Activation-responsive promoters and uses thereof

Abstract

Described herein are compositions and methods for regulating the expression of effector molecules using engineered CCL3 promoters.Also described are immunoresponsive cells comprising the same.Furthermore, wherein the engineered CCL3 promoter comprises a truncation of at least one nucleotide motif, wherein the truncation increases the inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of the wild-type CCL3 promoter in the presence of the same immune cell activation signal.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 289,983, filed December 15, 2021, and U.S. Provisional Patent Application No. 63 / 352,995, filed June 16, 2022, each of which is incorporated by reference in its entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing that was submitted via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy was created in XX month of 20XX, is named XXXXXUS_sequencelisting.txt, and is X,XXX,XXX bytes in size. [Background technology]

[0003] Cell-based therapeutic platforms provide a promising means to treat various diseases. One such promising platform is CAR-T-based therapy in the treatment of cancer. Given their promise, improvements in cell-based therapy are needed. An active area of ​​exploration is to engineer cell-based therapy to produce and / or secrete effector molecules, such as cytokines, that enhance cell-based therapy, a process referred to as armoring. For example, non-armored CAR-T therapy has poor efficacy in solid tumors, and armoring can affect the entire cancer-immunity cycle and enhance the activity of CAR-T. However, uncontrolled or unregulated armoring strategies can have negative effects on therapy, such as off-target effects and toxicity in subjects. Thus, additional methods of controlling and regulating the armoring of cell-based therapy are required, such as regulating the production and / or secretion of payload effector molecules. Summary of the Invention

[0004] One embodiment of the present disclosure provides an engineered CCL3 promoter comprising an excision of at least one nucleotide motif, which excision increases the inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal.

[0005] In one aspect, provided herein is an engineered CCL3 promoter comprising an excision of at least one nucleotide motif, wherein the excision increases inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal; Optionally, the wild-type CCL3 promoter comprises the nucleotide sequence of SEQ ID NO: 132, and optionally, at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; Optionally, the motif comprises a sequence selected from the group consisting of positions 566 to 576 of SEQ ID NO:132, positions 674 to 695 of SEQ ID NO:132, positions 820 to 832 of SEQ ID NO:132, positions 1089 to 1105 of SEQ ID NO:132, positions 1127 to 1141 of SEQ ID NO:132, positions 1184 to 1199 of SEQ ID NO:132, positions 1475 to 1500 of SEQ ID NO:132, positions 1534 to 1544 of SEQ ID NO:132, positions 1553 to 1595 of SEQ ID NO:132, positions 1634 to 1674 of SEQ ID NO:132, positions 1681 to 1692 of SEQ ID NO:132, and positions 1982 to 1998 of SEQ ID NO:132; Optionally, the truncation comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif, and optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; Optionally, the motif corresponds to position 566 to position 576 of SEQ ID NO:132; optionally, the truncation comprises a nucleotide substitution comprising the sequence GTACCAGAATA (SEQ ID NO:191) from position 566 to position 576 of SEQ ID NO:132; optionally, the truncation comprises a nucleotide deletion from position 566 to position 576 of SEQ ID NO:132; optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132; and optionally the truncation comprises a nucleotide substitution from position 674 to position 695 of SEQ ID NO: 132 comprising the sequence TATATACCAGCGAGTTCGATAA (SEQ ID NO: 193); and optionally the truncation comprises a nucleotide deletion from position 674 to position 695 of SEQ ID NO: 132; and optionally the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; optionally the motif corresponds to position 820 to position 832 of SEQ ID NO: 132; and optionally the truncation comprises the sequence ACGAAGCAATACT (SEQ ID NO: 195) from position 820 to position 832 of SEQ ID NO: 132. and optionally the excision comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199) at positions 1089 to 1105 of SEQ ID NO:132; and optionally the excision comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132; and optionally the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132; and optionally the motif corresponds to position 1089 to position 1105 of SEQ ID NO:132; and optionally the excision comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199) at positions 1089 to 1105 of SEQ ID NO:132; 105 nucleotide deletion, and optionally at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally the motif corresponds to position 1127 to position 1141 of SEQ ID NO:132, and optionally the truncation comprises a nucleotide substitution comprising the sequence CCATAGTGAGGAAAT (SEQ ID NO:201) from position 1127 to position 1141 of SEQ ID NO:132, and optionally the truncation comprises a nucleotide deletion from position 1127 to position 1141 of SEQ ID NO:132, and optionally at least one nucleotide motif comprisesand optionally the truncation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO:203) from position 1184 to position 1199 of SEQ ID NO:132, and optionally the truncation comprises a nucleotide deletion from position 1184 to position 1199 of SEQ ID NO:132, and optionally at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, and optionally the motif corresponds to position 1184 to position 1199 of SEQ ID NO:132. 32, optionally wherein the truncation comprises a nucleotide substitution comprising the sequence CCGATCTCTAGTTAAGTTAGCTGTAT (SEQ ID NO:217) from position 1475 to position 1500 of SEQ ID NO:132, optionally wherein the truncation comprises a nucleotide deletion from position 1475 to position 1500 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO:132, and optionally the truncation comprises a nucleotide substitution comprising the sequence GTAGAACTCTT (SEQ ID NO:219) from position 1534 to position 1544 of SEQ ID NO:132, and optionally the truncation comprises a nucleotide deletion from position 1534 to position 1544 of SEQ ID NO:132, and optionally the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally the motif corresponds to position 1553 to position 1595 of SEQ ID NO:132, and optionally the truncation comprises a nucleotide substitution comprising the sequence AATACCTTGGTGGAGCTCATCTAATATC from position 1553 to position 1595 of SEQ ID NO:132. Optionally, the truncation comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO:223) from position 1634 to position 1645 of SEQ ID NO:132; and optionally, the truncation comprises a nucleotide deletion from position 1553 to position 1595 of SEQ ID NO:132; and optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1634 to position 1645 of SEQ ID NO:132; and optionally, the truncation comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO:223) from position 1634 to position 1645 of SEQ ID NO:132; and optionally, the truncation comprisesand optionally the truncation comprises a nucleotide substitution comprising the sequence TATACCTTGGTT (SEQ ID NO:225) at position 1663 to position 1674 of SEQ ID NO:132; and optionally the truncation comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO:132; and optionally the truncation comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO:132; and optionally the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO:227) at position 1681 to position 1692 of SEQ ID NO:132; and optionally the engineered CCL3 promoter comprises a polynucleotide of SEQ ID NO:4; Optionally, the truncation comprises a nucleotide deletion from position 1681 to position 1692 of SEQ ID NO:132, optionally the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally the motif corresponds to position 1982 to position 1998 of SEQ ID NO:132, optionally the truncation comprises a nucleotide substitution comprising the sequence GGAAGTAGCTTGTTTAA (SEQ ID NO:241) from position 1982 to position 1998 of SEQ ID NO:132, optionally the truncation comprises a nucleotide deletion from position 1982 to position 1998 of SEQ ID NO:132; Optionally, the excision comprises excision of at least two nucleotide motifs, at least three nucleotide motifs, at least four nucleotide motifs, at least five nucleotide motifs, or at least six nucleotide motifs; Optionally, the at least six nucleotide motifs include a nucleotide motif corresponding to positions 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO:132, and a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO:132; Optionally, the excision of at least six nucleotide motifs comprises a deletion corresponding to position 566 to position 1199 of SEQ ID NO:132, optionally, the excision of at least six nucleotide motifs comprises a deletion corresponding to position 550 to position 1259 of SEQ ID NO:132, optionally, the excision further comprises an excision of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132, optionally, the excision of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132 comprises a deletion of a nucleotide motif, optionally, the excision further comprises an excision of a nucleotide motif corresponding to position 1681 to position 1692 of SEQ ID NO:132, optionally, the excision comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO:227) at position 1681 to position 1692 of SEQ ID NO:132, optionally, the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:2; Optionally, the excision of the nucleotide motif corresponding to positions 1681 to 1692 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, and optionally, the excision further comprises excision of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO:132, and optionally, the excision of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, and optionally, the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:1; Optionally, the truncation comprises excision of at least nine nucleotide motifs, optionally the at least nine nucleotide motifs comprise a nucleotide motif corresponding to positions 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1475-1500 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1553-1595 of SEQ ID NO:132, and a nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO:132, optionally the truncation comprises a deletion of each of the at least nine nucleotide motifs, optionally the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:3, Optionally, the at least nine nucleotide motifs are selected from the group consisting of a nucleotide motif corresponding to positions 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to positions 911-926 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1184-119 of SEQ ID NO:132, and a nucleotide motif corresponding to positions 1190-1190 of SEQ ID NO:132. 9, a nucleotide motif corresponding to positions 1211 to 1223 of SEQ ID NO:132, and a nucleotide motif corresponding to positions 1236 to 1248 of SEQ ID NO:132, optionally wherein the excision of at least nine nucleotide motifs comprises a deletion corresponding to positions 556 to 1248 of SEQ ID NO:132, optionally wherein the excision of at least nine nucleotide motifs comprises a deletion corresponding to positions 550 to 1250 of SEQ ID NO:132, and optionally wherein the excision comprises a deletion corresponding to positions 1425 to 1445 of SEQ ID NO:132. Optionally, the excision of the nucleotide motif corresponding to positions 1425 to 1445 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, and optionally, the excision further comprises excision of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO:132, and optionally, the excision of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, and optionally, the excision further comprises excision of the nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO:132. and optionally, the excision of a nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif, and optionally, the excision further comprises an excision of a nucleotide motif corresponding to positions 1663 to 1679 of SEQ ID NO: 132, and optionally, the excision of a nucleotide motif corresponding to positions 1663 to 1679 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif, and optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, and optionally, the motif iscorresponding to position 1681 to position 1692 of SEQ ID NO: 132, and optionally, the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, and optionally, the CCL3 promoter comprises SEQ ID NO: 242; Optionally, the excision comprises a deletion of at least two nucleotide motifs according to position 1425 to position 1500 of SEQ ID NO:132, optionally the excision further comprises an excision of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132, optionally the excision of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132 comprises a deletion of a nucleotide motif, optionally the excision further comprises an excision of a nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132, optionally the excision of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132 comprises a deletion of a nucleotide motif, optionally the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally the motif corresponds to position 1681 to position 1692 of SEQ ID NO:132. and optionally, the excision comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, optionally, the excision further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO: 132, optionally, the CCL3 promoter comprises SEQ ID NO: 243, optionally, the excision further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO: 132, optionally, the CCL3 promoter comprises SEQ ID NO: 244, optionally, the excision further comprises a deletion for position 1663 to position 1692 of SEQ ID NO: 132, optionally, the excision further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO: 132, optionally, the excision further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO: 132, or optionally, the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 245.

[0006] In another aspect, provided herein is an engineered CCL3 promoter comprising at least one nucleotide motif, Optionally, at least one nucleotide motif is a) a nucleotide motif corresponding to positions 60 to 77 of SEQ ID NO: 132; b) a nucleotide motif corresponding to positions 92 to 111 of SEQ ID NO: 132; c) a nucleotide motif corresponding to positions 201 to 224 of SEQ ID NO: 132; d) a nucleotide motif corresponding to positions 231 to 243 of SEQ ID NO: 132; e) a nucleotide motif corresponding to positions 265 to 284 of SEQ ID NO: 132; f) a nucleotide motif corresponding to positions 307 to 324 of SEQ ID NO: 132; g) a nucleotide motif corresponding to positions 376 to 388 of SEQ ID NO: 132; h) a nucleotide motif corresponding to positions 452 to 475 of SEQ ID NO: 132; i) a nucleotide motif corresponding to positions 494 to 507 of SEQ ID NO: 132; k) a nucleotide motif corresponding to positions 533 to 549 of SEQ ID NO: 132; l) a nucleotide motif corresponding to positions 1260 to 1288 of SEQ ID NO: 132; m) a nucleotide motif corresponding to positions 1345 to 1363 of SEQ ID NO: 132; n) a nucleotide motif corresponding to positions 1534 to 1544 of SEQ ID NO: 132; o) a nucleotide motif corresponding to positions 1634 to 1645 of SEQ ID NO: 132; and p) a nucleotide motif corresponding to positions 1840 to 1861 of SEQ ID NO: 132 or selected from the group consisting of; Optionally, the engineered CCL3 promoter comprises: a) a nucleotide motif corresponding to positions 60 to 77 of SEQ ID NO: 132; b) a nucleotide motif corresponding to positions 92 to 111 of SEQ ID NO: 132; c) a nucleotide motif corresponding to positions 201 to 224 of SEQ ID NO: 132; d) a nucleotide motif corresponding to positions 231 to 243 of SEQ ID NO: 132; e) a nucleotide motif corresponding to positions 265 to 284 of SEQ ID NO: 132; f) a nucleotide motif corresponding to positions 307 to 324 of SEQ ID NO: 132; g) a nucleotide motif corresponding to positions 376 to 388 of SEQ ID NO: 132; h) a nucleotide motif corresponding to positions 452 to 475 of SEQ ID NO: 132; i) a nucleotide motif corresponding to positions 494 to 507 of SEQ ID NO: 132; j) a nucleotide motif corresponding to positions 533 to 549 of SEQ ID NO: 132; k) a nucleotide motif corresponding to positions 1260 to 1288 of SEQ ID NO: 132; l) a nucleotide motif corresponding to positions 1345 to 1363 of SEQ ID NO: 132; m) a nucleotide motif corresponding to positions 1534 to 1544 of SEQ ID NO: 132; n) a nucleotide motif corresponding to positions 1634 to 1645 of SEQ ID NO: 132, and o) A nucleotide motif corresponding to positions 1840 to 1861 of SEQ ID NO: 132 or Optionally, the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:246.

[0007] In another aspect, provided herein is an engineered CCL3 promoter comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-4 and 242-246.

[0008] In another aspect, provided herein is a heterologous construct comprising an engineered CCL3 promoter according to any one of the above aspects or embodiments operably linked to a polynucleotide comprising a polynucleotide sequence encoding a polypeptide, Optionally, the polypeptide comprises at least one effector molecule; Optionally, the polypeptide comprises a first effector molecule and a second effector molecule; Optionally, the polynucleotide comprises a polynucleotide sequence encoding a first effector molecule, a linker polynucleotide sequence, and a polynucleotide sequence encoding a second effector molecule; Optionally, the linker polynucleotide sequence encodes one or more 2A ribosomal skipping elements, optionally the one or more 2A ribosomal skipping elements comprise an element each selected from the group consisting of P2A, T2A, E2A, and F2A; Optionally, the at least one effector molecule is selected from a therapeutic class, the therapeutic class being selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides, and enzymes; Optionally, each of the at least one effector molecule comprises: a) a cytokine, optionally selected from the group consisting of IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha; b) a chemokine, optionally selected from the group consisting of CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and XCL1; c) a homing molecule, optionally selected from the group consisting of anti-integrin alpha 4, beta 7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15; d) a growth factor, optionally selected from the group consisting of FLT3L and GM-CSF; e) a co-activating molecule, optionally selected from the group consisting of c-Jun, 4-1BBL, and CD40L; f) a tumor microenvironment modifier, optionally selected from the group consisting of adenosine deaminase, TGF beta inhibitors, immune checkpoint inhibitors, VEGF inhibitors, and HPGE2; Including, Optionally, each of the first effector molecule and the second effector molecule is from a distinct therapeutic class; And, optionally, each of the at least one effector molecule is a human-derived effector molecule.

[0009] In another aspect, provided herein is a vector comprising a heterologous construct of any one of the above aspects or embodiments.

[0010] In another aspect, provided herein is a dual expression vector comprising the heterologous construct of the above aspect and a second construct comprising a polynucleotide sequence encoding an activating immune receptor, optionally wherein the activating immune receptor comprises an antigen recognition receptor; Optionally, the antigen recognition receptor comprises a T cell receptor (TCR), optionally the TCR is an endogenous T cell receptor or an exogenous T cell receptor; and Optionally, the antigen recognition receptor comprises a chimeric antigen receptor (CAR).

[0011] In another aspect, provided herein is an immunoresponsive cell comprising a heterologous construct, vector, or dual expression vector of any one of the above aspects or embodiments, Optionally, the immunoresponsive cell is selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells; Optionally, the immunoresponsive cell expresses an activating immunoreceptor, optionally the activating immunoreceptor comprises an antigen recognition receptor, optionally the antigen recognition receptor comprises a T cell receptor (TCR), optionally the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and optionally the antigen recognition receptor comprises a chimeric antigen receptor (CAR); Optionally, the antigen recognition receptor comprises an activating NK cell receptor, and optionally the activating NK cell receptor is selected from the group consisting of NKG2D, NKp30, NKp44, NKp46, and an ITAM-containing killer cell Ig-like receptor (KIR); Optionally, the immunoresponsive cell comprises a heterologous construct encoding an antigen-recognizing receptor; and Optionally, the immunoresponsive cells are autologous, or optionally, the immunoresponsive cells are allogeneic.

[0012] In another aspect, provided herein is a pharmaceutical composition comprising an engineered CCL3 promoter, a heterologous construct, a vector, a dual expression vector, an immunoresponsive cell, and a pharma- ceutical acceptable carrier, a pharma-ceutical acceptable excipient, or a combination thereof.

[0013] In another aspect, provided herein is a method of increasing expression of a target gene, the method comprising use of an engineered CCL3 promoter, a heterologous construct, a vector, or a dual expression vector to increase expression of a target gene, optionally wherein the target gene is an immune modulating gene.

[0014] In another aspect, provided herein is a method of treating a subject in need thereof, the method comprising administering an engineered CCL3 promoter, heterologous construct, vector, dual expression vector, immunoresponsive cell, or pharmaceutical composition of any one of the above aspects or embodiments.

[0015] In another aspect, provided herein is a method of stimulating a cell-mediated immune response in a subject, the method comprising administering to a subject an engineered CCL3 promoter, heterologous construct, vector, dual expression vector, immunoresponsive cell, or pharmaceutical composition of any one of the above aspects or embodiments.

[0016] In another aspect, provided herein is a method of reducing tumor volume in a subject, the method comprising administering to a tumor-bearing subject a composition, engineered CCL3 promoter, heterologous construct, vector, dual expression vector, immunoresponsive cell, or pharmaceutical composition of any one of the above aspects or embodiments.

[0017] In another aspect, provided herein is a method of providing anti-tumor immunity in a subject, the method comprising administering to a subject in need thereof an engineered CCL3 promoter, heterologous construct, vector, dual expression vector, immunoresponsive cell, or pharmaceutical composition of any one of the above aspects or embodiments.

[0018] In another aspect, provided herein is a method of treating a subject having cancer, the method comprising administering to a subject in need thereof an engineered CCL3 promoter, heterologous construct, vector, dual expression vector, immunoresponsive cell, or pharmaceutical composition of any one of the above aspects or embodiments.

[0019] In another aspect, provided herein is a kit for treating and / or preventing a tumor comprising an immunoresponsive cell or pharmaceutical composition of any one of the above aspects or embodiments, optionally wherein the kit further comprises written instructions for using the immunoresponsive cell or pharmaceutical composition to treat and / or prevent a tumor in a subject. [Brief description of the drawings]

[0020] [Figure 1]FIG. 1 depicts the fold change in geometric mean fluorescence intensity (gMFI) of mKate- and YFP-expressing T cells driven by CCL3 promoter excision variants.

[0021] [Diagram 2] Figure 2A depicts mCherry (mKate) fluorescence expression in stimulated and unstimulated NK cells at 24 hours as determined by flow cytometry. Fluorescence is driven by a CCL3 promoter excision variant. Figure 2B depicts mCherry fluorescence expression in stimulated and unstimulated NK cells at 48 hours as determined by flow cytometry. Fluorescence is driven by a CCL3 promoter excision variant.

[0022] [Diagram 3] Figure 3A depicts gMFI of stimulated and unstimulated NK cells at 24 hours, with mCherry expression driven by a CCL3 promoter excision variant. Figure 3B depicts gMFI fold change following stimulation of NK cells. Figure 3C depicts stimulated NK cell gMFI plotted against unstimulated NK cell gMFI. Figure 3D depicts stimulated NK cell gMFI plotted against unstimulated NK cell gMFI, with 1682 outliers removed.

[0023] [Figure 4] Figure 4A depicts gMFI of stimulated and unstimulated NK cells at 48 hours, with mCherry expression driven by a CCL3 promoter excision variant. Figure 4B depicts gMFI fold change following stimulation of NK cells. Figure 4C depicts stimulated NK cell gMFI plotted against unstimulated NK cell gMFI. Figure 4D depicts stimulated NK cell gMFI plotted against unstimulated NK cell gMFI, with 1682 outliers removed.

[0024] [Diagram 5]Figure 5A depicts the gMFI of stimulated and unstimulated T cells with BFP expression driven by various CCL3 promoter variants, and Figure 5B depicts the gMFI fold change following stimulation of T cells.

[0025] [Figure 6] Figure 6A depicts the gMFI of stimulated and unstimulated T cells with BFP expression driven by various CCL3 promoter variants, and Figure 6B depicts the gMFI fold change following stimulation of T cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0026] Detailed Description definition Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0027] The term "ameliorating" refers to any therapeutically beneficial outcome in the treatment of a disease state, e.g., a cancer disease state, including prevention, reduction in severity or progression, remission, or cure thereof.

[0028] The term "in situ" refers to processes that occur in living cells that are grown separately from a living organism, for example, in tissue culture.

[0029] The term "in vivo" refers to a process that takes place inside a living organism.

[0030] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0031] The term "percent identity" in the context of two or more nucleic acid or polypeptide sequences refers to two or more sequences or subsequences that, when compared and aligned for maximum correspondence, have a certain percentage of the same nucleotides or amino acid residues, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those of skill in the art) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0032] For sequence comparison, typically one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the designated program parameters.

[0033] Optimal alignment of sequences for comparison can be carried out, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0034] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0035] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example an amount sufficient to modulate protein aggregation in a cell.

[0036] The term "therapeutically effective amount" is an amount effective for ameliorating symptoms of a disease. A therapeutically effective amount can be a "prophylactically effective amount" since prevention can be considered a treatment.

[0037] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0038] Engineered Nucleic Acids and Polypeptides Regulation of drug expression in cell therapy is required to hit the therapeutic efficacy window. Such a method is described herein, using regulatable transcription factors that can drive the expression of any desired effector molecule or combination of effector molecules. This system is versatile because it can regulate intracellular or membrane-bound proteins, for example, by using a modular protease system that allows for ON or OFF configuration. It can use FDA-approved protease switch drugs and can be administered via oral delivery with a good pharmacokinetic profile. The methods and compositions described herein may also be used for regulated immune-modulating effector expression, for example, in cell therapy or gene therapy. Regulatable transcription factors can be used in conjunction with, for example, CAR T cells, CAR NK cells, TCR T cells, TIL therapy, virus-specific T cells, or other suitable immune cell therapy.

[0039] CCL3 inducible promoter and truncation variants CCL3 (also known in the art as CC motif chemokine ligand, MIP-1-alpha, G0S19, LD78ALPHA, SCYA3, small inducible cytokine A3 (homologous to mouse Mip-1a), macrophage inflammatory protein 1-alpha, tonsillar lymphocyte LD78 alpha protein, G0 / G1 switch regulatory protein 19-1, CC motif chemokine 3, PAT 464.1, SIS-beta, MIP1A, chemokine (CC motif) ligand 3, and small inducible cytokine A3) is a small inducible cytokine. Since the CCL3 promoter is inducible upon stimulation with immune cell activation signals, it can be a tool for regulating the expression of effector molecules. As used herein, "immune cell activation signals" refers to the association of proteins and / or protein complexes sufficient to stimulate an immune response determined by activation of the CCL3 promoter, including, but not limited to, CD3 and 4-1BB, CD3 and CD28, etc. In certain embodiments, the immune cell activation signal comprises CD3 and CD28. In certain embodiments, the immune cell activation signal comprises CD3 and 4-1BB. In certain embodiments, the immune cell activation signal comprises a cell that comprises the protein, e.g., a Huh7 cell.

[0040] The CCL3 promoter is greater than about 2000 base pairs in length. In some embodiments, the CCL3 promoter comprises an excision of a series of consecutive nucleotides (referred to as a "nucleotide motif") in the promoter. As used herein, "excision" can refer to a deletion using any means of nucleotide deletion known in the art (e.g., molecular cloning, CRISPR, etc.), or a substitution (i.e., nucleotide substitution) in which at least one nucleotide is replaced with at least one other nucleotide. In some embodiments, the excision of the nucleotide motif increases the inducibility of the CCL3 promoter (e.g., transcription levels downstream of the promoter after stimulation), where the increased inducibility is compared to the wild-type CCL3 promoter. Methods for quantifying transcription levels are known in the art, including, for example, but not limited to, mRNA analysis by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR), fluorescent reporters, colorimetric reporters, and the like. In some embodiments, ablation increases inducibility by at least 0.5-fold, at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, or at least 8-fold. It is contemplated herein that changes in inducibility of the CCL3 promoter may depend on the test system, e.g., the cell type containing the promoter.

