Compositions and methods for treating muscle atrophy and myotonic dystrophies

Abstract

To provide compositions and methods for treating muscle atrophy and myotonic dystrophies.SOLUTION: This application discloses a polynucleic acid molecule conjugate comprising an antibody or binding fragment thereof conjugated to a polynucleic acid molecule that hybridizes to a target sequence of an atrogene, wherein the polynucleic acid molecule comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety, and the polynucleic acid molecule conjugate mediates RNA interference against the atrogene, thereby treating muscle atrophy or myotonic dystrophy in a subject. In a certain embodiment, atrogene comprises atrogin-1 gene (FBXO32), MuRF1 gene (TRIA63), FOXO1, FOXO3, or MSTN.SELECTED DRAWING: Figure 19A

Description

[Technical field]

[0001] cross reference This application is a continuation of U.S. Provisional Patent Application No. 62 / 595,545, filed December 6, 2017. No. 62 / 725,883, filed August 31, 2018. No. 6,393,633, each of which is incorporated herein by reference in its entirety. Can be enjoyed.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in ASCII format. , which is incorporated herein by reference in its entirety. The above ASCII copy is in the file name 45532-722_601_SL.txt and has a size of 3,143,382 bytes. [Background technology]

[0003] Gene suppression by RNA-induced gene silencing is regulated at multiple levels: transcription Inactivation, small interfering RNA (siRNA)-induced mRNA reduction, and siRNA-induced transcription In some instances, RNA interference (RNAi) provides transcriptional attenuation over multiple cell divisions. RNAi has a long-lasting effect on the target of a drug and a gene. This represents a viable methodology that can aid in function analysis, pathway analysis, and disease treatment. Summary of the Invention

[0004] In one embodiment, a muscle atrophy (or atrogene)-associated Disclosed herein are polynucleic acid molecules and pharmaceutical compositions for regulating certain genes. In some embodiments, the polynucleic acid molecules or polynucleic acid molecule conjugates disclosed herein Also described herein are methods for treating muscle wasting in the body.

[0005] In certain embodiments, the compound of formula (I): (AX 1 -BX 2 The molecule of formula I is In the specification, A is a binding moiety; B is a hybridizable moiety that hybridizes to the target sequence of the atrogene. C is a polymer; and X is a polynucleotide that encodes 1 and X 2 are respectively , a single bond or a non-polymeric linker; the polynucleotide may include at least at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic portion; and A and C are linked to B at the same terminus. In some embodiments, the atrogene inhibits the IGF1-Akt-FoxO pathway. , glucocorticoid-GR pathway, PGC1α-FoxO pathway, TNFα-NFκB pathway , or differentially regulated within the myostatin-ActRIIb-Smad2 / 3 pathway Contains genes (e.g., up-regulated or down-regulated) In some embodiments, the atrogene encodes an E3 ligase. In embodiments, the atrogene encodes a forkhead box transcription factor. In some embodiments, the atrogen is an atrogin-1 gene. (FBXO32), MuRF1 gene (TRIM63), FOXO1, FOXO3, In some embodiments, the atrogene comprises DMPK. In some embodiments, B is a polynucleotide that hybridizes to the target sequence of the atrogene. In some embodiments, C is a polymer. In this embodiment, at least one 2'-modified nucleotide is 2'-O-methyl, 2'-O-meth Oxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy Oxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-di Methylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2 '-O-DMAP), TO-Dimethylaminoethyloxyethyl (2'-O-DMAE OE) or 2'-ON-methylacetamide (2'-O-NMA) modified nucleoside In some embodiments, at least one 2' modified nucleotide comprises a lock In some embodiments, the nucleic acid is a lysine nucleic acid (LNA) or an ethylene nucleic acid (ENA). At least one modified internucleotide bond is a phosphorothioate bond or In some embodiments, at least one reverse In some embodiments, the abasic portion is at least one end. The tide comprises a single strand that hybridizes to the target sequence of the atrogene. In one embodiment, the polynucleotide is a first polynucleotide that is cleaved with a second polynucleotide to form a double stranded polynucleic acid molecule. a nucleotide and a second polynucleotide hybridized to the first polynucleotide. wherein either the first polynucleotide or the second polynucleotide In some embodiments, the first hybridizes to a target sequence of the atrogene. In some embodiments, the first polynucleotide comprises at least one modification. The polynucleotide and the second polynucleotide are RNA molecules. In one embodiment, the polynucleotide comprises at least eight adjacent sequences of the target sequence of the atrogene. In some embodiments, the polynucleotide hybridizes to the base SEQ ID NO: to sequences set forth in ID NOs: 28-141, 370-480, and 703-3406 , at least 60%, 70%, 80%, 85%, 90%, 95%, or 99% complementary In some embodiments, the polynucleotide comprises a sequence that is from about 8 to about 50 In some embodiments, the polynucleotide is about 10 to 20 nucleotides in length. In some embodiments, the first polynucleotide is about 30 nucleotides in length. The codes are SEQ ID NOs: 142-255, 256-369, 481-591, and 592. -702, and at least 80% to the sequence described in 3407-14222; 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some embodiments, the second polynucleotide comprises a sequence having identity to S EQ ID NO:142-255, 256-369, 481-591, 592-702 , and at least 80%, 85%, to the sequence described in 3407-14222; 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some embodiments, X 1 and X 2 is independently C 1 -C 6 Alki In some embodiments, X is a 1 and X 2 is independent, C 1 -C 6 Alkyl A homobifunctional or heterobifunctional linker optionally attached to a group. In some embodiments, A is an antibody or a binding fragment thereof. In embodiments, A is a humanized antibody or binding fragment, a chimeric antibody or binding fragment thereof. fragment, monoclonal antibody or binding fragment thereof, monovalent Fab', bivalent Fab 2 , single chain variable fragment (scFv), diabody, minibody y), nanobody, single domain antibody (sdAb), or camelid antibody, or combination thereof In some embodiments, A comprises an anti-transferrin receptor antibody. In some embodiments, C is a polyethylene glycol or a binding fragment thereof. In some embodiments, AX 1 binds to the 5' end of B, and X 2 - C is linked to the 3' end of B. In some embodiments, X 2 -C to the 5' end of B Combined, AX 1 is attached to the 3' end of B. In some embodiments, A is 1 To In some embodiments, C is directly linked to X 2 Directly bind to In terms of form, B is X 1 and X 2 In some embodiments, the molecule further comprises D. In some embodiments, D is linked to C or A. In the embodiment, D is an endosomolytic polymer.

[0006] In one embodiment, a polynucleotide that hybridizes to a target sequence of an atrogene is Disclosed herein are polynucleic acid molecule conjugates that contain linked binding moieties; The nucleotide optionally comprises at least one 2' modified nucleotide, at least one modified Polynucleic acid molecule conjugates containing an internucleotide bond or at least one inverted abasic portion The present invention relates to a method for treating muscle atrophy in a subject, comprising the steps of: (a) administering a therapeutic agent to a subject; and (b) administering a therapeutic agent to a subject. In some embodiments, atrogenes inhibit the IGF1-Akt-FoxO pathway. pathway, glucocorticoid-GR pathway, PGC1α-FoxO pathway, TNFα-NFκB pathway or differentially regulated within the myostatin-ActRIIb-Smad2 / 3 pathway. including genes that were up-regulated or down-regulated In some embodiments, the atrogene encodes an E3 ligase. In one embodiment, the atrogene encodes a forkhead box transcription factor. In some embodiments, the atrogene binds to the protein TGFβ (transforming growth factor In some embodiments, the atrogene comprises a ligand of the D In some embodiments, the binding moiety comprises an antibody or binding fragment thereof. In some embodiments, the binding moiety is a humanized antibody or binding fragment, mAb or binding fragment thereof, monoclonal antibody or binding fragment thereof , monovalent Fab', divalent Fab 2 , single chain variable fragment (scFv), diabody, a minibody, a nanobody, a single domain antibody (sdAb), or In some embodiments, the binding The moiety is an anti-transferrin receptor antibody or a binding fragment thereof. In some embodiments, the binding moiety is cholesterol. The nucleotide comprises a single strand that hybridizes to the target sequence of the atrogene. In one embodiment, the polynucleotide is a first nucleic acid molecule. and a second polynucleotide hybridized to the first polynucleotide. and a nucleotide sequence, wherein the first polynucleotide or the second polynucleotide Either one further hybridizes to the target sequence of the atrogene. In some embodiments, the second polynucleotide comprises at least one modification. In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In one embodiment, the polynucleotide comprises at least eight sequences of the target sequence of the atrogene. In some embodiments, the polynucleotide hybridizes to adjacent bases. , as described in SEQ ID NOs: 28-141, 370-480, and 703-3406 sequence, at least 60%, 70%, 80%, 85%, 90%, 95%, or 99% In some embodiments, the polynucleotide comprises a sequence that is about 8 to 100% complementary to the In some embodiments, the polynucleotide is In some embodiments, the first polynucleotide is about 10 to about 30 nucleotides in length. The nucleotides are SEQ ID NOs: 142-255, 256-369, 481-591 , 592-702, and 3407-14222. 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% In some embodiments, the second polynucleotide comprises a sequence having sequence identity of The codes are SEQ ID NOs: 142-255, 256-369, 481-591, and 592. -702, and at least 80% to the sequence described in 3407-14222; 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some embodiments, the polynucleic acid molecule conjugate comprises a sequence having a sequence identity. Optionally, the linker connects the binding moiety to the nucleotide. The further polynucleic acid molecule conjugate is optionally indirectly linked to the polynucleotide by an additional linker. In some embodiments, the linker and the additional linker are optionally linked to the polymer. Each linker is independently a bond or a non-polymeric linker. In the present invention, the polynucleic acid molecule conjugate comprises a molecule of formula (I), 1 -BX 2 -C(Formula I where A is a binding moiety; B is a polynucleotide that hybridizes to the target sequence of the atrogene. C is a polymer; and X is a 1 and X 2 are either single bonds or are independently selected from non-polymeric linkers; the polynucleotide comprises at least one 'modified nucleotides, at least one modified internucleotide bond, or at least and A and C do not bind to B at the same end. In one embodiment, at least one 2' modified nucleotide is 2'-O-methyl, 2'- O-Methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy , T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2' -O-Dimethylaminoethyl (2'-O-DMAOE), 2'-O-Dimethylaminopropionate Pyr(2'-O-DMAP), TO-Dimethylaminoethyloxyethyl(2'-O- DMAEOE) or 2'-ON-methylacetamide (2'-O-NMA) modification In some embodiments, at least one 2' modified nucleotide Some embodiments include locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In one embodiment, at least one modified internucleotide bond is a phosphorothioate bond. In some embodiments, the at least one aryl group comprises a cyclic or phosphorodithioate bond. In some embodiments, one inverted abasic moiety is present at at least one terminus. In some embodiments, the muscle wasting disorder is diabetes-related muscle wasting disorder. In some embodiments, the muscle wasting disorder is associated with cachexia. In some embodiments, the muscle wasting is associated with chronic renal failure. In some embodiments, the muscle wasting is associated with congestive heart failure. In some embodiments, the muscle wasting is associated with a chronic respiratory disease. In some embodiments, the muscle wasting is associated with fasting. In embodiments, the muscle atrophy is associated with denervation. Shrinkage is associated with sarcopenia, glucocorticoid treatment, stroke, and / or heart attack. In some cases, myotonic dystrophy type 1 (DM1) is caused by a mutation in the 3′-terminal DMPK gene. 'Associated with an expansion of a CTG repeat in the UTR.

[0007] In some embodiments, a pharmaceutical composition is disclosed herein, the pharmaceutical composition comprising the a molecule or a polynucleic acid molecule conjugate as described above; and a pharma- ceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. In embodiments, the pharmaceutical compositions are administered parenterally, orally, intranasally, bucally, It is formulated for rectal or transdermal administration.

[0008] In one embodiment, the subject is treated for muscle atrophy or myotonic dystrophy. Disclosed herein is a method, comprising: A therapeutically effective amount of a polynucleic acid molecule conjugate comprising a binding moiety attached to a polynucleotide is administered to the subject. administering to the subject; wherein the polynucleotide optionally has at least one 2' Modified nucleotides, at least one modified internucleotide bond, or at least The polynucleic acid molecule conjugate further comprises an inverted abasic portion, and the polynucleic acid molecule conjugate is capable of controlling RNA interference against atrogenes. and thereby treating muscle atrophy or myotonic dystrophy in a subject. In some embodiments, the muscle wasting disease is diabetes-related muscle wasting disease. In some embodiments, the muscle wasting is muscle wasting associated with cancer cachexia. In some embodiments, the muscle wasting is associated with insulin deficiency. The muscle wasting is associated with chronic renal failure. In some embodiments, the muscle wasting is associated with congestive heart failure. In some embodiments, the muscle wasting is associated with chronic respiratory disease. In some embodiments, the muscle wasting disorder is associated with a chronic infection. is associated with fasting. In some embodiments, the muscle atrophy is associated with denervation. In some embodiments, the muscle wasting is associated with sarcopenia. In some embodiments, the myotonic dystrophy is DM1. Rosin inhibits the IGF1-Akt-FoxO pathway, the glucocorticoid-GR pathway, and PGCs. 1α-FoxO pathway, TNFα-NFκB pathway, or myostatin-ActRIIb -Differentially regulated (e.g., upregulated) within the Smad2 / 3 pathway In some embodiments, the at The atrogene encodes an E3 ligase. In some embodiments, the atrogene encodes a fusion enzyme. In some embodiments, the atry The atrogin-1 gene (FBXO32), MuRF1 gene (TRIM63), and FO In some embodiments, the atrogene comprises XO1, FOXO3, or MSTN. In some embodiments, the polynucleic acid molecule conjugate has formula (I): A -X 1 -BX 2 -C (Formula I), wherein A is a linking moiety; B is an alogarithmetic is a polynucleotide that hybridizes to a target sequence of the target molecule; C is a polymer; and And X 1 and X 2 are each independently selected from a single bond or a non-polymeric linker; the polynucleotide comprises at least one 2' modified nucleotide, at least one modified or at least one inverted abasic moiety; and and C are not bound to B at the same end. In some embodiments, B is an atrogene. In some embodiments, the nucleic acid sequence comprises a polynucleotide that hybridizes to a target sequence. and C is a polymer. In some embodiments, at least one 2' modified nucleotide The 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), and 2'-O- Aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl Dopyl (2'-O-AP), 2'-O-Dimethylaminoethyl (2'-O-DMAOE) , 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylamino Ethyloxyethyl (2'-O-DMAEOE) or 2'-ON-methylacetonitrile In some embodiments, at least one of the nucleotides is an amide (2'-O-NMA) modified nucleotide. Each 2'-modified nucleotide is a locked nucleic acid (LNA) or an ethylene nucleic acid (ENA). In some embodiments, the at least one modified nucleotide The linkages between the amino acids include phosphorothioate or phosphorodithioate linkages. In this embodiment, at least one inverted abasic portion is at least one terminus. In some embodiments, the polynucleotide hybridizes to a target sequence of the atrogene. In some embodiments, the polynucleotide comprises a double stranded polynucleotide. A nucleic acid molecule is formed by ligating a first polynucleotide with a nucleic acid fragment that is hybridized to the first polynucleotide. and a second polynucleotide hybridized thereto, wherein the first polynucleotide Either the first polynucleotide or the second polynucleotide further hybridizes to the target sequence of the atrogene. In some embodiments, the second polynucleotide comprises at least one modified In some embodiments, the first polynucleotide and the second polynucleotide In some embodiments, the polynucleotide is an RNA molecule. In some embodiments, the nucleic acid hybridizes to at least 8 contiguous bases of the target sequence. In some embodiments, the polynucleotide is selected from the group consisting of SEQ ID NOs: 28-141, 370-480, and 703-3406, , 90%, 95%, or 99% complementary to each other. In some embodiments, the polynucleotide is from about 8 to about 50 nucleotides in length. In some embodiments, the polynucleotide is about 10 to about 30 nucleotides in length. In an embodiment, the first polynucleotide is selected from SEQ ID NOs: 142-255, Call 256-369, 481-591, 592-702, or 3407-14222. At least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 2 In some embodiments, the sequences share 8%, 99%, or 100% sequence identity. The second polynucleotide is selected from SEQ ID NOs: 142-255, 256- 369, 481-591, 592-702, and 3407-14222 At least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 9 In some embodiments, the sequence identity is 9%, or 100%. , X 1 and X 2 is independently C 1 -C 6 In some embodiments, X is an alkyl group. 1 and X 2 is independent, C 1 -C 6 A homobifunctional linker or or a heterobifunctional linker. In some embodiments, A is an antibody or In some embodiments, A is a binding fragment of a humanized antibody or a binding fragment of a a chimeric antibody or a binding fragment thereof; a monoclonal antibody or a binding fragment thereof Fragments, monovalent Fab', divalent Fab 2 , single chain variable fragment (scFv), Earbodies, minibodies, nanobodies, single domain antibodies (sdA b) or a camelid antibody, or a binding fragment thereof. In the above, A is an anti-transferrin receptor antibody or a binding fragment thereof. In some embodiments, C is polyethylene glycol. AX 1 binds to the 5' end of B, and X 2 -C binds to the 3' end of B. In terms of form, X 2 -C binds to the 5' end of B, and AX 1 binds to the 3' end of B. In some embodiments, A is X 1 In some embodiments, C is X 2 In some embodiments, B is directly linked to X 1 and X 2 Directly binds to In some embodiments, the method further comprises D. In some embodiments, D is In some embodiments, D is an endosomolytic polymer. In some embodiments, the polynucleic acid molecule conjugate is administered parenterally, orally. They are formulated for intranasal, buccal, rectal, or transdermal administration. In some embodiments, the subject is a human.

[0009] In certain embodiments, a kit comprising the above molecule or the above polynucleic acid molecule conjugate is provided. Disclosed herein are: [Brief description of the drawings]

[0010] Various aspects of the present disclosure are set forth with particularity in the appended claims. A better understanding of the invention and its advantages will be readily apparent from the following detailed description of exemplary embodiments in which the principles of the present disclosure are utilized. The present invention can be practiced by reference to the following detailed description and the accompanying drawings, in which: The application file contains at least one drawing executed in color. Copies of this patent application publication will be available to the Office upon request and payment of the necessary fee. This is provided by: [Figure 1] Illustrates an exemplary structure of a cholesterol-myostatin siRNA conjugate. [Diagram 2] Illustrates the SAX HPLC chromatogram of TfR mAb-(Cys)-HPRT-PEG5k, DAR1. [Diagram 3] Illustrates the SEC HPLC chromatogram of TfR mAb-(Cys)-HPRT-PEG5k, DAR1. [Figure 4] 1 illustrates an overlay of SAX HPLC chromatograms of DAR1 and DAR2 of TfR1mAb-Cys-BisMal-siRNA conjugates. [Diagram 5] 1 illustrates an overlay of SEC HPLC chromatograms of DAR1 and DAR2 of TfR1mAb-Cys-BisMal-siRNA conjugates. [Figure 6] 6 illustrates the SEC chromatogram of CD71 Fab-Cys-HPRT-PEG5. [Figure 7] 1 illustrates the SAX chromatogram of CD71 Fab-Cys-HPRT-PEG5. [Figure 8]FIG. 1 illustrates the relative expression levels of Murf1 and atrogin-1 in C2C12 myoblasts and myotubes, which were generated as described in Example 4. mRNA levels were determined as described in Example 4. [Figure 9A] Illustrates an in vivo study design to evaluate the ability of exemplary conjugates for their ability to mediate myostatin (MSTN) mRNA downregulation in skeletal muscle. [Figure 9B] 1 shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc. [Figure 10A] Illustrates an in vivo study design to evaluate the ability of exemplary conjugates for their ability to mediate myostatin (MSTN) mRNA downregulation in skeletal muscle. [Figure 10B] 1 shows tissue concentration-time profiles up to 1008 h after administration of an exemplary molecule of Formula (I). [Figure 10C] 1 shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc. [Figure 10D] 1 shows plasma MSTN protein reduction following siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc. [Figure 10E] 1 shows changes in muscle size following siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc. [Figure 10F] Welch's two-tailed unpaired t-test is shown in FIG. 10E. [Figure 11A] An exemplary in vivo study design is illustrated. [Figure 11B] FIG. 1 shows tissue accumulation of siRNA in mouse gastroc following a single intravenous administration of an exemplary molecule of Formula (I) at the indicated doses. [Figure 11C]1 shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc. [Figure 12A] An exemplary in vivo study design is illustrated. [Figure 12B] siRNA accumulation in various muscle tissues. [Figure 12C] Figure 1 shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc and cardiac muscle. [Figure 12D] RISC loading of the MSTN guide strand in mouse gastrocnemius muscle. [Figure 13A] An exemplary in vivo study design is illustrated. [Figure 13B] 1 shows siRNA-mediated mRNA knockdown of mouse MSTN in mouse gastroc, quadriceps, triceps, and heart. [Figure 13C] Illustrates plasma myostatin levels. [Figure 13D] Illustrates siRNA accumulation in various tissue types: gastrocnemius, triceps, quadriceps, and heart tissue. [Figure 13E] RISC loading of the MSTN guide strand in mouse gastrocnemius muscle. [Figure 13F] Shows changes in muscle area. [Figure 13G] Welch's two-tailed unpaired t-test in FIG. 13F is shown. [Figure 14A] An exemplary in vivo study design is illustrated. [Figure 14B] 1 shows HPRT mRNA expression in gastrocnemius muscle by exemplary conjugates described herein. [Figure 14C] 1 shows SSB mRNA expression in gastrocnemius muscle by exemplary conjugates described herein. [Figure 14D] 1 shows HPRT mRNA expression in cardiac tissue by exemplary conjugates described herein. [Figure 14E]1 shows SSB mRNA expression in cardiac tissue by exemplary conjugates described herein. [Figure 14F] Shows accumulation of siRNA in gastrocnemius muscle. [Figure 15A] An exemplary in vivo study design is illustrated. [Figure 15B] 1 shows downregulation of atrogin-1 in gastroc muscle. [Figure 15C] 1 shows downregulation of atrogin-1 in cardiac tissue. [Figure 16A] An exemplary in vivo study design is illustrated. [Figure 16B] 1 shows downregulation of MuRF-1 in gastrocnemius muscle. [Figure 16C] 1 shows downregulation of MuRF-1 in cardiac tissue. [Figure 17] Figure 1 illustrates siRNAs transfected in vitro into mouse C2C12 myoblasts. All four DMPK siRNAs evaluated showed DMPK mRNA knockdown, whereas the negative control siRNA did not. The dotted lines are three parameter curves fitted by nonlinear regression. [Figure 18] AF shows in vivo results demonstrating a robust dose response for DMPK mRNA knockdown 7 days after a single intravenous administration of a DMPK siRNA-antibody conjugate. A: gastrocnemius; B: tibialis anterior; C: quadriceps; D: diaphragm; E: heart; and F: liver. [Figure 19A] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19B] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19C] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19D] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19E] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19F] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19G] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19H] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19I] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19J] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19K] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19L] 1 shows an exemplary antibody-nucleic acid conjugate described herein. [Figure 19M] A cartoon representation of the antibodies utilized is presented in Figures 19A-19E. [Figure 20A] 1 illustrates an exemplary 21-mer duplex utilized in Example 20. A shows a representative structure of the siRNA passenger strand with a C6-NH2 conjugation handle at the 5' end and a C6-S-NEM at the 3' end. [Figure 20B] 1 illustrates an exemplary 21-mer duplex utilized in Example 20. A shows a representative structure of a 21-mer duplex with 19 bases of complementarity and a 3' dinucleotide overhang. [Figure 21A] Illustrates a second exemplary 21-mer duplex utilized in Example 20. A shows a representative structure of the siRNA passenger strand with a 5' conjugation handle. [Figure 21B] FIG. 2 illustrates a second exemplary 21-mer duplex utilized in Example 20. A shows a representative structure of a blunt-ended duplex with 19 bases of complementarity and a single 3′ dinucleotide overhang. [Figure 22] 1 shows an exemplary in vivo study design. [Diagram 23] 1 illustrates the time course of atrogin-1 mRNA downregulation in gastrocnemius muscle mediated by TfR1 antibody siRNA conjugate following IV delivery at a single dose of 3 mg / kg. [Figure 24] 1 illustrates the time course of atrogin-1 mRNA downregulation in the myocardium mediated by TfR1 antibody siRNA conjugate after IV delivery at a single dose of 3 mg / kg. [Diagram 25] 1 shows an exemplary in vivo study design. [Figure 26] 1 shows MuRF1 mRNA downregulation in gastrocnemius muscle at 96 hours mediated by TfR1 antibody-siRNA conjugates after IV delivery at the indicated doses. [Figure 27] 1 shows MuRF1 mRNA downregulation in the myocardium at 96 hours mediated by TfR1 antibody-siRNA conjugates after IV delivery at the indicated doses. [Figure 28] 1 shows the time course of MuRF1 and atrogin-1 mRNA downregulation in gastrocnemius muscle mediated by TfR1 antibody-siRNA conjugate (IV delivery at 3 mg / kg siRNA) in the presence and absence of dexamethasone-induced muscle atrophy. [Figure 29] 1 shows the time course of MuRF1 and atrogin-1 mRNA downregulation in the myocardium mediated by TfR1 antibody-siRNA conjugate (IV delivery of 3 mg / kg siRNA) in the presence and absence of dexamethasone-induced muscle atrophy. [Diagram 30] 1 shows the time course of changes in stomach weight mediated by TfR1 antibody-siRNA conjugate (IV delivery of 3 mg / kg siRNA) in the presence and absence of muscle atrophy. [Diagram 31] 1 shows the time course of siRNA tissue concentration in gastrocnemius and myocardium mediated by TfR1 antibody-siRNA conjugate (IV delivery of 3 mg / kg siRNA) in the presence and absence of muscle atrophy. [Diagram 32] 1 shows an exemplary in vivo study design. [Diagram 33]Figure 1 shows atrogin-1 mRNA downregulation in gastrocnemius muscle after 10 days of TfR1 antibody siRNA conjugate in the presence and absence of dexamethasone-induced muscle atrophy (starting at day 7) relative to the measured concentration of siRNA in the tissue. [Diagram 34] Relative atrogin-1 mRNA levels in gastrocnemius muscle versus scrambled control group in the absence (groups 10 & 13, and groups 11 & 14) and presence (groups 12 & 15) of dexamethasone-induced muscle atrophy are shown. [Diagram 35] Figure 1 shows the relative RISC loading of atrogin-1 guide strands in mouse gastrocnemius muscle following TfR1-mAb conjugate delivery in the absence and presence of dexamethasone-induced muscle atrophy. [Diagram 36] Time course of MSTN mRNA downregulation in gastrocnemius muscle following TfR1 antibody-siRNA conjugate delivery in the absence (solid line) and presence (dotted line) of dexamethasone-induced muscle atrophy (starting at day 7) versus PBS control. [Figure 37] FIG. 1 shows the rate of leg muscle growth in the gastrocnemius following delivery of TfR1-mAb conjugates in the presence and absence of dexamethasone-induced muscle atrophy. [Figure 38] 1 shows an exemplary in vivo study design. [Figure 39A] We show that a single treatment with 4.5 mg / kg (siRNA) of either atrogin-1 siRNA or MuRF1 siRNA, or a single dose of both siRNAs in combination, resulted in up to 75% downregulation of each target in gastrocnemius muscle. [Figure 39B] FIG. 1 shows that mRNA knockdown of both targets in gastrocnemius muscle is maintained at 75% of untreated legs up to 37 days after ASC administration. [Figure 39C] Shows changes in muscle area. [Figure 39D] Changes in gastrocnemius muscle weight are shown. [Figure 39E]Treatment-induced sparing of muscle wasting for leg muscle regions is shown. Statistical analysis compared siRNA control groups with scrambled treatment groups using Welch's T-test. [Figure 39F] 1 shows the treatment-induced sparing of muscle wasting with respect to gastrocnemius muscle weight. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Muscle atrophy is a condition characterized by a loss of muscle mass or the functioning of muscles, e.g., those that control movement, cardiac muscles, and smooth muscles. It is the progressive weakening and degeneration of skeletal or voluntary muscles that leads to joint dysfunction. It can be caused by a number of factors, including disuse, cancer, diabetes, and kidney failure. Various pathophysiological diseases, including muscle atrophy, or treatment with glucocorticoids, are The phenotypic effects of muscle atrophy include inhibition of muscle protein synthesis, muscle tachycardia, and muscle fatigue. Enhanced protein turnover, abnormal regulation of satellite cell differentiation, and It is caused by a variety of molecular events, including abnormal muscle fiber type conversion.

[0012] Extensive research has demonstrated that muscle atrophy is regulated by specific signaling pathways and transcriptional programs It has been identified as an active process that involves Pathways include, but are not limited to, IGF1-Akt-FoxO, glucocorticoid-GR, P GC1α-FoxO, TNFα-NFκB, and myostatin-ActRIIb-Sm Includes ad2 / 3.

[0013] In some instances, therapeutic manipulation of mechanisms regulating muscle atrophy includes IGF1-Akt, We have focused on TNFα-NFκB and myostatin. IGF1 analogs have been shown to reduce muscle atrophy. Although IGF1 has been shown to be effective in treating glaucoma, its role in promoting tumor formation and hypertrophy has not been shown to be significant. -Akt pathway involvement may hinder these treatments. A similar risk is seen in Akt-mTO Involved in the use of β-adrenergic agonists for regulation of the R pathway. By using a possible ActRIIB or ligand-blocking ActRIIb antibody Thus, inhibition of myostatin may prevent and restore skeletal muscle loss and improve tumor-bearing However, dominant negative ActRIIb expression also increased survival time of animals. Myostatin blockade also did not prevent loss of muscle force after denervation, The mechanism of the anti-atrophic effect of remains uncertain (Satori et al., "S mad2 and 3 transcription factors control muscle mass in adulthood”, Am J Physiol Cell Physiol 296: C1248-C1257, 2009).

