constructs or sequences described herein may include one or more sequences encoding a polypeptide, e.g., two, three, four, five, six, or more sequences encoding a polypeptide. Each of the plurality may encode the same or different proteins. For example, the ssDNA constructs or sequences described herein may include a plurality of sequences encoding multiple proteins, e.g., multiple proteins in a biological pathway.

[0100] In some embodiments, the ssDNA constructs or sequences described herein may include multiple sequences encoding polypeptides, e.g., 2, 3, 4, 5, 6, or more sequences encoding polypeptides, separated by a self-cleaving peptide, e.g., P2A, T2A, E2A, or F2A. The self-cleaving peptides are 18-22 amino acids in length and may induce ribosomal skipping during protein translation such that two polypeptides may be encoded in the same transcript. Each of the polypeptides may encode the same or different proteins. In one embodiment, the ssDNA constructs or sequences described herein may include a promoter, followed by a sequence encoding a first polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, and a polyA tail. In another embodiment, the ssDNA constructs or sequences described herein may include a promoter followed by a sequence encoding a first polypeptide of interest, a sequence encoding a first 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, a sequence encoding a second 2A self-cleaving peptide, a sequence encoding a third polypeptide of interest, and a polyA tail.

[0101] RNA effectors: The effector sequence may be a DNA sequence encoding one or more of non-coding RNA, such as small interfering RNA (siRNA), microRNA (miRNA), long non-coding RNA, piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), small specific Cajal body RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), RNA aptamer, and small nuclear RNA (snRNA).

[0102] In some embodiments, the ssDNA constructs or sequences disclosed herein include one or more expression sequences that code for regulatory RNA, e.g., RNA that modulates the expression of endogenous and / or foreign genes. In some embodiments, the ssDNA constructs or sequences disclosed herein may include sequences that are antisense to regulatory nucleic acids, such as, but not limited to, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and non-coding RNA, such as hnRNA. In one embodiment, the regulatory nucleic acid targets a host gene. Regulatory nucleic acids may include, but are not limited to, endogenous genes, e.g., antisense RNA, nucleic acids that hybridize to guide RNA, nucleic acids that hybridize to exogenous nucleic acids, such as viral DNA or RNA, nucleic acids that hybridize to RNA, nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, nucleic acids that stabilize RNA or destabilize RNA, such as by targeting for degradation, and nucleic acids that regulate DNA or RNA binding factors. In one embodiment, the sequence is an miRNA. In some embodiments, the regulatory nucleic acid targets the sense strand of the host gene. In some embodiments, the regulatory nucleic acid targets the antisense strand of the host gene.

[0103] In some embodiments, the ssDNA constructs or sequences disclosed herein encode guide RNAs. Guide RNA sequences are generally designed to have a length of 15-30 nucleotides (e.g., 17, 19, 20, 21, 24 nucleotides) and to be complementary to the targeted nucleic acid sequence. Custom gRNA generators and algorithms are commercially available for use in designing effective guide RNAs. Gene editing has also been achieved using chimeric "single guide RNAs" ("sgRNAs"), which are engineered (synthetic) single RNA molecules that mimic the naturally occurring crRNA-tracrRNA complex and contain both tracrRNA (to bind nucleases) and at least one crRNA (to guide nucleases to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective for genome editing; see, e.g., Hendel et al. (2015) Nature Biotechnol., 985-991. The gRNA can recognize a specific DNA sequence (e.g., a sequence adjacent to or within a promoter, enhancer, silencer, or repressor of a gene). In one embodiment, the gRNA is used as part of a CRISPR system for gene editing. For gene editing, the ssDNA constructs or sequences disclosed herein can be designed to include one or more sequences that code for guide RNA sequences that correspond to the desired target DNA sequence; see, e.g., Cong et al. (2013) Science, 339:819-823; Ran et al. (2013) Nature Protocols, 8:2281-2308.

[0104] The disclosed ssDNA constructs or sequences may encode specific regulatory nucleic acids that can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules typically contain 15-50 base pairs (such as about 18-25 base pairs) and include RNA or RNA-like structures with nucleobase sequences that are identical (complementary) or nearly identical (substantially complementary) to coding sequences in target genes expressed in cells. Such RNAi molecules include, but are not limited to: small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), meroduplex, and dicer substrates (U.S. Pat. Nos. 8,084,599, 8,349,809, and 8,513,207), RNA antisense oligonucleotides (RNA ASO).

[0105] In one embodiment, the ssDNA construct or sequence disclosed herein comprises a sequence comprising the sense strand of a lncRNA.In one embodiment, the ssDNA construct or sequence disclosed herein comprises a sequence encoding the antisense strand of a lncRNA.

[0106] The ssDNA constructs or sequences disclosed herein may encode regulatory nucleic acids that are substantially complementary or completely complementary to a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acid may complement sequences at the boundaries between introns and exons, between exons, or adjacent to exons to prevent the maturation of the newly generated nuclear RNA transcript of a particular gene into mRNA for transcription. A regulatory nucleic acid complementary to a particular gene can hybridize with the mRNA for that gene and prevent its translation. An antisense regulatory nucleic acid can be DNA, RNA, or derivatives or hybrids thereof. In some embodiments, the regulatory nucleic acid comprises a protein binding site that can bind to a protein involved in regulating the expression of an endogenous or foreign gene.

[0107] The length of the ssDNA constructs or sequences disclosed herein that can encode regulatory nucleic acids that hybridize to a transcript of interest can be about 5-30 nucleotides, about 10-30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0108] The ssDNA constructs or sequences disclosed herein may encode a microRNA (miRNA) molecule identical to about 5 to about 30 contiguous nucleotides of a target gene. In some embodiments, the miRNA sequence targets an mRNA, starts with the dinucleotide AA, contains about 30-70% (about 30-60%, about 40-60%, or about 45%-55%) GC content, and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the mammal into which it is introduced, as determined, for example, by a standard BLAST search. In some embodiments, the ssDNA constructs or sequences disclosed herein encode at least one miRNA, e.g., 2, 3, 4, 5, 6, or more. In some embodiments, the ssDNA construct or sequence disclosed herein comprises a sequence encoding a miRNA or a sequence complementary to a target sequence with at least about 75%, 80%, 85%, 90% 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any one of the nucleotide sequences. Lists of known miRNA sequences can be found in databases maintained by research institutions such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, the Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are easily designed by techniques known in the art. In addition, there are computational tools that increase the chances of discovering effective and specific sequence motifs (see, for example, Lagana et al., Methods Mol.Bio., 2015, 1269:393-412).

[0109] The ssDNA constructs or sequences disclosed herein may regulate the expression of RNA encoded by a gene. Because multiple genes may share some degree of sequence homology to each other, in some embodiments, the ssDNA constructs or sequences disclosed herein may be designed to target a class of genes with sufficient sequence homology. In some embodiments, the ssDNA constructs or sequences disclosed herein may contain sequences that have complementarity to sequences that are shared between different gene targets or that are unique to a particular gene target. In some embodiments, the ssDNA constructs or sequences disclosed herein may be designed to target conserved regions of RNA sequences that have homology between several genes, thereby targeting several genes in a gene family (e.g., different gene isoforms, splice variants, mutant genes, etc.). In some embodiments, the ssDNA constructs or sequences disclosed herein may be designed to target sequences that are unique to a particular RNA sequence of a single gene.

[0110] In embodiments, the effector sequence encoding the regulatory RNA has a length of less than 5000 bps (e.g., less than about 5000 bps, 4000 bps, 3000 bps, 2000 bps, 1000 bps, 900 bps, 800 bps, 700 bps, 600 bps, 500 bps, 400 bps, 300 bps, 200 bps, 100 bps, 50 bps, 40 bps, 30 bps, 20 bps, 10 bps, or less). In some embodiments, the effector sequences, independently or in addition, are more than 10 bps (e.g., at least about 10 bps, 20 bps, 30 bps, 40 bps, 50 bps, 60 bps, 70 bps, 80 bps, 90 bps, 100 bps, 200 bps, 300 bps, 400 bps, 500 bps, 600 bps, 700 bps, 800 bps, 900 bps, 1000 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, , 1.7kb, 1.8kb, 1.9kb, 2kb, 2.1kb, 2.2kb, 2.3kb, 2.4kb, 2.5kb, 2.6kb, 2.7kb, 2.8kb, 2.9kb, 3kb, 3.1kb, 3.2kb, 3.3kb, 3.4kb, 3.5kb, 3.6kb, 3.7kb, 3.8kb, 3.9kb, 4kb, 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8kb, 4.9kb, 5kb or more in length.

[0111] In some embodiments, the ssDNA construct or sequence disclosed herein comprises one or more of the features described herein above, such as one or more structural DNA sequences, one or more peptide or protein coding sequences, one or more regulatory element coding sequences, one or more regulatory nucleic acid coding sequences, such as one or more non-coding RNAs, other expression sequences, and any combination of the above. The constructs described herein may have one or more effector sequences, such as two, three, four, five or more effector sequences. In the case of multiple effector sequences in a single construct, the effector sequences may be the same or different.

[0112] In one embodiment, the ssDNA comprises a therapeutically functional structural DNA sequence. In one embodiment, the ssDNA comprises a promoter and a sequence encoding a therapeutic peptide, polypeptide, or protein as described herein. In one embodiment, the ssDNA comprises a promoter and a sequence encoding a regulatory RNA as described herein.

[0113] In some embodiments, the effector sequence encoding a polypeptide or protein is codon-optimized, e.g., codon-optimized for expression in a mammal, e.g., a human. In general, codon optimization involves modifying a nucleic acid sequence for enhanced expression in a host cell of interest by replacing at least one codon (e.g., one or more, e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons; e.g., at least 1%, 5%, 10%, 20%, 25%, 50%, 60%, 70%, 80%, 90% or 100%) of the native sequence with a codon that is more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Codon usage tables are available, for example, in the "Codon Usage Database" available at http: / / www.kazusa.or.jp / codon / . These tables can be adapted in a number of ways, see, e.g., Nakamura et al., 2000, Nucl. Acids Res. 28:292. Computer algorithms are also available, e.g., Gene Forge, for codon-optimizing a particular sequence for expression in a particular host cell.

[0114] DNA template: The DNA sequence can be a template for a genome engineering enzyme (nuclease, e.g., an endonuclease, e.g., a nuclease component of the CRISPR system, e.g., Cas9, dCas9, aCas9-nickase, Cpf / Cas12a, etc.), a Crispr ligase, e.g., a base editor or a prime editor; a mobile genetic element protein (e.g., a transposase, a retrotransposase, a recombinase, an integrase); a gene writer; a polymerase). The DNA template can include one or more sequences bound by the genome engineering enzyme, e.g., a DNA binding domain sequence, a sequence targeted by a guide RNA, an inverted repeat, an inverted terminal repeat, a long terminal repeat, a left terminal sequence (LTS), a right terminal sequence (LTR), an untranslated region, a binding site (attP, attB, attL, attR, etc.), a lox site (LoxP, loxB, etc.). The DNA template may include sequences that are homologous to sequences in the genome, sequences that are non-homologous to sequences in the genome, or combinations thereof. The template may be a substrate for DNA repair, such as non-homologous end joining, homologous recombination, or microhomology-mediated end joining. The DNA template may include mechanisms for expressing genes or RNA, such as enhancers, promoters, protein coding regions, RNA coding regions. In some embodiments, the sequences bound by the genome engineering enzyme are placed on either side of a functional DNA sequence that is inserted into the genome or used as a template for genome repair. In some embodiments, one or both of the sequences bound by the genome engineering enzyme are inserted into the genome, and in some embodiments, they are not inserted. In embodiments, the ssDNA constructs or sequences described herein may include one or more functional template sequences, such as 2, 3, 4, 5, 6, or more sequences, which may be the same or different.

[0115] Nuclear targeting sequence (NTS) The DNA constructs or sequences disclosed herein may contain a nuclear targeting sequence (NTS) that facilitates transport of DNA from the cytoplasm of a cell into the nucleus. The NTS contains binding sites for proteins (e.g., transcription factors, chaperones, etc.) that bind to importins that transport cargo into the nucleus through the nuclear pore complex. In embodiments, the NTS may function generally (e.g., SV40 enhancer NTS). In other embodiments, the NTS may be cell or tissue specific, for example, containing binding sites for transcription factors expressed in a unique cell type, targeting the ssDNA sequences or constructs described herein to the nucleus in a cell-specific manner (e.g., SRF, Nkx3). The NTS may be functional at multiple locations in the ssDNA or constructs described herein, for example, before the promoter and / or after the effector sequence.

[0116] The NTS can be of viral or non-viral origin. NTSs are described, for example, in Le Guen et al. 2021. Nucleic Acids Vol. 24: 477-486. Examples of NTSs are disclosed in Table 2:

[0117] [Table 2]

[0118] Nuclear transport proteins In some embodiments, the ssDNA (e.g., as described herein) can be transported into the nucleus, for example, by a nuclear transport protein (e.g., a nuclear transport protein listed in Table 2B). In some embodiments, the ssDNA (e.g., as described herein) can be bound by a nuclear transport protein (e.g., a nuclear transport protein listed in Table 2B). In some embodiments, the ssDNA (e.g., as described herein) comprises a recognition sequence for a nuclear transport protein (e.g., listed in any one row of Table 2B). In some embodiments, the ssDNA (e.g., as described herein) comprises a recognition sequence listed in Table 2B or a nucleic acid sequence having at least 75%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0119] Exemplary transport proteins include, for example, basic helix-loop-helix (bHLH) proteins, heterogeneous nuclear ribonucleoprotein (hnRNP) isoforms, nuclear factor I (NFI) proteins, such as those listed in Table 2B. In some embodiments, the bHLH protein comprises an acetylcholine receptor subunit, for example, an alpha subunit, for example, CHRNA1, CHRNA2, CHRNA3, CHRNA4, CHRNA5, or CHRNA7. In some embodiments, the acetylcholine receptor subunit comprises a gamma or epsilon subunit. In some embodiments, the transport protein comprises desmin. In some embodiments, the transport protein comprises an hnRNP, for example, hnRNP A1, hnRNP C, hnRNP K, hnRNP U. In some embodiments, the transport protein comprises an importin. In some embodiments, the transport protein comprises a myosin light chain. In some embodiments, the transport protein comprises NFI. In some embodiments, the transport protein comprises NFKB. In some embodiments, the transport protein comprises a nucleoside diphosphate kinase, for example, NM23-H2. In some embodiments, the transport protein comprises Oct1. In some embodiments, the transport protein comprises Oct2.