[0041] In some embodiments, the excision comprises the substitution of a second nucleotide motif at the site of the excision. In some embodiments, the introduction of the second nucleotide motif at the site of the excision does not introduce a new regulatory site (e.g., a transcription factor binding site) in the CCL3 promoter. Such CCL3 promoters that comprise a deletion or substitution of a nucleotide motif at the site of the excision are referred to herein as "excision variants."

[0042] The sequences of exemplary CCL3 promoter excision variants are provided below in Table 1. The sequences of the wild-type excision motif and the second nucleotide motif used for replacement of the same excision variant are provided in Table 2.

[0043] Table 1. DNA sequences of CCL3 promoter truncation variants TIFF2024546926000002.tif195166TIFF2024546926000003.tif239166TIFF2024546926000004.tif239166TIFF2024546926000005.tif239166TIFF2024546926000006.tif239166TIFF2024546926000007.tif239166TIFF2024546926000008.tif239166TIFF2024546926000009.tif239166TIFF2024546926000010.tif239166TIFF2024546926000011.tif239166TIFF2024546926000012.tif234166TIFF2024546926000013.tif234166TIFF2024546926000014.tif234166TIFF2024546926000015.tif234166TIFF2024546926000016.tif234166TIFF2024546926000017.tif234166TIFF2024546926000018.tif234166TIFF2024546926000019.tif234166TIFF2024546926000020.tif234166TIFF2024546926000021.tif234166TIFF2024546926000022.tif234166TIFF2024546926000023.tif234166TIFF2024546926000024.tif234166TIFF2024546926000025.tif234166TIFF2024546926000026.tif234166TIFF2024546926000027.tif234166TIFF2024546926000028.tif234166TIFF2024546926000029.tif234166TIFF2024546926000030.tif234166TIFF2024546926000031.tif234166TIFF2024546926000032.tif234166TIFF2024546926000033.tif234166TIFF2024546926000034.tif234166TIFF2024546926000035.tif234166TIFF2024546926000036.tif234166TIFF2024546926000037.tif234166TIFF2024546926000038.tif234166TIFF2024546926000039.tif234166TIFF2024546926000040.tif238166TIFF2024546926000041.tif239166TIFF2024546926000042.tif239166TIFF2024546926000043.tif239166TIFF2024546926000044.tif239166TIFF2024546926000045.tif239166TIFF2024546926000046.tif239166TIFF2024546926000047.tif239166TIFF2024546926000048.tif239166TIFF2024546926000049.tif239166TIFF2024546926000050.tif239166TIFF2024546926000051.tif239166TIFF2024546926000052.tif239166TIFF2024546926000053.tif239166TIFF2024546926000054.tif239166TIFF2024546926000055.tif239166TIFF2024546926000056.tif239166TIFF2024546926000057.tif239166TIFF2024546926000058.tif239166TIFF2024546926000059.tif239166TIFF2024546926000060.tif239166TIFF2024546926000061.tif239166TIFF2024546926000062.tif239166TIFF2024546926000063.tif239166TIFF2024546926000064.tif239166TIFF2024546926000065.tif239166TIFF2024546926000066.tif239166TIFF2024546926000067.tif239166TIFF2024546926000068.tif239166TIFF2024546926000069.tif239166TIFF202 4546926000070.tif239166TIFF2024546926000071.tif239166TIFF2024546926000072.ti f239166TIFF2024546926000073.tif239166TIFF2024546926000074.tif239166TIFF20245 46926000075.tif239166TIFF2024546926000076.tif239166TIFF2024546926000077.tif23 9166TIFF2024546926000078.tif239166TIFF2024546926000079.tif239166TIFF20245469 26000080.tif239166TIFF2024546926000081.tif234166TIFF2024546926000082.tif2391 66TIFF2024546926000083.tif239166TIFF2024546926000084.tif239166TIFF2024546926 000085.tif238166TIFF2024546926000086.tif233166TIFF2024546926000087.tif146166.

[0044] Table 2: DNA sequences of the wild-type excision motif and the second nucleotide motif for the CCL3 excision variants with the substitutions described in Table 1 above TIFF2024546926000088.tif55166TIFF2024546926000089.tif236166TIFF2024546926000090.tif214166TIFF2024546926000091.tif207166 TIFF2024546926000092.tif221166TIFF2024546926000093.tif236166TIFF2024546926000094.tif207166TIFF2024546926000095.tif207166

[0045] In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least two nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least three nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least four nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least five nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least six nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least seven nucleotide motifs relative to SEQ ID NO: 132s. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least eight nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of at least nine nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of ten or more nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the nucleotide motif is selected from Table 2. In certain embodiments, the CCL3 promoter of the disclosure comprises all of the nucleotide motifs from Table 2, e.g., truncations and substitutions of SEQ ID NO:169.

[0046] In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of two nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of three nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of four nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of five nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of six nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of seven nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of eight nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of nine nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of ten nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 11 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 12 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 13 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 14 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 15 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 16 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise an excision of 17 nucleotide motifs relative to SEQ ID NO: 132.In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of 18 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of 19 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of 20 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may comprise a truncation of more than 20 nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the nucleotide motif is selected from Table 2.

[0047] In some embodiments, the CCL3 promoter comprises at least one nucleotide motif. In some embodiments, the CCL3 promoter comprises at least two nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least three nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least four nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least five nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least six nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least seven nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least eight nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least nine nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least ten nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least eleven nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least twelve nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least thirteen nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least fourteen nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least fifteen nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least 16 nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least 17 nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least 18 nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least 19 nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least 20 nucleotide motifs. In some embodiments, the nucleotide motifs are selected from Table 2.

[0048] In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 133. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 134. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 135. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 136. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 137. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 138. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 139. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 140. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 141. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 142. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 143. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 144. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 145. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 146. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 147. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 148. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 149. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 150.In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 151. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 152. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 153. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 154. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 155. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 156. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 157. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 158. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 159. In some embodiments, the CCL3 promoter excision variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 160. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 161. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 162. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 163. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 164. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 165. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 166. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 167. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises the nucleotide sequence of SEQ ID NO: 168.In some embodiments, the CCL3 promoter truncation variant of the disclosure comprises the nucleotide sequence of SEQ ID NO: 169. In certain embodiments, the engineered CCL3 promoter of the disclosure further comprises GGACAGAATTCCAAAGGCATGGTCGCACTTGGCTTCTGTCCTCTGTTATTCTCCAGCATCAAATGTATCAACTCTAACCCCTTTG (SEQ ID NO: 5) at the 5' end.

[0049] In some embodiments, the CCL3 promoter truncation variant of the present disclosure does not include a substitution at the truncation. In some embodiments, the CCL3 promoter truncation variant comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the CCL3 promoter truncation variant of the present disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3. In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4. In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:242.In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 243. In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 244. In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 245. In some embodiments, a CCL3 promoter truncation variant of the disclosure comprises a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 246.

[0050] In some embodiments, the CCL3 promoter or CCL3 promoter truncation variant described above may be operably linked to a nucleotide sequence encoding a polypeptide, such as an effector molecule described herein.

[0051] Non-CCL3 engineered nucleic acids In another aspect, provided herein is an engineered nucleic acid comprising: a first expression cassette comprising a first promoter and a first exogenous polynucleotide sequence encoding an activation condition-controlled polypeptide (ACP) and / or an antigen recognition receptor, wherein the first promoter is operably linked to the first exogenous polynucleotide; and an activation condition-controlled polypeptide-responsive (ACP-responsive) promoter and a first exogenous polynucleotide sequence encoding an antigen recognition receptor, wherein the first promoter is operably linked to the first exogenous polynucleotide; X wherein E comprises a polynucleotide sequence encoding an effector molecule, L comprises a linker polynucleotide sequence, and X=1-20, wherein an ACP responsive promoter is operably linked to the second exogenous polynucleotide, wherein for a first repeat of the (LE) unit, L is absent, and optionally, wherein the ACP is capable of inducing expression of the first expression cassette by binding to the ACP responsive promoter. In some embodiments, the ACP comprises a drug inducible domain, such as a tetracycline responsive domain (e.g., TetR domain) or an inhibitory protease domain (e.g., NS3 protease). In some embodiments, the ACP is a transcriptional modulator, such as a zinc finger protein. In some embodiments, the ACP is a small molecule (e.g., drug) inducible peptide. In certain embodiments, the ACP is coupled to a promoter, such as an alternative promoter for a CCL3 variant described herein. Exemplary promoters are known in the art.

[0052] Multicistronic and multipromoter systems In some embodiments, the engineered nucleic acid is configured to produce different effector molecules, for example, the nucleic acid may be configured to produce between 2 and 20 different effector molecules.In some embodiments, the nucleic acid is 2-20, 2-19, 2-18, 2-17, 2-16, 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-20, 3-19, 3-18, 3-17, 3-16, 3-15, 3-14, 3-13, 3-12, 3-11, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-20, 4-19, 4-18, 4-17, 4-16, 4-15, 4-14, 4-13, 4-12, 4-11, 4-10 , 4-9, 4-8, 4-7, 4-6, 4-5, 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-20, 8-1 9, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 9-20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, 9-10, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-20, 11-19, 11-18, 11-17, 11-16, 11-15, 11-14, 11-13, 11-12, 12-20, 12-1 9, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-20, 14-19, 14-18, 14-17, 14-16, 14-15, 15-20, 15-19, 15-18, 15-17, 15-16, 16-20, 16-19, 16-18, 16-17, 17-20, 17-19, 17-18, 18-20, 18-19, or 19-20 effector molecules.In some embodiments, the nucleic acid is configured to produce 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 effector molecules.

[0053] In some embodiments, the engineered nucleic acid can be multicistronic, i.e., two or more separate polypeptides (e.g., multiple exogenous polynucleotides or effector molecules) can be produced from a single transcription product. The engineered nucleic acid can be multicistronic through the use of various linkers, for example, a polynucleotide sequence encoding a first exogenous polynucleotide or effector molecule can be linked to a nucleotide sequence encoding a second exogenous polynucleotide or effector molecule, e.g., in a 5' to 3' direction: first gene: linker: second gene, etc. The linker polynucleotide sequence can encode a 2A ribosomal skipping element, such as T2A. Other 2A ribosomal skipping elements include, but are not limited to, E2A, P2A, and F2A. The 2A ribosomal skipping element allows for the production of separate polypeptides encoded by the first and second genes during translation. The linker can encode a cleavable linker polypeptide sequence, such as a furin cleavage site or a TEV cleavage site, and following expression, the cleavable linker polypeptide is cleaved such that separate polypeptides encoded by the first and second genes are produced. The cleavable linker can include a polypeptide sequence that further facilitates cleavage, such as a flexible linker (e.g., a Gly-Ser-Gly sequence).

[0054] In some embodiments, the second expression cassette comprises 1 -E) X If it contains two or more units of L 1 The linker polynucleotide sequence operably links the translation of each effector molecule as a separate polypeptide.

[0055] The linker can encode an internal ribosome entry site (IRES) such that separate polypeptides encoded by the first and second genes are produced during translation. The linker can encode a splice acceptor, such as a viral splice acceptor.

[0056] The linker may be a combination of linkers, such as a furin-2A linker, that can produce separate polypeptides through 2A ribosomal skipping followed by further cleavage of the furin site, allowing complete removal of the 2A residue. In some embodiments, the linker combination may include a furin sequence, a flexible linker, and a 2A linker. Thus, in some embodiments, the linker is a furin-Gly-Ser-Gly-2A fusion polypeptide. In some embodiments, the linker is a furin-Gly-Ser-Gly-T2A fusion polypeptide.

[0057] Generally, a multicistronic system can express any number of genes or portions thereof using any number or combination of linkers (e.g., an engineered nucleic acid can encode a first, second, and third effector molecule, each separated by a linker, such that separate polypeptides encoded by the first, second, and third effector molecules are produced).

[0058] As used herein, a "linker" may refer to a polypeptide that links a first polypeptide sequence and a second polypeptide sequence, or to a multicistronic linker as described above.

[0059] Effector molecules Any suitable effector molecule known in the art can be encoded by the engineered nucleic acid or expressed by the engineered cell. Suitable effector molecules can be grouped into therapeutic classes based on structural similarity, sequence similarity, or function. Therapeutic classes of effector molecules include, but are not limited to, cytokines, chemokines, homing molecules, growth factors, coactivation molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, polynucleotides, peptides, and enzymes.

[0060] In some embodiments, each effector molecule is independently selected from a therapeutic class, where the therapeutic class is selected from the following: cytokines, chemokines, homing molecules, growth factors, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, polynucleotides, peptides, and enzymes.

[0061] In some embodiments, each effector molecule is independently selected from a therapeutic class, where the therapeutic class is selected from the following: cytokines, chemokines, homing molecules, growth factors, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides, and enzymes.

[0062] In some embodiments, the effector molecule is a chemokine. Chemokines are small cytokines or signaling proteins secreted by cells that can induce directional chemotaxis in cells. Chemokines can be classified into four main subfamilies: CXC, CC, CX3C, and XC, all of which exert their biological effect by selectively binding to chemokine receptors located on the surface of target cells. Non-limiting examples of chemokines that can be encoded by the engineered nucleic acids of the present disclosure include: CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and XCL1, any combination thereof. In some embodiments, the chemokine is selected from: CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and XCL1.

[0063] In some embodiments, the effector molecule is a cytokine. Non-limiting examples of cytokines that may be encoded by the engineered nucleic acids of the present disclosure include: IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha, or any combination thereof. In some embodiments, the cytokine is selected from: IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha.

[0064] In some embodiments, the engineered nucleic acid is configured to produce at least one homing molecule. "Homing" refers to the active navigation (migration) of a cell to a target site (e.g., a cell, a tissue (e.g., a tumor), or an organ). A "homing molecule" refers to a molecule that directs a cell to a target site. In some embodiments, a homing molecule functions to recognize and / or initiate interaction of the engineered cell to a target site. Non-limiting examples of homing molecules include CXCR1, CCR9, CXCR2, CXCR3, CXCR4, CCR2, CCR4, FPR2, VEGFR, IL6R, CXCR1, CSCR7, PDGFR, anti-integrin alpha 4, beta 7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15, or any combination thereof. In some embodiments, the homing molecule is selected from: anti-integrin alpha 4, beta 7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15.

[0065] In some embodiments, the engineered nucleic acid is configured to produce at least one growth factor. Suitable growth factors for use as effector molecules include, but are not limited to, FLT3L and GM-CSF, or any combination thereof. In some embodiments, the growth factor is selected from: FLT3L and GM-CSF.

[0066] In some embodiments, the engineered nucleic acid is configured to produce at least one co-activator molecule. Suitable co-activator molecules for use as effector molecules include, but are not limited to, c-Jun, 4-1BBL, and CD40L, or any combination thereof. In some embodiments, the co-activator molecule is selected from the following: c-Jun, 4-1BBL, and CD40L.

[0067] "Tumor microenvironment" refers to the cellular environment in which a tumor resides, including the surrounding blood vessels, immune cells, fibroblasts, bone marrow-derived inflammatory cells, lymphocytes, signaling molecules, and extracellular matrix (ECM) (see, e.g., Pattabiraman, DR & Weinberg, R Anature Reviews Drug Discovery 13, 497-512 (2014); Balkwill, FR et al. J Cell Sci 125, 5591-5596, 2012; and Li, H. et al. J Cell Biochem 101 (4), 805-15, 2007). Suitable tumor microenvironment modifiers for use as effector molecules include, but are not limited to, adenosine deaminase, TGF beta inhibitors, immune checkpoint inhibitors, VEGF inhibitors, and HPGE2, or any combination thereof. In some embodiments, the tumor microenvironment modifier is selected from the following: adenosine deaminase, TGF beta inhibitors, immune checkpoint inhibitors, VEGF inhibitors, and HPGE2.

[0068] In some embodiments, the engineered nucleic acid is configured to produce at least one TGF beta inhibitor. Suitable TGF beta inhibitors for use as effector molecules include, but are not limited to, anti-TGF beta peptides, anti-TGF beta antibodies, TGFb-TRAP, or combinations thereof. In some embodiments, the TGF beta inhibitor is selected from: anti-TGF beta peptides, anti-TGF beta antibodies, TGFb-TRAP, and combinations thereof.

[0069] In some embodiments, the engineered nucleic acid is configured to produce at least one immune checkpoint inhibitor. Suitable immune checkpoint inhibitors for use as effector molecules include, but are not limited to, an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, an anti-TIGIT antibody, an anti-VISTA antibody, an anti-KIR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-HVEM antibody, an anti-BTLA antibody, an anti-GAL9 antibody, an anti-A2AR antibody, an anti-phosphatidylserine antibody, an anti-CD27 antibody, an anti-TNFa antibody, an anti-TREM1 antibody, and an anti-TREM2 antibody, or any combination thereof. In some embodiments, the immune checkpoint inhibitor is selected from: an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, an anti-TIGIT antibody, an anti-VISTA antibody, an anti-KIR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-HVEM antibody, an anti-BTLA antibody, an anti-GAL9 antibody, an anti-A2AR antibody, an anti-phosphatidylserine antibody, an anti-CD27 antibody, an anti-TNFa antibody, an anti-TREM1 antibody, and an anti-TREM2 antibody.

[0070] Illustrative immune checkpoint inhibitors include pembrolizumab (anti-PD-1; MK-3475 / Keytruda® - Merck), nivolumab (anti-PD-1; Opdivo® - BMS), pidilizumab (anti-PD-1 antibody; CT-011 - Teva / CureTech), AMP224 (anti-PD-1; NCI), avelumab (anti-PD-L1; Bavencio® - Pfizer), durvalumab (anti-PD-L1; MEDI4736 / Imf inzi®-Medimmune / AstraZeneca), atezolizumab (anti-PD-L1; Tecentriq®-Roche / Genentech), BMS-936559 (anti-PD-L1-BMS), tremelimumab (anti-CTLA-4; Mediimmune / AstraZeneca), ipilimumab (anti-CTLA-4; Yervoy®-BMS), lirilumab (anti-KIR; BMS), and monalizumab (anti-NKG2A; Innate Pharma / AstraZeneca).

[0071] In some embodiments, the engineered nucleic acid is configured to produce at least one VEGF inhibitor. Suitable VEGF inhibitors for use as effector molecules include, but are not limited to, anti-VEGF antibodies, anti-VEGF peptides, or combinations thereof. In some embodiments, the VEGF inhibitor comprises an anti-VEGF antibody, an anti-VEGF peptide, or a combination thereof.

[0072] In some embodiments, each effector molecule is a human-derived effector molecule.

[0073] Secretion signal Typically, one or more effector molecules contain a secretory signal peptide (also referred to as a signal peptide or signal sequence) at the N-terminus of the effector molecule, which directs newly synthesized proteins destined for secretion or membrane insertion into the appropriate protein processing pathway. In embodiments involving two or more effector molecules, each effector molecule can contain a secretory signal (S). In embodiments involving two or more effector molecules, each effector molecule can contain a secretory signal, allowing each effector molecule to be secreted from the engineered cell. In embodiments, (LE) X The second expression cassette further comprises a polynucleotide sequence encoding a secretory signal peptide (S). In an embodiment, for each X, the corresponding secretory signal peptide is operably associated with an effector molecule. In an embodiment, the second expression cassette comprises an ACP responsive promoter and a polypeptide of the formula: (LSE) X and a second exogenous polynucleotide sequence having the following structure:

[0074] The secretory signal peptide operably associated with the effector molecule can be a native secretory signal peptide (e.g., a secretory signal peptide typically endogenously associated with a given effector molecule). The secretory signal peptide operably associated with the effector molecule can be a non-native secretory signal peptide. The non-native secretory signal peptide can facilitate improved expression and function, such as sustained secretion, in a particular environment, such as a tumor microenvironment. Non-limiting examples of non-native secretory signal peptides are shown in Table 3.

[0075] Table 3. Exemplary signal secretion peptides TIFF2024546926000096.tif91159TIFF2024546926000097.tif231159TIFF2024546926000098.tif128159

[0076] Antigen Recognition Receptor Certain aspects of the present disclosure relate to engineered nucleic acids comprising an antigen recognition receptor. In some embodiments, the engineered nucleic acid of the present disclosure comprises a first expression cassette further comprising an antigen recognition receptor. In some embodiments, the first expression cassette comprises a polynucleotide sequence encoding an antigen recognition receptor operably linked to a first exogenous polynucleotide sequence encoding an ACP and to a first promoter. Suitable antigen recognition receptors for use as effector molecules include, but are not limited to, 5T4, ADAM9, AFP, AXL, B7-H3, B7-H4, B7-H6, C4.4, CA6, cadherin 3, cadherin 6, CCR4, CD123, CD133, CD138, CD142, CD166, CD25, CD30, CD352, CD37, CD38, CD44, CD56, CD66e, CD70, CD71, CD74, CD79b, CD80, CEA, CEACAM5, claudin 18.2, cMet, CSPG4, CTLA, DLK1, DLL3, DR5, EGFR, ENPP3, EpCAM, EphA2, EphrinA4, ETBR, FGFR2, FGFR3, FR alpha, FRb, GCC, GD2, GFRa4, gpA33, GPC3, gpNBM, GPRC5, HER2, IL-13R, IL-13Ra, IL-13Ra2, IL- 8, IL-15, IL1RAP, integrin aV, KIT, L1CAM, LAMP1, Lewis Y, LeY, LIV-1, LRRC, LY6E, MCSP, mesothelin (MSLN), MUC1, MUC16, MUC1C, NaPi2B, Nectin 4, NKG2D, NOTCH3, NY The antigens recognized include ESO 1, Oberlin, P-cadherin, pan-Erb2, PSCA, PSMA, PTK7, ROR1, SAures, SCT, SLAMF7, SLITRK6, SSTR2, STEAP1, survivin, TDGF1, TIM1, TROP2, and WT1, or combinations thereof.

[0077] In some embodiments, the antigen recognition receptor recognizes an antigen selected from the following: 5T4, ADAM9, AFP, AXL, B7-H3, B7-H4, B7-H6, C4.4, CA6, cadherin 3, cadherin 6, CCR4, CD123, CD133, CD138, CD142, CD166, CD25, CD30, CD352, CD37, CD38, CD44, CD56, CD66e, CD70, CD71, CD74, CD79b, CD80, CEA, CEACAM5, claudin 18.2, cMet, CSPG4, CTLA, DLK1, DLL3, DR 5, EGFR, ENPP3, EpCAM, EphA2, EphrinA4, ETBR, FGFR2, FGFR3, FR alpha, FRb, GCC, GD2, GFRa4, gpA33, GPC3, gpNBM, GPRC5, HER2, IL-13R, IL-13Ra, IL-13Ra2 , IL-8, IL-15, IL1RAP, Integrin aV, KIT, L1CAM, LAMP1, Lewis Y, LeY, LIV-1, LRRC, LY6E, MCSP, Mesothelin, MUC1, MUC16, MUC1C, NaPi2B, Nectin 4, NKG2D, NOTCH3, NY ESO-1, Oberlin, P-cadherin, pan-Erb2, PSCA, PSMA, PTK7, ROR1, S Aures, SCT, SLAMF7, SLITRK6, SSTR2, STEAP1, survivin, TDGF1, TIM1, TROP2, and WT1.

[0078] In some embodiments, the first expression cassette further comprises a linker polynucleotide sequence located between the ACP and the antigen recognition receptor.

[0079] In some embodiments, the antigen recognition receptor comprises an antigen binding domain. In some embodiments, the antigen binding domain comprises an antibody, an antigen binding fragment of an antibody, a F(ab) fragment, a F(ab') fragment, a single chain variable fragment (scFv), or a single domain antibody (sdAb). In some embodiments, the antigen binding domain comprises a single chain variable fragment (scFv). In some embodiments, the scFv comprises a heavy chain variable domain (VH) and a light chain variable domain (VL). In some embodiments, the VH and VL are separated by a peptide linker.

[0080] An scFv has a variable domain of a light chain (VL) connected from its C-terminus by a polypeptide chain to the N-terminus of the variable domain of a heavy chain (VH). Alternatively, an scFv comprises a polypeptide chain connected at the C-terminus of the VH to the N-terminus of the VL by a polypeptide chain. In some embodiments, an scFv comprises the structure VH-L-VL or VL-L-VH, where VH is a heavy chain variable domain, L is a peptide linker, and VL is a light chain variable domain.