[0014] Various models of muscle wasting (including diabetes, cancer cachexia, chronic renal failure, fasting, and denervation) By comparing gene expression in the skeletal muscle, we found that genes that are upregulated in atrophy-prone muscles were These down-regulate or up-regulate the atrogenes (Sacheck et al. al.,“Rapid disuse and denervation atrop hy involving transcriptional changes simil ar to those of muscle wasting during sys temic diseases”, The FASEB Journal, 21(1): 140-155, 2007) Identified genes related to atrophy. Among the regulated genes, muscle-specific ubiquitin protein (E3) ligase ze (e.g., atrogin-1, MuRF1), forkhead box transcription factors, and These are proteins that mediate stress responses. In some cases, these effector proteins Many proteins are difficult to regulate using conventional drugs.

[0015] Nucleic acid (e.g., RNAi) therapy is a targeted therapy that boasts high selectivity and specificity. However, in some instances, nucleic acid therapeutics also suffer from poor cellular uptake, limited blood stability, and In order to address these issues, the use of nucleic acid combinations has been Various modifications of the composition, e.g., novel suitable linkers, optimization of binding moieties for increased target specificity and / or targeted delivery, and In addition, modifications of nucleic acid polymers to increase stability and / or reduce off-target effects are being explored. It is required.

[0016] In some embodiments, the composition or order of the various components that make up the nucleic acid composition may be further modified. In addition, the intracellular uptake, stability, toxicity, efficacy, and / or non-specific immune stimulation may also be evaluated. For example, the nucleic acid component may be a combination of a binding moiety, a polymer, and a polynucleic acid molecule (or a poly nucleotides), the binding moiety, polymer, and / or polynucleic acid molecule (including or polynucleotide) (e.g., binding moiety polynucleic acid molecule polymer) , binding moiety polymer polynucleic acid molecule, or polymer binding moiety polynucleic acid molecule) further comprising Effects on cellular uptake, stability, toxicity, efficacy, and / or non-specific immune stimulation .

[0017] In some embodiments, the present disclosure relates to muscle atrophy or myotonia. Polynucleic acid molecules and polynucleic acid molecule conjugates for the treatment of dystrophies. In certain examples, the polynucleic acid molecule conjugates described herein exhibit improved intracellular uptake, stability, and In some examples, the polynucleic acid molecule conjugate has the formula (I): Molecule:AX 1 -BX 2 In some cases, the polynucleic acid molecule may include one or more amino acids. The hybridization sequence is then hybridized to the target sequence of the gene.

[0018] Further embodiments described herein include the polynucleic acid molecules or The method comprises administering to a subject a polynucleic acid molecule conjugate comprising administering to said subject a method for treating muscle atrophy or myotonic dystrophy. The present invention includes a method for treating lophi.

[0019] Atrogenes Atrophy-related genes, or atrophy-related genes, are upregulated in atrophying muscles. In some cases, genes that are upregulated or downregulated. The atrogenes identified in this study are ubiquitin ligases, forkhead box transcription factors, and growth factors. Involved in atrophy induced by ubiquitinases, deubiquitinases, or glucocorticoids Contains genes that code for proteins.

[0020] Ubiquitin ligase In some embodiments, the atrogenes described herein are capable of binding to the E3 ubiquitin Exemplary E3 ubiquitin ligases include, but are not limited to, Atrogene E3 ubiquitin ligases. Atrogin-1 / MAFbx, muscle RING finger1 (MuRF1), TNF receptor adaptor protein 6 (TRAF6), F-Box protein Protein 30 (Fbxo30), F-Box protein 40 (Fbxo40), neural progenitor cell Neural precursor cell expression down-regulated protein 4 ll expressed developmentally down-regula ted protein 4) (Nedd4-1), and tripartite motif-containing proteins Exemplary mitochondrial ubiquitin ligases include Trim32 (Trim32). However, mitochondrial E3 ubiquitin protein ligase 1 (Mul1) and Hsc7 Contains the carboxy terminus of 0-interacting protein (CHIP).

[0021] In some embodiments, the atrogenes described herein are F-box tagged A member of the protein family, also known as muscle atrophy F-box (MAFbx) Atrogin-1 / MAFbx encodes atrogin-1, a transcription factor that regulates MyoD, the muscle transcription factor. factors, and ubiquitin that promotes degradation of eukaryotic translation initiation factor 3 subunit F (eIF3-f) Four subunits of the chitin ligase complex SKP1-cullin-F-box (SCF) Atrogin-1 / MAFbx is encoded by FBXO32. will be done.

[0022] In some embodiments, the atrogenes described herein are MuRF1 encodes the muscle-specific RING finger 1 (MuRF1). A member of the RING finger protein family, and a member of the MuR family Together with F2 and MuRF3, it is found in the lattice of M and Z lines of myofibrils. These studies have demonstrated that MuRF1 binds to muscle structural proteins, such as troponin I, myosin heavy chain, and actin. tin, myosin binding protein C, and myosin light chains 1 and 2, and MuRF1 is co-regulated by TRIM63 and / or its half-life. will be loaded.

[0023] In some embodiments, the atrogenes described herein are TNF receptor antagonists. Transducer of interleukin-1 signaling protein 6 (TRAF6) , also known as RING finger protein 85, or RNF85 TRAF6 encodes the ubiquitin-binding domain that mediates Lys63-linked polyubiquitination of target proteins. It is a member of the E3 ligases that mediate the conjugation of polyubiquitin chains. Chains are autophagy-dependent cargo recognition by the scaffold protein p62 (SQSTM1) TRAF6 is encoded by the TRAF6 gene.

[0024] In some embodiments, the atrogenes described herein are F-box tagged F-box only protein 30 (Fbxo30) (also known as F-box only protein, helicase, 18; muscle ubiquitin ligase of the SCF complex in atrophy-1; or MU Fbxo30 encodes the SCF complex family of E3 ubiquitin ligases. In one study, Fbox30 was found to be involved in the regulation of bone morphogenetic protein (BMP) ) pathway and during atrophy-inducing conditions, and upregulation Fbxo30 is expressed by the FBXO30 gene and subsequently undergoes autoubiquitination. Coded by child.

[0025] In some embodiments, the atrogenes described herein are F-box tagged F-box only protein 40 (Fbxo40) (F-box only protein 40 or muscle disease-related protein) It encodes the SCF complex of the E3 ubiquitin ligase (also known as the SCF-associated protein). A second member of the fusion family, Fbxo40, regulates anabolic signaling. In some instances, Fbxo40 mediates the expression of insulin receptor substrate 1, an insulin receptor-mediated It ubiquitinates downstream effectors of F signaling, affecting their degradation. bxo40 is encoded by the FBXO40 gene.

[0026] In some embodiments, the atrogenes described herein are capable of inducing neural progenitor cell development. Current development down-regulated protein 4 (Nedd4-1), upregulated in muscle cells during disuse It encodes a HECT domain E3 ubiquitin ligase that has been shown to be regulated by Nedd4-1 is encoded by the NEDD4 gene.

[0027] In some embodiments, the atrogenes described herein include a tripartite motif. Trim32 encodes actin, tropomyosin, and cytoplasmic endothelial cell lineage. Degradation of thin filaments such as eosin, troponin, α-actin, and desmin Trim32 is a member of the Trim32 gene, an E3 ubiquitin ligase involved in the Coded by child.

[0028] In some embodiments, the atrogenes described herein are mitochondrial E3 ubiquitin protein ligase 1 (Mul1) (mitochondrial anchor protein Ligase, RING finger protein 218, RNF218, MAPL, MU Mul1 encodes the mitochondrial endothelial cell line (also known as LAN, GIDE, and GIDE). The transcription factor Fo is involved in remodeling of the retinal network and is upregulated under catabolic conditions such as denervation or fasting. xO family members are upregulated and subsequently promote autophagy (mitophagy) In addition, Mul1 induces mitochondrial severing and removal via the mitochondrial cleavage pathway. Mitochondrial pro-fusion, a GTPase involved in endothelial fusion It ubiquitinates the protein mitofusin 2, leading to its degradation. 1 is encoded by the Mul1 gene.

[0029] In some embodiments, the atrogenes described herein interact with Hsc70. Carboxy-Terminal of Action Protein (CHIP) (STIP1 Homology and U-Box-Containing Protein 1, STUB1, CLL-associated antigen KW-8, antigen NY-CO-7, SCAR1 6, SDCCAG7, or UBOX1). P promotes ubiquitination and lysosomal dependency of filamin C (a muscle protein found in Z-lines). Z-lines or Z-discs are mitochondrial ubiquitin ligases that regulate the degradation of mitochondrial is a structure formed between adjacent sarcomeres, which are the basic units of muscle. Modification of filamin structure is mediated by a complex containing CHIP-containing chaperones Hsc70 and HspB8. CHIP induces the binding of the co-chaperone BAG3, which is a complex with the filaria Subsequent ubiquitination of filamin activates the autophagy pathway, leading to the degradation of filamin C. CHIP is encoded by the STUB1 gene.

[0030] Forkhead box transcription factors In some embodiments, the atrogenes described herein are forkhead Exemplary forkhead box transcription factors include those that encode forkhead box transcription factors. However, the isoforms forkhead box protein O1 (FoxO1) and fox Contains the foxhead box protein O3 (FoxO3).

[0031] In some embodiments, the atrogenes described herein are forkhead Box protein O1 (FoxO1) (in rhabdomyosarcoma, FKHR, or FKH1) FoxO1 encodes the forkhead homolog (also known as the forkhead homolog). FoxO1 is involved in gluconeogenesis and Involved in the regulation of glycogenolysis and initiation of adipogenesis by preadipocytes FoxO1 is encoded by the FOXO1 gene.

[0032] In some embodiments, the atrogenes described herein are forkhead Box protein O3 (FoxO3) (rhabdomyosarcoma-like 1, FKHRL1, or FO It encodes the forkhead of XO3A, which is involved in AMP activation. It is activated by the activating protein kinase AMPK, which in turn activates atrogin-1 and Mu It induces the expression of RF1. FoxO3 is encoded by the FOXO3 gene.

[0033] growth factors In some embodiments, the atrogenes described herein encode growth factors. Exemplary growth factors include myostatin.

[0034] In some instances, the atrogenes described herein are directed to myostatin (Mstn). (also known as growth / differentiation factor 8 (GDF-8)) is converted intracellularly into an activator that stimulates muscle breakdown and activates Smads (small molecule thers against decapentaplegic) Therefore, inhibiting Akt suppresses muscle synthesis. In some cases, myostatin It has been shown that Akt-FoxO signaling pathway regulates the expression of IL-1. In one example, myostatin suppresses satellite cell differentiation and inhibits muscle breakdown by inhibiting the Akt pathway. It has been shown to stimulate and suppress muscle synthesis via the mTOR pathway.

[0035] Deubiquitinase In some embodiments, the atrogenes described herein are capable of inhibiting deubiquitination. Exemplary deubiquitinases include, but are not limited to, ubiquitin-specific peptides. Ubiquitin-specific peptidase 14 (USP14) and ubiquitin-specific peptidase 19 (USP19) In some examples, the atrogenes described herein include USP14 (deubiquitin In another example, the present The atrogenes described herein are USP19 (zinc finger MYND domain-containing Also known as ubiquitinase 9, deubiquitinase 19, or ZMYND9 USP14 is encoded by the USP14 gene. USP19 is encoded by the It is encoded by the SP19 gene.

[0036] Further Atrogenes In some embodiments, the atrogenes described herein are capable of inducing DNA damage. Also known as Dysfunctional Transcriptome 4 (DDIT4) and HIF-1-responsive protein RTP801 regulated in development and DNA da It encodes mage response 1 (Redd1). Redd1 is 14-3-3 By sequestering TSC1 / 2, it inhibits mTOR function and increases TSC1 / 2 activity. Redd1 reduces the phosphorylation of 4E-BP1 and S6K1, which are involved in muscle protein synthesis. Redd1 is encoded by the DDIT4 gene.

[0037] In some embodiments, the atrogenes described herein are associated with cathepsin V. Cathepsin L2 encodes cathepsin L2, which is also known as lysosomal cytoplasmic reductase (LCR) kinase. It is an endonucleaser proteinase encoded by the CTSL2 gene.

[0038] In some embodiments, the atrogenes described herein are TG interactors. It encodes the TG-interacting factor, or homeobox protein TGIF1. TGI is a transcription factor that regulates signaling pathways involved in embryonic development. It is encoded by the F gene.

[0039] In some embodiments, the atrogenes described herein are associated with myogenic factor 4. Myogenin encodes myogenin, which is also known to mediate skeletal muscle growth and repair. Members of the MyoD family of muscle-specific base-helix-loop-helix (bHLH) transcription factors are involved. Myogenin is encoded by the MYOG gene.

[0040] In some embodiments, the atrogenes described herein are useful in treating myotonic dystonia. Myotonic dystrophy protein kinase (MDPK) or myotonic dystrophy protein kinase Myotonin protein kinase (MT-PK), also known as deoxymyelinase (DMK) MT-PK encodes a serine / threonine kinase and a GTPase Rho In humans, MT-PK is expressed by the DMPK gene. This is coded as:

[0041] In some embodiments, the atrogenes described herein are histone deacetylases. It encodes histone deacetylase 2, a member of the histone deacetylase family. Acetylase 2 is encoded by the HDAC2 gene.

[0042] In some embodiments, the atrogenes described herein are histone deacetylases. Encodes histone deacetylase 3, another member of the histone deacetylase family. Deacetylase 3 is encoded by the HDAC3 gene.

[0043] In some embodiments, the atrogenes described herein are metallothioneins. Metallothionein 1, which encodes a member of the metallothionein family. Metallothionein (MT) is a cysteine-rich low molecular weight protein that can bind heavy metals, Thus, it provides protection against metal toxicity and / or oxidative stress. 1L is encoded by the MT1L gene.

[0044] In some embodiments, the atrogenes described herein are metallothioneins. Metallothionein 1B, which encodes the second member of the metallothionein family. 1B is encoded by the MT1B gene.

[0045] In some embodiments, the atrogenes described herein are those depicted in Table 14. It is an atrogene.

[0046] Polynucleic acid molecule In one embodiment, the polynucleic acid molecule is a nucleic acid sequence encoding an atrophy-associated gene (also called an atrophy gene). In some examples, the polynucleic acid molecule described herein hybridizes to a target sequence. ubiquitin ligases (e.g., E3 ubiquitin ligases or mitochondrial ubiquitin ligases) In some instances, the hybridization sequence may be a target sequence for a chitin ligase, such as that described herein. The polynucleic acid molecule to be synthesized hybridizes to a target sequence of a forkhead box transcription factor. In some examples, the polynucleic acid molecules described herein bind to a target sequence of a growth factor. In some examples, the polynucleic acid molecules described herein hybridize to a deubiquitin It hybridizes to the target sequence of the tinylating enzyme.

[0047] In some embodiments, the polynucleic acid molecules described herein include FBXO32, TRIM63, TRAF6, FBXO30, FBXO40, NEDD4, TRIM32, MUL1, STUB1, FOXO1, FOXO3, MSTN, USP14, USP19, DDIT4, CTSL2, TGIF, MYOG, HDAC2, HDAC3, MT1L, M , T1B, or DMPK target sequences. The polynucleic acid molecules described in are FBXO32, TRIM63, FOXO1, FOXO3, Alternatively, it hybridizes to a target sequence of MSTN. The polynucleic acid molecule hybridizes to a target sequence of FBXO32. The polynucleic acid molecules described herein hybridize to a target sequence of TRIM63. In some cases, the polynucleic acid molecules described herein hybridize to a target sequence of TRAF6. In some cases, the polynucleic acid molecules described herein may be modified to encode a polypeptide of FBXO30. Hybridizes to a target sequence. In some cases, the polynucleic acid molecules described herein , which hybridizes to a target sequence of FBXO40. The polynucleic acid molecule hybridizes to a target sequence of NEDD4. The polynucleic acid molecules described herein hybridize to a target sequence of TRIM32. In some cases, the polynucleic acid molecules described herein hybridize to a target sequence of MUL1. In some cases, the polynucleic acid molecules described herein may be modified to encode a target sequence for STUB1. In some cases, the polynucleic acid molecules described herein hybridize to FOX Optionally, the polynucleic acid described herein hybridizes to a target sequence of O1. The molecule hybridizes to a target sequence of FOXO3. The polynucleic acid molecule hybridizes to a target sequence of MSTN. The polynucleic acid molecules described herein hybridize to the target sequence of USP14. In some cases, the polynucleic acid molecules described herein may hybridize to a target sequence of USP19. In some cases, the polynucleic acid molecules described herein encode target sequences of DDIT4. In some cases, the polynucleic acid molecules described herein hybridize to a CT SL2 hybridizes to a target sequence. The acid molecule hybridizes to a target sequence of TGIF. The polynucleic acid molecule to be detected hybridizes to a target sequence of MYOG. The polynucleic acid molecules described herein hybridize to a target sequence of HDAC2. In some cases, the polynucleic acid molecules described herein hybridize to a target sequence of HDAC3. In some cases, the polynucleic acid molecules described herein encode a target sequence for MT1L. Optionally, the polynucleic acid molecules described herein hybridize to MT1. B. Optionally, the polynucleic acid molecule described herein hybridizes to a target sequence of B. The product hybridizes to the target sequence of DMPK.

[0048] In some embodiments, the polynucleic acid molecule comprises SEQ ID NO:28-141 and and at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or even 100% sequence identity. The polynucleic acid molecules are set forth in SEQ ID NOs: 28-141 and 370-480. The sequence contains a sequence having at least 50% sequence identity to the target sequence. In an embodiment, the polynucleic acid molecule is selected from SEQ ID NOs: 28-141 and 370-4. 80. The present invention includes sequences having at least 60% sequence identity to the target sequences set forth in 80. In some embodiments, the polynucleic acid molecule is selected from SEQ ID NOs:28-141 and and 370-480, which have at least 70% sequence identity to the target sequence described in In some embodiments, the polynucleic acid molecule comprises the sequence SEQ ID NO:28 At least 75% sequence identity to the target sequences described in -141 and 370-480 In some embodiments, the polynucleic acid molecule comprises a sequence having a sequence identity of SEQ ID NO: At least 8 for the target sequences described in NOs:28-141 and 370-480 In some embodiments, the polynucleic acid molecule comprises a sequence having 0% sequence identity to the For target sequences set forth in SEQ ID NOs: 28-141 and 370-480 In some embodiments, the polynucleotide comprises a sequence having at least 85% sequence identity. The nucleic acid molecule may comprise a target molecule as set forth in SEQ ID NOs: 28-141 and 370-480. In some embodiments, the sequence has at least 90% sequence identity to the sequence. In the present invention, the polynucleic acid molecule is represented by SEQ ID NOs: 28-141 and 370-480. The sequences include sequences having at least 95% sequence identity to the target sequence provided. In one embodiment, the polynucleic acid molecule is selected from the group consisting of SEQ ID NOs: 28-141 and 370. -480, which contains a sequence having at least 96% sequence identity to the target sequence described in In some embodiments, the polynucleic acid molecule is selected from the group consisting of SEQ ID NO:28-141 and 370-480, having at least 97% sequence identity to the target sequence described therein. In some embodiments, the polynucleic acid molecule comprises a sequence comprising SEQ ID NO: At least 98% sequence identity to the target sequences described in 28-141 and 370-480. In some embodiments, the polynucleic acid molecule comprises a sequence having sequence identity to SEQ ID NO: At least one of the target sequences set forth in ID NOs: 28-141 and 370-480 In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to Consisting of target sequences set forth in SEQ ID NOs: 28-141 and 370-480 .

[0049] In some embodiments, the polynucleic acid molecule is SEQ ID NO:743-340 At least 50%, 55%, 60%, 65%, 70% for the target sequence described in 6, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or In some embodiments, the polynucleic acid molecule comprises a sequence having 100% sequence identity. has at least 5 copies of the target sequence set forth in SEQ ID NO:743-3406 In some embodiments, the polynucleic acid molecule comprises a sequence having 0% sequence identity to the At least 60% to the target sequence set forth in SEQ ID NO:743-3406 In some embodiments, the polynucleic acid molecule comprises a sequence having a sequence identity of A sequence that is at least 70% identical to the target sequence described in Q ID NO: 743-3406. In some embodiments, the polynucleic acid molecule comprises a sequence having sequence identity to SEQ ID NO: At least 75% sequence identity to the target sequence set forth in ID NO:743-3406 In some embodiments, the polynucleic acid molecule comprises a sequence having a sequence identity of SEQ ID NO: At least 80% sequence identity to the target sequence set forth in NO:743-3406 In some embodiments, the polynucleic acid molecule comprises a sequence having SEQ ID N A sequence identity of at least 85% to the target sequence described in O:743-3406. In some embodiments, the polynucleic acid molecule comprises a sequence comprising SEQ ID NO: 743-3406. In some embodiments, the polynucleic acid molecule comprises the sequence SEQ ID NO:74 A sequence having at least 95% sequence identity to the target sequence described in 3-3406 In some embodiments, the polynucleic acid molecule comprises SEQ ID NO:743- 3406. In some embodiments, the polynucleic acid molecule is selected from the group consisting of SEQ ID NO:743-34 06. The present invention relates to a method for the preparation of a nucleic acid sequence comprising the steps of: In some embodiments, the polynucleic acid molecule is SEQ ID NO:743-3406 The target sequences include sequences having at least 98% sequence identity to the target sequences described in. In some embodiments, the polynucleic acid molecule is selected from the group consisting of SEQ ID NO:743-3406. The sequences include sequences having at least 99% sequence identity to the target sequence provided. In one embodiment, the polynucleic acid molecule is set forth in SEQ ID NO:743-3406. It consists of a target sequence.

[0050] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some examples, the first polynucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: : 142-255, 256-369, 481-591, 592-702, and 3407 At least 50%, 55%, 60%, 65% against the target sequence described in -14222 , 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% In some instances, the second polynucleotide comprises a sequence having 100% sequence identity to the first polynucleotide. The nucleotides are SEQ ID NOs: 142-255, 256-369, 481-591 , 592-702, and 3407-14222. Also 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% , 96%, 97%, 98%, 99%, or 100% sequence identity. In some examples, the polynucleic acid molecule is selected from the group consisting of SEQ ID NOs: 142-255, 481- 591, 3407-6110, and 8815-11518. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% %, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity The first polynucleotide and SEQ ID NO: 256-369, 592-702, 6 At least 50% against the target sequences 111-8814 and 11519-14222 , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% , 97%, 98%, 99%, or 100% sequence identity to the second polynucleotide. Includes chid.

[0051] In some embodiments, the polynucleic acid molecule comprises a sense strand (e.g., a passenger strand). ) and an antisense strand (e.g., a guide strand). In some instances, the sense strand (e.g., , passenger strand) are SEQ ID NOs: 142-255, 481-591, 34 07-6110, and 8815-11518 for the target sequences described at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, This includes sequences with 96%, 97%, 98%, 99% or 100% sequence identity. In some examples, the antisense strand (e.g., the guide strand) is SEQ ID NO:25 Call 6-369, 592-702, 6111-8814, and 11519-14222 At least 50%, 55%, 60%, 65%, 70%, 75% of the target sequence , 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % sequence identity.

[0052] In some embodiments, the polynucleic acid molecules described herein are RNA or DNA. In some cases, the polynucleic acid molecule comprises RNA. In some instances, the RNA are small interfering RNA (siRNA), small hairpin RNA (shRNA), and microRNA. RNA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal In some cases, the nucleobase is a type of RNA that is expressed by the nucleobase, which is a genomic RNA (e.g., rRNA), or heterogeneous nuclear RNA (hnRNA). In some instances, the RNA comprises an shRNA. In some instances, the RNA comprises an miRNA. In some instances, the RNA comprises dsRNA. In some instances, the RNA comprises tRNA. In some instances, the RNA comprises rRNA. In some instances, the RNA comprises hnRNA. In some examples, the RNA comprises a siRNA. In some examples, the polynucleic acid molecule comprises siRNA.

[0053] In some embodiments, the nucleic acid polymer is about 10 to about 50 nucleotides in length. In some embodiments, the polynucleic acid molecule comprises from about 10 to about 30, from about 15 to about 30 , about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 20 to about 22 It is the length of nucleotides.

[0054] In some embodiments, the polynucleic acid molecule is about 50 nucleotides in length. In some examples, the polynucleic acid molecule is about 45 nucleotides in length. In some examples, the polynucleic acid molecule is about 40 nucleotides in length. In some examples, the polynucleic acid molecule is about 30 nucleotides in length. In some examples, the polynucleic acid molecule is about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 20 nucleotides in length. In some examples, the polynucleic acid molecule is about 19 nucleotides in length. In some examples, the polynucleic acid molecule is about 17 nucleotides in length. In some examples, the polynucleic acid molecule is about 16 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 nucleotides in length. In some instances, the polynucleic acid molecule is about 14 nucleotides in length. In some examples, the polynucleic acid molecule is about 12 nucleotides in length. In some examples, the polynucleic acid molecule is about 11 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 nucleotides in length. The nucleic acid molecule is about 10 to about 50 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 45 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 40 nucleotides in length. In some examples, the polynucleic acid molecule is from about 10 to about 35 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 10 to about 20 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 to about 25 nucleotides in length. In some examples, the polynucleic acid molecule is about 15 to about 30 nucleotides in length. In some examples, the polynucleic acid molecule is from about 12 to about 30 nucleotides in length.

[0055] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide. In some instances, the polynucleic acid molecule comprises a second polynucleotide. The acid molecule comprises a first polynucleotide and a second polynucleotide. The first polynucleotide is a sense strand or a passenger strand. The second polynucleotide is the antisense strand or guide strand.

[0056] In some embodiments, the polynucleic acid molecule is the first polynucleotide. In some embodiments, the first polynucleotide is about 10 to about 50 nucleotides in length. In some embodiments, the first polynucleotide is from about 10 to about 30, about 1 5 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 2 It is from 0 to about 22 nucleotides in length.

[0057] In some examples, the first polynucleotide is about 50 nucleotides in length. In some examples, the first polynucleotide is about 45 nucleotides in length. In examples, the first polynucleotide is about 40 nucleotides in length. In some examples, the first polynucleotide is about 35 nucleotides in length. In some examples, the first polynucleotide is about 30 nucleotides in length. The nucleotide is about 25 nucleotides in length. In some examples, the first polynucleotide In some examples, the first polynucleotide is about 20 nucleotides in length. In some examples, the first polynucleotide is about In some examples, the first polynucleotide is about 17 nucleotides in length. In some examples, the first polynucleotide is about 16 nucleotides in length. In some examples, the first polynucleotide is about 15 nucleotides in length. In some examples, the first polynucleotide is about 14 nucleotides in length. In some examples, the first polynucleotide is about 13 nucleotides in length. In some examples, the first polynucleotide is about 12 nucleotides in length. In some examples, the first polynucleotide is about 11 nucleotides in length. In some instances, the first polynucleotide is about 10 nucleotides in length. A polynucleotide of one is about 10 to about 50 nucleotides in length. In some embodiments, the first polynucleotide is about 10 to about 45 nucleotides in length. In some embodiments, the first polynucleotide is about 10 to about 40 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 35 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 30 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 25 nucleotides in length. In some examples, the first polynucleotide is about 10 to about 20 nucleotides in length. In some examples, the first polynucleotide is about 15 to about 25 nucleotides. In some examples, the first polynucleotide is about 15 to about 30 nucleotides in length. In some examples, the first polynucleotide is about 12 to about 30 nucleotides in length. The length of the leotide.

[0058] In some embodiments, the polynucleic acid molecule is a second polynucleotide. In some embodiments, the second polynucleotide is about 10 to about 50 nucleotides in length. In some embodiments, the second polynucleotide is from about 10 to about 30, about 1 5 to about 30, about 18 to about 25, about 18 to about 24, about 19 to about 23, or about 2 It is from 0 to about 22 nucleotides in length.

[0059] In some examples, the second polynucleotide is about 50 nucleotides in length. In some examples, the second polynucleotide is about 45 nucleotides in length. In examples, the second polynucleotide is about 40 nucleotides in length. In some instances, the second polynucleotide is about 35 nucleotides in length. In some instances, the second polynucleotide is about 30 nucleotides in length. The nucleotide is about 25 nucleotides in length. In some examples, the second polynucleotide In some instances, the second polynucleotide is about 20 nucleotides in length. In some examples, the second polynucleotide is about In some examples, the second polynucleotide is about 17 nucleotides in length. In some examples, the second polynucleotide is about 16 nucleotides in length. In some examples, the second polynucleotide is about 15 nucleotides in length. In some examples, the second polynucleotide is about 14 nucleotides in length. In some examples, the second polynucleotide is about 13 nucleotides in length. In some examples, the second polynucleotide is about 12 nucleotides in length. In some examples, the second polynucleotide is about 11 nucleotides in length. In some instances, the second polynucleotide is about 10 nucleotides in length. The two polynucleotides are about 10 to about 50 nucleotides in length. In some embodiments, the second polynucleotide is about 10 to about 45 nucleotides in length. In some embodiments, the second polynucleotide is about 10 to about 40 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 35 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 30 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 25 nucleotides in length. In some examples, the second polynucleotide is about 10 to about 20 nucleotides in length. In some examples, the second polynucleotide is about 15 to about 25 nucleotides. In some examples, the second polynucleotide is about 15 to about 30 nucleotides in length. In some examples, the second polynucleotide is about 12 to about 30 nucleotides in length. The length of the leotide.

[0060] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the polynucleic acid molecule further comprises blunt ends, overhangs, or a combination thereof. In some examples, the blunt ends include a 5' blunt end, a 3' blunt end, In some cases, the overhang may be a 5' overhang, a slip end, or both. 3' overhang, 3' overhang, or both. In some cases, the overhang is , 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base paired nucleotides. Depending on the sequence, the overhang may consist of 1, 2, 3, 4, 5, or 6 non-base paired nucleotides. In some cases, the overhang may contain 1, 2, 3, or 4 non-base paired nucleotides. In some cases, the overhang contains one non-base paired nucleotide. In some cases, the overhang comprises two non-base paired nucleotides. The overhang contains three non-base paired nucleotides. contains four non-base paired nucleotides.

