Treating nociceptive pain

Abstract

The present disclosure relates to meteorin and its use in the prevention and / or treatment of nociceptive pain. Acute and chronic nociceptive pain, for example caused by physical injury or inflammation, can be treated by administering meteorin to a patient.

Description

[Technical field]

[0001] The present invention relates to meteorin and its use in the treatment and / or prevention of nociceptive pain. [Background technology]

[0002] Acute pain is an unpleasant, dynamic psychophysiological process that usually occurs in response to tissue trauma and associated inflammatory processes and plays a key role in wound healing. However, pain that lasts beyond a 3-month healing period (according to the criteria of the International Classification of Diseases, 11th edition) is considered to have no obvious biological purpose and is chronic in nature. The International Association for the Study of Pain defines pain as "an unpleasant sensory and emotional experience associated with or likened to actual or potential tissue damage" and classifies chronic pain into three main categories: nociceptive, neuropathic, and nociceptive. Nociceptive pain is the most common form of chronic pain, including arthritis and most forms of spinal pain. However, it is becoming recognized that many pain disorders, especially those involving cancer and spinal pain, have a mixed pain phenotype. For the purposes of this application, a brief comparison of these three chronic pain categories will be made to assist in providing a precise definition.

[0003] Nociceptive pain versus neuropathic and nociceptive pain Nociceptive pain is caused by tissue damage or potential tissue damage. Typical examples include degenerative changes caused by normal wear and tear (degenerative disc disease, facet joint disease, primary osteoarthritis), trauma (burns, muscle tears, traumatic arthritis, etc.), muscle spasm, and visceral lesions (ulcers, kidney stones, pancreatitis, etc.). It is typically described as a throbbing or dull pain and, in contrast to neuropathic pain, is rarely accompanied by sensory disturbances (e.g. numbness, tingling, tingling). Nociceptive hypersensitivity is generally localized around the site of injury, again in contrast to neuropathic pain, which is generally associated with non-painful stimuli (allodynia) and extends distally to the nerve or nerve root. Nociceptive pain can be effectively treated with opioid analgesics (which are being avoided due to safety and tolerability issues), nonsteroidal anti-inflammatory drugs (topical and systemic), muscle relaxants (effective for acute and subacute spinal pain), and disease-modifying antirheumatic drugs (inflammatory arthritis).

[0004] Neuropathic pain also has an identifiable basis as a result of disease or injury affecting the nervous system. Compared to nociceptive pain, neuropathic pain is usually accompanied by sensory abnormalities such as numbness and allodynia, more prominent pain attacks, and neurological findings depending on the nerve(s) affected. Neuropathic pain is generally described as having stabbing and / or shooting characteristics. In contrast to many forms of nociceptive pain and acute nerve injury, chronic neuropathic pain is always maladaptive.

[0005] The differences between nociceptive and neuropathic pain are also reflected in official treatment guidelines, and as detailed below, there is little overlap between the medications recommended and used to treat neuropathic pain and those recommended and used to treat nociceptive pain.

[0006] Regarding the pharmacological treatment of neuropathic pain, clinical practice guidelines have been published by the International Association for the Study of Pain (Finnerup et al. 2015), the European Federation of Neurological Societies (EFNS) (Attal et al. 2010), the UK National Institute for Health and Care Excellence (NICE) (NICE 2013), and the Canadian Pain Society (CPS) (Moulin et al. 2014). All guidelines recommend the following three drug classes as first-line treatment: 1. Tricyclic antidepressants, especially amitriptyline 2. Serotonin-norepinephrine reuptake inhibitors (SNRIs) such as duloxetine 3. Ca 2+ Channel α-2-δ ligands gabapentin and pregabalin

[0007] Tramadol, a mixed opioid / SNRI, is recommended for second-line treatment of neuropathic pain. Recommended third- and fourth-line treatments generally include strong non-gabapentinoid opioids and anticonvulsants (such as lamotrigine), as well as cannabinoids.

[0008] For the pharmacological treatment of nociceptive pain, the WHO recommends the use of a three-step ladder approach: i) In Step 1, non-opioid analgesics (e.g. paracetamol) and NSAIDs (e.g. aspirin, diclofenac, ibuprofen) are recommended. ii) In step 2, a weak opioid (such as codeine, tramadol) can be introduced in combination with the step 1 analgesic. iii) In step 3, strong opioids, primarily morphine, can be used in combination with step 1 painkillers.

[0009] Furthermore, the distinction between nociceptive and neuropathic pain is reflected in the official clinical development guidelines for pain medications available from the EMA (EMA / CHMP / 970057 / 2011) and the FDA (FDA34355740dft.docx02 / 07 / 22, draft version).

[0010] Throughout the guidelines, the regulator makes a clear distinction between nociceptive and neuropathic pain. It is emphasized that analgesics for nociceptive pain must target the underlying etiology and disease pathogenesis, and that study populations must be homogenous and selected by diagnosis, intensity, and duration (acute vs. chronic). If successfully developed, approval will be granted only for the nociceptive pain indication and etiology investigated. The same applies to neuropathic pain; that is, if a neuropathic pain medication is developed for diabetic neuropathic pain, the label will only state this indication.

[0011] In the case of mixed pain (algesic pain (revised IASP terminology)), potential drug candidates should be investigated and validated in at least two different clinical programs (one for nociceptive pain and one for neuropathic pain).

[0012] In conclusion, regulatory agencies acknowledge that approval of a drug candidate in one pain indication does not automatically mean it will be approved or considered for other pain types, acknowledging that it is not possible to predict whether a drug developed for neuropathic pain may or will be effective in treating nociceptive pain, and vice versa.

[0013] The third type of chronic pain is called nociceptive pain, which is a type of pain resulting from abnormal processing of pain signals without any clear evidence of tissue damage or of any individual lesion involving the somatosensory system. These conditions, previously called functional pain syndromes, include pain conditions such as fibromyalgia, irritable bowel syndrome, and in some cases nonspecific back pain. The pathophysiological mechanisms that cause these disorders primarily involve increased sensory processing across the nociceptive axis and reduced function of inhibitory pathways within the central nervous system.

[0014] Currently available analgesic treatments are only mildly effective for most patients and their side effects severely limit their use.Therefore, there is a strong need for safe and effective therapies for the prevention and treatment of nociceptive pain that do not induce analgesic tolerance and have no or minimal side effects that affect the patient's overall health and well-being.

[0015] Meteorin is an endogenous protein that has previously been demonstrated to promote the growth of cultured neurons (WO2005 / 095450). Furthermore, meteorin has previously been shown to be effective in reversing neuropathic pain resulting from peripheral nerve injury (WO2012 / 041328). Summary of the Invention

[0016] The present invention provides a means to improve the quality of life of patients suffering from acute and chronic nociceptive pain. The inventors of the present disclosure have discovered that administration of meteorin is an effective therapeutic strategy for managing nociceptive pain. Meteorin has been shown to have a strong and long-lasting analgesic effect, and is also well tolerated. Meteorin completely reverses mechanical hyperalgesia in subjects suffering from inflammatory hyperalgesia, and does not induce analgesic tolerance even with repeated administration.

[0017] In one aspect, the present invention provides an isolated polypeptide for use in treating and / or preventing nociceptive pain in a subject, comprising: a. the amino acid sequence of SEQ ID NO:3, and b. a biologically active sequence variant of the amino acid sequence of SEQ ID NO:3, said variant having at least 70% sequence identity to SEQ ID NO:3.

[0018] In a second aspect, the present invention provides an isolated nucleic acid molecule for use in the treatment and / or prevention of nociceptive pain in a subject, comprising: a. the amino acid sequence of SEQ ID NO:3; b. a nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of: a biologically active sequence variant of the amino acid sequence of SEQ ID NO:3, wherein the variant has at least 70% sequence identity to SEQ ID NO:3.

[0019] In a further aspect, the present invention relates to a vector for use in the treatment or prevention of nociceptive pain in a subject, said vector comprising a polynucleotide encoding a polypeptide for use in the treatment and / or prevention of nociceptive pain in a subject. [Brief description of the drawings]

[0020] [Figure 1] General study design using the CFA inflammatory pain model. Mechanical thresholds were assessed using von Frey filaments (VF; solid arrows) at baseline (BL) and then 3-5 days after injection of the hind paw with complete Freund's adjuvant (CFA; dashed circle). After sufficient hyperalgesia, mice were administered 1.8 mg / kg recombinant mouse rm meteorin or vehicle sc on days 5, 7, 9, 11 and 13 in the first experiment (Example 1) and on days 3 (one injection), 3 and 5 (two injections), and 3, 5 and 7 (three injections) in the second experiment (Example 2). Abbreviations; subcutaneous (sc). [Diagram 2]Repeated treatment with rmMeteorin completely reverses mechanical pain in mice with CFA inflammatory hyperalgesia. a) Hind paw withdrawal thresholds (g) to von Frey stimulation were assessed in female C57BL / 6JRj mice before CFA (20 μl, sc) injection into the hind paw at baseline (BL) (dashed arrow) and periodically thereafter up to day 15 after CFA injection. (b, c) Paw width (mm) and body weight (g) were measured before CFA injection and after regular CFA injections (dashed arrow) as surrogate markers of inflammatory burden and general health, respectively. Repeated systemic injections of rmMeteorin (1.8 mg / kg, sc) from day 5 to day 13 (solid arrow) led to a robust reversal of mechanical pain. In contrast, no effects were observed on paw width or body weight. Naive mice were included for the purpose of collecting trunk blood samples for exposure analysis at the end of the study. *P<0.05, **P<0.01, two-way repeated measures ANOVA and Tukey's test. Data are means ± SEM. [Diagram 3]Acute treatment with rmMeteorin restores mechanical pain similarly to repeated treatment in mice with CFA inflammatory hyperalgesia. a) Hindpaw withdrawal thresholds (g) to von Frey stimulation were assessed in female C57BL / 6JRj mice before CFA (20 μl, sc) injection into the hindpaw at baseline (BL) (dashed arrow) and periodically thereafter up to day 14 after CFA injection. Systemic injections of rmMeteorin (1.8 mg / kg, sc) were administered to three separate groups of mice on day 3 (group 1 (Meteorin 1): 1 injection), days 3 and 5 (group 2 (Meteorin 2): 2 injections), and days 3, 5, and 7 (group 3 (Meteorin 3): 3 injections), as indicated by solid arrows. A single injection of rmMeteorin resulted in restoration of mechanical hyperalgesia of similar extent and duration. b) At the end of the experiment on days 14-15, the μ-opioid receptor partial agonist buprenorphine (0.1 mg / kg, sc) or vehicle was administered to mice previously treated with repeated injections of vehicle to assess the effect on mechanical withdrawal threshold. The number of mice in each group is indicated in brackets. ^,#,*P<0.05,##,**P<0.01,∧∧∧P<0.001,∧∧∧∧P<0.0001 vs. corresponding vehicle, two-way repeated measures ANOVA and Tukey's test. (b)****P<0.0001 vs. vehicle, Student's t-test. Data are means ± SEM. [Figure 4] CLUSTAL W (1.82) multiple sequence alignment of meteorin. A) Alignment of meteorin precursors from human (SEQ ID NO:2), rat (SEQ ID NO:9), and mouse (SEQ ID NO:5). B) Alignment of mature meteorin from human (SEQ ID NO:3), rat (SEQ ID NO:10), and mouse (SEQ ID NO:6). C) Consensus sequence of mature meteorin generated from residues completely conserved in human, mouse, and rat sequences (SEQ ID NO:11). X represents any of the 21 naturally occurring amino acids encoded by DNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0021] definition As used herein, "biocompatible capsule" means that the capsule, when implanted into a host mammal, does not elicit a deleterious host response sufficient to result in rejection of the capsule or to render the capsule inoperable, e.g., by degradation.

[0022] As used herein, a "coding sequence" is a polynucleotide sequence that is transcribed and translated into a polypeptide.

[0023] As used herein, the term "expression vector" refers to vectors capable of directing the expression of genes to which they are operatively linked. In general, expression vectors useful in recombinant DNA techniques are often in the form of plasmids.

[0024] As used herein, "meteorin" refers to a polypeptide having the amino acid sequence of substantially purified meteorin from any source, whether natural, synthetic, semi-synthetic or recombinant, obtained from any species, particularly mammals such as chimpanzees, cows, sheep, pigs, mice, horses and preferably humans. The term also refers to biologically active fragments of meteorin obtained from any of these species, as well as biologically active sequence variants thereof and post-translationally modified proteins.

[0025] As used herein, the term "operably linked" is intended to mean that a nucleotide sequence of interest is linked to a regulatory sequence(s) within a recombinant expression vector in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell when the vector is introduced into a host cell).

[0026] As used herein, the term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals).