[0081] An sdAb is a molecule in which one variable domain of an antibody specifically binds to an antigen, without the presence of other variable domains.

[0082] F(ab) fragments contain the constant domain of the light chain (CL) and the first constant domain of the heavy chain (CH1), together with the variable domains of the light and heavy chains VL and VH, respectively. F(ab)' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region. 2 The fragment contains two Fab' fragments linked by a disulfide bond near the hinge region.

[0083] In some embodiments, the antigen-recognizing receptor is a chimeric antigen receptor (CAR) or a T cell receptor (TCR). In some embodiments, the antigen-recognizing receptor is a CAR. In some embodiments, the CAR comprises one or more intracellular signaling domains, and the one or more intracellular signaling domains are selected from the following: CD3 zeta chain intracellular signaling domain, CD97 intracellular signaling domain, CD11a-CD18 intracellular signaling domain, CD2 intracellular signaling domain, ICOS intracellular signaling domain, CD27 intracellular signaling domain, CD154 intracellular signaling domain, CD8 intracellular signaling domain, OX40 intracellular signaling domain, 4-1BB intracellular signaling domain, CD28 intracellular signaling domain, ZAP40 intracellular signaling domain, CD30 intracellular signaling domain, GITR intracellular signaling domain, HVEM intracellular signaling domain, DAP10 intracellular signaling domain, DAP12 intracellular signaling domain, and MyD88 intracellular signaling domain.In some embodiments, the CAR comprises a CD3 zeta chain intracellular signaling domain and one or more additional intracellular signaling domains (e.g., costimulatory domains) selected from a CD97 intracellular signaling domain, a CD11a-CD18 intracellular signaling domain, a CD2 intracellular signaling domain, an ICOS intracellular signaling domain, a CD27 intracellular signaling domain, a CD154 intracellular signaling domain, a CD8 intracellular signaling domain, an OX40 intracellular signaling domain, a 4-1BB intracellular signaling domain, a CD28 intracellular signaling domain, a ZAP40 intracellular signaling domain, a CD30 intracellular signaling domain, a GITR intracellular signaling domain, an HVEM intracellular signaling domain, a DAP10 intracellular signaling domain, a DAP12 intracellular signaling domain, a MyD88 intracellular signaling domain, a 2B4 intracellular signaling domain, a CD16a intracellular signaling domain, a DNAM-1 intracellular signaling domain, a KIR2DS1 intracellular signaling domain, a KIR3DS1 intracellular signaling domain, a NKp44 intracellular signaling domain, a NKp46 intracellular signaling domain, an FceRlg intracellular signaling domain, a NKG2D intracellular signaling domain, and an EAT-2 intracellular signaling domain.

[0084] In some embodiments, the CAR further comprises a transmembrane domain, wherein the transmembrane domain is selected from: CD8 transmembrane domain, CD28 transmembrane domain, CD3 zeta chain transmembrane domain, CD4 transmembrane domain, 4-1BB transmembrane domain, OX40 transmembrane domain, ICOS transmembrane domain, CTLA-4 transmembrane domain, PD-1 transmembrane domain, LAG-3 transmembrane domain, 2B4 transmembrane domain, BTLA transmembrane domain, OX40 transmembrane domain, DAP10 transmembrane domain, DAP12 transmembrane domain, CD16a transmembrane domain, DNAM-1 transmembrane domain, KIR2DS1 transmembrane domain, KIR3DS1 transmembrane domain, NKp44 transmembrane domain, NKp46 transmembrane domain, FceRlg transmembrane domain, and NKG2D transmembrane domain.

[0085] In some embodiments, the CAR further comprises a spacer region (e.g., a hinge domain) between the antigen binding domain and the transmembrane domain. A spacer domain or hinge domain is any oligopeptide or polypeptide that functions to link a transmembrane domain to an extracellular domain and / or an intracellular signaling domain in a polypeptide chain. The spacer domain or hinge domain provides flexibility to the inhibitory chimeric receptor or tumor-targeting chimeric receptor or domains thereof or prevents steric hindrance of the inhibitory chimeric receptor or tumor-targeting chimeric receptor or domains thereof. In some embodiments, the spacer domain or hinge domain can comprise up to 300 amino acids (e.g., 10-100 amino acids, or 5-20 amino acids). In some embodiments, one or more spacer domains can be included in other regions of the inhibitory chimeric receptor or tumor-targeting chimeric receptor.

[0086] Exemplary spacer or hinge domains may include, but are not limited to, an IgG domain (such as an IgG1 hinge, an IgG2 hinge, an IgG3 hinge, or an IgG4 hinge), an IgD hinge domain, a CD8α hinge domain, and a CD28 hinge domain. In some embodiments, the spacer or hinge domain is an IgG domain, an IgD domain, a CD8α hinge domain, or a CD28 hinge domain.

[0087] Exemplary spacer or hinge domain protein sequences are shown in Table 4. Exemplary spacer or hinge domain nucleotide sequences are shown in Table 5.

[0088] (Table 4) TIFF2024546926000099.tif113164

[0089] (Table 5) TIFF2024546926000100.tif168163

[0090] Suitable transmembrane domains, spacer or hinge domains, and intracellular domains for use in CARs are generally described in Stoiber et al, Cells 2019, 8(5), 472; Guedan et al, Mol Therapy: Met&Clinic Dev, 2019 12:145-156; and Sadelain et al, Cancer Discov; 2013, 3(4); 388-98, each of which is hereby incorporated by reference in their entirety.

[0091] In some embodiments, the CAR further comprises a secretory signal peptide. Any suitable secretory signal peptide of the present disclosure may be used.

[0092] Post-transcriptional regulatory elements In some embodiments, the engineered nucleic acid of the present disclosure comprises a post-transcriptional regulatory element (PRE). A PRE can enhance gene expression by enabling tertiary RNA structure stability and 3' end formation. Non-limiting examples of PREs include Hepatitis B virus PRE (HPRE) and Woodchuck Hepatitis virus PRE (WPRE). In some embodiments, the post-transcriptional regulatory element is a Woodchuck Hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, a WPRE comprises the alpha, beta, and gamma components of a WPRE element. In some embodiments, a WPRE comprises the alpha component of a WPRE element.

[0093] Immunoresponsive cells Certain aspects of the present disclosure relate to cells, such as immunoresponsive cells, that have been genetically engineered to contain one or more chimeric receptors of the present disclosure or one or more polynucleotides encoding such chimeric receptors, and to methods of using such cells to treat solid tumors.

[0094] In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a primary cell. In some embodiments, the mammalian cell is a cell line. In some embodiments, the mammalian cell is a bone marrow cell, a blood cell, a skin cell, a bone cell, a muscle cell, a neuronal cell, an adipocyte, a liver cell, or a cardiac cell. In some embodiments, the cell is a stem cell. Exemplary stem cells include, but are not limited to, embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), adult stem cells, and tissue-specific stem cells, such as hematopoietic stem cells (blood stem cells), mesenchymal stem cells (MSCs), neural stem cells, epithelial stem cells, or skin stem cells. In some embodiments, the cell is a cell derived from or differentiated from a stem cell of the present disclosure. In some embodiments, the cell is an immune cell. The immune cells of the present disclosure can be isolated or differentiated from a stem cell of the present disclosure (e.g., from an ESC or an iPSC). Exemplary immune cells include, but are not limited to, T cells (e.g., helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, alpha beta T cells, and gamma delta T cells), B cells, natural killer (NK) cells, dendritic cells, myeloid cells, macrophages, and monocytes. In some embodiments, the cell is a neuronal cell. Neuronal cells of the present disclosure can be isolated or differentiated from stem cells of the present disclosure (e.g., from ESCs or iPSCs). Exemplary neuronal cells include, but are not limited to, neural progenitor cells, neurons (e.g., sensory neurons, motor neurons, cholinergic neurons, GABAergic neurons, glutamatergic neurons, dopaminergic neurons, or serotonergic neurons), astrocytes, oligodendrocytes, and microglia.

[0095] In some embodiments, the cell is an immunoresponsive cell. The immunoresponsive cells of the present disclosure can be isolated or differentiated from stem cells of the present disclosure (e.g., from ESCs or iPSCs). Exemplary immunoresponsive cells of the present disclosure include, but are not limited to, cells of the lymphoid lineage. The lymphoid lineage, including B cells, T cells, and natural killer (NK) cells, provide for the production of antibodies, regulation of the cellular immune system, detection of foreign substances in the blood, detection of cells foreign to the host, and the like. Examples of immunoresponsive cells of the lymphoid lineage include, but are not limited to, T cells, natural killer (NK) cells, embryonic stem cells, pluripotent stem cells, and induced pluripotent stem cells (e.g., from which lymphocytes can be derived or differentiated). T cells mature in the thymus and can be lymphocytes primarily responsible for cell-mediated immunity. T cells are involved in the adaptive immune system. In some embodiments, the T cells of the present disclosure can be any type of T cell, including, but not limited to, T helper cells, cytotoxic T cells, memory T cells (central memory T cells, stem cell-like memory T cells (or stem-like memory T cells), as well as two types of effector memory T cells, e.g., T EM Cells and T EMRA These include T cells, regulatory T cells (also known as suppressor T cells), natural killer T cells, mucosal-associated invariant T cells, and γδ T cells. Cytotoxic T cells (CTLs or killer T cells) are a subset of T lymphocytes capable of inducing the death of infected somatic or tumor cells. A patient's own T cells can be genetically modified to target specific antigens through the introduction of one or more chimeric receptors, such as chimeric TCRs or CARs.

[0096] Natural killer (NK) cells are lymphocytes that are part of cell-mediated immunity and act during the innate immune response. NK cells do not require prior activation to exert their cytotoxic effect on target cells.

[0097] In some embodiments, the immunoresponsive cells of the present disclosure are T cells. The T cells of the present disclosure can be autologous, allogeneic, or derived in vitro from engineered progenitor or stem cells.

[0098] In some embodiments, the immunoresponsive cells of the present disclosure are universal T cells with defective TCR-αβ. Methods for generating universal T cells have been described in the art, for example, in Valton et al., Molecular Therapy (2015); 23 9, 1507-1518, and Torikai et al., Blood 2012 119:5697-5705.

[0099] In some embodiments, the immunoresponsive cells of the present disclosure are isolated immunoresponsive cells that comprise one or more chimeric receptors of the present disclosure, hi some embodiments, the immunoresponsive cells comprise one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more chimeric receptors of the present disclosure.

[0100] In some embodiments, the immunoresponsive cell is a T cell. In some embodiments, the immunoresponsive cell is a natural killer (NK) cell.

[0101] In some embodiments, the immunoresponsive cells express or are capable of expressing an immunoreceptor. An immunoreceptor is generally capable of inducing signal transduction or changes in protein expression in an immunoreceptor-expressing cell, thereby resulting in the modulation of an immune response upon binding to a cognate ligand (e.g., modulating, activating, initiating, stimulating, increasing, preventing, attenuating, inhibiting, reducing, decreasing, inhibiting, or suppressing an immune response). For example, when the CD3 chains present on a TCR / CAR cluster in response to ligand binding, a signal transduction cascade occurs via an immunoreceptor tyrosine-based activation motif (ITAM). Specifically, in certain embodiments, when an endogenous TCR, an exogenous TCR, a chimeric TCR, or a CAR (specifically an activated CAR) binds to their respective antigens, the formation of an immunological synapse occurs, which includes the clustering of many molecules (e.g., CD4 or CD8, CD3 gamma / delta / epsilon / zeta, etc.) in the vicinity of the bound receptor. This clustering of membrane-bound signaling molecules phosphorylates ITAM motifs contained within the CD3 chains, which initiates T cell activation pathways and ultimately activates transcription factors such as NF-κB and AP-1. These transcription factors can induce global gene expression in T cells to initiate T cell-mediated immune responses such as cytokine production and / or T cell-mediated killing, increasing IL-2 production for proliferation and expression of master regulator T cell proteins.

[0102] Cells expressing multiple chimeric antigen receptors In some embodiments, a cell (e.g., an immunoresponsive cell) of the disclosure comprises two or more chimeric receptors of the disclosure. In some embodiments, a cell comprises two or more chimeric receptors, where a first of the two or more chimeric receptors is an activating chimeric receptor and a second of the two or more chimeric receptors is a chimeric inhibitory receptor. In some embodiments, a cell comprises a first activating chimeric receptor and a second activating chimeric receptor. In some embodiments, a cell comprises three or more chimeric receptors, where at least one of the three or more chimeric receptors is an activating chimeric receptor. In some embodiments, a cell comprises three or more chimeric receptors, where at least one of the three or more chimeric receptors is a chimeric inhibitory receptor. In some embodiments, a cell comprises four or more chimeric receptors. In some embodiments, a cell comprises five or more chimeric receptors.

[0103] In some embodiments, each of the two or more chimeric receptors comprises a different antigen binding domain, e.g., that binds to the same antigen or to different antigens. In some embodiments, each antigen bound by the two or more chimeric receptors is expressed on the same cell, such as an epithelial cell type (e.g., the same epithelial cell type).

[0104] In embodiments in which a cell (e.g., an immunoresponsive cell) of the present disclosure expresses two or more distinct chimeric receptors, the antigen binding domain of each of the different chimeric receptors can be designed such that the antigen binding domains do not interact with one another. For example, a cell (e.g., an immunoresponsive cell) of the present disclosure that expresses a first chimeric receptor and a second chimeric receptor can include a first chimeric receptor that includes an antigen binding domain that does not form an association with the antigen binding domain of the second chimeric receptor. For example, the antigen binding domain of the first chimeric receptor can include an antibody fragment, such as an scFv, while the antigen binding domain of the second ... H It may contain H.

[0105] Without wishing to be bound by theory, it is believed that in cells having multiple chimeric membrane-embedded receptors, each comprising an antigen-binding domain, interactions between the antigen-binding domains of each receptor may be undesirable as such interactions may inhibit the ability of one or more of the antigen-binding domains to bind their cognate antigen. Thus, in embodiments in which a cell (e.g., an immunoresponsive cell) of the present disclosure expresses two or more chimeric receptors, the chimeric receptors comprise antigen-binding domains that minimize such inhibitory interactions. In one embodiment, the antigen-binding domain of one chimeric receptor comprises an scFv, and the antigen-binding domain of a second chimeric receptor comprises a single VH domain, e.g., a camel, shark, or lamprey single VH domain, or a single VH domain derived from a human or mouse sequence.

[0106] In some embodiments, when present on the surface of a cell, the binding of the antigen binding domain of the first chimeric receptor to its cognate antigen is not substantially reduced by the presence of the second chimeric receptor. In some embodiments, the binding of the antigen binding domain of the first chimeric receptor to its cognate antigen in the presence of the second chimeric receptor is 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the binding of the antigen binding domain of the first chimeric receptor to its cognate antigen in the absence of the second chimeric receptor. In some embodiments, when present on the surface of a cell, the antigen binding domains of the first chimeric receptor and the second chimeric receptor associate with each other less than when both are scFv antigen binding domains. In some embodiments, the antigen binding domains of the first chimeric receptor and the second chimeric receptor associate with each other less than when both are scFv antigen binding domains.

[0107] Costimulatory Ligands In some embodiments, the cells (e.g., immunoresponsive cells) of the present disclosure can further comprise one or more recombinant or exogenous costimulatory ligands. For example, the cells can be further transduced with one or more costimulatory ligands, such that the cells co-express or are induced to co-express one or more chimeric receptors and one or more costimulatory ligands. Without wishing to be bound by theory, it is believed that the interaction between one or more chimeric receptors and one or more costimulatory ligands can provide a non-antigen specific signal that is important for the full activation of the cells. Examples of suitable costimulatory ligands include, but are not limited to, members of the tumor necrosis factor (TNF) superfamily and immunoglobulin (Ig) superfamily ligands. TNF is a cytokine involved in systemic inflammation and stimulates the acute phase response. Its main role is in regulating immune cells. Members of the TNF superfamily share a number of common features. The majority of TNF superfamily members are synthesized as type II transmembrane proteins (extracellular C-terminus) that contain a short cytoplasmic segment and a relatively long extracellular region. Examples of suitable TNF superfamily members include, but are not limited to, nerve growth factor (NGF), CD40L (CD40L) / CD 154, CD137L / 4-1BBL, TNF-α, CD134L / OX40L / CD252, CD27L / CD70, Fas Ligand (FasL), CD30L / CD153, tumor necrosis factor beta (TNFP) / lymphotoxin-alpha (LTa), lymphotoxin-beta (LTP), CD257 / B cell activating factor (B AFF) / Bly s / THANK / Tall-1, glucocorticoid-inducible TNF receptor ligand (GITRL), and TNF-related apoptosis-inducing ligand (TRAIL), LIGHT (TNFSF 14). The immunoglobulin (Ig) superfamily is a large group of cell surface and soluble proteins involved in cell recognition, binding, or adhesion processes. These proteins share structural features with immunoglobulins and contain immunoglobulin domains (folds).Examples of suitable immunoglobulin superfamily ligands include, but are not limited to, CD80 and CD86, both of which are ligands for CD28, and PD-L1 (B7-H1), which is a ligand for PD-1. In certain embodiments, the one or more costimulatory ligands are selected from 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof.

[0108] In some embodiments, a cell (e.g., an immunoresponsive cell) of the disclosure comprises one or more recombinant or exogenous costimulatory ligands that are regulated by an engineered CCL3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1. In certain embodiments, members of the TNF superfamily (e.g., nerve growth factor (NGF), CD40L (CD40L) / CD 154, CD137L / 4-1BBL, TNF-α, CD134L / OX40L / CD252, CD27L / CD70, Fas Ligand (FasL), CD30L / CD153, tumor necrosis factor beta (TNFP) / lymphotoxin-alpha (LTa), lymphotoxin-beta (LTP), CD257 / B cell activating factor (B AFF) / Bly s / THANK / Tall-1, glucocorticoid-inducible TNF receptor ligand (GITRL), and TNF-related apoptosis-inducing ligand (TRAIL), LIGHT (TNFSF 14)) are regulated by an engineered CCL3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1. In certain embodiments, an Ig superfamily member ligand (e.g., CD80, CD86, PD-L1, and B7-H1) is regulated by an engineered CCL3 promoter described herein, such as an engineered CCL-3 promoter from Table 1. In embodiments, a costimulatory ligand (e.g., 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof) is regulated by an engineered CCL-3 promoter described herein, such as an engineered CCL-3 promoter from Table 1.

[0109] Chemokine Receptors In some embodiments, the cells (e.g., immunoresponsive cells) of the present disclosure comprise one or more chimeric receptors and may further comprise one or more chemokine receptors. For example, transgenic expression of chemokine receptors CCR2b or CXCR2 in cells, such as T cells, enhances trafficking to CCL2-secreting or CXCL1-secreting solid tumors (Craddock et al, J Immunother. 2010 Oct;33(8):780-8 and Kershaw et al. Hum Gene Ther. 2002 Nov 1;13(16):1971-80). Without wishing to be bound by theory, it is believed that the chemokine receptors expressed on the chimeric receptor-expressing cells of the present disclosure may recognize chemokines secreted by the tumor and improve targeting of the cells to the tumor, which may promote invasion of the cells into the tumor and enhance the anti-tumor effect of the cells. The chemokine receptor of the present disclosure may include naturally occurring chemokine receptors, recombinant chemokine receptors, or chemokine-binding fragments thereof. Examples of suitable chemokine receptors that may be expressed on the cells of the present disclosure include, but are not limited to, CXC chemokine receptors, such as CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, or CXCR7; CC chemokine receptors, such as CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, or CCR11; CX3C chemokine receptors, such as CX3CR1; XC chemokine receptors, such as XCR1; and chemokine-binding fragments thereof. In some embodiments, the chemokine receptors expressed on the cells are selected based on the chemokines secreted by tumors.

[0110] In some embodiments, a cell (e.g., an immunoresponsive cell) of the disclosure comprises one or more chemokine receptors regulated by an engineered CCL3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1. Examples of such chemokine receptors include, but are not limited to, CXC chemokine receptors, such as CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, or CXCR7; CC chemokine receptors, such as CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, or CCR11; CX3C chemokine receptors, such as CX3CR1; XC chemokine receptors, such as XCR1; and chemokine-binding fragments thereof. In certain embodiments, the chemokine receptor regulated by an engineered CCL3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1, is selected based on a chemokine secreted by the tumor.

[0111] Chimeric Receptor Modulation Some embodiments of the present disclosure relate to modulating one or more chimeric receptor activities of the chimeric receptor expressing cells of the present disclosure. There are several ways in which chimeric receptor activity can be modulated. In some embodiments, a regulatable chimeric receptor that can control one or more chimeric receptor activities would be desirable to optimize the safety and / or efficacy of chimeric receptor therapy. For example, inducing apoptosis using a caspase fused to a dimerization domain (see, e.g., Di et al., N Engl. J. Med. 2011 Nov. 3; 365(18): 1673-1683) can be used as a safety switch in chimeric receptor therapy. In some embodiments, the chimeric receptor-expressing cells of the present disclosure can also express inducible caspase-9 (iCaspase-9), which upon administration of a dimerizing agent, such as rimiduside (IUPAC name: [(1R)-3-(3,4-dimethoxyphenyl)-1-[3-[2-[2-[[2-[3-[(1R)-3-(3,4-dimethoxyphenyl)-1-[(2S)-1-[(2S)-2-(3,4,5-trimethoxyphenyl)butanoyl]piperidine-2-carbonyl]oxypropyl]phenoxy]acetyl]amino]ethylamino]-2-oxoethoxy]phenyl]propyl](2S)-1-[(2S)-2-(3,4,5-trimethoxyphenyl)butanoyl]piperidine-2-carboxylate), induces activation of caspase-9, resulting in apoptosis of the cells. In some embodiments, iCaspase-9 contains a binding domain that contains a chemical inducer of dimerization (CID) that mediates dimerization in the presence of the CID, resulting in inducible and selective depletion of chimeric receptor-expressing cells.

[0112] Alternatively, in some embodiments, the chimeric receptor of the present disclosure may be modulated by utilizing small molecules or antibodies that inactivate or inhibit chimeric receptor activity. For example, an antibody may delete chimeric receptor expressing cells by inducing antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, the chimeric receptor expressing cells of the present disclosure may further express an antigen that is recognized by a molecule capable of inducing cell death by ADCC or complement-induced cell death. For example, the chimeric receptor expressing cells of the present disclosure may further express a receptor that can be targeted by an antibody or antibody fragment. Examples of suitable receptors that can be targeted by an antibody or antibody fragment include, but are not limited to, EpCAM, VEGFR, integrins (e.g., ανβ3, α4, αΙ3 / 4β3, α4β7, α5β1, ανβ3, αν), members of the TNF receptor superfamily (e.g., TRAIL-R1 and TRAIL-R2), PDGF receptor, interferon receptor, folate receptor, GPNMB, ICAM-1, HLA-DR, CEA, CA-125, MUC1, TAG-72, IL-6 receptor, 5T4, GD2, GD3, CD2 , CD3, CD4, CD5, CD11, CD11a / LFA-1, CD15, CD18 / ITGB2, CD19, CD20, CD22, CD23 / IgE receptor, CD25, CD28, CD30, CD33, CD38, CD40, CD41, CD44, CD51, CD52, CD62L, CD74, CD80, CD125, CD147 / basigin, CD152 / CTLA-4, CD154 / CD40L, CD195 / CCR5, CD319 / SLAMF7, and EGFR, as well as truncated versions thereof.

[0113] In some embodiments, the chimeric receptor-expressing cells of the present disclosure may also express a truncated epidermal growth factor receptor (EGFR) that lacks signaling capability but retains an epitope recognized by a molecule capable of inducing ADCC (e.g., WO2011 / 056894).

[0114] In some embodiments, the chimeric receptor expressing cells of the present disclosure further comprise a highly expressed compact marker / suicide gene that combines target epitopes from both CD32 and CD20 antigens in the chimeric receptor expressing cells that binds to an anti-CD20 antibody (e.g., rituximab) and results in selective depletion of the chimeric receptor expressing cells by ADCC. Other methods for depleting the chimeric receptor expressing cells of the present disclosure include, but are not limited to, administration of a monoclonal anti-CD52 antibody that selectively binds and targets the chimeric receptor expressing cells for destruction by inducing ADCC. In some embodiments, the chimeric receptor expressing cells can be selectively targeted using a chimeric receptor ligand, such as an anti-idiotypic antibody. In some embodiments, the anti-idiotypic antibody can initiate effector cell activity, such as ADCC activity or ADC activity. In some embodiments, the chimeric receptor ligand can further be bound to an agent that induces cell death, such as a toxin. In some embodiments, the chimeric receptor expressing cells of the present disclosure can further express a target protein that is recognized by the cell depletion agent of the present disclosure. In some embodiments, the target protein is CD20 and the cell depletion agent is an anti-CD20 antibody. In such embodiments, the cell depletion agent is administered when it is desired to reduce or eliminate chimeric receptor-expressing cells. In some embodiments, the cell depletion agent is an anti-CD52 antibody.