[0061] In some embodiments, the sequence of the polynucleic acid molecule is a target sequence described herein. At least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80% %, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary. In some embodiments, the sequence of the polynucleic acid molecule is at least equal to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is In some embodiments, the target sequence is at least 60% complementary to the target sequence set forth in The sequence of the polynucleic acid molecule is at least 70% complementary to the target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least partially similar to a target sequence described herein. In some embodiments, the sequences of the polynucleic acid molecules are at least 80% complementary to each other. At least 90% complementary to the target sequence described herein. In some embodiments, Thus, the sequence of the polynucleic acid molecule is at least 95% complementary to the target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule is at least 99% complementary to the sequence of the It is 100% complementary to the target sequence shown.

[0062] In some embodiments, the sequence of the polynucleic acid molecule corresponds to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule has five or fewer mismatches. The sequence has no more than four mismatches to the target sequence described herein. In this case, the sequence of the polynucleic acid molecule has no more than three mismatches with the target sequence described herein. In some cases, the sequence of the polynucleic acid molecule corresponds to a target sequence described herein. Optionally, the sequence of the polynucleic acid molecule may be any of the sequences described herein. It has no more than one mismatch to the target sequence listed.

[0063] In some embodiments, a polypeptide that hybridizes to a target sequence described herein is The specificity of the polynucleic acid molecule for the target sequence is 95%, 98%, 99%, or 99%. 0.5%, or 100% sequence complementarity. In some instances, the hybridization sequence These are highly stringent hybridization conditions.

[0064] In some embodiments, the polynucleic acid molecule has reduced off-target effects. In some instances, "off-target" or "off-target effect" refers to a substance that is The target polynucleic acid polymer is a nucleic acid that binds to another mRNA sequence, a DNA sequence, or a cellular protein. Direct or indirect interaction with the quality or other parts of the In some cases, the transcriptional regulation of a polynucleic acid molecule with other transcripts is called Partial homology or complementarity between the sense and / or antisense strands allows for differentiation of "Off-target effects" occur when there is simultaneous degradation of the transcript.

[0065] In some embodiments, the polynucleic acid molecule may be a mixture of natural or synthetic or artificial nucleotides. In some cases, the polynucleic acid molecule may be DNA, RNA, or and / or combinations of nucleotide analogs. In some instances, synthetic or human The nucleotide analog or base is a ribose moiety, a phosphate moiety, a nucleoside moiety, , or a combination thereof.

[0066] In some embodiments, the nucleotide analog or artificial nucleotide base is In some instances, the modification may be at the 2' hydroxyl group of the ribose moiety. Decorations are H, OR, R, Halo, SH, SR, NH 2 , NHR, NR2, or CN, R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogen, Sulfur, thiol, thioether, thioester, amine (primary, secondary, or tertiary), Amides, ethers, esters, alcohols, and oxygen. The alkyl moiety further comprises a modification. In some instances, the modification is an azo group, a keto group, an aldehyde group, or an aldehyde group. A carboxyl group, a nitro group, a nitroso group, a nitrile group, a heterocycle (e.g., imidazo hydroxyl, hydrazino, or hydroxylamino groups, isocyanate or cyanate groups, or sulfur-containing groups (e.g., sulfoxide, sulfone, sulfide, and disulfide) In some instances, the alkyl moiety further comprises heterosubstitution. In some examples, the carbon of the heterocyclic group is replaced by nitrogen, oxygen, or sulfur. Examples of heterocyclic substituents include, but are not limited to, morpholino, imidazole, and pyrrolidin. Including Gino.

[0067] In some cases, the modification of the 2' hydroxyl group is a 2'-O-methyl modification or a 2' 2'-O-Methoxyethyl (2'-O-MOE) modification. The methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety, while the 2'O-methionine modification adds a methyl group to the 2' hydroxyl group of the ribose moiety. The methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. Representative examples of 2'-O-methyl modifications of adenine molecules and 2'O-methoxyethyl modifications of uridine Typical chemical structures are illustrated below.

[0068] [ka]

[0069] In some embodiments, the modification of the 2' hydroxyl group is an extension comprising a propyl linker. The modified amine group is a 2'-O-aminopropyl modification, which attaches an amine group to the 2' oxygen. In some instances, this modification involves the introduction of one positive charge from an amine group per sugar. neutralizes the overall negative charge of the phosphate group of the oligonucleotide molecule, thereby to improve cellular uptake properties due to its zwitterionic properties. Exemplary chemical structures of nucleoside phosphoramidites are illustrated below.

[0070] [ka]

[0071] In some instances, the 2' hydroxyl group modification is a locked or bridged ribose modification (e.g. For example, locked nucleic acid or LNA), in which the oxygen molecule attached at the 2' carbon is a methyl It is attached to the 4' carbon by a ethylene group, and is therefore 2'-C,4'-C-oxy-methyl The LNA molecule is a dicyclic ribonucleotide that is linked to a cyclic alkyl chain to form a bicyclic ribonucleotide monomer. A representative example of the LNA chemical structure is shown below. The representative example shown on the left highlights the chemical bond nature of the LNA monomer. A typical example is the locked 3'-endo (3E) structure of the furanose ring of the LNA monomer. It emphasizes.

[0072] [ka]

[0073] In some embodiments, the modification at the 2' hydroxyl group converts the sugar structure to a 3'-endo sugar. Sugar puckering conformation Locking, e.g., ethylene nucleic acids (ENA), such as 2'-4'-ethylene bridged nucleic acids ENAs are part of the bridged nucleic acid class of modified nucleic acids that also includes LNAs. Exemplary chemical structures of ENAs and cross-linked nucleic acids are illustrated below.

[0074] [ka]

[0075] In some embodiments, the additional modification at the 2' hydroxyl group is 2'-deoxy, T -Deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O -Dimethylaminoethyl (2'-O-DMAOE), 2'-O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyloxyethyl (2'-O-DM AEOE), or 2'-ON-methylacetamide (2'-O-NMA).

[0076] In some embodiments, the nucleotide analog includes, but is not limited to, 5-propionyl Niluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N ,N,-Dimethyladenine, 2-Propyladenine, 2-Propylguanine, 2-Amino Adenine, 1-methylinosine, 3-methyluridine, 5-methylcytidine, 5-methyl Uridine and other nucleotides with modifications at the 5-position, 5-(2-amino)propyl Luuridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 1-methyl Adenosine, 2-methyladenosine, 3-methylcytidine, 6-methyluridine, 2-methyl 7-methylguanosine, 2,2-dimethylguanosine, 5-methylamino Deazanidine such as 5-ethyluridine, 5-methoxyuridine, and 7-deaza-adenosine 6-Azouridine, 6-Azocytidine, 6-Azothymidine, 5-methyl-2-thio Auridine, other thio bases such as 2-thiouridine and 4-thiouridine, and 2- Thiocytidine, dihydrouridine, pseudouridine, queusine, archaeosine, Naphthyl and substituted naphthyl groups, O- and N-alkylated purines and pyrimidines N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine , 5-oxyacetic acid, pyridin-4-one, pyridin-2-one, phenyl and modified phenyl Nyl groups, such as aminophenol or 2,4,6-trimethoxybenzene, G-clan Modified cytosines, 8-substituted adenines and guanidines that act as p-nucleotides 5-substituted uracil and thymine, azapyrimidine, carboxyhydroxyapatidine alkyl nucleotides, carboxyalkylaminoalkyl nucleotides, and alkyl Modified nucleotides further include ribosylated nucleotides. As with nucleotides with non-glycosylated sugars or their analogs, For example, in some cases, the sugar moiety may be mannose, arabinose, or , glucopyranose, galactopyranose, 4'-thioribose, and other sugars , heterocyclic, or carbocyclic rings, or these are the bases. The term further includes those known in the art as universal bases. Universal bases include, but are not limited to, 3-nitropyrrole, 5-nitroindole, or Contains nebularine.

[0077] In some embodiments, the nucleotide analogs are morpholinos, peptide nucleic acids (PN A), methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'- Fluoro-N3-P5'-phosphoramidite, 1',5'-anhydrohexitol nucleic acid (H NA), or combinations thereof. Promorpholino oligos (PMOs) are synthetic molecules whose structures consist of normal sugars and phosphates. It mimics the natural nucleic acid structure by deviating from the structure. In this example, the five-membered ribose ring contains four carbons, one nitrogen, and one oxygen. In some cases, the ribose monomer is replaced with a six-membered morpholino ring. In some cases, the backbone is modified by phosphorodiamidate groups instead of aryl groups. , cellular delivery agents such as those used by charged oligonucleotides Can cross cell membranes without the aid of delivery agents Remove all positive and negative charges making the morpholino neutral molecule.

[0078] [ka]

[0079] In some embodiments, peptide nucleic acids (PNAs) contain phosphate linkages in the sugar backbone ring. The bases are linked and properly spaced by oligoglycine-like molecules, and thus the bone Remove the negative charge.

[0080] [ka]

[0081] In some embodiments, one or more modifications optionally occur at an internucleotide linkage. In some examples, the modified internucleotide linkage can be, but is not limited to, a phosphorothioate. phosphate, phosphorodithioate, methylphosphonate, 5'-alkylenephosphonate, 5 '-Methylphosphonate, 3'-alkylenephosphonate, boron trifluoride trifluoridates), 3'-5' or 2'-5' boranoline Acid esters and selenophosphates, phosphotriesters, thionoalkylphosphotriesters Esters, hydrogen phosphonate bonds, alkyl phosphonates, alkyl phosphonothioates , aryl phosphorothioates, phosphoroselenoates, phosphorodiselenoates, phosphatides Phosphoramidates, 3'-alkyl phosphoramidates, phosphoropipera Didates, phosphoroanilothioates, phosphoroanilidates, ketones, sulfones, sulfurs Amides, carbonates, carbamates, methylenehydrazo, methylenedimethyldimethyl hydrazo, formacetal, thioformacetal, oxime, methyleneimino, methylene Aminomethylimino, thioamidate, and riboacetyl group binding, aminoethylglycine, cyano or siloxane bonds, e.g., saturated or unsaturated and / or substituted and / or containing heteroatoms, 1 to 10 carbons, with or without heteroatoms Alkyl or cycloalkyl bonds, bonds with morpholino structures, amides, and bases in the backbone Polyamides with aza nitrogens bonded directly or indirectly, or combinations thereof. Phosphorothioate antisense oligonucleotides (PS ASOs) are An exemplary PS ASO is an antisense oligonucleotide that contains a thioate bond. Explained below.

[0082] [ka]

[0083] In some instances, the modification is a methylphosphonate or thiolphosphonate modification. Which methyl or thiol modification. A typical thiol phosphonate nucleotide (left) ) and methylphosphonate nucleotides (right) are illustrated below.

[0084] [ka]

[0085] In some examples, modified nucleotides include, but are not limited to, the following: The 2'-fluoro N3-P5'-phosphoramidites include:

[0086] [ka]

[0087] In some examples, modified nucleotides include, but are not limited to, the following: Hexitol nucleic acid (also called 1',5'-anhydrohexitol nucleic acid (HNA) ) including:

[0088] [ka]

[0089] In some embodiments, the one or more modifications further include a ribose moiety, a phosphate Backbone and nucleoside modifications, or 3' or 5' terminal nucleotide analogs For example, the 3' terminus optionally includes a 3' cationic group, or a 3'-3' Invert the nucleoside at the 3'-terminus containing the bond. In another alternative, the 3'-terminus is optionally to an aminoalkyl group, e.g., 3'C5-aminoalkyl dT. In some embodiments, the 3'-terminus is optionally terminated with an abasic site, e.g., an apurinic or apyrimidinic acid moiety. In some instances, the 5'-terminus is linked to an aminoalkyl group, e.g., 5'-O -aminoalkyl substituent. In some cases, the 5'-end is linked to an abasic site, e.g. For example, it binds to apurinic or apyrimidinic acid sites.

[0090] In some embodiments, the polynucleic acid molecule comprises one or more of the artificial nucleic acid molecules described herein. In some instances, the polynucleic acid molecules described herein include nucleotide analogs. , 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more artificial nucleotides described herein In some embodiments, the artificial nucleotide analog includes a 2'-O-methyl analog. 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2' -Deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-OA P), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethyl Aminopropyl (2'-O-DMAP), TO-Dimethylaminoethyloxyethyl ( 2'-O-DMAEOE), or 2'-ON-methylacetamide (2'-O- NMA) modified LNA, ENA, PNA, HNA, morpholino, methylphosphonate Nucleotides, thiol phosphonate nucleotides, 2'-fluoro N3-P5'-phospho In some embodiments, the polynucleic acid comprises a carboxyl group, a carboxyl group, a phosphate ... The molecules are 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O -aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-amino Propyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE ), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminopropyl Noethyloxyethyl (2'-O-DMAEOE) or modified 2'-ON -Methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, morpho lino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2'- one selected from the group consisting of N3-P5'-phosphoramidites, or combinations thereof , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 20, 25 or more artificial nucleotide analogs. In embodiments, the polynucleic acid molecule is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1 2, 13, 14, 15, 16, 17, 18, 20, 25 or more 2'-O- In some embodiments, the polynucleic acid molecule comprises 1, 2, 3 , 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 25 or more 2'-O-methoxyethyl (2'-O-MOE) modified nucleic acids In some examples, the polynucleic acid molecules described herein include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 , 20, 25 or more thiol phosphonate nucleotides.

[0091] In some examples, the polynucleic acid molecule comprises at least one of the following: about 5% to about 10 0% modification, about 10% to about 100% modification, about 20% to about 100% modification, about 30% from about 100% modification, from about 40% to about 100% modification, from about 50% to about 100% modification , about 60% to about 100% modification, about 70% to about 100% modification, about 80% to about 10 0% modification, and from about 90% to about 100% modification.

[0092] Optionally, the polynucleic acid molecule comprises at least one of the following: about 10% to about 90% modification, about 20% to about 90% modification, about 30% to about 90% modification, about 40% to about 9 0% modification, about 50% to about 90% modification, about 60% to about 90% modification, about 70% to About 90% modified, and about 80% to about 100% modified.

[0093] Optionally, the polynucleic acid molecule comprises at least one of the following: about 10% to about 80% about 20% to about 80% modification, about 30% to about 80% modification, about 40% to about 8 0% modification, about 50% to about 80% modification, about 60% to about 80% modification, and about 70% modification. 0% to approximately 80% modification.

[0094] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 7 0% modification, about 20% to about 70% modification, about 30% to about 70% modification, about 40% to about 70% modified, about 50% to about 70% modified, and about 60% to about 70% modified.

[0095] In some examples, the polynucleic acid molecule comprises at least one of the following: about 10% to about 6 0% modification, about 20% to about 60% modification, about 30% to about 60% modification, about 40% to About 60% modified, and about 50% to about 60% modified.

[0096] Optionally, the polynucleic acid molecule comprises at least one of the following: about 10% to about 50% about 20% to about 50% modification, about 30% to about 50% modification, and about 40% to about Approximately 50% modified.

[0097] Optionally, the polynucleic acid molecule comprises at least one of the following: about 10% to about 40% modification, about 20% to about 40% modification, and about 30% to about 40% modification.

[0098] Optionally, the polynucleic acid molecule comprises at least one of the following: about 10% to about 30% modification, and from about 20% to about 30% modification.

[0099] Optionally, the polynucleic acid molecule contains about 10% to about 20% modifications.

[0100] In some cases, the polynucleic acid molecules are about 15% to about 90%, about 20% to about 80%, about 30% to about 50%, about 60% to about 70%, about 80% to about 90%, about 10% to about 15%, about 20% to about 30%, about 30% to about 50%, about 10% to about 15%, about 20% to about 30%, about 30% It includes from 0% to about 70%, or from about 40% to about 60% modifications.

[0101] In further instances, the polynucleic acid molecule is at least about 15%, 20%, 30%, 40%, 50%, Includes 0%, 60%, 70%, 80%, 90%, 95%, or 99% qualification.

[0102] In some embodiments, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5 , about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16 , about 17, about 18, about 19, about 20, about 21, about 22, or more modifications.

[0103] In some examples, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6 , about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 1 7, about 18, about 19, about 20, about 21, about 22 or more modified nucleotides. Includes do.

[0104] In some instances, about 5 to about 100% of the polynucleic acid molecules are selected from the group consisting of the artificial polynucleic acid molecules described herein. In some instances, about 5%, 10%, 15%, or 20% of the polynucleic acid molecule comprises a nucleotide analog. %, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65 %, 70%, 75%, 80%, 85%, 90%, 95%, or 100% are herein defined as In some instances, about 5% of the polynucleic acid molecule comprises an artificial nucleotide analog as described. In some examples, the polynuclear nucleotide analog comprises an artificial nucleotide analog as described herein. Approximately 10% of the acid molecules contain the artificial nucleotide analogs described herein. In one example, about 15% of the polynucleic acid molecules contain an artificial nucleotide analog as described herein. In some examples, about 20% of the polynucleic acid molecules comprise an artificial nucleic acid as described herein. In some examples, about 25% of the polynucleic acid molecules comprise a nucleic acid analog as described herein. In some instances, about 30% of the polynucleic acid molecule comprises an artificial nucleotide analog. In some examples, the polynuclear nucleotide analog comprises an artificial nucleotide analog as described herein. Approximately 35% of the acid molecules contain the artificial nucleotide analogs described herein. In one embodiment, about 40% of the polynucleic acid molecules are comprised of the artificial nucleotide analogs described herein. In some examples, about 45% of the polynucleic acid molecules comprise an artificial nucleic acid as described herein. In some examples, about 50% of the polynucleic acid molecules comprise a nucleic acid analog as described herein. In some instances, about 55% of the polynucleic acid molecule comprises an artificial nucleotide analog. In some examples, the polynuclear nucleotide analog comprises an artificial nucleotide analog as described herein. Approximately 60% of the acid molecules contain the artificial nucleotide analogs described herein. In one example, about 65% of the polynucleic acid molecules are comprised of the artificial nucleotide analogs described herein. In some examples, about 70% of the polynucleic acid molecules comprise an artificial nucleic acid as described herein. In some examples, about 75% of the polynucleic acid molecules comprise a nucleic acid analog as described herein. In some instances, about 80% of the polynucleic acid molecule comprises an artificial nucleotide analogue. In some examples, the polynuclear nucleotide analog comprises an artificial nucleotide analog as described herein. Approximately 85% of the acid molecules contain the artificial nucleotide analogs described herein. In one embodiment, about 90% of the polynucleic acid molecule comprises an artificial nucleotide analog as described herein. In some examples, about 95% of the polynucleic acid molecules comprise the artificial nucleic acid sequences described herein. In some examples, about 96% of the polynucleic acid molecules comprise a nucleic acid analog as described herein. In some instances, about 97% of the polynucleic acid molecule comprises an artificial nucleotide analogue. In some examples, the polynuclear nucleotide analog comprises an artificial nucleotide analog as described herein. Approximately 98% of the acid molecules contain the artificial nucleotide analogs described herein. In one embodiment, about 99% of the polynucleic acid molecule comprises an artificial nucleotide analog as described herein. In some examples, about 100% of the polynucleic acid molecules are comprised of the artificial nucleic acid sequences described herein. In some embodiments, the artificial nucleotide analog comprises 2 '-O-Methyl, 2'-O-Methoxyethyl (2'-O-MOE), 2'-O-Aminopeptide propyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl ( 2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'- O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyl 2'-O-DMAEOE or 2'-ON-methylacetamide (2'-O-NMA) modified LNA, ENA, PNA, HNA, morpholino, -methyl 2'-Fluoro-N3 -P5'-phosphoramidites, or combinations thereof.

[0105] In some embodiments, the polynucleic acid molecule comprises from about 1 to about 25 modifications, wherein the modifications The decoration comprises an artificial nucleotide analog described herein. In some embodiments, In accordance with the present invention, the polynucleic acid molecule comprises about one modification, wherein the modification is an artificial nucleotide as described herein. In some embodiments, the polynucleic acid molecule comprises about two modifications. , where the modification comprises an artificial nucleotide analog as described herein. In embodiments, the polynucleic acid molecule comprises about three modifications, where the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue having about 4 wherein the modification includes an artificial nucleotide analog as described herein. In some embodiments, the polynucleic acid molecule comprises about 5 modifications, wherein the modifications are In some embodiments, the polynuclear nucleotide analogs include those described in the above. The acid molecule contains about six modifications, where the modifications are selected from the group consisting of the artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 7 modifications, wherein Modifications include artificial nucleotide analogs as described herein. In one embodiment, the polynucleic acid molecule comprises about 8 modifications, wherein the modifications are selected from the group consisting of artificial nucleotides described herein. In some embodiments, the polynucleic acid molecule comprises about 9 modifications. wherein the modification includes an artificial nucleotide analog as described herein. In an embodiment, the polynucleic acid molecule comprises about 10 modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. and about 11 modifications, wherein the modifications are selected from the group consisting of artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 12 modifications, wherein the modifications comprises an artificial nucleotide analog as described herein. In some embodiments, The polynucleic acid molecule comprises about 13 modifications, where the modifications are artificial nucleotides as described herein. In some embodiments, the polynucleic acid molecule comprises about 14 modifications. wherein the modification includes an artificial nucleotide analog as described herein. In an embodiment, the polynucleic acid molecule comprises about 15 modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. and about 16 modifications, wherein the modifications are selected from the group consisting of artificial nucleotide analogs described herein. In some embodiments, the polynucleic acid molecule comprises about 17 modifications, wherein the modifications comprises an artificial nucleotide analog as described herein. In some embodiments, The polynucleic acid molecule comprises about 18 modifications, where the modifications are artificial nucleotides as described herein. In some embodiments, the polynucleic acid molecule comprises about 19 modifications. wherein the modification includes an artificial nucleotide analog as described herein. In an embodiment, the polynucleic acid molecule comprises about 20 modifications, wherein the modifications are as described herein. In some embodiments, the polynucleic acid molecule comprises an artificial nucleotide analogue. The modified nucleotides include about 21 modifications, where the modifications are artificial nucleotide analogs as described herein. In some embodiments, the polynucleic acid molecule comprises about 22 modifications, wherein the modifications comprises an artificial nucleotide analog as described herein. In some embodiments, The polynucleic acid molecule comprises about 23 modifications, where the modifications are artificial nucleotides as described herein. In some embodiments, the polynucleic acid molecule comprises about 24 modifications. wherein the modification includes an artificial nucleotide analog as described herein. In an embodiment, the polynucleic acid molecule comprises about 25 modifications, wherein the modifications are as described herein. The artificial nucleotide analogues include

[0106] In some embodiments, the polynucleic acid molecule is composed of two separate polynucleotides. wherein one polynucleotide comprises a sense strand and the second polynucleotide comprises a sense strand. In another embodiment, the sense strand is linked to a linker molecule. Thus, the antisense strand is connected to the polynucleotide linker, which in some instances is - or a non-nucleotidic linker.

[0107] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, The pyrimidine nucleotides in the sense strand are 2'-O-methylpyrimidine nucleotides. The purine nucleotides in the sense strand include 2'-deoxy purine nucleotides. In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, wherein: The pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'-fluoropyrimidines. purine nucleotides present in the sense strand are 2'-deoxy purine nucleotides. Contains phosphorus nucleotides.

[0108] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and pyrimidine nucleotides, when present in the antisense strand, are 2'-deoxy 2'-fluoropyrimidine nucleotides, and purine nucleotides are When present in the base strand, they are 2'-O-methyl purine nucleotides.

[0109] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and pyrimidine nucleotides, when present in the antisense strand, are 2'-deoxy 2'-fluoropyrimidine nucleotides, and purine nucleotides are When present in the source strand, it contains 2'-deoxy-purine nucleotides.

[0110] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, The sense strand can be the 5'-end, the 3'-end, or both the 5' and 3' ends of the sense strand. In another embodiment, the terminal cap moiety comprises an inverted deoxy abasic moiety. minutes.

[0111] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, In the antisense strand, a phosphate backbone modification is included at the 3' end of the antisense strand. In an example, the phosphate backbone modification is phosphorothioate.

[0112] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand contains a glyceryl modification at the 3' end of the antisense strand.

[0113] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the sense strand has one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phospho thioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl , 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2 , 3, 4, 5, 6, 7, 8, 9, 10 or more) and / or Universal base-modified nucleotides, and optionally the 3'-terminus, 5'-terminus, or or containing terminal cap molecules at both the 3'- and 5'-ends; and is from about 1 to about 10, particularly about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphoro thioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) universal base-modified nucleotides , and optionally the 3'-terminus, 5'-terminus, or 3'- and 5'-terminus of the antisense strand. In other embodiments, the amine comprises one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of the sense strand and / or The pyrimidine nucleotides in the antisense strand are 2'-deoxy, 2'-O-methyl, and and / or 2'-deoxy-2'-fluoro nucleotides, or , e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioates. oate internucleotide linkages and / or 3'- with end-capping molecules at the termini, the 5'-terminus, or both the 3'- and 5'-terminus, Alternatively, it may be chemically modified without using any of the above.

[0114] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the sense strand is about 1 to about 25, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioates and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) of 2'-deoxy, 2'-O-methyl, 2'- deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4 , 5, 6, 7, 8, 9, 10 or more) universal base-modified nucleotides, and, optionally, the 3'-terminus, 5'-terminus, or both the 3'- and 5'-terminus of the sense strand. and the antisense strand comprises an end cap molecule having from about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 1 7, 18, 19, 20 or more phosphorothioate internucleotide linkages, and and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or (or more) 2'-deoxy, 2'-O-methyl, 2'-deoxy-2'-fluoro, etc. and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) universal base modified nucleotides, and optionally Contains terminal capping molecules at the 3'-terminus, 5'-terminus, or both the 3'- and 5'-terminus In other embodiments, one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9 , 10, or more pyrimidine nucleotides in the sense and / or antisense strands. The oxidases are 2'-deoxy, 2'-O-methyl, and / or 2'-deoxy-2'- Using fluoronucleotides, from about 1 to about 25 or more, e.g., about 1, 2, 3, 4, 5 , 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 2 0 or more phosphorothioate internucleotide linkages and / or or the 3'-terminus, 5'-terminus, or both the 3'- and 5'-terminus on different strands. The carboxylates are chemically modified with or without end-capping molecules.

[0115] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand is one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate internucleotide linkages, and / or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2'-deoxy, 2'-O -methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g. Approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the universal base modification nucleic acids nucleotide, and optionally the 3'-terminus, 5'-terminus, or 3'- and 5'-terminus of the sense strand. and the antisense strand comprises an end cap molecule at both ends of the antisense strand and an end cap molecule at both ends of the antisense strand. 0, especially about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more hosts Holothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3 , 4, 5, 6, 7, 8, 9, 10 or more) of 2'-deoxy, 2'-O-methyl 1, 2'-difluoro, 2'-deoxy-2'-fluoro, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modification nucleoside tide, and optionally the 3'-terminus, 5'-terminus, or 3'- and 5'-terminus of the antisense strand. In other embodiments, one or more, e.g., , about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20 or more, sense and / or antisense strands The pyrimidine nucleotides are 2'-deoxy, 2'-O-methyl, and / or 2' 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide bonds and / or 3'-terminus, 5'-terminus or any combination thereof present on the same or different strands. Chemically modified with or without end capping molecules at both the 3' and 5' ends. will be done.

[0116] In some embodiments, the polynucleic acid molecule comprises a sense strand and an antisense strand, and the antisense strand is about 1 to about 25, e.g., about 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or one or more phosphorothioate internucleotide linkages, and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of 2'-deoxy, 2 '-O-methyl, 2'-deoxy-2'-fluoro, and / or one or more (e.g. For example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more universal bases Modified nucleotides, and optionally, the 3'-terminus, 5'-terminus, or 3' and the antisense strand comprises a terminal cap molecule at both the - and 5'-ends, and to about 25, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20 or more phosphorothioate nucleic acids Internucleotide bonds and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10 or more) of 2'-deoxy, 2'-O-methyl, 2'-deoxy and / or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and Optionally, the 3'-terminus, the 5'-terminus, or both the 3'- and 5'-terminus of the antisense strand. In other embodiments, the end capping molecule comprises one or more, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more of the sense and / or antisense strands Pyrimidine nucleotides can be 2'-deoxy, 2'-O-methyl, and / or 2'- Using deoxy-2'-fluoro nucleotides, the , 4, 5 or more phosphorothioate internucleotide linkages, and / or the same or 3'-terminus, 5'-terminus, or both 3'- and 5'-terminus on different strands It is chemically modified with or without end-capping molecules.

[0117] In some embodiments, the polynucleic acid molecules described herein are In each chain, about 1 to about 25, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more hosts Chemically modified short interfering nucleic acid molecules having holothioate internucleotide linkages.

[0118] In another embodiment, the polynucleic acid molecules described herein have a 2'-5' internucleotide linkage. In some instances, the 2'-5' internucleotide linkage is At the 3'-end, 5'-end, or both the 3'-end and 5'-end of the strand. Additional examples In the case of 2'-5' internucleotide linkages, the 2'-5' internucleotide linkages can be located at various other positions within one or both strands of the sequence. For example, all of the pyrimidine nucleotides in one or both strands of a polynucleic acid molecule Approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more of all internucleotide bonds The above may contain 2'-5' internucleotide linkages or may be present at one or both ends of a polynucleic acid molecule. In one strand, approximately 1, 2, 3, 4, 5, or 6 of all internucleotide bonds of purine nucleotides are 6, 7, 8, 9, 10, or more contain 2'-5' internucleotide linkages.

[0119] In some embodiments, the polynucleic acid molecule mediates RNAi activity in a cell or A single stranded polynucleic acid molecule reconstituted in an in vitro system, wherein the polynucleic acid molecule is a target nucleic acid molecule. The nucleic acid sequence of the nucleic acid is a single stranded polynucleotide having a complementarity to the nucleic acid sequence of the nucleic acid. At least one of the pyrimidine nucleotides is a 2'-deoxy-2'-fluoro pyrimidine nucleotides (e.g., where all pyrimidine nucleotides are 2'-deoxy or, alternatively, a plurality of pyrimidine nucleotides. The pyrimidine nucleotide is a 2'-deoxy-2'-fluoropyrimidine nucleotide), and Any purine nucleotide present in the polynucleic acid is converted to a 2'-deoxypurine nucleotide. (e.g., all purine nucleotides are 2'-deoxypurine nucleotides) or alternatively, the plurality of purine nucleotides are 2'-deoxypurine nucleotides. The terminal cap modification is at the 3'-end of the antisense sequence, Optionally, the polynucleic acid molecule may have a 3′-terminus, or both the 3′- and 5′-terminus, and the polynucleic acid molecule may have a 3′-terminus or both the 3′- and 5′-terminus. The 3' end of the molecule has from about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2'-deoxy Optionally, the terminal nucleotide may further comprise one or more silibonucleotides. containing the above (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages , and, optionally, the polynucleic acid molecule further comprises a terminal phosphate group, such as a 5'-terminal phosphate group.

