Compositions Comprising Selected Kozak Sequences for Enhanced Expression

Abstract

Some embodiments of the present disclosure relate to the selection of a Kozak sequence that results in enhanced expression of a transgene of interest. Some embodiments relate to a Kozak sequence that is non-native to either the gene to be expressed and / or the promoter driving the expression of said gene. Some embodiments relate to a synthetic Kozak sequence designed to result in enhanced expression of said gene in a tissue of interest, such as cardiac tissue.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 265,262, filed December 10, 2021, the entire contents of which are incorporated herein by reference.

[0002] Incorporation by reference of the contents of the sequence listing This application incorporates the content provided in the attached XML file entitled AAVAN069WO_ST26.xml, created on December 8, 2022, and measuring 21,730 bytes. [Background technology]

[0003] Cardiomyopathy represents a collection of various conditions of the heart muscle and is the second most common cause of heart disease in subjects, and medical management of secondary symptoms is the only treatment option. These diseases have many causes, symptoms, and treatments, and can affect people of all ages and races. When cardiomyopathy occurs, the normal muscle of the heart can thicken, harden, thin, or become filled with substances produced by the body that do not belong to the heart muscle. As a result, the heart muscle's blood pumping function decreases, which can lead to arrhythmias, blood backing up into the lungs or other parts of the body, and heart failure. Cardiomyopathy can be acquired or hereditary. Although not all of its causes are known, there is an increasing understanding of the genetic basis of hereditary forms of the disease.

[0004] Gene transfer strategies have been shown to alleviate heart disease. Through gene transfer, replacement of damaged or non-functioning alleles with functional copies that can be translated into proteins can be achieved. The efficiency of such replacement, and downstream translation, can be attenuated by various means. Summary of the Invention

[0005] Some embodiments provided herein relate to compositions and methods for more effective gene therapy, in particular, some embodiments relate to enhanced expression of therapeutic genes in cardiac tissue.

[0006] Cardiomyopathy is a class of heart muscle diseases that adversely affect the heart's ability to circulate blood through the cardiovascular system.There are various types of cardiomyopathy, including dilated cardiomyopathy, hypertrophic cardiomyopathy, and restrictive cardiomyopathy.Cardiomyopathy is a major medical burden in the human population, and although cardiomyopathy in the human population is particularly desirable, there is currently an unmet need for treatment.

[0007] Dilated cardiomyopathy (DCM) is one of the most common types of human cardiomyopathy, mostly occurring in adults between the ages of 20 and 60. DCM affects the ventricles and atria, the upper and lower chambers of the heart, respectively. Most forms of DCM are acquired due to numerous causes, including coronary heart disease, heart attack, high blood pressure, diabetes, thyroid disease, viral hepatitis, and viral infections that cause inflammation in the heart muscle. Alcohol abuse, and certain drugs such as cocaine and amphetamines, as well as at least two drugs used to treat cancer (doxorubicin and daunorubicin), can also cause DCM. In addition, there are numerous genetic forms of DCM, including but not limited to DCM associated with Duchenne muscular dystrophy and Becker muscular dystrophy. In cases of certain forms of Becker muscular dystrophy, as well as in most cases of Duchenne muscular dystrophy, cardiomyopathy can ultimately limit the patient's survival.

[0008] Hypertrophic cardiomyopathy (HCM) occurs when the walls of the heart muscle become abnormally thickened. The increased wall thickness can increase cardiac complications as well as block or obstruct blood flow in the heart.

[0009] Restrictive cardiomyopathy (RCM) is a condition that causes stiffening of the heart's chambers over time. Although the heart's ability to contract remains largely unaffected, the myocardium does not relax adequately between heart beats. This limits the ability of the ventricles to fill with blood and causes blood to back up into the circulatory system.

[0010] Cardiac function is critically dependent on calcium-dependent signaling. During cardiac disease, calcium channel dysfunction in cardiac cells promotes calcium cycling abnormalities, further impairing cardiac function. Gene transfer strategies that reduce calcium cycle abnormalities have been reported to alleviate cardiac disease in small and large animal models, as well as in human clinical trials. The selection of feasible regulatory elements to achieve said gene transfer is crucial for optimal protein expression. Gene delivery approaches have been attempted to treat human subjects with one or more types of cardiomyopathies or symptoms thereof. The selection of vectors, regulatory elements, and transgenes can affect the overall efficiency of protein expression.

[0011] The Kozak sequence is a functional sequence motif located near or at the translation start site of eukaryotic mRNAs that mediates ribosome assembly and translation initiation and helps regulate proper transcription of proteins in the correct reading frame.

[0012] In some embodiments, a nucleic acid is provided that includes an expression construct that includes a transgene coding sequence, a promoter, and a consensus Kozak sequence, wherein the expression construct is flanked on either side by inverted terminal repeat sequences, and the synthetic Kozak sequence has at least 80%, at least 85%, or at least 88% identity to a sequence of AGCCCCAAC. In some embodiments, the consensus Kozak sequence has a sequence of AGCCCCAAC. In some embodiments, the promoter includes a cardiac specific promoter. In some embodiments, the promoter is selected from the group consisting of CMV, mini-CMV, CBA, HSV, TK, RSV, SV40, MMTV, Ad E1A, cardiac troponin C, cardiac troponin I, cardiac troponin T (cTnT), and combinations thereof.

[0013] In some embodiments, the transgene coding sequence encodes a cardiac gene. In some embodiments, the cardiac gene is BAG3. In some embodiments, the transgene coding sequence encodes a protein having at least 90, 91, 92, 93, 94, 95% or more sequence identity to SEQ ID NO: 10. In some embodiments, the cardiac gene is cardiac myosin binding protein C (MYBPC3). In some embodiments, the transgene coding sequence encodes a protein having at least 90, 91, 92, 93, 94, 95% or more sequence identity to SEQ ID NO: 11.

[0014] In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector genome. In some embodiments, the genome is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, a recombinant adeno-associated virus (rAAV) particle is provided comprising any of the nucleic acids disclosed herein. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 particle. In some embodiments, the rAAV particle is an AAVmut5 particle comprising a tryptophan to arginine mutation at amino acid 505 of the VP1 capsid. In some embodiments, the rAAV particle is a rh10 particle. Also provided is a composition comprising a plurality of rAAV particles as defined herein. In some embodiments, the composition further comprises a pharma- ceutically acceptable carrier.

[0015] In addition to the compositions defined herein, their use for treating a subject is also defined.For example, in some embodiments, a method is provided for inducing increased expression of a human transgene in a target cell, the method comprising contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a sequence encoding a human transgene, a Kozak sequence, and an enhancer element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and the contacting results in increased expression of the human transgene in the target cell compared to before contacting, thereby increasing the expression of the human transgene.In some embodiments, the Kozak sequence is non-native to one or more of the transgene, the enhancer element, and / or the promoter.In some embodiments, the Kozak sequence is a synthetic consensus sequence.

[0016] As noted above, in some embodiments, the transgene coding sequence encodes a cardiac gene, such as BAG3 or MYBPC3. In some embodiments, the transgene coding sequence encodes a protein having at least 90, 91, 92, 93, 94, 95% or more sequence identity to SEQ ID NO: 10. In some embodiments, the transgene coding sequence encodes a protein having at least 90, 91, 92, 93, 94, 95% or more sequence identity to SEQ ID NO: 11.

[0017] In some embodiments, the contacting is in vivo.

[0018] In some embodiments, a method of generating a consensus Kozak sequence is provided, the method including: constructing a collection of multiple naturally occurring Kozak sequences associated with a gene of interest; for each nucleotide position of at least a first naturally occurring Kozak sequence, comparing a first identity of a first nucleotide of at least a first naturally occurring Kozak sequence to a first identity of a first nucleotide of a second naturally occurring Kozak sequence, where the first nucleotide of the at least a first naturally occurring Kozak sequence and the first nucleotide of the second Kozak sequence occupy the same position relative to the length of the at least a first naturally occurring Kozak sequence and the second naturally occurring Kozak sequence; identifying a predominant nucleotide at each position, where identifying includes one or more of nucleotide identity, purine identity, or pyrimidine identity; and constructing a consensus sequence comprising the predominant nucleotide for each position.

[0019] In some embodiments, the gene of interest is a cardiac gene. In some embodiments, the collection of natural Kozak sequences includes at least six genes of interest. In some embodiments, the method further comprises performing an in silico stability assessment of the consensus sequence and / or an in silico prediction of the binding efficiency of a ribosome complex to the consensus sequence. In some embodiments, the method further comprises cloning the consensus Kozak sequence into a transgene.

[0020] In some embodiments, a method for generating a consensus Kozak sequence is provided, the method comprising: constructing a collection of multiple natural Kozak sequences associated with a gene of interest; and utilizing a computer-implemented method to generate a consensus sequence. In some embodiments, the gene of interest is highly expressed in a tissue of interest. In some embodiments, the tissue is cardiac tissue.

[0021] Disclosed herein are methods for determining Kozak sequences for regulating or enhancing expression of a gene of interest for treating a human subject having one or more types of cardiomyopathy or symptoms thereof, and compositions of said Kozak sequences. In some embodiments, the Kozak sequence is selected to enhance expression of a non-native transgene (e.g., a gene not normally associated with said Kozak sequence). In some embodiments, the Kozak sequence is non-native to the promoter driving expression of the transgene. In some embodiments, the Kozak sequence is non-native to both the promoter and the transgene. In some embodiments, the Kozak sequence is a synthetic consensus sequence.

[0022] Some embodiments of the present disclosure provide methods for the introduction and insertion of one or more Kozak sequences into constructs and vectors encoding one or more genes of interest. These consensus sequences can thus enhance protein translation efficiency compared to vectors and constructs lacking the sequences (e.g., non-native Kozak sequences and / or consensus sequences).