[0120] In some embodiments, the transport protein comprises SRF. In some embodiments, the transport protein comprises TEF-1. In some embodiments, the transport protein comprises AP2. In some embodiments, the transport protein comprises a troponin, e.g., troponin I, e.g., troponin I 2. In some embodiments, the transport protein comprises TTF-1. In some embodiments, the transport protein comprises a Ran binding protein, e.g., RanBP3 or RanBP1. In some embodiments, the transport protein comprises a homeobox transcription factor, e.g., Chx10.

[0121] In some embodiments, the transport factor specifically binds to an E-box, a DTS (e.g., SV40 DTS or SMGA DTS), a promoter (e.g., SP-C promoter or htk promoter), a telomere, an ATTT motif, a cell cycle regulatory unit (CCRU), a CT3 sequence, an S / MAR, a topoisomerase II consensus sequence, an ARS consensus sequence, 3NF, or a viral origin of replication (ori) (e.g., the EBV oriP site).

[0122] [Table 2B-1]

[0123] [Table 2B-2]

[0124] [Table 2B-3]

[0125] [Table 2B-4]

[0126] [Table 2B-5]

[0127]

Table 2B-6

[0128]

Table 2B-7

[0129]

Table 2B-8

[0130]

Table 2B-9

[0131]

Table 2B-10

[0132]

Table 2B-11

[0133]

Table 2B-12

[0134]

Table 2B-13

[0135]

Table 2B-14

[0136]

Table 2B-15

[0137]

Table 2B-16

[0138]

Table 2B-17

[0139]

Table 2B-18

[0140]

Table 2B-19

[0141]

Table 2B-20

[0142]

Table 2B-21

[0143]

Table 2B-22

[0144]

Table 2B-23

[0145]

Table 2B-24

[0146]

Table 2B-25

[0147] [Table 2B-26]

[0148] [Table 2B-27]

[0149] [Table 2B-28]

[0150] [Table 2B-29]

[0151] [Table 2B-30]

[0152] Maintenance sequence The DNA constructs or sequences disclosed herein may include maintenance sequences that support or enable sustained gene expression through successive series of cell divisions and / or progenitor cell differentiation in the host cell for the ssDNA or constructs of the invention. In an embodiment, the maintenance sequence is a nucleoskeletal / matrix attachment region (S / MAR). S / MAR elements are diverse AT-rich sequences ranging from 60-500 bp that are conserved across species and are thought to anchor chromatin to nuclear matrix proteins during interphase (Bode et al. 2003. Chromosome Res 11, 435-445. S / MARs may be incorporated into the ssDNA or constructs described herein to promote long-term transgene expression and extrachromosomal maintenance. In one embodiment, the maintenance sequence is a nucleoskeletal / matrix attachment region (S / MAR) that is conserved across species and is ... MAR (5'tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3'). In embodiments, S / MARs useful in the constructs described herein can be found by searching MARome at http: / / bioinfo.net.in / MARome and are also described in Narwade et al. 2019. Nucleic Acids Research. Volume 47, Issue 14:7247-7261.

[0153] In embodiments, the ssDNA or constructs described herein are capable of replicating in mammalian cells, e.g., human cells. In some embodiments, the ssDNA or constructs described herein are maintained in a host cell, tissue, or subject through at least one cell division. For example, the ssDNA or constructs described herein are maintained in a host cell, tissue, or subject through at least 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 40, 50, or more cell divisions. In vitro cell division can be tracked by flow cytometry or microscopy. In vivo cell division can be tracked by intravital microscopy.

[0154] Second strand motif The DNA constructs or ssDNA sequences disclosed herein may also include second strand motifs. Examples of SSMs are derived from viruses or mobile genetic elements. In some embodiments, the SSM is an inverted repeat or hairpin sequence, such as an inverted terminal repeat (ITR) from a virus, such as an AAV, or a conserved 8-nucleotide hairpin in an anellovirus origin of replication. Examples of SSMs are listed in Table 3 below:

[0155] [Table 3]

[0156] In some embodiments, the SSM is a short sequence of RNA or DNA that is complementary to a region of ssDNA, e.g., an RNA primer or a DNA primer. In some embodiments, the primer is a splint sequence that joins the ends of the ssDNA described herein. In some embodiments, the RNA or DNA primer is less than 100, 75, 50, 40, 30, 25, 20, 15, 10, or 5 nucleotides. In some embodiments, the RNA or DNA primer is 5-100 nucleotides, 10-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides.

[0157] Other elements The ssDNA constructs or sequences disclosed herein may also include effector sequences, e.g., other control elements operably linked to the effector-encoding sequence in a manner that allows for its transport, localization, transcription, translation and / or expression in target cells, or promotes its degradation or inhibition of expression in non-target cells. As used herein, "operably linked" sequences include both expression control sequences adjacent to the effector-encoding sequence and expression control sequences that act in trans or at a distance that control the effector-encoding sequence. The exact nature of the regulatory sequences required for gene expression in a host cell may vary between species, tissues or cell types, but generally may include 5' untranscribed and 5' untranslated sequences involved in initiation of transcription and translation, respectively, such as TATA boxes, capping sequences, CAAT sequences, enhancer elements, etc., as appropriate. Regulatory sequences may also include enhancer sequences or upstream activator sequences as appropriate. The constructs described herein may optionally include 5' leader or signal sequences.

[0158] Modified Nucleotides The DNA constructs and compositions described herein, whether linear or cyclic, e.g., covalently closed, may have chemical modifications of the nucleobase, sugar, and / or phosphate backbone. Without wishing to be bound by theory, such modifications may be useful to protect the DNA from degradation (e.g., from exonucleases) or from the immune system of the host tissue or subject. In general, modified nucleotides have the same base pairing specificity as unmodified nucleotides, i.e., a modified adenine "A" can base pair with a thymine "T". One or more atoms of a pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino, an optionally substituted thiol, an optionally substituted alkyl (e.g., methyl or ethyl), or a halo (e.g., chloro or fluoro). In certain embodiments, the modification (e.g., one or more modifications) is present in each of the sugar and the internucleoside linkage.

[0159] In some embodiments, the ssDNA comprises at least one covalent modification. Suitable modifications are described by Sood et al. 2019.DNAmod: the DNA modification database.J Cheminform 11,30. DNAmod is an open-source database (https: / / dnamod.hoffmanlab.org) that catalogs DNA modifications and provides a single source to learn about their properties. DNAmod provides a web interface to easily browse and search these modifications. The database annotates the chemical properties and structures of all curated modified DNA bases, as well as a much larger list of candidate chemicals. DNAmod includes manual annotation of available sequencing methods, descriptions of their occurrence in nature, and provides existing and recommended nomenclature. Examples of DNA modifications useful in the methods described herein include, for example, N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5fC, f5C); 5-carboxylcytosine (ca5C, 5caC); 5-hydroxymethylcytosine (5hmC, hm5C); 5-methyldeoxycytosine (m5dC); 5-methylcytosine (5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioates; S and R phosphorothioate linkages; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); tricyclo-DNA (tcDNA).For example, see Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113:452-463; Zheng & Sheng. 2021. Synthesis of N4-methylcytidine (m4C) and N4,N4-dimethylcytidine (m42C) modified RNA. Current Protocols, 1, e248; Ohkubo et al. 2021. Chemical synthesis of modified oligonucleotides containing 5’-amino-5’-deoxy-5’-hydroxymethylthymidine residues. Current Protocols, 1, e70; Bao & Xu. 2021. Observation of Z-DNA structure via the synthesis of oligonucleotide DNA containing 8-rifluoromethyl-2-deoxyguanosine. Current Protocols, 1, e28; Skakuj et al. 2020. Automated synthesis and purification of guanidine-backbone oligonucleotides. Current Protocols in Nucleic Acid Chemistry, 81, e110.

[0160] In some embodiments, the ssDNA compositions described herein may include one or both of S phosphorothioate and R phosphorothioate modified nucleotide linkages. In one embodiment, the phosphorothioate linkages are made according to Iwamoto et al, 2017, Nature Biotechnology, Volume 35:845-851. Briefly, nucleoside 3'-oxazaphosphoridine derivative monomers undergo stereocontrolled oligonucleotide synthesis with repeated capping and sulfurization to form stereocontrolled phosphorothioate linkages. The final samples may be analyzed by reversed-phase high performance liquid chromatography (RP-HPLC) and ultra-performance liquid chromatography mass spectrometry (UPLC / MS) to determine the stereochemistry of the modifications. Nucleic acids containing phosphorothioate linkages are also commercially available.

[0161] In some embodiments, the ssDNA compositions described herein may include one or more boranophosphate modified nucleotides, for example, according to the method in Sergueev and Shaw, 1998, J Am Chem Soc, Volume 120, Issue 37:9417-9427. Briefly, in some embodiments, H-phosphonate chain elongation is followed by boronation to replace non-bridging oxygens in the phosphate backbone with borano groups. The final sample may be purified and analyzed by RP-HPLC to determine the stereochemistry of the modification. Boranophosphate modified nucleotides are also commercially available.

[0162] In some embodiments, the ssDNA compositions described herein may include one or more 5-methylcytosine modified nucleotides, for example, made according to the method in Lin et al, 2002, Mol Cell Biol, Volume 22, Issue 3:704-723. Briefly, in some embodiments, cytosine or a sequence containing cytosine is incubated with a glutathione S-transferase fusion of wild-type Dnmt3a (GST-3a) protein using unlabeled S-adenosylmethionine (AdoMet). The nucleotides may be purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. 5-methylcytosine modified nucleotides are also commercially available.

[0163] In some embodiments, the ssDNA compositions described herein may include one or more 7-methylguanine modified nucleotides. In some embodiments, the 7-methylguanine modified nucleotides are made according to the method in Jones and Robins, 1963, Purine nucleosides. III. Methylation studies of certain naturally occurring purine nucleosides, J Am Chem Soc, Volume 85:193. Briefly, in some embodiments, 2'-deoxyguanosine in dimethylsulfoxide is treated with methyl iodide. The nucleotides may be purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. In another embodiment, the 7-methylguanine modified nucleotides are made according to the method described in Hendler et al, 1970, Volume 9, Issue 21:4141:4153, and Kore and Parmar, 2006, Biochemistry, Volume 25, Issue 3:337-340. Briefly, in some embodiments, guanine 5'-diphosphate in water, instead of guanosine 5'-diphosphate, is added to dimethyl sulfate to obtain 7-methyl GDP. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the appropriate positions. 7-methylguanine modified nucleotides are also commercially available.

[0164] In embodiments, the ssDNA constructs and compositions described herein comprise between 1 and 100% modified nucleotides, between 1% and 90% modified nucleotides, between 1% and 80% modified nucleotides, between 1% and 70% modified nucleotides, between 1% and 60% modified nucleotides, between 1% and 50% modified nucleotides, between 1% and 40% modified nucleotides, between 1% and 30% modified nucleotides, between 1% and 20% modified nucleotides, between 1% and 15% modified nucleotides, between 1% and 10% modified nucleotides, between 20% and 90% modified nucleotides, between 20% and 80% modified nucleotides. In embodiments, the ssDNA constructs and compositions described herein comprise at least 1% modified nucleotides, at least 5% modified nucleotides; at least 10% modified nucleotides; at least 15% modified nucleotides; at least 20% modified nucleotides; at least 25% modified nucleotides; at least 30% modified nucleotides; at least 40% modified nucleotides; at least 50% modified nucleotides; at least 60% modified nucleotides; at least 70% modified nucleotides; at least 80% modified nucleotides; at least 85% modified nucleotides; at least 90% modified nucleotides; at least 92% modified nucleotides; at least 95% modified nucleotides; at least 97% modified nucleotides. In embodiments, the ssDNA constructs and compositions described herein comprise 0%-100% modified nucleotides of each different nucleotide, for example, 0%-100% modified T nucleotides, 0%-100% modified A nucleotides, 0%-100% modified C nucleotides, and 0%-100% modified G nucleotides for each construct.In embodiments, the ssDNA constructs and compositions described herein may comprise 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% modified nucleotides of each different nucleotide, e.g., 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% modified T nucleotides; ~100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% modified A nucleotides; 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% modified C nucleotides; or 0-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% modified G nucleotides. For example, the ssDNA construct may contain 100% modified T nucleotides, 50% modified A nucleotides, 0% modified C nucleotides, and 25% modified G nucleotides.

[0165] In embodiments, DNA modifications, e.g., modifications described herein, may be introduced into the ssDNA compositions described herein throughout the entire sequence; within elements of the sequence, e.g., elements described herein; at the 5' or 3' end; and / or within the last 10, 8, 6, 5, 4, 3, or 2 nucleotides at the 5' or 3' end.

[0166] In embodiments, the ssDNA described herein has one or more modifications that prevent the ability of the ssDNA to form a double-stranded structure, for example, the ssDNA described herein has one or more modifications on nucleotides present in regions of intramolecular complementarity. In embodiments, the ssDNA described herein has one or more modifications that prevent base pairing in regions of intramolecular complementarity compared to the unmodified sequence of the ssDNA. In some embodiments, the modified nucleotides used herein have a decreased tendency to base pair with the modified nucleotide compared to the tendency of the unmodified nucleotide to base pair with the unmodified nucleotide. In some embodiments, the modified nucleotides used herein have an increased tendency to base pair with the unmodified nucleotide compared to the modified nucleotide.

[0167] Other modifications are also contemplated. For example, the ends of the linear DNA described herein can be modified, for example, to protect them from exonucleases. For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule, and / or self-complementary oligonucleotides can be ligated to one or both ends. See, for example, Chang, et al. (1987) Proc. Nail. Acad. Sci. USA 84:4959-4963; Nehls, et al. (1996) Science 272:886-889.

[0168] In some embodiments, the ssDNA is substantially free (eg, free) of biotin.