[0120] In some cases, one or more of the artificial nucleotide analogs described herein are naturally occurring. In comparison with the polynucleic acid molecules of, for example, ribonucleases such as RNase H, DNase Deoxyribonucleases such as 5'-3' exonucleases and 3'-5' Resistant to nucleases such as exonucleases In some instances, 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE ), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2' -O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O -DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO- Dimethylaminoethyloxyethyl (2'-O-DMAEOE) or modified 2'-ON-methylacetamide (2'-O-NMA), LNA, ENA, PNA, H NA, morpholino, methylphosphonate nucleotide, thiolphosphonate nucleotide 2'-fluoroN3-P5'-phosphoramidite, or a combination of these. Artificial nucleotide analogs containing ribonucleases such as RNase H and DNase Which deoxyribonuclease or 5'-3' exonuclease or 3'-5' endonuclease It is resistant to nucleases, such as exonucleases, such as xonucleases. In some instances, the 2'-O methyl modified polynucleic acid molecule is nuclease resistant (e.g., RNaseH, DNase, 5'-3' exonuclease, or 3'-5' exonuclease In some instances, 2'O-methoxyethyl (2'-O- The MOE modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase , 5'-3' exonuclease, or 3'-5' exonuclease resistant In some instances, the 2'-O-aminopropyl modified polynucleic acid molecule is nuclease resistant. Resistance (e.g., to RNase H, DNase, 5'-3' exonuclease, or 3 In some instances, 2'-deoxy modified polynucleotides are The nucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' endonucleases, etc.). xonuclease, or 3'-5' exonuclease resistant). In an example, the T-deoxy-2'-O-fluoro modified polynucleic acid molecule is nuclease resistant ( For example, RNaseH, DNase, 5'-3' exonuclease, or 3'-5 'exonuclease resistant). In some instances, 2'-O-aminopropyl ( The 2'-O-AP) modified polynucleic acid molecules are nuclease resistant (e.g., RNase H, D Nase, 5'-3' exonuclease, or 3'-5' exonuclease resistance In some instances, 2'-O-dimethylaminoethyl (2'-O-DMAO E) The modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 The two types of exonuclease resistant nucleotides are 3'-3' exonuclease resistant, or 3'-5' exonuclease resistant. In some examples, 2'-O-dimethylaminopropyl (2'-O-DMAP) modified poly The nucleic acid molecule may be nuclease resistant (e.g., RNase H, DNase, 5'-3' exon, Some examples are: Then, TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified poly The nucleic acid molecule may be nuclease resistant (e.g., RNase H, DNase, 5'-3' exon, Some examples are: In this study, 2'-ON-methylacetamide (2'-O-NMA) modified polynucleic acid molecules were Nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease In some instances, the LNA modification is The modified polynucleotide molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3 'Exonuclease, or 3'-5' exonuclease resistant). In some instances, the ENA modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease, or 3'-5' exonuclease resistance In some instances, the HNA modified polynucleic acid molecule is nuclease resistant (e.g. For example, RNaseH, DNase, 5'-3' exonuclease, or 3'-5' In some instances, the morpholino is nuclease resistant. Resistance (e.g., to RNase H, DNase, 5'-3' exonuclease, or 3 In some instances, the PNA modified polynucleic acid molecule is The product is resistant to nucleases (e.g., RNaseH, DNase, 5'- 3' exonuclease or 3'-5' exonuclease resistant). In an example, the methylphosphonate nucleotide modified polynucleic acid molecule is nuclease resistant (e.g. For example, RNaseH, DNase, 5'-3' exonuclease, or 3'-5' In some instances, thiolphosphonate nucleosides are used. The tide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 The two types of exonuclease resistant nucleotides are 3'-3' exonuclease resistant, or 3'-5' exonuclease resistant. In some examples, polynucleic acid molecules comprising 2'-fluoro N3-P5'-phosphoramidites. , nuclease resistance (e.g., RNase H, DNase, 5'-3' exonuclease In some cases, the The 5' conjugates described herein inhibit 5'-3' exonucleolytic cleavage. In some instances, the 3' conjugates described herein inhibit 3'-5' exonucleolytic cleavage. To harm.

[0121] In some embodiments, one of the artificial nucleotide analogs described herein The above shows that the binding affinity of the polynucleic acid molecule to its mRNA target is higher than that of the equivalent natural polynucleic acid molecule. 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2' -O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl Aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMA OE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethyl Aminoethyloxyethyl (2'-O-DMAEOE) or modified 2'-O -N-methylacetamide (2'-O-NMA), LNA, ENA, PNA, HNA, phosphono, methylphosphonate nucleotides, thiolphosphonate nucleotides, and is one of the artificial nucleotide analogues containing 2'-fluoro N3-P5'-phosphoramidites. At least one of the nucleic acid molecules has a higher binding affinity for its mRNA target than a comparable naturally occurring polynucleic acid molecule. In some instances, the 2'-O-methyl modified polynucleic acid molecule has increased Compared to polynucleic acid molecules, they have increased binding affinity to their mRNA targets. In the example, a 2'-O-methoxyethyl (2'-O-MOE) modified polynucleic acid molecule is equivalent to The polynucleic acid molecule has increased binding affinity to its mRNA target compared to the natural polynucleic acid molecule. In some instances, the 2'-O-aminopropyl modified polynucleic acid molecule has a similar structure to the equivalent naturally occurring polynucleic acid. In some cases, the binding affinity of the target mRNA was increased compared to that of the non-targeted siRNA. , 2'-deoxy modified polynucleic acid molecules have a lower mR than comparable natural polynucleic acid molecules. In some instances, T-deoxy-2'-furan was used to increase the binding affinity to the NA target. Luoro-modified polynucleic acid molecules bind to their mRNA targets more efficiently than comparable natural polynucleic acid molecules. In some instances, 2'-O-aminopropyl (2'- O-AP) modified polynucleic acid molecules have been shown to have a higher mRNA targeting activity compared to comparable natural polynucleic acid molecules. In some instances, 2'-O-dimethylaminoethyl The 2'-O-DMAOE modified polynucleic acid molecules have been shown to be more effective than the equivalent natural polynucleic acid molecules. In some instances, the 2'-O-diaminophenyl 2'-amino acid residues were used to increase the binding affinity for their mRNA targets. Methylaminopropyl (2'-O-DMAP) modified polynucleic acid molecules are similar to the natural polynucleic acid molecules. In some cases, the agonist molecule has increased binding affinity to its mRNA target compared to the agonist molecule. The 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) modified poly The nucleic acid molecule has a higher binding affinity for its mRNA target compared to a comparable naturally occurring polynucleic acid molecule. In some cases, 2'-ON-methylacetamide (2'-ON MA) modified polynucleic acid molecules bind to their mRNA targets more efficiently than comparable natural polynucleic acid molecules. In some instances, the LNA modified polynucleic acid molecules have increased binding affinity to The binding affinity to its mRNA target is increased compared to the natural polynucleic acid molecule. In some instances, the ENA-modified polynucleic acid molecule exhibits a reduced m In some instances, PNA-modified polynucleic acid molecules have been used to increase the binding affinity to RNA targets. The molecule has increased binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule. In some instances, the HNA modified polynucleic acid molecules have a higher affinity for nucleotides compared to the equivalent natural polynucleic acid molecule. In some instances, morpholinotransferases were used to increase the binding affinity for their mRNA targets. A modified polynucleic acid molecule has a lower affinity for its mRNA target than a comparable natural polynucleic acid molecule. In some instances, methylphosphonate nucleotide modified polynucleotides were used to increase the binding affinity of the nucleotides. The nucleic acid molecule has a higher binding affinity for its mRNA target than a comparable naturally occurring polynucleic acid molecule. In some instances, the thiol phosphonate nucleotide modified polynucleic acid molecule has increased binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule. In some instances, polynuclear 2'-fluoro N3-P5'-phosphoramidites were used. The acid molecule has a higher binding affinity for its mRNA target compared to a comparable natural polynucleic acid molecule. In some cases, the increased affinity is due to a lower Kd, a higher melting temperature (Tm), or or combinations thereof.

[0122] In some embodiments, the polynucleic acid molecules described herein are chirally pure. or stereopure) polynucleic acid molecules, or polynucleic acid molecules containing a single enantiomer. In some examples, the polynucleic acid molecule comprises L-nucleotides. In some instances, the polynucleic acid molecule comprises D-nucleotides. is 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2% of its enantiomer. %, 1%, or less. In some cases, the polynucleic acid molecule composition comprises a racemic mixture. 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or In some examples, the polynucleic acid molecule is selected from the group consisting of U.S. Patent Application Publication No. 2014 / 1 94610 and 2015 / 211006; and PCT International Publication No. WO20151 07425.

[0123] In some embodiments, the polynucleic acid molecules described herein are aptamer-binding In some instances, the aptamer-binding moiety is further modified to include a DNA In some instances, the aptamer binding moiety is an Alphame r (Centauri Therapeutics), which targets specific cell surface and a portion that displays a specific epitope for binding to circulating antibodies. In some instances, the polynucleic acid molecules described herein include those disclosed in U.S. Pat. Nos. 8,604,184, 8,591,910 and 7,850,975 It is further modified to include an aptamer-binding moiety as described.

[0124] In additional embodiments, the polynucleic acid molecules described herein may be modified to increase their stability. In some embodiments, the polynucleic acid molecule is an RNA (e.g., an siRNA). In some instances, the polynucleic acid molecule is a nucleic acid molecule as described above in order to increase its stability. In some cases, the polynucleic acid molecule is modified by one or more of the modifications described above. '-O-Methyl, 2'-O-Methoxyethyl (2'-O-MOE), 2'-O-Aminopeptide propyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl ( 2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'- O-Dimethylaminopropyl (2'-O-DMAP), TO-Dimethylaminoethyl 2'-O-DMAEOE, or 2'-O-Methylacetamide ( 2'-O-NMA) modifications, or locked or bridged ribose structures (e.g., LNA In some cases, the polyamine is modified at the 2 hydroxyl position, for example with phenylalanine or phenylalanine. The nucleic acid molecules are linked by 2'-O-methyl and / or 2'-O-methoxyethyl ribose. In some cases, the polynucleic acid molecule is further modified with a nucleotide sequence to increase its stability. , morpholino, PNA, HNA, methylphosphonate nucleotides, thiolphosphonate and / or 2'-fluoro N3-P5'-phosphoramidites In some instances, the polynucleic acid molecule is a chirally pure (or stereopure) polynucleic acid. In some instances, chirally pure (or stereopure) polynucleic acid molecules. has been modified to increase its stability. Suitable modifications of A will be apparent to those skilled in the art.

[0125] In some instances, the polynucleic acid molecule comprises self-complementary sense and antisense regions. wherein the antisense region is a double-stranded polynucleotide molecule comprising a target nucleic acid sequence. a nucleotide sequence complementary to a nucleotide sequence in the nucleic acid sequence or a portion thereof; has a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. A polynucleic acid molecule is assembled from two separate polynucleotides, one of which is the sense strand. and the other strand is the antisense strand, where the antisense strand and the sense strand are They are self-complementary (i.e., each strand contains nucleotides that are complementary to the nucleotide sequence of the other strand). the antisense strand and the sense strand form a duplex or double-stranded structure; For example, the double-stranded region may be about 19, 20, 21, 22, 23, or more base pairs long. The antisense strand is complementary to the nucleotide sequence of the target nucleic acid molecule or a portion thereof. the sense strand contains a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof; Alternatively, the polynucleic acid molecule can be assembled from a single oligonucleotide. The self-complementary sense and antisense regions of the polynucleic acid molecule may be nucleic acid-based or non-nucleic acid-based. Attached via an acid-based linker.

[0126] In some cases, the polynucleic acid molecule has self-complementary sense and antisense regions. duplex, asymmetric duplex, hairpin, or asymmetric hairpin secondary structures wherein the antisense region is a polynucleotide having the structure The nucleotide sequence of the sense region is complementary to a nucleotide sequence of the target nucleic acid. In other cases, the nucleic acid molecule has a nucleotide sequence corresponding to the nucleic acid sequence or a portion thereof. The fragment has two or more loop structures and a base that contains self-complementary sense and antisense regions. wherein the antisense region is a circular single-stranded polynucleotide having a target nucleic acid sequence. A nucleotide sequence complementary to the nucleotide sequence of the nucleic acid molecule or a portion thereof, The region has a nucleotide sequence corresponding to a target nucleic acid sequence or a portion thereof, The tides are then transfected in vivo to generate active polynucleic acid molecules capable of mediating RNAi. In a further instance, the polynucleic acid molecule is further treated with a target nucleic acid sequence. A single-stranded polynucleotide having a nucleotide sequence complementary to the nucleotide sequence of the nucleic acid fragment or a portion thereof. Such polynucleic acid molecules include nucleic acid fragments that are directed to a target nucleic acid sequence or a portion thereof. (It is not necessary that the corresponding nucleotide sequence is present within a polynucleic acid molecule) Nucleotides can also be converted to 5'-phosphates (e.g., Martinez et al., 2013). 02,Cell.,110,563-574 and Schwarz et al.,200 2, Molecular Cell, 10, 537-568) or 5',3' -Containing a terminal phosphate group, such as diphosphate.

[0127] In some instances, the asymmetric hairpin may comprise an antisense region and a nucleotide or A linear polynucleic acid molecule comprising a loop portion containing a non-nucleotide and a sense region, the sense region has sufficient complementary nucleotides to base pair with the antisense region, The antisense region has fewer nucleotides than the antisense region so as to form a double strand having a loop. For example, asymmetric hairpin-shaped polynucleic acid molecules can be used to generate R sequences in cells or in vitro systems. has a length sufficient to mediate NAi and contains about 4 to about 8 nucleotides An antisense region having a loop region (e.g., about 19 to about 22 nucleotides) and an antisense region having an antisense loop region (e.g., about 19 to about 22 nucleotides). and a sense region having about 3 to about 18 nucleotides complementary to the sense region. Therefore, the asymmetric hairpin polynucleic acid molecule further comprises a chemically modified 5'-terminal linker. In a further embodiment, the loop portion of the asymmetric hairpin polynucleic acid molecule comprises , nucleotides, non-nucleotides, linker molecules, or conjugate molecules.

[0128] In some embodiments, the asymmetric duplex comprises a sense region and an antisense region. A polynucleic acid molecule having two separate strands containing a sense region and an antisense region. has sufficient complementary nucleotides to base pair with and form a duplex , which contains fewer nucleotides than the antisense region. For example, an asymmetric double polynucleotide The acid molecule is an amplicon of sufficient length to mediate RNAi in cells or in vitro systems. a sense region (e.g., about 19 to about 22 nucleotides) and a region complementary to the antisense region and a sense region having a target sequence of about 3 to about 18 nucleotides.

[0129] In some cases, the universal bases are virtually indistinguishable from natural DNA / RNA Refers to nucleotide base analogs that form base pairs with each of the bases. Typical examples are C-phenyl, C-naphthyl, and other aromatic aryl groups known in the art. Aromatic derivatives, inosine, azole carboxamides, and 3-nitropyrrole, 4-nitropyrrole, Nitroazoins, such as troindole, 5-nitroindole, and 6-nitroindole Nucleic Acids R (see esearch,29,2437-2447).

[0130] Polynucleic acid molecule synthesis In some embodiments, the polynucleic acid molecules described herein are Constructed using chemical synthesis and / or enzymatic ligation reactions using known procedures. For example, polynucleic acid molecules can be constructed using naturally occurring nucleotides or by synthesis. To increase the biostability of the nucleic acid molecule, or to enhance the affinity of the nucleic acid molecule formed between the polynucleic acid molecule and the target nucleic acid. A variety of modified nucleotides designed to increase the physical stability of the resulting duplex were used. Exemplary methods include those described in U.S. Pat. No. 42,047; No. 5,185,444; No. 5,889,136; No. 6,008,4 00; and 6,111,086; PCT International Publication No. WO2009099942 or European Patent Publication No. 1579015. Additional exemplary methods are described below. Griffey et al., "2'-O-aminopropyl ribonucleotides: a zwitterionic modific ation that enhances the exonuclease resi stance and biological activity of antise nse oligonucleotides,” J. Med. Chem. 39( 26):5100-5109 (1997)); Obika, et al. thesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides h aving a fixed C3,-endo sugar puckering”. Tetrahedron Letters 38 (50): 8735 1997; Koizumi, M. “ENA oligonucleotides as the current opinion in molecular therapeutics 8 (2): 144-149 (2006); and Abramova et al., “Novel oligonucleotide analogues based on morpholino nucleosides subunits-antisense technologies: new ch emical possibilities,” Indian Journal of Chemistry 48B:1721-1726 (2009). Alternatively, polynuclear The nucleic acid molecule is produced using an expression vector into which a polynucleic acid molecule has been subcloned in an antisense orientation. The inserted polynucleic acid molecule is then biologically produced (i.e., the transcribed RNA of the inserted polynucleic acid molecule is the desired (in an antisense orientation relative to the target polynucleic acid molecule).

[0131] In some embodiments, the polynucleic acid molecule is synthesized by a tandem synthesis method, Here, both strands are bound to a single adjacent oligonucleotide fragment separated by a cleavable linker. The fragments or strands are then cleaved to form the hybridization duplex. This results in separate fragments or strands which allow for purification of the duplex.

[0132] In some instances, a polynucleic acid molecule may also be composed of two distinct nucleic acid strands or fragments. A fragment containing the sense region and a second fragment containing the split region are constructed. The antisense region of the gene is included.

[0133] Further modification methods, for example to incorporate sugar, base, and phosphate modifications, include the following: Includes: Eckstein et al., International Publi cation PCT No. WO 92 / 07065; al. Nature,1990,344,565-568; Pieken et a l. Science,1991,253,314-317; Usman and C edergren,Trends in Biochem. Sci.,1992,17 ,334-339; Usman et al. International Pub lication PCT No. WO 93 / 15187; Sproat,US Pat. No. 5,334,711 and Beigelman et al. .,1995,J. Biol. Chem.,270,25702; Beigelm an et al.,International PCT publication No. WO 97 / 26270; Beigelman et al., US P at. No. 5,716,824; Usman et al., US Pat No. 5,627,053; Woolf et al. nal PCT Publication No. WO 98 / 13526; mpson et al., US Ser. No. 60 / 082,404 wh ich was filed on Apr. 20,1998; Karpeisky et al.,1998,Tetrahedron Lett.,39,1131; Earnshaw and Gait, 1998, Biopolymers (Nucl eic Acid Sciences),48,39-55; Verma and E. ckstein,1998,Annu. Rev. Biochem.,67,99-1 34; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010. The above publication discloses a method for the synthesis of nucleic acids without regulating the catalytic activity. Methods for determining locations for incorporating sugar, base, and / or phosphate modifications into a molecule. It describes the methods and tactics.

[0134] In some instances, phosphorothioate, phosphorodithioate, and / or 5' Chemical modification of the internucleotide bonds of polynucleic acid molecules with -methylphosphonate bonds increases their stability. While this improves the overall activity of the protein, excessive modification often leads to toxicity or reduced activity. However, when designing nucleic acid molecules, the amount of these internucleotide bonds may be minimized. In such cases, decreasing the concentration of these bonds reduces the toxicity of these molecules. This increases efficacy and high specificity.

[0135] polynucleic acid molecule conjugate In some embodiments, the polynucleic acid molecule further comprises a polypeptide to be delivered to a desired site. In some cases, the polynucleic acid molecule is optionally polymerized with polypeptide A. Bind to the part.

[0136] In some instances, at least one polypeptide A binds to at least one B. In some instances, at least one polypeptide A is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 29, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, to at least one B. In some embodiments, at least one A is , the 5' end of B, the 3' end of B, an internal site of B, or any combination thereof. In some examples, at least one polypeptide A binds to at least two B. In some examples, at least one polypeptide A has at least 2, 3, 4, 5 , 6, 7, 8 or more Bs.

[0137] In some embodiments, at least one polypeptide A is linked to at least one B. while at least one C forms an ABC conjugate. In some instances, at least one B is attached at the opposite end to Another polypeptide A is linked at one end to at least one B, while C At least one of B binds to an internal site of at least one of B. In some instances, at least At least one polypeptide A is directly linked to at least one C. In some examples, At least one B is linked via at least one C to form an ACB conjugate. It indirectly binds to at least one polypeptide A.

[0138] In some examples, at least one B and / or at least one C, and Optionally, at least one D is linked to at least one polypeptide A. In an example, at least one B is attached to at least one polypeptide A at a terminal (e.g., 5' or at the 3'-terminus or 3'-terminus) or at an internal site in at least one polypeptide A. In some cases, at least one C is linked to at least one polypeptide via a directly to peptide A or indirectly via at least one B. At least one C is generated by at least one B, and at least one polypeptide on B is generated by at least one C. at the same end as polypeptide A, at the opposite end from at least one polypeptide A, or In some instances, at least one additional polypeptide independently binds at an internal site. The peptide A further binds to at least one of the polypeptides A, B, or C. In some embodiments, at least one D is optionally linked to at least one polypeptide A, at least Directly or indirectly binds to one B or at least one C. When bound to at least one polypeptide A, at least one D also binds to the ADB. Optionally linked to at least one B to form a bond, or ADBC Optionally binds to at least one B and at least one C to form a conjugate. In some instances, to form a DABC conjugate, at least one D is directly to at least one polypeptide A, and directly to at least one B and at least one When it is indirectly bound to at least one polypeptide A, it is indirectly bound to at least one polypeptide C. At least one D is optionally linked to at least one B to form an ABD conjugate. Alternatively, at least one B and at least one C to form an ABDC conjugate. In some examples, at least one additional D is optionally linked to one or more C's. It binds to at least one of polypeptides A, B, or C.

[0139] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19A. Includes buildings.

[0140] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19B. Includes buildings.

[0141] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19C. Includes buildings.

[0142] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19D. Includes buildings.

[0143] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19E. Includes buildings.

[0144] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. Includes buildings.

[0145] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19G. Includes buildings.

[0146] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. 19H. Includes buildings.

[0147] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. Includes buildings.

[0148] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. Includes buildings.

[0149] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. Includes buildings.

[0150] In some embodiments, the polynucleic acid molecule conjugate has a structure as illustrated in FIG. Includes buildings.

[0151] The cartoon representation of the antibody as illustrated in FIG. 19M is for illustrative purposes only; or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal Antibodies or binding fragments thereof, monovalent Fab', divalent Fab 2 , single-stranded variable fragment scFv, diabody, minibody, nanobody, single target The main antibody (sdAb) or camelid antibody or binding fragment thereof .

[0152] joining part In some embodiments, the binding moiety A is a polypeptide. The polypeptide is an antibody or a fragment thereof. In some examples, the antibody or binding fragment thereof is Humanized antibodies or binding fragments thereof, murine antibodies or binding fragments thereof, chimeric antibodies antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, Monovalent Fab', divalent Fab 2 , F(ab)' 3 Fragment, single chain variable fragment (s cFv), bis-scFv, (scFv) 2 , diabodies, minibodies, nanobodies, Triabodies, tetrabodies, disulfide-stabilized Fv proteins (dsFv), Single domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof , a bispecific antibody or a binding fragment thereof, or a chemically modified derivative thereof. nothing.

[0153] In some examples, A is an antibody or a binding fragment thereof. A is a humanized antibody or a binding fragment thereof, a murine antibody or a binding fragment thereof , chimeric antibodies or binding fragments thereof, monoclonal antibodies or binding fragments thereof Fab', monovalent Fab', divalent Fab' 2 , F(ab)' 3 Fragment, single chain variable fragment (scFv), bis-scFv, (scFv) 2 , diabody, minibody, nanobody Diabodies, triabodies, tetrabodies, disulfide-stabilized Fv proteins ("dsFvs") v"), single domain antibodies (sdAb), Ig NAR, camelid antibodies or their binding fragments fragments, bispecific antibodies or binding fragments thereof, or chemically modified versions thereof In some examples, A is a humanized antibody or binding fragment thereof. In some examples, A is a mouse antibody or a binding fragment thereof. In some embodiments, A is a chimeric antibody or binding fragment thereof. In some embodiments, A is a monovalent Fab' antibody or a binding fragment thereof. In some instances, A is a bivalent Fab 2 In some instances, A is a single chain variable It is a fragment (scFv).

[0154] In some embodiments, binding moiety A is a bispecific antibody or binding fragment thereof. In some instances, the bispecific antibody is a trifunctional antibody or a bispecific miniantibody. In some cases, the bispecific antibody is a trifunctional antibody. A functional antibody is a full-length monoclonal antibody that contains binding sites for two different antigens. be.

[0155] In some cases, the bispecific antibody is a bispecific miniantibody. Bispecific miniantibodies consist of bivalent Fab 2 , F(ab)' 3 Fragment, bis-scFv, ( scFv) 2 , diabodies, minibodies, triabodies, tetrabodies, or In some embodiments, the bispecific T cell engager (BiTE) is Bispecific T cell engagers are designed to bind two scFvs that target epitopes from two different antigens. It is a fusion protein containing two targeting single-chain variable fragments (scFvs).

[0156] In some embodiments, binding moiety A is a bispecific miniantibody. In some examples, A is a bispecific Fab2. In some examples, A is a bispecific F(ab)' 3 Optionally, A is a bispecific bis-scFv fragment. Optionally, A is a bispecific bis-scFv fragment. Thus, in some embodiments where A is a bispecific (scFv), A is a bispecific In some embodiments, A is a bispecific minibody. In some embodiments, A is a bispecific triabody. In other embodiments, A is In another embodiment, A is a bispecific T cell antigen binding antibody. The device is called BiTE.

[0157] In some embodiments, binding moiety A is a trispecific antibody. , and trispecific antibodies are F(ab)' 3 Fragment or trispecific antibody. In one example, A is a trispecific F(ab)' 3 A is a fragment. In some cases, A is In some embodiments, A is a trispecific antibody. ,“Development of a trispecific antibody designed to simultaneously and efficiently ly target three different antigens on tu mor cells,” Mol. Pharmaceutics, 12(9): 34 90-3501(2015).

[0158] In some embodiments, binding moiety A is an antibody or is a binding fragment thereof. In some instances, binding moiety A is a cell surface The binding moiety is an antibody or a binding fragment thereof that recognizes the protein. Fragment A is an antibody or binding fragment thereof that recognizes a cell surface protein on skeletal muscle cells. It is.

[0159] In some embodiments, exemplary antibodies include, but are not limited to, anti-myosin antibodies, anti A transferrin antibody and an antibody that recognizes muscle-specific kinase (MuSK). In some examples, the antibody is an anti-transferrin (anti-CD71) antibody.

[0160] In some embodiments, the binding moiety A binds non-specifically to the polynucleic acid molecule (B). In some instances, the binding moiety A is linked to a lysine residue or a cis- In some examples, the binding moiety A is linked to the polynucleic acid molecule (B) via a tein residue. It is linked to the polynucleic acid molecule (B) via a lysine residue in a non-site specific manner. In other words, the binding moiety A is attached to the polynucleic acid molecule via a cysteine ​​residue in a non-site specific manner. Binds to (B).

[0161] In some embodiments, the binding moiety A binds to the polynucleic acid molecule in a non-site specific manner. In some instances, the binding moiety A binds to a lysine residue in a site-specific manner. at the 5'-terminus, at the 3'-terminus, via a cysteine ​​residue, a non-natural amino acid, or Enzyme-modified or enzyme-catalyzed residues are attached to the polynucleic acid molecule (B). Some examples In the example, a binding moiety A is attached to a polynucleic acid molecule (B) via a lysine residue in a site-specific manner. In some instances, binding moiety A binds to a cysteine ​​residue in a site-specific manner. In some instances, the binding moiety A binds to the polynucleic acid molecule (B) via a site-specific In some embodiments, the binding moiety A is linked to a polynucleic acid molecule (B) at its 5' end. , which is linked in a site-specific manner at its 3' end to a polynucleic acid molecule (B). The binding moiety A is attached to the polynucleic acid molecule (B) via the unnatural amino acid in a site-specific manner. In some instances, the binding moiety A binds to an enzyme modification or an enzyme in a site-specific manner. It binds to the polynucleic acid molecule (B) via the catalyzed residue.

[0162] In some embodiments, one or more polynucleic acid molecules (B) bind to a binding moiety A. In some instances, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16 or more polynucleic acid molecules are bound to one binding moiety A. In some instances, about one polynucleic acid molecule binds to one binding moiety A. In some cases, about 2 polynucleic acid molecules are bound to one binding moiety A. In some cases, about 3 polynucleic acid molecules are bound to one binding moiety A. The nucleic acid molecule binds to one binding moiety A. In some instances, about 4 polynucleic acid molecules bind to one In some examples, about 5 polynucleic acid molecules bind to one binding moiety A. In some examples, about 6 polynucleic acid molecules bind to one binding moiety A. In some examples, about 7 polynucleic acid molecules are bound to one binding moiety A. In some examples, About 8 polynucleic acid molecules are bound to one binding moiety A. In some examples, about 9 polynucleic acid molecules are bound to one binding moiety A. In some instances, about 10 polynucleic acid molecules are bound to one binding moiety A. In some examples, about 11 polynucleic acid molecules are bound to one binding moiety A. In some examples, about 12 polynucleic acid molecules bind to one binding moiety A. In some examples, about 13 polynucleic acid molecules are bound to one binding moiety A. In some cases, about 14 polynucleic acid molecules are bound to one binding moiety A. In some cases, about 15 The polynucleic acid molecule binds to one binding moiety A. In some examples, about 16 polynucleic acid molecules binds to one binding moiety A. In some cases, the one or more polynucleic acid molecules are the same. In other instances, one or more of the polynucleic acid molecules are different.