[0023] Thus, some aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) vector for delivering a transgene to the heart of a subject. Such a rAAV vector may include, in order from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, one or more transgenes operably linked to a promoter, and a second AAV inverted terminal repeat (ITR) sequence. In some embodiments, the rAAV vector includes a regulatory element in addition to a promoter that regulates expression, for example, in a manner that results in a physiologically equivalent expression level and / or restricts expression to a specific cell type or tissue. In some embodiments, the regulatory element includes one or more of an enhancer, a 5' untranslated region (UTR), and a 3' UTR. In some embodiments, the regulatory element includes a Kozak sequence (e.g., a consensus sequence) as defined herein. In some embodiments, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of the transgene). In some embodiments, the two transgenes are operably linked to the same single promoter. In some embodiments, each transgene is operably linked to a separate promoter. In some embodiments where multiple transgenes are provided, the rAAV vector also includes at least one polyadenylation signal (e.g., located 3' of two transgenes expressed from a single promoter, or located 3' of one or both transgenes expressed from different promoters). Aspects of the present disclosure provide a recombinant adeno-associated virus (rAAV) nucleic acid vector for delivering two or more transgenes to the heart of a subject, wherein the vector includes, from 5' to 3', a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, two or more transgenes and a promoter operably linked to the two or more transgenes, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0024] In some embodiments, a nucleic acid is provided comprising an expression construct, wherein the expression construct comprises, consists of, or consists essentially of a transgene encoding sequence, a promoter, and a synthetic consensus Kozak sequence, the expression construct being flanked on either side by inverted terminal repeats, the synthetic Kozak sequence having at least 88% sequence identity to the sequence of AGCCCCAAC. In some embodiments, the consensus Kozak sequence has the sequence of AGCCCCAAC.

[0025] In some embodiments, a nucleic acid is provided that comprises an expression construct, wherein the expression construct comprises, consists of, or consists essentially of a transgene coding sequence, a promoter, and a Kozak sequence that is non-native (e.g., not normally associated with the expression or function) to one or more of the transgene, promoter, and enhancer element (if present). In some embodiments, the expression construct is flanked on both sides by inverted terminal repeat sequences.

[0026] In some embodiments, the promoter comprises a cardiac specific promoter. In other embodiments, a non-specific promoter is used. In some embodiments, the promoter is selected from CMV, mini-CMV, CBA, HSV, TK, RSV, SV40, MMTV, Ad E1A, cardiac troponin C, cardiac troponin I, cardiac troponin T (cTnT), and combinations thereof. If space permits, in some embodiments, multiple promoters are optionally used, and in some embodiments, they may be the same or different from each other.

[0027] In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector genome. In some embodiments, the genome is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, a plurality of rAAV particles is provided, comprising one or more nucleic acid constructs disclosed herein. In some embodiments, the plurality of rAAV particles comprises AAV9 particles. In some embodiments, the plurality of rAAV particles comprises rh74 particles. In some embodiments, the plurality of rAAV particles comprises rh10 particles. In some embodiments, the plurality of rAAV particles comprises AAVmut5 particles comprising a tryptophan to arginine mutation at amino acid 505 of the VP1 capsid.

[0028] Additionally defined herein is a composition comprising a plurality of rAAV particles as disclosed herein, said plurality of rAAV particles being of the same type or a combination of different types of rAAV particles as defined herein, in some embodiments, said composition is formulated with one or more pharma- ceutically acceptable carriers.

[0029] In some embodiments, a method of inducing increased expression of a human transgene in a target cell is provided, the method comprising contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a sequence encoding a human transgene, a Kozak sequence, and an enhancer element operably linked to a promoter, wherein the Kozak sequence is non-native to one or more of the transgene, the enhancer element, and / or the promoter, the expression construct is flanked on either side by inverted terminal repeat sequences, and the contacting results in increased expression of the human transgene in the target cell compared to before the contacting, thereby increasing expression of the human transgene. In some embodiments, the non-native Kozak sequence is a synthetic consensus sequence. In some embodiments, the contacting is in vivo.

[0030] In some embodiments, a method for generating a consensus Kozak sequence is provided, the method comprising: constructing a collection of multiple natural Kozak sequences, each associated with a natural gene of interest; comparing a first identity of a first nucleotide of at least a first natural Kozak sequence with a first identity of a first nucleotide of a second natural Kozak sequence (at least for each nucleotide position of the first natural Kozak sequence), where the first nucleotide of at least the first natural Kozak sequence and the first nucleotide of the second natural Kozak sequence occupy the same position relative to the length of at least the first natural Kozak sequence and the second natural Kozak sequence; identifying a predominant nucleotide at each position, where identifying comprises one or more of nucleotide identity, purine identity, or pyrimidine identity; and constructing a consensus sequence comprising the predominant nucleotide for each position. In some embodiments, the gene of interest is a cardiac gene, or a gene known to be expressed at a relatively high level in cardiac tissue. In some embodiments, the collection of natural Kozak sequences comprises at least six genes of interest. In some embodiments, the method further comprises performing an in silico stability assessment of the consensus sequence and / or an in silico prediction of the binding efficiency of a ribosome complex to the consensus sequence. In some embodiments, the method further comprises cloning the consensus Kozak sequence into a transgene.

[0031] In some embodiments, the Kozak sequence is encoded by a polynucleotide having at least 85%, at least 88%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence represented as AGCCCCAAC. In some embodiments, one or more Kozak sequences of the present disclosure are consensus sequences. In some embodiments, one or more Kozak sequences are engineered to be species-specific. In some embodiments, one or more Kozak sequences are engineered to be tissue-specific. In some embodiments, one or more Kozak sequences are engineered to enhance expression in a tissue of interest (e.g., cardiac tissue). In some embodiments, one or more Kozak sequences are computer-derived sequences.

[0032] The composition of the present disclosure may be administered to a subject via various routes. In some embodiments, the composition is administered to a subject via intravenous injection. In some embodiments, administration of the composition results in expression of the transgene (or expression of two or more transgenes, if multiple transgenes are used) in the subject's heart. In various embodiments, administering the composition results in improved cardiac function in the subject, for example, improved cardiac function in the subject for a period of more than 10 months. In some embodiments, administration results in improved cardiac function for a period of more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, the improved cardiac function is represented by an increase in left ventricular ejection fraction (LVEF). In some embodiments, LVEF (compared to pre-treatment measurements) is increased by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between the recited amounts). In some embodiments, LVEF is measured by echocardiography. In some embodiments, administration results in improved cardiac physiology (e.g., structural properties) for a period of more than 12 months, more than 14 months, more than 16 months, more than 17 months, more than 20 months, more than 22 months, or more than 24 months. In some embodiments, the improved cardiac physiology is represented by a reduction in left ventricular wall thickness. In some embodiments, the left ventricular wall thickness is reduced by at least about 1%, about 2%, about 3%, about 4%, about 5%, or more (including any amount between the recited amounts). In some embodiments, the left ventricular wall thickness is measured by cardiac magnetic resonance imaging (MRI) or transthoracic echocardiography (TTE).

[0033] In some embodiments, compositions comprising AAV vectors, virions, viral particles, and pharmaceutical formulations thereof are described that are useful in methods for delivering genetic material encoding one or more beneficial or therapeutic products to mammalian cells and tissues. The rAAV vectors, rAAV particles, or compositions comprising the rAAV particles of the present disclosure may be used for gene therapy of cardiac disease in a subject in need of gene therapy, such as one or more types of cardiomyopathies.

[0034] In some embodiments, an optimized Kozak sequence designed to enhance expression of a transgene within an expression construct is described.

[0035] In some embodiments, a nucleic acid is described, the nucleic acid comprising an expression construct comprising a sequence encoding a transgene, a promoter, and a consensus Kozak sequence, wherein the expression construct is flanked on either side by inverted terminal repeat sequences.

[0036] In some embodiments, the nucleic acid is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the nucleic acid is a single-stranded or self-complementary rAAV nucleic acid vector. In some embodiments, the rAAV particle is an AAV9 particle. In some embodiments, the rAAV particle is a rh74 particle. In some embodiments, the rAAV particle is an AAVmut5 particle. In some embodiments, the rAAV particle is a rh10 particle. In some embodiments, a composition is provided comprising a plurality of rAAV particles. In some embodiments, the plurality of rAAV particles further comprises a pharma- ceutically acceptable carrier. In some embodiments, the rh74 particles comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a nucleotide sequence represented as SEQ ID NO:1, or as a portion of SEQ ID NO:4 (e.g., SEQ ID NO:1 encodes the VP1, VP2, and VP3 proteins of rh74; i.e., in some embodiments, the rh74 particles described in the embodiments disclosed herein comprise at least one capsid protein encoded by a polynucleotide having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a subpart of the nucleotide sequence of SEQ ID NO:1). In some embodiments, the rh74 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence depicted in SEQ ID NO:4, or as a portion of SEQ ID NO:4 (e.g., SEQ ID NO:4 is the amino acid sequence of the VP1, VP2, and VP3 proteins of rh74.That is, in some embodiments, the rh74 particles described in the embodiments disclosed herein comprise at least one capsid protein having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a subportion of the amino acid sequence of SEQ ID NO:4. In some embodiments, the AAV9 particles comprise an amino acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence represented as SEQ ID NO:8, or are encoded by a nucleic acid sequence having at least about 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to one or more of the sequences represented as SEQ ID NOs:5, 6, or 7.

[0037] Also described herein is a method of inducing increased expression of a human transgene in a target cell, the method comprising contacting a target cell with a plurality of rAAVs comprising a nucleic acid expression construct comprising an enhancer element operably linked to a promoter, a Kozak sequence, and a sequence encoding a human transgene, wherein the expression construct is flanked on either side by inverted terminal repeat sequences, and the contacting results in increased expression of the human transgene in the target cell compared to before the contacting, thereby increasing expression of the transgene. In some embodiments, the contacting is in vivo. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0038] Reference is made to specific features and / or non-limiting embodiments of the invention. It is understood that the disclosure of the invention in this specification includes all possible combinations of such specific features. For example, if a specific feature is disclosed in the context of a specific aspect or embodiment of the invention, or a specific claim, that feature can also be used in combination with and / or in the context of other specific aspects and embodiments of the invention, to the extent possible, and can be used universally in the present invention.

[0039] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.All patents, applications, published applications, and other publications referenced herein are incorporated by reference in their entirety unless otherwise stated.In the present specification, if there are multiple definitions of a term, the definition in this section shall prevail unless otherwise stated.

[0040] "Subject" refers to a mammal that is the object of treatment using the methods or compositions provided herein. "Mammals" include, but are not limited to, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates such as monkeys, chimpanzees, and apes, and humans. In some embodiments, the subject is a human.