[0027] "Sequence identity": A high level of sequence identity indicates the likelihood that a first sequence is derived from a second sequence. Amino acid sequence identity requires identical amino acid sequences between two aligned sequences. Thus, a candidate sequence that shares 70% amino acid identity with a reference sequence requires that after alignment, 70% of the amino acids in the candidate sequence are identical to the corresponding amino acids in the reference sequence. Identity can be determined by computer analysis, such as, but not limited to, the ClustalW computer alignment program (Higgins D., Thompson J., Gibson T., Thompson JD, Higgins DG, Gibson TJ, 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22: 4673-4680) and the default parameters proposed in the literature. The ClustalW software is available from the European Bioinformatics Institute as the ClustalW WWW Service at http: / / www.ebi.ac.uk / clustalw. Use this program with default settings to align the mature (bioactive) parts of the query and reference polypeptides. Count the number of perfectly conserved residues and divide by the length of the reference polypeptide.

[0028] The ClustalW algorithm can similarly be used to align nucleotide sequences. Sequence identity can be calculated in a similar manner as shown for amino acid sequences.

[0029] The term "subject" as used herein is intended to mean any mammal to which a meteorin polypeptide or polynucleotide, therapeutic cells, or biocompatible capsules may be administered. Subjects specifically intended for treatment by the methods of the present invention include humans, as well as non-human primates, sheep, horses, cows, goats, pigs, dogs, cats, rabbits, guinea pigs, hamsters, gerbils, rats, and mice.

[0030] "Treatment" can be performed in a variety of ways, including curative treatment and / or ameliorative treatment. Curative treatment generally aims to cure an already existing clinical condition in the treated individual. Ameliorative treatment generally means treating to improve an existing clinical condition in an individual.

[0031] As used herein, the term "prevention" refers to preventing a clinical condition or reducing the risk of acquiring a condition or reducing the severity of a condition. Prevention may also be referred to herein as prophylactic or preemptive treatment.

[0032] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated. In this specification, "plasmid" and "vector" can be used interchangeably, since plasmid is the most commonly used form of vector. However, the present invention is intended to include other forms of such expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses) that perform equivalent functions.

[0033] Nociceptive pain There are two main types of pain: nociceptive pain, which occurs when the nervous system is intact, and neuropathic pain, which results from damage to the nervous system.

[0034] The term "neuropathic pain" as used herein refers to pain caused by damage (lesion or disease) to the sensory nerves of the somatosensory nervous system (both peripheral and central nervous systems), as described by the International Association for the Study of Pain (IASP) (https: / / www.iasp-pain.org / resources / terminology / #neuropathic-pain). Neuropathic pain is typically very localized, persistent, and often accompanied by aching or throbbing pain.

[0035] The term "nociceptive pain" as used herein, as defined by the IASP (https: / / www.iasp-pain.org / resources / terminology / #nociceptive-pain), means pain resulting from actual or threatened injury to non-neural tissue and resulting from activation of nociceptors.

[0036] Nociceptive pain is developed in response to specific stimuli directed at the body and non-neuronal tissues of the body, and alerts the subject to impending tissue damage.

[0037] Nociceptive pain includes tissue injury-induced pain and inflammatory pain.

[0038] The IASP recently revised its definitions and terminology for nociceptive and neuropathic pain to avoid misunderstandings. Under the definition of nociceptive pain, the IASP added the phrase, "This term is designed to contrast with neuropathic pain." The revised definition emphasizes that the term nociceptive pain is designed to contrast with the term neuropathic pain.

[0039] As can be seen from the above, neuropathic pain and nociceptive pain are distinct phenomena with different underlying causes: nociceptive pain describes pain generated by a normally functioning somatosensory nervous system, as opposed to the abnormal nerve function seen in neuropathic pain.

[0040] Common examples of nociceptive pain include low back pain, shoulder pain, musculoskeletal pain, arthritis pain, joint pain, post-operative pain, post-traumatic pain, and cancer pain.

[0041] Nociceptive pain can be classified as either visceral or somatic.

[0042] "Visceral pain" refers to pain originating from internal organs such as the digestive tract or pancreas.

[0043] "Somatic pain" refers to pain originating from the musculoskeletal system, including the skin, subcutaneous tissues, muscles, and joints.

[0044] Furthermore, nociceptive pain can be both acute and chronic.

[0045] As used herein, "acute pain" refers to sudden, severe pain of limited duration due to a specific cause (trauma, infection, inflammation, etc.).

[0046] As used herein, "chronic pain" refers to a persistent pain condition in which the cause of the pain cannot be easily eliminated. Chronic pain can be constant or intermittent. Chronic pain can be defined as pain that lasts for a period of time or more, usually about three months. Chronic pain often occurs in association with a long-term incurable or intractable medical condition or disease.

[0047] Common causes of chronic pain include, but are not limited to, arthritis, cancer, repetitive stress injuries, headaches, low back pain, neck and shoulder pain, post-traumatic pain, post-surgical pain, moderate to severe osteoarthritis, and severe migraines.

[0048] As used herein, the term "inflammatory pain" refers to pain associated with inflammation, characterized by redness, swelling, heat and pain. Inflammation is a non-specific immune response of an organism to infection, irritation, and / or injury, and is accompanied by the release of proinflammatory molecules (peptides, cytokines, prostanoids, growth factors, etc.). These molecules sensitize the afferent fiber terminals of peripheral sensory neurons involved in the transduction and transmission of stimuli such as touch, heat, cold, and chemical information. Inflammatory pain often causes inflammatory hyperalgesia.

[0049] Hyperalgesia Hyperalgesia is an extreme response to a stimulus that is normally perceived as painful. The stimulus may be of mechanical / tactile, thermal, or chemical origin. Hyperalgesia is often associated with nerve damage (neuropathic pain), but as used herein, hyperalgesia refers to the increased sensitivity caused by tissue injury or inflammation.

[0050] "Inflammatory hyperalgesia" as used herein refers to increased pain sensitivity occurring directly in injured tissue, as well as in surrounding uninjured tissue.

[0051] In one embodiment, the present invention relates to the use of meteorin in the treatment of hyperalgesia. In one embodiment of the present invention, the hyperalgesia to be treated is inflammatory hyperalgesia.

[0052] In one embodiment of the invention, the hyperalgesia to be treated is mechanical hyperalgesia, hi another embodiment, the hyperalgesia to be treated is thermal hyperalgesia.

[0053] In one embodiment of the invention, the thermal hyperalgesia is cold hyperalgesia, hi another embodiment, the thermal hyperalgesia is heat hyperalgesia.

[0054] Environmental irritants such as phthalates and heavy metals including lead, aluminum, and mercury can inhibit immune function, thereby causing increased inflammation and leading to chemical hyperalgesia.

[0055] In one embodiment of the invention, the hyperalgesia is chemical hyperalgesia, hi one embodiment, the chemical hyperalgesia is caused by phthalates, lead, aluminum, mercury, and / or other environmental irritants.

[0056] As mentioned above, normal sensory function was substantially completely restored in animals administered meteorin, and it is therefore believed that meteorin can mediate a complete recovery of hyperalgesia in at least a portion of treated subjects.

[0057] Nociceptive pain can be caused by a variety of stimuli, including trauma and inflammation. Meteorin can be used to prevent or treat nociceptive pain, such as acute nociceptive pain, chronic nociceptive pain, visceral nociceptive pain, and somatic nociceptive pain.

[0058] In one embodiment, the nociceptive pain is one or more of inflammatory pain, low back pain, shoulder pain, musculoskeletal pain, arthritis pain, joint pain, post-operative pain, post-traumatic pain, cancer pain, and other nociceptive pain.

[0059] In one embodiment, nociceptive pain is experienced in response to specific physical stimuli, including, but not limited to, physical injury and tissue damage associated with inflammation, surgery, physical trauma, arthritis, cancer, repetitive stress injuries, headaches, moderate to severe osteoarthritis, and migraines.

[0060] In one embodiment, nociceptive pain is associated with inflammation, which sensitizes the afferent fiber endings of peripheral sensory neurons involved in the transduction and transmission of stimuli such as touch, heat, cold, and chemical information.

[0061] In one embodiment, the nociceptive pain is associated with arthritis.

[0062] In one embodiment, meteorin is administered by intermittent dosing.

[0063] In one embodiment, meteorin reverses inflammatory hyperalgesia within days of administration.

[0064] Treatment and / or prevention of nociceptive pain In Example 1, it is demonstrated that continuous intermittent administration of meteorin completely reverses CFA-induced inflammatory hyperalgesia within a few days after the start of administration (Figure 2). Furthermore, it is demonstrated that the size of inflammatory edema is not affected at all by rm meteorin treatment. The failure of rm meteorin to affect the inflammatory burden indicates that it does not have a direct anti-inflammatory mechanism by itself.

[0065] Example 2 demonstrates that acute treatment (single injection) with rm meteorin reverses mechanical pain similarly to repeated treatment (multiple injections) in mice with CFA inflammatory hyperalgesia. A single injection of rm meteorin resulted in a reversal of hyperalgesia of similar magnitude and duration to that observed with three injections (Figure 3).

[0066] Because drugs that are normally effective against chronic pain disorders, such as opioids, are associated with many side effects, there is a need to develop safe and effective therapies to prevent or treat nociceptive pain.

[0067] The present invention provides for the treatment, amelioration and / or prevention of nociceptive pain by administering meteorin to a painful subject.Accordingly, in one embodiment, the present invention relates to meteorin for use in the treatment and / or prevention of nociceptive pain.In one embodiment, the present invention relates to meteorin for use in the treatment of nociceptive pain.

[0068] Meteorin can be used for the prevention and treatment of acute nociceptive pain. In one embodiment, Meteorin is used for the treatment of acute nociceptive pain. Furthermore, Meteorin can be used for the treatment and prevention of chronic nociceptive pain. In one embodiment, Meteorin is used for the treatment of chronic nociceptive pain.

[0069] In one embodiment, the present disclosure provides an isolated polypeptide for use in the treatment and / or prevention of nociceptive pain in a subject, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, which variant has at least 70% sequence identity to SEQ ID NO: 3; The polypeptide further comprises an amino acid sequence selected from the group consisting of:

[0070] In one embodiment, the present invention relates to a method for the treatment and / or prevention of nociceptive pain, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. a biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, wherein the variant has at least 70% sequence identity to SEQ ID NO: 3,

[0071] In one embodiment, the present disclosure provides a use of an isolated polypeptide for the manufacture of a medicament for the treatment and / or prevention of nociceptive pain in a subject, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, which variant has at least 70% sequence identity to SEQ ID NO: 3; The present invention provides a use of said polypeptide, comprising an amino acid sequence selected from the group consisting of:

[0072] In one embodiment, the invention relates to the use of meteorin in a method for the treatment of nociceptive hyperalgesia. In another embodiment, the invention relates to the use of meteorin for the treatment of mechanical nociceptive hyperalgesia. In one embodiment, the invention relates to the use of meteorin for the treatment of thermal nociceptive hyperalgesia. In another embodiment, the invention relates to the use of meteorin for the treatment of cold nociceptive hyperalgesia. In another embodiment, the invention relates to the use of meteorin for the treatment of thermal nociceptive hyperalgesia. In another embodiment, the invention relates to the use of meteorin for the treatment of chemical hyperalgesia.

[0073] In one embodiment, the present invention relates to the use of meteorin for the treatment of nociceptive pain.In a more preferred embodiment, the present invention relates to the use of meteorin for the treatment of pain associated with inflammation or injury in the body.In one embodiment, meteorin is used in a method for relieving mechanical pain in subjects suffering from inflammatory hyperalgesia.

[0074] As demonstrated in Examples 1 and 2 of the present disclosure, administration of meteorin sufficiently reduces the acquisition of sensory function in subjects suffering from inflammatory hyperalgesia. Because meteorin does not induce analgesic tolerance, the recovery of inflammatory hyperalgesia can be maintained.

[0075] Therefore, in a preferred embodiment, the present invention relates to meteorin for use in the prevention and / or treatment of nociceptive pain.

[0076] In one embodiment, the present disclosure provides an isolated polypeptide for use in the prevention and / or treatment of nociceptive pain in a subject, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, which variant has at least 70% sequence identity to SEQ ID NO: 3; The polypeptide further comprises an amino acid sequence selected from the group consisting of:

[0077] In one aspect, the disclosure relates to an isolated polypeptide for use in the prevention and / or treatment of nociceptive pain in a subject.

[0078] In one embodiment, the present disclosure relates to an isolated polypeptide for use in the prevention and / or treatment of nociceptive pain in a subject.In one embodiment, the nociceptive pain is somatic pain or visceral pain.In another embodiment, the nociceptive pain is inflammatory pain, low back pain, shoulder pain, musculoskeletal pain, arthritis pain, joint pain, post-operative pain, post-traumatic pain, or cancer pain.

[0079] In another embodiment, the nociceptive pain is selected from the group consisting of inflammatory pain and post-surgical pain.

[0080] In one embodiment of the disclosure, the isolated polypeptide is for use in the prevention and / or treatment of nociceptive pain, wherein the nociceptive pain is nociceptive hyperalgesia or inflammatory pain, such as inflammatory hyperalgesia. In another embodiment of the disclosure, the isolated polypeptide is for use in the prevention and / or treatment of chemical hyperalgesia.