[0163] In some embodiments, the number of polynucleic acid molecules (B) bound to the binding moiety A is In some instances, the ratio is referred to as the DAR (drug-to-antibody) ratio, and is used in the present invention. The drug as referred to in the specification is a polynucleic acid molecule (B). In some instances, the binding moiety The DAR ratio of the polynucleic acid molecule (B) to A is about 1, 2, 3, 4, 5, 6, 7, 8, 9 , 10, 11, 12, 13, 14, 15, 16, or more. In some cases, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1 or more. In this example, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 2 or more. In some embodiments, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 3 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 4 or more. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is: The DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 5 or more. In some embodiments, the D of the polynucleic acid molecule (B) to the binding moiety A is about 6 or more. The AR ratio is greater than or equal to about 7. In some examples, the ratio of the polynucleic acid molecule (B) to the binding moiety A is In some instances, the DAR ratio of the polynucleic acid moiety A to the binding moiety B is about 8 or greater. The DAR ratio of the molecule (B) to the binding moiety A is about 9 or greater. The DAR ratio of the nucleic acid molecule (B) is about 10 or more. The DAR ratio of the polynucleic acid molecule (B) that binds the ligase is about 11 or more. The DAR ratio of polynucleic acid molecule (B) to component A is about 12 or greater.

[0164] In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1, 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 2 In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is: In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is about 4. , about 5. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is is about 6. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is In some examples, the DAR of the polynucleic acid molecule (B) relative to the binding moiety A is about 7. The ratio is about 8. In some examples, the DA of the polynucleic acid molecule (B) to the binding moiety A is The R ratio is about 9. In some examples, the D of the polynucleic acid molecule (B) to the binding moiety A The AR ratio is about 10. In some examples, the ratio of the polynucleic acid molecule (B) to the binding moiety A is about 10. is about 11. In some examples, the DAR ratio of the polynucleic acid molecule ( B) has a DAR ratio of about 12. The DAR ratio of the polynuclear molecule (B) to the binding moiety A is about 13. The DAR ratio of the acid molecule (B) is about 14. In some examples, the DAR ratio of the poly(A) to the binding moiety (A) is about 14. The DAR ratio of the nucleic acid molecule (B) to the binding moiety A is about 15. The DAR ratio of the polynucleic acid molecule (B) is about 16.

[0165] In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 In some instances, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 1. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 2. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 4. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 6. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 8. In some examples, the DAR ratio of the polynucleic acid molecule (B) to the binding moiety A is 12. do.

[0166] In some instances, compared to a conjugate comprising a polynucleic acid molecule (B) without a binding moiety A. In some cases, conjugates comprising a polynucleic acid molecule (B) and a binding moiety (A) have improved activity. The improved activity may be an enhancement of a biologically relevant function, e.g., the treatment of a disease state or This results in improved stability, affinity, binding, functional activity, and efficacy in prophylaxis. In some instances, the disease state is the result of one or more mutated exons of a gene. In some instances, the polynucleic acid molecule (B) is more specific than the conjugate (B) without the binding moiety A. A conjugate comprising a nucleic acid molecule (B) and a binding moiety (A) binds one or more mutated exons. In some instances, the polynucleic acid molecule without the binding moiety A may be Exon skipping is a process that involves the synthesis of a conjugate that contains a polynucleotide (B) and a nucleic acid molecule (C). In conjugates containing moiety A, at least or about 5%, 10%, 20%, 25%, 30%, %, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more than 95% Increase.

[0167] In some embodiments, the antibodies or binding fragments thereof, alone or in combination, In combination with conventional techniques known in the art, e.g., amino acid deletions By using deletions, insertions, substitutions, additions, and / or recombinations, and / or or other modifications known in the art (e.g., translational modifications such as glycosylation and phosphorylation). In some instances, the modification is by F In some instances, one or more modifications may be included to modulate interaction with the c receptor. The modifications include, for example, those described in International Publication No. WO97 / 34631, discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Such a nucleic acid sequence underlying the amino acid sequence of the antibody or binding fragment thereof may be Methods for introducing modifications are well known to those skilled in the art.

[0168] In some instances, the antibody binding fragment further includes derivatives thereof, and may include at least one The polypeptide sequence comprises one CDR.

[0169] In some instances, the term "single chain" as used herein refers to a bispecific single chain. The first and second domains of the chain construct are preferably encoded by a single nucleic acid molecule. Co-linear amino acid sequence This means that the bond is covalently bonded in the form of .nce.

[0170] In some instances, the bispecific single chain antibody construct comprises binding domains from two antibodies. In such an embodiment, the bispecific single chain antibody construct comprises a tandem b In some embodiments, the scFv is a linker peptide. In some embodiments, the linker comprises a VH domain and a VL domain connected by a peptide. Each of the first and second domains retains its differential binding specificity independently of the other. The length and sequence are sufficient to support the

[0171] In some embodiments, as used herein, the term "conjugate" refers to a bond with or by Interaction defines the binding / interaction of at least two antigen interaction sites with each other. In some instances, the antigen interaction site is identified as a specific antigen or a specific group of antigens. Define motifs of polypeptides that exhibit the ability to interact with one another. In some cases, binding / interaction The interaction is also understood to define a specific recognition. In such a case, the specific recognition is determined by an antibody or or the binding fragment is specific for at least two amino acids of each of the target molecules. It refers to the ability to interact and / or bind. For example, a particular recognition , which refers to the specificity of an antibody molecule, or its ability to distinguish a particular range of target molecules. In this example, the specificity of the antigen interaction site and the specific interaction with the antigen can be determined, for example, by the positioning of the antigen. This leads to signal initiation by inducing conformational changes and oligomerization of antigens. In one embodiment, the binding is based on the "key-lock principle." Thus, in some instances, the antigen interaction site and Certain motifs in the amino acid sequence of the antigen and the nucleotide sequence of ... , which bind to each other as a result of their primary, secondary, or tertiary structure. In such cases, antigens The specific interaction of an interaction site with its specific antigen allows for easy binding of the site to the antigen. bring about.

[0172] In some instances, the specific interaction further results in a reduction in the antibody or binding fragment thereof. This refers to less cross-reactivity or reduced off-target effects. peptide / protein but does not bind essentially to any other polypeptides The antibody or binding fragment thereof is specific for the desired polypeptide / protein. Specificity of the antigen interaction site Examples of specific interactions with antigens include ligands The specificity of the antibody with its receptor, e.g., the antigen-binding site of an antibody This includes interactions with the position.

[0173] Additional binding moieties In some embodiments, the binding moiety is a plasma protein. Plasma proteins include albumin. In some instances, binding moiety A is albumin. In some instances, albumin is conjugated to the albumin complex by one or more of the conjugation chemistries described herein. , which binds to polynucleic acid molecules. In some instances, albumin is a naturally occurring ligation site. In some instances, albumin binds to polynucleic acid molecules via lysine bonds. The nucleic acid molecule is then bound to the nucleic acid molecule.

[0174] In some examples, the binding moiety A is a steroid. Exemplary steroids are cholesterol, rols, phospholipids, diacylglycerols and triacylglycerols, fatty acids, carbonized Contains hydrogen (saturated, unsaturated, substituted, or a combination thereof). In some instances, the steroid is cholesterol. In some instances, cholesterol is a terol. In some instances, cholesterol is attached to the polynucleic acid molecule by one or more of the following: In some instances, the nucleic acid molecule is linked to a cholesterol-binding site by natural ligation chemistry. The role is bound to the polynucleic acid molecule by a lysine bond.

[0175] In some instances, the binding moiety may bind to, but is not limited to, a specific surface marker on a cell. In this example, the binding moiety is a polymer that contains a polynucleic acid molecule aptamer that binds to a target gene. They do not hybridize to the target molecule or mRNA, but instead identify cell surface markers that Similar to antibodies that bind to epitopes on the surface of cells, It is a polynucleic acid.

[0176] In some cases, the binding moiety A is a peptide. In some cases, the peptide is about 1 to about Optionally, the peptide is from about 1.2 to about 2.8 kDa, from about 1.5 to about 3 kDa. In some examples, the peptide comprises about 2.5 kDa, or about 1.5 to about 2 kDa. In some cases, the bicyclic peptide is a constrained bicyclic peptide ( In some cases, The peptide moiety is a bicyclic peptide (e.g., Bicycle Therapeutic s bicycles).

[0177] In further instances, the binding moiety is a small molecule. In some instances, the small molecule is an antibody-recruiting small molecule. molecule (antibody-recruiting small molecule) In some cases, the antibody-mobilizing small molecule comprises a target-binding end and an antibody-binding end, The binding terminus can then recognize and interact with cell surface receptors. For example, In one example, targets containing the compound glutamate urea were The binding terminus allows interaction with PSMA, thereby binding to cells expressing PSMA. In some instances, the binding moiety enhances antibody interactions as described by Zhang et al. ,“A remote arene-binding site on prostat e specific membrane antigen revealed by antibody-recruiting small molecules,” J Am Chem Soc. 132(36): 12711-12716 (2010) ;Alternatively, McEnaney, et al., “Antibody-recruitment ting molecules: an emerging paradigm for engaging immune function in treating hu man disease,” ACS Chem Biol. 7(7): 1139- 1151 (2012).

[0178] Production of antibodies or binding fragments thereof In some embodiments, the polypeptides described herein (e.g., antibodies and the like) (binding fragment) can be produced, inter alia, by chemical synthesis or by recombinant expression, Any method known in the art to aid in the synthesis of polypeptides (e.g., antibodies) may be used. and preferably produced by recombinant expression techniques.

[0179] In some instances, the antibody or binding fragment thereof is recombinantly expressed and the antibody or The nucleic acid encoding the binding fragment may be a chemically synthesized oligonucleotide (e.g. For example, Kutmeier et al., 1994, BioTechniques 17 242), which is a portion of the antibody coding sequence. Synthesis of overlapping oligonucleotides containing α-aminobutyric acid, annealing and lamination of the oligonucleotides Igation and subsequent amplification of ligated oligonucleotides by PCR Including width.

[0180] Alternatively, the nucleic acid molecule encoding the antibody may be a nucleic acid sequence that hybridizes to the 3' and 5' ends of the sequence. by PCR amplification using synthetic primers that can be used to identify specific gene sequences By cloning using oligonucleotide probes specific for the sequence, Any suitable source (e.g., antibody cDNA library or any nucleic acid expressing immunoglobulin) may be used. The cDNA library may be generated from any of a number of tissues or cells.

[0181] In some instances, the antibody or conjugate thereof is cultured in rabbit serum to produce polyclonal antibodies. or more preferably, by immunizing an animal such as a hamster, e.g., R and Milstein (1975, Nature 256:495-497) or as described by Kozbor et al. (1983, Immunology T oday 4:72) or Cole et al. (1985 in Monoclonal An tibodies and Cancer Therapy,Alan R. Liss , Inc., pp. 77-96) to produce monoclonal antibodies. Alternatively, a nucleic acid sequence encoding at least the Fab portion of the antibody may be produced. The clones that produce Fab fragments that bind to specific antigens are used as the clones that produce Fab fragments. Current libraries (e.g., Huse et al., 1989, Science 246 1275-1281), or by antibody labeling. Ibraly (Clackson et al., 1991, Nature 352:62 4; Hane et al.,1997 Proc. Natl. Acad. Sc i. Optionally obtained by screening do.

[0182] In some embodiments, the genes from a human antibody molecule of suitable biological activity By splicing genes from mouse antibody molecules of appropriate antigen specificity into "Chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855;Neuberger et al., 1984,Nature 312:604-608;Takeda et al.,19 85, Nature 314:452-454) was used. Chimeric antibodies are antibodies in which different portions are derived from a mouse monoclonal antibody, such as the variable region, and various animal species having human immunoglobulin constant regions (e.g., humanized antibodies). It is a molecule derived from an animal species.

[0183] In some embodiments, techniques described for the production of single chain antibodies (US Pat. No. 6,333,629) are used. t.No.4,694,778;Bird,1988,Science 242:423 -42;Huston et al.,1988,Proc. Natl. Acad. Sci.USA 85:5879-5883; and Ward et al.,19 89, Nature 334:544-54) is suitable for producing single chain antibodies. Single chain antibodies link the heavy or light chain fragments of the Fv region by an amino acid bridge. It is formed by the synthesis of 1,2-diaminobenzylamino-3-(2-methylphenyl)-2-propanediol, resulting in a single polypeptide chain. Function in E. coli Techniques for the assembly of standard Fv fragments are also optionally used (Skerra et al. al., 1988, Science 242:1038-1041).

[0184] In some embodiments, an expression vector comprising the nucleotide sequence of an antibody or an antibody The nucleotide sequence of the vector can be introduced into the host cell using conventional techniques (e.g., electroporation, liposome transfer, etc.). The plasmid is introduced into the host cell by transfection and calcium phosphate precipitation. The transfected cells are then cultured by conventional techniques to produce the antibody. In certain embodiments, expression of the antibody is constitutive, inducible, or tissue-specific. It is regulated by a promoter.

[0185] In some embodiments, various host-expression vector systems can be used to express the antibodies described herein. Such host expression systems are utilized to express the polypeptides or binding fragments thereof. Not only do they represent the vehicle in which the coding sequence of the antibody is generated and subsequently purified, but they also represent the appropriate nucleic acid. When modified or transfected with a nucleic acid coding sequence, the antibody or also refers to cells expressing the binding fragments in situ. These include, but are not limited to, However, recombinant bacteriophage DNA, plasmid DNA, or antibodies or Bacteria transformed with cosmid DNA expression vectors containing the ligation fragment coding sequences ( Microorganisms such as Escherichia coli and Bacillus subtilis; antibody or binding fragment coding sequences Yeast (e.g., Saccharomyces pichia) transformed with a recombinant yeast expression vector containing ); into a recombinant viral expression vector containing the antibody or binding fragment thereof coding sequence. Infected insect cell systems (e.g., baculovirus); recombinant viral expression vectors (e.g., , Cauliflower mosaic virus (CaMV) and Tobacco mosaic virus (TMV) ) or a recombinant plasmid containing the antibody or its binding fragment coding sequence. a plant cell line transformed with a smid expression vector (e.g., a Ti plasmid); or , the genome of mammalian cells (e.g., metallothionein promoter), or Animal viruses (e.g., adenovirus late promoter; vaccinia virus 7.5K A mammalian cell line containing a recombinant expression construct comprising a promoter derived from Cellular lines (e.g., COS, CHO, BH, 293, 293T, 3T3 cells).

[0186] For long-term, high-yield production of recombinant proteins, stable expression is preferred. In some instances, cell lines that stably express the antibody are engineered. Rather than using expression vectors containing origins, host cells are required to express appropriate expression control elements, e.g. For example, promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc. ) and DNA controlled by a selectable marker. After induction, cells are engineered to grow in enriched media for 1-2 days and then switched to selective media. The selectable marker on the recombinant plasmid confers resistance to the selection The cells stably integrate the plasmid into their chromosomes and are grown and cloned to produce cell lines. This method allows the formation of foci that extend into the target area. This can be advantageously used to engineer cell lines which express the fragment.

[0187] In some examples, but not limited to, tk-, hgprt-, or apr Herpes simplex virus thymidine kinase utilized in t-cells (Wigler et al. , 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase sferase (Szybalska & Szybalski, 192, Proc. atl. Acad. Sci. USA 48:202), and adenine phosphoribosyl Transferase (Lowy et al., 1980, Cell 22:817) Many selection systems are used, including the selection of the following genes: Used as a standard: dhfr (Wigle r et al., 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al.,1981,Proc. Natl. Acad. Sci. USA 78:1527); gpt (Mulligan & Berg, 1981, Proc. Natl. A cad. Sci. USA 78:2072); for aminoglycoside G-418 resistance-conferring neo (Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; stoshev, 1993, Ann. Rev. Pharmacol. Toxi col. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 199 3,Ann.Rev.Biochem.62:191-217;May,1993, TIB TECH 11(5):155-215), and against hygromycin Resistance-conferring hygro (Santerre et al., 1984, Gene 30:147). Methods known in the art of recombinant DNA technology can be used. Generally, Ausubel et al. (eds., 1993, Current Proceedings otocols in Molecular Biology,John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer a nd Expression,A Laboratory Manual,Stockt on Press,NY; and in Chapters 12 and 13,D racopoli et al. (eds), 1994, Current Proto cols in Human Genetics,John Wiley & Sons , NY.; Colberre-Garapin et al., 1981, J. Mo l. Biol. 150:1).

[0188] In some instances, antibody expression levels are increased by vector amplification (see for discussion). In Bebbington and Hentschel,The use of ve ctors based on gene amplification for th e expression of cloned genes in mammalia n cells in DNA cloning,Vol.3.(Academic P Ress, New York, 1987). If the marker is amplifiable, the level of inhibitor present in the host cell culture increases. The number of copies of the marker gene increases as the amplified region becomes related to the nucleotide sequence of the antibody. This increases the production of antibodies (Crouse et al., 1983, Mol . Cell Biol. 3:257).

[0189] In some instances, methods known in the art for purifying or analyzing antibodies or antibody conjugates are well known in the art. Any known method may be used, for example, chromatography (e.g., ion exchange, affinity chromatography, etc. The affinity to specific antigens after protein A and sizing column cleavage are important. chromatography), centrifugation, differential solubility, or other methods for the purification of proteins. Exemplary chromatographic methods include, but are not limited to, However, strong anion exchange chromatography, hydrophobic interaction chromatography, These include size exclusion chromatography, and fast protein liquid chromatography. can be.

[0190] bond chemistry In some embodiments, polynucleic acid molecule B is linked to a binding moiety. The binding moiety may be an amino acid, a peptide, a polypeptide, a protein, an antibody, an antigen, a toxin, Hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polyethylene glycols polymers such as polyvinyl chloride and polypropylene glycol, as well as all of these classes of materials Additional examples of binding moieties include cholesterol, riboflavin, riboflavin, and the like. lipids, diacylglycerols and triacylglycerols, fatty acids, carbohydrates (e.g. (e.g., saturated, unsaturated, or substituted), enzyme substrates, biotin, digoxigenin, and In some instances, the binding moiety includes an antibody or a binding agent thereof. In some instances, the polynucleic acid molecule is further attached to a polymer, optionally The endothelial cell line selectively binds to the endosomolytic moiety.

[0191] In some embodiments, the polynucleic acid molecules are synthesized by a chemical ligation process. In some instances, the polynucleic acid molecule is attached to the binding moiety by native ligation. In some examples, the conjugate is as described below: on, et al. “Synthesis of proteins by nativ e chemical ligation,” Science 1994, 266, 776-779; Dawson, et al. “Modulation of Re activity in Native Chemical Ligation thr ough the Use of Thiol Additives,” J. Am. Chem. Soc. 1997, 119, 4325-4329; Hacken g, et al. “Protein synthesis by native ch. chemical ligation: Expanded scope by using straightforward methodology.,” Proc. Nat Acad. Sci. USA 1999,96,10068-10073; or Wu, et al. “Building complex glycopeptid es: Development of a cysteine-free nativ e chemical ligation protocol,” Angew.Che m. Int. Ed. 2006, 45, 4116-4125. In some cases, the bond is In some embodiments, the method is as described in US Pat. No. 8,936,910. Polynucleic acid molecules can be linked to binding moieties site-specifically or via native ligation chemistry. Binds non-specifically.

[0192] In some instances, the polynucleic acid molecule may be a "traceless" capsule. Attached to the binding moiety in a site-directed manner using RING technology (PhiloChem) In some instances, the "traceless" coupling technique can be used to prepare polymers containing aldehyde groups. Utilizing the N-terminal 1,2-aminothiol group of the binding moiety that is then attached to the nucleic acid molecule . (Casi et al.,“Site-specific traceless c oupling of potent cytotoxic drugs to rec ombinant antibodies for pharmacodelivery ,” JACS 134(13): 5887-5892 (2012)

[0193] In some instances, the polynucleic acid molecule utilizes unnatural amino acids introduced into the binding moiety. In some instances, the unnatural amino acid is linked to a binding moiety in a site-directed manner. p-acetylphenylalanine (pAcPhe). In some instances, pAcPhe The keto group of e is selected as the linking moiety derived from the alkoxy-amine to form an oxime bond. (Axup et al., “Synthesis of site- specific antibody-drug conjugates using unnatural amino acids,” PNAS 109(40): 16 101-16106 (2012)).

[0194] In some instances, the polynucleic acid molecules are synthesized in a site-directed manner utilizing an enzyme-catalyzed process. In some cases, the site-directed method is SMARTag (Single-Sequence Artificial Reagents). In some cases, the system utilizes SMARTa technology (Catalent, Inc.). The .g™ technology converts formylglycine to aldehyde through an oxidation process in the presence of an aldehyde tag. Formation of formylglycine (FGly) residues from cysteine ​​by formylglycine synthesis enzyme (FGE) , and hydrazino-Pictet-Spengler (HIPS) ligation The subsequent conjugation of FGly to an alkylhydrazine-functionalized polynucleic acid molecule via a ligation reaction with glycerol. u et al.,”Site-specific chemical modifica ation of recombinant proteins produced i n mammalian cells by using the genetical ly encoded aldehyde tag,” PNAS 106(9): 3 000-3005 (2009); Agarwal,et al.,”A Picte t-Spengler ligation for protein chemical modification,” PNAS 110(1): 46-51 (2013 )

[0195] In some instances, the enzyme-catalyzed process uses microbial transglutaminase (mTG). In some instances, the polynucleic acid molecule is selected from the group consisting of a microbial transglutaminase catalyzed process. In some instances, mTG binds to the binding moiety using the Catalyzes the formation of covalent bonds between amide side chains and primary amines of functionalized polynucleic acid molecules In some cases, mTG has been shown to be effective against Streptomyces mobaraensis (Streptomyces mobaraensis). It is produced by the yeast Lactobacillus subtilis (Lyces mobarensis). (Strop et al., "Lactobacillus subtilis" location matters: site of conjugation mod stability and pharmacokinetics of antibody drug conjugates,”Chemistry and (see Biology 20(2) 161-167 (2013))

[0196] In some instances, the polynucleic acid molecule is a P The binding moiety can be prepared by the method described in International Publication No. WO2014 / 140317. Bind to.

[0197] In some examples, the polynucleic acid molecule is a nucleic acid molecule as described in U.S. Patent Publication No. 2015 / 0105539 and U.S. Patent Publication No. 2015 / 0105539. and 2015 / 0105540.

[0198] Polymer Binding Moiety In some embodiments, the polymer moiety C further comprises a polynuclear polymer as described herein. The compound may be attached to an acid molecule, a binding moiety described herein, or a combination thereof. In some instances, the polymer moiety C is linked to a polynucleic acid molecule. In other cases, the polymer moiety C is a polynucleic acid molecule binding moiety. In a further case, the polymer moiety C is linked as illustrated above.

[0199] In some examples, the polymer portion C may be a branched or unbranched monomer, and and / or natural or synthetic, consisting of long chains of cross-linked networks of two- or three-dimensional monomers. In some examples, the polymer moiety C is a polysaccharide, lignin, rubber, , or polyalkylene oxides (e.g., polyethylene glycol). In some examples, the at least one polymer moiety C can include, but is not limited to, alpha- , omega-dihydroxyl polyethylene glycol, a biodegradable lactone-based polymer , e.g., polyacrylic acid, polylactide acid (PLA), poly(glycolic acid) (PGA ), polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate Polyimide, Polyethylene terephthalate (Poly(ethylene terephthalate), P Polytetramethylene glycol (PETE, also known as ET, PETG, or PETE) Polyurethane (PTG), or polyurethane, and mixtures thereof. As used, a mixture refers to a mixture of the same compounds, as in the context of block copolymers. In some cases, block copolymers refer to the use of various polymers within a A polymer in which at least one portion is constructed from monomers of another polymer. In some examples, the polymer moiety C comprises a polyalkylene oxide. The polymer moiety C comprises PEG. In some examples, the polymer moiety C is polyethyleneimide ( PEI) or hydroxyethyl starch (HES).

[0200] In some instances, C is a PEG moiety. In some instances, the PEG moiety is a polynucleic acid. The binding moiety is attached at the 5' end of the molecule, whereas the binding moiety is attached at the 3' end of the polynucleic acid molecule. In some instances, the PEG moiety is attached at the 3' end of the polynucleic acid molecule, whereas the attachment moiety is In some instances, the PEG moiety is attached to an internal site of the polynucleic acid molecule. In some instances, the PEG moiety, the linking moiety, or a combination thereof, is linked to a polysaccharide. Binds to an internal site of the nucleic acid molecule. In some instances, the conjugate is a direct conjugate. In some instances, the linkage is via native ligation.

[0201] In some embodiments, the polyalkylene oxide (e.g., PEG) is polydisperse. In some instances, polydisperse materials are compounds that are monodisperse or have an average weight (weight average) It contains a dispersed distribution of materials of different molecular weights, characterized by size and dispersity. In some embodiments, monodisperse PEG contains molecules of one size. C is a polydisperse or monodisperse polyalkylene oxide (e.g., PEG) as shown The molecular weight represents the average molecular weight of the polyalkylene oxide (eg, PEG) molecules.

[0202] In some embodiments, the molecular weight of the polyalkylene oxide (e.g., PEG) is , about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1 800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2 600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3 750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6 000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20 ,000, 35,000, 40,000, 50,000, 60,000, or 100, It is 000Da.

[0203] In some embodiments, C is a polyalkylene oxide (e.g., PEG). , about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1 800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2 600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3 750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6 000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20 ,000, 35,000, 40,000, 50,000, 60,000, or 100, In some embodiments, C is PEG and has a molecular weight of about 20,000 Da. 0, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000 , 35,000, 40,000, 50,000, 60,000, or 100,000 In some instances, C has a molecular weight of about 200 Da. In some examples, C has a molecular weight of about 300 Da. In some examples, C has a molecular weight of about 400 Da. In some examples, the molecular weight of C is about 500 Da. The molecular weight of C is about 600 Da. In some instances, the molecular weight of C is about 700 Da. In some examples, the molecular weight of C is about 800 Da. In some examples, the molecular weight of C is about In some instances, the molecular weight of C is about 1000 Da. In some examples, the molecular weight of C is about 1100 Da. In some instances, the molecular weight of C is about 1300 Da. In some examples, the molecular weight of C is about 1400 Da. In some instances, the molecular weight of C is about 1500 Da. In some instances, the molecular weight of C is about 1600 Da. In some instances, the molecular weight of C is about 1700 Da. In some examples, the molecular weight of C is about 1800 Da. The molecular weight of C is about 1900 Da. In some instances, the molecular weight of C is about 2000 Da. In some instances, the molecular weight of C is about 2100 Da. The molecular weight is about 2200 Da. In some instances, the molecular weight of C is about 2300 Da. In some instances, the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2500 Da. In some instances, the molecular weight of C is about 2600 Da. In some instances, the molecular weight of C is about 2700 Da. In some instances, the molecular weight of C is In some instances, the molecular weight of C is about 2800 Da. In some examples, the molecular weight of C is about 3000 Da. In some instances, the molecular weight of C is about 3350 Da. In some examples, the molecular weight of C is about 3500 Da. In some instances, the molecular weight of C is about 4000 Da. In some instances, the molecular weight of C is about 4250 Da. In some instances, the molecular weight of C is about 4500 Da. In some examples, the molecular weight of C is about 4600 Da. The molecular weight of C is about 4750 Da. In some instances, the molecular weight of C is about 5000 Da. In some instances, the molecular weight of C is about 5500 Da. The molecular weight is about 6000 Da. In some instances, the molecular weight of C is about 6500 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7500 Da. In some instances, the molecular weight of C is about 8000 Da. In some instances, the molecular weight of C is about 10,000 Da. In some instances, the molecular weight of C is about 20,000 Da. In some instances, the molecular weight of C is about 35,000 Da. The molecular weight of C is about 40,000 Da. In some instances, the molecular weight of C is about 50,000 Da. In some instances, the molecular weight of C is about 60,000 Da. In the example, C has a molecular weight of about 100,000 Da.

[0204] In some embodiments, the polyalkylene oxide (e.g., PEG) is a separate Contains ethylene oxide units (e.g., 4 to about 48 ethylene oxide units). In this example, the polyalkylene oxide containing discrete ethylene oxide units is linear. In some cases, the polyalkylene oxide comprising discrete ethylene oxide units is branched.

[0205] In some examples, the polymer moiety C is a polyalkylene copolymer containing discrete ethylene oxide units. In some cases, the polymer moiety C is about 4 to about 48 In some cases, the polymer portion C comprises about 4, about 5, about 6, Approx. 7, Approx. 8, Approx. 9, Approx. 10, Approx. 11, Approx. 12, Approx. 13, Approx. 14, Approx. 15, Approx. 16, Approx. 17 , about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27 , about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37 , about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47 , or about 48 ethylene oxide units.