[0041] The terms "treating", "treatment", "therapeutic" or "treatment" do not necessarily mean a complete cure or disappearance of a disease or condition. Any attenuation of any undesirable sign or symptom of a disease or condition, to any extent, can be considered to be treatment and / or therapy. "Treating" a disease, as the term is used herein, means reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.

[0042] As used herein, the term "effective amount" refers to an amount that can treat or alleviate a disease or condition, or that can produce the intended therapeutic effect, such as reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.

[0043] A "nucleic acid" sequence refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequence. The term includes 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxy-methyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil, benzylaminomethyluracil, 5-methyl ... The bases include sequences that contain any known base analogs of DNA and RNA, such as, but not limited to, beta-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.

[0044] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including DNA, RNA, or their analogs. A polynucleotide may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be separated by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. As used herein, the term polynucleotide refers interchangeably to double-stranded or single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is a polynucleotide encompasses both the double-stranded form and each of the two complementary single-stranded forms that are known or predicted to form a duplex.

[0045] The term "isolated," when referring to a nucleotide sequence, means that the molecule is present in the substantial absence of other macromolecules of the same type. That is, an "isolated nucleic acid molecule encoding a particular polypeptide" refers to a nucleic acid molecule that is substantially free of other nucleic acid molecules that do not encode the polypeptide of interest, although the molecule may contain some additional bases or moieties that do not substantially affect the basic characteristics of the composition.

[0046] The term "identity" refers to the exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotide or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their "percent identity." The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence, multiplied by 100.

[0047] Throughout this application, for purposes of describing the relative positions of nucleotide sequences in a particular nucleic acid molecule, for example, when a particular nucleotide sequence is described as being located "upstream," "downstream," "3'" or "5'" to another sequence, this is understood as referring to the position of that sequence in the "sense" or "coding" strand of the DNA molecule being referred to, as is customary in the art.

[0048] Sequence identity can be determined by aligning sequences using algorithms such as BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis., using default gap parameters, or by inspection, and by the best alignment (i.e., resulting in the highest sequence similarity percentage over the comparison window). The sequence identity percentage is calculated by comparing two optimally aligned sequences over a comparison window, determining the number of positions where identical residues occur in both sequences, obtaining the number of matching positions, dividing the number of matching positions by the total number of matching and non-matching positions (not counting gaps) in the comparison window (i.e., the window size), and multiplying the quotient by 100 to obtain the sequence identity percentage. Unless otherwise indicated, the comparison window between two sequences is defined by the total length of the shorter of the two sequences.

[0049] The term "recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps and other procedures that result in constructs that differ from naturally occurring polynucleotides and / or combinations of non-naturally occurring polynucleotides with viral proteins. A recombinant virus is a viral particle that contains a recombinant polynucleotide. These terms include copies of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0050] The term "gene" refers to a polynucleotide that contains at least one open reading frame that can code for a particular gene product. Any polynucleotide sequence described herein may be used to identify larger fragments or full-length coding sequences of the gene to which they relate. Methods for isolating larger fragment sequences are known to those skilled in the art.

[0051] The term "transgene" as used herein refers to a nucleic acid sequence located in a viral vector and encoding a polypeptide, protein, or other product of interest.In some embodiments, one rAAV vector may contain a sequence encoding one or more transgenes (possibly the same gene or different genes).For example, one rAAV vector may contain the coding sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 transgenes.The transgenes of the present disclosure are related to the improvement of one or more cardiac conditions as defined herein, such as cardiomyopathies.

[0052] The term "gene transfer" or "gene delivery" refers to a method or system for inserting DNA, such as a transgene, into a host cell, such as the cell of a subject suffering from cardiomyopathy. In some embodiments, gene transfer results in transient expression of unintegrated introduced DNA, extrachromosomal replication, and expression of an introduced replicon (e.g., episome). In additional embodiments, gene transfer results in integration of the introduced genetic material into the genomic DNA of the host cell.

[0053] The term "regulatory element" or "regulatory sequence", or variations thereof, refers to a nucleotide sequence involved in the functional regulation of a polypeptide, including the replication, duplication, transcription, splicing, translation, or degradation of a polynucleotide. Regulatory elements may be enhancing or repressive in nature, depending on the embodiment. Non-limiting examples of regulatory elements include transcriptional regulatory sequences such as promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (IRES), enhancers, and the like. These elements together provide for the replication, transcription, and translation of coding sequences in recipient cells, although not all of these sequences need always be present. It is understood that the structural components of the rAAV vectors defined herein may be listed in individual paragraphs alone for clarity, and may be used together in combination. For example, any regulatory element or other components may be used in combination with any transgene (or transgenes) defined herein.

[0054] A "promoter" is a polynucleotide that interacts with RNA polymerase and initiates transcription of a coding region (eg, a transgene) that is usually located downstream (3' direction) from the promoter.

[0055] The term "operably linked" refers to an arrangement of elements configured so that the components perform a function. For example, a regulatory sequence operably linked to a coding sequence provides the nucleic acid of the coding sequence. In some embodiments, the regulatory sequence need not be contiguous with the coding sequence; that is, for example, one or more non-translated but transcribed sequences can be present between the promoter sequence and the coding sequence, and the two sequences are still considered to be "operably linked."

[0056] The term "vector" refers to any molecular vehicle, such as a plasmid, phage, transposon, cosmid, chromosome, virus, viral particle, virion, etc., capable of transferring genetic sequences (e.g., a transgene) into or between a target cell.

[0057] An "expression vector" is a vector that contains a region of nucleic acid (e.g., a transgene) that encodes a gene product (e.g., a polypeptide or protein) of interest. As disclosed herein, vectors are used to achieve expression, e.g., stable expression, of the protein in an intended target cell. An expression vector may also contain control elements operably linked to the transgene to facilitate expression of the encoded protein in the target cell. The combination of one or more regulatory elements and the gene or genes to which they(they) are operably linked for expression may be referred to herein as an "expression cassette."

[0058] The term "AAV" is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or its derivatives. Unless otherwise indicated, the term includes all subtypes and both naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus, which is also called recombinant AAV vector (or "rAAV vector"), and refers to AAV that contains a polynucleotide sequence (e.g., a transgene) that is not of AAV origin. The term "AAV" includes AAV serotype 1 (AAV-1), AAV serotype 2 (AAV-2), AAV serotype 3 (AAV-3), AAV serotype 4 (AAV-4), AAV serotype 5 (AAV-5), AAV serotype 6 (AAV-6), AAV serotype 7 (AAV-7), AAV serotype 8 (AAV-8), AAV serotype 9 (AAV-9), serotype rh10 AAV, serotype rh74 AAV, or pseudotyped rAAV (e.g., AAV2 / 9, which refers to an AAV vector having the genome of AAV2 (e.g., the ITRs of AAV2) and the capsid of AAV9). In some embodiments, the preferred serotype for delivery to a human patient suffering from cardiomyopathy is one of AAV-9, serotype rh74, serotype rh10, or AAV-8. In some embodiments, rh74 AAV is mutated to advantageously enhance delivery to cardiac tissue, for example, by a tryptophan to arginine mutation at amino acid 505 of the VP1 capsid (also known as AAVmut5), or by other mutations as described in PCT Publication WO2019 / 178412, which is incorporated by reference in its entirety.

[0059] The term "AAV virus" or "AAV viral particle" or "AAV vector particle" refers to a viral particle that is composed of at least AAV capsid proteins and an encapsidated polynucleotide.

[0060] The term "heterologous" refers to a different origin of a genotype. For example, a heterologous polynucleotide is one that originates from a different species compared to the reference species (e.g., a human gene inserted into a viral plasmid is a heterologous gene). A promoter that is taken from its native coding sequence and is operably linked to a coding sequence with which it is not naturally linked is a heterologous promoter.

[0061] As used herein, the term "kit" may be used to describe a variety of portable, self-contained enclosures that include at least one set of components for performing one or more of the diagnostic or therapeutic methods of the present disclosure.

[0062] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle for administering rAAV particles or formulations and / or rAAV vectors. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including mineral oils such as petroleum oil, vegetable oils such as peanut oil, soybean oil, and sesame oil, animal oils, or oils of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions may also be employed as liquid carriers.

[0063] In some embodiments, the sequences described herein are CpG-depleted and cDNA codon-optimized. In some embodiments, the sequences encoding the transgenes are optionally CpG-depleted.

[0064] Terms and phrases used in this application, and variations thereof, unless expressly stated otherwise, particularly in the appended claims, should be construed as open-ended, not limiting. As in the examples above, the word "comprising" should be construed to mean "including without limitation," "including but not limited to," and the like. As used herein, "comprising" is synonymous with "including," "containing," or "featuring," and is inclusive or open-ended, and does not exclude additional elements or method steps not recited. The term "having" should be construed as "having at least." The term "including" should be construed as "including but not limited to." The term "example" is used to provide illustrative examples of the items being described, rather than a complete or exhaustive listing thereof. And the use of terms such as "preferably," "preferred," "desired," or "desirable," and words of similar import, should not be understood to suggest that a particular feature is critical, essential, or critical to structure or function, but instead should be understood as merely intended to highlight alternative or additional features that may or may not be utilized in a particular embodiment. Additionally, the term "comprising" should be construed as synonymous with the phrases "having at least" or "including at least." When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components. Similarly, a group of items joined by "and" should not be construed as requiring the presence of each and every item in the group, but rather as "and / or" unless expressly stated otherwise.Similarly, groups of items connected with "or" should not be construed as requiring mutual exclusivity among the groups, but rather as "and / or" unless expressly stated otherwise.

[0065] For the use of virtually any plural and / or singular term herein, a person skilled in the art may convert from plural to singular and / or from singular to plural as appropriate to the context and / or application. For clarity, various singular / plural permutations may be expressly expressed herein. The indefinite article "a" or "an" does not exclude a plurality. A single processor or other unit may fulfill the functions of several items recited in the claims. The mere fact that certain means are recited in mutually different dependent claims does not indicate that a combination of these means cannot be used to advantage. Any reference signs in the claims should not be interpreted as limiting the scope thereof.