[0169] In some embodiments, the modified ssDNA described herein exhibits reduced recognition by a DNA sensor in a host tissue or subject compared to unmodified ssDNA of the same sequence, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced recognition by a DNA sensor in a host tissue or subject compared to unmodified ssDNA of the same sequence. In some embodiments, the modified ssDNA described herein exhibits reduced degradation by a DNA nuclease compared to unmodified ssDNA of the same sequence, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced degradation by a DNA nuclease in a host tissue or subject compared to unmodified ssDNA. In some embodiments, the modified ssDNA described herein exhibits reduced activation of the innate immune system in a target / host tissue or subject, as compared to unmodified ssDNA of the same sequence, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced activation of the innate immune system in a target / host tissue or subject, as compared to unmodified ssDNA of the same sequence. In some embodiments, the modified ssDNA described herein exhibits any of the following properties in a target / host tissue or subject, as compared to unmodified ssDNA of the same sequence: increased integration of the exogenous construct into the genome of the target cell; increased retention in the target cell by replication; reduced secondary or tertiary structure formation; reduced interaction with innate immune sensors; reduced interaction with nucleases; improved stability; improved longevity; reduced toxicity; improved delivery; increased expression; increased second strand synthesis; increased transport between membranes; or increased binding to DNA-binding moieties, such as nuclear DNA-binding proteins, transcription factors, chaperones, DNA polymerases, and the like. In embodiments, any of the above listed properties are modulated by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more in a target / host tissue or subject compared to unmodified ssDNA of the same sequence.

[0170] Structure of DNA constructs In some embodiments, the ssDNA constructs or sequences disclosed herein are at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 20,000 nucleotides, at least about 30,000 nucleotides, at least about 40,000 nucleotides, at least about 50,000 nucleotides. In some embodiments, the size of the ssDNA constructs or sequences disclosed herein is of sufficient length to encode a useful polypeptide or RNA.

[0171] The ssDNA constructs described herein can be circular, e.g., covalently closed.

[0172] The ssDNA constructs described herein may have less than a threshold level of intramolecular complementarity or double-stranded structure. In one embodiment, the ssDNA does not contain more than 50, 40, 30, 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2, or 1 double-stranded region that is longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 base pairs, i.e., does not contain a region of intramolecular complementarity that is longer than 100, 80, 70, 60, 50, 40, 30, 20, or 10 base pairs. In some embodiments, the ssDNA contains 1, 2, 3, 4, 5, 7, 8, 10, 21, 14, 15, 18, or 20 double-stranded regions, e.g., the double-stranded region is 100, 80, 70, 60, 50, 40, 30, 20, or 10 base pairs or less. In one embodiment, the ssDNA does not contain a region of intramolecular complementarity longer than 100, 80, 70, 60, 50, 40, 30, or 20 base pairs, e.g., the ssDNA is not a doggybone structure, i.e., it is not a predominantly double-stranded, closed-end construct.

[0173] In some embodiments, the ssDNA does not form a double-stranded structure longer than 100 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 80 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 60 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 50 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 45 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 40 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 35 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 30 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 25 base pairs. In some embodiments, the ssDNA does not form a double-stranded structure longer than 20 base pairs. In some embodiments, the ssDNA does not include the length of the double strand recognized by cyclic GMP-AMP synthase (cGAS) in the cell. Without wishing to be bound by theory, cGAS is thought to mediate innate immunity against foreign double-stranded DNA.

[0174] In some embodiments, the ssDNA does not comprise a first sequence that hybridizes to a second sequence, the first sequence and the second sequence are at least 5, 10, 15, 20, or 25 nt in length, and the first sequence and the second sequence are positioned less than 6, 5, 4, 3, 2, or 1 nucleotide apart from each other.

[0175] In one embodiment, the double-stranded regions formed by the ssDNA described herein are determined as described by Xayaphoummine et al. 2005. Kinefold web server for RNA / DNA folding path and structure prediction including pseudoknots and knots. Nucleic Acids Research, Volume 33:W605-610. In one embodiment, the Kinefold website (http: / / kinefold.curie.fr / cgi-bin / form.pl) is used to predict the double-stranded regions of the constructs described herein using the following parameters: -Folding sequence: Enter and select "DNA sequence" Stochastic simulation: co-transcriptional folding, 3 ms · Simulated molecular time: Default Pseudoknots: Not allowed Intertwining: No intersection Random seed: 11453

[0176] In one embodiment, the double-stranded regions formed by the ssDNA described herein are determined as described by Lorenz et al. 2011. Vienna RNA Package 2.0. Algorithms for Molecular Biology, Volume 6, Article 26. In one embodiment, the RNAFold web server (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi) is used to predict the double-stranded regions of the constructs described herein using the following parameters: Folding algorithms and basic options: Minimum free energy (MFE) and partition function (default) · Avoid isolated base pairs (default)

[0177] Advanced folding options: In either case, dangling energy on both sides of the helix (default) DNA parameters (Matthews model, 2004) Apply pseudoenergies to stack pairs after SHAPE reactivity transformation (Deigan et al., 2009) (default) · Slope (m) = 1.9; Intercept (b) = -0; Rescale energy parameters for a given temperature = 3 (default) Assume that the RNA molecule is circular.

[0178] Output options · Interacting RNA secondary structure plot (default) RNA secondary structure plot with reliable annotations (partition function folding only) (default) Mountain Plot (default)

[0179] An exemplary computational folding of a single-stranded covalently closed circular DNA is shown in Figure 16. As can be seen, ssDNA can be expected to have a significant number of double-stranded regions, such as hairpins. However, the ssDNA in Figure 16 lacks long continuous stretches of double-stranded DNA. More specifically, the longest continuous dsDNA region in Figure 16 is 16 nucleotides or less in length. This construct is not expected to form double-stranded structures longer than 100 base pairs; rather, bulges, internal loops, and other structures are located between the shorter double-stranded regions.

[0180] Production In general, the ssDNA constructs of the present invention are produced from plasmids assembled to contain the desired elements described herein. Plasmid templates can be assembled using Golden Gate cloning for assembly of multiple DNA fragments in a defined linear order in a recipient vector using a one-pot assembly procedure. Golden Gate cloning is described in Marillonnet & Gruetzner, 2020, Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline, Current Protocols in Molecular Biology, 130:e115. The templates are then used to generate single-stranded DNA using methanol-responsive (MeRPy) PCR, as described, for example, in Minev et al., 2019, Rapid in vitro production of single-stranded DNA, Nucleic Acids Research, Volume 47, Issue 22:11956-11962. In embodiments where the ssDNA is circular, the resulting ssDNA can be circularized, for example, using DNA ligase. A schematic of an exemplary production process is shown in FIG.

[0181] In some embodiments, a method or composition described herein comprises a nicking endonuclease. In some embodiments, the endonuclease is naturally occurring. In some embodiments, the endonuclease is mutated or engineered, e.g., derived from an enzyme that creates a double-stranded break.

[0182] In some embodiments, the methods described herein include the use of the compositions described herein or the compositions described herein include Nb.BsrDI. In some embodiments, Nb.BsrDI comprises the large subunit of the BsrDI restriction gene from Bacillus stearothermophilus D70, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nb.BsrDI comprises the amino acid sequence represented by Genbank Accession No. ABD15132.1 (incorporated herein by reference in its entirety), or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nb.BsrDI cleaves at the site set forth in the following sequences, set forth as SEQ ID NOs: 31 and 32, respectively: [ka] In some embodiments, the digestion reaction using Nb.BsrDI is carried out in rCutSmart™ Buffer (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of potassium acetate (e.g., at 50 mM), Tris acetate (e.g., 20 mM), magnesium acetate (e.g., 10 mM), or recombinant albumin (e.g., 100 μg / ml), where optionally the buffer has a pH of 7.9 as measured at 25° C. In some embodiments, the digestion reaction is carried out at 30° C. to 70° C. (e.g., about 37° C. or about 65° C.). In some embodiments, the digestion reaction is carried out for 10 minutes to 3 hours (e.g., about 30 minutes or about 1 hour).

[0183] In some embodiments, the methods described herein include the use of the compositions described herein or the compositions described herein include Nb.Bpu10I. In some embodiments, Nb.Bpu10I includes an amino acid sequence encoded by a wild-type bpu10IRα or mutant bpu10IRβ gene from Bacillus pumilus RFL10, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nb.Bpu10I cleaves at the site set forth in the following sequences, set forth as SEQ ID NOs: 33 and 34, respectively: [ka] In some embodiments, the digestion reaction using Nb.Bpu10I is carried out in R Buffer (ThermoFisher Scientific). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of Tris-HCl (e.g., 10 mM), MgCl2 (e.g., 10 mM), KCl (e.g., 100 mM), and BSA (e.g., 0.1 mg / mL). In some embodiments, the digestion reaction is carried out at 30° C. to 50° C. (e.g., about 37° C.). In some embodiments, the digestion reaction is carried out for 30 minutes to 3 hours (e.g., about 1 hour).

[0184] In some embodiments, the methods described herein include the use of the compositions described herein or the compositions described herein include Nt.BspQI. In some embodiments, Nt.BspQI comprises an engineered BspQI variant derived from the BspQI restriction enzyme, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Nt.BspQI cleaves at the site set forth in the following sequences, set forth as SEQ ID NOs: 35 and 36, respectively: [ka] In some embodiments, the digestion reaction using Nt.BspQI is carried out in NEBuffer™ r3.1 (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of NaCl (e.g., 100 mM), Tris-HCl (e.g., 50 mM), MgCl2 (e.g., 10 mM), recombinant albumin (e.g., 100 μg / mL), optionally wherein the buffer has a pH of 7.9 as measured at 25° C. In some embodiments, the digestion reaction is carried out at 40° C. to 60° C. (e.g., about 50° C.). In some embodiments, the digestion reaction is carried out for 30 minutes to 3 hours (e.g., about 1 hour).

[0185] In some embodiments, the methods described herein include the use of a composition described herein, or the composition described herein includes T7 exonuclease. In some embodiments, the digestion reaction using T7 exonuclease is carried out in NEBuffer™ 4 (NEB). In some embodiments, the digestion reaction is carried out in a buffer comprising one or more (e.g., all) of potassium acetate (e.g., at 50 mM), Tris acetate (e.g., at 20 mM), magnesium acetate (e.g., at 10 mM), or DTT (e.g., at 1 mM), optionally wherein the buffer has a pH of 7.9 as measured at 25° C. In some embodiments, the digestion reaction is carried out at 20° C. to 50° C. (e.g., at about 25° C. or at about 37° C.). In some embodiments, the digestion reaction is carried out for 15 to 120 minutes, e.g., for 20 to 60 minutes, e.g., for about 30 minutes.

[0186] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include T5 exonuclease. In some embodiments, the digestion reaction using T5 exonuclease is carried out in NEBuffer™ 4 (NEB). In some embodiments, the digestion reaction is carried out in a buffer containing one or more (e.g., all) of potassium acetate (e.g., at 50 mM), Tris acetate (e.g., at 20 mM), magnesium acetate (e.g., at 10 mM), or DTT (e.g., at 1 mM), where optionally the buffer has a pH of 7.9 as measured at 25° C. In some embodiments, the digestion reaction is carried out at 30° C. to 50° C. (e.g., at about 37° C.). In some embodiments, the digestion reaction is carried out for 10 minutes to 3 hours (e.g., at about 30 minutes).

[0187] In some embodiments, the methods described herein include the use of the compositions described herein or the compositions described herein include exonuclease III. In some embodiments, the digestion reaction using exonuclease III is carried out in NEBuffer™ 1 (NEB). In some embodiments, the digestion reaction is carried out in a buffer comprising one or more (e.g., all) of Bis-Tris-propane-HCl (e.g., 10 mM), MgCl2 (e.g., 10 mM), or DTT (e.g., 1 mM), where optionally the buffer has a pH of 7 as measured at 25° C. In some embodiments, the digestion reaction is carried out at 30° C. to 50° C. (e.g., about 37° C.). In some embodiments, the digestion reaction is carried out for 10 minutes to 3 hours (e.g., about 30 minutes).

[0188] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include a high-fidelity DNA polymerase, such as Q5 high-fidelity DNA polymerase (M0491L, New England Biolabs). In some embodiments, a polymerase chain reaction is performed using the high-fidelity DNA polymerase. In some embodiments, a polymerase chain reaction using Q5 high-fidelity DNA polymerase is performed using Q5 reaction buffer (NEB).

[0189] In some embodiments, the methods described herein include the use of the compositions described herein, or the compositions described herein include Exonuclease I. In some embodiments, Exonuclease I includes an amino acid sequence of the Exo I gene from E. coli NM554, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 98%, or 99% identity thereto. In some embodiments, Exonuclease I catalyzes the removal of nucleotides from linear single-stranded DNA (e.g., in the 3' to 5' direction). In some embodiments, the digestion reaction using Exonuclease I is carried out in Exonuclease I reaction buffer (NEB). In some embodiments, the digestion reaction is carried out in a buffer comprising one or more (e.g., all) of glycine-KOH (e.g., at 67 mM), or MgCl2 (e.g., at 6.7 mM), β-ME (e.g., at 10 mM), where, optionally, the buffer has a pH of 9.5 as measured at 25° C. In some embodiments, the digestion reaction is carried out at 30° C. to 50° C. (e.g., about 37° C.). In some embodiments, the digestion reaction is carried out for 10 minutes to 3 hours (e.g., about 30 minutes). In some embodiments, the circular ssDNA is resistant to degradation by exonuclease I.

[0190] In some embodiments, the cyclization efficiency of the cyclization methods provided herein is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or more.

[0191] The ssDNA or circular, e.g., covalently closed, ssDNA can be enriched or purified from impurities or by-products selected from the group consisting of endotoxins, mononucleotides, modified mononucleotides, double-stranded DNA, linear DNA (for circular products), proteins (e.g., enzymes, e.g., ligases, restriction enzymes), DNA fragments or cleavages. In some embodiments, the purified ssDNA is substantially free of process by-products and impurities, e.g., process by-products or impurities described herein.

[0192] The ssDNA or circular, e.g., covalently closed, ssDNA can be sequenced to confirm the desired designed sequence. In embodiments, other structural analyses of the ssDNA (e.g., restriction enzyme analysis) can be performed to confirm or verify its sequence.