[0081] In one embodiment of the disclosure, the isolated polypeptide is for use in the prevention and / or treatment of nociceptive pain, wherein the nociceptive pain is post-operative pain.

[0082] In one embodiment of the disclosure, the isolated polypeptide is for use in the prevention and / or treatment of nociceptive pain, wherein the subject suffers from a disease or disorder selected from the group consisting of arthritis, inflammatory pain, and post-surgical pain.

[0083] In one embodiment, the arthritis is selected from the group consisting of osteoarthritis, rheumatoid arthritis, or lupus.

[0084] In another embodiment, the inflammatory pain is selected from the group consisting of inflammatory hyperalgesia, post-surgical pain and arthritis.

[0085] In one embodiment, the present invention provides a method for the treatment of nociceptive pain, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. administering a therapeutically effective amount of an isolated polypeptide comprising an amino acid sequence selected from the group consisting of: a biologically active sequence variant of the amino acid sequence of SEQ ID NO:3, the variant having at least 70% sequence identity to SEQ ID NO:3. administering to a subject in need thereof.

[0086] In one embodiment, the disclosure provides a use of an isolated polypeptide for the manufacture of a medicament for use in preventing and / or treating nociceptive pain in a subject, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, which variant has at least 70% sequence identity to SEQ ID NO: 3; The present invention provides a use of said polypeptide, comprising an amino acid sequence selected from the group consisting of:

[0087] Administration and Formulation Meteorin polypeptides can be administered in any medically acceptable manner, which may include parenteral injection, such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumoral, intraperitoneal, intraventricular, epidural, intrathecal, intracerebroventricular, interhemispheric, or other, and intranasal or topical injection. Sustained release administration, such as by means of depot injection or degradable implants, is also specifically included in the present invention.

[0088] Administration of meteorin according to the present invention can be accomplished using any suitable delivery means, including: injection (either subcutaneous, intravenous, intraarterial, intramuscular, intrathecal, or other suitable site); pumps (e.g., Annals of Pharmacotherapy, 27:912 (1993); Cancer, 41:1270 (1993); Cancer, 41:1270 (1993); Research, 44:1698 (1984), incorporated herein by reference); microencapsulation (see, e.g., U.S. Pat. Nos. 4,352,883; 4,353,888; and 5,084,350, incorporated herein by reference); slow-release polymer implants (see, e.g., Sabel, U.S. Pat. No. 4,883,666, incorporated herein by reference); encapsulated cells (see "biocompatible capsules"); non-encapsulated cell implants (see, e.g., U.S. Pat. Nos. 5,082,670 and 5,618,531, both of which are incorporated herein by reference); and inhalation.

[0089] Administration may be by periodic bolus injection of the formulation, or more continuously by intravenous or intraperitoneal administration from a reservoir either external (e.g., an IV bag) or internal (e.g., a biodegradable implant, a bioartificial organ, a biocompatible capsule of meteorin-producing cells, or a colony of transplanted meteorin-producing cells). See, e.g., US 4,407,957, 5,798,113, and 5,800,828, all of which are incorporated herein by reference.

[0090] Localized delivery may be by means such as delivery via a catheter into one or more arteries. In one embodiment of the present invention, localized delivery includes delivery using encapsulated cells (described in the "Biocompatible Capsules" section). A further type of localized delivery includes the localized delivery of gene therapy vectors, which are usually injected.

[0091] In a preferred embodiment of the invention, administration is by parenteral injection, preferably subcutaneous or intrathecal injection.

[0092] Although it is possible for the compounds of the present invention to be administered as raw chemicals, it is preferred to present them in the form of pharmaceutical preparations, which can be prepared by conventional techniques, for example those described in Remington: The Science and Practice of Pharmacy 2005, Lippincott, Williams & Wilkins.

[0093] The term "pharmaceutical acceptable carrier" refers to one or more organic or inorganic components, natural or synthetic, that are combined with the meteorin polypeptide to facilitate its application. Suitable carriers include sterile saline, but other aqueous and non-aqueous isotonic sterile solutions and sterile suspensions known to be pharmaceutical acceptable are known to those skilled in the art.

[0094] The compound of the present invention can be formulated for parenteral administration, and can be provided in unit dose form in ampoules, prefilled syringes, small drops, or multiple dose containers, optionally with the addition of preservatives.The composition can take the form of suspension, solution, or emulsion in oily or aqueous vehicles, for example, aqueous polyethylene glycol solution.Examples of oily or non-aqueous carriers, diluents, solvents, or vehicles include propylene glycol, polyethylene glycol, vegetable oils (e.g. olive oil), and injectable organic esters (e.g. ethyl oleate), and may contain agents such as preservatives, wetting agents, emulsifiers or suspending agents, stabilizers, and / or dispersants.Alternatively, the active ingredient can be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, and is composed with a suitable vehicle, for example, sterile pyrogen-free water, before use.

[0095] An "effective amount" refers to an amount that can ameliorate or slow the progression of a disease, degenerative, or damaging condition. An effective amount can be determined on an individual basis and is based, in part, on a consideration of the condition being treated and the results desired. An effective amount can be determined by one of ordinary skill in the art using such factors and using only routine experimentation.

[0096] The liposomal system may be any type of unilamellar vesicle, multilamellar vesicle, or stable plurilamellar vesicle, and may be prepared and administered according to methods well known to those skilled in the art, for example, according to the teachings of U.S. Pat. Nos. 5,169,637, 4,762,915, 5,000,958, or 5,185,154. In addition, it may be desirable to express the novel polypeptides of the present invention and other selected polypeptides as lipoproteins to enhance binding to liposomes. Recombinant meteorin protein is purified, for example, from CHO cells by immunoaffinity chromatography or any other convenient method, and then mixed with liposomes and incorporated therein with high efficiency. The liposome-encapsulated protein may be tested in vitro for any effect of stimulating cell growth.

[0097] Microencapsulation of meteorin polypeptides is contemplated when sustained release administration of meteorin polypeptides is desired in a formulation with release characteristics suitable for the treatment of any disease or disorder requiring administration of meteorin polypeptides. Microencapsulation of recombinant proteins for sustained release has been successful with human growth hormone (rhGH), interferon (rhIFN-), interleukin-2, and MN rgp120. Johnson et al., Nat. Med., 2:795-799 (1996); Yasuda, Biomed. Ther., 27:1221-1223 (1993); Hora et al., Bio / Technology, 8:755-758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems," in Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462; WO 97 / 03692, WO 96 / 40072, WO 96 / 07399; and U.S. Pat. No. 5,654,010.

[0098] The sustained release formulations of these proteins were developed using poly-lactic-coglycolic acid (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic acid and glycolic acid, can be rapidly excreted in the human body. Furthermore, the degradability of this polymer can be tuned from months to years depending on its molecular weight and composition. Lewis, “Controlled release of bioactive agents from lactide / glycolide polymer,” in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41.

[0099] In one embodiment of the present invention, a composition comprising meteorin is contemplated.The composition may comprise the isolated polypeptide described herein, the isolated nucleic acid described herein, the expression vector encoding meteorin described herein, the cell line expressing meteorin described herein, or the biocompatible capsule secreting meteorin described herein.

[0100] Dosage Various dosing regimens for systemic administration are contemplated. In one embodiment, the method of administering a formulation comprising a meteorin polypeptide to a subject comprises administering meteorin at a dose of 1 μg to 10,000 μg per kg of subject's body weight per administration. In another embodiment, the dose is 1 μg to 7,500 μg per kg of subject's body weight per administration. In a further embodiment, the dose is 1 μg to 5,000 μg per kg of subject's body weight per administration. In a different embodiment, the dose is 1 μg to 2,000 μg per kg of subject's body weight per administration. In yet another embodiment, the dose is 1 μg to 1,000 μg per kg of subject's body weight per administration. In yet another embodiment, the dose is 1 μg to 700 μg per kg of subject's body weight per administration. In a more preferred embodiment, the dose is 5 μg to 500 μg per kg of subject's body weight per administration. In a most preferred embodiment, the dosage is 10 μg to 100 μg per kg of the subject's body weight per administration. In a preferred embodiment, the subject to be treated is a human.

[0101] Guidance regarding specific doses and methods of delivery is provided in the literature, see, for example, WO02 / 78730 and WO07 / 100898. Guidance for calculating human equivalent doses based on doses used in animal studies is provided in Reagan-Shaw et al., FASEB J, 22, 659-661 (2007).

[0102] The dose administered must be carefully adjusted to the age, weight and condition of the individual being treated, as well as the route of administration, dosage form and regimen, and the desired result, and the exact dosage should be determined by the attending physician.

[0103] In one embodiment of the invention, meteorin is administered by systemic administration.

[0104] In one embodiment, meteorin is administered by parenteral injection, preferably subcutaneous or intrathecal injection.

[0105] In one embodiment, the meteorin polypeptide is administered at a dose of 1 μg / kg to 10,000 μg / kg, for example, 1 μg / kg to 7,500 μg / kg, for example, 1 μg / kg to 5,000 μg / kg, for example, 1 μg / kg to 2,000 μg / kg, for example, 1 μg / kg to 1,000 μg / kg, for example, 1 μg / kg to 700 μg / kg, for example, 5 μg / kg to 500 μg / kg, for example, 10 μg / kg to 100 μg / kg.

[0106] In one embodiment of the invention, administration is repeated daily, hi another embodiment, administration is repeated at least 1-3 times per week, such as 2-5 times per week, for example 3-6 times per week.

[0107] In one embodiment, administration is repeated once a day, once every 2 days, once every 3 days, once every 4 days, once every 5 days, once every 6 days, or once every 7 days. In a preferred embodiment, administration is repeated once every 2 days.

[0108] In one embodiment, the present invention provides for the treatment of nociceptive pain. Thus, in one embodiment, administration is initiated after the onset of nociceptive pain symptoms.

[0109] In one embodiment, the present invention provides for the prevention of nociceptive pain. Thus, in one embodiment, the meteorin polypeptide is administered prior to the onset of nociceptive pain symptoms.

[0110] In another embodiment, meteorin is administered at a relatively long interval between doses.A relatively long interval between doses is intended to include at least 2 days between doses, for example at least 3 days between doses, for example twice weekly administration.More preferably, the long interval between doses is at least 1 week, for example at least 2 weeks, more preferably at least 3 weeks, for example at least 4 weeks, or at least 1 month.

[0111] A relatively long dosing interval is intended to mean at least 2 days between doses, such as at least 3 days between doses, e.g., twice weekly dosing. More preferably, the long dosing interval is at least 1 week, such as at least 2 weeks, more preferably at least 3 weeks, such as at least 4 weeks, or at least 1 month.

[0112] In other words, the administration interval is long enough that after one dose of meteorin polypeptide, the polypeptide is no longer detectable in the serum of the treated subject when the next dose is administered. In another embodiment, the serum level is less than 10 ng / mL, such as less than 5 ng / mL, more preferably less than 1 ng / mL, such as less than 0.5 ng / mL, such as less than 0.1 ng / mL.

[0113] In some embodiments, a more frequent initial administration of meteorin is administered before a long administration range, for example, twice a day, once a day, once every 2 days, once every 3 days, or once every 4 days. This initial administration schedule may be maintained for, for example, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 9 days, 11 days, 14 days, 21 days, or more. After completion of this administration schedule, meteorin may be administered less frequently, for example, as described above.

[0114] Thus, in one aspect, the present invention relates to a method of treating neuropathic pain in a human subject in need thereof, comprising administering to the subject a therapeutically effective amount of a neurotrophic polypeptide comprising an amino acid sequence having at least 70% identity to the amino acid sequence of SEQ ID NO:3, wherein said administration is three times a week or less frequent.

[0115] Preferably, administration is weekly or less frequent. Even more preferably, administration is biweekly or less frequent.

[0116] In other words, the administration interval is long enough that after one dose of meteorin polypeptide, the polypeptide is no longer detectable in the serum of the treated subject when the next dose is administered. In another embodiment, the serum level is less than 10 ng / mL, such as less than 5 ng / mL, more preferably less than 1 ng / mL, such as less than 0.5 ng / mL, such as less than 0.1 ng / mL.

[0117] In some embodiments, the initial administration of meteorin is, for example, twice a day, once a day, once every 2 days, once every 3 days, or once every 4 days. This administration schedule may be maintained for, for example, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 9 days, 11 days, 14 days, 21 days, or more. After completion of this administration schedule, meteorin may be administered less frequently, for example, as described above.

[0118] Meteorin The present invention relates to the use of polypeptides identified as meteorin proteins and polynucleotides encoding said proteins in the treatment of nociceptive pain.In one embodiment, delivery is contemplated by using capsules to deliver secreted biologically active meteorin and / or its homologues to a subject.Meteorin proteins have been identified in humans (SEQ ID NO:2), mice (SEQ ID NO:5), and rats (SEQ ID NO:8), as well as in various other species.