[0115] In some embodiments, a regulated chimeric receptor comprises a set of polypeptides in which the components of the chimeric receptor of the present disclosure are distributed on separate polypeptides or members. For example, the set of polypeptides can include a dimerization switch that, in the presence of a dimerization molecule, can bind the polypeptides to each other to form a functional chimeric receptor.

[0116] Polynucleotide constructs encoding chimeric receptors Certain aspects of the present disclosure relate to polynucleotides (e.g., isolated polynucleotides) encoding one or more chimeric receptors of the present disclosure. In some embodiments, the polynucleotide is an RNA construct, such as a messenger RNA (mRNA) transcript or a modified RNA. In some embodiments, the polynucleotide is a DNA construct.

[0117] In some embodiments, a polynucleotide of the present disclosure encodes a chimeric receptor comprising one or more antigen binding domains, where each domain binds to a target antigen, a transmembrane domain, and one or more intracellular signaling domains. In some embodiments, a polynucleotide encodes a chimeric receptor comprising an antigen binding domain, a transmembrane domain, a primary signaling domain (e.g., a CD3-zeta domain), and one or more costimulatory signaling domains. In some embodiments, the polynucleotide further comprises a nucleic acid sequence encoding a spacer region. In some embodiments, the antigen binding domain is connected to the transmembrane domain by a spacer region. In some embodiments, the nucleic acid further comprises a nucleotide sequence encoding a leader sequence.

[0118] The polynucleotides of the present disclosure can be obtained using any suitable recombinant method known in the art, including, but not limited to, screening libraries from cells expressing the gene of interest, inducing the gene of interest from a vector known to contain the gene, or isolating the gene of interest directly from cells and tissues containing the gene using standard techniques. Alternatively, the gene of interest can be produced synthetically.

[0119] In some embodiments, the polynucleotides of the disclosure are contained within a vector. In some embodiments, the polynucleotides of the disclosure are expressed in cells via transposons, CRISPR / Cas9 systems, TALENs, or zinc finger nucleases.

[0120] In some embodiments, expression of a polynucleotide encoding a chimeric receptor of the present disclosure can be achieved by operably linking the nucleic acid to a promoter and incorporating the construct into an expression vector. Suitable vectors are capable of replicating and integrating in eukaryotic cells. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulating expression of the desired nucleic acid.

[0121] In some embodiments, the expression constructs of the present disclosure can also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols (e.g., US5399346, US5580859, and US5589466). In some embodiments, the vectors of the present disclosure are gene therapy vectors.

[0122] The polynucleotides of the present disclosure can be cloned into many types of vectors. For example, the polynucleotides can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, or cosmids. In some embodiments, the vectors can be expression vectors, replication vectors, probe generation vectors, or sequencing vectors.

[0123] In some embodiments, the plasmid vector comprises a transposon / transposase system for integrating the polynucleotides of the present disclosure into a host cell genome. Methods for expressing proteins in immune cells using transposon and transposase plasmid systems are generally described in Chicaybam L, Hum Gene Ther. 2019 Apr; 30(4): 511-522. doi: 10.1089 / hum.2018.218; and Ptackova P, Cytotherapy. 2018 Apr; 20(4): 507-520. doi: 10.1016 / j.jcyt.2017.10.001, each of which is incorporated herein by reference in their entirety. In some embodiments, the transposon system is a Sleeping Beauty transposon / transposase or a piggyBac transposon / transposase.

[0124] In some embodiments, the expression vector of the present disclosure can be provided to cells in the form of a viral vector. Suitable viral vector systems are well known in the art. For example, viral vectors can be derived from retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In some embodiments, the vector of the present disclosure is a lentiviral vector. Lentiviral vectors are suitable for long-term gene transfer, since such vectors allow long-term stable integration of transgenes and their propagation in daughter cells. Lentiviral vectors are also advantageous over vectors derived from oncoretroviruses (e.g., murine leukemia viruses) in that lentiviral vectors can transduce non-proliferating cells. In some embodiments, the vector of the present disclosure is an adenoviral vector (A5 / 35). In some embodiments, the vector of the present disclosure comprises an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., WO01 / 96584; WO01 / 29058; and US6326193). A number of virus-based systems have been developed for gene transfer into mammalian cells. A selected gene can be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to mammalian cells either in vivo or ex vivo. A number of retroviral systems are known in the art.

[0125] In some embodiments, vectors of the present disclosure include additional promoter elements, such as enhancers that regulate the frequency of transcription initiation. Enhancers are typically located in the region 30 bp to 110 bp upstream of the start site, although many promoters have been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements can be flexible so that promoter function is maintained when elements are inverted or moved relative to one another. For example, in the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decrease. Depending on the promoter, individual elements can function cooperatively or independently to activate transcription. Exemplary promoters can include, but are not limited to, the SFFV gene promoter, the EFS gene promoter, the CMV IE gene promoter, the EF1a promoter, the ubiquitin C promoter, and the phosphoglycerokinase (PGK) promoter.

[0126] In some embodiments, the promoter capable of expressing the polynucleotide of the present disclosure in mammalian cells, such as the immunoresponsive cells of the present disclosure, is EF1a promoter.Natural EF1a promoter drives the expression of the alpha subunit of the elongation factor-1 complex, which is involved in the enzymatic delivery of aminoacyl-tRNA to ribosomes.EF1a promoter is widely used in mammalian expression plasmids and has been shown to be effective in promoting chimeric receptor expression from polynucleotides cloned into lentiviral vectors.

[0127] In some embodiments, the promoter capable of expressing the polynucleotide of the present disclosure in a mammalian cell, such as an immunoresponsive cell of the present disclosure, is a constitutive promoter. For example, a suitable constitutive promoter is the spleen focus forming virus (SFFV) promoter. Another example of a suitable constitutive promoter is the immediate early cytomegalovirus (CMV) promoter. The CMV promoter is a strong constitutive promoter capable of driving high-level expression of any polynucleotide sequence operably linked to the promoter. Other suitable constitutive promoters include, but are not limited to, the ubiquitin C (UbiC) promoter, the simian virus 40 (SV40) early promoter, the mouse mammary tumor virus (MMTV) promoter, the human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, the MoMuLV promoter, the avian leukosis virus promoter, the Epstein-Barr virus immediate early promoter, the Rous sarcoma virus promoter, the actin promoter, the myosin promoter, the elongation factor 1a promoter, the hemoglobin promoter, and the creatine kinase promoter.

[0128] In some embodiments, the promoter capable of expressing a polynucleotide of the present disclosure in a mammalian cell, such as an immunoresponsive cell of the present disclosure, is an inducible promoter. The use of an inducible promoter can provide a molecular switch capable of inducing or suppressing expression of a polynucleotide of the present disclosure when the promoter is operably linked to the polynucleotide. Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0129] In some embodiments, vectors of the disclosure may further include a signal sequence to facilitate secretion, a polyadenylation signal and a transcription terminator, elements allowing episomal replication, and / or elements allowing selection.

[0130] In some embodiments, the vectors of the present disclosure may further comprise a selectable marker gene and / or a reporter gene to facilitate identification and selection of chimeric receptor expressing cells from a population of cells transduced with the vector. In some embodiments, the selectable marker may be encoded by a polynucleotide that is separate from the vector and used in the co-transfection procedure. Either the selectable marker or the reporter gene may be flanked by suitable regulatory sequences to allow expression in the host cell. Examples of selectable markers include, but are not limited to, antibiotic resistance genes, such as neo and the like.

[0131] In some embodiments, reporter genes can be used to identify transduced cells and to evaluate the functionality of regulatory sequences. As disclosed herein, a reporter gene is a gene that encodes a polypeptide that is not present or expressed in the recipient organism or tissue and whose expression results in an easily detectable property, such as an enzymatic activity. Expression of the reporter gene can be assayed at an appropriate time after the polynucleotide is introduced into the recipient cell. Examples of reporter genes include, but are not limited to, genes encoding luciferase, genes encoding beta-galactosidase, genes encoding chloramphenicol acetyltransferase, genes encoding secreted alkaline phosphatase, and genes encoding green fluorescent protein. Suitable expression systems are well known in the art and can be prepared using known techniques or obtained commercially. In some embodiments, the construct with the minimal 5' flanking region that exhibits the highest level of expression of the reporter gene is identified as the promoter. Such promoter regions can be linked to the reporter gene and used to evaluate drugs for their ability to modulate promoter-driven transcription.

[0132] In some embodiments, a vector comprising a polynucleotide sequence encoding a chimeric receptor of the present disclosure further comprises a second polynucleotide encoding a polypeptide that increases the activity of the chimeric receptor.

[0133] In embodiments in which the chimeric receptor-expressing cell comprises two or more chimeric receptors, a single polynucleotide may encode the two or more chimeric receptors under a single regulatory control element (e.g., promoter) or under separate regulatory control elements for each chimeric receptor-encoding nucleotide sequence contained in the polynucleotide. In some embodiments in which the chimeric receptor-expressing cell comprises two or more chimeric receptors, each chimeric receptor may be encoded by a separate polynucleotide. In some embodiments, each separate polynucleotide comprises its own regulatory element (e.g., promoter). In some embodiments, a single polynucleotide encodes two or more chimeric receptors, and the nucleotide sequences encoding the chimeric receptors are in the same reading frame and are expressed as a single polypeptide chain. In such embodiments, the two or more chimeric receptors may be separated by one or more peptide cleavage sites, such as an autocleavage site or a substrate for an intracellular protease. Suitable peptide cleavage sites may include, but are not limited to, a T2A peptide cleavage site, a P2A peptide cleavage site, an E2A peptide cleavage site, and an F2A peptide cleavage site. In some embodiments, two or more chimeric receptors comprise a T2A peptide cleavage site. In some embodiments, two or more chimeric receptors comprise an E2A peptide cleavage site. In some embodiments, two or more chimeric receptors comprise a T2A and an E2A peptide cleavage site.

[0134] Methods for introducing and expressing genes into cells are well known in the art. For example, in some embodiments, expression vectors can be transferred into host cells by physical, chemical, or biological means. Examples of physical means for introducing polynucleotides into host cells include, but are not limited to, calcium phosphate precipitation, lipofection, particle bombardment, microinjection, and electroporation. Examples of chemical means for introducing polynucleotides into host cells include, but are not limited to, colloidal dispersion systems, macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Examples of biological means for introducing polynucleotides into host cells include, but are not limited to, the use of DNA and RNA vectors.

[0135] In some embodiments, liposomes may be used as a non-viral delivery system for introducing the disclosed polynucleotides or vectors into host cells in vitro, ex vivo, or in vivo. In some embodiments, polynucleotides may be associated with lipids, for example, by being encapsulated in the aqueous interior of liposomes, interspersed within the lipid bilayer of liposomes, attached to liposomes via a linking molecule associated with both liposomes and polynucleotides, entrapped in liposomes, complexed with liposomes, dispersed in a solution containing lipids, mixed with lipids, combined with lipids, contained as a suspension in lipids, contained or complexed with micelles, or otherwise associated with lipids. As disclosed herein, lipid-associated polynucleotide or vector compositions are not limited to any particular structure in solution. In some embodiments, such compositions may exist as micelles or in bilayer structures with a "collapsed" structure. Such compositions may also be interspersed in solution to form aggregates that are not uniform in size or shape. As disclosed herein, lipids are fatty substances that can be naturally occurring or synthetic. In some embodiments, lipids can include lipid droplets naturally occurring in the cytoplasm, or a class of compounds including long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, aminoalcohols, and aldehydes. Suitable lipids may be obtained from commercial sources, including, but not limited to, dimyristyl phosphatidylcholine ("DMPC"), dicetyl phosphate ("DCP"), cholesterol, and dimyristyl phosphatidylglycerol ("DMPG"). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as a solvent because it evaporates more easily than methanol. As used herein, "liposomes" can encompass a variety of single and multilamellar lipid vesicles formed by the formation of enclosed lipid bilayers or aggregates. In some embodiments, liposomes can be characterized as having a vesicular structure with a phospholipid bilayer membrane and an internal aqueous medium.In some embodiments, multilamellar liposomes may have multiple lipid layers separated by aqueous medium. When phospholipids are suspended in an excess of aqueous solution, multilamellar liposomes may form spontaneously. In some embodiments, the lipid components may undergo self-rearrangement before the formation of a closed structure, and may trap water and dissolved solutes between the lipid bilayers. In some embodiments, the lipids may assume a micellar structure or may exist only as heterogeneous aggregates of lipid molecules.

[0136] In some embodiments, a polynucleotide or vector of the disclosure is introduced into a mammalian host cell, such as an immunoresponsive cell of the disclosure. In some embodiments, the presence of a polynucleotide or vector of the disclosure in the host cell may be confirmed by any suitable assay known in the art, including, but not limited to, Southern blot assay, Northern blot assay, RT-PCR, PCR, ELISA assay, and Western blot assay.

[0137] In some embodiments, a polynucleotide or vector of the disclosure is stably transduced into an immunoresponsive cell of the disclosure. In some embodiments, cells exhibiting stable expression of the polynucleotide or vector express the encoded chimeric receptor for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 3 months, at least 6 months, at least 9 months, or at least 12 months after transduction.

[0138] In embodiments in which the chimeric receptor of the present disclosure is transiently expressed in a cell, a polynucleotide or vector encoding the chimeric receptor of the present disclosure is transfected into an immunoresponsive cell of the present disclosure. In some embodiments, the immunoresponsive cell expresses the chimeric receptor for about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, or about 15 days after transfection.

[0139] How to Manipulate Cells Also provided herein are compositions and methods for engineering cells to produce an activation condition-controlled polypeptide (ACP) and one or more effector molecules encoded by any engineered nucleic acid comprising a first and second expression cassette, as described herein or otherwise known in the art.

[0140] Generally, cells are engineered to produce ACP and effector molecules through the introduction (i.e., delivery) into the cytosol and / or nucleus of the cells of one or more polynucleotides of the present disclosure comprising a first promoter and an exogenous polynucleotide sequence encoding ACP, and a second expression cassette comprising an ACP-responsive promoter and a second exogenous sequence encoding one or more effector molecules. For example, the polynucleotide expression cassette encoding the ACP polypeptide and one or more effector molecules can be any of the engineered nucleic acids described herein. Delivery methods include, but are not limited to, viral-mediated delivery, lipid-mediated transfection, nanoparticle delivery, electroporation, sonication, and cell membrane deformation by physical means. One of skill in the art will appreciate that the choice of delivery method may depend on the particular cell type to be engineered.

[0141] In some embodiments, the engineered cells are transduced with an oncolytic virus. Examples of oncolytic viruses include, but are not limited to, oncolytic herpes simplex virus, oncolytic adenovirus, oncolytic measles virus, oncolytic influenza virus, oncolytic Indiana vesiculovirus, oncolytic Newcastle disease virus, oncolytic vaccinia virus, oncolytic poliovirus, oncolytic myxoma virus, oncolytic reovirus, oncolytic mumps virus, oncolytic Maraba virus, oncolytic rabies virus, oncolytic rotavirus, oncolytic hepatitis virus, oncolytic rubella virus, oncolytic dengue virus, oncolytic chikungunya virus, oncolytic respiratory syncytial virus, oncolytic lymphocytic choriomeningitis virus, oncolytic morbillivirus, oncolytic lentivirus, oncolytic replicating retrovirus, oncolytic rhabdovirus, oncolytic Seneca Valley virus, oncolytic Sindbis virus, and any variant or derivative thereof. In some embodiments, the oncolytic virus is a recombinant oncolytic virus comprising a first expression cassette and a second expression cassette, hi some embodiments, the oncolytic virus further comprises a third expression cassette.

[0142] Viruses, including any of the oncolytic viruses described herein, can be recombinant viruses that encode one or more transgenes that encode one or more effector molecules, such as any of the engineered nucleic acids described herein. Viruses, including any of the oncolytic viruses described herein, can be recombinant viruses that encode one or more transgenes that encode one or more of two or more effector molecules, such as any of the engineered nucleic acids described herein. In some embodiments, cells are engineered via transduction with an oncolytic virus.

[0143] Viral-Mediated Delivery Viral vector-based delivery platforms can be used to engineer cells. Generally, viral vector-based delivery platforms engineer cells by introducing (i.e., delivering) them into a host cell. For example, viral vector-based delivery platforms can engineer cells by introducing any of the engineered nucleic acids described herein. Viral vector-based delivery platforms can be nucleic acids, but as such, engineered nucleic acids can also include nucleic acids derived from engineered viruses. Such engineered viral nucleic acids can also be referred to as recombinant viruses or engineered viruses.

[0144] A viral vector-based delivery platform may encode two or more engineered nucleic acids, genes, or transgenes within the same nucleic acid. For example, an engineered virus-derived nucleic acid, e.g., a recombinant virus or engineered virus, may encode one or more transgenes, including, but not limited to, any of the engineered nucleic acids described herein that encode one or more effector molecules. The one or more transgenes encoding one or more effector molecules may be configured to express the one or more effector molecules. In addition to one or more transgenes (e.g., transgenes encoding one or more effector molecules), a viral vector-based delivery platform may encode one or more genes, referred to as cis-acting elements or cis-acting genes, such as viral genes required for viral infectivity and / or viral production (e.g., capsid proteins, envelope proteins, viral polymerase, viral transcriptase, etc.).

[0145] A viral vector-based delivery platform can include two or more viral vectors, such as separate viral vectors encoding engineered nucleic acids, genes, or transgenes, as described herein and referred to as trans-acting elements or genes. For example, a helper-dependent viral vector-based delivery platform can provide additional genes required for viral infectivity and / or virus production on one or more additional separate vectors in addition to a vector encoding one or more effector molecules. One viral vector can deliver two or more engineered nucleic acids, such as one vector delivering an engineered nucleic acid configured to produce two or more effector molecules. Two or more viral vectors can deliver two or more engineered nucleic acids, such as two or more vectors delivering one or more engineered nucleic acids configured to produce one or more effector molecules. The number of viral vectors used can depend on the packaging capacity of the viral vector-based vaccine platform described above, and one of skill in the art can select the appropriate number of viral vectors.

[0146] In general, any of the viral vector-based systems can be used for in vitro production of molecules, such as effector molecules, or can be used in in vivo and ex vivo gene therapy procedures, for example for in vivo delivery of engineered nucleic acids encoding one or more effector molecules. Selection of an appropriate viral vector-based system depends on a variety of factors, such as the size of the cargo / payload, the immunogenicity of the viral system, the intended target cell, the strength and timing of gene expression, and other factors that will be appreciated by those of skill in the art.

[0147] The viral vector-based delivery platform can be an RNA-based virus or a DNA-based virus.Exemplary viral vector-based delivery platforms include, but are not limited to, herpes simplex virus, adenovirus, measles virus, influenza virus, Indiana vesiculovirus, Newcastle disease virus, vaccinia virus, poliovirus, myxoma virus, reovirus, mumps virus, Maraba virus, rabies virus, rotavirus, hepatitis virus, rubella virus, dengue virus, chikungunya virus, respiratory syncytial virus, lymphocytic choriomeningitis virus, morbillivirus, lentivirus, replicating retrovirus, rhabdovirus, Seneca Valley virus, Sindbis virus, and any variant or derivative thereof.Other exemplary viral vector-based delivery platforms have been described in the art, such as vaccinia, fowlpox, self-replicating alphaviruses, Maraba virus, adenoviruses (see, e.g., Tatsis et al., Adenoviruses, Molecular Therapy (2004) 10, 616-629), or lentiviruses, including, but not limited to, second, third or hybrid second / third generation lentiviruses and recombinant lentiviruses of any generation designed to target specific cell types or receptors (see, e.g., Hu et al., Immunization Delivered by Lentiviral Vectors for Cancer and Infectious Diseases, Immunol Rev. (2011) 239(1):45-61; Sakuma et al., Lentiviral vectors: basic to translational, Biochem J. (2012) 443(3):603-18; Cooper et al., Rescue of splicing-mediated intron loss maximizes expression in lentiviral vectors containing (see, for example, the human ubiquitin C promoter, Nucl. Acids Res. (2015) 43(1):682-690; Zufferey et al., Self-Inactivating Lentivirus Vector for Safe and Efficient In vivo Gene Delivery, J. Virol. (1998) 72(12):9873-9880).

[0148] This sequence may be preceded by one or more sequences that target intracellular compartments. Upon introduction (i.e., delivery) into a host cell, the infected cell (i.e., engineered cell) can express, and in some cases, secrete, one or more effector molecules. Vaccinia vectors and methods useful in immunization protocols are described, for example, in U.S. Pat. No. 4,722,848. Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover et al. (Nature 351:456-460 (1991)). A wide variety of other vectors useful for introduction (i.e., delivery) of engineered nucleic acids, such as Salmonella typhi vectors, and the like, will be apparent to those skilled in the art from the description herein.

[0149] The viral vector-based delivery platform can be a virus that targets tumor cells, and is referred to herein as an oncolytic virus. Examples of oncolytic viruses include, but are not limited to, oncolytic herpes simplex viruses, oncolytic adenoviruses, oncolytic measles viruses, oncolytic influenza viruses, oncolytic Indiana vesiculoviruses, oncolytic Newcastle disease viruses, oncolytic vaccinia viruses, oncolytic polioviruses, oncolytic myxoma viruses, oncolytic reoviruses, oncolytic mumps viruses, oncolytic Maraba viruses, oncolytic rabies viruses, oncolytic rotaviruses, oncolytic hepatitis viruses, oncolytic rubella viruses, oncolytic dengue viruses, oncolytic chikungunya viruses, oncolytic respiratory syncytial viruses, oncolytic lymphocytic choriomeningitis viruses, oncolytic morbilliviruses, oncolytic lentiviruses, oncolytic replicating retroviruses, oncolytic rhabdoviruses, oncolytic Seneca Valley viruses, oncolytic Sindbis viruses, and any variants or derivatives thereof. Any of the oncolytic viruses described herein can be a recombinant oncolytic virus that includes another transgene (e.g., an engineered nucleic acid) that encodes one or more effector molecules. The transgene encoding the one or more effector molecules can be configured to express the one or more effector molecules.

[0150] In some embodiments, the virus is selected from a lentivirus, a retrovirus, an oncolytic virus, an adenovirus, an adeno-associated virus (AAV), and a virus-like particle (VLP).

[0151] Viral vector-based delivery platforms can be retroviral-based. Generally, retroviral vectors consist of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimal cis-acting LTRs are sufficient for replication and packaging of the vector, which is then used to integrate one or more engineered nucleic acids (e.g., transgenes encoding one or more effector molecules) into target cells to provide permanent transgene expression. Retroviral-based delivery systems include, but are not limited to, delivery systems based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700). Other retroviral systems include the Phoenix retroviral system.

[0152] The viral vector-based delivery platform can be lentivirus-based. In general, lentivirus vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The lentivirus-based delivery platform can be HIV-based, such as the ViraPower system (ThermoFisher) or the pLenti system (Cell Biolabs). The lentivirus-based delivery platform can be SIV or FIV-based. Other exemplary lentiviral-based delivery platforms are described in more detail in U.S. Pat. Nos. 7,311,907, 7,262,049, 7,250,299, 7,226,780, 7,220,578, 7,211,247, 7,160,721, 7,078,031, 7,070,993, 7,056,699, and 6,955,919, each of which is incorporated herein by reference for all purposes.

[0153] Viral vector-based delivery platform can be adenovirus-based.Generally, adenovirus-based vectors can achieve very high transduction efficiency in many cell types, do not require cell division, achieve high titer and expression levels, and can be produced in large quantities in a relatively simple system.Since adenoviruses do not typically integrate into the genome of the host, adenoviruses can generally be used for the transient expression of transgenes in infected cells. Adenovirus-based delivery platforms are described in more detail in Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5:1088 1097, 1999; WO94 / 12649, WO93 / 03769, WO93 / 19191, WO94 / 28938, WO95 / 11984, and WO95 / 00655, each of which is incorporated herein by reference for all purposes. Other exemplary adenovirus-based delivery platforms are described in more detail in U.S. Pat. Nos. 5,585,362; 6,083,716; 7,371,570; 7,348,178; 7,323,177; 7,319,033; 7,318,919; and 7,306,793, and International Patent Application WO 96 / 13597, each of which is incorporated herein by reference for all purposes.