[0193] purity In some embodiments, the composition comprising ssDNA described herein has a certain purity.For example, in some embodiments, at least 70%, 80%, 85%, 90%, 95%, or 99% by mass of the total DNA in the composition can be covalently closed circular ssDNA.For example, the composition can also contain linear DNA or circular dsDNA, for example, as a contaminant.

[0194] In some embodiments, a composition described herein (e.g., a composition comprising circular ssDNA, e.g., a pharmaceutical composition comprising circular ssDNA or a manufacturing intermediate comprising circular ssDNA) is free or substantially free of one or more contaminants, e.g., as described in this section. In some embodiments, a method described herein (e.g., a method of making circular ssDNA), e.g., as described in this section, results in a composition that is free or substantially free of one or more contaminants. In some embodiments, a method described herein (e.g., a method of making circular ssDNA), includes a step of assaying for one or more contaminants, e.g., as described in this section. In some embodiments, the method includes approving or releasing the batch if the batch is free or substantially free of contaminants.

[0195] In some embodiments, the contaminants include non-human animal serum (e.g., fetal bovine serum); enzymes, such as ligases, polymerases, or digestive enzymes (e.g., trypsin, collagenase, DNase, RNase, exonuclease, or endonuclease, e.g., restriction endonucleases); growth factors; cytokines; antibodies (e.g., monoclonal antibodies); beads (e.g., antibody-coated beads); antibiotics; cell culture medium; components of cell culture medium; detergents; proteins, such as host cell proteins; foreign nucleic acid sequences (e.g., mononucleotides (e.g., modified mononucleotides), or DNA fragments or truncations; helper virus contaminants (e.g., infectious viruses, viral DNA, or viral proteins); or solvents; cellular debris; cells; pyrogens; fungi; or any combination thereof, or portions of any of the above. In some embodiments, the contaminants were components introduced during the manufacturing process.

[0196] In some embodiments, the contaminant comprises a transmissible spongiform encephalopathy (TSE) agent, hi some embodiments, testing for this contaminant is performed in compositions in which bovine-derived materials were used in the manufacture.

[0197] In some embodiments, the contaminant comprises a zoonotic virus, porcine circovirus 1, porcine circovirus 2, or porcine parvovirus; or any combination thereof, or any portion of the above. In some embodiments, the test for this contaminant is performed in a composition in which non-human animal-derived material, e.g., porcine-derived material, was used in the manufacture.

[0198] In some embodiments, the contaminant comprises a virus or portion thereof, such as a human virus; human immunodeficiency virus (HIV); HIV-1; HIV-2; hepatitis B virus (HBV); hepatitis C virus (HCV); human TSE, including Creutzfeldt-Jakob disease (CJD); variant CJD (vCJD); Treponema pallidum (syphilis); human T-lymphotropic virus (HTLV), HTLV-1, HTLV-2; or cytomegalovirus, human herpesvirus (e.g., human herpesvirus-6, -7, or -8 (HHV-6, -7, and -8)), JC virus, BK virus, Epstein-Barr virus (EBV), human parvovirus B19, human papillomavirus (HPV); adenovirus, such as adenovirus E1; SV40 Large T antigen sequence; HPV E6 or E7 DNA; or any combination thereof, or a portion of any of the above. In some embodiments, the testing for contaminants is performed on compositions whose manufacture uses human donor cells (e.g., white blood cell rich cells). In some embodiments, the testing for contaminants is performed on cell banks.

[0199] In some embodiments, the contaminant comprises a microorganism or part thereof; bacteria (e.g., gram-negative bacteria); mycoplasma; spiroplasma (e.g., when insect cells are used); bacterial toxins (e.g., endotoxins); or adventitious agents, such as adventitious viral agents or non-viral adventitious agents, or any combination thereof, or parts of any of the above. In some embodiments, the contaminant comprises a simian virus, such as simian polyomavirus SV40 or simian retrovirus, or any combination thereof, or parts of any of the above. In some embodiments, the contaminant comprises an arbovirus. In some embodiments, the contaminant comprises a bacteriophage. In some embodiments, the testing for the contaminant is performed on a cell bank, such as a cell bank of bacterial cells.

[0200] In some embodiments, the contaminant comprises DNA derived from a host cell, for example, where the host cell is a non-tumorigenic cell. In some embodiments, the DNA is present at a level of less than 10 ng / dose. In some embodiments, the DNA size is less than about 200 nucleotides in length.

[0201] In some embodiments, the contaminant is an endotoxin. In some embodiments, the level of endotoxin is less than 5 endotoxin units (EU) / kg body weight / hour, e.g., the composition is formulated for parenteral administration. In some embodiments, the level of endotoxin is less than 0.2 EU / kg body weight / hour, e.g., the composition is formulated for intrathecal administration. In some embodiments, the level of endotoxin is less than 2.0 EU / administration / eye, e.g., the composition is formulated for injection or infusion into the eye, or less than 0.5 EU / mL, e.g., the composition is formulated for intraocular administration.

[0202] In some embodiments, the contaminant comprises an organic solvent, for example, an aromatic organic solvent, for example, phenol or chloroform.

[0203] In some embodiments, the contaminant is a contaminant described in Chemistry, Manufacturing, and Control (CMC) Information for Human Gene Therapy Investigational New Drug Applications (INDs)-Guidance for Industry (U.S. Department of Health and Human Services, U.S. Food and Drug Administration, Center for Biologics Evaluation and Research, January 2020), which is incorporated herein by reference in its entirety.

[0204] In some embodiments, the composition is substantially free (e.g., free) of a polymerase. In some embodiments, the composition is substantially free (e.g., free) of a polymerase that performs rolling circle amplification. In some embodiments, the composition is substantially free (e.g., free) of LNPs. In some embodiments, the composition is substantially free (e.g., free) of nanoparticles.

[0205] In some embodiments, the composition is substantially free (e.g., free) of agarose. In some embodiments, the composition is substantially free (e.g., free) of acrylamide.

[0206] In some embodiments, the composition is substantially free (eg, free) of polypeptides.

[0207] In some embodiments, the ratio of the number of molecules of covalently closed ssDNA to other DNA molecules in the composition is at least 10:1, 20:1, 50:1, 80:1, 90:1, 100:1, 200:1, 500:1, or 1000:1. In some embodiments, the composition is substantially free of DNA derived from a host cell, e.g., DNA is present at a level of less than 10 ng / dose. In some embodiments, the composition is substantially free of DNA having a size less than about 200 nucleotides in length. In some embodiments, the composition is substantially free of individual nucleotides. In some embodiments, the ratio of covalently closed ssDNA to dsDNA in the composition is at least 100:1, 200:1, 500:1, or 1000:1. In some embodiments, at least 70%, 80%, 85%, 90%, 95%, or 99% of the DNA in the composition by mass (or by copy number) is full length.

[0208] Pharmaceutical Compositions The present disclosure includes ssDNA and related compositions in combination with one or more pharma- ceutically acceptable excipients and / or carriers.

[0209] The pharmaceutical composition may optionally comprise one or more further active substances, e.g. therapeutically and / or prophylactically active substances. Pharmaceutical compositions of the invention are generally sterile and / or pyrogen-free.

[0210] The ssDNA or constructs described herein may be formulated without a carrier, e.g., the ssDNA or constructs described herein may be administered to a host cell, tissue or subject "naked." Naked formulations may include pharmaceutical excipients or diluents, but lack a carrier.

[0211] Pharmaceutically acceptable excipients or diluents may include inert substances that act as vehicles or media for the compositions described herein, such as any one of the active ingredients approved by the United States Food and Drug Administration (FDA) and listed in the inactive ingredient database, which is incorporated herein by reference. Non-limiting examples of pharma-ceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, isotonicity agents, dispersion media, cryoprotectants, diluents, suspension aids, surfactants, isotonicity agents, thickeners, emulsifiers, preservatives, hyaluronidase, dispersants, preservatives, lubricants, granulating agents, disintegrants, binders, antioxidants, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and mixtures thereof.

[0212] General considerations in the formulation and / or manufacture of pharmaceutical products can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005, incorporated herein by reference.

[0213] Carrier The ssDNA or constructs described herein may also be formulated or included with a carrier. General considerations of carriers and pharmaceutical delivery can be found, for example, in Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids and Vaccines (Lene Jorgensen and Hanne Morck Nielson, Eds.) Wiley; 1st edition (December 21, 2009); and Vargason et al. 2021. Nat Biomed Eng 5, 951-967.

[0214] Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials, GalNAc), nanoparticles (e.g., nanoparticles encapsulating or covalently linked to ssDNA, gold nanoparticles, silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., cationic lipopolymers or transfection reagents), fusosomes, non-nucleated cells (e.g., ex vivo differentiated reticulocytes), nucleated cells, exosomes, protein carriers (e.g., proteins covalently linked to ssDNA), peptides (e.g., cell-penetrating peptides), materials (e.g., graphene oxide), simple pure lipids (e.g., cholesterol), DNA origami (e.g., DNA tetrahedrons).

[0215] In one embodiment, the ssDNA compositions, constructs and systems described herein can be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicular structures composed of a unilamellar or multilamellar lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, can protect their cargo from degradation by plasma enzymes, and can transport cargo across biological membranes and the blood-brain barrier (BBB) ​​(see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679 for a review).

[0216] Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for the preparation of multilamellar vesicular lipids are known in the art (see, for example, U.S. Pat. No. 6,693,086, the teachings of which are incorporated herein by reference for the preparation of multilamellar vesicular lipids). Vesicle formation can occur spontaneously when lipid film is mixed with aqueous solution, but it can also be promoted by applying force in the form of shaking by using homogenizer, sonicator, or extrusion device (see, for example, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, article ID 469679, page 12, 2011.doi:10.1155 / 2011 / 469679 for review). Extruded lipids can be prepared by extrusion through size-reducing filters as described in Templeton et al., Nature Biotech, 15:647-652, 1997, the teachings of which regarding the preparation of extruded lipids are incorporated herein by reference.

[0217] Exosomes may also be used as drug delivery vehicles for the compositions and systems described herein. For review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0218] Ex vivo differentiated erythrocytes can also be used as carriers for the agents described herein (eg, ssDNA). See, e.g., WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO 2016183482; WO 2015153102; WO 2018151829; WO 2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; U.S. Patent No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136.

[0219] For example, fusosome compositions as described in WO2018208728 may also be used as carriers to deliver the ssDNA described herein.

[0220] Lipid nanoparticles: Lipid nanoparticles (LNPs) are carriers made of ionizable lipids. LNPs are taken up by cells via endocytosis, and their properties allow endosomal escape, which allows the release of cargo into the cytoplasm of target cells. In addition to ionizable lipids, LNPs may contain helper lipids to promote cell binding, cholesterol to fill gaps between lipids, and / or polyethylene glycol (PEG) to reduce opsonization and reticuloendothelial clearance by serum proteins. Lipid nanoparticles, in some embodiments, include one or more ionizable lipids, such as non-cationic lipids (e.g., neutral or anionic, or amphoteric lipids); one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers described in Table 5 of WO2019217941, which is incorporated herein by reference in its entirety); one or more sterols (e.g., cholesterol); and, optionally, one or more targeting molecules (e.g., conjugated receptors, receptor ligands, antibodies); or combinations of the above.

[0221] Lipids that can be used in nanoparticle formulations (e.g., lipid nanoparticles) include, for example, those described in Table 4 of WO2019217941 (incorporated by reference), e.g., lipid-containing nanoparticles can include one or more of the lipids in Table 4 of WO2019217941. The lipid nanoparticles can include additional components, e.g., polymers, such as those described in Table 5 of WO2019217941 (incorporated by reference).

[0222] In some embodiments, the conjugated lipid, if present, is a PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEGS-DAG) (4-0-(2',3'-di(tetradecanoyloxy)propyl-1-0-(w- Methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of WO2019051289, dx.doi.org / 10.1021 / acs.nanolett.0c01386 (incorporated by reference), as well as one or more of the above combinations.

[0223] In some embodiments, sterols that may be incorporated into the lipid nanoparticles include one or more of cholesterol or cholesterol derivatives, such as those described in WO 2009 / 127060 or US 2010 / 0130588 (incorporated by reference). Additional exemplary sterols include plant sterols, including those described in Eygeris et al. (2020), which are incorporated by reference herein.

[0224] In some embodiments, the lipid particles include an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits particle aggregation, and a sterol. The amounts of these components can be varied independently and to achieve the desired properties. For example, in some embodiments, the lipid nanoparticles include an ionizable lipid in an amount of about 20 mol% to about 90 mol% of the total lipid (in other embodiments, it can be 20-70% (mol), 30-60% (mol), or 40-50% (mol); about 50 mol% to about 90 mol% of the total lipid present in the lipid nanoparticle), a non-cationic lipid in an amount of about 5 mol% to about 30 mol% of the total lipid, a conjugated lipid in an amount of about 0.5 mol% to about 20 mol% of the total lipid, and a sterol in an amount of about 20 mol% to about 50 mol% of the total lipid. The ratio of total lipid to nucleic acid can be varied as needed. For example, the ratio of total lipid to nucleic acid (mass or weight) can be about 10:1 to about 30:1.

[0225] In some embodiments, the lipid to nucleic acid ratio (mass / mass ratio; w / w ratio) can be in the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to obtain a desired N / P ratio, for example, an N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. In general, the total lipid content of the lipid nanoparticle formulation can range from about 5 mg / mL to about 30 mg / mL.

[0226] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for the compositions described herein, e.g., delivery of the nucleic acids (e.g., RNA) described herein, include: [ka] The following are some of the reasons:

[0227] In some embodiments, LNPs comprising formula (i) are used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0228] In some embodiments, LNPs comprising formula (ii) are used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0229] In some embodiments, an LNP comprising formula (iii) is used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0230] In some embodiments, an LNP comprising formula (v) is used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0231] In some embodiments, an LNP comprising formula (vi) is used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0232] In some embodiments, LNPs comprising formula vii or (viii) are used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0233] In some embodiments, an LNP comprising formula (ix) is used to deliver the DNA compositions described herein to the liver and / or liver cells.