[0066] Ranges disclosed herein also encompass any and all overlaps, sub-ranges, and combinations thereof. Words such as "up to," "at least," "greater than," "less than," "between," and the like, include the recited number. Numbers recited after terms such as "about" or "approximately" include the recited number. For example, "about 90%" includes "90%." In some embodiments, at least 95% homologous or identical to a reference sequence includes 96%, 97%, 98%, 99%, and 100% homologous or identical. In addition, when a sequence is disclosed as "comprising" a nucleotide or amino acid sequence, such reference will also include that the sequence "comprises," "consists of," or "consists essentially of" the sequence recited, unless otherwise indicated. [Table 1]

[0067] Transgene Transgenes may be employed to correct, reduce, eliminate, or otherwise alleviate genetic deficiencies, which may include deficiencies in which a normal gene is expressed at lower than normal levels, deficiencies in which a gene product is expressed at normal or near normal levels but has abnormal activity, or deficiencies in which a functional gene product is not expressed. In some embodiments, the transgene sequence encodes a therapeutic protein or polypeptide to be expressed in the host cell. Embodiments of the present disclosure also include the use of multiple transgenes.

[0068] Kozak sequence The Kozak sequence provided herein can enhance translation in eukaryotic cells through any gene alteration technique. The Kozak sequence provided herein can be inserted into a construct carrying a transgene encoding a polypeptide, where the Kozak sequence is operably linked to the transgene sequence. When transcribed, the Kozak sequence on the resulting mRNA transcript can signal or otherwise increase the recruitment of ribosome translation machinery. Thus, the addition or modification of a Kozak sequence to an expression construct can act to enhance the translation of the corresponding mRNA transcript.

[0069] The known consensus Kozak motif (A / G)CCAUGG has been demonstrated to be a strong aid in transcription initiation. Genetic engineers have used this sequence to generate high levels of recombinant protein expression. In the human genome, it has been reported that 11% of genes use the classical consensus sequence (A / G)CCAUGG (Ferreira et. al., Proc Natl Acad Sci US A. 2013 Jul 9; 110(28): 11284-11289). That is, about 89% of human gene sequences differ from the consensus Kozak sequence. The addition of the consensus Kozak sequence can serve to enhance translation and production of downstream proteins.

[0070] Regulatory elements In some embodiments, the rAAV vector comprises one or more regions that include a sequence that promotes expression of a heterologous nucleic acid, e.g., one or more expression regulatory sequences operably linked to the heterologous nucleic acid. A promoter drives transcription of the nucleic acid sequence that it regulates. That is, a promoter is typically located at or near the transcription start site of a gene. A promoter may have a length of, for example, 100 to 1000 nucleotides. In some embodiments, a promoter is operably linked to a nucleic acid, or a sequence of a nucleic acid (a nucleotide sequence). A promoter is considered to be "operably linked" to a sequence of a nucleic acid that it controls when the promoter is in the correct functional location and orientation relative to the sequence such that the promoter regulates the sequence (e.g., controls ("drives") transcription initiation and / or expression). Many such sequences are known in the art.

[0071] Promoters that may be used according to the present disclosure may include any promoter that can drive expression of a transgene in the heart of a subject. In some embodiments, the promoter may be a tissue-specific promoter. As used herein, a "tissue-specific promoter" refers to a promoter that can only function in a particular type of tissue, such as the heart. That is, a "tissue-specific promoter" cannot drive expression of a transgene in other types of tissue. In some embodiments, a promoter that may be used according to the present disclosure is a heart-restricted promoter. Non-limiting examples of tissue-specific promoters and / or regulatory elements that may be used include (1) myocyte-specific desmin, creatine kinase, myogenin, alpha myosin heavy chain, and natriuretic peptide, and (2) hepatocyte-specific albumin, alpha-1-antitrypsin, hepatitis B virus core protein promoters. Non-limiting examples of heart-restricted promoters are selected from cardiac troponin C, cardiac troponin I, and cardiac troponin T (cTnT). In the treatment of cardiomyopathy as defined herein, the heart-restricted promoter is advantageous in that it at least reduces the possibility of off-target expression of transgene, thereby effectively increasing the amount of delivery to the heart and enhancing treatment.Non-limiting examples of expression regulatory sequences include promoter, insulator, silencer, response element, intron, enhancer, start site, termination signal, and poly(A) tail.Any combination of such regulatory sequences is contemplated herein (e.g. promoter and enhancer).

[0072] Alternatively, the promoter may be a promoter of one of the following genes, including, but not limited to, the α-myosin heavy chain gene, the 6-myosin heavy chain gene, the myosin light chain 2v (MLC-2v) gene, the myosin light chain 2a gene, the CARP gene, the cardiac α-actin gene, the cardiac m2 muscarinic acetylcholine gene, the atrial natriuretic factor gene (ANF), the cardiac sarcoplasmic reticulum Ca-ATPase gene, the skeletal α-actin gene; or the artificial heart promoter derived from the MLC-2v gene.

[0073] Any number of promoters suitable for use in the selected host cell may be employed to achieve the appropriate expression level of the nucleic acid, protein, or polypeptide of interest. The promoter may be, for example, a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a synthetic promoter. For example, constitutive promoters of different strengths may be used. The rAAV vectors described herein may include one or more constitutive promoters, such as viral promoters or promoters of mammalian genes that are generally active in promoting transcription. Non-limiting examples of viral constitutive promoters include herpes simplex virus (HSV), thymidine kinase (TK), Rous sarcoma virus (RSV), simian virus 40, (SV40), mouse mammary tumor virus (MMTV), Ad E1A, and cytomegalovirus (CMV) promoters. Non-limiting examples of non-viral constitutive promoters include various housekeeping gene promoters, typified by the β-actin promoter, including chicken β-actin promoter (CBA).

[0074] Inducible promoters and / or regulatory elements may also be contemplated to achieve appropriate expression levels of the protein or polypeptide of interest.Non-limiting examples of suitable inducible promoters include promoters of genes such as cytochrome P450 genes, heat shock protein genes, metallothionein genes, and hormone-inducible genes such as estrogen genes.Another example of an inducible promoter is the tetVP16 gene promoter, which is responsive to tetracycline.

[0075] Synthetic promoters are also contemplated herein. Synthetic promoters may contain, for example, regions of known promoters, regulatory elements, transcription factor binding sites, enhancer elements, repressor elements, and the like.

[0076] Enhancer elements may function in combination with other regulatory elements to increase expression of a transgene. In some embodiments, the enhancer element is upstream (located 5') of the transgene. Non-limiting embodiments of enhancer elements include nucleotide sequences including, for example, a 100 base pair element of Simian Virus 40 (SV40 late 2XUSE), a 35 base pair element of Human Immunodeficiency Virus 1 (HIV-1 USE), a 39 base pair element of Ground Squirrel Hepatitis Virus (GHV USE), a 21 base pair element of Adenovirus (Adenovirus L3 USE), a 21 base pair element of human prothrombin (hTHGB USE), a 53 base pair element of human C2 component gene (hC2 USE), truncations of any of the foregoing, and combinations of the foregoing. In some embodiments, the enhancer is derived from the α-myosin heavy chain (αMHC) gene. In some embodiments, the αMHC enhancer comprises a nucleic acid sequence having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity to CCTTCAGATTAAAAATAACTAAGGTAAGGGCCATGTGGGTAGGGGAGGTGGTGTGAGACGGTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCCTGGAGCCAGAGGGGCGAGGGCAGCAGACCTTTCATGGGCAAACCTCAGGGCTGCTGTC (SEQ ID NO: 9).

[0077] Non-limiting polyadenylation signals include nucleotide sequences including, for example, the 624 base pair polyadenylation signal of human growth hormone (hGH), the 135 base pair polyadenylation signal of simian virus 40 (sV40 late), the 49 base pair synthetic polyadenylation signal (SPA) from rabbit beta globin, the 250 base pair polyadenylation signal of bovine growth hormone (bGH), truncations of any of the foregoing, and combinations of the foregoing.

[0078] In some embodiments of the disclosed rAAV vectors, two or more transgenes are operably controlled by a single promoter, hi some embodiments, each of the two or more transgenes is operably controlled by a separate promoter.

[0079] In some embodiments, the rAAV vector of the present disclosure further comprises an internal ribosome entry site (IRES). IRES is a nucleotide sequence that allows translation initiation in the middle of a messenger RNA (mRNA) sequence as part of the larger process of protein synthesis. Normally, in eukaryotes, translation can only be initiated at the 5' end of an mRNA molecule, since the assembly of the initiation complex requires recognition of the 5' cap. In some embodiments, the IRES is located between transgenes.

[0080] In some embodiments, proteins encoded by different transgenes are translated individually (ie, as opposed to being translated as a fusion protein).

[0081] In some embodiments, an rAAV vector of the disclosure comprises at least, in 5' to 3' order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a first transgene operably linked to a promoter, a second transgene operably linked to an IRES, a polyadenylation signal, and a second AAV inverted terminal repeat (ITR) sequence.

[0082] In some embodiments, the rAAV vector of the disclosure further comprises a polyadenylation (pA) signal.

[0083] Expression cassette The expression cassette is composed of, at a minimum, a transgene and its regulatory sequences, including a Kozak sequence. When the cassette is designed to be expressed from a rAAV, the expression cassette further comprises 5' and 3' ITRs. These ITRs may be full-length, or one or both of the ITRs may be truncated. In some embodiments, the rAAV is pseudotyped. That is, the capsid of the AAV is from a different source AAV than the AAV that provides the ITRs. In some embodiments, the ITRs of AAV serotype 2 are used. In additional embodiments, the ITRs of AAV serotype 1 are used. However, ITRs from other suitable sources may be selected.

[0084] vector Further provided herein is a rAAV virus particle or a rAAV formulation containing such a particle. In some embodiments, the rAAV particle comprises a viral capsid and one or more transgenes described herein, which are encapsidated by the viral capsid. Methods for producing rAAV particles are known in the art and are commercially available (see, for example, Zolotukhin, et. al. Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28 (2002) 158-167, which are incorporated herein by reference; and US Patent Application Publication Nos. US2007 / 0015238 and US2012 / 0322861; and plasmids and kits available from ATCC and Cell Biolabs, Inc.). For example, a plasmid containing the rAAV vector may be combined with one or more helper plasmids, such as a plasmid containing the rep gene (encoding, e.g., Rep78, Rep68, Rep52 and Rep40) and the cap gene (encoding VP1, VP2, and VP3, including the modified VP3 regions described herein), and transfected into a producer cell line such that the AAV particles may be packaged and subsequently purified.