[0119] Human meteorin exists as a precursor of 293 amino acids that can be processed to generate at least one biologically active peptide. Meteorin is expressed at high levels in the nervous system and the eye, particularly in subregions of the brain. The meteorin precursors of mouse (SEQ ID NO:5) and rat (SEQ ID NO:8) consist of 291 amino acids and share 80.3 and 80.2% sequence identity with the human meteorin protein (SEQ ID NO:2), respectively (see FIG. 4).

[0120] Human meteorin contains a 23 amino acid N-terminal signal peptide sequence that is cleaved at the sequence motif ARA-GY. This signal peptide cleavage site is predicted by the SignalP method. The N-terminus of mouse meteorin has been verified by N-terminal sequencing (Jorgensen et al., Characterization of Meteorin - An evolutionary conserved neurotrophic factor, J mol Neurosci 2009 Sep;39 (1-2): 104-116).

[0121] Table 1 shows the % sequence identity between full-length human meteorin and the mouse and rat sequences, see alignment in Figure 4a. [Table 1] Table 2 shows the % sequence identity between human meteorin and the mouse and rat sequences after removal of the N-terminal signal peptide, see alignment in Figure 4b. [Table 2]

[0122] Based on the completely conserved residues, a consensus sequence for mature meteorin can be derived (SEQ ID NO: 11, FIG. 4c), where X is independently selected from any of the 21 naturally occurring amino acids encoded by DNA. In a preferred embodiment, the variant meteorin comprises the consensus sequence.

[0123] One of the biological functions of Meteorin is its ability to induce neurite outgrowth in isolated dorsal root ganglion (DRG) cultures, as described in Jorgensen et al., Characterization of Meteorin - An evolutionary conserved neurotrophic factor, J mol Neurosci 2009 Sep;39 (1-2): 104-116 and Nishino et al., “Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension”, EMBO J., 23(9):1998-2008 (2004).

[0124] Due to the high conservation of cysteines, these residues are predicted to play important roles in the secondary and tertiary structure of biologically active proteins. One or more of the cysteines may be involved in the formation of intra- and / or intermolecular disulfide bridges.

[0125] Meteorin Polypeptide In addition to full-length meteorin, substantially full-length meteorin, and prometeorin, the present invention provides biologically active variants of the polypeptide. A meteorin polypeptide or fragment is biologically active if it exhibits the biological activity of naturally occurring meteorin described herein, such as neurotrophic activity. It should be understood that the present invention relates to meteorin as defined herein.

[0126] The present invention relates to an isolated polypeptide molecule for use in a method for the treatment of nociceptive pain, said polypeptide comprising: a) an amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 6, and 9; b) biologically active sequence variants of an amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 6, and 9, which have at least 70% sequence identity to the above SEQ ID NOs, and c) a biologically active fragment of at least 50 consecutive amino acids of either a) or b), which fragment is at least 70% identical to the above SEQ ID NO:

[0127] In one embodiment, the present invention provides a method for the preparation of a method for the treatment of atopic dermatitis comprising the steps of: i) AA of SEQ ID NO:2 30 ~AA 288 and a polypeptide having 1 to 5 extra amino acids at one or both termini compared to the native sequence, 25 ~AA 293 Up to; ii) AA of SEQ ID NO:8 28 ~AA 286 and a polypeptide having 1 to 5 extra amino acids at one or both termini compared to the native sequence, 23 ~AA 291 Up to; iii) AA of SEQ ID NO:5 31 ~AA 289 and a polypeptide having 1 to 5 extra amino acids at one or both termini compared to the native sequence, 26 ~AA 294 and iv) variants of said polypeptides, wherein any amino acid specified in the selected sequence is changed to a different amino acid, provided that no more than 20 of the amino acid residues in the sequence are so changed.

[0128] A preferred biological activity is the ability to elicit substantially the same response as the DRG assay obtained with mouse meteorin described in Jorgensen et al., Characterization of Meteorin - An evolutionary conserved neurotrophic factor, J mol Neurosci 2009 Sep;39 (1-2): 104-116, in which DRG cells are grown in the presence of the full-length human meteorin coding sequence (SEQ ID NO:3). By substantially the same response in the DRG assay, it is intended that the neurite outgrowth from DRG cells is at least 20%, more preferably at least 30%, more preferably at least 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90% of the number obtained in the DRG assay described in Jorgensen et al., Characterization of Meteorin - An evolutionary conserved neurotrophic factor, J mol Neurosci 2009 Sep;39 (1-2): 104-116. The biological activity of a fragment or variant of meteorin may also be higher than the biological activity of naturally occurring meteorin (SEQ ID NO: 3).

[0129] A variant may differ from naturally occurring meteorin in amino acid sequence or in a manner unrelated to sequence, or both. A variant in amino acid sequence ("sequence variant") is generated when one or more amino acids of naturally occurring meteorin are replaced with different natural amino acids, amino acid derivatives, or non-natural amino acids. Particularly preferred variants include naturally occurring meteorin, or biologically active fragments of naturally occurring meteorin, whose sequence differs from the wild-type sequence by one or more conservative and / or semi-conservative amino acid substitutions that typically have minimal effect on the secondary and tertiary structure and hydrophobic properties of the protein or peptide. A variant may also have a sequence that differs by one or more non-conservative amino acid substitutions, deletions, or insertions that do not destroy the biological activity of meteorin. The Clustal W alignment of FIG. 4 can be used to predict which amino acid residues can be substituted without substantially affecting the biological activity of the protein. In a preferred embodiment, the variant meteorin sequence comprises the consensus sequence having SEQ ID NO: 11.

[0130] Substitutions within the following groups (Clustal W, "strong" conserved groups) should be considered as conservative substitutions within the meaning of the present invention: -S,T,A;N,E,Q,K;N,H,Q,K;N,D,E,Q;Q,H,R,K;M,I,L,V;M,I,L,F;H,Y;F,Y,W.

[0131] Substitutions within the following groups (Clustal W, "weakly" conserved groups) should be considered as semi-conservative substitutions within the meaning of the present invention: -C,S,A;A,T,V;S,A,G;S,T,N,K;S,T,P,A;S,G,N,D;S,N,D,E,Q,K;N,D,E,Q,H,K;N,E,Q,H,R,K;V,L,I,M;H,F,Y.

[0132] Other variants within the present invention are those that have modifications that improve the stability of the peptide. Such variants may, for example, include one or more non-peptide bonds (replacing peptide bonds) in the peptide sequence. Also included are variants that include residues other than naturally occurring L-amino acids, such as D-amino acids, or non-naturally occurring or synthetic amino acids, such as beta or gamma amino acids, and cyclic variants. Incorporating D-amino acids into a polypeptide instead of L-amino acids may increase resistance to proteases. See, for example, US 5,219,990. Splice variants are specifically included in the present invention.

[0133] When the outcome of a given substitution cannot be predicted with certainty, derivatives can be readily assayed for the presence or absence of neurotrophic activity according to the methods disclosed herein, preferably using the DRG assay described in Jorgensen et al., Characterization of meteorin-An evolutionary conserved neurotrophic factor, J mol Neurosci 2009 Sep;39(1-2):104-116.

[0134] In one embodiment, the polypeptide is a naturally occurring allelic variant of a sequence selected from the group consisting of SEQ ID NOs: 3, 6, and 9. The polypeptide may comprise an amino acid sequence that is the translation of a nucleic acid sequence that differs by one nucleotide from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 4, and 7.

[0135] The variant polypeptides described herein include, in one embodiment, polypeptides in which any amino acid specified in a selected sequence has been altered to provide a conservative substitution.

[0136] Variants within the scope of the present invention, in one embodiment, include proteins and peptides having an amino acid sequence that has at least 70% identity to human, mouse or rat meteorin (SEQ ID NOs: 3, 6 and 9). More preferably, the sequence identity is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98%.

[0137] In a preferred embodiment, the sequence identity of the variant meteorin is determined with reference to the human meteorin polypeptide (SEQ ID NO:3).

[0138] In one embodiment, the variant comprises a protein comprising an amino acid sequence having at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98% sequence identity to SEQ ID NO:3.

[0139] In one embodiment, preferred variants include proteins comprising an amino acid sequence having at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98% sequence identity to SEQ ID NO:6.

[0140] In one embodiment, preferred variants include proteins comprising an amino acid sequence having at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98% sequence identity to SEQ ID NO:9.

[0141] The neurotrophic polypeptide preferably has at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98% sequence identity to the amino acid sequence of SEQ ID NO:3.

[0142] In one embodiment, the neurotrophic polypeptide comprises the consensus sequence of SEQ ID NO:11.

[0143] Preferably, the neurotrophic polypeptide has cysteine ​​residues at positions 7, 28, 59, 95, 148, 151, 161, 219, 243, and 265 relative to the amino acid sequence of SEQ ID NO:3.

[0144] In one embodiment, preferred variants of meteorin include proteins comprising 50 to 270 amino acids, more preferably 75 to 270 amino acids, more preferably 90 to 270 amino acids, more preferably 100 to 270 amino acids, more preferably 125 to 270 amino acids, more preferably 150 to 270 amino acids, more preferably 175 to 270 amino acids, more preferably 200 to 270 amino acids, more preferably 225 to 270 amino acids, more preferably 250 to 270 amino acids.

[0145] In one embodiment, the variant meteorin comprises residues marked (*) in FIG. 4 as being completely conserved at the corresponding positions, more preferably the variant meteorin also comprises residues marked (*) in FIG. 4 as being strongly conserved at the corresponding positions (strongly conserved groups are S,T,A; N,E,Q,K; N,H,Q,K; N,D,E,Q; Q,H,R,K; M,I,L,V; M,I ,L,F;H,Y;F,Y,W), more preferably the variant meteorin also comprises residues marked as less conserved in FIG. 4 at the corresponding positions (the less conserved groups include: C,S,A;A,T,V;S,A,G;S,T,N,K;S,T,P,A;S,G,N,D;S,N,D,E,Q,K;N,D,E,Q,H,K;N,E,Q,H,R,K;V,L,I,M;H,F,Y). In particular, it is contemplated that the conserved cysteines must be located at the corresponding positions in the variant meteorin. Thus, in one embodiment, the variant meteorin sequence has cysteine ​​residues at positions 7, 28, 59, 95, 148, 151, 161, 219, 243 and 265 relative to the amino acid sequence of SEQ ID NO:3.

[0146] In one embodiment the polypeptide for use in the treatment and / or prevention of nociceptive pain comprises the consensus sequence of SEQ ID NO:11.

[0147] In one embodiment, the polypeptide for use in the treatment and / or prevention of nociceptive pain has cysteine ​​residues at positions 7, 28, 59, 95, 148, 151, 161, 219, 243 and 265 relative to the amino acid sequence of SEQ ID NO:3.

[0148] In one embodiment the polypeptide for use in the treatment and / or prevention of nociceptive pain is a variant polypeptide, wherein any amino acid substitutions are conservative substitutions.

[0149] In one embodiment the polypeptide for use in the treatment and / or prevention of nociceptive pain is capable of forming at least one intramolecular disulfide bridge.

[0150] In one embodiment, the polypeptides are used for the treatment and / or prevention of nociceptive pain in a subject, such as a mammal, preferably a primate, more preferably a human.

[0151] In one embodiment, the polypeptide for use in the treatment and / or prevention of nociceptive pain is administered systemically, for example by parenteral injection, preferably subcutaneous or intrathecal injection.

[0152] In one embodiment, the polypeptide for use in the treatment and / or prevention of nociceptive pain is administered at a dose of 1 μg / kg to 10,000 μg / kg, such as 1 μg / kg to 7,500 μg / kg, for example 1 μg / kg to 5,000 μg / kg, for example 1 μg / kg to 2,000 μg / kg, for example 1 μg / kg to 1,000 μg / kg, for example 1 μg / kg to 700 μg / kg, for example 5 μg / kg to 500 μg / kg, for example 10 μg / kg to 100 μg / kg per kg of body weight.

[0153] In one embodiment, the polypeptide for use in the treatment and / or prevention of nociceptive pain is administered at least 1-3 times per week, such as 2-5 times per week, for example 3-6 times per week. In another embodiment, the polypeptide is administered every day. In another embodiment, the polypeptide is administered daily.

[0154] In one embodiment of the polypeptide for use in the treatment and / or prevention of nociceptive pain, administration of said polypeptide is initiated after the onset of nociceptive pain symptoms.

[0155] In one embodiment, the encoded polypeptide comprises the consensus sequence of SEQ ID NO: 11. The consensus sequence comprises amino acid residues conserved in human, mouse and rat meteorin as shown in Figure 4c. Preferably, the neurotrophic polypeptide has cysteine ​​residues at positions 7, 28, 59, 95, 148, 151, 161, 219, 243 and 265 relative to the amino acid sequence of SEQ ID NO:3.