[0154] The viral vector-based delivery platform may be adeno-associated virus (AAV)-based. Adeno-associated virus (AAV) vectors may be used to transduce cells with engineered nucleic acids (e.g., any of the engineered nucleic acids described herein). AAV systems can be used for in vitro production of effector molecules or can be used for in vivo delivery of engineered nucleic acids, e.g., encoding one or more effector molecules, in in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Patent Nos. 4,797,368; 5,436,146; 6,632,670; 6,642,051; 7,078,387; 7,314,912; 6,498,244; 7,906,111; U.S. Patent Publications US2003-0138772, US2007 / 0036760, and US2009 / 0197338; Gao, et al. al., J. Virol, 78(12):6381-6388 (June 2004); Gao, et al, Proc Natl Acad Sci USA, 100(10):6081-6086 (May 13, 2003); and International Patent Applications WO2010 / 138263 and WO93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994), each of which is incorporated by reference herein for all purposes. Exemplary methods for constructing recombinant AAV vectors are described in more detail in U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:64666470 (1984); and Samuiski et al., J. Virol. 63:03822-3828 (1989).Generally, an AAV-based vector comprises a capsid protein having an amino acid sequence corresponding to any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11, and variants thereof.

[0155] The viral vector-based delivery platform can be a virus-like particle (VLP) platform. Generally, VLPs are constructed by producing viral structural proteins and purifying the resulting viral particles. Then, after purification, the cargo / payload (e.g., any of the engineered nucleic acids described herein) is encapsulated ex vivo within the purified particles. Thus, the production of VLPs maintains the separation of the nucleic acid encoding the viral structural proteins and the nucleic acid encoding the cargo / payload. The viral structural proteins used in VLP production can be produced in a variety of expression systems, including mammalian, yeast, insect, bacterial, or in vivo translational expression systems. The purified viral particles can be denatured and reformed in the presence of the desired cargo using methods known to those skilled in the art to produce VLPs. The production of VLPs is described in more detail in Seow et al. (Mol Ther. 2009 May;17(5):767-777).

[0156] Viral vector-based delivery platforms can be engineered to target (i.e., infect) a range of cells, target a narrow subset of cells, or target specific cells. In general, the envelope protein selected for the viral vector-based delivery platform will determine the tropism of the virus. The viruses used in the viral vector-based delivery platform can be pseudotyped to target specific cells of interest. The viral vector-based delivery platform is pantropic and can infect a range of cells. For example, a pantropic viral vector-based delivery platform can include a VSV-G envelope. The viral vector-based delivery platform is amphotropic and can infect mammalian cells. Thus, one skilled in the art can select the appropriate tropism, pseudotype, and / or envelope protein to target the desired cell type.

[0157] Lipid structure delivery system The engineered nucleic acids of the present disclosure (e.g., any of the engineered nucleic acids described herein) can be introduced into cells using lipid-mediated delivery systems. Generally, lipid-mediated delivery systems use structures that are composed of an outer lipid membrane that encases an internal compartment. Examples of lipid-based structures include, but are not limited to, lipid-based nanoparticles, liposomes, micelles, exosomes, vesicles, extracellular vesicles, cells, or tissues. The lipid structure delivery system can deliver cargo / payload (e.g., any of the engineered nucleic acids described herein) in vitro, in vivo, or ex vivo.

[0158] Lipid-based nanoparticles can include, but are not limited to, unilamellar liposomes, multilamellar liposomes, and lipid preparations. As used herein, "liposome" is a general term that encompasses in vitro preparations of lipid vehicles formed by encapsulating a desired cargo, such as an engineered nucleic acid, such as any of the engineered nucleic acids described herein, within a lipid shell or lipid aggregate. Liposomes can be characterized as having a vesicular structure with a bilayer membrane that generally comprises phospholipids, and an internal medium that generally comprises an aqueous composition. Liposomes include, but are not limited to, emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers, and the like. The liposomes can be unilamellar liposomes. The liposomes can be multilamellar liposomes. The liposomes can be multivesicular liposomes. The liposomes can be positively charged, negatively charged, or neutrally charged. In certain embodiments, the liposomes are neutrally charged. Liposomes can be formed from standard vesicle-forming lipids, including neutral and negatively charged phospholipids, and sterols, such as cholesterol. The selection of lipids is generally guided by consideration of the desired purpose, such as criteria for in vivo delivery, such as liposome size, acid instability, and stability of liposomes in the bloodstream. A variety of methods are available for preparing liposomes, as described, for example, in Szoka et al., Ann.Rev.Biophys.Bioeng.9;467(1980), U.S. Patent Nos. 4,235,871, 4,501,728, 4,501,728, 4,837,028, and 5,019,369.

[0159] Multilamellar liposomes are formed spontaneously when lipids, including phospholipids, are suspended in an excess of aqueous solution such that multiple lipid layers are separated by aqueous medium. Water and dissolved solutes are trapped in a closed structure between the lipid bilayers after self-rearrangement of the lipid components. The desired cargo (e.g., polypeptides, nucleic acids, small molecule drugs, engineered nucleic acids, such as any of the engineered nucleic acids described herein, viral vectors, viral-based delivery systems, etc.) can be encapsulated in the aqueous interior of the liposome, attached to the liposome via a linking molecule associated with both the liposome and the polypeptide / nucleic acid, interspersed within the lipid bilayer of the liposome, encapsulated in the liposome, complexed with the liposome, or otherwise associated with the liposome, allowing it to be delivered to the target entity. Lipophilic molecules or molecules with lipophilic regions can also dissolve in or associate with the lipid bilayer.

[0160] The liposomes used according to the present embodiment can be prepared by different methods, as known to those skilled in the art. The preparation of liposomes is described in more detail in WO2016 / 201323, International Application Nos. PCT / US85 / 01161 and PCT / US89 / 05040, and US Patent Nos. 4,728,578, 4,728,575, 4,737,323, 4,533,254, 4,162,282, 4,310,505, and 4,921,706, each of which is incorporated herein by reference for all purposes.

[0161] The liposome can be a cationic liposome. Examples of cationic liposomes are described in more detail in U.S. Patent Nos. 5,962,016, 5,030,453, 6,680,068, U.S. Patent Application No. 2004 / 0208921, and International Patent Application Nos. WO03 / 015757A1, WO04029213A2, and WO02 / 100435A1, each of which is incorporated herein by reference for all purposes.

[0162] Lipid-mediated gene delivery methods are described, for example, in WO 96 / 18372, WO 93 / 24640, Mannino & Gould-Fogerite, BioTechniques 6(7):682-691 (1988); U.S. Patent No. 5,279,833 Rose U.S. Patent No. 5,279,833; WO 91 / 06309; and Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7414 (1987), each of which is incorporated herein by reference for all purposes.

[0163] Exosomes are small membrane vesicles of endocytic origin that are released into the extracellular environment after fusion of multivesicular bodies with the plasma membrane. The size of exosomes ranges from 30 to 100 nm in diameter. Their surface consists of a lipid bilayer from the plasma membrane of the donor cell, they contain cytosol from the cell that produced the exosomes, and display membrane proteins from the parent cell on their surface. Exosomes useful for delivery of nucleic acids are known to those skilled in the art and are, for example, exosomes described in more detail in U.S. Pat. No. 9,889,210, which is incorporated herein by reference for all purposes.

[0164] As used herein, the term "extracellular vesicles" or "EVs" refers to cell-derived vesicles that contain a membrane that encloses an internal space. In general, extracellular vesicles include all membrane-bound vesicles that have a smaller diameter than the cell from which they are derived. In general, extracellular vesicles range from 20 nm to 1000 nm in diameter and can contain a variety of macromolecular cargo, either within the internal space and / or across the membrane that is presented on the outer surface of the extracellular vesicle. The cargo can include nucleic acids (e.g., any of the engineered nucleic acids described herein), proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. By way of example and without limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (e.g., by successive extrusion or treatment with alkaline solutions), vesiculated organelles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or fusion of late endosomes with the plasma membrane). Extracellular vesicles can be derived from living or dead organisms, explanted tissues or organs, and / or cultured cells.

[0165] As used herein, the term "exosome" refers to a small (20-300 nm diameter, more preferably 40-200 nm diameter) cell-derived vesicle that includes a membrane surrounding an internal space and is generated from a cell by direct plasma membrane budding or fusion of a late endosome with the plasma membrane. Exosomes contain lipids or fatty acids and polypeptides, and optionally include a payload (e.g., a therapeutic agent), a receiver (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA, or DNA, such as any of the engineered nucleic acids described herein), a sugar (e.g., a monosaccharide, polysaccharide, or glycan), or other molecules. Exosomes are derived from producing cells and can be isolated from producing cells based on their size, density, biochemical parameters, or a combination thereof. Exosomes are a type of extracellular vesicle. Generally, exosome production / biogenesis does not result in the destruction of the producing cells. Exosomes and the preparation of exosomes are described in further detail in WO2016 / 201323, which is hereby incorporated by reference in its entirety.

[0166] As used herein, the term "nanovesicles" (also referred to as "microvesicles") refers to small (20-250 nm diameter, more preferably between 30-150 nm diameter) vesicles of cell origin that include a membrane surrounding an internal space and are generated from a producing cell by direct or indirect manipulation such that the nanovesicles are not produced by the producing cell without said manipulation. Generally, nanovesicles are a subspecies of extracellular vesicles. Suitable manipulations of producing cells include, but are not limited to, continuous extrusion, treatment with alkaline solutions, sonication, or combinations thereof. The production of nanovesicles may, in some cases, result in the destruction of the producing cell. Preferably, the population of nanovesicles is substantially free of vesicles derived from the producing cell by direct budding from the plasma membrane or fusion of late endosomes with the plasma membrane. Nanovesicles comprise lipids or fatty acids and polypeptides, and optionally comprise a payload (e.g., a therapeutic agent), a receiver (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA, or DNA, such as any of the engineered nucleic acids described herein), a sugar (e.g., a monosaccharide, polysaccharide, or glycan), or other molecule. Once it has been derived from the production cell according to the engineered procedure, the nanovesicle can be isolated from the production cell based on its size, density, biochemical parameters, or a combination thereof.

[0167] Lipid nanoparticles (LNPs) are generally synthetic lipid structures that rely on the amphiphilic nature of lipids to form membrane and vesicle-like structures (Riley 2017). Generally, these vesicles deliver cargo / payload, such as any of the engineered nucleic acids or viral systems described herein, by absorbing into the membrane of a target cell and releasing the cargo into the cytosol. The lipids used in LNP formation can be cationic, anionic, or neutral. The lipids can be synthetic or naturally derived and, in some cases, biodegradable. Lipids can include fats, cholesterol, phospholipids, lipid conjugates, including but not limited to polyethylene glycol (PEG) conjugates (PEGylated lipids), waxes, oils, glycerides, and fat-soluble vitamins. The lipid composition generally includes a mixture of defined materials, such as cationic lipids, neutral lipids, anionic lipids, and amphiphilic lipids. In some cases, specific lipids are included to prevent LNP aggregation, prevent lipid oxidation, or provide functional chemical groups that facilitate attachment of additional moieties. The lipid composition can affect the overall LNP size and stability. In one example, the lipid composition comprises dilinoleylmethyl-4-dimethylaminobutyrate (MC3) or MC3-like molecules. MC3 and MC3-like lipid compositions can be formulated to include one or more other lipids, such as PEG or PEG-conjugated lipids, sterols, or neutral lipids. LNPs can also be further engineered or functionalized to facilitate targeting of specific cell types. Another consideration in LNP design is the balance between targeting efficiency and cytotoxicity.

[0168] Micelles are generally spherical synthetic lipid structures formed using single-chain lipids, where the hydrophilic heads of the single-chain lipids form the outer layer or membrane, and the hydrophobic tails of the single-chain lipids form the micellar core. Micelles typically refer to lipid structures that contain only a lipid monolayer. Micelles are described in detail by Quader et al. (Mol Ther. 2017 Jul 5;25(7):1501-1513).

[0169] Nucleic acid vectors, such as expression vectors, directly exposed to serum may have some undesirable consequences, including degradation of nucleic acid by serum nucleases or off-target stimulation of the immune system by free nucleic acid. Similarly, viral delivery systems directly exposed to serum may induce undesirable immune responses and / or neutralization of the viral delivery system. Therefore, encapsulation of engineered nucleic acid and / or viral delivery systems can be used to avoid degradation while also avoiding potential off-target effects. In certain instances, the engineered nucleic acid and / or viral delivery system is fully encapsulated within the delivery vehicle, such as within the aqueous interior of the LNP. Encapsulation of engineered nucleic acid and / or viral delivery systems within LNPs can be performed by techniques well known to those skilled in the art, such as microfluidic mixing and droplet generation performed on a microfluidic droplet generation device. Such devices include, but are not limited to, standard T-junction devices or flow focusing devices. In one example, a desired lipid formulation, such as an MC3 or MC3-like containing composition, is provided to a droplet generating device in parallel with an engineered nucleic acid or viral delivery system and any other desired agents, such that the delivery vector and desired agent are fully encapsulated within the interior of the MC3 or MC3-like based LNPs. In one example, the droplet generating device can control the size range and size distribution of the LNPs produced. For example, the LNPs can have a size ranging from 1 to 1000 nanometers in diameter, e.g., 1, 10, 50, 100, 500, or 1000 nanometers in size. Following droplet generation, the delivery vehicles (e.g., engineered nucleic acid and / or viral delivery systems) encapsulating the cargo / payload can be further processed or manipulated to prepare them for administration.

[0170] Nanoparticle Delivery Nanomaterials can be used to deliver engineered nucleic acids (e.g., any of the engineered nucleic acids described herein). Importantly, nanomaterial vehicles can be made of non-immunogenic materials and generally avoid eliciting immunity against the delivery vector itself. These materials can include, but are not limited to, lipids (as previously described), inorganic nanomaterials, and other polymeric materials. Nanomaterial particles are described in detail by Riley et al. (Recent Advances in Nanomaterials for Gene Delivery-A Review. Nanomaterials 2017,7(5),94).

[0171] Genome Editing A genome editing system can be used to engineer a host genome to encode an engineered nucleic acid, for example, an engineered nucleic acid of the present disclosure. In general, "genome editing system" refers to any system for integrating an exogenous gene into the genome of a host cell. Genome editing systems include, but are not limited to, transposon systems, nuclease genome editing systems, and viral vector-based delivery platforms.

[0172] A transposon system can be used to integrate engineered nucleic acids, such as the engineered nucleic acids of the present disclosure, into a host genome. A transposon generally comprises a terminal inverted repeat (TIR) ​​flanking a cargo / payload nucleic acid and a transposase. The transposon system can provide the transposon in cis or in trans, with the TIR flanking cargo. The transposon system can be a retrotransposon system or a DNA transposon system. Generally, the transposon system randomly integrates the cargo / payload (e.g., engineered nucleic acid) into the host genome. Examples of transposon systems include systems using transposons of the Tc1 / mariner transposon superfamily, such as the Sleeping Beauty transposon system, which are described in more detail in Hudecek et al. (Crit Rev Biochem Mol Biol. 2017 Aug;52(4):355-380), as well as U.S. Patent Nos. 6,489,458, 6,613,752, and 7,985,739. Another example of a transposon system includes the PiggyBac transposon system, which is described in more detail in U.S. Patent Nos. 6,218,185 and 6,962,810, each of which is incorporated herein by reference for all purposes.

[0173] Nuclease genome editing systems can be used to engineer host genomes to code engineered nucleic acids, such as engineered nucleic acids of the present disclosure. Although not wishing to be bound by theory, nuclease-mediated gene editing systems used to introduce exogenous genes generally utilize the cell's natural DNA repair mechanisms, particularly the homologous recombination (HR) repair pathway. Briefly, following damage to genomic DNA (typically a double-strand break), cells can eliminate the damage by using another DNA source with identical or substantially identical sequences at both its 5' and 3' ends as a template during DNA synthesis to repair the damage. In a natural situation, HDR can use other chromosomes present in the cell as templates. In gene editing systems, exogenous polynucleotides are introduced into cells and used as homologous recombination templates (HRT or HR templates). Generally, any additional exogenous sequence not naturally found in a chromosome, with the lesion contained within the HRT (e.g., a gene or portion of a gene) between the 5' and 3' complementary ends, can be incorporated (i.e., "integrated") into a given genomic locus during templated HDR. Thus, a typical HR template for a given genomic locus has a nucleotide sequence identical to a first region of the endogenous genomic target locus, a nucleotide sequence identical to a second region of the endogenous genomic target locus, and a nucleotide sequence encoding a cargo / payload nucleic acid (e.g., any of the engineered nucleic acids described herein, such as any of the engineered nucleic acids encoding one or more effector molecules).

[0174] In some examples, the HR template can be linear. Examples of linear HR templates include, but are not limited to, linearized plasmid vectors, ssDNA, synthetic DNA, and PCR amplified DNA. In certain examples, the HR template can be circular, such as a plasmid. The circular template can include a supercoiled template.

[0175] The identical or substantially identical sequences found at the 5' and 3' ends of the HR template are generally referred to as arms (HR arms) with respect to the exogenous sequence to be introduced. The HR arms can be identical (i.e., 100% identical) to the region of the endogenous genome target locus. The HR arms can, in some cases, be substantially identical to the region of the endogenous genome target locus. While substantially identical HR arms can be used, it can be advantageous for the HR arms to be identical, since the efficiency of the HDR pathway can be affected by HR arms with less than 100% identity.

[0176] Each HR arm, i.e., the 5' and 3' HR arms, can be the same size or different sizes. Each HR arm can be greater than or equal to 50, 100, 200, 300, 400, or 500 bases in length, respectively. The HR arms can generally be any length, but practical considerations, such as the effect of the HR arm length and overall template size on the overall editing efficiency, can also be taken into account. The HR arms can be identical or substantially identical to the region of the endogenous genome target locus immediately adjacent to the cleavage site. Each HR arm can be identical or substantially identical to the region of the endogenous genome target locus immediately adjacent to the cleavage site. Each HR arm can be identical or substantially identical to the region of the endogenous genome target locus within a particular distance of the cleavage site, such as 1 base pair, less than or equal to 10 base pairs, less than or equal to 50 base pairs, or less than or equal to 100 base pairs from each other.

[0177] Nuclease genome editing systems can cleave target genomic loci using a variety of nucleases, including but not limited to clustered regularly interspaced short palindromic repeats (CRISPR) family nucleases or derivatives thereof, transcription activator-like effector nucleases (TALENs) or derivatives thereof, zinc finger nucleases (ZFNs) or derivatives thereof, and homing endonucleases (HEs) or derivatives thereof.

[0178] A CRISPR-mediated gene editing system can be used to engineer a host genome to encode an engineered nucleic acid, such as an engineered nucleic acid encoding one or more of the effector molecules described herein. The CRISPR system is described in more detail in M. Adli ("The CRISPR tool kit for genome editing and beyond" Nature Communications; volume 9 (2018), Article number: 1911), which is incorporated herein by reference for all that it teaches. In general, a CRISPR-mediated gene editing system includes a CRISPR-associated (Cas) nuclease and an RNA that directs cleavage to a specific target sequence. An exemplary CRISPR-mediated gene editing system is the CRISPR / Cas9 system, which is composed of a Cas9 nuclease and an RNA with a CRISPR RNA (crRNA) domain and a transactivating CRISPR (tracrRNA) domain. A crRNA typically has two RNA domains: a guide RNA sequence (gRNA) that directs specificity to a target sequence ("defined nucleotide sequence"), e.g., a genomic sequence, through base pair hybridization; and an RNA domain that hybridizes to the tracrRNA. The tracrRNA can interact with a nuclease (e.g., Cas9), thereby facilitating its recruitment to a genomic locus. The crRNA and tracrRNA polynucleotides can be separate polynucleotides. The crRNA and tracrRNA polynucleotides can be a single polynucleotide, also referred to as a single guide RNA (sgRNA). While the Cas9 system is exemplified herein, other CRISPR systems can be used, such as the Cpf1 system. Nucleases can include derivatives thereof, such as Cas9 functional mutants, e.g., Cas9 "nickase" mutants, which generally mediate only a single strand cleavage of a defined nucleotide sequence, as opposed to the complete double strand cleavage typically produced by the Cas9 enzyme.

[0179] In general, the components of the CRISPR system interact with each other to form a ribonucleoprotein (RNP) complex to mediate sequence-specific cleavage. In some CRISPR systems, each component can be produced separately and used to form an RNP complex. In some CRISPR systems, each component can be produced separately in vitro and contacted with each other (i.e., "complexed") in vitro to form an RNP complex. The RNPs produced in vitro can then be introduced (i.e., "delivered") into the cytosol and / or nucleus of a cell, for example, the cytosol and / or nucleus of a T cell. The RNP complexes produced in vitro can be delivered to cells by various means, including but not limited to electroporation, lipid-mediated transfection, cell membrane deformation by physical means, lipid nanoparticles (LNPs), virus-like particles (VLPs), and sonication. In a particular example, the RNP complexes produced in vitro can be delivered to cells using Nucleofactor / Nucleofection® electroporation-based delivery system (Lonza®). Other electroporation systems include, but are not limited to, MaxCyte electroporation system, Miltenyi CliniMACS electroporation system, Neon electroporation system, and BTX electroporation system. CRISPR nucleases, such as Cas9, can be produced in vitro (i.e., synthesized and purified) using various protein production techniques known in the art. CRISPR RNAs, such as sgRNAs, can be produced in vitro (i.e., synthesized and purified) using various RNA production techniques known to those skilled in the art, such as in vitro transcription or chemical synthesis.

[0180] The RNP complex produced in vitro can be complexed with different ratios of nuclease and gRNA.The RNP complex produced in vitro can also be used in different amounts in CRISPR-mediated editing system.For example, depending on the number of cells that are desired to be edited, the total amount of RNP added can be adjusted, such as the amount of RNP complex added when editing a large number of cells in reaction.

[0181] In some CRISPR systems, each component (e.g., Cas9 and sgRNA) can be encoded by a polynucleotide separately, and each polynucleotide can be introduced into a cell together or separately. In some CRISPR systems, each component can be encoded by a single polynucleotide (i.e., a multi-promoter or multi-cistronic vector, see the description of an exemplary multi-cistronic system below) and introduced into a cell. After expression of the CRISPR components encoded by each polynucleotide in the cell (e.g., translation of nucleases and transcription of CRISPR RNA), an RNP complex can be formed in the cell and then directed to site-specific cleavage.

[0182] Some RNPs can be engineered to have moieties that facilitate delivery of the RNP into the nucleus. For example, Cas9 nuclease can have a nuclear localization signal (NLS) domain, where the Cas9 RNP complex is delivered into the cytosol of a cell, or after translation of Cas9 and subsequent RNP formation, the NLS can facilitate further transport of the Cas9 RNP into the nucleus.

[0183] The engineered cells described herein can be engineered using non-viral methods, for example, the nucleases and / or CRISPR-mediated gene editing systems described herein can be delivered to cells using non-viral methods. The engineered cells described herein can be engineered using viral methods, for example, the nucleases and / or CRISPR-mediated gene editing systems described herein can be delivered to cells using viral methods, for example, adenovirus, retrovirus, lentivirus, or any of the other viral-based delivery methods described herein.

[0184] In some CRISPR systems, two or more CRISPR compositions can be provided, each of which targets the same gene or common genomic locus separately with two or more target nucleotide sequences. For example, two separate CRISPR compositions can be provided to direct cleavage at two different target nucleotide sequences within a certain distance of each other. In some CRISPR systems, two or more CRISPR compositions can be provided, each of which targets opposite strands of the same gene or common genomic locus separately. For example, two separate CRISPR "nickase" compositions can be provided to direct cleavage at the same gene or common genomic locus on opposite strands.

[0185] In general, the features of the CRISPR-mediated editing system described herein can be applied to other nuclease-based genome editing systems. TALEN is an engineered site-specific nuclease that is composed of the DNA binding domain of TALE (transcription activator-like effector) and the catalytic domain of the restriction endonuclease Fokl. By changing the amino acids present in the highly variable residue region of the monomer of the DNA binding domain, different artificial TALENs can be created to target different nucleotide sequences. The DNA binding domain then directs the nuclease to the target sequence and creates a double-strand break. TALEN-based systems are described in more detail in US 12 / 965,590, US 8,450,471, US 8,440,431, US 8,440,432, US 10,172,880, and US 13 / 738,381, all of which are incorporated herein by reference in their entirety. ZFN-based editing systems are described in more detail in U.S. Pat. Nos. 6,453,242, 6,534,261, 6,599,692, 6,503,717, 6,689,558, 7,030,215, 6,794,136, 7,067,317, 7,262,054, 7,070,934, 7,361,635, 7,253,273, and U.S. Patent Publication Nos. 2005 / 0064474, 2007 / 0218528, and 2005 / 0267061, all of which are incorporated by reference in their entireties for all purposes.