[0206] In some examples, the polymer portion C may contain, for example, about 4 to about 48 ethylene oxide units. In some cases, the polymer moiety C may comprise another PEG having, for example, about 4, about 5, about 6, Approx. 7, Approx. 8, Approx. 9, Approx. 10, Approx. 11, Approx. 12, Approx. 13, Approx. 14, Approx. 15, Approx. 16, Approx. 17 , about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27 , about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37 , about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47 or about 48 ethylene oxide units. The polymer moiety C is, for example, a discrete PEG containing about 4 ethylene oxide units. Thus, the polymer moiety C may be, for example, a discrete PEG containing about 5 ethylene oxide units. In some cases, the polymer portion C may be another polymer containing, for example, about 6 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 7 ethylene oxide units. In some cases, the polymer moiety C is a discrete PEG containing, for example, about 8 ethyl units. In some cases, the polymer portion C is a discrete PEG containing ethylene oxide units. For example, a discrete PEG containing about 9 ethylene oxide units. Moiety C is, for example, a discrete PEG containing about 10 ethylene oxide units. The polymer moiety C is, for example, a discrete PEG containing about 11 ethylene oxide units. In some cases, the polymer portion C may be a separate polymer that contains, for example, about 12 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 13 ethylene oxide. In some cases, the polymer portion C is a discrete PEG containing, for example, about 14 ethylene units. In some cases, the polymer moiety C is a discrete PEG containing ethylene oxide units, e.g. For example, a discrete PEG containing about 15 ethylene oxide units. Moiety C is, for example, a discrete PEG containing about 16 ethylene oxide units. Thus, polymer portion C may be, for example, a discrete PEG containing about 17 ethylene oxide units. In some cases, the polymer portion C contains, for example, about 18 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 19 ethyleneoxy groups. In some cases, the polymer portion C is a separate PEG containing a phenyl group unit, e.g., about 2 0 ethylene oxide units. In some cases, the polymer moiety C is For example, discrete PEGs containing about 21 ethylene oxide units. The polymer moiety C is, for example, a discrete PEG containing about 22 ethylene oxide units. In some cases, the polymer portion C may be, for example, a discrete PE containing about 23 ethylene oxide units. G. In some cases, the polymer portion C contains, for example, about 24 ethylene oxide units. In some cases, the polymer moiety C is a separate PEG containing, for example, about 25 ethylenediamines. In some cases, the polymer moiety C is, for example, a discrete PEG containing oxide units. A discrete PEG containing about 26 ethylene oxide units. C is, for example, a discrete PEG containing about 27 ethylene oxide units. , polymer moiety C is, for example, a discrete PEG containing about 28 ethylene oxide units. In some cases, the polymer portion C may be, for example, a separate copolymer containing about 29 ethylene oxide units. PEG. In some cases, the polymer moiety C is, for example, about 30 ethylene oxide units. In some cases, the polymer moiety C is a separate PEG containing, for example, about 31 ethyl groups. In some cases, the polymer portion C is a discrete PEG containing ethylene oxide units. For example, a discrete PEG containing about 32 ethylene oxide units. Moiety C is, for example, a discrete PEG containing about 33 ethylene oxide units. In this case, the polymer moiety C is, for example, a discrete PEG containing about 34 ethylene oxide units. In some cases, the polymer portion C may be another polymer containing, for example, about 35 ethylene oxide units. In some cases, the polymer moiety C is, for example, about 36 ethyleneoxy In some cases, the polymer portion C is a discrete PEG containing, for example, about 37 Optionally, the polymer moiety C is a discrete PEG containing ethylene oxide units. For example, a discrete PEG containing about 38 ethylene oxide units. The mer moiety C is, for example, a discrete PEG containing about 39 ethylene oxide units. Thus, the polymer moiety C may be, for example, a discrete PEG containing about 40 ethylene oxide units. In some cases, the polymer portion C contains, for example, about 41 ethylene oxide units. In some cases, the polymer moiety C is a discrete PEG having, for example, about 42 ethylene oxide. In some cases, the polymer portion C is a discrete PEG containing an oxide unit, e.g., about 43 ethylene oxide units. is, for example, a discrete PEG containing about 44 ethylene oxide units. Polymer portion C is, for example, a discrete PEG containing about 45 ethylene oxide units. In some cases, the polymer portion C may be, for example, a separate P EG. In some cases, the polymer portion C is, for example, about 47 ethylene oxide units. In some cases, the polymer moiety C is a separate PEG comprising, for example, about 48 ethyl The PEGs are different and contain dimethyl ether units.

[0207] In some cases, the polymer moiety C is dPEGR (Quanta Biodesign Ltd).

[0208] In some embodiments, the polymer moiety C is a cationic mucic acid-based polymer. In some instances, the cMAP comprises at least one repeat subunit. The subunit structure is represented by the formula (∨):

[0209] [ka]

[0210] where m, in each occurrence, is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 1 0, preferably 4-6, or 5; and n is independently at each occurrence: In some embodiments, m and n are, for example, about It is 10.

[0211] In some instances, cMAP can be further conjugated to a PEG moiety to form a cMAP-PEG copolymer. -, mPEG-cMAP-PEGm triblock polymer, or cMAP-PEG- cMAP triblock polymers are produced. In some examples, the PEG moiety is about 500 D In some examples, the PEG moiety ranges from about 500 Da to about 50,000 Da. ~ approx. 1000 Da, greater than 1000 Da ~ approx. 5000 Da, greater than 5000 Da Larger than 10,000 Da to about 25,000 Da, 25,0 00 Da to about 50,000 Da, or any two or more of these ranges It's a combination.

[0212] In some examples, the polymer moiety C is a cMAP-PEG copolymer, mPEG-cMAP-PEG copolymer, AP-PEGm triblock polymer or cMAP-PEG-cMAP triblock Optionally, polymer moiety C is a cMAP-PEG copolymer. In other cases, the polymer moiety C is a mPEG-cMAP-PEGm triblock polymer. In a further case, the polymer moiety C is a cMAP-PEG-cMAP triblock. It is a copolymer.

[0213] In some embodiments, the polymer moiety C is a polynucleic acid moiety, as illustrated above. The molecule is linked to a binding moiety and, optionally, an endosomolytic moiety.

[0214] Endosomolytic moiety In some embodiments, the compound of formula (I):AX 1 -BX 2 The -C molecule is further In some instances, the additional binding moiety is an endosomolytic moiety. In some cases, the endosomolytic moiety may be a cellular compartment releasing component, e.g., lysosomes, endoplasmic reticulum (ER), Golgi apparatus, microtubules, peroxisomes, or cells. The cells may be released from any of the compartments of a cell known in the art, such as the endoplasmic reticulum or other vesicles. In some cases, the endosomolytic moiety is a compound that can release endosomolytic Endosomolytic polypeptides, endosomolytic polymers, endosomolytic lipids, or an endosomolytic small molecule. In some cases, the endosomolytic moiety is an endosomolytic In other cases, the endosomolytic moiety comprises an endosomal lytic polypeptide. The somolytic polymer comprises:

[0215] Endosomolytic Polypeptides In some embodiments, the compound of formula (I):AX 1 -BX 2 The -C molecule is an endosomal In some cases, the endosomolytic polypeptide further binds to an endosomolytic polypeptide. The peptides are pH-dependent membrane active peptides. In some cases, endosomolytic polypeptides In additional cases, the endosomolytic polypeptide is an amphipathic polypeptide. In some instances, the endosomolytic polypeptide is a peptidomimetic. NF, melittin, mucin, or their respective derivatives. In some examples, the endosomolytic polypeptide includes INF or a derivative thereof. In the present case, the endosomolytic polypeptide comprises melittin or a derivative thereof. In some cases, the endosomolytic polypeptide comprises a mucin or a derivative thereof.

[0216] In some instances, INF7 is a 24-residue polypeptide, and these sequences include the CG IFGEIEELIEEGLENLIDWGNA (SEQ ID NO:1), or Contains GLFEAIEGFIENGWEGMIDGWYGC (SEQ ID NO:2) In some instances, INF7 or a derivative thereof comprises the following sequence: GLFEAIE GFIENGWEGMIWDYGSGSCG (SEQ ID NO:3), GLFEA IEGFIENGWEGMIDG WYG-(PEG)6-NH 2 (SEQ ID N O:4), or GLFEAIEGFIENGWEGMIWDYG-SGSC-K(G alNAc)2 (SEQ ID NO:5).

[0217] In some cases, melittin is a 26 residue polypeptide, the sequence of which is LKVLATGLPTLISWIKNKRKQ (SEQ ID NO: 6), or G Contains IGAVLKVLTTGLPALISWIKRKRQQ (SEQ ID NO:7) In some instances, melittin may be prepared using the polysaccharides described in U.S. Pat. No. 8,501,930. Contains a peptide sequence.

[0218] In some instances, mucins are derived from the venom of the scorpion Mesobuthus eupeus. In some cases, mucins are mucin-13, an antimicrobial peptide (AMP) derived from the mucin gland. (These sequences are IFGAIAGLLKNIF-NH 2 (SEQ ID NO:8) ) and mucin-18 (these sequences are SEQ ID NO:9)).

[0219] In some instances, the endosomolytic polypeptide has a sequence similar to that of INF7 or At least 50%, 60%, 70%, 80%, 90%, 95% or more of its derivatives. or a polypeptide having 99% sequence identity thereto, melittin or a derivative thereof, or mu In some instances, the endosomolytic moiety comprises an IFN-γ receptor antagonist or a derivative thereof. 7 or its derivatives, melittin or its derivatives, or mucin or its derivatives. nothing.

[0220] In some examples, the endosomolytic moiety is INF7 or a derivative thereof. In some examples, the endosomolytic moiety is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% %, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a nucleotide sequence similar to that of SEQ ID NO:1. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a polypeptide having SEQ ID NO: At least 50%, 55%, 60%, 65%, 70%, 75% for 2-5, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Optionally, the endosomolytic moiety comprises a polypeptide having sequence identity to Optionally, the endosomolytic moiety comprises SEQ ID NO:1. D NO:2-5. O:1. Optionally, the endosomolytic moiety comprises SEQ ID NO:2- It consists of 5.

[0221] In some instances, the endosomolytic moiety is melittin or a derivative thereof. In some examples, the endosomolytic moiety has a low affinity to SEQ ID NO:6 or 7. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, Polypeptides with 95%, 96%, 97%, 98%, 99% or 100% sequence identity In some examples, the endosomolytic moiety comprises a peptide having SEQ ID NO: At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% for 6 %, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety includes a polypeptide having SEQ ID NO: At least 50%, 55%, 60%, 65%, 70%, 75% for ID NO:7, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Optionally, the endosomolytic moiety comprises a polypeptide having sequence identity to Optionally, the endosomolytic moiety comprises SEQ ID NO:6. D NO:7. Optionally, the endosomolytic moiety comprises SEQ ID NO: 6. Optionally, the endosomolytic moiety consists of SEQ ID NO:7. do.

[0222] In some instances, the endosomolytic moiety is a mucin or a derivative thereof. In some examples, the endosomolytic moiety has at least one amino acid sequence similar to SEQ ID NO:8 or 9. At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 9 Polypeptides with 5%, 96%, 97%, 98%, 99%, or 100% sequence identity In some examples, the endosomolytic moiety comprises a peptide of SEQ ID NO:8 At least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% , 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some examples, the endosomolytic moiety includes a polypeptide having SEQ ID NO:1. D NO:9 at least 50%, 55%, 60%, 65%, 70%, 75%, 8 0%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Optionally, the endosomolytic moiety comprises a polypeptide having sequence identity to S Optionally, the endosomolytic moiety comprises SEQ ID NO:8. Optionally, the endosomolytic moiety comprises SEQ ID NO:8. Optionally, the endosomolytic moiety consists of SEQ ID NO:9. .

[0223] In some examples, the endosomolytic moiety comprises a sequence as illustrated in Table 1.

[0224] [Table 1-1]

[0225] [Table 1-2]

[0226] In some cases, the endosomolytic moiety is selected from the group consisting of Bcl-2 and / or Bcl-xL. Bak BH3 polypeptide induces apoptosis through antagonism of inhibitory targets such as In some examples, the endosomolytic moiety is described in Albarran, et al. l., “Efficient intracellular delivery of a pro-apoptotic peptide with a pH-respon sive carrier,” Reactive & Functional Pol ymers 71: 261-265 (2011) Includes petite.

[0227] In some examples, the endosomolytic moiety is a compound according to PCT International Publication No. WO2013 / 16 6155 or WO2015 / 069587 (e.g. For example, cell-penetrating polypeptides.

[0228] Endosomolytic lipids In some embodiments, the endosomolytic moiety is a lipid (e.g., a fusogenic lipid). In some embodiments, the compound of formula (I): AX 1 -BX 2 The molecule of -C is The endosomal lytic lipid further binds to an endosomolytic lipid (e.g., a fusogenic lipid). Exemplary fusogenic lipids include , 1,2-dileoyl-sn-3-phosphoethanolamine (DOP E), phosphatidylethanolamine (POPE), palmitoyloleoyl ... Polypeptide-tidylcholine (POPC), (6Z, 9Z, 28Z, 31Z)-Heptatriaconta-6 , 9, 28, 31-Tetraen-19-ol (Di-Lin), and N-methyl (2 ,2-Di(9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolane -4-yl)methanamine (DLin-k-DMA) and N-methyl-2-(2,2 -Di(9Z,12Z)-octadeca-9,12-dienyl)-1,3-dioxolane-4 -yl)ethanamine (XTC).

[0229] In some instances, the endosomolytic moiety is a compound described in PCT International Publication No. WO09 / 126, 933 (e.g., fusogenic lipids).

[0230] Endosomolytic small molecules In some embodiments, the endosomolytic moiety is a small molecule. In this embodiment, the compound of formula (I): AX 1 -BX 2 The -C molecule is an endosomolytic small molecule Exemplary small molecules suitable as endosomolytic moieties include, but are not limited to, However, quinine, chloroquine, hydroxychloroquine, amodiaquine (carnoquine) nes), amphotericin, primaquine, mefloquine, nivaquines, halofan In some examples, the quinone imine is a quinone. Endosomolytic moieties include, but are not limited to, 7-chloro-4-(4-diethyl Amino-1-methylbutyl-amino)quinoline (chloroquine); 7-chloro-4-(4- Ethyl-(2-hydroxyethyl)-amino-1-methylbutyl-amino)quinoline (H 7-Fluoro-4-(4-diethylamino-1-methylbutyl- 4-(4-diethylamino-1-methylbutylamino)quinoline;7 -Hydroxy-4-(4-diethyl-amino-1-methylbutylamino)quinoline;7- Chloro-4-(4-diethylamino-1-butylamino)quinoline (desmethylchloroquinoline) 7-Fluoro-4-(4-diethylamino-1-butylamino)quinoline; 4-( 4-Diethyl-amino-1-butylamino)quinoline; 7-Hydroxy-4-(4-diethylamino)quinoline 7-Chloro-4-(1-carboxy-4-diphenylamino)quinoline; Ethylamino-1-butylamino)quinoline;7-fluoro-4-(1-carboxy-4 -Diethyl-amino-1-butylamino)quinoline;4-(1-carboxy-4-diethyl 7-Hydroxy-4-(1-carboxy-4- Diethylamino-1-butylamino)quinoline;7-chloro-4-(1-carboxy-4 -Diethylamino-1-methylbutylamino)quinoline;7-Fluoro-4-(1-carboxamide 4-(1-Carboxy-4-diethyl-amino-1-methylbutylamino)quinoline 7-Hydroxy-4-diethylamino-1-methylbutylamino)quinoline; (1-Carboxy-4-diethylamino-1-methylbutylamino)quinoline;7-Fluor O-4-(4-ethyl-(2-hydroxyethyl)amino-1-methylbutylamino )quinoline;4-(4-ethyl-(2-hydroxy-ethyl)-amino-1-methylbutyrate 7-Hydroxy-4-(4-ethyl-(2-hydroxyethyl) -amino-1-methylbutylamino)quinoline;Hydroxychloroquine phosphate;7 -Chloro-4-(4-ethyl-(2-hydroxyethyl-1)-amino-1-butylamine Quinoline (desmethylhydroxychloroquine); 7-fluoro-4-(4-ethyl- (2-hydroxyethyl)-amino-1-butylamino)quinoline;4-(4-ethyl- (2-hydroxyethyl)-amino-1-butylamino)quinoline;7-hydroxy-4 -(4-ethyl-(2-hydroxyethyl)-amino-1-butylamino(quinoline; 7 -Chloro-4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino-1 -Butylamino)quinoline;7-Fluoro-4-(1-carboxy-4-ethyl-(2- 4-(1-carboxy-4-hydroxyethyl)-amino-1-butylamino)quinoline -Ethyl-(2-hydroxyethyl)-amino-1-butylamino)quinoline;7-Hydroxy 4-(1-carboxy-4-ethyl-(2-hydroxyethyl)amino-1- butylamino)quinoline;7-chloro-4-(1-carboxy-4-ethyl-(2-hydro 7-Fluoro-4-(1-methoxyethyl)amino-1-methylbutylamino)quinoline; -Carboxy-4-ethyl-(2-hydroxyethyl)-amino-1-methylbutyric acid Quinoline; 4-(1-carboxy-4-ethyl-(2-hydroxyethyl)-amino -1-methylbutylamino)quinoline;7-hydroxy-4-(1-carboxy-4-en 8-[ethyl-(2-hydroxyethyl)-amino-1-methylbutylamino)quinoline; (4-aminopentyl)amino-6-methoxydihydrochloridequinoline;1-acetyl -1,2,3,4-Tetrahydroquinoline;8-[(4-aminopentyl)amino]-6 -Methoxyquinoline dihydrochloride;1-Butyryl-1,2,3,4-tetrahydroquinone Nolin; 3-chloro-4-(4-hydroxy-α,α'-bis(2-methyl-1-pyrrolidine) 4-[(4-diethyl-amino)-1-methyl-2,5-xylidinoquinoline] 3-Fluoro-4-(4-hydroxy-α ,α'-Bis(2-methyl-1-pyrrolidinyl)-2,5-xylidinoquinoline(4-[ (4-diethylamino)-1-methylbutyl-amino]-6-methoxyquinoline; 4-Hydroxy-α,α'-bis(2-methyl-1-pyrrolidinyl)-2,5-xylidine Quinoline;4-[(4-diethylamino)-1-methylbutyl-amino]-6-methoxy Quinoline; 3,4-dihydro-1-(2H)-quinolinecarboxaldehyde; 1,1 '-Pentamethylenequinolinium iodide; 8-quinolinol sulfate and amino, aldehyde Hydroxy, carboxylic acid, hydroxyl, halogen, keto, sulfhydryl, and vinyl derivatives. In some instances, the endosomolytic moiety is a Naisbi tt et al (1997, J Pharmacol Exp Therapy 2 80:884-893) and U.S. Pat. No. 5,736,557. do.

[0231] Linker In some embodiments, the linkers described herein are cleavable linkers. In some instances, the linker is a cleavable linker. In other examples, the linker is a non-cleavable linker.

[0232] In some cases, the linker is a non-polymeric linker. A non-polymeric linker is a polymeric Refers to a linker that does not contain repeating units of the monomers produced by the process. Examples of the rema linker include, but are not limited to, C 1 -C 6 Alkyl groups (e.g., C 5 , C 4 , C 3 , C 2, or C 1 Alkyl groups), homobifunctional cross-linkers, heterobifunctional Cross-linker, peptide linker, traceless linker, self-immolative linker, maleimide In some cases, the linker may be a non-poly Marlin Carr is C 1 -C 6 Alkyl groups (e.g., C 5 , C 4 , C 3 , C 2 , or C 1 alkyl group), homobifunctional cross-linker, heterobifunctional cross-linker, peptide linker linkers, traceless linkers, self-immolative linkers, maleimide-based linkers, or includes combinations thereof. In further cases, the non-polymeric linker may include more than two Linkers of the same type, e.g., more than two homobifunctional cross-linkers, or In further instances, the non-polymeric linker is optionally Contains one or more reactive functional groups.

[0233] In some instances, the non-polymeric linker does not include a polymer as described above. In some examples, the non-polymeric linker may be a polymer that is encompassed by the polymer moiety C. In some cases, the non-polymeric linker is a polyalkylene oxide (e.g., P In some cases, the non-polymeric linker does not include PEG.

[0234] In some examples, the linker comprises a homobifunctional linker. An anchor may be, but is not limited to, Lomant's reagent, dithiobis(succinimidylpropionyl) 3',3'-dithiobis(sulfosuccinimidyl proprionate (DSP) TSSP), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl ) Suberate (BS), Disuccinimidyl Tartrate (DST), Disulfosuccinimidyl Succinimidyl tartrate (Sulfo-DST), Ethylene Glycobis(succinimidyl succinate) Disuccinimidyl glutarate (EGS), N,N'-disuccinimidyl glutarate (DSG), Dimethyl adipimidate (DMA), Dimethyl pime Limidate pimelimidate (DMP), dimethylsuberimidate (DMS), dimethyl- 3,3'-Dithiobispropionimidate (DTBP), 1,4-di-3'-(2'- Pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane ( BMH), for example, 1,5-difluoro-2,4-dinitrobenzene, 1,3-difluoro Halogenated aryl-containing compounds such as 4,6-dinitrobenzene (DFDNB), 4 , 4'-difluoro-3,3'-dinitrophenylsulfone (DFDNPS), bis-[ β-(4-azidosalicylamido)ethyl] disulfide (BASED), formaldehyde Hydride, glutaraldehyde, 1,4-butanediol diglycidyl ether, adipine Acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, Benzidine, α,α'-p-diaminodiphenyl, diiodo-p-xylene sulfonic acid , N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethion Contains len-bis(iodoacetamide).

[0235] In some embodiments, the linker comprises a heterobifunctional linker. Bifunctional linkers include, but are not limited to, amine-reactive and sulfhydryl-bridged linkers. anchors, such as N-succinimidyl 3-(2-pyridyldithio)propionate ( sPDP), long-chain N-succinimidyl 3-(2-pyridyldithio)propionate ( LC-sPDP), a water-soluble long-chain N-succinimidyl 3-(2-pyridyldithio)peptide dopionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-α-methyl 6-methyl-α-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl- -[α-Methyl-α-(2-pyridyldithio)toluamide]hexanoate(sulfo-L C-sMPT), Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1 -carboxylate (sMCC), sulfosuccinimidyl-4-(N-maleimidomethyl m-maleimidobenzene Zoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl -N-hydroxysulfosuccinimide ester (Sulfo-MB), N-succinimide 4-iodoacetylaminobenzoate (sIAB), sulfosuccinimidyl ( 4-iodoacteyl)aminobenzoate (sulfo-sIAB), succinimidyl 4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl -4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(γ-maleimidophenyl)butyrate N-(γ-maleimidobutyryloxy)succinimide ester (GMB), (aryloxy)sulfosuccinimide ester (sulfo-GMB), succinimidyl 6 -((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6- [6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIA XX), Succinimidyl 4-(((iodoacetyl)amino)methyl)cyclohexa 4-iodo-1-carboxylate (sIAC), succinimidyl 6-((((4-iodo- Cetyl)amino)methyl)cyclohexane-1-carbonyl)amino)hexanoate ( sIACX), p-nitrophenyl iodoacetate (NPIA), 4-(4-N-maleic acid (N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane Xanthane-1-carboxyl-hydrazide-8 (M2C2H), 3-(2-pyridyldithio ) Propionyl hydrazide (PDPH) and other carbonyl-reactive and sulfhydryl-reactive reactive cross-linkers, amine-reactive and photoreactive cross-linkers, e.g., N-hydroxy Succinimidyl-4-azidosalicylate (NH-AsA), N-hydroxysulfonyl Succinimidyl-4-azidosalicylate (sulfo-NH-AsA), sulfosuccinimidyl 4-Azidosalicylamidohexanoate (sulfo-NH-LC-AsA) , sulfosuccinimidyl-2-(ρ-azidosalicylamido)ethyl-1,3'-dithio Opropionate (sAsD), N-hydroxysuccinimidyl-4-azidobenzoate HsAB, N-hydroxysulfosuccinimidyl-4-azidobenzoate ( Sulfo-HsAB), N-Succinimidyl-6-(4'-azido-2'-nitrophenyl Sulfosuccinimidyl-6-(4'-amino)hexanoate (sANPAH), Dido-2'-nitrophenylamino)hexanoate (sulfo-sANPAH), N-5 -Azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimide Cinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-1,3'-dithio opropionate (sAND), N-succinimidyl-4(4-azidophenyl)1, 3'-dithiopropionate (sADP), N-sulfosuccinimidyl (4-azidophenyl) phenyl)-1,3'-dithiopropionate (sulfo-sADP), sulfosuccinimide Dimethyl 4-(ρ-azidophenyl)butyrate (sulfo-sAPB), sulfosuccinimide 2-(7-azido-4-methylcoumarin-3-acetamido)ethyl-1,3' -dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4-methyl Lucoumarin-3-acetate (sulfo-sAMCA), p-nitrophenyl diazopyrba ρ-Nitrophenyl-2-diazo-3,3,3-trifluoropropanediol (ρNPDP), Pionate (PNP-DTP), a sulfhydryl-reactive and photoreactive cross-linker; For example, 1-(ρ-azidosalicylamido)-4-(iodoacetamido)butane (As IB), N-[4-(ρ-azidosalicylamido)butyl]-3'-(2'-pyridyldi Thio)propionamide (APDP), Benzophenone-4-iodoacetamide, Zyphenone-4-maleimide carbonyl-reactive and photoreactive cross-linkers, e.g. ρ-Azidobenzoylhydrazide (ABH), a Carboxylate-Reactive and Photoreactive Crosslinker Linkers, such as 4-(ρ-azidosalicylamido)butylamine (AsBA), and and arginine-reactive and photoreactive cross-linkers, e.g., ρ-azidophenylglycol. Examples include oxal (APG).

[0236] In some instances, the linker comprises a reactive functional group. In some instances, the reactive functional group is , which contains a nucleophilic group reactive to an electrophilic group present in the binding moiety. Exemplary electrophilic groups are aldehydes, amides, ketones, carboxylic acids, esters, amides, enones, acyl halides, or acid anhydrides In some embodiments, the reactive functional group comprises an aldehyde, Exemplary nucleophilic groups are hydrazide, oxime, amino, hydrazine, thiosemicarbamates, These include arylhydrazides, hydrazine carboxylates, and aryl hydrazides.

[0237] In some embodiments, the linker comprises a maleimide group. The maleimide group is also called a maleimide spacer. In some instances, the maleimide group is a caproic acid spacer. Optionally, phosphoric acid may be further included to form maleimidocaproyl (mc). The linker comprises maleimidocaproyl (mc). In another embodiment, the maleimide group is a succinimidyl group as described above. 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sMCC) , or sulfosuccinimidyl-4-(N-maleimidomethyl)cyclohexane- Contains a maleimidomethyl group, such as 1-carboxylate (sulfo-sMCC).

[0238] In some embodiments, the maleimide group is a self-stabilizing maleimide. In the example, the self-stabilizing maleimide is involved in the intramolecular catalysis of thiosuccinimide ring hydrolysis. To provide this, diaminopropyl ether was added to incorporate a basic amino group adjacent to the maleimide. The maleimide is eliminated by the retro-Michael reaction using diphenyl ether (DPR). In some instances, the self-stabilizing maleimide is L yon, et al., “Self-hydrolyzing maleimide s improve the stability and pharmacology cal properties of antibody-drug conjugat es,” Nat. Biotechnol. 32(10):1059-1062 ( 2014). In some instances, the linker is a self-stabilizing maleimide group. In some instances, the linker is a self-stabilizing maleimide.

[0239] In some embodiments, the linker comprises a peptide moiety. The amino acid moiety contains at least 1, 2, 3, 4, 5, or more than 6 amino acid residues. In some examples, the peptide moiety has at most 1, 2, 3, 4, 5, 6, 7, or 8 amino acids. In some examples, the peptide portion comprises about 2, about 3, about 4, about 5, or about 6 amino acid residues. In some instances, the peptide moiety comprises a cleavable peptide. In some instances, the peptide moiety can be cleaved (e.g., enzymatically or chemically). In some examples, the peptide moiety is a Val-Cit( Valine-Citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 142 23), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe- Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu- Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala- Leu (SEQ ID NO: 14224), or Gly-Phe-Leu-Gly ( SEQ ID NO:14225). In some examples, the linker comprises Val-C it (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 14223), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-P he-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, L eu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-A la-Leu(SEQ ID NO:14224), or Gly-Phe-Leu-G ly (SEQ ID NO:14225). The linker comprises Val-Cit. Optionally, the linker is Val-Cit.

[0240] In some embodiments, the linker comprises a benzoic acid group or a derivative thereof. In some examples, the benzoic acid group or its derivatives include para-aminobenzoic acid (PABA). In some instances, the benzoic acid group or its derivatives include γ-aminobutyric acid (GABA). nothing.

[0241] In some embodiments, the linker is a maleimide group, in any combination. , a peptide moiety, and / or a benzoic acid group. In the present invention, the linker is a combination of a maleimide group, a peptide moiety, and / or a benzoic acid group. In some examples, the maleimide group is maleimidocaproyl (mc). In some instances, the peptide group is val-cit. In some instances, the benzoic acid In some examples, the linker comprises a mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. The car contains a mc-val-cit-PABA group.

[0242] In some embodiments, the linker is a self-immolative or self-eliminating linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-immolative linker. In some examples, the linker is a self-eliminating linker (e.g., a cyclized self-eliminating linker). is described in U.S. Patent No. 9,089,614 or PCT Publication WO2015038426 The linker is

[0243] In some embodiments, the linker is a dendritic linker. The dendritic linker comprises a branched multifunctional linker moiety. In some examples, the dendritic linker is used to increase the molar ratio of polynucleotide B to binding moiety A. In some examples, the dendritic linker comprises a PAMAM dendrimer.

[0244] In some embodiments, the linker is a traceless linker or a linker that is cleaved and then A linker moiety (e.g., an atom or a linker group) is connected to a linking moiety A, a polynucleotide B, The linker does not leave the endosomolytic moiety C or the endosomolytic moiety D. The sulfur linker may be, but is not limited to, a germanium linker, a silicon linker, a sulfur phosphorus linker, Car, selenium linker, nitrogen linker, phosphorus linker, boron linker, chromium linker or a phenylhydrazide linker. sen, et al., “A traceless aryl-triazene l inker for DNA-directed chemistry,” Org B Described in iomol Chem 11(15):2493-2497 (2013) In some examples, the linker is a traceless aryl-triazene linker. laney, et al., “Traceless solid-phase orga nic synthesis,”Chem.Rev.102:2607-2024(20 02). In some examples, the linker is a traceless linker as described in U.S. This is a traceless linker described in Patent No. 6,821,783.

[0245] In some embodiments, the linker is a compound as described in U.S. Pat. No. 8,298; No. 8,288,352; No. 8,609,105; or No. 8,6 No. 97,688; U.S. Patent Publication No. 2014 / 0127239; No. 2013 / 02891 No. 9; No. 2014 / 286970; No. 2013 / 0309256; No. 2015 / 03 7360; or 2014 / 0294851; or PCT Publication No. WO20 No. 15057699; No. WO2014080251; No. WO2014197854; No. WO2014145090; or as described in WO2014177042 It is a linker.

[0246] In some embodiments, X 1 and X 2 are each independently a single bond or a non-poly In some cases, X 1 and X 2 each independently represents a single bond. In some cases, X 1 and X 2 are each independently a non-polymeric linker.