[0234] In some embodiments, LNPs comprising formula (x) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes: [ka] During the ceremony, X 1 But, O, NR 1 or a direct bond, X 2 is C2-5 alkylene, and X 3 is C(=O) or a direct bond, and R 1 is H or Me, and R 3 is Ci-3 alkyl, R 2 is Ci-3 alkyl, or R 2 The nitrogen atom and X to which they are attached 2 together with 1 to 3 carbon atoms of X to form a 4-, 5-, or 6-membered ring, or 1 But NR 1 and R 1 and R 2 together with the nitrogen atom to which they are attached form a 5- or 6-membered ring, or R 2 But R 3 and together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered ring; Y 1 is C2-12 alkylene, and Y 2 but, [ka] is selected from n is 0 to 3, R 4 is Ci-15 alkyl, Z 1 is Ci-6 alkylene or a direct bond; Z 2 but, [ka] (in either orientation) or absent, with the proviso that Z 1 is a direct bond, and Z 2 If is non-existent; R 5 is C5-9 alkyl or C6-10 alkoxy, R 6 is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, R 7 is H or Me, or a salt thereof, with the proviso that R 3 and R 2 is a C2 alkyl group, and X 1 is O and X 2 is a linear C3 alkylene, and X 3 is C(=0) and Y 1 is a linear Ce alkylene, (Y 2 )nR 4 but, [ka] and R 4 is a linear C5 alkyl; Z 1 is C2 alkylene, and Z 2 is absent, W is methylene, and R 7 If H, then R 5 and R 6 is not a Cx alkoxy. [ka]

[0235] In some embodiments, an LNP comprising formula (xi) is used to deliver the DNA compositions described herein to the liver and / or liver cells.

[0236] In some embodiments, an LNP comprising formula (xii) is used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0237] In some embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv). [ka]

[0238] In some embodiments, an LNP comprising formula (xv) is used to deliver the DNA compositions described herein to the liver and / or liver cells. [ka]

[0239] In some embodiments, LNPs comprising a formulation of formula (xvi) are used to deliver the DNA compositions described herein to pulmonary endothelial cells.

[0240] In some embodiments, LNPs comprising a formulation of formula (xvii), xviii, or xix are used to deliver the DNA compositions described herein to pulmonary endothelial cells. [ka]

[0241] In some embodiments, the lipid compounds used to form the compositions described herein, e.g., lipid nanoparticles for delivery of the nucleic acids (e.g., RNA) described herein, are made by one of the following reactions: [ka]

[0242] In some embodiments, the compositions (e.g., nucleic acids or proteins) described herein are provided in LNPs that include an ionizable lipid. In some embodiments, the ionizable lipid is heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102), e.g., as described in Example 1 of U.S. Pat. No. 9,867,888, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is 9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate (LP01), e.g., as synthesized in Example 13 of WO 2015 / 095340, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is di((Z)-non-2-en-1-yl) 9-((4-dimethylamino)-butanoyl)oxy)heptadecanedioate (L319), for example, as synthesized in Examples 7, 8, or 9 of U.S. Patent Publication No. 2012 / 0027803, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), for example, as synthesized in Examples 14 and 16 of WO 2010 / 053572, which is incorporated herein by reference in its entirety.In some embodiments, the ionizable lipid is the imidazole cholesterol ester (ICE) lipid (3S,10R,13R,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazol-4-yl)propanoate, e.g., structure (I) from WO 2020 / 106946, which is incorporated herein by reference in its entirety.

[0243] In some embodiments, the ionizable lipid may be a cationic lipid, an ionizable cationic lipid, for example, a cationic lipid that may exist in a positively charged or neutral form depending on pH, or an amine-containing lipid that may be easily protonated. In some embodiments, the cationic lipid is a lipid that may be positively charged, for example, under physiological conditions. Exemplary cationic lipids include one or more amine groups that are positively charged. In some embodiments, the lipid particles include cationic lipids in a combination with one or more of neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structured lipids (e.g., sterols), PEG, cholesterol, and polymer-conjugated lipids. In some embodiments, the cationic lipid may be an ionizable cationic lipid. Exemplary cationic lipids disclosed herein may have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticle may include a second cationic lipid that has a different effective pKa than the first cationic lipid (e.g., higher than the first effective pKa). The lipid nanoparticles may include 40-60 mol percent cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and a therapeutic agent, such as a nucleic acid (e.g., RNA) as described herein, encapsulated within or associated with the lipid nanoparticles. In some embodiments, the nucleic acid is formulated simultaneously with the cationic lipids. The nucleic acid may be adsorbed to the surface of the LNP, e.g., LNPs that include cationic lipids. In some embodiments, the nucleic acid may be encapsulated within the LNP, e.g., LNPs that include cationic lipids. In some embodiments, the lipid nanoparticles may include a targeting moiety, e.g., coated with a targeting agent. In embodiments, the LNP formulation is biodegradable.In some embodiments, lipid nanoparticles comprising one or more lipids described herein, e.g., formula (i), (ii), (vii) and / or (ix), encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98% or 100% of the RNA molecules.

[0244] Exemplary ionizable lipids that may be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of International Publication No. WO2019051289, which is incorporated herein by reference. Additional exemplary lipids include, but are not limited to, one or more of the following formulas: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; No. Ic of US Patent Application Publication No. 2013 / 0178541; U.S. Patent Application Publication No. 2013 / 0303587 or U.S. Patent Application Publication No. 2013 / 0123338; ​​U.S. Patent Application Publication No. 2015 / 0141678; U.S. Patent Application Publication No. 2015 / 0239926, II, III, IV, or V; U.S. Patent Application Publication No. 2017 / 0119904; WO 2017 / 117528, I or II; U.S. Patent Application Publication No. 2012 / 0149894; U.S. Patent Application Publication No. 2015 / 0057373; WO 2013 / 116126; U.S. Patent Application Publication No. 2013 / 0090372; U.S. Patent Application Publication No. 2013 / 0274523; U.S. Patent Application Publication No. 2013 / 0274504; U.S. Patent Application Publication No. 2013 / 0053572; WO 2013 / 01 6058, A; WO 2012 / 162210, A; U.S. Patent Application Publication No. 2008 / 042973, I; U.S. Patent Application Publication No. 2012 / 01287670, I, II, III, or IV; U.S. Patent Application Publication No. 2014 / 0200257, I or II; U.S. Patent Application Publication No. 2015 / 0203446, I, II, or III; U.S. Patent Application Publication No. 2015 / 0005363, I or III;U.S. Patent Application Publication No. 2014 / 0308304, I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV; U.S. Patent Application Publication No. 2013 / 0338210; WO 2009 / 132131, I, II, III, or IV; U.S. Patent Application Publication No. 2012 / 01011478, A; U.S. Patent Application Publication No. 2012 / 0027796, I or XXXV; U.S. Patent Application Publication No. 2012 / 0058144, XIV or XVII; U.S. Patent Application Publication No. 2013 / 0 No. 323269; U.S. Patent Application Publication No. I of U.S. Patent Application Publication No. 2011 / 0117125; U.S. Patent Application Publication No. I, II, or III of U.S. Patent Application Publication No. 2011 / 0256175; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, IX, X, XI, or XII of U.S. Patent Application Publication No. 2012 / 0202871; U.S. Patent Application Publication No. I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011 / 0076335; U.S. Patent Application Publication No. I or II of U.S. Patent Application Publication No. 2006 / 008378; US Patent Application Publication No. 2013 / 0123338, I; US Patent Application Publication No. 2015 / 0064242, I or XAYZ; US Patent Application Publication No. 2013 / 0022649, XVI, XVII, or XVIII; US Patent Application Publication No. 2013 / 0116307, I, II, or III; US Patent Application Publication No. 2013 / 0116307, I, II, or III; US Patent Application Publication No. 2010 / 0062967, I or II; US Patent Application Publication No. 2013 / 0189351, I-X; US Patent Application Publication No. No. 2014 / 0039032, I; U.S. Patent Publication No. 2018 / 0028664, V; U.S. Patent Publication No. 2016 / 0317458, I; U.S. Patent Publication No. 2013 / 0195920, I; U.S. Patent Publication No. 10,221,127, 5, 6, or 10; WO 2018 / 081480, III-3; WO 2020 / 081938, I-5 or I-8; U.S. Patent Publication No. 9,867,888, 18 or 25; U.S. Patent Publication No. 2019 / 0136231, A;II of WO 2020 / 219876; 1 of U.S. Patent Application Publication No. 2012 / 0027803; OF-02 of U.S. Patent Application Publication No. 2019 / 0240349; 23 of U.S. Patent No. 10,086,013; cKK-E12 / A6 of Miao et al. (2020); C12-200 of WO 2010 / 053572; 7C1 of Dahlman et al. (2017); 304-O13 or 503-O13 of Whitehead et al.; TS-P4C2 of U.S. Patent No. 9,708,628; I of WO 2020 / 106946; I of WO 2020 / 106946. ;

[0245] In some embodiments, the ionizable lipid is MC3(6Z,9Z,28Z,3lZ)-heptatriaconta-6,9,28,3l-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3), as described, for example, in Example 9 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, as described, for example, in Example 10 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (13Z,16Z)-A,A-dimethyl-3-nonyldocosa-13,16-diene-1-amine (compound 32), for example, as described in Example 11 of WO2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is compound 6 or compound 22, for example, as described in Example 12 of WO2019051289A9 (incorporated herein by reference in its entirety).

[0246] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidyl 16-O-dimethyl-1, ... PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soy phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoyl phosphatidylserine (DOPS), sphingomyelin (SM), dimyristoyl phosphatidylcholine (DMPC), dimyristoyl phosphatidylglycerol (DMPG), distearoyl phosphatidylglycerol (DSPG), diercoyl phosphatidylcholine (DEPC), palmitoyl oleoyl ... dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylethanolamine phatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine, or mixtures thereof.It is understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Additional exemplary lipids include, in certain embodiments, but are not limited to, those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386 (herein incorporated by reference). Such lipids include, in some embodiments, plant lipids that have been shown to improve hepatic transfection with mRNA (e.g., DGTS).

[0247] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymers, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin, etc. Other non-cationic lipids are described in WO 2017 / 099823 or US 2018 / 0028664, the entire contents of which are incorporated herein by reference.

[0248] In some embodiments, the non-cationic lipid is oleic acid or a compound of formula I, II, or IV of US Patent Publication No. 2018 / 0028664 (herein incorporated by reference in its entirety). The non-cationic lipid may comprise, for example, 0-30% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticle. In embodiments, the molar ratio of ionizable lipid to neutral lipid is in the range of about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 8:1).

[0249] In some embodiments, the lipid nanoparticles do not comprise any phospholipids.

[0250] In some embodiments, the lipid nanoparticles may further comprise components such as sterols to provide membrane integrity. One exemplary sterol that may be used in the lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2 , 4'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogs such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In some embodiments, the cholesterol derivative is a polar analog, such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO 2009 / 127060 and U.S. Patent Publication No. 2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0251] In some embodiments, components that provide membrane integrity, such as sterols, may comprise 0-50% (mol) of the total lipid present in the lipid nanoparticle (e.g., 0-10%, 10-20%, 20-30%, 30-40%, or 40-50%). In some embodiments, such components comprise 20-50% (mol) 30-40% (mol) of the total lipid content of the lipid nanoparticle.

[0252] In some embodiments, the lipid nanoparticles may include polyethylene glycol (PEG) or conjugated lipid molecules. These are generally used to inhibit lipid nanoparticle aggregation and / or provide steric stabilization. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates, and mixtures thereof. In some embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, such as a (methoxypolyethylene glycol)-conjugated lipid.

[0253] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG diacylglycerol succinate (PEGS-DAG) (4-0-(2',3'-di(tetradecanoyloxy)propyl- PEG-lipid conjugates include, for example, PEG-dialkoxypropylcarbamate, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are described, for example, in U.S. Pat. No. 5,885,613, U.S. Pat. No. 6,287,591, U.S. Patent Application Publication No. 2003 / 0077829, and the like. No. 2003 / 0077829, U.S. Patent Application Publication No. 2005 / 0175682, U.S. Patent Application Publication No. 2008 / 0020058, U.S. Patent Application Publication No. 2011 / 0117125, U.S. Patent Application Publication No. 2010 / 0130588, U.S. Patent Application Publication No. 2016 / 0376224, U.S. Patent Application Publication No. 2017 / 0119904, and U.S. Patent Application No. 099823, all of which are incorporated herein by reference in their entireties. In some embodiments, the PEG-lipid is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2, or V of U.S. Patent Application Publication No. 2018 / 0028664, the entire contents of which are incorporated herein by reference. In some embodiments, the PEG-lipid is of formula II of U.S. Patent Application Publication No. 20150376115 or U.S. Patent Application Publication No. 2016 / 0376224, the entire contents of which are both incorporated herein by reference.In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. The PEG-lipid can be PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG-disterylglycamide, PEG-cholesterol (l-[8'-(cholest-5-ene-3[β]-oxy)carboxamido-3',6'-dioxaoctanyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB (3,4 -ditetradecoxylbenzyl-[ω]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises: [ka] The present invention includes a structure selected from the following:

[0254] In some embodiments, lipids conjugated with molecules other than PEG can be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates can be used in place of or in addition to PEG-lipids.

[0255] Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer lipids, are described in the PCT and LIS patent applications listed in Table 2 of WO2019051289A9, all of which are incorporated herein by reference in their entireties.