[0085] The particles in the rAAV particles or rAAV formulations disclosed herein may be any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, 2 / 9, 3 / 1, 3 / 5, 3 / 8, or 3 / 9). As used herein, the serotype of the rAAV particle refers to the serotype of the capsid protein of the recombinant virus. In some embodiments, the rAAV particle is rAAV6 or rAAV9. In some embodiments, the rAAV particle is AAVrh.74. In preferred embodiments, the rAAV particle is AAVrh74. In additional preferred embodiments, the rAAV is AAV9. In some embodiments, rh74 AAV may be mutated to advantageously enhance delivery to cardiac tissue, for example, by a tryptophan to arginine mutation at amino acid 505 of the VP1 capsid, or other mutations described in PCT Publication WO2019 / 1784412, which is incorporated by reference in its entirety. Non-limiting examples of derivatives, pseudotypes, and / or other vector types include AAVrh.10, AAVrh.74, AAV2 / 1, AAV2 / 5, AAV2 / 6, AAV2 / 8, AAV2 / 9, AAV2-AAV3 hybrid, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAVrh.10, AAVrh.12, AAVrh.16, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.26, AAVrh.27, AAVrh.28, AAVrh.29 ... , AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2(Y->F), AAV8(Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45.

[0086] Such AAV serotypes and derivatives / pseudotypes, and methods for producing such derivatives / pseudotypes, are known in the art (see, e.g., Mol Ther. 2012 Apr;20(4):699- 708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan Al, Schaffer DV, Samulski RJ.). In certain embodiments, the capsid of any of the rAAV particles disclosed herein is a capsid of the AAVrh.10 serotype. In preferred embodiments, the capsid of the rAAV particle is an AAVrh10 serotype. In some embodiments, the capsid is a capsid of the AAV2 / 6 serotype. In some embodiments, the rAAV particle is a pseudotyped rAAV particle, which comprises (a) a rAAV vector that includes the ITRs of one serotype (e.g., AAV2, AAV3), and (b) a capsid that includes capsid proteins from another serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al, J. Virol., 75:7662-7671, 2001; Halbert et al, J. Virol., 74:1524-1532, 2000; Zolotukhin et al, Methods, 28:158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001). rAAV Gene Therapy for Heart Diseases

[0087] In some embodiments, the rAAV vector of the disclosure further comprises a polyadenylation (pA) signal.

[0088] In some embodiments, an rAAV vector of the disclosure comprises at least, in 5' to 3' order, a first adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence, a transgene operably linked to a promoter, a polyadenylation signal, and a second inverted terminal repeat (ITR) sequence.

[0089] In some embodiments, the rAAV vector genome is circular. In some embodiments, the rAAV vector genome is linear. In some embodiments, the rAAV vector genome is single-stranded. In some embodiments, the rAAV vector genome is double-stranded. In some embodiments, the rAAV genome vector is a self-complementary rAAV vector. In preferred embodiments, the rAAV vector genome is single-stranded. In preferred embodiments, the rAAV vector genome is self-complementary.

[0090] Non-limiting examples of rAAV vectors are described herein. The vectors exemplified below include one or more of the linearized plasmid sequences depicted in SEQ ID NOs: 1-8. The vectors of the present disclosure may include a nucleotide sequence or amino acid sequence having at least 70% identity, at least about 80% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, at least about 99% identity, at least about 99.5% identity, or at least about 99.9% identity to the sequences depicted in SEQ ID NOs: 1-8. In some embodiments, the rAAV may have 100% sequence identity to the sequences depicted in SEQ ID NOs: 1-8. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0091] In some embodiments, any of the disclosed rAAV nucleic acid vector sequences comprises a truncation at the 5' or 3' end relative to any of SEQ ID NOs: 16-23. In some embodiments, any of the rAAV vectors comprises a nucleotide sequence that differs by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or more than 18 nucleotides from any of SEQ ID NOs: 1-8.

[0092] Recombinant adeno-associated viral vectors and therapeutic uses thereof Many serotypes of AAV have been cloned and sequenced. Serotypes 1 and 6 have greater than 99% amino acid homology in their capsid proteins. Of the first six AAV serotypes, serotype 2 has been extensively characterized and is therefore often used in gene transfer studies, but other AAV serotypes, such as AAV9, AAV20, AAVrh74, and AAVrh10, are also used in accordance with embodiments disclosed herein. In some embodiments, repeated administration of a given serotype predicted to elicit a humoral immune response is linked to an immune management regimen. In some embodiments, the immune management regimen includes administration of one or more agents that function as B-cell depletors, alone or in combination with one or more agents that inhibit one or more aspects of the mTOR pathway. In some embodiments, an anti-CD20 antibody is administered and rapamycin is administered. In some embodiments, this allows for repeated administration of rAAV of a given serotype with reduced, limited, or no immune response to subsequent rAAV administrations. Further information on immune management is described in U.S. Patent Application No. 15 / 306,139, the entire contents of which are incorporated herein by reference.

[0093] The therapeutic rAAV vectors, therapeutic rAAV particles, or compositions comprising therapeutic rAAV particles of the present disclosure may be used for gene therapy of cardiac disease in a human subject in need of treatment, such as cardiomyopathies as defined herein. Examples of cardiac disease that may be treated using the methods and compositions of the present disclosure include, but are not limited to, cardiomyopathies and acute ischemia. In some embodiments, the cardiomyopathies are hypertrophic or dilated cardiomyopathy. In some embodiments, the cardiomyopathies are dilated cardiomyopathy and are caused by or associated with reduced or absent expression and / or function of genes. The therapeutic rAAV vectors, particles, and compositions comprising therapeutic rAAV particles may be administered to a subject in need of treatment, for example, via transvascular delivery to a coronary artery and / or by direct injection into the heart, for use in treating such cardiac failure (e.g., cardiac failure secondary to cardiomyopathies). The therapeutic rAAV vectors, particles, and compositions comprising rAAV particles drive co-expression of transgenes in cardiac myocytes of the subject.

[0094] In some embodiments, amino acid sequences corresponding to any of the nucleic acids disclosed herein (and / or contained in the attached sequence listing) are provided, taking into account the degeneracy of the nucleic acid code. Furthermore, those sequences (whether nucleic acid or amino acid) that differ from the sequences explicitly disclosed herein (and / or contained in the attached sequence listing) but have functional similarity or equivalence are also contemplated within the scope of the present disclosure. This includes mutations, truncations, substitutions, or other types of modifications.

[0095] According to some embodiments described herein, any of the sequences disclosed herein may be used, or truncated or mutated versions of any of the sequences disclosed herein (and / or the sequences contained in the attached sequence listing) may be used, and may be used in any combination.

[0096] The promoter driving the expression of the therapeutic nucleic acid can be, but is not limited to, a constitutive promoter, an inducible promoter, a tissue-specific promoter, a neurospecific promoter, a muscle-specific promoter, or a synthetic promoter. In some embodiments, the promoter is a neurospecific promoter or a muscle-specific promoter. The constitutive promoter can be, but is not limited to, a herpes simplex virus (HSV) promoter, a thymidine kinase (TK) promoter, a Rous sarcoma virus (RSV) promoter, a simian virus 40 (SV40) promoter, a mouse mammary tumor virus (MMTV) promoter, an adenovirus E1A promoter, a cytomegalovirus (CMV) promoter, a mammalian housekeeping gene promoter, or a β-actin promoter. The inducible promoter can be, but is not limited to, a cytochrome P450 gene promoter, a heat shock protein gene promoter, a metallothionein gene promoter, a hormone-inducible gene promoter, an estrogen gene promoter, or a tetVP16 promoter responsive to tetracycline. The muscle-specific promoter can be, but is not limited to, a desmin promoter, a creatine kinase promoter, a myogenin promoter, an alpha myosin heavy chain promoter, or a natriuretic peptide promoter.

[0097] In some embodiments, the therapeutic rAAV promoter is a neural-specific promoter or a cardiac-specific promoter.

[0098] The therapeutic rAAV can be serotype 1, serotype 2, serotype 3, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype rh10, or serotype rh74. The therapeutic rAAV can also be a pseudotyped rAAV.

[0099] In some embodiments, the therapeutic rAAV has a Kozak sequence with at least 85% sequence identity to AGCCCCAAC.

[0100] In some embodiments, the therapeutic rAAV has a sequence with at least 95% sequence identity to AGCCCCAAC.

[0101] In some embodiments, the therapeutic rAAV has a sequence with at least 99% sequence identity to AGCCCCAAC.

[0102] Pharmaceutical Formulation and Administration

[0103] The compositions described herein may further comprise pharmaceutical excipients, buffers, or diluents, and may be formulated for administration to host cells, ex vivo, or in situ in animals, and particularly humans. Such compositions may optionally further comprise or be otherwise formulated with liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles for administration to cells, tissues, organs, or bodies of subjects in need of administration. Such compositions may be formulated for use in a variety of therapies, such as, for example, alleviation, prevention, and / or treatment of conditions such as peptide deficiency, polypeptide deficiency, peptide overexpression, polypeptide overexpression, including conditions that result in diseases or disorders described herein.

[0104] Formulations containing pharma- ceutically acceptable excipient and / or carrier solutions are well known to those of skill in the art, as are the development of suitable dosing and treatment regimens for use with the particular compositions described herein in a variety of treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intraarticular, and intramuscular administration and formulations.

[0105] Typically, these formulations may contain at least about 0.1% of a therapeutic agent (e.g., therapeutic rAAV particles or formulations) or more, although the percentage of active ingredient may of course vary and may conveniently be between about 1 or 2% to about 70% or 80% or more by weight or volume of the total formulation. Of course, the amount of therapeutic agent in each therapeutically useful composition may be prepared in such a way that an appropriate dosage is obtained in any given unit dose of compound. In preparing such pharmaceutical formulations, factors such as solubility, bioavailability, biological half-life, route of administration, shelf life of the product, as well as other pharmaceutical considerations will be taken into account by those skilled in the art. In addition, various dosages and treatment regimes may be desirable.