[0247] In some cases, X 1 may include a single bond or a non-polymeric linker. X 1 is a single bond. In some cases, X 1 is a non-polymeric linker. In this example, the linker is 1 -C 6 In some cases, X is an alkyl group. 1 For example, , C 5 , C 4 , C 3 , C 2 , or C 1 C such as alkyl group 1 -C 6 is an alkyl group In some cases, C 1 -C 6 The alkyl group is unsubstituted C 1 -C 6 It is an alkyl group. In the context of Carr, especially X 1 When used in the context of It means a saturated straight or branched chain hydrocarbon radical containing 6 carbon atoms. In some cases, X 1 is a homobifunctional linker or heterobifunctional linker as described above. In some cases, X 1 comprises a heterobifunctional linker. X 1 In another embodiment, X 1 is C 1 -C 6 Optionally attached to an alkyl group In another embodiment, the X 1 is C 1 -C 6Optionally attached to an alkyl group In some additional examples, X 1 is a homobifunctional phosphoprotein as described above. It does not contain a linker or heterobifunctional linker.

[0248] In some cases, X 2 is a single bond or a linker. In some examples, X 2 is single In other cases, X 2 is a linker. In a further case, X 2 teeth In some embodiments, X is a non-polymeric linker. 2 is C 1 -C 6 It is an alkyl group. In some cases, X 2 The homobifunctional linker or heterobifunctional linker described above may be used. In some instances, X 2 is the homobifunctional linker described above In some cases, X 2 is a heterobifunctional linker as described above. In one example, X 2 is a maleimide group such as maleimidocaproyl (mc) described above. or a self-stabilizing maleimide group. In some examples, X 2 Val-Cit In some instances, X 2 contains a benzoic acid group, such as PABA. In a further example, X 2 of the maleimide group, peptide moiety, and / or benzoic acid group Additional examples include combinations of X 2 In a further example, X 2 mc-v Further examples include X 2 contains the val-cit-PABA group. In the example, X2 contains the mc-val-cit-PABA group.

[0249] How to use Muscle atrophy refers to the loss of muscle mass and / or the progressive weakening and degeneration of muscles. Therefore, the loss of muscle mass or the progressive weakening and degeneration of muscle is due to high rates of protein degradation, low In some cases, this can be caused by high protein synthesis rates, low protein synthesis rates, or a combination of both. The rate of muscle protein breakdown is related to the amount of amines available as substrates for muscle protein catabolism (i.e., gluconeogenesis). The breakdown of muscle proteins to make up the fatty acids.

[0250] In one embodiment, muscle atrophy refers to a significant loss of muscle strength. and compare diseased, injured, or unused muscle tissue in a subject with the same muscle tissue in a control subject. In one embodiment, a significant loss of muscle strength is greater than that of a control subject. At least 10%, at least 15%, at least 20%, compared to the same muscle tissue in the body At least 25%, at least 30%, at least 35%, at least 40%, at least The reduction in strength is at least 45%, at least 50%, or even more. The significant loss of muscle strength was compared to the strength of the same muscle tissue in the same subject prior to the period of disuse. In some embodiments, a significant decrease in muscle strength is seen in muscle tissue that is not being used. The loss is at least 10% greater than the muscle strength of the same muscle tissue in the same subject before the disuse period. %, at least 15%, at least 20%, at least 25%, at least 30%, at least At least 35%, at least 40%, at least 45%, at least 50%, or This is an even greater decline than that.

[0251] In another embodiment, muscle atrophy refers to a significant loss of muscle mass. Therefore, diseased, injured, or unused muscle tissue in a subject is better than the same muscle tissue in a control subject. In one embodiment, a significant loss of muscle volume refers to a reduction in muscle tissue volume. , at least 10%, at least 15%, at least At least 20%, at least 25%, at least 30%, at least 35%, at least 40% , at least 45%, at least 50%, or more. , with a significant loss of muscle mass, the muscle volume of the same muscle tissue in the same subject prior to the period of disuse was In comparison, this refers to a reduction in muscle mass of unused muscle tissue. The significant loss of tissue was small compared to the muscle volume of the same muscle tissue in the same subject prior to the period of disuse. at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, Muscle volume can be measured using magnetic resonance imaging (e.g., muscle volume / cross-sectional area (C Optionally, it is measured by assessing the cross-sectional area of ​​the muscle, such as by SA (MRI method) do.

[0252] Myotonic dystrophy is divided into two main types: myotonic dystrophy type 1 (DM1) and and myotonic dystrophy type 2 (DM2). DM1 is a genetic disorder characterized by A dominantly inherited "CTG" repeat expansion in the gene DM protein kinase (DMPK) This is caused by the transcription of the protein Musclebli when it is transcribed into mRNA. It forms a hairpin that binds with high affinity to the nd-like (MBNL) family. BNL proteins are involved in post-transcriptional splicing and polyadenylation. Loss of MBNL protein function and regulation of the enylatin site leads to downstream accumulation of nuclear foci This leads to increased mis-splicing events, subsequently resulting in myotonia and other clinical symptoms. Wake up.

[0253] In some embodiments, the subject is treated with muscle atrophy or myotonic dystrophy. Described herein are methods of administering a therapeutically effective amount of a compound described herein. Administering a polynucleic acid molecule or a polynucleic acid molecule conjugate as described herein to a subject. In some instances, the muscle wasting disorder may be caused by cachexia (e.g., cancer cachexia), denervation, myopathy, or other conditions. opiates, motor neuron disease, diabetes, chronic obstructive pulmonary disease, liver disease, congestive heart failure, Chronic renal failure, chronic infection, sepsis, fasting, sarcopenia, glucocorticoid-induced atrophy Related to and / or caused by atrophy, disuse or space flight In some cases, the myotonic dystrophy is DM1.

[0254] Cachexia Cachexia is an acquired accelerated loss of muscle caused by an underlying disease. In some cases, cachexia refers to weight loss that cannot be restored through nutrition, generally It is associated with an underlying disease, such as cancer, COPD, AIDS, and heart failure. When this condition is seen in patients with terminal cancer, it is called "cancer cachexia." It affects a large proportion of patients with advanced cancer and has been associated with poor treatment tolerance, response to treatment, quality of life, and survival. In some instances, cancer cachexia is associated with a loss of body fat mass. is defined as a multifactorial syndrome characterized by the ongoing loss of skeletal muscle mass, with or without Conventional nutritional support may not provide complete recovery and may lead to progressive impairment. In some cases, loss of skeletal muscle appears to be the most significant event in cancer cachexia. In addition, the classification of cancer cachexia is based on the diagnostic criteria that weight loss is a signal of the cachexia process. Consider not only the patient's initial reserves, low BMI or low levels of muscle mass, but also the It is suggested that this should be taken into consideration.

[0255] In some embodiments, the method of treating cachexia-associated muscle wasting in a subject comprises administering to a subject a therapeutically effective amount of As described herein, the method includes administering a therapeutically effective amount of a polynucleic acid molecule described herein, Alternatively, the method comprises administering to a subject a polynucleic acid molecule conjugate as described herein. In additional embodiments, a method of treating muscle wasting associated with cancer cachexia in a subject is provided herein. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule as described herein, Alternatively, the method comprises administering to a subject a polynucleic acid molecule conjugate as described herein.

[0256] Denervation Denervation is a peripheral process that involves partial or complete blockage of nerve fibers between organs and the central nervous system. Damage to motor neurons in the spinal cord, causing blockage of nerve conduction and motor neuron firing. This in turn impairs the contractibility of skeletal muscles. This loss may be localized with loss of entire motor neuron units or generalized. The inability to contract leads to muscle atrophy. In some instances, denervation can lead to degenerative, metabolic, and Neuropathic or inflammatory neuropathy (e.g., Guillain-Barré syndrome, peripheral neuropathy, or Associated with or as a result of exposure to environmental toxins or drugs In a further example, denervation is associated with physical injury, for example surgery.

[0257] In some embodiments, the denervation of a subject is associated with or caused by denervation. Described herein is a method for treating muscle atrophy induced by a steroid, the method comprising administering to the subject a therapeutically effective amount of a steroid. In some embodiments, the method includes administering to a subject a sufficient amount of a polynucleic acid molecule described herein. In some embodiments, the method is associated with or induced by denervation of a subject. Described herein is a method for treating muscle atrophy, the method comprising administering a therapeutically effective amount of the compound described herein. The method includes administering to a subject a polynucleic acid molecule conjugate as described in .

[0258] Myopathy Myopathy is a general term that describes disorders of the muscles. In some cases, myopathy causes muscle tension. congenital myopathies, e.g., nemaline myopathy, multicore / minicore myopathy - and myotubular (centronuclear) myopathy; mitochondrial myopathy; familial periodic limb syndrome Paralysis; inflammatory myopathy; e.g., caused by glycogen or lipid storage disorders metabolic myopathy; dermatomyositis; polymyositis; inclusion body myositis; myositis ossificans; rhabdomyolysis and myoglobinuria. In some instances, the myopathy includes Duchenne myopathy, , Becker type, myotonic, facioscapulohumeral type, Emery-Dreyfus type, oculopharyngeal type, scapulohumeral type Bone, limb-girdle, Fukuyama, congenital muscular dystrophy, or genetic distal myopathy Which muscular dystrophic syndrome is caused by. In some cases, myopathy is Myotonic dystrophy (e.g., myotonic dystrophy type 1 or DM1) In some instances, the myopathy is caused by DM1.

[0259] In some embodiments, the myopathy is associated with or associated with a myopathy in a subject. Described herein is a method for treating muscle atrophy induced by seaweed, the method comprising: The method includes administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In some embodiments, the myopathy is associated with or is caused by the myopathy in the subject. Described herein is a method for treating muscle atrophy induced by mitosis, the method being therapeutically useful. The method includes administering to the subject an effective amount of a polynucleic acid molecule conjugate described herein.

[0260] Motor neuron disease Motor neuron disease (MND) affects motor neurons (cells that control the body's voluntary muscles). Exemplary motor neuron diseases include, but are not limited to, neurological disorders that affect the Human motor neuron disease, infantile spinal muscular atrophy, amyotrophic lateral sclerosis, juvenile spinal muscular atrophy atrophy, autoimmune motor neuropathy with multifocal conduction block, stroke or spinal cord injury Includes paralysis due to wounds or skeletal immobilization due to trauma.

[0261] In some embodiments, the subject has a motor neuron disease associated with or associated with a motor neuron disease. Described herein are methods for treating muscle atrophy induced by motor neuron disease. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the subject is provided with a method for detecting a motor neuron disease associated with the disease. Methods for treating muscle atrophy induced by motor neuron disease are described herein. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule conjugate as described herein. The method includes administering to

[0262] diabetes Diabetes mellitus (DM) is classified into type 1 diabetes, type 2 diabetes, type 3 diabetes, type 4 diabetes, Double diabetes, latent autoimmune diabetes (LAD), gestational diabetes, neonatal diabetes mellitus (NDM) DM), maturity-onset diabetes of the young (MODY), Wolfram syndrome, Alström syndrome Type 2 diabetes, also known as non-insulin-dependent diabetes mellitus Diabetes mellitus is the most common type of diabetes, accounting for 95% of all diabetes cases. For example, type 2 diabetes is caused by a combination of factors including insulin resistance due to pancreatic β cell dysfunction. This combination leads to high blood glucose levels. Increased glucagon levels stimulate the liver to produce excessive amounts of unnecessary glucose. This leads to high blood glucose levels.

[0263] Type 1 diabetes, also known as insulin-dependent diabetes, accounts for approximately 5% of all diabetes cases. Type 1 diabetes occurs when T cells attack and destroy insulin-producing beta cells in the pancreas. In some embodiments, type 1 diabetes is an autoimmune disease caused by genetic and environmental factors. This is what causes it.

[0264] Type 4 diabetes is a recently discovered form of diabetes that affects approximately 20% of people over the age of 65. In some embodiments, type 4 diabetes is caused by age-related insulin resistance. It is characterized by resistance.

[0265] In some embodiments, type 3 diabetes results in insulin resistance in the brain. It is used as a term for Alzheimer's disease.

[0266] In some embodiments, the method of treating diabetes-associated muscle wasting in a subject comprises administering to said subject a therapeutically effective amount of As described herein, the method includes administering a therapeutically effective amount of a polynucleic acid molecule described herein, Alternatively, the method comprises administering to a subject a polynucleic acid molecule conjugate as described herein. In additional embodiments, a method of treating muscle wasting associated with cancer or diabetes in a subject is provided herein. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein, or comprises administering to a subject a polynucleic acid molecule conjugate as described herein.

[0267] Chronic obstructive pulmonary disease Chronic obstructive pulmonary disease (COPD) is characterized by long-term breathing problems and poor airflow. It is a type of obstructive pulmonary disease. Chronic bronchitis and emphysema are two different types of COPD. In some examples, the subject is diagnosed with a condition associated with COPD (e.g., chronic bronchitis or emphysema). Methods for treating muscle atrophy, which involve or are induced by the The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the subject is diagnosed with COPD (e.g., chronic bronchitis or Methods for treating muscle atrophy associated with or induced by muscular dystrophy (e.g., muscular dystrophy or emphysema) are provided. As described herein, the method comprises administering a therapeutically effective amount of a polynucleic acid molecule described herein. The method includes administering the conjugate to a subject.

[0268] Liver disease Liver disease (or liver disease) includes fibrosis, cirrhosis, hepatitis, alcoholic liver disease, and fatty liver. In some instances, the subject may have a liver disease associated with the disease. Described herein are methods for treating muscle atrophy caused by or induced by liver disease. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the method comprises the steps of: Described herein are methods for treating disease-induced muscle atrophy, the methods comprising: administering to a subject a therapeutically effective amount of a polynucleic acid molecule conjugate as described herein. .

[0269] Congestive heart failure Congestive heart failure is when the heart cannot pump enough blood and oxygen to the body's tissues. In some instances, the condition is associated with or is associated with congestive heart failure in a subject. Described herein is a method for treating muscle atrophy induced by congestive heart failure, the method comprising administering to the subject a therapeutically effective amount of The method includes administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In other embodiments, the subject has a congestive heart failure associated with or associated with congestive heart failure. Described herein is a method for treating muscle atrophy induced by chronic heart failure, the method comprising administering to a subject a administering to the subject a therapeutically effective amount of a polynucleic acid molecule conjugate described herein. include.

[0270] chronic renal failure Chronic kidney failure or chronic kidney disease is the gradual loss of kidney function over time. In some instances, the disease is associated with chronic renal failure in a subject. Alternatively, a method for treating muscle atrophy induced by chronic renal failure is described herein, comprising: The method includes administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the method comprises administering to the subject a therapeutically effective amount of ... medicament for treating chronic renal failure associated with or associated with chronic renal failure in the subject. Described herein is a method for treating muscle atrophy induced by renal failure, the method comprising: The method includes administering to a subject a therapeutically effective amount of a polynucleic acid molecule conjugate as described herein. nothing.

[0271] chronic infection In some embodiments, a chronic infection such as AIDS may also cause muscle wasting. In some instances, the subject is diagnosed with a chronic infection (e.g., AIDS-related Methods for treating muscle atrophy induced by or in association with the present invention are described herein. The method includes the steps of administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the subject is diagnosed with a chronic infection (e.g., AIDS). Methods for treating muscle atrophy associated with or induced by the present invention are described herein. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule conjugate as described herein. The method includes administering.

[0272] sepsis Sepsis is a condition in which the immune system is compromised against an infection leading to tissue damage, organ dysfunction, and / or death. In another embodiment, the immune response is associated with or associated with sepsis in the subject. Described herein is a method for treating muscle atrophy induced by a disease, the method comprising the steps of: The method includes administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In some embodiments, the method is associated with or induced by sepsis in a subject. Described herein is a method for treating muscle atrophy, the method comprising administering a therapeutically effective amount of the compound described herein. The method includes administering to a subject a polynucleic acid molecule conjugate as described in .

[0273] Fasting Fasting is the voluntary abstinence from some or all food, drink, or both for a period of time. In another embodiment, the fasting of the subject is controlled by abstinence or reduction. Methods for treating muscle atrophy associated with or induced by fasting are described herein. The method comprises administering to a subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the method comprises administering a fasting-associated or fasting-associated Described herein are methods for treating diet-induced muscle atrophy, the methods comprising the steps of: The method includes administering to the subject an effective amount of a polynucleic acid molecule conjugate described herein.

[0274] Sarcopenia Sarcopenia is the gradual loss of muscle mass and strength that occurs over a period of months to years. It is a continuing process of muscle wasting during normal aging, characterized by The mitochondrial process is not affected or accelerated by the presence of disorders and diseases that promote skeletal muscle neurodegeneration. By this term is meant the unaccelerated aging process.

[0275] In some embodiments, the sarcopenia-associated or sarcopenic phenotype in a subject is Described herein is a method for treating muscle atrophy induced by Copenia, the method comprising: The method includes administering to the subject a therapeutically effective amount of a polynucleic acid molecule described herein. In another embodiment, the sarcopenia-associated or sarcopenic inflammatory disease in a subject. Described herein is a method for treating muscle atrophy induced by The method includes administering to a subject an effective amount of a polynucleic acid molecule conjugate described herein.

[0276] Glucocorticoid-associated muscle atrophy In some embodiments, treatment with a glucocorticoid further reduces muscle atrophy. Exemplary glucocorticoids include, but are not limited to, cortisol, dexamethasone, betamethasone, betamethasone, prednisone, methylprednisolone, and prednisolone. include.

[0277] In some embodiments, the method comprises treating glucocorticoid-associated muscle atrophy in a subject. Methods are described herein, the methods comprising administering a therapeutically effective amount of a polypeptide as described herein. In another embodiment, the method further comprises administering a glycoprotein comprising administering to the subject a nucleic acid molecule comprising administering to the subject a glycoprotein comprising the nucleic acid molecule. Described herein is a method for treating cytotoxic muscle atrophy, the method comprising: The method includes administering to a subject an effective amount of a polynucleic acid molecule conjugate described herein.

[0278] Disuse-related muscle atrophy Disuse-related muscle atrophy occurs as a result of limb immobilization (e.g., limb or (due to fracture of a joint, or orthopedic surgery such as hip or knee replacement surgery). As used, "fixed" or "fixed" means fixed for an extended period of time (e.g., 2 or 3 days). , 4 days, 5 days, 6 days, 1 week, 2 weeks, or more), limbs, muscles, bones, tendons, and joints It refers to partial or complete restriction of movement of the pelvis, arm, or other body parts. The period of immobilization may consist of short or short restraints such as bathing, changing external devices, or adjusting external devices. Limb immobilization may include, but is not limited to, braces, slings, casts, and wraps. Bandages and splints (any of which may be made of, but are not limited to, cloth, gauze, glass, (composed of hard or soft materials including fiberglass, plastic, gypsum, or metal) Any of a variety of external devices, including surgically implanted splints, plates, braces, etc. In the context of limb immobilization, the restriction of movement is achieved by any of a variety of internal devices, including The estimates are for single or multiple joints (e.g., single joints such as the shoulder or hip, radiocarpal joint, etc.) Any complex joint, such as the knee, including, but not limited to, one or more of the following: Hand joints, shoulder joints, elbow joints, wrist joints, accessory joints, sternoclavicular joints, vertebral joints, temporomandibular joints, sacral joints in the hip, knee, and ankle joints), a single tendon or ligament, or multiple tendons or ligaments or ligaments (e.g., including, but not limited to, one or more of the following: anterior cruciate ligament, posterior cruciate ligament, Rotator cuff tendons, medial collateral ligaments of the elbow and knee, flexor tendons of the hand, lateral ligaments of the ankle, tendons of the jaw or temporomandibular joint and ligaments), a single bone or multiple bones (including, but not limited to, one or more of the following: Skull, mandible, clavicle, ribs, radius, ulna, humerus, pelvis, sacrum, femur, patella, phalanges , carpals, metacarpals, tarsals, metatarsals, fibula, tibia, scapula, and vertebrae), single muscles and or multiple muscles (e.g., including, but not limited to, one or more of the following: latissimus dorsi, trapezius, Deltoids, chest muscles, biceps, triceps, external obliques, abdominal muscles, gluteus maximus, thigh flexors, quadriceps, gastrocnemius, and diaphragm); one or more limbs, one or more arms and legs), or skeletal muscles This may include the entire system or a portion of it (e.g., in the case of a total body cast or spica cast).

[0279] In some embodiments, a method of treating disuse-related muscle atrophy in a subject is provided herein. The method comprises administering a therapeutically effective amount of a polynucleic acid molecule as described herein to a subject. In another embodiment, the method comprises administering to the subject a method for treating disuse-related muscle atrophy in the subject. Methods of treating are described herein, which include administering a therapeutically effective amount of a compound described herein. The method includes administering to a subject a polynucleic acid molecule conjugate comprising the steps of:

[0280] Pharmaceutical preparations In some embodiments, the pharmaceutical formulations described herein include, but are not limited to, Oral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal administration In some examples, the compound is administered to a subject by multiple routes of administration, including the routes described herein. The pharmaceutical compositions described in are administered parenterally (e.g., intravenously, subcutaneously, intramuscularly, intraarterially, intraperitoneally, In another embodiment, the compound is formulated for administration intrathecally, intracerebrally, intraventricularly, or intracranially. In some embodiments, the pharmaceutical compositions described herein are formulated for oral administration. In accordance with the present invention, the pharmaceutical compositions described herein are formulated for intranasal administration.

[0281] In some embodiments, the pharmaceutical composition may be, but is not limited to, an aqueous dispersion, a self-emulsifying Dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate release formulations, controlled Release formulations, fast dissolve formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsed release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate-release and controlled-release formulations. include.

[0282] In some examples, the pharmaceutical formulation comprises a multiparticulate formulation. In some examples, the pharmaceutical formulation comprises a nanoparticulate formulation. In some examples, the nanoparticles include cMAP, cyclodextrin, In some cases, the nanoparticles include solid lipid nanoparticles, polymeric nanoparticles, This includes self-emulsifying nanoparticles, liposomes, microemulsions, or micellar solutions. Exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, , metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (covalently bound gold (e.g., those with chelates), nanofibers, nanohorns, nanoonions, nanorods In some examples, the nanoparticles include metal nanoparticles, nanoropes, and quantum dots. Nanoparticles, such as scandium, titanium, vanadium, chromium, manganese, iron, cobalt Nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium aluminum, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, nium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, Indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium Zn, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium Nanoparticles of aluminum, arsenic, antimony, and combinations, alloys, or oxides thereof It is.

[0283] In some instances, the nanoparticles may be a core, or as in a core-shell nanoparticle. , including a core and a shell.

[0284] In some examples, the nanoparticles can be a nucleic acid molecule (e.g., a polynucleic acid molecule or The substrate is further coated with a molecule for binding of the functional element (to one or more of the binding moieties). In some examples, the coating may be chondroitin sulfate, dextran sulfate, carboxylate, or the like. Methyldextran, alginic acid, pectin, carrageenan, fucoidan, agaropectin porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acid, gluco samine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid Laginic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotryptophan Sinogen, α-chymotrypsin, polylysine, polyarginine, histones, protamine , ovalbumin, or dextrin or cyclodextrin. In the present invention, the nanoparticles include graphene-coated nanoparticles.

[0285] In some cases, the nanoparticles are about 500 nm, 400 nm, 300 nm, 200 nm, Alternatively, it has at least one dimension less than 100 nm.

[0286] In some instances, the nanoparticle formulations include paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, molecules, fullerene-like materials, inorganic nanotubes, dendrimers (containing covalently bound metal chelates) nanofiber, nanohorn, nanoonion, nanorod, nanolow In some examples, the polynucleic acid molecules described herein include Alternatively, the binding moiety may be directly or indirectly attached to the nanoparticle. At least 1, 5, 10, 15, 20, 30, 40, 50, 60, 7 0, 80, 90, 100 or more polynucleic acid molecules or binding moieties may be Binds directly or indirectly to a child.

[0287] In some embodiments, the pharmaceutical formulation comprises a delivery vector, e.g., a polynucleic acid, into a cell. In some instances, the recombinant vector comprises a DNA In another embodiment, the recombinant vector is a viral vector. Common viral vectors include adeno-associated viruses, retroviruses, adenoviruses, and In some instances, vectors that express polynucleic acid molecules include vectors derived from vectors derived from alphaviruses. The recombinant vector capable of expressing the gene results in stable expression in target cells. In some instances, viral vectors are used that provide for the transient expression of polynucleic acid molecules.

[0288] In some embodiments, the pharmaceutical formulation is a pharmaceutical agent compatible with the compositions disclosed herein. and the carrier or carrier material selected based on the release profile characteristics of the desired dosage form. Exemplary carrier materials include, for example, binders, suspending agents, disintegrants, fillers, surfactants, and the like. These include additives, solubilizers, stabilizers, lubricants, humectants, diluents, etc. Pharmaceutically compatible Suitable carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, Calcium glycerophosphate, calcium lactate, maltodextrin, glycerin, silicic acid Magnesium, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esther ter, sodium caseinate, soy lecithin, taurocholic acid, phosphatidylcholine, Sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose Conjugates, sugars sodium stearoyl lactylate l lactylate), carrageenan, monoglyceride, diglyceride, pregelatinized starch For example, Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Ea ston, Pa.: Mack Publishing Company, 1995. ); Hoover, John E., Remington's Pharmace utical Sciences, Mack Publishing Co., Ea. ston, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Do sage Forms, Marcel Decker, New York, NY ., 1980; and Pharmaceutical Dosage Forms a nd Drug Delivery Systems, Seventh Ed. (See Pincott Williams & Wilkins 1999).

[0289] In some examples, the pharmaceutical formulation further comprises acetic acid, boric acid, citric acid, lactic acid, phosphoric acid, and and acids such as hydrochloric acid; sodium hydroxide, sodium phosphate, sodium borate, citric acid Sodium, sodium acetate, sodium lactate, and tris(hydroxymethylamino)methyl Bases such as tallow, as well as citrate / dextrose, sodium bicarbonate, and salts The pH adjusting or buffering agent may further include a buffer such as ammonium chloride. Acids, bases, and buffers are included in amounts necessary to maintain the pH of the composition in an acceptable range. Can be enjoyed.

[0290] In some instances, the pharmaceutical formulation may be added in an amount sufficient to bring the osmolality of the composition into an acceptable range. Such salts include one or more salts of sodium, potassium, or ammonium. Thione, as well as chloride, citrate, ascorbate, borate, phosphate, and carbonate Suitable salts include sodium chloride, sulfate, thiosulfate, or bisulfite anions. Sodium, potassium chloride, sodium thiosulfate, sodium bisulfite, and ammonium sulfate. Contains monium.

[0291] In some instances, pharmaceutical formulations may provide a more stable environment, thereby stabilizing the compound. Further examples of diluents include, but are not limited to, phosphate buffered saline. The salts dissolved in the buffer containing the phosphate ion exchange buffer (which also controls or maintains pH) are rare in the art. In certain instances, a diluent serves to increase the size of the composition and thus the pressure. To facilitate shrinkage or to obtain a homogeneous mixture for capsule filling. Such compounds include, for example, lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel®; Calcium hydrogen phosphate, calcium phosphate dihydrate; Tricalcium phosphate, calcium phosphate anhydrous lactose, spray-dried lactose; pregelatinized starch, Di-Pac® Compressible sugars such as Amstar; mannitol, hydroxypropyl methylcellulose sucrose, hydroxypropyl methylcellulose acetate stearate, sucrose-based Diluent, Powdered Sugar; Monobasic Calcium Sulfate Monohydrate; Calcium Sulfate Dihydrate; Calcium Lactate Sodium trihydrate, dextrates; hydrolyzed cereal solids , amylose; powdered cellulose; calcium carbonate; glycine; kaolin; mannitol, Sodium chloride; inositol, bentonite, etc.

[0292] In some cases, pharmaceutical formulations contain disintegrants to facilitate the breakdown or disintegration of the material. Integration agents or disintegrants The term "disintegrate" includes both the dissolution and dispersion of the dosage form upon contact with gastrointestinal fluids. Examples of disintegrants include starches, such as natural starches, e.g., corn starch. or potato starch, pregelatinized starch, e.g. National 1551 or Amijel®, or sodium starch glycolate, e.g., Prom ogel® or Explotab®, cellulose, e.g. wood methyl crystalline cellulose, e.g. Avicel®, Avicel® ) PH101, Avicel (registered trademark) PH102, Avicel (registered trademark) PH1 05, Elcema® P100, Emcocel®, Vivace l®, Min Tia®, and Solka-Floc® )), methylcellulose, croscarmellose, or crosslinked cellulose, e.g. Sodium carboxymethylcellulose (Ac-Di-Sol®), cross-linked carboxymethylcellulose crosslinked starch, e.g., sodium hydroxymethylcellulose, or crosslinked croscarmellose; cross-linked polymers such as crospovidone, cross-linked polyvinylpyrrolidone Don, alginates, such as alginic acid or sodium alginate Salt, clay such as Veegum® HV (magnesium aluminum silicate), agar, guar, locust bean, karaya, pectin, or tragacanth , sodium starch glycolate, bentonite, natural sponge, surfactant, cation It is a combination of resins such as ion exchange resins, citrus pulp, sodium lauryl sulfate, and starch. Sodium lauryl sulfate and the like.

[0293] In some examples, the pharmaceutical formulation may include lactose, calcium carbonate, calcium phosphate, Dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose Rose, dextrate, dextran, starch, pregelatinized starch, sucrose, xylitol Tol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol Contains fillers such as recall.

[0294] Lubricants and glidants are also used herein to refer to any substance or material that is intended to prevent, reduce or inhibit adhesion or friction of materials. Exemplary lubricants include, for example, stearic acid, water, Calcium oxide, talc, sodium stearyl fumarate, mineral oil and other hydrocarbons, Hardened vegetable oils, such as hydrogenated soybean oil (Sterotex®), higher fatty acids, and and alkali metal and alkaline earth metal salts, e.g., aluminum, calcium, magnesium , Zinc, Stearic Acid, Sodium Stearate, Glycerol, Talc, Wax, S Tearowet®, boric acid, sodium benzoate, sodium acetate, sodium chloride thorium, leucine, polyethylene glycol (e.g. PEG-4000) or methionine Polyethylene glycols, such as Carbowax™, sodium oleate , Sodium Benzoate, Glyceryl Behenate, Polyethylene Glycol, Magnesium Lauryl Sulfate Colloidal silica such as sodium lauryl sulfate or Syloid(TM) Starches such as moss, Cab-O-Sil®, corn starch, silicone Contains oils, surfactants, etc.