[0156] Non-sequence modifications may include, for example, chemical derivatization in vivo or in vitro of parts of naturally occurring meteorin, as well as acetylation, methylation, phosphorylation, carboxylation, PEGylation, or glycosylation. Just as it is possible to replace protein substituents, it is also possible to replace functional groups attached to proteins with groups characterized by similar characteristics. Such modifications do not change the primary sequence. They are initially conservative, i.e. the replaced group will have approximately the same size, shape, hydrophobicity, and charge as the original group.

[0157] Many amino acids, including terminal amino acids, may be modified in a given polypeptide by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques well known in the art. Some of the known modifications that may be present in the polypeptides of the invention are acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a polynucleotide or polynucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamic acid, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, protein processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer RNA-mediated addition of amino acids to proteins, such as arginylation, and ubiquitination, to name a few.

[0158] Such modifications are well known to those skilled in the art and have been described in great detail in the scientific literature, with some of the most common modifications, such as glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation, being described in most basic textbooks, such as IE Creighton, Proteins-Structure and Molecular Properties, 2nd Ed., WH Freeman and Company, New York, 1993. Many detailed reviews are available on this topic, e.g., Wold, F., in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, pp 1-12, 1983; Seifter et al., Meth. Enzymol. 182: 626-646, 1990 and Rattan et al., Protein Synthesis: Posttranslational Modifications and Aging, Ann. NY Acad. Sci. 663: 48-62, 1992.

[0159] In addition, the protein may contain a protein tag, allowing for subsequent purification and, optionally, removal of the tag using an endopeptidase. The tag may contain a protease cleavage site to facilitate subsequent removal of the tag. Non-limiting examples of affinity tags include poly-his tag, GST tag, HA tag, Flag tag, C-myc tag, HSV tag, V5 tag, maltose binding protein tag, cellulose binding domain tag. Preferably, for production and purification, the tag is a poly-his tag. Preferably, the tag is present at the C-terminal portion of the protein.

[0160] To increase secretion of the protein in recombinant production in other mammalian cell types, the native signal sequence of meteorin may be replaced.

[0161] Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains, and the amino or carboxyl termini, Indeed, blocking of amino or carboxyl groups, or both, in a polypeptide by a covalent modification is common in naturally occurring and synthetic polypeptides, and such modifications can likewise be present in the polypeptides of the present invention.

[0162] Modifications that occur in a polypeptide often depend on the method of its production. For example, in the case of a polypeptide produced by expressing a cloned gene in a host, the nature and extent of the modification is determined in large part by the post-translational modification capabilities of the host cell and the modification signals present in the polypeptide amino acid sequence. For example, glycosylation often does not occur in bacterial hosts such as E. coli. Therefore, if glycosylation is desired, the polypeptide should be expressed in a glycosylating host, typically a eukaryotic cell. Insect cells often perform the same post-translational glycosylation as mammalian cells, and for this reason insect cell expression systems have been developed specifically to efficiently express mammalian proteins with native glycosylation patterns. Similar considerations apply to other modifications.

[0163] It will be understood that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide, and a given polypeptide may contain many types of modifications.

[0164] Generally, as used herein, the term polypeptide encompasses all such modifications, particularly those present in polypeptides synthesized by expressing a polynucleotide in a host cell.

[0165] Meteorin nucleotide sequence The present invention provides medical uses of genomic and cDNA encoding meteorin, for example the human cDNA nucleotide sequences (SEQ ID NO:1 and 10), the mouse cDNA sequence (SEQ ID NO:4), and the rat cDNA sequence (SEQ ID NO:7).

[0166] Variants of these sequences are also included within the scope of the present invention.

[0167] The present invention relates to an isolated nucleic acid molecule for use in a method for the treatment and / or prevention of nociceptive pain, said nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide, said polypeptide comprising: i. the amino acid sequence of SEQ ID NO:3; ii. biologically active sequence variants of the amino acid sequence of SEQ ID NO: 3, which variants have at least 70% sequence identity to SEQ ID NO: 3, and iii. A biologically active fragment of at least 50 consecutive amino acids of i) or ii), which comprises an amino acid sequence selected from the group consisting of fragments that are at least 70% identical to SEQ ID NO:3.

[0168] In one aspect, the present invention relates to an isolated nucleic acid molecule for use in the treatment and / or prevention of nociceptive pain in a subject.

[0169] In one embodiment, the isolated nucleic acid molecule is a. the amino acid sequence of SEQ ID NO:3; b. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, said variant having at least 70% sequence identity to SEQ ID NO: 3; The present invention also includes a nucleic acid sequence that encodes a polypeptide comprising an amino acid sequence selected from the group consisting of:

[0170] In one embodiment, the present invention relates to an isolated nucleic acid molecule encoding a polypeptide for use in a method for the treatment and / or prevention of nociceptive pain, said polypeptide comprising: i) AA of SEQ ID NO:2 30~AA 288 and a polypeptide having 1 to 5 extra amino acids at one or both termini compared to the native sequence, 25 ~AA 293 Up to; ii) AA of SEQ ID NO:8 28 ~AA 286 and a polypeptide having 1 to 5 extra amino acids at one or both termini compared to the native sequence, 23 ~AA 291 Up to; iii) AA of SEQ ID NO:5 31 ~AA 289 and a polypeptide having 1 to 5 extra amino acids at one or both termini compared to the native sequence, 26 ~AA 294 and iv) A variant of said polypeptide, comprising an amino acid sequence selected from the group consisting of variants of said polypeptide, in which any amino acid specified in the selected sequence is changed to a different amino acid, provided that no more than 20 of the amino acid residues in the sequence are so changed.

[0171] The nucleic acid molecule may comprise the nucleotide sequence of a naturally occurring allelic nucleic acid variant.

[0172] A nucleic acid molecule of the invention may encode a variant polypeptide, which has the polypeptide sequence of a naturally occurring polypeptide variant.

[0173] In one embodiment, the nucleic acid molecule differs from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, and 10 by one nucleotide.

[0174] Preferably, the encoded polypeptide has at least 60% sequence identity, preferably at least 65% sequence identity, more preferably at least 70% sequence identity, more preferably at least 75% sequence identity, more preferably at least 80% sequence identity, more preferably at least 85% sequence identity, more preferably at least 90% sequence identity, more preferably at least 95% sequence identity, more preferably at least 98% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 3, more preferably said polypeptide has a sequence selected from the group consisting of SEQ ID NO: 3, said sequence constituting human meteorin.

[0175] In a preferred embodiment, the encoded polypeptide comprises the consensus sequence having SEQ ID NO:11.

[0176] In preferred embodiments, the encoded polypeptide has at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 95%, more preferably at least 98% sequence identity to SEQ ID NO:3, and more preferably the polypeptide has the sequence of SEQ ID NO:3.

[0177] In one aspect, the nucleic acid molecule comprises: a) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, and 10; b) a nucleotide sequence having at least 70% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, and 10; and c) a nucleic acid sequence of at least 150 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs: 1, 4, 7, and 10.

[0178] In one embodiment, the isolated polynucleotide of the present invention has at least 60, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98% sequence identity to the polynucleotide sequence provided as SEQ ID NO:1.

[0179] In one preferred embodiment, the isolated polynucleotide of the present invention has at least 50%, preferably at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98% sequence identity to the polynucleotide sequence provided as SEQ ID NO:10.

[0180] In one embodiment, a preferred isolated polynucleotide variant of the present invention comprises 150 to 900 nucleic acids, more preferably 175 to 900 nucleic acids, more preferably 200 to 900 nucleic acids, more preferably 225 to 900 nucleic acids, more preferably 250 to 900 nucleic acids, more preferably 300 to 900 nucleic acids, more preferably 350 to 900 nucleic acids, more preferably 400 to 900 nucleic acids, more preferably 450 to 900 nucleic acids, more preferably 500 to 900 nucleic acids, more preferably 550 to 900 nucleic acids, more preferably 600 to 900 nucleic acids, more preferably 650 to 900 nucleic acids, more preferably 700 to 900 nucleic acids, more preferably 750 to 900 nucleic acids, more preferably 800 to 900 nucleic acids, more preferably 850 to 900 nucleic acids.

[0181] A preferred group of isolated polynucleotides includes the human meteorin cDNA sequences SEQ ID NOs: 1 and 10. Generally, cDNA sequences are much shorter than genomic sequences and are more easily inserted into an appropriate expression vector and transduced / transfected into producer cells or human cells in vivo or ex vivo.

[0182] In addition, the nucleotide sequences of the present invention include sequences that are derivatives of these sequences.The present invention also includes vectors, liposomes and other carrier vehicles that include one of these sequences or a derivative of one of these sequences.The present invention also includes proteins transcribed and translated from meteorin cDNA, preferably human meteorin cDNA, including but not limited to human meteorin and derivatives and variants.

[0183] Codon-optimized nucleic acid molecules are also contemplated for enhanced expression in a selected host cell, including, but not limited to, E. coli, yeast species, Chinese hamster, baby hamster, insect, fungi, and human.

[0184] Variant nucleic acids can be generated by modern mutagenesis methods. Methods of shuffling coding sequences from human to mouse, rat or chimpanzee are also contemplated.

[0185] Variant nucleic acids are made by replacing an amino acid present in human meteorin with an amino acid at the corresponding position present in mouse or rat meteorin, if this amino acid is different from that present in human meteorin.

[0186] Viral Vectors Broadly speaking, gene therapy aims to introduce new genetic material into a patient's cells to result in a therapeutic benefit to the patient, including the treatment or prevention of a wide range of diseases, disorders, and other conditions.

[0187] Ex vivo gene therapy approaches involve the modification of isolated cells (including, but not limited to, stem cells, neural and glial progenitor cells, and fetal stem cells) which are then injected, grafted, or otherwise transplanted into a patient. See, e.g., U.S. Patent Nos. 4,868,116, 5,399,346, and 5,460,959. In vivo gene therapy aims to directly target host patient tissue in vivo.

[0188] Viruses useful as gene transfer vectors include papovaviruses, adenoviruses, vaccinia viruses, adeno-associated viruses, herpes viruses, and retroviruses.Suitable retroviruses include the group consisting of HIV, SIV, FIV, EIAV, and MoMLV.Another group of suitable retroviruses includes the group consisting of HIV, SIV, FIV, EAIV, and CIV.Another group of preferred viral vectors includes the group consisting of alphaviruses, adenoviruses, adeno-associated viruses, baculoviruses, HSV, coronaviruses, bovine papillomaviruses, and Mo-MLV, and is preferably adeno-associated virus.

[0189] Preferred viruses for the treatment of disorders of the nervous system are lentiviruses and adeno-associated viruses. Both types of viruses can integrate into the genome without cell division, and both types have been tested in preclinical animal studies for applications in the nervous system, particularly the central nervous system.

[0190] Methods for the preparation of AAV are described in the art, for example in US 5,677,158. Examples of AAV delivery to the central nervous system are described in US 6,309,634 and US 6,683,058.

[0191] Preferably, lentiviral vector is a replication-defective lentiviral particle.Such lentiviral particle can be produced from a lentiviral vector comprising 5' lentiviral LTR, tRNA binding site, packaging signal, promoter operably linked to polynucleotide signal encoding fusion protein, origin of second strand DNA synthesis, and 3' lentiviral LTR.The method for preparing lentivirus and administering it to neural cells in vivo is described in US20020037281 (Methods for transducing neural cells using lentiviral vectors).

[0192] Retroviral vectors are the most commonly used vectors in human clinical trials because they have 7-8 kb and the ability to infect cells and stably integrate their genetic material into host cells with high efficiency. See, for example, WO95 / 30761; WO95 / 24929. Oncovirinae require at least one round of target cell proliferation for the introduction and integration of exogenous nucleic acid sequences into the patient. Retroviral vectors randomly integrate into the patient's genome. Retroviruses can be used to target stem cells of the nervous system, because very little cell division occurs in other cells of the nervous system (especially the CNS).

[0193] Three classes of retroviral particles have been described; ecotropic, which can efficiently infect mouse cells, and amphotropic, which can infect cells of many species. The third class includes xenotropic retroviruses, which can infect cells of other species than the one that produced the virus. Their ability to integrate only into the genome of dividing cells makes retroviruses attractive for marking cell lineages in developmental studies and for delivering therapeutic or suicide genes to cancers or tumors.

[0194] For use in human patients, retroviral vectors must be replication-deficient. This prevents further production of infectious retroviral particles in the target tissue; instead, the replication-deficient vector becomes a "capture" transgene stably integrated into the target cell genome. Typically, in a replication-deficient vector, the gag, env, and pol genes have been removed (along with most of the rest of the viral genome). Heterologous DNA is inserted in place of the removed viral genes. The heterologous gene may be under the control of an endogenous heterologous promoter, another heterologous promoter that is active in the target cell, or the retroviral 5'LTR (the viral LTR is active in a variety of tissues). Typically, retroviral vectors have a transgene capacity of about 7-8 kb.