[0186] Other engineered delivery systems A variety of additional means for introducing an engineered nucleic acid (e.g., any of the engineered nucleic acids described herein) into a cell or other target recipient entity, such as, for example, any of the lipid structures described herein.

[0187] Electroporation can be used to deliver polynucleotides to recipient entities. Electroporation is a method of internalizing a cargo / payload into an internal compartment of a target cell or entity through the application of an electric field to transiently permeabilize the outer membrane or shell of the target cell or entity. In general, the method involves placing a cell or target entity between two electrodes in a solution containing the cargo of interest (e.g., any of the engineered nucleic acids described herein). The lipid membrane of the cell is then disrupted, i.e., permeabilized, by applying a transient set voltage, thereby allowing the cargo to enter the interior of the entity, e.g., the cytoplasm of the cell. In the example of cells, at least some, but not most, of the cells remain viable. Cells and other entities can be electroporated in vitro, in vivo, or ex vivo. Electroporation conditions (e.g., number of cells, concentration of cargo, recovery conditions, voltage, time, volume, pulse type, pulse length, volume, cuvette length, composition of electroporation solution, etc.) vary depending on several factors, including, but not limited to, the type of cell or other recipient entity, the cargo to be delivered, the desired efficiency of internalization, and the desired survival rate. Optimization of such criteria is within the skill of one of ordinary skill in the art. A variety of devices and protocols can be used for electroporation. Examples include, but are not limited to, the Neon® Transfection System, MaxCyte® Flow Electroporation™, Lonza® Nucleofector™ System, and the Bio-Rad® Electroporation System.

[0188] Other means for introducing an engineered nucleic acid (e.g., any of the engineered nucleic acids described herein) into a cell or other target recipient entity include, but are not limited to, sonication, gene guns, hydrodynamic injection, and cell membrane deformation by physical means.

[0189] Compositions and methods for delivering engineered mRNA, such as naked plasmids or mRNA, in vivo are described in detail in Kowalski et al. (Mol Ther. 2019 Apr 10;27(4):710-728) and Kaczmarek et al. (Genome Med. 2017;9:60), each of which is incorporated by reference herein for all purposes.

[0190] How to use Methods for the treatment of disease are also encompassed by the present disclosure, comprising administering a therapeutically effective amount of an engineered nucleic acid, engineered cell, or isolated cell as described above. In some aspects, provided herein are methods of treating a subject in need of treatment, comprising administering a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0191] In some aspects, provided herein are methods of increasing expression of a target gene, e.g., a tumor suppressor gene.

[0192] In some aspects, provided herein are methods of increasing expression of a target gene, e.g., an immunomodulatory gene. Exemplary immunomodulatory genes include, but are not limited to, cytokines, chemokines, their receptors, and derivatives thereof.

[0193] In some aspects, provided herein is a method of stimulating a cell-mediated immune response to tumor cells in a subject, the method comprising administering to a tumor-bearing subject a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0194] In some aspects, provided herein are methods of providing anti-tumor immunity in a subject, the method comprising administering to a subject in need thereof a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0195] In some aspects, provided herein are methods of treating a subject having cancer, the methods comprising administering a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0196] In some aspects, provided herein is a method of reducing tumor volume in a subject, the method comprising administering to a subject having a tumor a composition comprising any of the engineered cells, isolated cells, or compositions disclosed herein.

[0197] In some embodiments, the administering comprises systemic administration. In some embodiments, the administering comprises intratumoral administration. In some embodiments, the isolated cells are derived from the subject. In some embodiments, the isolated cells are allogeneic with respect to the subject.

[0198] In some embodiments, the method further comprises administering a checkpoint inhibitor selected from: an anti-PD-1 antibody, an anti-PD-L1 antibody, an anti-PD-L2 antibody, an anti-CTLA-4 antibody, an anti-LAG-3 antibody, an anti-TIM-3 antibody, an anti-TIGIT antibody, an anti-VISTA antibody, an anti-KIR antibody, an anti-B7-H3 antibody, an anti-B7-H4 antibody, an anti-HVEM antibody, an anti-BTLA antibody, an anti-GAL9 antibody, an anti-A2AR antibody, an anti-phosphatidylserine antibody, an anti-CD27 antibody, an anti-TNFa antibody, an anti-TREM1 antibody, and an anti-TREM2 antibody. In some embodiments, the method further comprises administering an anti-CD40 antibody.

[0199] In some embodiments, the tumor is selected from: adenocarcinoma, bladder tumor, brain tumor, breast tumor, cervical tumor, colon tumor, esophageal tumor, glioma, kidney tumor, liver tumor, lung tumor, melanoma, mesothelioma, ovarian tumor, pancreatic tumor, gastric tumor, testicular yolk sac tumor, prostate tumor, skin tumor, thyroid tumor, and uterine tumor.

[0200] Some methods involve selecting a subject (or patient population) that has a tumor (or cancer) and treating the subject with engineered cells or delivery vehicles that modulate tumor-mediated immune suppression mechanisms.

[0201] The methods provided herein also include delivering a preparation of engineered cells or a delivery vehicle. The preparation, in some embodiments, is a substantially pure preparation, e.g., containing less than 5% (e.g., less than 4%, 3%, 2%, or 1%) cells other than the engineered cells. The preparation may be 1×10 5 Cells / kg to 1 x 10 7 cells / kg of cells.

[0202] The methods provided herein also include administering a drug or pharmaceutical composition in combination with a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein such that ACP is induced and / or inhibitory proteases are inhibited. For example, tamoxifen or a metabolite thereof (e.g., 4-hydroxytamoxifen, N-desmethyltamoxifen, tamoxifen-N-oxide, or endoxifen) can be administered to induce ACP. The drug or pharmaceutical can be administered prior to, with, simultaneously, and / or following administration of any of the engineered cells, isolated cells, or compositions disclosed herein. The drug or pharmaceutical can be administered sequentially. The drug or pharmaceutical can be administered with or simultaneously with administration of any of the engineered cells, isolated cells, or compositions disclosed herein. The drug or pharmaceutical can be administered at a separate interval (e.g., prior to or following) administration of any of the engineered cells, isolated cells, or compositions disclosed herein. The drug or pharmaceutical agent can be administered both together / concurrently with any of the engineered cells, isolated cells, or compositions disclosed herein, as well as at separate intervals therefrom. The drug or pharmaceutical composition and the engineered cells, isolated cells, or compositions can be administered via different routes, for example, the drug or pharmaceutical composition can be administered orally and the engineered cells, isolated cells, or compositions can be administered intraperitoneally, intravenously, subcutaneously, or any other route suitable for administration, as will be appreciated by one of skill in the art.

[0203] The specific dose level and frequency of administration for any particular patient may vary, but will depend on a variety of factors, including the activity of the particular compound employed, the metabolic stability and length of action of that compound, age, body weight, general health, sex, diet, mode and time of administration, excretion rate, drug combination, the severity of the particular condition, and the host being treated.

[0204] The methods provided herein include administering a protease inhibitor. In some embodiments, NS3 protease can be inhibited by a protease inhibitor. Any suitable protease inhibitor can be used, including but not limited to simeprevir, danoprevir, asunaprevir, silprevir, boceprevir, sovaprevir, paritaprevir, telaprevir, grazoprevir, glecaprevir, and voxiloprevir, or any combination thereof. In some embodiments, the protease inhibitor is selected from simeprevir, danoprevir, asunaprevir, silprevir, boceprevir, sovaprevir, paritaprevir, telaprevir, grazoprevir, glecaprevir, and voxiloprevir.

[0205] In some embodiments, the protease inhibitor is grazoprevir. In some embodiments, the protease inhibitor is a combination of grazoprevir and elbasvir (NS5A inhibitor of the Hepatitis C virus NS5A replication complex). Grazoprevir and elbasvir can be formulated together as a pharmaceutical composition, such as in tablet form (e.g., tablets available under the trade name Zepatier®). Grazoprevir and elbasvir can be formulated together in a 2:1 weight ratio, such as in a unit dose of 100 mg grazoprevir, 50 mg elbasvir, respectively (e.g., as in tablets available under the trade name Zepatier®). The protease inhibitor can be administered in a dose capable of inhibiting the inhibitory protease domain of ACP. The protease inhibitor can be administered in an approved dose for another indication. As an illustrative, non-limiting example, Zepatier can be administered in an approved dose for the treatment of HCV.

[0206] Grazoprevir, including in combination with elbasvir, can be administered orally in a dosage range of 0.001 to 1000 mg / kg of mammalian (e.g., human) body weight per day, in a single dose or in divided doses. One dosage range is 0.01 to 500 mg / kg of body weight per day, orally, in a single dose or in divided doses. Another dosage range is 0.1 to 100 mg / kg of body weight per day, orally, in a single dose or in divided doses. For oral administration, grazoprevir, including in combination with elbasvir, can be provided in the form of tablets or capsules containing 1.0 to 500 mg of active ingredient, in particular 1, 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500, and 750 mg of active ingredient, for symptomatic adjustment of dosage to the patient being treated. In general, the total daily dose of grazoprevir, including in combination with elbasvir, can range from about 1 to about 2500 mg per day, although variations will inevitably occur depending on the therapeutic target, the patient, and the route of administration. In one embodiment, the dose of grazoprevir, including in combination with elbasvir, is about 10 to about 1000 mg / day, administered in a single dose or in 2 to 4 divided doses. In another embodiment, the dose of grazoprevir, including in combination with elbasvir, is about 1 to about 500 mg / day, administered in a single dose or in 2 to 4 divided doses. In yet another embodiment, the dose of grazoprevir, including in combination with elbasvir, is about 1 to about 100 mg / day, administered in a single dose or in 2 to 4 divided doses. In yet another embodiment, the dose of grazoprevir, including in combination with elbasvir, is about 1 to about 50 mg / day, administered in a single dose or in 2 to 4 divided doses. In another embodiment, the dosage of grazoprevir, including in combination with elbasvir, is about 500 to about 1500 mg / day, administered in a single dose or in 2 to 4 divided doses. In yet another embodiment, the dosage of grazoprevir, including in combination with elbasvir, is about 500 to about 1000 mg / day, administered in a single dose or in 2 to 4 divided doses.In yet another embodiment, the dosage of grazoprevir, including in combination with elbasvir, is about 100 to about 500 mg / day administered in a single dose or in 2 to 4 divided doses.

[0207] In vivo expression The methods provided herein also include delivering compositions in vivo that are capable of producing engineered cells as described herein, e.g., capable of delivering any of the engineered nucleic acids as described herein to cells in vivo. Such compositions include any of the viral-mediated delivery platforms, any of the lipid structure delivery systems, any of the nanoparticle delivery systems, any of the genome editing systems, or any of the other genetic engineering delivery systems described herein that are capable of engineering cells in vivo.

[0208] The methods provided herein also include delivering in vivo a composition capable of producing any of the effector molecules described herein. The methods provided herein also include delivering in vivo a composition capable of producing two or more of the effector molecules described herein. Compositions capable of in vivo production of effector molecules include, but are not limited to, any of the engineered nucleic acids described herein. Compositions capable of in vivo production of effector molecules can be naked mRNA or naked plasmids.

[0209] Pharmaceutical Compositions The engineered nucleic acids or engineered cells can be formulated into pharmaceutical compositions. These compositions may contain, in addition to one or more engineered nucleic acids or engineered cells, pharma- ceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other materials may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.

[0210] Pharmaceutical compositions for oral administration may be in tablet, capsule, powder, or liquid form. Tablets may contain a solid carrier, such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally contain a liquid carrier, such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil. Physiological saline, dextrose, or other saccharide solutions, or glycols, such as ethylene glycol, propylene glycol, or polyethylene glycol, may be included.

[0211] For intravenous, cutaneous or subcutaneous injection, or injection at the affected site, the active ingredient can be in the form of a parenterally acceptable aqueous solution that is pyrogen-free and has appropriate pH, isotonicity and stability.Those skilled in the art can easily prepare appropriate solutions, for example, using isotonic solvents such as sodium chloride injection, Ringer's injection, lactated Ringer's injection, etc.Preservatives, stabilizers, buffers, antioxidants, and / or other additives can be included as necessary.

[0212] Whether it is a polypeptide, nucleic acid, small molecule, or other medicamentously useful compound according to the present disclosure given to an individual, the administration is preferably a "therapeutically effective amount" or a "prophylactically effective amount" (in some cases, prevention can be considered treatment), which is sufficient to show benefit to the individual. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the protein aggregation disorder being treated. Prescription of treatment, e.g., determining dosage, etc., is within the responsibility of general practitioners and other physicians, and typically takes into account the disorder being treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to the practitioner. Examples of the above techniques and protocols can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed), 1980.

[0213] The compositions may be administered alone or in combination with other treatments, either simultaneously or sequentially, depending on the condition to be treated.

[0214] kit Certain aspects of the present disclosure relate to kits for the treatment and / or prevention of cancer (e.g., solid tumors). In certain embodiments, the kits include a therapeutic or prophylactic composition comprising an effective amount of one or more chimeric receptors of the present disclosure, an isolated nucleic acid of the present disclosure, a vector of the present disclosure, and / or a cell (e.g., an immunoresponsive cell) of the present disclosure. In some embodiments, the kits include a sterile container. In some embodiments, such a container can be a box, an ampoule, a bottle, a vial, a tube, a bag, a pouch, a blister pack, or other suitable container form known in the art. The container may be made of plastic, glass, laminated paper, metal foil, or other material suitable for holding a drug.

[0215] In some embodiments, the therapeutic or prophylactic composition is provided with instructions for administering the therapeutic or prophylactic composition to a subject having or at risk of developing cancer (e.g., a solid tumor). In some embodiments, the instructions may include information regarding the use of the composition for the treatment and / or prevention of a disorder. In some embodiments, the instructions include, but are not limited to, a description of the therapeutic or prophylactic composition, dosing schedules, dosing schedules for the treatment or prevention of a disease or symptoms thereof, precautions, warnings, indications, contraindications, overdosing information, adverse reactions, animal pharmacology, clinical trials, and / or bibliographic references. In some embodiments, the instructions may be printed directly on the container (if present), or may be printed as a label affixed to the container, or as a separate sheet, pamphlet, card, or folder provided in or with the container.