[0106] In certain circumstances, it may be desirable to deliver the rAAV particles or formulations as appropriately formulated pharmaceutical compositions disclosed herein, either subcutaneously, intracardially, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by inhalation through the mouth or nose, or by direct injection into one or more cells (e.g., cardiomyocytes and / or other cardiac cells), tissues, or organs. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising the therapeutic rAAV particles of the invention are delivered systemically via intravenous injection, particularly for treating humans. In some embodiments, the therapeutic rAAV particles of the invention or compositions comprising the therapeutic rAAV particles of the invention are injected directly into the heart of the subject. Direct injection into the heart may include injection into one or more of myocardial tissue, the endocardium of the heart, or the skeletal muscle surrounding the heart, e.g., using a needle catheter. In some embodiments, direct injection into the human heart is preferred, e.g., when delivery is performed simultaneously with a surgical procedure, thereby improving access to the heart.

[0107] Pharmaceutical preparations of compositions suitable for injection include sterile aqueous solutions or dispersions. In some embodiments, the preparations are sterile and fluid to the extent that easy syringability exists. In some embodiments, the forms are stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier may be a solvent or dispersion medium, containing, for example, water, saline, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, vegetable oils, or other pharma- ceutically acceptable carriers, such as carriers generally recognized as safe (GRAS) by the U.S. Food and Drug Administration. Proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. In fact, there is virtually no limit to the other components that may be included, so long as the additional substances do not cause significant adverse effects upon contact with target cells or host tissues. That is, the therapeutic rAAV or formulation may be delivered together with a variety of other pharma- ceutically acceptable substances as required in a particular case. Such compositions may be purified from host cells or other biological sources, or may be chemically synthesized as described herein.

[0108] The amount of therapeutic rAAV particles or formulations and / or therapeutic rAAV vector compositions and the time of administration of such compositions will be within the scope of those skilled in the art who have the benefit of this disclosure.However, it is believed that administration of a therapeutically effective amount of the compositions of the present disclosure may be achieved by a single administration, for example, by a single administration of a sufficient number of infectious particles to provide a therapeutic benefit to the patient undergoing such treatment.In some situations, it may be desirable to provide multiple or continuous administrations of the rAAV particles or formulations and / or rAAV vector compositions, either over a relatively short or a relatively long period of time, which may be determined by the medical professional supervising the administration of such compositions.

[0109] Toxicity and efficacy of the compositions utilized in the methods of the present invention are evaluated using standard pharmaceutical procedures, including LD 50 The dose ratio between toxicity and efficacy is the therapeutic index, and it is called the LD 50 / ED 50 The therapeutic index may be expressed as a ratio of 0.1 to 0.2. Compositions that exhibit a high therapeutic index are preferred. Compositions that exhibit toxic side effects may be used, but care should be taken to design a delivery system that minimizes the potential damage of such side effects. Dosages of the compositions described herein are generally administered at doses that are sufficient to prevent ED with little or no toxicity. 50 The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.

[0110] Other aspects of the disclosure relate to methods and formulations for use in subjects, such as human or non-human subjects, host cells in situ in subjects, or host cells derived from subjects. In some embodiments, the subject is a mammal. In some embodiments, the subject is a companion animal. As used herein, "companion animal" refers to pets and other domestic animals. Non-limiting examples of companion animals include dogs and cats; farm animals such as horses, cows, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters. In some embodiments, the subject is a human subject.

[0111] In some embodiments, one or more pharma- ceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition containing a therapeutic agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a subject, such as a human.

[0112] A pharmaceutical composition or medicament comprises at least one of a therapeutic agent and, optionally, one or more pharma- ceutically acceptable excipients in a pharma- ceutically acceptable amount. A pharma- ceutically acceptable excipient (excipient) is a substance, other than an active pharmaceutical ingredient (API, therapeutic agent), that is intentionally included in a drug delivery system. An excipient has no therapeutic effect or is not intended to have a therapeutic effect at the intended dose. An excipient may a) aid in the processing of the drug delivery system during manufacturing, b) protect, support, or enhance the stability, bioavailability, or patient tolerability of the API, c) aid in product identification, and / or d) act to enhance any other property of the overall safety, efficacy, or delivery of the API during storage or use. A pharma-ceutically acceptable excipient may or may not be an inert substance.

[0113] Non-limiting examples of excipients include, but are not limited to, absorption enhancers, anti-adherents, antifoaming agents, antioxidants, binders, buffers, carriers, coatings, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavors, flow agents, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water-repelling agents, and wetting agents.

[0114] The pharmaceutical composition may contain other additional components commonly included in pharmaceutical compositions, including, but not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.).

[0115] The carrier may be, for example, but not limited to, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.The carrier may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents.The carrier may also contain isotonic agents such as sugars, polyalcohols, and sodium chloride in the composition.

[0116] Pharmaceutically acceptable refers to properties and / or substances that are acceptable to a subject from a pharmacological / toxicological standpoint. The phrase pharmaceutically acceptable refers to molecular entities, compositions, and properties that are physiologically tolerated and typically do not cause allergic or other adverse or toxic reactions when administered to a subject. In some embodiments, a pharmaceutically acceptable compound is approved by a federal or state government regulatory agency or is listed in the United States Pharmacopeia or other generally recognized pharmacopoeias for use in animals, and more specifically, in humans.

[0117] The rAAV or pharmaceutical composition described herein may be formulated for administration to host cells ex vivo or in situ in animals and especially humans. The rAAV or pharmaceutical composition may be administered by various routes. Routes of administration include, but are not limited to, intravenous administration, intraarterial administration, subcutaneous administration, intramuscular administration, intrahepatic administration, intraperitoneal administration, and / or localized delivery to target tissue. In some embodiments, multiple injections or other types of administration, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more injections, are provided. Routes of administration may be combined if necessary. In some embodiments, the first and second rAAV need not be administered the same number of times (e.g., the first rAAV may be administered once and the second vector may be administered three times). In some embodiments, administration is intramuscular.

[0118] In some embodiments, the number of rAAV particles administered to a subject is about 10 6 About 10 14 particles / mL, or approximately 10 3 About 10 13 It may be an order of magnitude range of particles / mL, or any value between any of the ranges, for example about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , or 10 14 In some embodiments, the number of rAAV particles administered to a subject may be about 10 6 About 10 14 vector genomes (vgs) / mL, or 10 3 From 10 15 vgs / mL, or any value between any of the ranges, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 1012 , 10 13 , or 10 14 In some embodiments, between about 0.5 and about 5 rAAV vector genomes are administered per cell. In some embodiments, between about 0.5 and about 2 rAAV vector genomes are administered per cell. In some embodiments, about 1 x 10 per kilogram are administered. 13 From about 3x10 14 Vector genomes (vgs / kg) are administered. In some embodiments, administration is based on the subject's myocardial mass. In some embodiments, administration is based on body weight. In some embodiments, administration is based on body surface area. The rAAV particles may be administered as a single dose or may be divided into two or more administrations as required to achieve treatment of the particular disease or disorder being treated. In some embodiments, a dose ranging from about 0.0001 mL to about 10 mL is delivered to the subject.

[0119] For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, and if necessary, the liquid diluent may first be made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, intravitreal, subcutaneous, and intraperitoneal administration. In this regard, the sterile aqueous medium that may be employed will be apparent to those skilled in the art in light of this disclosure. For example, a single dose may be dissolved in 1 mL of isotonic NaCl solution and added to 1000 mL of continuous subcutaneous infusion or injected at the planned injection site (see, for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will in any event determine the appropriate dose for the individual subject. Additionally, for human administration, formulations should meet sterility, pyrogenicity, and overall safety and purity standards as required, for example, by FDA Office of Biologies standards. In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, a monobasic buffer (e.g., sodium phosphate monobasic buffer), a dibasic salt (e.g., sodium phosphate dibasic), a sodium-based tonicifier (e.g., sodium chloride tonicifier), a non-sodium tonicifier (e.g., magnesium chloride hexahydrate tonicifier), a surfactant (e.g., poloxamer 188 surfactant), and water. In some embodiments, the rAAV formulation will comprise, consist of, or consist essentially of active rAAV components, sodium phosphate monobasic buffer, sodium phosphate dibasic, a sodium chloride tonicifier, a magnesium chloride hexahydrate tonicifier, a poloxamer 188 surfactant, and water. In some embodiments, the active rAAV components are included in the formulation according to the vector genome amounts defined herein.In some embodiments, the monobasic buffer (e.g., sodium phosphate monobasic buffer) is included in the formulation at a concentration between about 0.2 mg / mL and about 0.5 mg / mL. In some embodiments, the dibasic salt (e.g., sodium phosphate dibasic) is included in the formulation at a concentration between about 1.5 mg / mL and about 4 mg / mL. In some embodiments, the sodium-based tonicity agent (e.g., sodium chloride tonicity agent) is included in the formulation at a concentration between about 8 mg / mL and about 12 mg / mL. In some embodiments, the non-sodium tonicity agent (e.g., magnesium chloride hexahydrate tonicity agent) is included in the formulation at a concentration between about 0.1 mg / mL and about 0.35 mg / mL. In some embodiments, the surfactant (e.g., poloxamer 188 surfactant) is included in the formulation at a concentration between about 0.05 mg / mL and about 0.8 mg / mL. In some embodiments, water is included to bring the volume of the formulation (e.g., dosage unit) to 1 mL.

[0120] Sterile injectable solutions are prepared by incorporating the rAAV particles or formulations in the required amount in a suitable solvent, optionally including some of the other ingredients listed above, followed by filtration sterilization. In general, dispersions are prepared by incorporating various sterilized active ingredients into a sterile medium containing a basic dispersion medium and the other ingredients listed above. In the case of sterile powders for preparing sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze-drying techniques. These methods allow the active ingredients and any additional desired ingredients to be obtained from their previously sterilized, filtered solutions.

[0121] The amount of rAAV particles or formulations and the time of administration of such particles or formulations will be within the scope of those skilled in the art who have the benefit of the present disclosure.However, it is believed that the administration of a therapeutically effective amount of the AAV particles or formulations of the present disclosure may be achieved by a single administration, for example, by a single administration of a sufficient number of infectious particles to provide therapeutic benefit to the patient undergoing such treatment.Instead, in some situations, it may be desirable to provide multiple or continuous administrations of the rAAV particles or formulations, either over a relatively short period of time or a relatively long period of time, which may be determined by the medical professional who supervises the administration of such compositions.