[0256] In some embodiments, the PEG or conjugated lipid may comprise 0-20% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipid present in the lipid nanoparticle. The molar ratios of ionizable lipid, non-cationic lipid, sterol, and PEG / conjugated lipid may be varied as needed. For example, the lipid particles may comprise 30-70% ionizable lipid per mole or total weight of the composition, 0-60% cholesterol per mole or total weight of the composition, 0-30% non-cationic lipid per mole or total weight of the composition, and 1-10% conjugated lipid per mole or total weight of the composition. Preferably, the composition comprises 30-40% ionizable lipid per mole or total weight of the composition, 40-50% cholesterol per mole or total weight of the composition, and 10-20% non-cationic lipid per mole or total weight of the composition. In some other embodiments, the composition is 50-75% ionizable lipid per mole or total weight of the composition, 20-40% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition and 1-10% conjugated lipid per mole or total weight of the composition. The composition may contain 60-70% ionizable lipid per mole or total weight of the composition, 25-35% cholesterol per mole or total weight of the composition, and 5-10% non-cationic lipid per mole or total weight of the composition. The composition may also contain up to 90% ionizable lipid per mole or total weight of the composition and 2-15% non-cationic lipid per mole or total weight of the composition.Formulations may also be used that contain, for example, 8-30% ionizable lipid per mole or total weight of the composition, 5-30% non-cationic lipid per mole or total weight of the composition, and 0-20% cholesterol per mole or total weight of the composition; 4-25% ionizable lipid per mole or total weight of the composition, 4-25% non-cationic lipid per mole or total weight of the composition, 2-25% cholesterol per mole or total weight of the composition, 10-35% conjugated lipid per mole or total weight of the composition, and 5% cholesterol per mole or total weight of the composition; or The lipid nanoparticle formulation may comprise 2-30% ionizable lipid per mole or total weight of the composition, 2-30% non-cationic lipid per mole or total weight of the composition, 1-15% cholesterol per mole or total weight of the composition, 2-35% conjugated lipid per mole or total weight of the composition, and 1-20% cholesterol per mole or total weight of the composition; or up to 90% ionizable lipid per mole or total weight of the composition and 2-10% non-cationic lipid per mole or total weight of the composition, or 100% cationic lipid per mole or total weight of the composition. In some embodiments, the lipid particle formulation comprises an ionizable lipid, phospholipid, cholesterol, and PEGylated lipid in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises an ionizable lipid, cholesterol, and PEGylated lipid in a molar ratio of 60:38.5:1.5.

[0257] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, where the molar ratio of lipids is in the range of 20-70 mole percent for the ionizable lipid, with a target of 40-60; the molar percent of the non-cationic lipid is in the range of 0-30, with a target of 0-15; the molar percent of the sterol is in the range of 20-70, with a target of 30-50; and the molar percent of the PEGylated lipid is in the range of 1-6, with a target of 2-5.

[0258] In some embodiments, the lipid particles comprise an ionizable lipid / non-cationic lipid / sterol / conjugated lipid molar ratio of 50:10:38.5:1.5.

[0259] In some aspects, the disclosure provides lipid nanoparticle formulations comprising a phospholipid, a lecithin, a phosphatidylcholine, and a phosphatidylethanolamine.

[0260] In some embodiments, one or more additional compounds may also be included. These compounds may be administered separately, or the additional compounds may be included in the lipid nanoparticles of the present invention. In other words, the lipid nanoparticles may contain other compounds in addition to the nucleic acid or at least a second nucleic acid different from the first nucleic acid. Without being limited thereto, the other additional compounds may be selected from the group consisting of small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptidomimetics, nucleic acids, nucleic acid analogs and derivatives thereof, extracts made from biological materials, or any combination thereof.

[0261] In some embodiments, LNPs are directed to specific tissues by the addition of a targeting domain. For example, a biological ligand can be presented on the surface of the LNP to promote interaction with cells presenting the cognate receptor, thereby driving receptor binding and cargo delivery to tissues where the cells express the receptor. In some embodiments, the biological ligand can be a ligand that drives delivery to the liver, for example, LNPs presenting GalNAc result in delivery of nucleic acid cargo to hepatocytes presenting the asialoglycoprotein receptor (ASGPR). The article by Akinc et al. Mol Ther 18(7):1357-1364 (2010) teaches the conjugation of trivalent GalNAc ligands to PEG-lipids (GalNAc-PEG-DSG) to obtain LNPs that are ASGPR-dependent for observable LNP cargo effects (see, for example, Figure 6 in Akinc et al. 2010, supra).For example, other ligand-presenting LNP formulations incorporating folate, transferrin, or antibodies are described in WO2017223135, which is incorporated by reference in its entirety, as well as in the references used therein, i.e., Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319;Akinc et al.,Mol Ther.2010 18:1357-1364;Srinivasan et al.,Methods Mol Biol.2012 820:105-116;Ben-Arie et al.,Methods Mol Biol.2012 757:497-507;Peer 2010 J Control Release.20:63-68;Peer et al.,Proc Natl Acad Sci US A.2007 104:4095-4100;Kim et al.,Methods Mol Biol.2011 721:339-353;Subramanya et al.,Mol Ther.2010 18:2028-2037;Song et al.,Nat Biotechnol.2005 23:709-717; Peer et al., Science. 2008 319:627-630; and Peer and Lieberman, Gene Ther. 2011 18:1127-1133.

[0262] In some embodiments, LNPs are selected for tissue-specific activity by the addition of Selective ORgan Targeting (SORT) molecules to formulations containing traditional components, such as ionizable cationic lipids, amphipathic phospholipids, cholesterol, and poly(ethylene glycol) (PEG) lipids. The teachings of Cheng et al. Nat Nanotechnol 15(4):313-320 (2020) demonstrate that the addition of auxiliary "SORT" components precisely alters in vivo RNA delivery profiles and mediates tissue-specific (e.g., lung, liver, spleen) gene delivery and editing, depending on the percentage and biophysical properties of the SORT molecules.

[0263] In some embodiments, the LNPs comprise a biodegradable, ionizable lipid, hi some embodiments, the LNPs comprise (9Z,l2Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,l2-dienoate (also referred to as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,l2Z)-octadeca-9,l2-dienoate)) or another ionizable lipid. See, e.g., the lipids in WO 2019 / 067992, WO 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086 and references provided therein. In some embodiments, the terms cationic and ionizable with respect to LNP lipids are synonymous, e.g., ionizable lipids are cationic depending on the pH.

[0264] In some embodiments, the average LNP diameter of an LNP formulation can be tens of nm to hundreds of nm, e.g., as measured by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of an LNP formulation can be about 40 nm to about 150 nm, e.g., about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 70 nm to about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation can be about 80 nm. In some embodiments, the average LNP diameter of the LNP formulation can be about 100 nm. In some embodiments, the average LNP diameter of the LNP formulation ranges from about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.

[0265] LNPs may be relatively homogeneous in some cases. Polydispersity index may be used to indicate the homogeneity of LNPs, e.g., the size distribution of lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow size distribution. LNPs may have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs may be about 0.10 to about 0.20.

[0266] The zeta potential of LNPs can be used to indicate the electrokinetic potential of a composition. In some embodiments, the zeta potential can represent the surface charge of LNPs. Lipid nanoparticles with relatively low positive or negative charges are generally desirable, since more highly charged species can undesirably interact with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0267] The efficiency of protein and / or nucleic acid encapsulation represents the amount of protein and / or nucleic acid encapsulated or otherwise associated with the LNP after preparation compared to the initial amount provided. It is desirable for the encapsulation efficiency to be high (e.g., near 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of protein and / or nucleic acid in a solution containing lipid nanoparticles before and after disintegrating the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (e.g., RNA) in a solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid (e.g., RNA) in a solution. For the lipid nanoparticles described herein, the encapsulation efficiency of proteins and / or nucleic acids may be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In some embodiments, the encapsulation efficiency may be at least 90%. In some embodiments, the encapsulation efficiency may be at least 95%.

[0268] The LNPs may optionally include one or more coatings. In some embodiments, the LNPs may be formulated into capsules, films, or tablets having a coating. The capsules, films, or tablets comprising the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0269] Additional exemplary lipids, formulations, methods, and characterization of LNPs are taught by WO2020061457, which is incorporated by reference in its entirety. See also Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). https: / / doi.org / 10.1038 / s41578-021-00358-0.

[0270] In some embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA Transfection Reagent (Mirus Bio). In certain embodiments, LNPs are formulated using GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, LNPs are formulated using 2,2-Dilinoleyl-4-Dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or Dilinoleylmethyl-4-Dimethylaminobutyrate (DLin-MC3-DMA or MC3), the formulation and in vivo use of which are taught in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012) (incorporated herein by reference in its entirety).

[0271] LNP formulations optimized for delivery of CRISPR-Cas systems, e.g., Cas9-gRNA RNP, gRNA, Cas9 mRNA, are described in WO2019067992 and WO2019067910 (both incorporated by reference).

[0272] Additional specific LNP formulations useful for delivery of nucleic acids are described in U.S. Pat. Nos. 8,158,601 and 8,168,775 (both of which are incorporated by reference), including the formulations used in patisiran, which is sold under the name ONPATTRO.

[0273] Exemplary dosages of DNA described herein with LNPs can include about 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4, 5, 6, 8, 10, or 100 mg / kg of DNA.

[0274] The following embodiments are contemplated: A. Lipid nanoparticles (LNPs) comprising the ssDNA constructs, sequences or compositions described herein. B. The LNP of embodiment A, comprising a cationic lipid. C. The cationic lipid is [ka] The LNP of embodiment B, having a structure represented by: D. The LNP of any of embodiments A-C, further comprising one or more neutral lipids, e.g., DSPC, DPPC, DMPC, DOPC, POPC, DOPE, SM, a steroid, e.g., cholesterol, and / or one or more polymer-conjugated lipids, e.g., a pegylated lipid, e.g., PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer, or PEG dialkyloxypropylcarbamate.

[0275] In embodiments, LNP formulations containing ssDNA or constructs described herein can be targeted to desired cell types by surface decoration with targeting effectors. Such targeting effectors include, for example, cell-specific receptor ligands that bind to target cells; antibodies or other binding agents to target cells; centrin; cell-penetrating peptides; peptides that allow endosomal escape (e.g., GALA, KALA). For a review, see, for example, Tables 1 and 2 in Tai & Gao. 2017. Adv Drug Deliv Rev. 110-111:157-168.

[0276] In embodiments, an LNP formulation comprising a ssDNA or construct described herein may be co-administered with an adjuvant, e.g., co-delivered in the same formulation as an adjuvant.

[0277] Route of administration The ssDNA or constructs described herein may be introduced into a cell, tissue or subject by any suitable route.

[0278] Administration to target cells or tissues (e.g., ex vivo) can be by methods known in the art, such as transfection, e.g., transient or stable transfection using reagents (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation, gene gun, microinjection, microfluidic shearing, cell squeezing). Other methods are described, for example, in Rad et al. 2021. Adv. Mater. 33:2005363, which is incorporated herein by reference.

[0279] Administration to a subject, e.g., a mammal, e.g., a human subject, can be by parenteral (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous, intracranial) routes; by topical, transdermal, or transcutaneous administration. Other suitable routes include oral, rectal, transmucosal, intranasal, inhalation (e.g., via aerosol), buccal (e.g., sublingual), intravaginal, intrathecal, intraocular, transdermal, intraendothelial, intrauterine (or intraovo), intrapleural, intracerebral, intraarticular, topical, intralymphatic. Direct tissue or organ injection (e.g., into the liver, eye, skeletal muscle, cardiac muscle, diaphragm, muscle, or brain) is also included.

[0280] Integration into the genome In some embodiments, the ssDNA described herein integrates into the genome of a cell when introduced into the cell. In other embodiments, the ssDNA described herein does not integrate into the genome of a cell when introduced into the cell. In some embodiments, the ssDNA described herein integrates into the genome of a subject at a frequency of less than about 0.0001%, 0.001%, 0.005%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 1.5%, or 2% of the copies of the ssDNA administered to the subject.

[0281] In some embodiments, the ssDNA described herein does not include a homology arm. In some embodiments, the ssDNA described herein does not include two homology arms. In some embodiments, the ssDNA described herein does not include more than 70%, 80%, or 90% identity to any 15 nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not include more than 70% identity to any 15 nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not include more than 70%, 80%, 90%, 95% identity to any 25 nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not include more than 70%, 80%, 90%, 95%, or 98% identity to any 50 nucleotide portion of the reference human genome hg38. In some embodiments, the ssDNA described herein does not contain more than 70%, 80%, 90%, 95%, 98%, or 99% identity to any 100 nucleotide portion of the reference human genome hg38.

[0282] In some embodiments, the ssDNA described herein is not a template for homology-directed repair (HDR).In some embodiments, the ssDNA described herein is not involved in microhomology-mediated end joining (MMEJ).In some embodiments, the ssDNA described herein is not involved in DNA repair.

[0283] In some embodiments, the formulation does not include a nuclease (e.g., a CRISPR nuclease, e.g., a CRISPR nuclease that generates a single-stranded or double-stranded break). In some embodiments, the formulation does not include a protein that promotes integration of ssDNA into the genome, e.g., the protein includes a recombinase or integrase.

[0284] Purpose The ssDNA and constructs described herein may be used in therapeutic or medical applications for subjects, e.g., humans. Although the description of pharmaceutical compositions provided herein primarily relates to pharmaceutical compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other animal. The subject may be any animal, e.g., a mammal, e.g., a human or a non-human mammal. In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject of the method is a non-human mammal. In embodiments, the subject is a non-human mammal, e.g., a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is an avian, e.g., a member of the avian taxa Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, goose), Paleaognathae (e.g., ostrich, emu), Columbiformes (e.g., pigeon, dove), or Psittaciformes (e.g., parrot). In embodiments, the subject is an invertebrate, e.g., an arthropod (e.g., insect, arachnid, crustacean), nematode, annelid, parasitic worm, or mollusc.

[0285] In some embodiments, the ssDNA or constructs described herein confer a biological effect of an effector, e.g., expression of a therapeutic polypeptide, on a host cell, tissue or subject over a period of at least 2, 3, 4, 5, 6 days or 1 week; at least 8, 9, 10, 12, 14 days or 2 weeks; at least 16, 18, 20 days or 3 weeks; at least 22, 24, 25, 27, 28 days or 1 month; at least 2 months, 3 months, 4 months, 5 months, 6 months or more; 1 week to 6 months, 1 month to 6 months, 3 months to 6 months.

[0286] In embodiments, the ssDNA or constructs described herein may be used to deliver an effector, such as an effector described herein, to a cell, tissue, or subject.

[0287] In embodiments, the ssDNA or constructs described herein may be used to modulate (e.g., increase or decrease) a biological parameter in a cell, tissue, or subject. The biological parameter may be an increase or decrease in gene expression of a gene of interest in a target cell, tissue, or subject.