[0216] Additional Embodiments Embodiment 1: An engineered CCL3 promoter comprising an excision of at least one nucleotide motif, wherein the excision increases inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal. Embodiment 2: 2. The engineered CCL3 promoter of embodiment 1, wherein the wild-type CCL3 promoter comprises the nucleotide sequence of SEQ ID NO: 132. Embodiment 3: 2. The engineered CCL3 promoter of embodiment 1 or embodiment 2, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein the motif comprises a sequence selected from the group consisting of positions 566 to 576 of SEQ ID NO:132, positions 674 to 695 of SEQ ID NO:132, positions 820 to 832 of SEQ ID NO:132, positions 1089 to 1105 of SEQ ID NO:132, positions 1127 to 1141 of SEQ ID NO:132, positions 1184 to 1199 of SEQ ID NO:132, positions 1475 to 1500 of SEQ ID NO:132, positions 1534 to 1544 of SEQ ID NO:132, positions 1553 to 1595 of SEQ ID NO:132, positions 1634 to 1674 of SEQ ID NO:132, positions 1681 to 1692 of SEQ ID NO:132, and positions 1982 to 1998 of SEQ ID NO:132. Embodiment 4: 4. The engineered CCL3 promoter according to any one of embodiments 1 to 3, wherein the truncation comprises a substitution or deletion of one or more nucleotides of at least one nucleotide motif. Embodiment 5: An engineered CCL3 promoter according to any one of embodiments 1 to 4, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, which motif corresponds to position 566 to position 576 of SEQ ID NO: 132. Embodiment 6: 6. The engineered CCL3 promoter of embodiment 5, wherein the truncation comprises a nucleotide substitution comprising the sequence GTACCAGAATA (SEQ ID NO: 191) from position 566 to position 576 of SEQ ID NO: 132. Embodiment 7: 6. The engineered CCL3 promoter of embodiment 5, wherein the truncation comprises a nucleotide deletion from position 566 to position 576 of SEQ ID NO:132. Embodiment 8: 8. The engineered CCL3 promoter of any one of embodiments 1 to 7, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, the motif corresponding to position 674 to position 695 of SEQ ID NO:132. Embodiment 9: 9. The engineered CCL3 promoter of embodiment 8, wherein the truncation comprises a nucleotide substitution comprising the sequence TATATACCAGCGAGTTCGATAA (SEQ ID NO: 193) from position 674 to position 695 of SEQ ID NO: 132. Embodiment 10: 9. The engineered CCL3 promoter of embodiment 8, wherein the truncation comprises a nucleotide deletion from position 674 to position 695 of SEQ ID NO:132. Embodiment 11: 11. The engineered CCL3 promoter of any one of embodiments 1 to 10, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, the motif corresponding to position 820 to position 832 of SEQ ID NO:132. Embodiment 12: 12. The engineered CCL3 promoter of embodiment 11, wherein the truncation comprises a nucleotide substitution comprising the sequence ACGAAGCAATACT (SEQ ID NO: 195) from position 820 to position 832 of SEQ ID NO: 132. Embodiment 13: 12. The engineered CCL3 promoter of embodiment 11, wherein the truncation comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132. Embodiment 14: 14. The engineered CCL3 promoter of any one of embodiments 1 to 13, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1089 to position 1105 of SEQ ID NO: 132. Embodiment 15: 15. The engineered CCL3 promoter of embodiment 14, wherein the truncation comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO: 199) from position 1089 to position 1105 of SEQ ID NO: 132. Embodiment 16: 15. The engineered CCL3 promoter of embodiment 14, wherein the truncation comprises a nucleotide deletion from position 1089 to position 1105 of SEQ ID NO:132. Embodiment 17: 17. The engineered CCL3 promoter of any one of embodiments 1 to 16, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, the motif corresponding to position 1127 to position 1141 of SEQ ID NO:132. Embodiment 18: 18. The engineered CCL3 promoter of embodiment 17, wherein the truncation comprises a nucleotide substitution comprising the sequence CCATAGTGAGGAAAT (SEQ ID NO: 201) from position 1127 to position 1141 of SEQ ID NO: 132. Embodiment 19: 18. The engineered CCL3 promoter of embodiment 17, wherein the truncation comprises a nucleotide deletion from position 1127 to position 1141 of SEQ ID NO:132. Embodiment 20: 20. The engineered CCL3 promoter of any one of embodiments 1 to 19, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, the motif corresponding to position 1184 to position 1199 of SEQ ID NO:132. Embodiment 21: 21. The engineered CCL3 promoter of embodiment 20, wherein the truncation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO: 203) from position 1184 to position 1199 of SEQ ID NO: 132. Embodiment 22: 21. The engineered CCL3 promoter of embodiment 20, wherein the truncation comprises a nucleotide deletion from position 1184 to position 1199 of SEQ ID NO:132. Embodiment 23: 23. The engineered CCL3 promoter of any one of embodiments 1 to 22, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1475 to position 1500 of SEQ ID NO: 132. Embodiment 24: 24. The engineered CCL3 promoter of embodiment 23, wherein the truncation comprises a nucleotide substitution comprising the sequence CCGATCTCTAGTTAAGTTAGCTGTAT (SEQ ID NO: 217) from position 1475 to position 1500 of SEQ ID NO: 132. Embodiment 25: 24. The engineered CCL3 promoter of embodiment 23, wherein the truncation comprises a nucleotide deletion from position 1475 to position 1500 of SEQ ID NO: 132. Embodiment 26: 26. The engineered CCL3 promoter of any one of embodiments 1 to 25, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1534 to position 1544 of SEQ ID NO: 132. Embodiment 27: 27. The engineered CCL3 promoter of embodiment 26, wherein the truncation comprises a nucleotide substitution comprising the sequence GTAGAACTCTT (SEQ ID NO: 219) at position 1534 to position 1544 of SEQ ID NO: 132. Embodiment 28: 27. The engineered CCL3 promoter of embodiment 26, wherein the truncation comprises a nucleotide deletion from position 1534 to position 1544 of SEQ ID NO:132. Embodiment 29: 29. The engineered CCL3 promoter of any one of embodiments 1 to 28, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132. Embodiment 30: 30. The engineered CCL3 promoter of embodiment 29, wherein the truncation comprises a nucleotide substitution comprising the sequence AATACCTTGGTGGAGCTCATCTAATATCTTCATATTACCTCCA (SEQ ID NO: 221) from position 1553 to position 1595 of SEQ ID NO: 132. Embodiment 31: 30. The engineered CCL3 promoter of embodiment 29, wherein the truncation comprises a nucleotide deletion from position 1553 to position 1595 of SEQ ID NO: 132. Embodiment 32: 32. The engineered CCL3 promoter of any one of embodiments 1 to 31, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1634 to position 1645 of SEQ ID NO: 132. Embodiment 33: 33. The engineered CCL3 promoter of embodiment 32, wherein the truncation comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO: 223) at position 1634 to position 1645 of SEQ ID NO: 132. Embodiment 34: 33. The engineered CCL3 promoter of embodiment 32, wherein the truncation comprises a nucleotide deletion from position 1634 to position 1645 of SEQ ID NO:132. Embodiment 35: 35. The engineered CCL3 promoter of any one of embodiments 1 to 34, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1663 to position 1674 of SEQ ID NO: 132. Embodiment 36: 36. The engineered CCL3 promoter of embodiment 35, wherein the truncation comprises a nucleotide substitution comprising the sequence TATACCTTGGTT (SEQ ID NO: 225) at position 1663 to position 1674 of SEQ ID NO: 132. Embodiment 37: 36. The engineered CCL3 promoter of embodiment 35, wherein the truncation comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO:132. Embodiment 38: 38. The engineered CCL3 promoter of any one of embodiments 1 to 37, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1681 to position 1692 of SEQ ID NO: 132. Embodiment 39: 39. The engineered CCL3 promoter of embodiment 38, wherein the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) at position 1681 to position 1692 of SEQ ID NO: 132. Embodiment 40: 40. The engineered CCL3 promoter of embodiment 39, wherein the engineered CCL3 promoter comprises the polynucleotide of SEQ ID NO:4. Embodiment 41: 39. The engineered CCL3 promoter of embodiment 38, wherein the truncation comprises a nucleotide deletion from position 1681 to position 1692 of SEQ ID NO: 132. Embodiment 42: 41. The engineered CCL3 promoter of any one of embodiments 1 to 40, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to position 1982 to position 1998 of SEQ ID NO: 132. Embodiment 43: 43. The engineered CCL3 promoter of embodiment 42, wherein the truncation comprises a nucleotide substitution comprising the sequence GGAAGTAGCTTGTTTAA (SEQ ID NO: 241) from position 1982 to position 1998 of SEQ ID NO: 132. Embodiment 44: 43. The engineered CCL3 promoter of embodiment 42, wherein the truncation comprises a nucleotide deletion from position 1982 to position 1998 of SEQ ID NO:132. Embodiment 45: 45. The engineered CCL3 promoter of any one of embodiments 1-44, wherein the truncation comprises truncation of at least two nucleotide motifs. Embodiment 46: 46. ​​The engineered CCL3 promoter of any one of embodiments 1-45, wherein the truncation comprises truncation of at least three nucleotide motifs. Embodiment 47: 47. The engineered CCL3 promoter of any one of embodiments 1-46, wherein the truncation comprises truncation of at least four nucleotide motifs. Embodiment 48: 48. The engineered CCL3 promoter of any one of embodiments 1-47, wherein the truncation comprises truncation of at least five nucleotide motifs. Embodiment 49: 49. The engineered CCL3 promoter of any one of embodiments 1-48, wherein the truncation comprises truncation of at least six nucleotide motifs. Embodiment 50: At least six nucleotide motifs a. A nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132; b. A nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132; c. a nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132; d. a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132; e. a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132; and f. The engineered CCL3 promoter of embodiment 49, comprising a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO: 132. Embodiment 51: 51. The engineered CCL3 promoter of embodiment 50, wherein the excision of at least six nucleotide motifs comprises a deletion corresponding to position 566 to position 1199 of SEQ ID NO:132. Embodiment 52: 51. The engineered CCL3 promoter of embodiment 50, wherein the excision of at least six nucleotide motifs comprises a deletion corresponding to position 550 to position 1259 of SEQ ID NO:132. Embodiment 53: 52. The engineered CCL3 promoter of embodiment 50 or embodiment 51, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132. Embodiment 54: 53. The engineered CCL3 promoter of embodiment 52, wherein the excision of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 55: 55. The engineered CCL3 promoter of embodiment 52 or embodiment 54, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1681 to position 1692 of SEQ ID NO: 132. Embodiment 56: 56. The engineered CCL3 promoter of embodiment 55, wherein the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) at position 1681 to position 1692 of SEQ ID NO: 132. Embodiment 57: 57. The engineered CCL3 promoter of embodiment 56, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:2. Embodiment 58: 57. The engineered CCL3 promoter of embodiment 56, wherein the excision of the nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 59: 58. The engineered CCL3 promoter of any one of embodiments 52-57, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO: 132. Embodiment 60: 60. The engineered CCL3 promoter of embodiment 59, wherein the excision of the nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 61: 58. The engineered CCL3 promoter of embodiment 57, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:1. Embodiment 62: 61. The engineered CCL3 promoter of any one of embodiments 1-60, wherein the truncation comprises truncation of at least nine nucleotide motifs. Embodiment 63: At least nine nucleotide motifs: A nucleotide motif corresponding to positions 566 to 576 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 674 to 695 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 820 to 832 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1089 to 1105 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1184 to 1199 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO: 132, and 62. The engineered CCL3 promoter of embodiment 61, comprising a nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO: 132. Embodiment 64: 64. The engineered CCL3 promoter of embodiment 63, wherein the truncation comprises a deletion of each of the at least nine nucleotide motifs. Embodiment 65: 64. The engineered CCL3 promoter of embodiment 62 or embodiment 63, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:3. Embodiment 66: At least nine nucleotide motifs: A nucleotide motif corresponding to positions 566 to 576 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 674 to 695 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 820 to 832 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 911 to 926 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1089 to 1105 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1184 to 1199 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1211 to 1223 of SEQ ID NO: 132, and 63. The engineered CCL3 promoter of embodiment 62, comprising a nucleotide motif corresponding to positions 1236-1248 of SEQ ID NO: 132. Embodiment 67: 63. The engineered CCL3 promoter of embodiment 62, wherein the excision of at least nine nucleotide motifs comprises a deletion corresponding to position 556 to position 1248 of SEQ ID NO: 132. Embodiment 68: 63. The engineered CCL3 promoter of embodiment 62, wherein the excision of at least nine nucleotide motifs comprises a deletion corresponding to position 550 to position 1250 of SEQ ID NO:132. 69. 69. The engineered CCL3 promoter of embodiment 68, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1425 to position 1445 of SEQ ID NO: 132. Embodiment 70: 70. The engineered CCL3 promoter of embodiment 69, wherein the excision of the nucleotide motif corresponding to positions 1425 to 1445 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 71: 71. The engineered CCL3 promoter of any one of embodiments 68-70, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO: 132. Embodiment 72: 72. The engineered CCL3 promoter of embodiment 71, wherein the excision of the nucleotide motif corresponding to positions 1475-1500 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 73: 73. The engineered CCL3 promoter of any one of embodiments 68-72, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132. Embodiment 74: 74. The engineered CCL3 promoter of embodiment 73, wherein the excision of the nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 75: 75. The engineered CCL3 promoter of any one of embodiments 68-74, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO: 132. EMBODIMENT 76: 76. The engineered CCL3 promoter of embodiment 75, wherein the excision of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. EMBODIMENT 77: 77. The engineered CCL3 promoter of any one of embodiments 68 to 76, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to positions 1681 to 1692 of SEQ ID NO: 132. EMBODIMENT 78: 78. The engineered CCL3 promoter of embodiment 77, wherein the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) at position 1681 to position 1692 of SEQ ID NO: 132. EMBODIMENT 79: 79. The engineered CCL3 promoter of embodiment 78, wherein the CCL3 promoter comprises SEQ ID NO:242. Embodiment 80: 73. The engineered CCL3 promoter of any one of embodiments 68-72, wherein the truncation comprises a deletion of at least two nucleotide motifs according to position 1425 to position 1500 of SEQ ID NO: 132. Embodiment 81: 81. The engineered CCL3 promoter of embodiment 80, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132. Embodiment 82: 82. The engineered CCL3 promoter of embodiment 81, wherein the excision of the nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 83: 83. The engineered CCL3 promoter of any one of embodiments 80-82, wherein the truncation further comprises truncation of a nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO: 132. EMBODIMENT 84: 84. The engineered CCL3 promoter of embodiment 83, wherein the excision of the nucleotide motif corresponding to positions 1663 to 1679 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif. Embodiment 85: 85. The engineered CCL3 promoter of any one of embodiments 80 to 84, wherein at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, the motif corresponding to positions 1681 to 1692 of SEQ ID NO: 132. EMBODIMENT 86: 86. The engineered CCL3 promoter of embodiment 85, wherein the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) at position 1681 to position 1692 of SEQ ID NO: 132. Embodiment 87: 87. The engineered CCL3 promoter of any one of embodiments 80-86, wherein the truncation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132. EMBODIMENT 88: 88. The engineered CCL3 promoter of embodiment 87, wherein the CCL3 promoter comprises SEQ ID NO:243. EMBODIMENT 89: 89. The engineered CCL3 promoter of embodiment 87 or 88, wherein the truncation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO: 132. Embodiment 90: 90. The engineered CCL3 promoter of embodiment 89, wherein the CCL3 promoter comprises SEQ ID NO:244. EMBODIMENT 91: 90. The engineered CCL3 promoter of any one of embodiments 80-89, wherein the truncation further comprises a deletion from position 1663 to position 1692 of SEQ ID NO:132. EMBODIMENT 92: 92. The engineered CCL3 promoter of embodiment 91, wherein the truncation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132. EMBODIMENT 93: 93. The engineered CCL3 promoter of any one of embodiments 91-92, wherein the truncation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132. EMBODIMENT 94: 94. The engineered CCL3 promoter of any one of embodiments 91-93, wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 245. EMBODIMENT 95: An engineered CCL3 promoter comprising at least one nucleotide motif. EMBODIMENT 96: At least one nucleotide motif is A nucleotide motif corresponding to positions 60 to 77 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 92 to 111 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 201 to 224 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 231 to 243 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 307 to 324 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 376 to 388 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 452 to 475 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 494 to 507 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 533 to 549 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1260 to 1288 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1345 to 1363 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1534 to 1544 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1634 to 1645 of SEQ ID NO: 132, and Nucleotide motif corresponding to positions 1840 to 1861 of SEQ ID NO: 132 96. The engineered CCL3 promoter of embodiment 95, selected from the group consisting of: EMBODIMENT 97: 96. The engineered CCL3 promoter of embodiment 95, comprising at least 15 nucleotide motifs including: A nucleotide motif corresponding to positions 60 to 77 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 92 to 111 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 201 to 224 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 231 to 243 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 307 to 324 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 376 to 388 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 452 to 475 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 494 to 507 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 533 to 549 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1260 to 1288 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1345 to 1363 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1534 to 1544 of SEQ ID NO: 132; A nucleotide motif corresponding to positions 1634 to 1645 of SEQ ID NO: 132, and A nucleotide motif corresponding to positions 1840 to 1861 of SEQ ID NO:132. EMBODIMENT 98: 98. The engineered CCL3 promoter of any one of embodiments 95-97, wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 246. EMBODIMENT 99: 1. An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:1. EMBODIMENT 100: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:2. EMBODIMENT 101: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:3. EMBODIMENT 102: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:4. EMBODIMENT 103: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:242. EMBODIMENT 104: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:243. EMBODIMENT 105: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:244. EMBODIMENT 106: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO: 245. EMBODIMENT 107: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:246. EMBODIMENT 108: A heterologous construct comprising the engineered CCL3 promoter of any one of embodiments 1 to 107 operably linked to a polynucleotide comprising a polynucleotide sequence encoding a polypeptide. EMBODIMENT 109: The heterologous construct of embodiment 108, wherein the polypeptide comprises at least one effector molecule. EMBODIMENT 110: The heterologous construct of embodiment 108 or embodiment 109, wherein the polypeptide comprises a first effector molecule and a second effector molecule. EMBODIMENT 111: 111. The heterologous construct of embodiment 110, wherein the polynucleotide comprises a polynucleotide sequence encoding a first effector molecule, a linker polynucleotide sequence, and a polynucleotide sequence encoding a second effector. EMBODIMENT 112: The heterologous construct of embodiment 111, wherein the linker polynucleotide sequence encodes one or more 2A ribosomal skipping elements. EMBODIMENT 113: The heterologous construct of embodiment 112, wherein the one or more 2A ribosomal skipping elements comprise an element each selected from the group consisting of: P2A, T2A, E2A, and F2A. EMBODIMENT 114: A heterologous construct according to any one of embodiments 109 to 113, wherein at least one effector molecule is selected from the group consisting of therapeutic classes, the therapeutic classes being selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides, and enzymes. EMBODIMENT 115: A heterologous construct according to any one of embodiments 109 to 114, wherein each of the at least one effector molecule comprises a cytokine. EMBODIMENT 116: The heterologous construct of embodiment 115, wherein the cytokine is selected from the group consisting of: IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha. EMBODIMENT 117: A heterologous construct according to any one of embodiments 109 to 114, wherein each of the at least one effector molecule comprises a chemokine. EMBODIMENT 118: The heterologous construct of embodiment 117, wherein the chemokine is selected from the group consisting of: CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and XCL1. EMBODIMENT 119: A heterologous construct according to any one of embodiments 109 to 114, wherein each of the at least one effector molecule comprises a homing molecule. EMBODIMENT 120: The heterologous construct of embodiment 119, wherein the homing molecule is selected from the group consisting of anti-integrin alpha 4, beta 7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15. EMBODIMENT 121: A heterologous construct according to any one of embodiments 109 to 114, wherein each of the at least one effector molecule comprises a growth factor. EMBODIMENT 122: The heterologous construct of embodiment 121, wherein the growth factor is selected from the group consisting of: FLT3L and GM-CSF. EMBODIMENT 123: A heterologous construct according to any one of embodiments 109 to 114, wherein each of the at least one effector molecule comprises a co-activator molecule. EMBODIMENT 124: The heterologous construct of embodiment 123, wherein the co-activator molecule is selected from the group consisting of: c-Jun, 4-1BBL and CD40L. EMBODIMENT 125: A heterologous construct according to any one of embodiments 109 to 114, wherein each of the at least one effector molecule comprises a tumor microenvironment modifier. EMBODIMENT 126: The tumor microenvironment modifiers are selected from the group consisting of: The heterologous construct of embodiment 123, wherein the heterologous construct is selected from adenosine deaminase, a TGF beta inhibitor, an immune checkpoint inhibitor, a VEGF inhibitor, and HPGE2. EMBODIMENT 127: The heterologous construct of any one of embodiments 110 to 114, wherein each of the first effector molecule and the second effector molecule is from a different therapeutic class. EMBODIMENT 128: A heterologous construct according to any one of embodiments 109 to 127, wherein each of the at least one effector molecule is a human-derived effector molecule. EMBODIMENT 129: A vector comprising a heterologous construct according to any one of embodiments 108 to 128. EMBODIMENT 130: A dual expression vector comprising a heterologous construct according to any one of embodiments 108 to 128 and a second construct comprising a polynucleotide sequence encoding an activating immune receptor. EMBODIMENT 131: The dual expression vector of embodiment 130, wherein the activating immune receptor comprises an antigen recognition receptor. EMBODIMENT 132: The dual expression vector of embodiment 131, wherein the antigen recognition receptor comprises a T cell receptor (TCR). EMBODIMENT 133: The dual expression vector of embodiment 132, wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor. EMBODIMENT 134: The dual expression vector of embodiment 132 or embodiment 133, wherein the TCR is an endogenous T cell receptor. EMBODIMENT 135: The dual expression vector of embodiment 132 or embodiment 133, wherein the TCR is an exogenous T cell receptor. EMBODIMENT 136: The dual expression vector of embodiment 131, wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR). EMBODIMENT 137: An immunoresponsive cell comprising a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, or a dual expression vector according to any one of embodiments 130 to 136. EMBODIMENT 138: The immunoresponsive cell of embodiment 137, wherein the immunoresponsive cell is selected from the group consisting of: T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, bone marrow cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells. EMBODIMENT 139: The immunoresponsive cell of embodiment 137, wherein the immunoresponsive cell is a T cell. Embodiment 140: The immunoresponsive cell of embodiment 137, wherein the immunoresponsive cell is a NK cell. EMBODIMENT 141: The immunoresponsive cell of any one of embodiments 137 to 140, wherein the immunoresponsive cell expresses an activating immunoreceptor. EMBODIMENT 142: The immunoresponsive cell of embodiment 141, wherein the activating immune receptor comprises an antigen recognition receptor. EMBODIMENT 143: The immunoresponsive cell of embodiment 142, wherein the antigen recognition receptor comprises a T cell receptor (TCR). EMBODIMENT 144: The immunoresponsive cell of embodiment 143, wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor. EMBODIMENT 145: The immunoresponsive cell of embodiment 143 or 144, wherein the TCR is an endogenous T cell receptor. EMBODIMENT 146: The immunoresponsive cell of embodiment 143 or 144, wherein the TCR is an exogenous T cell receptor. EMBODIMENT 147: The immunoresponsive cell of embodiment 142, wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR). EMBODIMENT 148: The immunoresponsive cell of embodiment 142, wherein the antigen recognition receptor comprises an activating NK cell receptor. EMBODIMENT 149: The immunoresponsive cell of embodiment 148, wherein the activating NK cell receptor is selected from the group consisting of NKG2D, NKp30, NKp44, NKp46, and ITAM-containing killer cell Ig-like receptors (KIR). EMBODIMENT 150: The immunoresponsive cell of embodiment 148 or 149, wherein the activating NK cell receptor is NKG2D. EMBODIMENT 151: The immunoresponsive cell of embodiment 148 or 149, wherein the activating NK cell receptor is NKp30. EMBODIMENT 152: The immunoresponsive cell of embodiment 148 or 149, wherein the activating NK cell receptor is NKp44. EMBODIMENT 153: The immunoresponsive cell of embodiment 148 or 149, wherein the activating NK cell receptor is NKp46. EMBODIMENT 154: The immunoresponsive cell of embodiment 148 or 149, wherein the activating NK cell receptor is an ITAM-containing KIR. EMBODIMENT 155: The immunoresponsive cell of any one of embodiments 142 to 147, wherein the immunoresponsive cell comprises a heterologous construct encoding an antigen-recognizing receptor. EMBODIMENT 156: The immunoresponsive cell of any one of embodiments 137 to 155, wherein the immunoresponsive cell is autologous. EMBODIMENT 157: The immunoresponsive cell of any one of embodiments 137 to 155, wherein the immunoresponsive cell is allogeneic. EMBODIMENT 158: An engineered CCL3 promoter according to any one of embodiments 1 to 107, a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, a dual expression vector according to any one of embodiments 130 to 136, or an immunoresponsive cell according to any one of embodiments 137 to 157, A pharma- ceutically acceptable carrier, a pharma-ceutically acceptable excipient, or a combination thereof. 13. A pharmaceutical composition comprising: EMBODIMENT 159: A method for increasing expression of a target gene, comprising the use of an engineered CCL3 promoter according to any one of embodiments 1 to 98, a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, or a dual expression vector according to any one of embodiments 130 to 136 for increasing expression of the target gene. EMBODIMENT 160: 160. The method of embodiment 159, wherein the target gene is an immunomodulatory gene. EMBODIMENT 161: A method of treating a subject in need thereof, comprising administering a therapeutically effective dose of an engineered CCL3 promoter according to any one of embodiments 1 to 107, a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, a dual expression vector according to any one of embodiments 130 to 136, an immunoresponsive cell according to any one of embodiments 137 to 157, or a pharmaceutical composition according to embodiment 158. EMBODIMENT 162: A method for stimulating a cell-mediated immune response in a subject, comprising administering to the subject a therapeutically effective dose of an engineered CCL3 promoter according to any one of embodiments 1 to 107, a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, a dual expression vector according to any one of embodiments 130 to 136, an immunoresponsive cell according to any one of embodiments 137 to 157, or a pharmaceutical composition according to embodiment 158. EMBODIMENT 163: A method for reducing tumor volume in a subject, comprising administering to a tumor-bearing subject a composition comprising an engineered CCL3 promoter according to any one of embodiments 1 to 107, a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, a dual expression vector according to any one of embodiments 130 to 136, an immunoresponsive cell according to any one of embodiments 137 to 157, or a pharmaceutical composition according to embodiment 158. EMBODIMENT 164: A method for providing anti-tumor immunity in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an engineered CCL3 promoter according to any one of embodiments 1-107, a heterologous construct according to any one of embodiments 108-128, a vector according to embodiment 56, a dual expression vector according to any one of embodiments 130-136, an immunoresponsive cell according to any one of embodiments 137-157, or a pharmaceutical composition according to embodiment 158. EMBODIMENT 165: A method of treating a subject having cancer, comprising administering to a subject in need thereof a therapeutically effective dose of an engineered CCL3 promoter according to any one of embodiments 1-107, a heterologous construct according to any one of embodiments 108-128, a vector according to embodiment 129, a dual expression vector according to any one of embodiments 130-136, an immunoresponsive cell according to any one of embodiments 137-157, or a pharmaceutical composition according to embodiment 158. EMBODIMENT 166: The method of any one of embodiments 134-138, wherein the method comprises administering an immunoresponsive cell. EMBODIMENT 167: A kit for treating and / or preventing a tumor, comprising an immunoresponsive cell according to any one of embodiments 137 to 157. EMBODIMENT 168: The kit of embodiment 167, wherein the kit further comprises written instructions for using the immunoresponsive cells to treat and / or prevent a tumor in a subject. EMBODIMENT 169: A kit for treating and / or preventing tumors, comprising a pharmaceutical composition according to embodiment 158. EMBODIMENT 170: The kit of embodiment 169, wherein the kit further comprises written instructions for using the pharmaceutical composition for treating and / or preventing a tumor in a subject. EXAMPLES

[0217] Below are examples of specific embodiments for carrying out the present disclosure. The examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

[0218] Efforts have been made to ensure accuracy with respect to numbers used (eg, amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0219] Example 1: Generation of CCL3 promoter excision series and evaluation in immunoresponsive cells To provide variants of the CCL3 promoter with reduced size, an engineering approach was attempted using the wild-type CCL3 promoter (SEQ ID NO: 132) as a template. Each regulatory element (e.g., transcription factor binding motif) was replaced with an artificial nucleotide sequence using standard molecular cloning techniques known in the art. After the introduction of the artificial nucleotide sequence, the new promoter sequence was bioinformatically analyzed to ensure that no new binding motifs were introduced. A total of 36 CCL3 promoter variants were produced. The sequences of these variants are provided in Table 1.

[0220] Inducibility of CCL3 promoter variants in T cells The CCL3 promoter variants were then tested for inducibility. Briefly, pan T cells were isolated from peripheral blood mononuclear cells (PBMCs) from apheresis packs and incubated with CD3 / CD28 antibody tagged beads at a 3:1 ratio for activation. After about 24 hours of incubation, pan T cells were co-transduced with a virus containing the CCL3 promoter driving mKate-PEST virus and an exemplary CAR (containing a GPC3-binding chimeric antigen receptor (CAR) with a CD8a hinge, CD8a transmembrane domain, and 4-1BB / CD3 zeta intracellular domain). After about 72 hours, the beads were washed. About 20,000 transduced pan T cells were seeded per well on a 96-well plate and allowed to attach for about 24 hours. The transduced pan T cells were activated with CD3 / CD28 beads at a 1:1 ratio for about 48 hours. Activated pan T cells were then quantified by flow cytometry for mCherry (mKate) and YFP (GPC3) expression.

[0221] Quantification of fluorescence is shown in Figure 1 and was normalized to the wild-type CCL3 promoter (SEQ ID NO: 132). The CCL3 promoter variants demonstrating the highest levels of inducibility were 4153 (SEQ ID NO: 161), 4141 (SEQ ID NO: 149), 4137 (SEQ ID NO: 145), 4136 (SEQ ID NO: 144), 4149 (SEQ ID NO: 157), 4135 (SEQ ID NO: 143), 4139 (SEQ ID NO: 147), and 4140 (SEQ ID NO: 148).

[0222] Inducibility of CCL3 promoter variants in natural killer (NK) cells Natural killer (NK) cells derived from human donors were activated with irradiated K562 feeder cells that display membrane-bound IL-21 and membrane-bound IL-15. 10 days after activation, NK cells were virally transduced. The medium was changed after 24 hours, and the cells were then rested until day 18. NK cells were virally transduced for the eight CCL3 promoter variants that show the highest level of inducibility in T cells (4153, 4141, 4137, 4136, 4149, 4135, 4139, and 4140) as described above. After about eight days of incubation, NK cells were activated by co-culturing with Huh7 cells at a 1:1 ratio, and the cells were co-cultured for a total of either about 24 hours or about 48 hours of incubation. NK cells, both activated and non-activated, were then assessed for mCherry (mKate) by flow cytometry. The wild-type CCL3 promoter (2935), SFFV mKate (1682), and 2096 (NFAT mKate) were used as controls.

[0223] Quantification of the fluorescent signal is shown in Figures 2A and 2B. Induction was observed for all constructs after activation for either 24 hours (Figure 2A) or 48 hours (Figure 2B).

[0224] FIG. 3A shows histograms depicting the geometric mean fluorescence intensity (gMFI) for mKate (mCherry) of activated and non-activated NK cells after 24 hours of stimulation. The 4153 promoter variant exhibited the highest mCherry fluorescence fold change compared to other CCL3 promoter variants, and the fold change was comparable to that observed in the NFAT promoter (2096) control. The mCherry fold change is demonstrated in FIG. 3B. As shown in FIG. 3C and FIG. 3D (which has 1682 removed due to its outlier level of gMFI), which depicts stimulated NK cells plotted against non-stimulated NK cells, variants 4137, 4136, 4153 had the highest gMFI when stimulated for 24 hours, and low basal levels of mCherry expression compared to the control. Also, as can be seen in both Figures 3C and 3D, the 2096 promoter results in higher levels of expression in both stimulated and unstimulated cells, thus one advantage of the CCL3 promoter variant is its inducibility upon NK cell activation, but with less leakiness (i.e., lower baseline expression) than the NFAT promoter.

[0225] FIG. 4A shows histograms depicting the geometric mean fluorescence intensity (gMFI) for mKate (mCherry) of activated and non-activated NK cells after 48 hours of stimulation. The 4153 promoter variant exhibited the highest mCherry fluorescence fold change compared to other CCL3 promoter variants, and the fold change was higher than the CCL3 promoter control (2935). The mCherry fold change is demonstrated in FIG. 4B. As shown in FIG. 4C and FIG. 4D (with 1682 removed due to its outlier level of gMFI) for stimulated NK cells plotted against non-stimulated NK cells, variant 4153 exhibited the highest gMFI when stimulated for 48 hours, and low basal mCherry expression compared to the control.

[0226] While the above studies were initially designed to determine a CCL3 promoter with reduced size, it was surprisingly observed that excision of specific nucleotide motifs in the CCL3 promoter provided enhanced inducibility of the variant promoter compared to the wild-type promoter.

[0227] Example 2: Generation and evaluation of CCL3 promoter deletions in immunoresponsive cells To reduce the size of the CCL3 promoter with enhanced inducibility, deletion variants were engineered to include deletions at substituted positions in the excised patch, as provided in Example 1.

[0228] The first promoter variant construct, 5958, was engineered to contain deletions of motifs at each excision patch replaced in the following constructs: 4141, 4137, 4136, 4135, 4139, 4140, 4148, 4150, and 4153. The second promoter variant construct, 5959, was engineered to delete, including but not limited to, the nucleotide sequence between the excision patches replaced in the 4134 and 4145 constructs (positions 550 to 1259 of SEQ ID NO:132) and replace the wild type sequence (AGAAACCATTTC SEQ ID NO:226) with the sequence of the excision patch replacement of 4153 (i.e., the nucleotide replacement containing the sequence ATTGCGTCAATT (SEQ ID NO:227) from position 1681 to position 1692 of SEQ ID NO:132). A third promoter variant construct 5960 was engineered to include, but is not limited to, a deletion of the nucleotide sequence between the excision patches replaced in the 4134 and 4145 constructs (positions 550 to 1259 of SEQ ID NO: 132), a deletion of the sequences of the excision patch replacements of 4148 and 4150, and an excision patch replacement sequence of 4153. Each of these deletion-containing constructs contained a secreted blue fluorescent protein (sec-BFP) reporter. In addition, a fourth promoter construct 5957 was engineered to contain the same excision patch replacement as 4153 and to contain a sec-BFP reporter. The sequences of these four promoter variants are provided in Table 1.