[0195] Replication-defective retroviral vectors require that the viral proteins necessary for replication and assembly are provided in trans, for example, from a genetically engineered packaging cell line. It is important that the packaging cell does not release replication-competent virus and / or helper virus. This is achieved by expressing viral proteins from RNA lacking the Ψ signal, as well as expressing the gag / pol and env genes from separate transcription units. In addition, in some second and third generation retroviruses, the 5'LTR has been replaced with a non-viral promoter that controls the expression of these genes, and the 3'promoter has been minimized to include only the proximal promoter. These designs minimize the possibility of recombination leading to the production of replication-competent vectors or helper viruses.

[0196] Expression vector The construction of vectors for recombinantly expressing meteorin polypeptides for use in the present invention can be accomplished using conventional techniques that do not require detailed explanation for those skilled in the art. However, for general information, those skilled in the art can refer to Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, (NY 1982) if necessary. The expression vectors can be used to generate production cells for recombinantly producing meteorin polypeptides for medical use, and to generate therapeutic cells that secrete meteorin polypeptides for naked or encapsulated therapy.

[0197] Briefly, the construction of recombinant expression vector uses standard ligation techniques.To analyze the constructed vector to confirm that the sequence is correct, the gene is sequenced, for example, using the method of Messing, et al., (Nucleic Acids Res., 9: 309-, 1981), the method of Maxam, et al., (Methods in Enzymology, 65: 499, 1980), or other suitable method known to those skilled in the art.

[0198] Size separation of the cleaved fragments is carried out using conventional gel electrophoresis as described, for example, in Maniatis, et al., (Molecular Cloning, pp. 133-134, 1982).

[0199] For efficient generation of expression vectors, the expression vector should contain the necessary regulatory sequences to express the encoded gene in the correct reading frame. Expression of genes is controlled at the transcriptional, translational, or post-translational level. Transcription initiation is an early and important event in gene expression. It depends on promoter and enhancer sequences and is influenced by specific cellular factors that interact with these sequences. The transcription unit of many genes consists of a promoter and in some cases an enhancer or regulatory element (Banerji et al., Cell 27: 299 (1981); Corden et al., Science 209: 1406 (1980); and Breathnach and Chambon, Ann. Rev. Biochem. 50: 349 (1981)). In the case of retroviruses, the control elements involved in the replication of the retroviral genome are present in the long terminal repeats (LTRs) (Weiss et al., eds., The molecular biology of tumor viruses: RNA tumor viruses, Cold Spring Harbor Laboratory, (NY 1982)). Moloney murine leukemia virus (MLV) and Rous sarcoma virus (RSV) LTRs contain promoter and enhancer sequences (Jolly et al., Nucleic Acids Res. 11: 1855 (1983); Capecchi et al., In: Enhancer and eukaryotic gene expression, Gulzman and Shenk, eds., pp. 101-102, Cold Spring Harbor Laboratories (NY 1991). Other strong promoters include those derived from cytomegalovirus (CMV) and other wild-type viral promoters.

[0200] Promoter and enhancer regions of several non-viral promoters have also been described (Schmidt et al., Nature 314: 285 (1985); Rossi and deCrombrugghe, Proc. Natl. Acad. Sci. USA 84: 5590-5594 (1987)). Methods for maintaining and increasing expression of transgenes in quiescent cells include the use of promoters including collagen type I (1 and 2) (Prockop and Kivirikko, N. Eng. J. Med. 311: 376 (1984); Smith and Niles, Biochem. 19: 1820 (1980); de Wet et al., J. Biol. Chem., 258: 14385 (1983)), SV40 and LTR promoters.

[0201] According to one embodiment of the present invention, the promoter is a constitutive promoter selected from the group consisting of ubiquitin promoter, CMV promoter, JeT promoter (US6,555,674), SV40 promoter, elongation factor 1 alpha promoter (EF1-alpha), RSV, CAG. Examples of inducible / repressible promoters include Tet-On, Tet-Off, rapamycin inducible promoter, Mx1, Mo-MLV-LTR, progesterone, RU486.

[0202] A group of preferred promoters includes CAG, CMV, human UbiC, JeT, SV40, RSV, Tet-regulated promoter, Mo-MLV-LTR, Mx1, Mt1, and EF-1 alpha.

[0203] In addition to using viral and non-viral promoters to promote the expression of transgenes, enhancer sequences may be used to increase the expression level of transgenes. Enhancers can increase the transcriptional activity of not only their native genes but also some foreign genes (Armelor, Proc. Natl. Acad. Sci. USA 70: 2702 (1973)). For example, in the present invention, collagen enhancer sequences can be used together with collagen promoter 2 (I) to increase the expression of transgenes. In addition, enhancer elements found in SV40 viruses can be used to increase the expression of transgenes. This enhancer sequence is composed of a 72 base pair repeat as described by Gruss et al., Proc. Natl. Acad. Sci. USA 78: 943 (1981);Benoist and Chambon, Nature 290: 304 (1981), and Fromm and Berg, J. Mol. Appl. Genetics, 1: 457 (1982), all of which are incorporated herein by reference. This repeat sequence, when in contiguous with various promoters, can increase the transcription of many different viral and cellular genes (Moreau et al., Nucleic Acids Res. 9: 6047 (1981)).

[0204] Additional expression enhancing sequences include, but are not limited to, the woodchuck hepatitis virus post-transcriptional regulatory element, WPRE, SP163, the CMV enhancer, and the chicken beta globin insulator, or other insulators.

[0205] In one aspect, the invention relates to a vector for use in the treatment or prevention of nociceptive pain in a subject.

[0206] In one embodiment, a vector for use in the treatment and / or prevention of nociceptive pain in a subject comprises a polynucleotide encoding a polypeptide as defined herein.

[0207] In another embodiment, the vector further comprises a promoter operably linked to the nucleic acid molecule.

[0208] In one embodiment, the vector for use in the treatment and / or prevention of nociceptive pain is selected from the group consisting of alphavirus, adenovirus, adeno-associated virus, baculovirus, HSV, coronavirus, bovine papilloma virus, and Mo-MLV, preferably adeno-associated virus.

[0209] cell line In one aspect, the present invention relates to an isolated host cell genetically modified with a vector according to the invention.

[0210] The present invention also relates to cells suitable for biodelivery of meteorin via naked or encapsulated cells that can be genetically modified to overexpress meteorin and implanted into a patient for localized delivery of bioactive meteorin polypeptides. Such cells can be broadly referred to as therapeutic cells.

[0211] For ex vivo gene therapy, preferred groups of cells include neural cells, neural precursor cells, neural progenitor cells, neural stem cells, human glial stem cells, human progenitor cells, stem cells, and fetal cells.

[0212] For encapsulation, preferred cells include retinal pigment epithelial cells, such as ARPE-19 cells, immortalized human fibroblasts, and immortalized human astrocytes.

[0213] The ARPE-19 cell line is an excellent platform cell line for encapsulated cell-based delivery techniques, and is also useful for non-encapsulated cell-based delivery techniques. The ARPE-19 cell line is robust (i.e., the cell line is viable under harsh conditions, such as implantation in the central nervous system or intraocular environment). ARPE-19 cells can be genetically modified to secrete substances of therapeutic interest. ARPE-19 cells have a relatively long life span. ARPE-19 cells are of human origin. Furthermore, encapsulated ARPE-19 cells have good in vivo device survival rates. ARPE-19 cells can deliver effective amounts of growth factors. ARPE-19 cells induce little host immune response. Furthermore, ARPE-19 cells are non-tumorigenic. Methods for culturing and encapsulating ARPE-19 cells are described in US 6,361,771.

[0214] In another embodiment, the therapeutic cell line is selected from the group consisting of a human fibroblast cell line, a human astrocyte cell line, a human mesencephalic cell line, and a human endothelial cell line, and is preferably immortalized with TERT, SV40T, or vmyc.

[0215] Extracellular matrix The invention further includes culturing meteorin producing cells in vitro on extracellular matrix prior to transplantation into the mammalian nervous system, as pre-attaching the cells to microcarriers prior to transplantation enhances the long-term viability of the transplanted cells and provides long-term functional benefits.

[0216] Materials that may constitute the extracellular matrix include materials to which cells can adhere and grow after in vitro incubation and that may be implanted into a mammalian body without producing toxic or inflammatory reactions that may destroy the implanted cells or otherwise inhibit their biological or therapeutic activity. Such materials may be synthetic or natural chemicals, or may be of biological origin.

[0217] Matrix materials include, but are not limited to, glass and other silicon oxides, polystyrene, polypropylene, polyethylene, polyvinylidene fluoride, polyurethane, polyalginates, polysulfones, polyvinyl alcohol, acrylonitrile polymers, polyacrylamides, polycarbonates, polypentenes, nylons, amylases, natural and modified gelatins and natural and modified collagens, natural and modified polysaccharides such as dextran and cellulose (e.g., nitrocellulose), agar, and magnetite. Either absorbable or non-absorbable materials can be used. Extracellular matrix materials well known in the art are also contemplated. Extracellular matrix materials may be commercially obtained or may be prepared by growing cells that secrete such matrix, removing the secreting cells, and allowing the transplanted cells to interact and adhere to the matrix. The matrix material on which the transplanted cells grow or with which the cells are mixed may be a resident product of the RPE cells. Thus, for example, the matrix material may be an extracellular matrix or basement membrane material produced and secreted by the transplanted RPE cells.

[0218] To improve cell adhesion, survival, and function, the solid matrix may optionally be coated on its exterior surface with factors known in the art that promote cell adhesion, growth, or survival, including cell adhesion molecules, extracellular matrices such as fibronectin, laminin, collagen, elastin, glycosaminoglycans, or proteoglycans, or growth factors.

[0219] Alternatively, if the solid matrix to which the implanted cells are attached is composed of a porous material, the growth or survival promoting factor(s) may be incorporated into the matrix material and released therefrom following in vivo implantation.

[0220] The configuration of the support is preferably spherical, such as a bead, but may also be cylindrical, elliptical, flat sheet or strip, needle or pin shaped, etc. A preferred form of support matrix is ​​glass beads. Another preferred bead is polystyrene beads.

[0221] The size of the beads may range from about 10 μm to 1 mm in diameter, preferably from about 90 μm to about 150 μm. For descriptions of various microcarrier beads, see, for example, Fisher Biotech Source 87-88, Fisher Scientific Co., 1987, pp. 72-75; Sigma Cell Culture Catalog, Sigma Chemical Co., St, Louis, 1991, pp. 162-163; Ventrex Product Catalog, Ventrex Laboratories, 1989 (these references are incorporated herein by reference). The upper limit of the size of the beads may be set by the beads stimulating an undesirable host response that may interfere with the function of the transplanted cells or cause damage to the surrounding tissue. The upper limit of the size of the beads may also be set by the method of administration. Such limits can be readily determined by one skilled in the art. EXAMPLES

[0222] Example 1: Repeated treatment of rmMeteorin completely ameliorates mechanical pain in mice with CFA inflammatory hyperalgesia Materials and Methods: Adult female C57BL / 6JRj mice were divided into three groups: (i) complete Freund's adjuvant (CFA) + vehicle (Dulbecco's PBS), (ii) CFA + rmMeteorin (1.8 mg / kg), and (iii) untreated satellites for exposure analysis. As shown in Figure 1, either vehicle or rmMeteorin (solid arrow) was administered by subcutaneous (sc) injection every other day (D1, D3, D5, D7, and D9) using an insulin syringe (30G). CFA (20 μl, dashed arrow) was injected sc under isoflurane anesthesia (4% at induction, 4 ml / min O2) followed by 2% at 2 ml / min O2 for maintenance. All mice recovered rapidly and usually became active within 5–10 min after anesthesia wore off. No postoperative analgesia was provided to facilitate the full development of CFA-induced sensitization. For behavioral testing, CFA mice were acclimated to clear acrylic behavioral chambers for 15–30 min before the start of the experiment. As a surrogate marker of mechanical nociceptive hyperalgesia, paw withdrawal thresholds (PWT) were tested at baseline and periodically thereafter using calibrated von Frey filaments until days 14–15. Paw thickness was measured from ventral to dorsal at the thickest part of the paw using a digital micrometer before CFA injection and periodically thereafter as an index of inflammatory edema / burden. Body weight was measured periodically throughout the study as a surrogate marker of general health. All tests were performed by the experimenter blinded to the treatment. Statistical analysis between groups was performed using mixed-effects ANOVA. All data are expressed as mean ± SEM, and p < 0.05 was considered significant.

[0223] result: On day 5, all CFA-injected mice showed significant mechanical nociceptive hyperalgesia in the hind paws, as shown in Fig. 2a. An increase in PWT was observed on day 9, 4 days after the first injection of 1.8 mg / kg rmMeteorin (solid line, black circle) (P<0.01). By continuing to administer rmMeteorin intermittently, the increase in PWT was maintained on days 11, 13, and 15, respectively. Fig. 2b clearly shows that CFA injection caused an almost two-fold increase in paw width, indicating the presence of a large amount of inflammatory edema that was not affected at all by rmMeteorin treatment. Finally, the body weight of rmMeteorin-treated CFA mice was almost the same as that of vehicle-treated CFA mice (Fig. 2c), suggesting that the general health of the mice was not affected by the treatment.