[0288] In embodiments, the ssDNA or constructs described herein may be used to treat a cell, tissue, or subject in need thereof by administering the ssDNA or constructs described herein to such cell, tissue, or subject. EXAMPLES

[0289] Example 1: Design and construction of a plasmid template for covalently circularizing ssDNA This example describes how to create a plasmid template for a ssDNA construct. In this example, a construct template is designed with the following specific sequence components: Promoter Ef1a: [ka] Effector sequence encoding a model / marker protein (mCherry): [ka] any: NTS: SV40 enhancer: 5'-cccaagaagaagaggaaagtc-3' (SEQ ID NO: 1) · Maintenance sequence: Human interferon-β MAR 5' tataattcactggaatttttttgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3' (SEQ ID NO: 39) Second strand motif: AAV2 wild type ITR 5' aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3' (SEQ ID NO: 26)

[0290] Plasmid templates are designed with these elements using standard DNA design and manipulation software. Assembly is performed by Golden Gate Assembly according to published protocols and commercial kits (Marillonnet & Gruetzner. 2020. Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline. Current Protocols in Molecular Biology. 130: e115; Golden Gate Assembly Protocol for Using NEB Golden Gate Assembly Mix (E1600) (New England Biolabs)). Golden Gate assembly of the designed construct is performed using a set of primers 120 bp long, including the first 30 bp matching relevant flanking fragments, the next 60 bp encoding new sequences, and the last 30 bp annealing to the target sequence. Fragments are assembled into the final construct design (NEB Golden Gate Assembly Kit) and the sequence is confirmed by Sanger Sequencing (Sigma Aldrich) according to the manufacturer's protocol.

[0291] Example 2: Conversion of plasmid DNA to circular ssDNA This example describes the generation of ssDNA from a template prepared as described in Example 1 according to the methods in Minev et al., 2019, Rapid in vitro production of single-stranded DNA, Nucleic Acids Research, Volume 47, Issue 22:11956-11962, which is incorporated herein by reference. Briefly, PCR using a forward primer with a methanol-responsive polymer generates tagged amplicons that allow selective precipitation of the modified strand under denaturing conditions. Unmodified and modified bases can be incorporated into constructs using these methods.

[0292] Final samples are analyzed using a NanoDrop to determine purity and concentration. The sequence of the construct is confirmed by next generation sequencing according to the manufacturer's protocol (Illumina).

[0293] Example 3: Generation of circularized ssDNA The linear ssDNA constructs produced as described in Example 2 are circularized, e.g., covalently closed, using a DNA ligase, e.g., Ampligase® Thermostable DNA Ligase (Lucigen, MA023E-Ampligase® Thermostable DNA Ligase) or CircLigase™ II ssDNA Ligase (Lucigen, MA298E-CircLigase-II-ssDNA-Ligase). Ampligase ligates DNA ends that are annealed adjacent to each other in complementary DNA sequences, while CircLigase II ssDNA ligase ligates the ends of ssDNA in the absence of complementary sequences. The linear DNA constructs remaining after ligation are removed by treatment with Exonuclease I and Exonuclease III. Agarose gel electrophoresis of the starting and resulting products is performed to confirm that the DNA constructs are circularized.

[0294] Example 4: Formulation of circular ssDNA with LNPs This example illustrates how to formulate constructs made as described in the previous examples with lipid nanoparticles.

[0295] The nucleic acid construct is combined with the lipid component by a microfluidic device according to the method of Chen et al. 2012. J Am Chem Soc. Volume 134, Issue 16:6948-6951. Briefly, the microfluidic device is fabricated in polydimethylsiloxane (PDMS) according to standard lithography procedures (McDonald & Whitesides. 2002. Accounts Chem Res Volume 35, Issue 7:491-499). Typically, lipid components containing cationic lipids, cholesterol, helper lipids, polyethylene glycol-modified lipids, and lipids that promote targeting moiety conjugation (optional) are combined and solubilized in 90% ethanol. The nucleic acid construct is dissolved in a buffer solution. The nucleic acid solution, lipid solution, and phosphate buffered saline (PBS) are injected into the microfluidic device. Freshly prepared LNPs are dialyzed against PBS buffer using a membrane with a MWCO of 3.5 kD to remove ethanol and exchange buffer.

[0296] LNPs are characterized for effective diameter, polydispersity, and zeta potential using dynamic light scattering (DLS) (ZetaPALS, Brookhaven Instruments, NY, 15 mW laser, incident beam 676 nm); total nucleic acid concentration is determined using the Quant-iT™ OliGreen® ssDNA Assay Kit according to the manufacturer's protocol (ThermoFisher Scientific, O11492).

[0297] Example 5: Evaluation of intracellular innate immune responses in vitro This example describes methods to test gene expression and to determine the effect of the constructs on the innate immune response of cultured cells.

[0298] Experimental constructs are prepared as in Examples 1-4 above. Constructs and controls are administered by electroporation at multiple concentrations to cells selected from HEK, keratinocytes, macrophages, T cells and epithelial cells. After electroporation, cells are transferred to the final culture vessel. Constructs formulated with LNPs are administered directly to cells in well plates.

[0299] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells are first washed with PBS before flow cytometry analysis. All flow cytometry is performed on a Miltenyi MACSQuant VYB. For detection of mCherry signal, a yellow laser (wavelength 561 nm) is used for excitation and a 615 / 620 nm emission filter is used. 20,000 events are recorded for each sample and data are analyzed using Flowjo V.9.0 software. Cells are first gated in FSC-A and SSC-A plots to remove cell debris. Populations are further plotted in FSC-A and FSC-H plots to enclose single cell populations. Finally, a bivariate plot between fluorescent signal expressing and non-expressing cells is used to determine the percentage of expressing cells. The distribution of expressing cells is used to determine the level of expression in each cell. Expression analysis is performed at multiple time points.

[0300] qPCR is performed on cells to determine the RNA levels of IFN-b in test cells as described in Jakobsen et al. 2013. Proc Natl Acad Sci USA Volume 110, Issue 48:E4571-80. Briefly, the probe-primer set used in qPCR is human IFN-b (ThermoFisher, Hs01077958_s1) and b-actin (ThermoFisher, Hs00357333_g1). Analysis is performed using pre-made Taqman assays and RNA-to-Ct one step kit (Applied Biosystems). qPCR is performed on a MX3005 system (Stratagene). RNA expression is normalized to b-actin and relevant untreated controls. Data are presented as mean ± SEM from biological replicates.

[0301] ELISA is performed on cell supernatants according to the manufacturer's protocol to determine secreted levels of IFN-b.

[0302] Example 6. Preparation of circular single-stranded DNA (ssDNA) This example demonstrates the preparation of circular ssDNA.

[0303] Plasmid DNA (1 ng / 50 ul PCR reaction) was used as template for PCR amplification with Q5 polymerase (M0494L, New England Biolabs). Other commercially available polymerases may also be used. In addition to containing sequences complementary to the plasmid, the primers contained additional sequences useful in downstream processes: a. Nicking enzyme recognition sequence; b. A restriction enzyme recognition sequence (e.g., BsaI, KpnI, or NheI) that is used to generate sticky ends in DNA after restriction enzyme digestion and facilitate DNA circularization; and c. additional bases to increase the efficiency of restriction enzyme digestion (e.g., 5'-CCGTGGTCCTTC-3') (SEQ ID NO:40).

[0304] The PCR product was purified using a DNA purification column (M0494L, Zymo Research). The DNA was digested in an overnight reaction using a restriction enzyme corresponding to the restriction enzyme recognition sequence, e.g., BsaI-HF-V2 (R3733L, New England Biolabs). The DNA was then purified using a DNA purification column.

[0305] The digested DNA was circularized using T4 DNA ligase (M0202M, New England Biolabs) at room temperature for 1 hour. Non-circularized DNA was degraded by incubating the DNA with T5 exonuclease (M0663L, New England Biolabs) at 37°C for 1 hour. T5 exonuclease was used to digest linear dsDNA but not circular dsDNA. DNA was purified using a DNA purification column. Other similar methods, such as agarose gel purification, can also be used.

[0306] The circular dsDNA was incubated with a nicking endonuclease (e.g., Nb.BsrDI, R0648L, New England Biolabs). This endonuclease is sequence-specific and cuts only one strand in the dsDNA molecule. The nicked DNA strand was removed by incubating the DNA with T7 exonuclease (New England Biolabs, M0263) for 30 minutes at 25°C. Exonuclease III (M0206, New England Biolabs) can also be used, for example, for 30 minutes at 37°C. The incubation of DNA with exonucleases is described in more detail in Example 7. A sample of the reaction was run on an agarose gel to confirm the generation of circular ssDNA (nicked DNA migrates slower than circular ssDNA). Circular ssDNA was directly purified using a purification column (Oligo Clean & Concentrator, D4061. Zymo Research) or agarose gel purification (for 3 kb, Long ssDNA Gel Extraction Kit, DS640, DiagnoCine). Circular ssDNA prepared by the methods described herein was shown to be resistant to degradation by Exonuclease I, whereas linear ssDNA was degraded by Exonuclease I (Figure 11).

[0307] Analysis of the composition and purity of both single-stranded and double-stranded DNA forms was performed on an Agilent 5300 Fragment Analyzer using the CRISPR Discovery Kit (DNF-930-K1000CP). dsDNA inlet buffer and electrophoresis gels with intercalating dye were prepared fresh daily, while marker trays and capillary conditioning solution with mineral oil overlay were prepared fresh monthly. Buffers were prepared according to the manufacturer's specifications. Single-stranded DNA samples were diluted with water to a final concentration of 1 ng / uL, and double-stranded DNA samples were diluted with water to a final concentration of 100 pg / uL. For each sample well, 2 uL of DNA sample was added to 22 uL of dilution buffer (0.1x TE) and each sample was run in 2-4 replicates, with one well used for the MDK DNA ladder. Samples were run by the instrument controller software using the default settings for the CRISPR Discovery Method (CRP-910-33).

[0308] Sample traces were analyzed using ProSize Data Analysis Software v4.0.2.7. Peak analysis conditions were set to a "Peak Width (sec)" of 15 and a "Minimum Peak Height (RFU)" of 75, an Extra Valley Point count of 3, and "Valley to Valley Baseline?" was turned off. A manual baseline was set at -2 minutes from the lower marker and +2 minutes from the upper marker. Peaks were automatically detected by the software under these conditions, and peak widths were selected by the software unless manual adjustments were required, e.g., due to broad peaks, peak shoulders, or multiple peaks within a narrow peak range.

[0309] Circular ssDNA and circular dsDNA of two constructs (construct 029) and (construct 001) were purified and analyzed using the methods described in this Example. Each DNA preparation was analyzed in 4x replicates in a Fragment Analyzer and sample traces are shown in Figures 3-9.

[0310] Prominent peaks include: Lower marker (LM) = 1bp, A residual peak at 19 bp (this peak was not taken into account in the final peak quantification value because it was also present in the blank wells and did not originate from the DNA preparation), Primary peak, Secondary peaks (impurities), and Upper marker (UM) = 6000bp

[0311] The blank well trace shows the presence of a peak at only 19 bp (Figure 3). Construct 029 circular ssDNA was quantified at 98.8% of the total peak area (n=4; Figure 4; Table 4). Construct 029 circular dsDNA, Construct 001 circular dsDNA, Construct 001 circular ssDNA prep #1, and Construct 001 circular ssDNA prep #2 were each quantified at 100% of their respective samples, i.e., no impurities were detected (n=4; Figures 5-8).

[0312] To assess the specificity of circular dsDNA contamination in the circular ssDNA preparations, 7.8 pg of Construct 001 circular dsDNA was spiked per ng of Construct 001 circular ssDNA to determine the lowest concentration at which peaks could be easily distinguished. The peak corresponding to the circular dsDNA is indicated by a red arrow (Figure 9). The resolution of the impurity was >6 pg / uL.

[0313] [Table 4]

[0314] In summary, this example describes the successful preparation of circular ssDNA with high purity from plasmid DNA.

[0315] Example 7. Incubation of DNA with exonuclease This example illustrates the effect of exonuclease III and T7 exonuclease on nicked circular dsDNA. As mentioned above, certain manufacturing methods described herein involve treating nicked circular dsDNA with one of these exonucleases to remove the nicked strands and generate circular ssDNA. Although these enzymes are generally considered to be specific for linear or nicked DNA, this example demonstrates that these enzymes have some activity on circular ssDNA. This example shows suitable digestion conditions that reduce the amount of nicked DNA while maintaining high levels of circular ssDNA.

[0316] 7.2 μg of circular dsDNA in 100 μl of 1× rCutSmart buffer (NEB, B6004S) was nicked with 20 units of Nb.BsrDI (NEB, R0648L) for 30 min at 37° C. The enzyme was heat inactivated by incubating the reaction at 80° C. for 20 min. FIG. 10A shows the nicked DNA construct visualized by DNA gel electrophoresis. The nicked DNA was converted to ssDNA by incubating a 50 μl sample (3.6 μg of DNA) with 7.5 units of T7 exonuclease (NEB, M0263L) for 30 min (FIG. 10B; lane 4), 1 h (FIG. 10B; lane 3) and 16 h (FIG. 10B; lane 2) at 25° C. The 30 min incubation resulted in the loss of detectable nicked DNA and the persistence of a large amount of circular ssDNA. In contrast, a 16 hour incubation period with T7 exonuclease resulted in some degradation of the circular single-stranded DNA.

[0317] This example also illustrates the effect of Exonuclease I on linear and circular dsDNA. Figure 11 shows the degradation of linear and circular ssDNA forms of construct 001 by Exonuclease I. Circular ssDNA prepared by the methods herein was shown to be resistant to degradation by Exonuclease I, while linear ssDNA was degraded by Exonuclease I. This highlights the general resistance of circular DNA to exonucleases that naturally contribute to the intracellular degradation of DNA, including the intracellular degradation of therapeutic constructs.

[0318] Example 8: Evaluation of reporter gene expression in vitro This example describes successful gene expression using circular ssDNA constructs in cultured cells.