[0229] T cells isolated from apheresis pack-derived PBMCs were transduced with the four CCL3 promoter variant constructs described in Example 1 above. T cells were transduced 24 hours after activation as described above. Two days after transduction, BFP expression was assessed by flow cytometry. For each of the four transductions, approximately 70% of the cells were BFP positive on day 2 (data not shown). On day 11 after transduction, T cells were transduced in 1: Cells were restimulated with Dynabeads coated with anti-CD3 and anti-CD28 agonist antibodies at a bead-to-cell ratio of 1, or not stimulated as a control. Cells were seeded at 200,000 cells / well two days prior to bead stimulation. Two days after bead stimulation, BFP expression was assessed again and bead-stimulated vs. unstimulated BFP levels were compared for each construct.

[0230] The geometric mean fluorescence intensity (gMFI) and fold change between stimulations are shown in Figures 5A and 5B, respectively. As shown in Figure 5B, each of the four constructs had at least a 10-fold increase in BFP expression for bead-stimulated T cells compared to unstimulated cells. This increased inducibility of the CCL3 promoter can be achieved by deleting the nucleotide sequences of the excision patches identified in Example 1. In addition, increased inducibility can be obtained by deleting the sequences including and between many of the excision patches identified in Example 1, which can beneficially reduce the size of the promoter to more than 700 nucleotides.

[0231] Example 3: Generation and evaluation of additional CCL3 promoter deletions in immunoresponsive cells Additional CCL3 promoter deletions were generated and tested.

[0232] The first promoter variant construct, 5957, was generated as previously described in Example 2.

[0233] A second promoter variant construct, 7293, was engineered to delete nucleotide sequences between but not including the excision patches replaced in the 4134 and 4145 constructs (positions 550 to 1259 of SEQ ID NO:132), to delete the sequences of the excision patch replacements of 4147, 4148, 4150, and 4152, and to include the excision patch replacement sequence of 4153. A third promoter variant construct, 7294, was engineered to delete nucleotide sequences between but not including the excision patches replaced in the 4134 and 4145 constructs (positions 550 to 1259 of SEQ ID NO:132), to delete the sequences of the excision patch replacements of 4150 and 4152, to include the excision patch replacement sequence of 4153, and to delete nucleotide sequences between and including the excision patches in the 4154 and 4156 constructs.

[0234] The third promoter variant construct, 7295, was engineered to delete nucleotide sequences between, but not including, the excision patches replaced in the 4134 and 4145 constructs (positions 550-1259 of SEQ ID NO:132), delete sequences including and between the excision patch replacements of 4147 and 4148 (from positions 1425-1500 of SEQ ID NO:132), delete the excision patch replacement of 4150, delete the excision patch replacement of 4152, delete sequences including and between the excision patch replacements of 4154 and 4156 (from positions 1750-1818 of SEQ ID NO:132), delete sequences including and between the excision patch replacements of 4158 and 4160 (from positions 1867-2000 of SEQ ID NO:132), and include the excision patch replacement sequence of 4153.

[0235] A fourth promoter variant construct, 7296, was engineered to delete nucleotide sequences between but not including the excision patches substituted in the 4134 and 4145 constructs (positions 550-1259 of SEQ ID NO:132), delete sequences including and between the 4147 and 4148 excision patch replacements (from positions 1425-1500 of SEQ ID NO:132), delete the 4150 excision patch replacement, delete sequences including and between the 4152 and 4156 excision patch replacements (from positions 1663-1818 of SEQ ID NO:132), and delete sequences including and between the 4158 and 4160 excision patch replacements (from positions 1867-2000 of SEQ ID NO:132). Each of these deletion-containing constructs contained a secreted blue fluorescent protein (sec-BFP) reporter. The sequences of these promoter variants are provided in Table 1.

[0236] A fifth promoter variant construct, 7297, was engineered to generate a small promoter containing excised patches of 4125, 4126, 4127, 4128, 4129, 4130, 4131, 4132, 4133, 4134, 4145, 4146, 4149, 4151, and 4157.

[0237] T cells isolated from apheresis pack-derived PBMCs were transduced with CCL3 promoter variant constructs as previously described. T cells were transduced 24 hours after activation as described above. On day 2 after transduction, BFP expression was assessed by flow cytometry. For each transduction, approximately 70% of the cells were BFP positive on day 2 (data not shown). On day 11 after transduction, T cells were transduced at 1: Cells were restimulated with Dynabeads coated with anti-CD3 and anti-CD28 agonist antibodies at a bead-to-cell ratio of 1, or not stimulated as a control. Cells were seeded at 200,000 cells / well two days prior to bead stimulation. Two days after bead stimulation, BFP expression was assessed again and bead-stimulated vs. unstimulated BFP levels were compared for each construct.

[0238] The geometric mean fluorescence intensity (gMFI) and the fold change between stimulated vs. unstimulated are shown in Figures 6A and 6B, respectively. As shown in Figure 6B, except for construct 7297, the constructs had an increase in BFP expression for bead-stimulated T cells compared to unstimulated cells. This increased inducibility of the CCL3 promoter can be achieved by deleting the nucleotide sequences of the excision patches identified in Example 1. In addition, increased inducibility can be obtained by deleting the sequences including and between many of the excision patches identified in Example 1, thereby beneficially reducing the size of the promoter.

[0239] interpretation All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may include the entire document.

[0240] The indefinite articles "a" and "an," as used herein in the specification and claims, unless clearly indicated to the contrary, should be understood to mean "at least one."

[0241] It should also be understood that, unless expressly stated to the contrary, in any method claimed herein that includes two or more steps or actions, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are described.

[0242] In the claims, as well as in the above specification, all transitional phrases, such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as set forth in Section 2111.03 of the United States Patent Office Manual of Patent Examining Procedure.

Claims

1. an engineered CCL3 promoter comprising an excision of at least one nucleotide motif, wherein said excision increases the inducibility of said engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal; optionally, the wild-type CCL3 promoter comprises the nucleotide sequence of SEQ ID NO: 132, and optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; Optionally, the motif comprises a sequence selected from the group consisting of positions 566 to 576 of SEQ ID NO:132, positions 674 to 695 of SEQ ID NO:132, positions 820 to 832 of SEQ ID NO:132, positions 1089 to 1105 of SEQ ID NO:132, positions 1127 to 1141 of SEQ ID NO:132, positions 1184 to 1199 of SEQ ID NO:132, positions 1475 to 1500 of SEQ ID NO:132, positions 1534 to 1544 of SEQ ID NO:132, positions 1553 to 1595 of SEQ ID NO:132, positions 1634 to 1674 of SEQ ID NO:132, positions 1681 to 1692 of SEQ ID NO:132, and positions 1982 to 1998 of SEQ ID NO:132; optionally, the truncation comprises a substitution or deletion of one or more nucleotides of the at least one nucleotide motif, and optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; Optionally, the motif corresponds to position 566 to position 576 of SEQ ID NO:132; optionally, the truncation comprises a nucleotide substitution comprising the sequence GTACCAGAATA (SEQ ID NO:191) from position 566 to position 576 of SEQ ID NO:132; optionally, the truncation comprises a nucleotide deletion from position 566 to position 576 of SEQ ID NO:132; optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132; optionally, the motif corresponds to position 674 to position 695 of SEQ ID NO:132; and optionally, the truncation comprises and optionally, said truncation comprises a nucleotide substitution comprising the sequence TATATACCAGCGAGTTCGATAA (SEQ ID NO:193) from position 674 to position 695 of SEQ ID NO:132, and optionally, said truncation comprises a nucleotide deletion from position 674 to position 695 of SEQ ID NO:132, and optionally, said at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, and optionally, said motif corresponds to position 820 to position 832 of SEQ ID NO:132, and optionally, said truncation comprises a nucleotide substitution comprising the sequence ACGAAGCAATACT from position 820 to position 832 of SEQ ID NO:

132. (SEQ ID NO:195), optionally wherein the excision comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the excision comprises a nucleotide substitution from position 1089 to position 1105 of SEQ ID NO:132 comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199), and optionally, said at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally said motif corresponding to position 1127 to position 1141 of SEQ ID NO:132, and optionally said truncation comprises a nucleotide substitution comprising the sequence CCATAGTGAGGAAAT (SEQ ID NO:201) from position 1127 to position 1141 of SEQ ID NO:132, and optionally said truncation comprises a nucleotide deletion from position 1127 to position 1141 of SEQ ID NO:132, and optionallyThe at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1184 to position 1199 of SEQ ID NO:132, and optionally wherein the excision comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO:203) from position 1184 to position 1199 of SEQ ID NO:132, and optionally wherein the excision comprises a nucleotide deletion from position 1184 to position 1199 of SEQ ID NO:132, and optionally wherein the at least one nucleotide motif comprises a nucleotide substitution from position 1184 to position 1199 of SEQ ID NO:

132. and optionally, the truncation comprises a nucleotide substitution comprising the sequence CCGATCTCTAGTTAAGTTAGCTGTAT (SEQ ID NO:217) from position 1475 to position 1500 of SEQ ID NO:132, and optionally, the truncation comprises a nucleotide deletion from position 1475 to position 1500 of SEQ ID NO:132, and optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, and optionally, wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO:132; optionally, the truncation comprises a nucleotide substitution comprising the sequence GTAGAACTCTT (SEQ ID NO:219) from position 1534 to position 1544 of SEQ ID NO:132; optionally, the truncation comprises a nucleotide deletion from position 1534 to position 1544 of SEQ ID NO:132; optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132; optionally, the motif corresponds to position 1553 to position 1595 of SEQ ID NO:132; wherein the excision comprises a nucleotide substitution comprising the sequence AATACCTTGGTGGAGCTCATCTAATATCTTCATATTACCTCCA (SEQ ID NO:221) from position 1553 to position 1595 of SEQ ID NO:132; optionally, the excision comprises a nucleotide deletion from position 1553 to position 1595 of SEQ ID NO:132; optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132; optionally, the motif corresponds to position 1634 to position 1645 of SEQ ID NO:132; and optionally, the excision comprisesand optionally, said at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein said motif corresponds to position 1663 to position 1674 of SEQ ID NO:132; and optionally, said excision comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO:223) from position 1634 to position 1645 of SEQ ID NO:132; and optionally, said excision comprises a nucleotide deletion from position 1634 to position 1645 of SEQ ID NO:132; and optionally, said at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, wherein said motif corresponds to position 1663 to position 1674 of SEQ ID NO:132; and optionally, said excision comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO:132 comprising the sequence TATACCTTGGTT (SEQ ID NO:225) from position 1663 to position 1674 of SEQ ID NO:

132. optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, the motif corresponding to position 1681 to position 1692 of SEQ ID NO:132, optionally, the truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO:227) from position 1681 to position 1692 of SEQ ID NO:132, and optionally, the engineered CCL3 promoter comprises the polynucleotide of SEQ ID NO:4; optionally, the excision comprises a nucleotide deletion from position 1681 to position 1692 of SEQ ID NO:132, optionally the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally the motif corresponds to position 1982 to position 1998 of SEQ ID NO:132, optionally the excision comprises a nucleotide substitution comprising the sequence GGAAGTAGCTTGTTTAA (SEQ ID NO:241) from position 1982 to position 1998 of SEQ ID NO:132, optionally the excision comprises a nucleotide deletion from position 1982 to position 1998 of SEQ ID NO:132; Optionally, the excision comprises excision of at least two nucleotide motifs, at least three nucleotide motifs, at least four nucleotide motifs, at least five nucleotide motifs, or at least six nucleotide motifs; Optionally, the at least six nucleotide motifs comprise a nucleotide motif corresponding to positions 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO:132, and a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO:132; optionally, the excision of the at least six nucleotide motifs comprises a deletion corresponding to position 566 to position 1199 of SEQ ID NO:132, optionally, the excision of the at least six nucleotide motifs comprises a deletion corresponding to position 550 to position 1259 of SEQ ID NO:132, optionally, the excision further comprises an excision of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132, optionally, the excision of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, optionally, the excision further comprises an excision of a nucleotide motif corresponding to position 1681 to position 1692 of SEQ ID NO:132, optionally, the excision comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO:227) from position 1681 to position 1692 of SEQ ID NO:132, and optionally, the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:2; optionally, said excision of the nucleotide motif corresponding to positions 1681 to 1692 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif; optionally, said excision further comprises excision of a nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132; optionally, said excision of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif; optionally, said engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 1; optionally, the excision comprises excision of at least nine nucleotide motifs, optionally comprising a nucleotide motif corresponding to positions 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1475-1500 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1553-1595 of SEQ ID NO:132, and a nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO:132; optionally, the excision comprises a deletion of each of the at least nine nucleotide motifs; optionally, the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:3; Optionally, the at least nine nucleotide motifs are a nucleotide motif corresponding to positions 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to positions 911-926 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1184-1189 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1190-1192 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1193-1194 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1195-1196 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1200-1202 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1210-1212 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1211-1214 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1212-1216 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1213-1218 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1214-1218 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1215-1219 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1216-1219 of SEQ ID NO:132, a nucleotide motif corresponding to positions 1217-1219 of SEQ and optionally, said excision of at least nine nucleotide motifs comprises a deletion corresponding to position 556 to position 1248 of SEQ ID NO:132; optionally, said excision of at least nine nucleotide motifs comprises a deletion corresponding to position 550 to position 1250 of SEQ ID NO:132; and optionally, said excision of at least nine nucleotide motifs comprises a deletion corresponding to position 1425 to position 1428 of SEQ ID NO:

132. and optionally, said excision of said nucleotide motif corresponding to positions 1425 to 1445 of SEQ ID NO:132 comprises a deletion of said nucleotide motif; and optionally, said excision further comprises excision of a nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO:132; and optionally, said excision of said nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO:132 comprises a deletion of said nucleotide motif; and optionally, said excision of a nucleotide motif corresponding to positions 1553 to 1555 of SEQ ID NO:

132. and optionally, said excision of said nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif; and optionally, said excision further comprises excision of a nucleotide motif corresponding to positions 1663 to 1679 of SEQ ID NO: 132; and optionally, said excision of said nucleotide motif corresponding to positions 1663 to 1679 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif; and optionally, said at least one nucleotide motif iscomprising a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein said motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132, and optionally wherein said truncation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, and optionally wherein said CCL3 promoter comprises SEQ ID NO: 242; Optionally, the excision comprises deletion of at least two nucleotide motifs according to position 1425 to position 1500 of SEQ ID NO:132, optionally, the excision further comprises excision of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132, optionally, the excision of the nucleotide motif corresponding to positions 1553 to 1595 of SEQ ID NO:132 comprises deletion of the nucleotide motif, optionally, the excision further comprises excision of a nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132, optionally, the excision of the nucleotide motif corresponding to positions 1663 to 1679 of SEQ ID NO:132 comprises deletion of the nucleotide motif, optionally, the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally, the motif comprises a sequence from position 1681 to position 1692 of SEQ ID NO:

132. and optionally, the excision comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO:227) from position 1681 to position 1692 of SEQ ID NO:132, and optionally, the excision further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132, and optionally, the CCL3 promoter comprises SEQ ID NO:243, and optionally, the excision further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132, and optionally, the CCL3 promoter comprises SEQ ID NO:244, and optionally the excision further comprises a deletion from position 1663 to position 1692 of SEQ ID NO:132, optionally the excision further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132, optionally the excision further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132, or optionally the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:

245. The engineered CCL3 promoter.

2. 1. An engineered CCL3 promoter comprising at least one nucleotide motif, Optionally, the at least one nucleotide motif is a) a nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132; b) a nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132; c) a nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132; d) a nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132; e) a nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132; f) a nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132; g) a nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132; h) a nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132; i) a nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132; k) a nucleotide motif corresponding to positions 533 to 549 of SEQ ID NO: 132; l) a nucleotide motif corresponding to positions 1260 to 1288 of SEQ ID NO: 132; m) a nucleotide motif corresponding to positions 1345 to 1363 of SEQ ID NO: 132; n) a nucleotide motif corresponding to positions 1534 to 1544 of SEQ ID NO: 132; o) a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132; and p) a nucleotide motif corresponding to positions 1840 to 1861 of SEQ ID NO: 132 or selected from the group consisting of: Optionally, the engineered CCL3 promoter comprises: a) a nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132; b) a nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132; c) a nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132; d) a nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132; e) a nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132; f) a nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132; g) a nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132; h) a nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132; i) a nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132; j) a nucleotide motif corresponding to positions 533 to 549 of SEQ ID NO: 132; k) a nucleotide motif corresponding to positions 1260 to 1288 of SEQ ID NO: 132; l) a nucleotide motif corresponding to positions 1345 to 1363 of SEQ ID NO: 132; m) a nucleotide motif corresponding to positions 1534 to 1544 of SEQ ID NO: 132; n) a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132; and o) a nucleotide motif corresponding to positions 1840 to 1861 of SEQ ID NO: 132 or, Optionally, the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:

246. The engineered CCL3 promoter.

3. An engineered CCL3 promoter comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-4 and 242-246.

4. A heterologous construct comprising the engineered CCL3 promoter of any one of claims 1 to 3 operably linked to a polynucleotide comprising a polynucleotide sequence encoding a polypeptide, Optionally, the polypeptide comprises at least one effector molecule; Optionally, the polypeptide comprises a first effector molecule and a second effector molecule; optionally, the polynucleotide comprises a polynucleotide sequence encoding the first effector molecule, a linker polynucleotide sequence, and a polynucleotide sequence encoding the second effector molecule; optionally, the linker polynucleotide sequence encodes one or more 2A ribosomal skipping elements, optionally the one or more 2A ribosomal skipping elements comprise elements each selected from the group consisting of P2A, T2A, E2A, and F2A; Optionally, the at least one effector molecule is selected from a therapeutic class, wherein the therapeutic class is selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, co-activation molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides, and enzymes; Optionally, each of said at least one effector molecule comprises: a) a cytokine, optionally selected from the group consisting of IL1-beta, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-gamma, and TNF-alpha; b) a chemokine, optionally selected from the group consisting of CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9, and XCL1; c) a homing molecule, optionally selected from the group consisting of anti-integrin alpha 4, beta 7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15; d) a growth factor, optionally selected from the group consisting of FLT3L and GM-CSF; e) a co-activator molecule, optionally selected from the group consisting of c-Jun, 4-1BBL, and CD40L; f) a tumor microenvironment modifier, optionally selected from the group consisting of adenosine deaminase, a TGFbeta inhibitor, an immune checkpoint inhibitor, a VEGF inhibitor, and HPGE2; Including, Optionally, each of the first effector molecule and the second effector molecule is from a different therapeutic class; and Optionally, each of the at least one effector molecule is a human-derived effector molecule. The heterologous construct.

5. A vector comprising the heterologous construct of claim 4.

6. 10. A dual expression vector comprising the heterologous construct of claim 4 and a second construct comprising a polynucleotide sequence encoding an activating immunoreceptor, optionally wherein the activating immunoreceptor comprises an antigen-recognizing receptor; optionally, the antigen-recognizing receptor comprises a T cell receptor (TCR), optionally, the TCR is an endogenous T cell receptor or an exogenous T cell receptor; and Optionally, the antigen recognition receptor comprises a chimeric antigen receptor (CAR). The dual expression vector.

7. 5. An immunoresponsive cell comprising the heterologous construct of claim 4, Optionally, the immunoresponsive cells are selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor-infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, erythrocytes, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells; optionally, the immunoresponsive cell expresses an activating immunoreceptor, optionally, the activating immunoreceptor comprises an antigen-recognizing receptor, optionally, the antigen-recognizing receptor comprises a T cell receptor (TCR), optionally, the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and optionally, the antigen-recognizing receptor comprises a chimeric antigen receptor (CAR); optionally, the antigen-recognizing receptor comprises an activating NK cell receptor, and optionally, the activating NK cell receptor is selected from the group consisting of NKG2D, NKp30, NKp44, NKp46, and an ITAM-containing killer cell Ig-like receptor (KIR); Optionally, the immunoresponsive cell comprises a heterologous construct encoding the antigen-recognizing receptor; and Optionally, the immunoresponsive cells are autologous; or optionally, the immunoresponsive cells are allogeneic. The immunoresponsive cell.

8. An immunoresponsive cell comprising the dual expression vector of claim 6, Optionally, the immunoresponsive cells are selected from the group consisting of T cells, CD8+ T cells, CD4+ T cells, gamma delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor-infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, erythrocytes, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells; optionally, the immunoresponsive cell expresses an activating immunoreceptor, optionally, the activating immunoreceptor comprises an antigen-recognizing receptor, optionally, the antigen-recognizing receptor comprises a T cell receptor (TCR), optionally, the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and optionally, the antigen-recognizing receptor comprises a chimeric antigen receptor (CAR); optionally, the antigen-recognizing receptor comprises an activating NK cell receptor, and optionally, the activating NK cell receptor is selected from the group consisting of NKG2D, NKp30, NKp44, NKp46, and an ITAM-containing killer cell Ig-like receptor (KIR); Optionally, the immunoresponsive cell comprises a heterologous construct encoding the antigen-recognizing receptor; and Optionally, the immunoresponsive cells are autologous; or optionally, the immunoresponsive cells are allogeneic. The immunoresponsive cell.

9. A pharmaceutical composition comprising the engineered CCL3 promoter of any one of claims 1 to 3 and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

10. A pharmaceutical composition comprising the heterologous construct of claim 4 and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

11. A pharmaceutical composition comprising the dual expression vector of claim 6, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

12. A pharmaceutical composition comprising the immunoresponsive cells of claim 7, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

13. A pharmaceutical composition comprising the immunoresponsive cells of claim 8, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

14. 10. A method for increasing expression of a target gene, said method comprising use of the engineered CCL3 promoter of any one of claims 1 to 3 to increase expression of said target gene, optionally wherein said target gene is an immunomodulatory gene.

15. A method for increasing expression of a target gene, the method comprising the use of a heterologous construct described in claim 4 to increase expression of the target gene, and optionally, the target gene is an immunomodulatory gene.

16. A method for increasing expression of a target gene, the method comprising the use of a dual expression vector described in claim 6 to increase expression of the target gene, and optionally, the target gene is an immunomodulatory gene.

17. 11. The pharmaceutical composition of claim 10 for use in treating a subject in need thereof.

18. The pharmaceutical composition of claim 11 for use in treating a subject in need thereof.

19. The pharmaceutical composition of claim 12 for use in treating a subject in need thereof.

20. The pharmaceutical composition of claim 13 for use in treating a subject in need thereof.

21. The pharmaceutical composition of claim 10 for use in stimulating a cell-mediated immune response in a subject in need thereof.

22. The pharmaceutical composition of claim 11 for use in stimulating a cell-mediated immune response in a subject in need thereof.

23. The pharmaceutical composition of claim 12 for use in stimulating a cell-mediated immune response in a subject in need thereof.

24. The pharmaceutical composition of claim 13 for use in stimulating a cell-mediated immune response in a subject in need thereof.

25. The pharmaceutical composition of claim 10 for use in reducing tumor volume in a subject in need thereof.

26. The pharmaceutical composition of claim 11 for use in reducing tumor volume in a subject in need thereof.

27. The pharmaceutical composition of claim 12 for use in reducing tumor volume in a subject in need thereof.

28. The pharmaceutical composition of claim 13 for use in reducing tumor volume in a subject in need thereof.

29. The pharmaceutical composition of claim 10 for providing anti-tumor immunity in a subject in need thereof.

30. The pharmaceutical composition of claim 11 for providing anti-tumor immunity in a subject in need thereof.

31. The pharmaceutical composition of claim 12 for providing anti-tumor immunity in a subject in need thereof.

32. The pharmaceutical composition of claim 13 for providing anti-tumor immunity in a subject in need thereof.

33. The pharmaceutical composition of claim 10 for use in treating cancer in a subject in need thereof.

34. The pharmaceutical composition of claim 11 for use in treating cancer in a subject in need thereof.

35. The pharmaceutical composition of claim 12 for use in treating cancer in a subject in need thereof.

36. The pharmaceutical composition of claim 13 for use in treating cancer in a subject in need thereof.

37. 10. A kit for treating and / or preventing a tumor, comprising the immunoresponsive cells of claim 7, and optionally further comprising written instructions for using the immunoresponsive cells or pharmaceutical composition to treat and / or prevent the tumor in a subject.

Images