[0224] Conclusion: Treatment with repeated sc injections of rm meteorin completely reversed CFA-induced inflammatory hyperalgesia within a few days of initiating treatment, and this recovery was maintained throughout the entire experimental period, indicating that rm meteorin does not induce analgesic tolerance. rm meteorin did not affect inflammatory burden, indicating that rm meteorin itself has no direct anti-inflammatory mechanism, whereas body weight was unaffected, indicating that the general health of rm meteorin mice was maintained.

[0225] Example 2: Acute treatment with rmMeteorin ameliorates mechanical pain as well as repeated treatment in mice with CFA inflammatory hyperalgesia Materials and Methods: Adult female C57BL / 6JRj mice were divided into four groups: (i) CFA + vehicle, (ii) one injection of CFA + meteorin, (iii) two injections of CFA + rm meteorin, and (iv) three injections of CFA + rm meteorin. Subcutaneous (sc) injections of vehicle or rm meteorin were administered every other day (D3, D5, and D9, solid arrows) using an insulin syringe (30G). CFA (20 μl) was injected sc under isoflurane anesthesia (4% O2 4 ml / min for induction), followed by 2% O2 2 ml / min for maintenance. All mice recovered rapidly and usually became active within 5–10 min after anesthesia wore off. No postoperative analgesia was administered to facilitate the full development of CFA-induced sensitization. For behavioral testing, CFA mice were acclimated to clear acrylic behavioral chambers for 15–30 min before the start of the experiment. As a surrogate marker of mechanical nociceptive hyperalgesia, paw withdrawal thresholds (PWT) were tested at baseline and periodically thereafter until days 14–15 using calibrated von Frey filaments. All tests were performed by an experimenter blinded to treatment. Statistical analysis between groups was performed using mixed-effects ANOVA. All data are expressed as mean ± SEM, with p < 0.05 considered significant.

[0226] result: On day 3, all mice exhibited significant hind paw mechanical nociceptive hyperalgesia induced by the CFA injection treatment, as shown in Figure 3a. Four days after the first injection of 1.8 mg / kg rmMeteorin (solid line, black circle), we observed an increase in PWT on day 7 (P<0.01). We also observed a similar increase in PWT on day 9 in CFA mice that had received two or three injections of rmMeteorin. By continuing intermittent administration, the increase in PWT was maintained on days 11, 13, and 14, respectively. At the end of the experiment on days 14-15, the μ-opioid receptor partial agonist buprenorphine (0.1 mg / kg, sc) or vehicle was administered to mice that had previously received repeated injections of vehicle to confirm the sensitivity of the assay conditions used. As expected, buprenorphine led to a complete recovery of PWT (P<0.0001).

[0227] Conclusion: Systemic injection of rmMeteorin completely reversed hindpaw mechanical pain in female mice with CFA-induced inflammatory hyperalgesia. A single injection of rmMeteorin resulted in reversal of nociceptive hyperalgesia of similar magnitude and duration as that observed with three injections.

[0228] Overview of Arrays SEQ ID NO: 1: Human meteorin cDNA SEQ ID NO: 2: Full length amino acid sequence of human meteorin SEQ ID NO: 3: Human meteorin amino acid sequence without the signal peptide SEQ ID NO: 4: Mouse meteorin cDNA SEQ ID NO: 5: Mouse meteorin full length amino acid sequence SEQ ID NO: 6: Mouse meteorin amino acid sequence without the signal peptide SEQ ID NO: 7: Rat meteorin cDNA SEQ ID NO: 8: Full length amino acid sequence of rat meteorin SEQ ID NO: 9: Rat meteorin amino acid sequence without the signal peptide SEQ ID NO: 10: Human codon optimized DNA sequence SEQ ID NO: 11: Consensus sequence of mature meteorin

[0229] Human meteorin cDNA (1109 base pairs; CDS=118-999) (SEQ ID NO: 1) >gi|34147349|ref|NM_024042.2| Homo sapiens protein of unknown function MGC2601 (MGC2601), mRNA

[0230] Full length amino acid sequence of human meteorin (SEQ ID NO:2) >IPI00031531.1 REFSEQ_NP:NP_076947 TREMBL:Q9UJH9 ENSEMBL:ENSP00000219542 Tax_Id=9606 C380A1.2.1(novel protein) MGFPAAAALLC ALCCGLLAPA ARAGYSEERC SWRGSGLTQE PGSVGQLALA CAEGAVEWLY PAGALRLTLG GPDPRARPGI ACLRPVRPFA GAQVFAERAG GALELLLAEG PGPAGGRCVR WGPRERRALF LQATPHQDIS RRVAAFRFEL REDGRPELPP QAHGLGVDGA CRPCSDAELL LAACTSDFVI HGIIHGVTHD VELQESVITV VAARVLRQTP PLFQAGRSGD QGLTSIRTPL RCGVHPGPGT FLFMGWSRFG EARLGCAPRF QEFRRAYEAA RAAHLHPCEV ALH

[0231] Human meteorin protein without the signal peptide (SEQ ID NO:3) GYSEERCSWR GSGLTQEPGS VGQLALACAE GAVEWLYPAG ALRLTLGGPD PRARPGIACL RPVRPFAGAQ VFAERAGGAL ELLLAEGPGP AGGRCVRWGP RERRALFLQA TPHQDISRRV AAFRFELRED GRPELPPQAH GLGVDGACRP CSDAELLLAA CTSDFVIHGI IHGVTHDVEL QESVITVVAA RVLRQTPPLF QAGRSGDQGL TSIRTPLRCG VHPGPGTFLF MGWSRFGEAR LGCAPRFQEF RRAYEAARAA HLHPCEVALH

[0232] Mouse meteorin cDNA, 1363 base pairs, CDS 84..959 (SEQ ID NO: 4) NM_133719. Mus musculus meteorin [gi:56550040] gggcagccgc gccgcgggct gctcgcgctg cggccccgac cctcccgggg cagcagtccg aggccccggc gcgtccccta accatgctgg tagccacgct tctttgcgcg ctctgttgcg gcctcctggc cgcgtccgct cacgctggct actcggaaga ccgctgcagc tggaggggca gcggtttgac ccaggagcct ggcagcgtgg ggcagctgac cctggactgt actgagggcg ctatcgagtg gctgtaccca gctggggcgc tgcgcctgac cctgggcggc cccgatccgg gcacacggcc cagcatcgtc tgtctgcgcc cagagcggcc cttcgctggt gcccaggtct tcgctgaacg tatgaccggc aatctagagt tgctactggc cgagggcccg gacctggctg ggggccgctg catgcgctgg ggtccccgcg agcgccgagc ccttttcctg caggccacac cacaccgcga catcagccgc agagttgctg ccttccgttt tgaactgcac gaggaccaac gtgcagaaat gtctccccag gctcaaggtc ttggtgtgga tggtgcctgc aggccctgca gtgatgccga gctcctcctg gctgcatgca ccagtgattt tgtgatccac gggaccatcc atggggtcgc ccatgacaca gagctgcaag aatcagtcat cactgtggtg gttgctcgtg tcatccgcca gacactgcca ctgttcaagg aagggagctc ggagggccaa ggccgggcct ccattcgtac cttgctgcgc tgtggtgtgc gtcctggccc aggctccttc ctcttcatgg gctggagccg atttggcgaa gcttggctgg gctgtgctcc ccgcttccaa gagttcagcc gtgtctattc agctgctctc acgacccatc tcaacccatg tgagatggca ctggactgag agacctggga gcaagccctg gatggacctt cttctggaga tggggtgttg gggagggtga tgggagggtg ggtgagaagg gtgtggctcg gatggcatcc tggtacccac agtgagctgg tagaatacta agtaatctgg accataccag ccactgtagt catggtcttc tgtggcaggc agcataccca gctctgtgcc tgcctcactt tgtctactct ccagtctgct gcccttctaa ccctcttag cctgctgacc agtgagctca tgttttcctc gaattccagg gtgctgctgg ggttcagagc aaccgtgccg tagtttggaa gacttgagct aattgttttttttttgtttg tttttttgtt tgtttaaagg tggcctgggg ggggcggcaa aca

[0233] Mouse meteorin full length amino acid sequence (SEQ ID NO:5) ref|NP_598480.1|Meteorin [Mus musculus] MLVATLLCAL CCGLLAASAH AGYSEDRCSW RGSGLTQEPG SVGQLTLDCT EGAIEWLYPA GALRLTLGGP DPGTRPSIVC LRPERPFAGA QVFAERMTGN LELLLAEGPD LAGGRCMRWG PRERRALFLQ ATPHRDISRR VAAFRFELHE DQRAEMSPQA QGLGVDGACR PCSDAELLLA ACTSDFVIHG TIHGVAHDTE LQESVITVVV ARVIRQTLPL FKEGSSEGQG RASIRTLLRC GVRPGPGSFL FMGWSRFGEA WLGCAPRFQE FSRVYSAALT THLNPCEMAL D

[0234] Mouse meteorin protein without signal peptide (SEQ ID NO:6) GYSEDRCSWR GSGLTQEPGS VGQLTLDCTE GAIEWLYPAG ALRLTLGGPD PGTRPSIVCL RPERPFAGAQ VFAERMTGNL ELLLAEGPDL AGGRCMRWGP RERRALFLQA TPHRDISRRV AAFRFELHED QRAEMSPQAQ GLGVDGACRP CSDAELLLAA CTSDFVIHGT IHGVAHDTEL QESVITVVVA RVIRQTLPLF KEGSSEGQGR ASIRTLLRCG VRPGPGSFLF MGWSRFGEAW LGCAPRFQEF SRVYSAALTT HLNPCEMALD

[0235] Rat meteorin cDNA (1026 base pairs; CDS=1-876) (SEQ ID NO: 7) >gi|34870570|ref|XM_213261.2| 1810034B16Rattus norvegicus (LOC287151), mRNA similar to Rik protein

[0236] Rat meteorin full length amino acid sequence (SEQ ID NO:8) >IPI00369281.1|REFSEQ_XP:XP_213261|ENSEMBL:ENSRNOP00000026676 MLVAALLCAL CCGLLAASAR AGYSEDRCSW RGSGLTQEPG SVGQLTLDCT EGAIEWLYPA GALRLTLGGS DPGTRPSIVC LRPTRPFAGA QVFAERMAGN LELLLAEGQG LAGGRCMRWG PRERRALFLQ ATPHRDISRR VAAFQFELHE DQRAEMSPQA QGFGVDGACR PCSDAELLLT ACTSDFVIHG TIHGVVHDME LQESVITVVA TRVIRQTLPL FQEGSSEGRG QASVRTLLRC GVRPGPGSFL FMGWSRFGEA WLGCAPRFQE FSRVYSAALA AHLNPCEVAL D

[0237] Rat meteorin protein without the signal peptide (SEQ ID NO: 9) GYSEDRCSWR GSGLTQEPGS VGQLTLDCTE GAIEWLYPAG ALRLTLGGSD PGTRPSIVCL RPTRPFAGAQ VFAERMAGNL ELLLAEGQGL AGGRCMRWGP RERRALFLQA TPHRDISRRV AAFQFELHED QRAEMSPQAQ GFGVDGACRP CSDAELLLTA CTSDFVIHGT IHGVVHDMEL QESVITVVAT RVIRQTLPLF QEGSSEGRGQ ASVRTLLRCG VRPGPGSFLF MGWSRFGEAW LGCAPRFQEF SRVYSAALAA HLNPCEVALD

[0238] Codon-optimized meteorin nucleotide sequence present in constructs pCAn.meteorin and pT2.CAn.meteorin (SEQ ID NO: 10) ATGGGCTTTCCCGCTCGCCCTGCTGTGCGCTCTGTGCTGCGGACTGCTGGCTCCTGCAGCCAGAGCCGGCTACAGCGAGGAACGGTGCAGCTGGCGGGGCAGCGGCCTGACCCAGGAACCTGGCAGCGTCGGCCAGCTCGCACTGGCCTGTGCAAGGCGCCGTGGAGTGGCTGTACCCCGCAGGCGCCCTGAGACTGACCCTGGGCGGACCCGACC CCAGAGCCAGACCCGGCATTGCCTGTCTGAGGCCCGTGCGGCCTTTCGCTGGCGCCCAGGTGTTCGCCGAGAGAGCCGGCGGAGCCCTGGAACTCCTGCTCGCCGAAGGCCCTGGTCCAGCCGGCGGAAGATGCGTGAGATGGGCCCAAGAGAGCGGAGAGCCCTGTTCCTGCAAGCCACCCCCCACAGGACATCAGCAGACGGGTGGCCGCCTTCAGA TTCGAGCTGCGGGAGGACGGTAGACCCGAGCTGCCACCTCAGGCCCACGGACTGGGAGTGGACGGCGCCTGCAGACCCTGTAGCGACGCCGAGCTGCTGCTCGCCGCCTGCACCAGCACTTCGTGATCCACGCATCATCCACGGCGTGACCCACGACGTGGAGCTGCAGGAAAGCGTCTCACCGTCGTCGCCGCCAGAGTGCTGAGACAGACCCCCCC CTCTGTTCCAGGCCGGCAGAAGCGGCGACCAGGGCCTGACCAGCATCCGGACCCCCCTGAGATGCGGCGTGCATCCCGGACCCGGCACCTTCCTGTTCATGGGCTGGTCCAGATTCGGCGAGGCCCGGCTGGGCTGCGCTCCCGGTTCCAGGAATTCAGACGGGCCTACGAGGCCGCCAGGGCCGCTCATCTGCACCCCTGCGAGGTGGCCCTGCATTGA

[0239] mature メテオリンのコンティスス アショ(アショック#11) TIFF2024546758000003.tif30159X is any of 21 amino acids that can be encoded by DNA.