[0319] Experimental constructs were prepared similarly to Examples 1-4 above. The circular ssDNA constructs and controls used in this example are listed in Table 5. Constructs and controls were administered by electroporation using the Neon Transfection System (ThermoFisher, MPK5000) at multiple concentrations. Recipient cell lines included HEKa keratinocytes (American Type Culture Collection (ATCC), PCS-200-011), HepG2 hepatocytes (ATCC, HB-8065), U2OS osteosarcoma cells (ATCC, HTB-96), and HEK293 epithelial cells (ATCC, CRL-1573). For electroporation experiments, approximately 5×10 6 The cells were electroporated at 1500 volts for 30 ms in DPBS buffer. After electroporation, the cells were transferred to the final culture vessel. The constructs formulated with LNPs were administered directly to the cells in the well plate.

[0320] [Table 5]

[0321] Experimental constructs and controls were also administered by lipid transfection (lipofection). Lipofection for DNA was performed using Lipofectamine3000 transfection reagent (# L3000001, ThermoFisher) in HEKa, HepG2, HEK293, and U2OS cells according to the manufacturer's instructions. A 1:2:3 ratio of DNA:P3000:Lipofectamine3000 was used for all DNA constructs and controls. 10,000 cells were pre-seeded in each well of a 96-well plate one day before transfection. Transfection was performed until the cells reached approximately 80-90% confluence. For each well of a 96-well plate, 3x Lipofectamine3000 was first diluted in 5uL of Opti-MEM™ I Reduced Serum Medium (#31985070, ThermoFisher). DNA was diluted in 5uL of Opti-MEM™ I Reduced Serum Medium with 2xP3000 reagent. DNA was then added to Lipofectamine3000 containing Opti-MEM™ I Reduced Serum Medium and mixed gently by pipetting. After 15 minutes of incubation at room temperature, DNA-Lipofectamine3000 complexes were added to the target cells in a dropwise manner in different areas of the wells along with complete culture medium. The plate was gently rocked back and forth and side to side to distribute the DNA-Lipofectamine3000 complexes evenly. After transfection, cells were incubated in a CO2 tissue culture incubator and the culture medium was changed 6-8 hours after transfection.

[0322] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells were first washed with PBS before flow cytometry analysis. All flow cytometry was performed on a Miltenyi MACSQuant VYB. For detection of mCherry signal, a yellow laser (wavelength 561 nm) was used for excitation and a 615 / 620 nm emission filter was used. 20,000 events were recorded for each sample and data were analyzed using Flowjo V.9.0 software. Cells were first gated in FSC-A and SSC-A plots to remove cell debris. Populations were further plotted in FSC-A and FSC-H plots to enclose single cell populations. Finally, a bivariate plot between fluorescent signal expressing and non-expressing cells was used to determine the percentage of expressing cells. The distribution of expressing cells was used to determine the level of expression in each cell. Expression analysis was performed at multiple time points.

[0323] Figures 12A-12D show the expression of circular ssDNA constructs in HEK293, HepG2, U2OS, and HEKa cells, respectively. A positive correlation was observed between the percentage of reporter-positive cells (X-axis) and the fluorescence intensity of such cells (Y-axis), normalized to the expression of the construct 001 plasmid. These results demonstrate that circular ssDNAs with multiple different sequence elements (Table 5) express a reporter gene (mCherry) with a similar expression profile.

[0324] Example 9: Evaluation of intracellular innate immune responses in vitro This example describes the effect of circular ssDNA constructs on the innate immune response of cultured cells.

[0325] The experimental constructs were prepared as in Examples 1-4 above and then administered to the cells as in Example 8 above. qPCR was performed on the cells to determine the RNA levels of the cytokines IFN-b, IL-6, IL-1b, TNF-a, and CXCL10 in the test cells. Briefly, the probe-primer sets used in the qPCR were human IFN-b (forward sequence: CTTGGATTCCTACAAAGAAGCAGC (SEQ ID NO: 41); reverse sequence: TCCTCCTCTCTGGAACTGCTGCA) (SEQ ID NO: 42); human IL-6 (forward sequence: AGACAGCCACTCACCTCTTCAG (SEQ ID NO: 43); reverse sequence: TTCTGCCAGTGCCTCTTTGCTG (SEQ ID NO: 44)); human IL-1b (forward sequence: CCACAGACCTTCCAGGAGAATG (SEQ ID NO: 45); reverse sequence: GTGCAGTTCAGTGATCGTACAGG (SEQ ID NO: 46)); human TNF-a (forward sequence: CTCTTCTGCCTG CTGCACTTTG (SEQ ID NO: 47); reverse sequence: ATGGGCTACAGGCTTGTCACTC (SEQ ID NO: 48); human CXCL10 (forward sequence: GGTGAGAAGAGATGTCTGAATCC (SEQ ID NO: 49); reverse sequence: GTCCATCCTTGGAAGCACTGCA (SEQ ID NO: 50)); human CCL20 (forward sequence: AAGTTGTCTGTGTGCGCAAATCC (SEQ ID NO: 51); reverse sequence: CCATTCCAGAAAAGCCACAGTTTT (SEQ ID NO: 52)), human GAPDH (forward sequence: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 53); reverse sequence: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 54)). Analysis was performed using QuantStudio7 Flex Real-time PCR System with SYBR Select Master Mix from Life Technologies Corporation. RNA expression was normalized to GAPDH and expressed as fold change compared to relevant untreated controls.

[0326] Expression and immunogenicity of construct 001 (containing the transgene mCherry) generated as circular ssDNA and circular dsDNA and delivered to HEKa cells by lipofection are shown in Figures 13A-13B and 14A-14E. Circular ssDNA was expressed at lower levels than equal molar concentrations ("1x") and equal masses ("2x") of circular dsDNA, as defined by the percentage of mCherry+ cells (Figures 13A-13B). Conversely, as shown in Figures 14A-14E, equal molar concentrations and masses of circular ssDNA were significantly less immunogenic than circular dsDNA, as evidenced by reduced production of interferons (i.e., IFN-B) and inflammatory cytokines and chemokines (e.g., IL-6). These results demonstrate the reduced natural immunogenicity of circular ssDNA compared to circular dsDNA.

[0327] Example 10. Preparation of circular single-stranded DNA (ssDNA) with chemical modifications This example describes the preparation and expression profiling of circular ssDNA with chemical modifications.

[0328] DNA was nicked by mixing 4ug of circular dsDNA and 20 units of Nb.BsrDI (NEB, R0648) in 50ul of 1x CutSmart buffer (NEB, B6004). The reaction was incubated at 37°C for 30 minutes.

[0329] DNA was methylated by adding 150 μl of methyltransferase reaction mix (S-adenosylmethionine to a final concentration of 160 μM and 20 units of EcoGII methyltransferase (NEB, M0603)) to the nicked DNA in 1× CutSmart buffer. The reaction was incubated at 37° C. for 1 hour.

[0330] DNA was purified using Zymo DNA purification columns as described above. Nicked circular methylated dsDNA was converted to a methylated circular ssDNA form by combining 4 μg of DNA with 15 units of T7 exonuclease (NEB, M0263) in 50 μl of 1× CutSmart buffer and incubating the reaction at 25° C. for 30 minutes. DNA was purified by gel electrophoresis as described above.

[0331] FIG. 15 shows two forms of construct 001: unmodified single-stranded circular DNA, and m6A(N 6 Figure 1 shows expression of single-stranded circular DNA bearing the (-methyladenosine) DNA modification. The chemically modified circular single-stranded DNA retained detectable function, as evidenced by expression of the mCherry reporter in transfected cells. This result indicates that transgene expression from circular ssDNA can be influenced by chemical modifications.

[0332] Example 11: Computer prediction of DNA secondary structure This example illustrates modeling the secondary structure of circular ssDNA.

[0333] The double-stranded regions formed by the ssDNA described herein were determined as described by Lorenz et al. 2011. Vienna RNA Package 2.0. Algorithms for Molecular Biology, Volume 6, Article 26. The RNAFold web server (http: / / rna.tbi.univie.ac.at / / cgi-bin / RNAWebSuite / RNAfold.cgi) was used to predict the double-stranded regions of construct 001 described herein. Briefly, the secondary structure of construct 001 was modeled based on minimum free energy using the default "folding algorithm" and "basic options". The default "advanced folding options" were used, except for the selection of "DNA" and "circular" parameters.

[0334] Figure 16 shows the prediction of the resulting structure of construct 001 as a circular ssDNA. No double-stranded regions of more than 16 consecutive base pairs were predicted. This result suggests that under physiological conditions, circular ssDNA constructs can be generated that lack long regions of double stranding that are associated with the stimulation of the innate immune response (see Luecke et al. 2017. EMBO Reports Volume 18, Issue 10:1707-1715).

[0335] Example 12: Purity levels of cssDNA constructs Circular single-stranded DNA constructs were generated as described in Examples 1-4. Their levels and purity were determined. Purity was determined using absorbance ratios, specifically A260 / A280 and A230 / A260 (Table 6).

[0336] [Table 6]

[0337] All publications, patents, and patent applications cited herein are incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of a conflict between a term in this specification and a term in an incorporated reference, the term in this specification shall control.

Claims

1. A pharmaceutical formulation comprising a lipid nanoparticle (LNP) containing single-stranded DNA (ssDNA), wherein the ssDNA is (a) encodes only one protein, which is a therapeutic protein; (b) covalently closed; (c) does not form double-stranded structures longer than 40 base pairs; (d) is at least 200 nucleotides in length; (e) does not contain a protelomerase target sequence; where: (i) at least 95% by mass of the total DNA in the composition is said covalently closed circular ssDNA; (ii) the pharmaceutical formulation does not contain a polypeptide; (iii) A pharmaceutical preparation in which the therapeutic protein is expressed when the ssDNA is introduced into a target cell.

2. A pharmaceutical formulation comprising LNPs containing single-stranded DNA (ssDNA), wherein the ssDNA is (a) encodes only one protein, which is a therapeutic protein; (b) covalently closed; (c) does not form double-stranded structures longer than 100 base pairs; (d) is at least 200 nucleotides in length; (e) does not contain a protelomerase target sequence; where: (i) at least 95% by mass of the total DNA in the composition is said covalently closed circular ssDNA; (ii) the pharmaceutical preparation does not contain viral proteins; (iii) A pharmaceutical preparation in which the therapeutic protein is expressed when the ssDNA is introduced into a target cell.

3. A pharmaceutical formulation comprising LNPs containing single-stranded DNA (ssDNA), wherein the ssDNA is (a) encoding a therapeutic protein; (b) covalently closed; (c) does not form double-stranded structures longer than 100 base pairs; (d) is at least 200 nucleotides in length; (e) does not contain a protelomerase target sequence; where: (i) at least 95% by mass of the total DNA in the composition is said covalently closed circular ssDNA; (ii) the pharmaceutical formulation does not contain a polypeptide; (iii) when the ssDNA is introduced into a target cell, the therapeutic protein is expressed; (iv) The pharmaceutical preparation, wherein the ssDNA does not encode a viral protein.

4. A pharmaceutical formulation comprising LNPs containing single-stranded DNA (ssDNA), wherein the ssDNA is (a) encoding a therapeutic protein; (b) covalently closed; (c) does not contain regions of intramolecular complementarity longer than 100 base pairs; (d) is at least 200 nucleotides in length; (e) does not contain a protelomerase target sequence; where: (i) at least 95% by mass of the total DNA in the composition is said covalently closed circular ssDNA; (ii) the pharmaceutical formulation does not contain a polypeptide; (iii) when the ssDNA is introduced into a target cell, the therapeutic protein is expressed; (iv) the therapeutic protein is selected from the group consisting of a transcription factor, a chromatin remodeling factor, an antigen, a peptide, a hormone, an enzyme, an antibody, a receptor ligand, a receptor, a coagulation factor, and a membrane protein; (v) A pharmaceutical formulation wherein the ssDNA does not encode a viral protein.

5. The pharmaceutical formulation of claim 1, wherein the ssDNA comprises a promoter sequence operably linked to a sequence encoding the therapeutic protein.

6. The pharmaceutical formulation described in any one of claims 1 to 3, wherein the therapeutic protein is selected from the group consisting of transcription factors, chromatin remodeling factors, antigens, peptides, hormones, enzymes, antibodies, receptor ligands, receptors, coagulation factors, and membrane proteins.

7. The pharmaceutical formulation of claim 1, wherein the ssDNA has a GC content of 30-40%, 40-50%, 50-60%, or 60-70%.

8. A pharmaceutical formulation described in any one of claims 1 to 4, wherein the ssDNA further comprises a nuclear targeting sequence (NTS).

9. The pharmaceutical formulation of claim 1, wherein the ssDNA further comprises a maintenance sequence.

10. The pharmaceutical formulation of claim 1, wherein the ssDNA further comprises a second strand motif (SSM).

11. The pharmaceutical formulation of claim 1, wherein the ssDNA comprises 200 to 3,000 nucleotides.

12. The pharmaceutical formulation of claim 1, wherein the ssDNA comprises 500 to 2,000 nucleotides.

13. The pharmaceutical formulation of claim 1, wherein the ssDNA is a sense ssDNA strand.

14. The pharmaceutical formulation of claim 1, wherein the ssDNA comprises at least one nucleotide modification.

15. The pharmaceutical formulation of claim 14, wherein the nucleotide modification is 5-formylcytosine.

16. The pharmaceutical preparation of any one of claims 1 to 4, which is formulated for parenteral administration.

17. The pharmaceutical preparation of any one of claims 1 to 4, which is formulated for topical administration.

18. The pharmaceutical formulation of any one of claims 1 to 4, which does not contain one or more of endotoxins, mononucleotides, modified mononucleotides, and double-stranded DNA.

19. The pharmaceutical formulation of claim 1, wherein the ssDNA lacks one or both of a bacteriophage packaging site and a bacteriophage origin of replication.

20. The pharmaceutical formulation of claim 1, wherein the ssDNA does not encode a bacteriophage capsid gene.

21. A pharmaceutical formulation according to any one of claims 1 to 4 for use in a method for delivering the therapeutic protein to a subject, the method comprising administering the pharmaceutical formulation to the subject.

22. Use of a pharmaceutical formulation according to any one of claims 1 to 4 in the manufacture of a drug for delivering the therapeutic protein to a subject.

23. The pharmaceutical formulation of claim 21, wherein the method does not result in substantial integration of the ssDNA into the genome of the subject.

24. The pharmaceutical formulation of claim 6, wherein the antibody is a monoclonal antibody, a Fab fragment, or a single-chain Fv.

Images