[0122] If necessary, the rAAV particles may be administered in combination with other substances, such as proteins or polypeptides, or various pharma- ceutically active substances, including one or more doses of a therapeutic polypeptide, biologically active fragment, or variant thereof. In fact, there is virtually no limit to the other components that may be included, so long as the additional substances do not cause significant adverse effects upon contact with target cells or host tissues. That is, the therapeutic rAAV or formulation may be delivered with various other pharma- ceutically acceptable substances as required in a particular case. Such compositions may be purified from host cells or other biological sources, or may be chemically synthesized as described herein.

[0123] In some embodiments, treatment of a subject with the rAAV particles described herein achieves one, two, three, four, or more of the following effects: for example, (i) a reduction or alleviation of the severity of a disease or a symptom associated therewith; (ii) a reduction in the duration of a symptom associated with a disease; (iii) protection against progression of a disease or a symptom associated therewith; (iv) a regression of a disease or a symptom associated therewith; (v) protection against the onset or occurrence of a symptom associated with a disease; (vi) protection against recurrence of a symptom associated with a disease; (vii) a reduction in hospitalization of the subject; (viii) a reduction in the length of hospitalization; (ix) an increase in the survival time of a subject with a disease; (x) a reduction in the number of symptoms associated with a disease; or (xi) an effect that includes enhancing, improving, complementing, compensating for, or augmenting the prophylactic or therapeutic effect of another treatment.

[0124] As will be apparent to those skilled in the art upon reference to the disclosure of this specification, the effective amount of viral vector to be added can be empirically determined. Administration can be a single dose, multiple doses, continuous or intermittent administration throughout the course of treatment. Methods for determining the most effective means and dosages of administration are well known to those skilled in the art and will vary depending on the vector, therapeutic composition, target cells, and subject being treated. Single and multiple administrations can be performed at dosage levels and patterns selected by the treating physician.

[0125] kit Described herein is a kit for diagnosing, preventing, treating, or alleviating one or more symptoms of cardiac disease or condition, such as cardiomyopathy, comprising a composition comprising one or more of the disclosed rAAV vectors.Such a kit may be useful for diagnosing, preventing, and / or treating human disease, and may be particularly useful for treating, preventing, and / or alleviating one or more symptoms of cardiac disease, such as cardiomyopathy.In some embodiments, the cardiac disease is caused by cardiomyopathy.In some embodiments, the cardiac disease is caused by hypertrophic cardiomyopathy or dilated cardiomyopathy.In some embodiments, the cardiac disease is dilated cardiomyopathy.

[0126] Kits including one or more of the disclosed rAAV vectors (as well as one or more virions, viral particles, transformed host cells, or pharmaceutical compositions including such vectors) and instructions for using such kits in one or more therapeutic, diagnostic, and / or prophylactic clinical embodiments are also provided according to some embodiments. Such kits may include one or more reagents, restriction enzymes, peptides, therapeutic agents, pharmaceutical compounds, or means for delivery of the compositions to a host cell or animal (e.g., syringes, injectables, etc.). In some embodiments, the kits may include those for treating, preventing, or alleviating symptoms of disease, deficiency, dysfunction, and / or injury, or may include components for large-scale production of the viral vectors themselves.

[0127] In some embodiments, the kit includes one or more containers or receptacles containing one or more doses of any of the therapeutic agents described. Such kits may be therapeutic in nature. In some embodiments, the kits contain unit doses, meaning a predetermined amount of a composition including, for example, a therapeutic agent described, with or without one or more additional agents.

[0128] One or more of the components of the kit may be provided in one or more liquid or frozen solvents. The solvents may be aqueous or non-aqueous. The formulations in the kit may also be provided as dry powders or lyophilized forms that can be reconstituted by adding a suitable solvent.

[0129] In some embodiments, the kit includes a label, marker, package insert, bar code, and / or reader indicating the appropriate use of the contents of the kit. In some embodiments, the kit may include a label, marker, package insert, bar code, and / or reader indicating that the contents of the kit may be administered to treat a subject according to a particular dosage or dosing regimen.

[0130] In addition, the kit may contain a variety of reagents, including, but not limited to, washing reagents, elution reagents, and concentration reagents. Such reagents may be readily selected from among those described herein and from among conventional concentration reagents.

[0131] As used herein, the term "kit" may be used to describe a variety of portable, self-contained enclosures that contain at least one set of components for carrying out one or more of the diagnostic or therapeutic methods of the present invention.

[0132] Combination Therapy Embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods is within the inventive scope of the present disclosure, provided that such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.

[0133] Compositions of the disclosure may include rAAV particles or formulations, and / or rAAV vectors, alone or in combination with one or more additional active ingredients, which may be obtained from natural or recombinant sources, or chemically synthesized. In some embodiments, the rAAV particles or formulations are administered in combination with a proteasome inhibitor, such as bortezomib, or hydroxyurea, either in the same composition or as part of the same treatment regimen.

[0134] If necessary, the rAAV particles may be administered in combination with other substances, such as proteins or polypeptides, or various pharma- ceutically active substances. In some embodiments, this may reflect, for example, one or more administrations of a therapeutic polypeptide (e.g., a recombinant form of a functional peptide or protein that serves to replace a protein encoded by a transgene or to complement rAAV-based production), biologically active fragment, or variant thereof. That is, the therapeutic rAAV or formulation may be delivered together with various other pharma- ceutically acceptable substances as required in a particular case. Such compositions may be purified from host cells or other biological sources, or may be chemically synthesized as described herein.

[0135] Also described herein is a method of inducing increased expression of a human transgene in a target cell, comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a sequence encoding a human transgene, a consensus Kozak sequence, and an enhancer element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the contacting results in increased expression of the human transgene in the target cell compared to before the contact, thereby increasing expression of the transgene. Also described herein is a method of inducing increased expression of a human transgene in a target cell, comprising contacting the target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising a sequence encoding a human transgene, a Kozak sequence that is non-native to either the transgene and / or the promoter and / or the enhancer element, and an enhancer element operably linked to a promoter, wherein the expression construct is flanked on both sides by inverted terminal repeats, and wherein the contacting results in increased expression of the human transgene in the target cell compared to before the contact, thereby increasing expression of the transgene. In some embodiments, the contacting is in vivo.

[0136] In some embodiments, the additional therapeutic agent comprises an anti-inflammatory agent, which may be, but is not limited to, a corticosteroid, cortisone, hydrocortisone, hydrocortisone-21-monoester (e.g., hydrocortisone 21-acetate, hydrocortisone 21-butyrate, hydrocortisone 21-propionate, hydrocortisone 21-valerate, etc.), hydrocortisone-17,21-diesters (e.g., hydrocortisone 17,21-diacetate, hydrocortisone 17-acetate-21-butyrate, hydrocortisone 17,21-dibutyrate, etc.), alclometasone, dexamethasone, flumethasone, prednisolone, methylprednisolone, betamethasone (typically as betamethasone benzoate or betamethasone dipropionate), fluocinonide, prednisone, and triamcinolone (typically as triamcinolone acetonide). In some embodiments, the anti-inflammatory agent is 2-carboxylatochromone-5'-yl-2-hydroxypropane (2-hydroxypropane-1,3-diyl) bis(oxy)bis(4-oxo-4H-chromene-2-carboxylic acid) (also known as cromoglycate), such as bis(acetoxymethyl), disodium cromoglycate, nedocromil (9-ethyl-4,6-dioxo-10-propyl-6,9-dihydro-4H-pyrano[3,2-g]quinoline-2,8-dicarboxylic acid), and tranilast (2-{[(2E)-3-(3,4-dimethoxyphenyl)prop-2-enoyl]amino}). and mast cell degranulation inhibitors such as, but not limited to, 2-[2-chloro-5-cyano-3-(oxaloamino)anilino]-2-oxoacetic acid (2-[2-chloro-5-cyano-3-(oxaloamino)anilino]-2-oxoacetic acid).In some embodiments, the anti-inflammatory agent is a nonsteroidal anti-inflammatory drug (NSAIDs) such as, but not limited to, aspirin compounds (acetylsalicylate), non-aspirin salicylates, diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, meclofenamate, naproxen, naproxen sodium, phenylbutazone, sulindac, and tometin.

[0137] In some embodiments, the anti-inflammatory agent comprises an antihistamine. The antihistamine may be, but is not limited to, clemastine, clemastine fumarate (2(R)-[2-[1-(4-chlorophenyl)-1-phenyl-ethoxy]ethyl-1-methylpyrrolidine), dexmedetomidine, doxylamine, loratidine, desloratidine, and promethazine, and diphenhydramine, or a pharma- ceutically acceptable salt, solvate, or ester thereof. In some embodiments, the antihistamine comprises, but is not limited to, azatadine, azelastine, burfroline, cetirizine, cyproheptadine, doxantrozole, etodroxydine, forskolin, hydroxyzine, ketotifen, oxatomide, pizotifen, proxicromil, N,N'-substituted piperazine, or terfenadine. In some embodiments, the antihistamine is an H1 antagonist, such as, but not limited to, cetirizine, chlorpheniramine, dimenhydrinate, diphenhydramine, fexofenadine, hydroxyzine, orphenadrine, pheniramine, and doxylamine. In some embodiments, the antihistamine is an H2 antagonist, such as, but not limited to, cimetidine, famotidine, lafutidine, nizatidine, ranitidine, and roxatidine.

[0138] In some embodiments, the additional therapeutic agent comprises an antiviral agent, including an antiretroviral agent. Suitable antiviral agents include, but are not limited to, remdesivir, acyclovir, famciclovir, ganciclovir, foscarnet, idoxuridine, sorivudine, trifluorothymidine, valacyclovir, vidarabine, didanosine, dideoxyinosine, stavudine, zalcitabine, zidovudine, amantadine, interferon alpha, ribavirin, and rimantadine.