[0240] References Armelor, Proc. Natl. Acad. Sci. USA 70: 2702 (1973). Attal et al. 2010, “EFNS guidelines on the pharmacological treatment of neuropathic pain: 2010 revision”, Eur J Neurol. 2010 Sep;17(9):1113-e88. doi: 10.1111 / j.1468-1331.2010.02999.x. Epub 2010 Apr 9. Fisher Biotech Source 87-88, Fisher Scientific Co., 1987, pp. 72-75. Banerji et al., Cell 27: 299 (1981). Benoist and Chambon, Nature 290: 304 (1981). Breathnach and Chambon, Ann. Rev. Biochem. 50: 349 (1981)). Capecchi et al., In : Enhancer and eukaryotic gene expression, Gulzman and Shenk, eds., pp. 101-102, Cold Spring Harbor Laboratories (NY 1991). Cleland, ”Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems,” in Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman, eds, (Plenum Press: New York, 1995), pp. 439-462 Corden et al., Science 209: 1406 (1980)。 EMA / CHMP / 970057 / 2011, “Guideline on the clinical development of medicinal products intended for the treatment of pain (EMA / CHMP / 970057 / 2011)” from EMA。 FDA 34355740dft.docx 02 / 07 / 22, ” Draft Development of Non-Opioid Analgesics for Acute Pain Guidance for Industry” from FDA。 Finnerup et al. 2015, ”Pharmacotherapy for neuropathic pain in adults: systematic review, meta-analysis and updated NeuPSIG recommendations”, Lancet Neurol. 2015 Feb; 14(2): 162-173。 Fromm and Berg, J. Mol. Appl. Genetics, 1 : 457 (1982)。 Gruss et al., Proc. Natl. Acad. Sci. USA 78: 943 (1981)。 Hora et al., Bio / Technology, 8:755-758 (1990)。 I. E. Creighton, Proteins-Structure and Molecular Properties, 2nd Ed., W. H. Freeman and Company, New York, 1993。 Johnson et al., Nat. Med., 2:795-799 (1996)。 Jolly et al., Nucleic Acids Res. 11: 1855 (1983)。 Jorgensen et al., Characterization of Meteorin - An evolutionary conserved neurotrophic factor, J mol Neurosci 2009 Sep; 39 (1-2): 104-116。 Lysaght et al., 56 J. Cell Biochem. 196 (1996)。 Maniatis et al., in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, (NY 1982)。 Maxam, et al., (Methods in Enzymology, 65: 499, 1980).Messing, et al., (Nucleic Acids Res., 9: 309-, 1981)。 Moulin et al. 2014, ”Pharmacological management of chronic neuropathic pain: Revised consensus statement from the Canadian Pain Society”, Pain Res Manag. 2014 Nov-Dec; 19(6): 328-335。 Moreau et al., Nucleic Acids Res. 9: 6047 (1981)。 NICE 2013, ”Neuropathic pain in adults: pharmacological management in non-specialist settings”, Clinical guideline [CG173], 20 November 2013。 Nishino et al., ”Meteorin: a secret3ed protein that regulates glial cell differentitaion and promotes axonal extension”, EMBO J., 23(9):1998-2008 (2004)。 Prockop and Kivirikko, N. Eng. J. Med. 311: 376 (1984)。 Rattan et al., Protein Synthesis: Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci. 663: 48-62, 1992。 Reagan-Shaw et al., FASEB J, 22, 659-661 (2007)。 Rossi and deCrombrugghe, Proc. Natl. Acad. Sci. USA 84: 5590-5594 (1987))。 Schmidt et al., Nature 314: 285 (1985)。 Seifter et al., Meth. Enzymol. 182: 626-646, 1990。 Sigma Cell Culture Catalog, Sigma Chemical Co., St, Louis, 1991, pp. 162-163 Smith and Niles, Biochem. 19: 1820 (1980)。 Ventrex Product Catalog, Ventrex Laboratories, 1989。 Weiss et al., eds., The molecular biology of tumor viruses: RNA tumor viruses, Cold Spring Harbor Laboratory, (NY 1982)). de Wet et al., J. Biol. Chem., 258: 14385 (1983). Wold, F., in Posttranslational Covalent Modification of Proteins, BC Johnson, Ed., Academic Press, New York, pp 1-12, 1983. Yasuda, Biomed. Ther., 27:1221-1223 (1993).

[0241] Terms 1. An isolated polypeptide for use in treating or preventing nociceptive pain in a subject, comprising: i. the amino acid sequence of SEQ ID NO:3, and ii. a biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, said variant having at least 70% sequence identity to SEQ ID NO: 3; The polypeptide comprising an amino acid sequence selected from the group consisting of:

[0242] 2. The polypeptide for use according to any one of the preceding clauses, wherein said nociceptive pain is somatic or visceral pain.

[0243] 3. The polypeptide for use according to any one of the preceding clauses, wherein said nociceptive pain is inflammatory pain, lower back pain, shoulder pain, musculoskeletal pain, arthritis pain, joint pain, post-operative pain, post-traumatic pain, or cancer pain.

[0244] 4. The polypeptide for use according to any one of the preceding clauses, wherein said nociceptive pain is selected from the group consisting of inflammatory pain and post-operative pain.

[0245] 5. The polypeptide for use according to clause 3, wherein said nociceptive pain is inflammatory pain, such as inflammatory hyperalgesia.

[0246] 6. The polypeptide for use according to clause 3, wherein said nociceptive pain is post-operative pain.

[0247] 7. The polypeptide for use according to clause 1, wherein said subject is suffering from a disease or disorder selected from the group consisting of arthritis, inflammatory pain, and post-operative pain.

[0248] 8. The polypeptide for use according to clause 6, wherein said arthritis is selected from the group consisting of osteoarthritis, rheumatoid arthritis, or lupus.

[0249] 9. The polypeptide for use according to clause 6, wherein said inflammatory pain is selected from the group consisting of inflammatory hyperalgesia, post-operative pain, and arthritis.

[0250] 10. A polypeptide for use according to any one of the preceding clauses, having at least 70% sequence identity to SEQ ID NO:3, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably 90%, more preferably 95%, more preferably 98% sequence identity.

[0251] 11. A polypeptide for use according to any one of the preceding clauses, comprising the consensus sequence of SEQ ID NO:11.

[0252] 12. A polypeptide for use according to any one of the preceding clauses, comprising cysteine ​​residues at positions 7, 28, 59, 95, 148, 151, 161, 219, 243 and 265 relative to the amino acid sequence of SEQ ID NO:3.

[0253] 13. A polypeptide for use according to any one of the preceding clauses, which is a variant polypeptide and wherein any amino acid substitutions are conservative substitutions.

[0254] 14. A polypeptide for use according to any one of the preceding clauses, which is capable of forming at least one intramolecular disulfide bridge.

[0255] 15. A polypeptide for use according to any one of the preceding clauses, wherein the subject to be treated is a mammal, preferably a primate, more preferably a human.

[0256] 16. A polypeptide for use according to any one of the preceding clauses, wherein the polypeptide is administered by systemic administration.

[0257] 17. A polypeptide for use according to any one of the preceding clauses, which is administered by parenteral injection, preferably subcutaneous or intrathecal injection.

[0258] 18. A polypeptide for use according to any one of the preceding clauses, wherein the polypeptide is administered at a dose of 1 μg / kg to 10,000 μg / kg, such as 1 μg / kg to 7,500 μg / kg, for example 1 μg / kg to 5,000 μg / kg, for example 1 μg / kg to 2,000 μg / kg, such as 1 μg / kg to 1,000 μg / kg, for example 1 μg / kg to 700 μg / kg, for example 5 μg / kg to 500 μg / kg, such as 10 μg / kg to 100 μg / kg per kg of body weight.

[0259] 19. A polypeptide for use according to any one of the preceding clauses, which is administered at least 1 to 3 times per week, such as 2 to 5 times per week, for example 3 to 6 times per week.

[0260] 20. A polypeptide for use according to any one of the preceding clauses, wherein the polypeptide is administered every other day.

[0261] 21. A polypeptide for use according to any one of the preceding clauses, which is administered daily.

[0262] 22. A polypeptide for use according to any one of the preceding clauses, wherein administration is initiated after the onset of nociceptive pain symptoms.

[0263] 23. An isolated nucleic acid molecule for use in treating or preventing nociceptive pain in a subject, comprising: a. the amino acid sequence of SEQ ID NO:3; b. a biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, said variant having at least 70% sequence identity to SEQ ID NO: 3; The nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of:

[0264] 24. A vector for use in the treatment or prevention of nociceptive pain in a subject, said vector comprising a polynucleotide encoding a polypeptide according to any one of clauses 1 to 22.

[0265] 25. A vector for use according to clause 24, further comprising a promoter operably linked to said nucleic acid molecule.

[0266] 26. A vector for use according to either clause 24 or clause 25, wherein said vector is selected from the group consisting of alphavirus, adenovirus, adeno-associated virus, baculovirus, HSV, coronavirus, bovine papilloma virus, and Mo-MLV, preferably an adeno-associated virus.

Claims

1. A pharmaceutical composition for use in treating or preventing nociceptive pain in a subject, comprising an isolated polypeptide, The polypeptide is i. the amino acid sequence of SEQ ID NO: 3, and ii. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, wherein the variant has at least 70% sequence identity to SEQ ID NO: 3, at least 75% sequence identity to SEQ ID NO: 3, at least 80% sequence identity to SEQ ID NO: 3, at least 85% sequence identity to SEQ ID NO: 3, at least 90% sequence identity to SEQ ID NO: 3, at least 95% sequence identity to SEQ ID NO: 3, or at least 98% sequence identity to SEQ ID NO: 3; comprising an amino acid sequence selected from the group consisting of: Pharmaceutical compositions.

2. The pharmaceutical composition of claim 1 , wherein the nociceptive pain is somatic or visceral pain.

3. 2. The pharmaceutical composition of claim 1, wherein the nociceptive pain is inflammatory pain, lower back pain, shoulder pain, musculoskeletal pain, arthritis pain, joint pain, post-operative pain, post-traumatic pain, or cancer pain.

4. 2. The pharmaceutical composition of claim 1, wherein the nociceptive pain is selected from the group consisting of inflammatory pain and post-operative pain.

5. The pharmaceutical composition of claim 3, wherein the nociceptive pain is inflammatory pain.

6. The pharmaceutical composition described in claim 5, wherein the inflammatory pain is inflammatory hyperalgesia.

7. The pharmaceutical composition of claim 1 , wherein the subject is suffering from arthritis.

8. 8. The pharmaceutical composition of claim 7, wherein the arthritis is selected from the group consisting of osteoarthritis, rheumatoid arthritis, and lupus.

9. The pharmaceutical composition described in claim 1, wherein the polypeptide comprises the consensus sequence of SEQ ID NO:

11.

10. The pharmaceutical composition of claim 1, which is administered by systemic administration.

11. The pharmaceutical composition of claim 1, which is administered by parenteral injection, subcutaneous injection, or intrathecal injection.

12. The pharmaceutical composition of claim 1, administered at a dose of 1 μg / kg to 10,000 μg / kg, 1 μg / kg to 7,500 μg / kg, 1 μg / kg to 5,000 μg / kg, 1 μg / kg to 2,000 μg / kg, 1 μg / kg to 1,000 μg / kg, 1 μg / kg to 700 μg / kg, 5 μg / kg to 500 μg / kg, or 10 μg / kg to 100 μg / kg per kg of body weight.

13. The pharmaceutical composition of claim 1, administered at least 1 to 3 times per week, 2 to 5 times per week, or 3 to 6 times per week.

14. A pharmaceutical composition for use in treating or preventing nociceptive pain in a subject, comprising an isolated nucleic acid molecule, The nucleic acid molecule a. the amino acid sequence of SEQ ID NO: 3; b. A biologically active sequence variant of the amino acid sequence of SEQ ID NO: 3, said variant having at least 70% sequence identity to SEQ ID NO: 3; a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence selected from the group consisting of: Pharmaceutical compositions.

15. A pharmaceutical composition for use in treating or preventing nociceptive pain in a subject, comprising a vector, wherein the vector comprises a polynucleotide encoding a polypeptide described in any one of claims 1 to 13.

Images