[0139] In some embodiments, the additional therapeutic agent comprises an antibiotic. Non-limiting examples of suitable antibiotics include beta-lactam antibiotics such as penicillin, aminopenicillins (e.g., amoxicillin, ampicillin, hetacillin, etc.), penicillinase-resistant antibiotics (e.g., cloxacillin, dicloxacillin, methicillin, nafcillin, oxacillin, etc.), broad-spectrum antibiotics (e.g., axlocillin, carbenicillin, mezlocillin, piperacillin, ticarcillin, etc.); cephalosporins (e.g., cefadroxil, Cefazolin, cephalexin, cephalothin, cephapirin, cephradine, cefaclor, cefacmandole, cefmetazole, cefonicid, ceforanide, cefotetan, cefoxitin, cefprozil, cefuroxime, loracarbef, cefixime, cefoperazone, cefotaxime, cefpodoxime, ceftazidime, ceftiofur, ceftizoxime, ceftriaxone, moxalactam etc.); monobactams such as aztreonam; carbapenems such as imipenem and meropenem; quinolone antibiotics (e.g. ciprofloxacin, enrofloxacin, difloxacin, orbifloxacin, marbofloxacin, etc.); chloramphenicol antibiotics (e.g. chloramphenicol, thiamphenicol, florfenicol, etc.); tetracycline antibiotics (e.g. chlortetracycline, tetracycline, oxytetracycline, etc. icrin, doxycycline, minocycline, etc.); macrolide antibiotics (e.g. erythromycin, tylosin, tlimicosin, clarithromycin, azithromycin, etc.); lincosamide antibiotics (e.g. lincomycin, clindamycin, etc.); aminoglycoside antibiotics (e.g. gentamicin, amikacin, kanamycin, apramycin, tobramycin, neomycin, dihydrostreptomycin, paromomycin, etc.);Sulfonamide antibiotics (e.g., sulfadmethoxine, sulfamethazine, sulfaquinoxaline, sulfamerazine, sulfathiazole, sulfasalazine, sulfadiazine, sulfabromomethazine, sulfaethoxypyridazine, etc.); glycopeptide antibiotics (e.g., vancomycin, teicoplanin, ramoplanin, and decaplanin); and other antibiotics (e.g., rifampin, nitrofuran, virginiamycin, polymyxin, tobramycin, etc.);

[0140] In some embodiments, the additional therapeutic agent comprises an antifungal agent, such as, but not limited to, itraconazole, ketoconazole, fluoconazole, and amphotericin B. In some embodiments, the therapeutic agent is an antiparasitic agent, such as, but not limited to, the broad-spectrum antiparasitic drug nitazoxanide; antimalarials and other antiprotozoal agents (such as artemisin, mefloquine, lumefantrine, tinidazole, and miltefosine); anthelmintics such as mebendazole, thiabendazole, and ivermectin; and anti-amebic agents such as rifampin and amphotericin B.

[0141] In some embodiments, the additional therapeutic substances include analgesics, including but not limited to, opioid analgesics, such as alfentanil, buprenorphine, butorphanol, codeine, drocode, fentanyl, hydrocodone, hydromorphone, levorphanol, meperidine, methadone, morphine, nalbuphine, oxycodone, oxymorphone, pentazocine, propoxyphene, sufentanil, and tramadol; and non-opioid analgesics, such as apazone, etodolac, diphenpyramide, indomethacin, meclofenamate, mefenamic acid, oxaprozin, phenylbutazone, piroxicam, and tolmetin.

[0142] Any particular feature, aspect, method, property, characteristic, quality, property, element, etc. disclosed herein in relation to an embodiment may be used in all other embodiments presented herein. It should therefore be understood that various features and aspects of the disclosed embodiments may be combined with or substituted for other features and aspects to form different versions of the disclosed invention. That is, it is not intended that the scope of the invention disclosed herein should be limited by the particular embodiment disclosed above. Furthermore, the invention is susceptible to various modifications and alternative forms, specific examples of which are shown in the drawings and described in detail herein. However, the invention is not limited to the particular form or method disclosed, but on the contrary, the invention should be understood to embrace all modifications, equivalents, and alternatives within the spirit and scope of the various embodiments described and the appended claims. Any method disclosed herein need not be performed in the order described. The methods disclosed herein include specific actions performed by the practitioner, which may include any third party's explicit or implied instructions to the actions. Additionally, when features or aspects of the disclosure are described in terms of a Markush group, those of skill in the art will recognize that the disclosure is also described in terms of any individual members or subgroups of members of the Markush group.

[0143] All headings and sub-headings used herein are for organizational purposes only and should not be used to limit the scope of the embodiments disclosed herein. EXAMPLES

[0144] The following examples are illustrative only and are not intended to be limitations on the scope of the invention. Example 1 - In silico derivation of a consensus Kozak sequence for enhanced expression in cardiac tissue

[0145] The known consensus Kozak motif (A / G)CCAUGG has been demonstrated to be a strong aid in translation initiation. Genetic engineers have used this sequence to generate high levels of recombinant protein expression. It has been reported that 11% of genes in the human genome use the consensus (A / G)CCAUGG (Ferreira et. al., Proc Natl Acad Sci US A. 2013 Jul 9; 110(28): 11284-11289). Thus, since ~89% of human gene sequences differ from the consensus, we performed an analysis of genes highly expressed in human cardiac tissue to design new synthetic Kozak sequences that enhance transgene expression in the heart. Genes were selected from the Human Protein Atlas and the Kozak sequence for each gene was identified in NCBI, as shown in Table 1 below. Consensus sequences were derived using Weblogo (https: / / weblogo.berkeley.edu / logo.cgi). The consensus sequence (AGCCCCAAC) was then utilized in the design of selected transgene constructs provided herein. [Table 3]

Claims

1. A nucleic acid comprising an expression construct comprising a sequence encoding a transgene, a promoter, and a consensus Kozak sequence, wherein the expression construct is flanked on both sides by inverted terminal repeat sequences, and the synthetic Kozak sequence has at least 88% sequence identity to the sequence of AGCCCCAAC.

2. The nucleic acid of claim 1, wherein the consensus Kozak sequence has the sequence AGCCCCAAC.

3. The nucleic acid of claim 1 , wherein the promoter comprises a cardiac-specific promoter.

4. 2. The nucleic acid of claim 1, wherein the promoter is selected from the group consisting of CMV, mini-CMV, CBA, HSV, TK, RSV, SV40, MMTV, Ad E1A, cardiac troponin C, cardiac troponin I, cardiac troponin T (cTnT), and combinations thereof.

5. The nucleic acid of claim 1 , wherein the transgene-encoding sequence encodes a cardiac gene.

6. The nucleic acid of claim 5, wherein the cardiac gene is BAG3.

7. 7. The nucleic acid of claim 6, wherein the sequence encoding the transgene encodes a protein having at least 95% sequence identity to SEQ ID NO:

10.

8. The nucleic acid of claim 5, wherein the cardiac gene is cardiac myosin binding protein C (MYBPC3).

9. 9. The nucleic acid of claim 8, wherein the sequence encoding the transgene encodes a protein having at least 95% sequence identity to SEQ ID NO:

11.

10. The nucleic acid of claim 1, which is a recombinant adeno-associated virus (rAAV) vector genome.

11. 11. The nucleic acid of claim 10, wherein the genome is a single-stranded or self-complementary rAAV nucleic acid vector.

12. A recombinant adeno-associated virus (rAAV) particle comprising the nucleic acid of any one of claims 1 to 10.

13. The rAAV particle of claim 12, which is an AAV9 particle.

14. The rAAV particle of claim 12, which is an rh74 particle.

15. 13. The rAAV particle of claim 12, which is an AAVmut5 particle containing a tryptophan to arginine mutation at amino acid 505 of the VP1 capsid.

16. 13. The rAAV particle of claim 12, which is a rh10 particle.

17. A composition comprising a plurality of rAAV particles described in claim 12.

18. 18. The composition of claim 17, further comprising a pharmaceutically acceptable carrier.

19. 1. A method for inducing increased expression of a human transgene in a target cell, comprising: a sequence encoding a human transgene; Kozak sequence; and an enhancer element operably linked to the promoter; contacting a target cell with a plurality of rAAV particles comprising a nucleic acid expression construct comprising: wherein the Kozak sequence is non-native to one or more of the transgene, enhancer element, and / or promoter; the expression construct is flanked on both sides by inverted terminal repeats; and said contacting results in increased expression of the human transgene in the target cell compared to before the contacting, thereby increasing expression of the human transgene. method.

20. 20. The method of claim 19, wherein the Kozak sequence is a synthetic consensus sequence.

21. 20. The method of claim 19, wherein the transgene-encoding sequence encodes a cardiac gene.

22. 22. The method of claim 21, wherein the cardiac gene is BAG3.

23. 22. The method of claim 21, wherein the sequence encoding the transgene encodes a protein having at least 95% sequence identity to SEQ ID NO:

10.

24. 22. The method of claim 21, wherein the cardiac gene is cardiac myosin binding protein C (MYBPC3).

25. 22. The method of claim 21, wherein the sequence encoding the transgene encodes a protein having at least 95% sequence identity to claim 11.

26. The method of any one of claims 19 to 25, wherein the contacting is in vivo.

27. 1. A method for generating a consensus Kozak sequence, comprising: constructing a collection of multiple naturally occurring Kozak sequences associated with a gene of interest; for each nucleotide position of the at least first naturally occurring Kozak sequence, comparing a first identity of a first nucleotide of the at least first naturally occurring Kozak sequence with a first identity of a first nucleotide of a second naturally occurring Kozak sequence, wherein the first nucleotide of the at least first naturally occurring Kozak sequence and the first nucleotide of the second Kozak sequence occupy the same position relative to the length of the at least first naturally occurring Kozak sequence and the second naturally occurring Kozak sequence; identifying the predominant nucleotide at each position, where identification includes one or more of nucleotide identity, purine identity, or pyrimidine identity; and Constructing a consensus sequence containing the dominant nucleotide for each position A method comprising:

28. 28. The method of claim 27, wherein the gene of interest is a cardiac gene.

29. 29. The method of claim 27 or 28, wherein the collection of natural Kozak sequences comprises at least six genes of interest.

30. 28. The method of claim 27, further comprising performing an in silico stability assessment of the consensus sequence and / or an in silico prediction of the binding efficiency of a ribosome complex to the consensus sequence.

31. 28. The method of claim 27, further comprising cloning the consensus Kozak sequence into a transgene.

32. 1. A method for generating a consensus Kozak sequence, comprising: Constructing a collection of multiple naturally occurring Kozak sequences associated with a gene of interest; and Using computer-implemented methods to generate consensus Kozak sequences A method comprising:

33. The method of claim 32, wherein the target gene is highly expressed in the target tissue.

34. 34. The method of claim 33, wherein the tissue is cardiac tissue.

Images