[0295] Plasticizers act by softening the microencapsulated material or film coating. Suitable plasticizers include compounds used to reduce the brittleness of polymers. 0, PEG400, PEG600, PEG1450, PEG3350, and PEG80 0, polyethylene glycol, stearic acid, propylene glycol, oleic acid, Plasticizers also function as dispersants or wetting agents. It works.

[0296] The solubilizers are triacetin, triethyl citrate, ethyl oleate, and ethyl caprylate. , Sodium Lauryl Sulfate, Sodium Docusate, Vitamin E TPGS, Dimethyl Acetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone rolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, Polyethylene glycol 200-600, glycofurol, transcutol, propylene These include compounds such as ethylene glycol, and dimethyl isosorbide.

[0297] Stabilizers include compounds such as any antioxidant, buffer, acid, preservative, etc.

[0298] The suspending agent is polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinyl Polyvinylpyrrolidone K17, Polyvinylpyrrolidone K25, or Polyvinylpyrrolidone K 30, Vinylpyrrolidone / Vinyl Acetate Copolymer (S630), Polyethylene Glycol (For example, polyethylene glycols may have a molecular weight of from about 300 to about 6000, from about 3350 to about 4000, or from about 7000 to about 5400), sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, Hydroxymethylcellulose stearate acetate, polysorbate 80, hydroxy Ethylcellulose, sodium alginate, gums such as tragacanth, gum arabic Gums, guar gum, xanthan including xanthan gum, sugars, cellulosics, e.g., natto Sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose cellulose, hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyiso Rubate 80, Sodium Alginate, Polyethoxylated Sorbitan Monolaurate, Poly Compounds include reethoxylated sorbitan monolaurate, povidone, etc.

[0299] Surfactants include sodium lauryl sulfate, sodium docusate, Tween 60, or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene Sorbitan monooleate, polysorbate, poloxamer ), bile salts, glyceryl monostearate, ethylene oxide and propylene oxide Copolymers of, for example, compounds such as Pluronic® (BASF) Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils (e.g., Polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkyl esters ethers and alkyl phenyl ethers, e.g., Octoxynol 10, Octoxynol 40, etc. Surfactants are often used to enhance physical stability or for other purposes. Included for the purpose.

[0300] Viscosity enhancers include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxy Hydroxypropyl methylcellulose acetate stearate, Hydroxypropyl methylcellulose Sulfate, Carbomer, Polyvinyl Alcohol, Alginate, Acacia, Chitosan and combinations thereof.

[0301] Wetting agents include oleic acid, glyceryl monostearate, sorbitan monooleate, and sol. Bitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan Monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, Sodium oleate, sodium lauryl sulfate, sodium docusate, triacetin , Tween 80, Vitamin E TPGS, ammonium salts and other compounds.

[0302] Treatment regimen In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic purposes. In some embodiments, the pharmaceutical composition is administered once a day, twice a day, or once a day. The pharmaceutical composition may be administered daily, every other day, five days a week, once a week, or more than three times a week. It may be administered every other week, two weeks a month, three weeks a month, once a month, twice a month, three times a month, or more frequently. The pharmaceutical composition may be preserved for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 2 years, 3 years, or more It is administered for a period of time.

[0303] In some embodiments, one or more pharmaceutical compositions may be administered simultaneously, sequentially, or over a period of time. In some embodiments, the one or more pharmaceutical compositions are administered simultaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. The above pharmaceutical compositions are administered at intervals (e.g., the first administration of the first pharmaceutical composition). is day 1, and thereafter, at least 1, 2, 3 days prior to administration of at least a second pharmaceutical composition. , 4, 5 days or more apart).

[0304] In some embodiments, two or more different pharmaceutical compositions are administered simultaneously. In some instances, two or more different pharmaceutical compositions are administered simultaneously. In other cases, the two different pharmaceutical compositions are administered simultaneously in succession with no interval between administrations. The different pharmaceutical compositions are administered at intervals of about 0.5 hours, 1 hour, 2 hours, 3 hours, 12 hours, etc. The drugs are administered consecutively at intervals of 1 or 2 days.

[0305] If the patient's condition improves, at the physician's discretion, administration of the composition may be continued; alternatively, Typically, the dosage of the composition being administered is temporarily reduced or maintained for a specific period of time. In some instances, the length of the drug holiday is approximately For example, the 2nd, 3rd, 4th, 5th, 6th, 7th, 10th, 12th, 15th, 20th Days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 20 0, 250, 280, 300, 320, 350, or 365 days, including The reduction in dosage during drug-free days varies from days to a year. For example, reductions in dosage can be as low as 10%, 15%, or 20%. , 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% , 70%, 75%, 80%, 85%, 90%, 95%, or 100%, including 10% ~100%.

[0306] Once the patient's condition improves, a maintenance dose is administered as needed. The dosage and / or frequency of administration may vary depending on the symptoms and / or the severity of the improved disease, disorder, or condition. It is possible to reduce the level to a level where the disease persists.

[0307] In some embodiments, the amount of a given drug that corresponds to such an amount is a specific compound, Factors such as the severity of the disease, the nature of the subject or host in need of treatment (e.g., weight), etc. The factors that influence the outcome may nevertheless include, for example, the specific drug being administered, the route of administration, etc. According to the specific circumstances surrounding the case, including the tract, and the subject or host being treated. In some instances, the desired dosage is determined routinely by methods known in the art. In a single dose, simultaneously (or over a short period of time), or at appropriate intervals The fractional dose administered, e.g., 2, 3, or 4 or more fractional doses per day (sub-d oses).

[0308] Due to the large number of variables associated with individual treatment regimens, the ranges presented above are only suggestive. However, it is not uncommon for such investments to deviate significantly from these recommendations. The dosage will depend, but is not limited to, on the activity of the compound used, the disease or condition being treated, and the mode of administration. The type, requirements of the individual subject, the severity of the disease or condition being treated, and the physician's It is subject to change and depends on many variables, including judgment.

[0309] In some embodiments, the toxicity and therapeutic efficacy of such treatment regimens are limited. However, the LD50 (lethal dose to 50% of the population) and the ED50 (lethal dose to 50% of the population) are Standard pharmaceutical procedures in cell cultures or experimental animals, including the determination of the therapeutically effective dose The dose ratio between toxic and therapeutic effects is the therapeutic index, which is the LD The therapeutic index is expressed as the ratio between the ED50 and the ED50. Compounds that exhibit high therapeutic indices are preferred. Data from cell culture assays and animal studies have been used to formulate a range of doses for use in humans. The dosage of such compounds is chosen to be within the range of ED50 with minimal toxicity. The dosage will preferably lie within a range of circulating concentrations that include the dosage form used and the dosage regimen utilized. It will vary within this range depending on the route of administration.

[0310] Kits / Products In some embodiments, the compositions may be used in conjunction with one or more of the compositions and methods described herein. Disclosed herein are kits and articles of manufacture that can be used to administer the present invention to patients. Such kits can include vials, tubes, including a carrier, package or container partitioned to accommodate one or more containers, such as bottles, Each container contains one of the separate elements for use in the methods described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In some embodiments, the containers may be formed from a variety of materials such as glass or plastic.

[0311] The products provided herein include packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, However, blister packs, bottles, tubes, bags, containers, bottles, and selected formulations and Any packaging material suitable for the intended mode of administration and treatment may be included.

[0312] For example, the container contains a target nucleic acid molecule as described herein. Separate description or labeling, or instructions for use in the methods described herein Optionally includes writing.

[0313] The kit typically includes a label listing the contents and / or instructions for use, and instructions for use. A set of instructions is also typically included.

[0314] In one embodiment, a label is on or associated with the container. Letters, numbers or other indicia forming a label are affixed to or molded into the container itself. If the label is marked or inscribed, the label is placed on the container. , when present in a receptacle or carrier that holds the container as a package insert, In one embodiment, the label indicates that the contents are to be used for a particular therapeutic application. The label is used to indicate that the product is a It also provides instructions on how to use the contents.

[0315] In certain embodiments, the pharmaceutical composition comprises one or more units comprising a compound provided herein. The dosage forms may be presented in a pack or dispenser device. The pack may, for example, be a blister pack. In one embodiment, the pack or The dispenser device is accompanied by instructions for administration. The pack or dispenser may contain any drug that is approved by any government agency that controls the manufacture, use or sale of pharmaceutical products. The container is affixed with a notice stating that the product is hazardous to humans or It reflects the government agency's approval of a drug form for administration to animals. Such notices may be issued, for example, by the U.S. Food and Drug Administration with respect to prescription drugs or approved package inserts. In one embodiment, the drug is formulated in a compatible pharmaceutical carrier. Compositions containing the compounds provided herein may also be prepared, placed in a suitable container, and Labeled for treatment of disease.

[0316] Specific Terms Unless otherwise specified, all technical and scientific terms used herein are intended to be understood as meaning those to which the subject The above terms have the same meaning as commonly understood by a person skilled in the art. The general description and the following detailed description are exemplary and explanatory only and are not intended to be limiting of any particular subject matter. It will be understood that the use of the singular is not intended to define the term. As used in the specification and the appended claims, the singular forms "a," "a "n" and "the" refer to plurals unless the context clearly dictates otherwise. In this application, the use of "or" means "and / or" unless expressly stated otherwise. Additionally, use of the term "including" means "in "include", "includes", and "included )" is not limiting, just like other forms such as "

[0317] As used herein, ranges and amounts can be expressed as "about" a particular value or range. "About" also includes the exact amount. So, "about 5 μL" can be used to mean "about 5 μL" and "about 5 μL". In general, the term "about" includes amounts that are expected to be within experimental error. There are.

[0318] The section headings used herein are for organizational purposes only and do not limit the scope of the invention. This document should not be construed as limiting the subject matter herein.

[0319] As used herein, the terms "individual," "subject," and "patient" refer to any mammal. In some embodiments, the mammal is a human. In some embodiments, mammals are non-human. Supervision of staff (e.g., regular The term "conditions" is not limited to conditions characterized by "periodic or intermittent" conditions.

[0320] The term "therapeutically effective amount" refers to an amount that provides a desired therapeutic effect in a mammalian subject. In some cases, the amount refers to an amount of polynucleic acid molecule conjugate sufficient to treat a disorder or recurrence. For treating, preventing, or preventing the onset of at least one symptom of a sexual disorder to cure, delay, reduce the severity or ameliorate said symptoms, or to prolong the patient's survival beyond that expected in the absence of such treatment. In particular, the amount of the compound administered to a patient (such as a human) may be one or more doses. Of course, the amount of the compound administered may be any amount that provides a therapeutically effective amount. The dosage level of the particular polynucleic acid molecule conjugate used to deliver the compound will depend on the type of injury, the subject being tested, The age, weight, sex, medical condition of the subject, the severity of the disease, the route of administration, and the specific In some instances, the therapeutically effective amount of the polynucleic acid molecule conjugate The effects of the present invention will be initially evaluated in cell culture and animal models, such as those described herein. For example, IC50 values ​​determined in cell culture methods can optionally serve as a starting point in animal models. On the other hand, IC50 values ​​determined in animal models are useful for finding therapeutically effective doses in humans. It is used optionally to

[0321] Skeletal or voluntary muscles are usually attached to bones by tendons and provide movement or posture It is usually used to bring about skeletal movement, such as during exercise. Multiple control of skeletal muscles is generally unconscious. skeletal muscles are not subject to conscious control, whereas the muscular system is maintained as a reflex of consciousness (e.g., postural muscles or the diaphragm). Smooth or involuntary muscles are found in organs such as the esophagus, stomach, intestines, uterus, urethra, and blood vessels. Found within the walls of vessels and structures.

[0322] Skeletal muscles are classified into two broad types: type I (or "slow twitch") and type II (or "fast twitch"). Type I muscle fibers are densely packed with capillaries and contain mitochondria and myofibers. Type I muscle tissue is rich in eosinophils, which give it its characteristic red color. In some cases, type I muscle fibers carry more oxygen and use more fat or carbohydrates for fuel. Type I muscle fibers contract for a long time but with little force. Type II muscle fibers Fibers are of three major subtypes (IIa, IIx, and Type II muscle fibers are further subdivided into type IIb and type IIc. Type II muscle fibers contract quickly and powerfully but fatigue quickly. Thus, muscle contractions result in a very short burst of anaerobic activity before they become painful.

[0323] Unlike skeletal muscles, smooth muscles are not under conscious control.

[0324] Cardiac muscle is also an involuntary muscle, but it is structurally very similar to skeletal muscle and is found only in the heart. Cardiac and skeletal muscles contain sarcomeres that are packed into highly ordered bundles. In contrast, smooth muscle cell myofibrils are not arranged in sarcomeres. Therefore, there are no striations.

[0325] Muscle cells include any cell that contributes to muscle tissue. Exemplary muscle cells include myoblasts, Includes satellite cells, myotubes, and myofibrillar tissue.

[0326] As used herein, muscle force is proportional to cross-sectional area (CSA) and muscle velocity is proportional to muscle fiber length. Therefore, comparison of cross-sectional area and muscle fiber size between various muscle types can be used to determine the severity of muscle atrophy. Various methods are known in the art for measuring muscle strength and muscle mass. are known in the field and are described, for example, in “Musculoskeletal assessment t: Joint range of motion and manual musc le strength” by Hazel M. Clarkson, publi shed by Lippincott Williams & Wilkins, 2 See "000" for information on generating cross-sectional images of selected muscle tissue using computed transverse tomography and sound analysis. Wavelength assessment is an additional method of measuring muscle strength. EXAMPLES

[0327] These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims. isn't it.

[0328] Example 1. siRNA Sequences and Synthesis

[0329] All siRNA single strands were fully synthesized on the solid phase using standard phosphoramidite chemistry. The purified single strand was duplexed to produce double stranded siRNA. All siRNA passenger strands contained one C6-NH 2 and / or C6-SH. The conjugation handle or handles may be reverse abasic phosphodiester or phosphorothioate. The following is used in the in vivo experiments: This is a typical structure of the format.

[0330] [ka]

[0331] The typical structure of siRNA is a C6-NH 2 Embracing Hand and C6-SH at the 3' end.

[0332] [ka]

[0333] The typical structure of the siRNA passenger strand is a C6-NH 2 Embossed Handle and C6-S-PEG at the 3' end.

[0334] [ka]

[0335] The typical structure of the siRNA passenger strand is a C6-NH 2 Embossed Handle and C6-S-NEM at the 3' end.

[0336] [ka]

[0337] The typical structure of the siRNA passenger strand is a C6-N-SMCC conjugate at the 5' end. It has a strand and a C6-S-NEM at the 3' end.

[0338] [ka]

[0339] The typical structure of the siRNA passenger strand is a PEG at the 5' end and a C6- Has SH.

[0340] [ka]

[0341] The typical structure of the siRNA passenger strand is C6-S-NEM at the 5' end and C6-S-NEM at the 3' end. C6-NH at the end 2 It has a co-hugging handle.

[0342] Cholesterol-myostatin siRNA conjugate The sequence of the guide / antisense strand is MSTN(UUAUUAUUGUUCUUUGC CUU; SEQ ID NO: 14226) The gene sequence was complementary to the gene sequence beginning at position 1169. All siRNA single strands were optimized to reduce immunogenicity by using on the solid phase using standard phosphoramidite chemistry The purified single strand was duplexed to produce the double stranded si The passenger strand was a 5' chain of RNA conjugated as described below in FIG. It contained terrorism.

[0343] Example 2. General Experimental Protocol and Materials

[0344] animal

[0345] Animal studies are covered by the Guide for the Care and Use of "USDA Animal Welfare Commission" as well as "Voluntary Animals" Explora BioLabs Institute, which adheres to the rules outlined in the Act tional Animal Care and Use Committee(I All mice were cultured according to a protocol based on the American College of Cardiology (ACUC). Iver Laboratories or Harlan Laboratories Obtained from either.

[0346] Wild-type CD-1 mice (4-6 weeks old) were transfected with the indicated ASCs (or antibody-nucleic acid conjugates). The subjects were dosed by intravenous (iv) injection at 100 mg / kg / day (body) and 100 mg / kg / day.

[0347] Anti-transferrin receptor antibody

[0348] Anti-mouse transferrin receptor antibody or CD71 mAb binds mouse CD71 or or mouse transferrin receptor 1 (mTfR1) The antibody is produced by BioXcell and is commercially available. Yes it is (Catalog # BE0175).

[0349] IgG2a isotype control antibody

[0350] Rat IgG2 from BioXcell (clone 2A3, catalog # BE0089) a Isotype control antibody was purchased. This antibody is specific for trinitrophenol and It has no known antigen in mice.

[0351] Anti-EGFR antibody

[0352] Anti-EGFR antibodies are fully human antibodies directed against the human epidermal growth factor receptor (EGFR). It is a human IgG1κ monoclonal antibody. It is expressed in the Chinese hamster ovary cell line D Human anti-EGFR produced in JT33 and hybridoma cell lines (2F8) CHO cells were transfected with GS vectors carrying the antibody genes derived from the antibodies. The strain was derived from CHO-K1SV. Standard mammalian cell culture and purification techniques were used. The technology is utilized to produce anti-EGFR antibodies.

[0353] The theoretical molecular weight (MW) of the glycan-free anti-EGFR antibody is 146.6 kDa. The experimental MW of the major glycosylated isoforms of the antibody was determined by mass spectrometry. Using SDS-PAGE under reducing conditions, the molecular mass is 149 kDa. The MW of the chain was found to be approximately 25 kDa, and the MW of the heavy chain was found to be approximately 50 kDa. The heavy chains are connected to each other by two interchain disulfide bonds, and one light chain is a single Each heavy chain is linked to the other heavy chain by an interchain disulfide bond. Light chains have two interchain disulfide bonds. The heavy chain has four interchain disulfide bonds. , Asn3 of the heavy chain with glycans consisting of mannose, fucose, and galactose It is N-linked and glycosylated at 05. The predominant glycan present is 0 or 1. It is a fucosylated, biantennary structure containing a terminal galactose residue.

[0354] Charge isoform patterns of IgG1κ antibodies imaged by capillary IEF, The results were investigated using agarose IEF and analytical cation exchange HPLC. Two isoelectric isoforms have been found, with the major isoform having an isoelectric point of approximately 8.7.

[0355] The main mechanism of action of anti-EGFR antibodies is the inhibition of EGF-induced EGF expression in A431 cancer cells. In addition, the antibody-dependent cell-mediated inhibition of R phosphorylation at low antibody concentrations Induction of cytotoxicity (ADCC) was observed in preclinical cell in vitro studies .

[0356] In vitro evaluation of siRNA potency and efficacy

[0357] C2C12 myoblasts (ATCC) were grown in DMEM supplemented with 10% v / v FBS. For transfection, cells were plated in 24-well plates at 10.000 cells / well. Cells were seeded at 100x the density of 100x the cells and transfected within 24 hours. C2C12 myotubes were cultured for 3–4 days. Confluent C2C12 myoblast cultures in DMEM supplemented with 2% v / v horse serum for 1 h. The medium was changed daily during and after differentiation. Pre-differentiated primary human skeletal muscle cells were obtained from ThermoFisher and purchased from the manufacturer. The cells were plated in DMEM with 2% v / v horse serum as recommended by SJCRH. 30 rhabdomyosarcoma myoblasts (ATCC) were cultured in 10% v / v heat-inactivated fetal bovine serum , 4.5 mg / mL glucose, 4 mM L-glutamine, 10 mM HEPES, and The cells were grown in DMEM supplemented with 0.1 mM sodium pyruvate and 1 mM sodium pyruvate. For this study, cells were plated in 24-well plates at a density of 10,000-20,000 cells / well. All cells were seeded at 100°C for 24 h and transfected according to the manufacturer's recommendations. Using RNAiMax (ThermoFisher), we analyzed the siRNAs at various concentrations. Transfected with As (0.0001-100 nM; 10-fold dilution). The transfected cells were incubated for 2 days at 37°C in 5% CO2, then resuspended in PB Wash with S, harvest with 300 ul of TRIzol (ThermoFisher), and freeze at -80 RNA was purified using the ZYMO 96-well RNA kit (ThermoFisher) and stored at 4 °C. r) and relative RNA expression levels were determined using commercially available TaqMan probes (L Expression data were quantified by RT-qPCR using the IFE Technology. Data were analyzed using the □□CT method normalized to Ppib expression and mock-transfected Data are presented as %KD relative to cells treated with 3-parameter dose-response inhibition. The data were analyzed by nonlinear regression using the All knockdown results represent the maximum KDs observed under these experimental conditions. There are.

[0358] Myostatin ELISA

[0359] Plasma myostatin protein was measured using the R&D System according to the manufacturer's instructions. s GDF-8 (myostatin) Quantikine ELISAImmunoas Quantified using say (part# DGDF80).

[0360] RISC loading assay

[0361] Specific immunoprecipitation of RISC from tissue lysates and quantification of small RNAs in the immunoprecipitates , Pei et al. Quantitative evaluation of s iRNA delivery in vivo. RNA (2010), 16:25 Using an adaptation of the assay described by PCR was determined.

[0362] Example 3. Conjugate synthesis

[0363] The following structures are exemplary AX 1 -BX 2 -Y (Formula I) Illustrate.

[0364] [ka]

[0365] Structure-1: Antibody-Cys-SMCC-S-5'-Passenger strand. This conjugate is Interchain cysteine ​​conjugation of antibody to maleimide (SMCC) at the 5' end of the sensor chain Generated by.

[0366] [ka]

[0367] Structure-2: Antibody-Cys-SMCC-S-3'-Passenger strand. This conjugate is Interchain cysteine ​​conjugation of antibody to maleimide (SMCC) at the 3' end of the sensor chain Generated by.

[0368] [ka]

[0369] ASC structure-3: Antibody-Cys-bisMal-3'-passenger chain. This conjugate The antibody reacts with the bismaleimide (bisMal) linker at the 3' end of the passenger strand. It is produced by interchain cysteine ​​conjugation of the cysteine ​​chain.

[0370] [ka]

[0371] ASC structure-4: Model structure of Fab-Cys-bisMal-3'-passenger strand This conjugate is a bismaleimide (bisMal) phosphoryl group at the 3' end of the passenger strand. It was generated by interchain cysteine ​​conjugation of Fab to Car.

[0372] [ka]

[0373] ASC structure-5: Antibody with two different siRNAs bound to one antibody molecule Model structure of an iRNA conjugate. The conjugate contains the 3' end of the passenger strand of each siRNA. mAb interchain cysteines reduced to terminal bismaleimide (bisMal) linkers was generated by combining a mixture of SSB and HPRT siRNAs into

[0374] [ka]

[0375] ASC Structure-6: Antibody-siRNA Conjugate with Two Different siRNAs Attached Model structure. The conjugate contains a maleimide ( SI of SSB and HPRT to the reduced mAb interchain cysteines relative to the SMCC linker It was produced by linking a mixture of RNAs. Example 3.1 SMCC Linker Synthesis of antibody-siRNA conjugates using

[0376] [ka]

[0377] Step 1: Reduction of antibody interchain disulfides with TCEP

[0378] Antibodies were buffer exchanged into borax buffer (pH 8) to a maximum concentration of 10 mg / ml. To this solution, 2 equivalents of TCEP in water was added and rotated at RT for 2 hours. The reaction mixture was buffer exchanged with PBS containing 5 mM EDTA, pH 7.4, and incubated at RT for 5 min. SMCC-C6-siRNA or S Add to a solution of MCC-C6-siRNA-C6-NHCO-PEG-XkDa (2 equiv.) (X=0.5 kDa~10 kDa) and rotated overnight. Analytical SAX column chromatography Analysis of the reaction mixture by Fie revealed that the antibody-siRNA along with unreacted antibody and siRNA were The conjugate was shown.

[0379] Step 2: Purification

[0380] The crude reaction mixture was purified by anion exchange chromatography as described in Example 3.4. Purified by AKTA explorer FPLC using method-1. and fractions containing antibody-siRNA-PEG conjugates with DAR>2 were isolated, concentrated, and purified using p The buffer was exchanged with PBS at H7.4.

[0381] Step 3: Analysis of purified conjugates

[0382] The isolated conjugates were subjected to SEC, SAX chromatography, and SDS-PAGE. The purity of the conjugate was further characterized by anion exchange chromatography method-2 or anion Assessed by analytical HPLC using one of three on-exchange chromatography methods Both methods are described in Example 3.4. The isolated DAR1 conjugates were typically elutes at 9.0±0.3 minutes on the analytical SAX method and is greater than 90% pure. Typical DAR>2 cysteine ​​conjugates are >85% DAR2 and <15% Contains DAR3.

[0383] Figure 2 shows the SAX HP of TfR mAb-(Cys)-HPRT-PEG5k and DAR1. Illustrated is the LC chromatogram.

[0384] Figure 3 shows the SEC HPRT of TfR mAb-(Cys)-HPRT-PEG5k and DAR1. Illustrated is the LC chromatogram.

[0385] Example 3.2. Antibody siRNA Conjugation Using a Bismaleimide (BisMal) Linker combination synthesis

[0386] [ka]

[0387] Step 1: Reduction of antibody with TCEP

[0388] The antibody was buffer exchanged into borax buffer (pH 8) to a maximum concentration of 5 mg / ml. To the solution was added 2 equivalents of TCEP in water and rotated at RT for 2 hours. The reaction mixture was replaced with PBS, pH 7.4, containing 5 mM EDTA and 5 mM E BisMal-C6-siRNA-C6-S- in PBS containing DTA, pH 7.4 The solution was added to NEM (2 equiv.) and kept at 40 °C overnight. Analytical SAX column chromatography Analysis of the reaction mixture by fluorometric analysis revealed that antibody-siRNA along with unreacted antibody and siRNA were isolated. NA conjugates were shown.

[0389] Step 2: Purification

[0390] The crude reaction mixture was purified by AKTA chromatography using anion exchange chromatography method-1. Purified by Xplorer FPLC. DAR1 and DAR2 antibodies-siRNA The fraction containing the conjugate was isolated, concentrated, and buffer exchanged into PBS, pH 7.4.

[0391] Step 3: Analysis of purified conjugates

[0392] The isolated conjugates were characterized either by mass spectrometry or SDS-PAGE. The purity of the conjugate was confirmed by anion exchange chromatography method-2 and size exclusion chromatography method-3. The chromatographic properties were evaluated by analytical HPLC using either the

[0393] Figure 4 shows the DAR1 and DA of the TfR1mAb-Cys-BisMal-siRNA conjugate. 1 illustrates an overlay of SAX HPLC chromatograms of R2.

[0394] Figure 5 shows the DAR1 and DA of the TfR1mAb-Cys-BisMal-siRNA conjugate. 1 illustrates an overlay of SEC HPLC chromatograms of R2.

[0395] Example 3.3. Fab' Generation from mAb and Conjugation to siRNA

[0396] [ka]

[0397] Step 1: Antibody digestion with pepsin

[0398] The antibody was buffer exchanged into 20 mM sodium acetate / acetic acid buffer, pH 4.0, for up to 5 min. The concentration was 100 mg / ml. Immobilized pepsin (Thermo Scientific, Prod#20343) was added and incubated at 37°C for 3 hours. 0 kDa MWCO Amicon spin filters and PBS pH 7.4 were used. The retentate was collected and purified using size exclusion chromatography to obtain F(a b')2 was isolated. The collected F(ab')2 was then reduced with 10 equivalents of TCEP. Conjugated with SMCC-C6-siRNA-PEG5 in PBS, pH 7.4 at room temperature. Analysis of the reaction mixture on SAX chromatography revealed unreacted Fab and s Conjugates of Fab-siRNA with iRNA-PEG are shown.

[0399] Step 2: Purification

[0400] The crude reaction mixture was purified by AKTA chromatography using anion exchange chromatography method-1. Purified by Xplorer FPLC. DAR1 and DAR2 Fab-siR The fraction containing NA conjugates was isolated, concentrated, and buffer exchanged into PBS, pH 7.4.

[0401] Step 3: Analysis of purified conjugates

[0402] Characterization and purity of the isolated conjugates were performed using anion exchange chromatography, similar to SEC method-1. The enzyme activity was evaluated by analytical HPLC using HPLC method-2 or 3.

[0403] Figure 6 shows an example of the SEC chromatogram of CD71 Fab-Cys-HPRT-PEG5. I testify.

[0404] Figure 7 shows an example of the SAX chromatogram of CD71 Fab-Cys-HPRT-PEG5. I testify.

[0405] Example 3.4. Purification and analytical methods

[0406] Anion Exchange Chromatography Method (SAX)-1. 1. Column: Tosoh Bioscience, TSKGel SuperQ-5PW , 21.5mm ID x 15cm, 13um 2. Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 ​​mM TRIS, 1 .5M NaCl, pH 8.0; Flow rate: 6.0mL / min 3. Gradient: a.%A %B column volume b.100 0 1.00 c.60 40 18.00 d.40 60 2.00 e.40 60 5.00 f.0 100 2.00 g.100 0 2.00

[0407] Anion Exchange Chromatography (SAX) Method-2 1. Column: Thermo Scientific, ProPacTM SAX-10, Bio LCTM, 4×250mm 2. Solvent A: 80%, 10 mM TRIS, pH 8, 20% ethanol; Solvent B: 80 %, 10 mM TRIS, pH 8, 20% ethanol, 1.5 M NaCl; flow rate: 0 .75mL / min 3. Gradient: a. Time %A %B b.0.0 90 10 c.3.00 90 10 d.11.00 40 60 e.13.00 40 60 f.15.00 90 10 g.20.00 90 10

[0408] Anion Exchange Chromatography (SAX) Method-3 1. Column: Thermo Scientific, ProPacTM SAX-10, Bio LCTM, 4×250mm 2. Solvent A: 80%, 10 mM TRIS, pH 8, 20% ethanol; Solvent B: 80 %, 10 mM TRIS, pH 8, 20% ethanol, 1.5 M NaCl; 3.Flow rate: 0.75mL / min 4. Gradient: a. Time %A %B b.0.0 90 10 c.3.00 90 10 d.11.00 40 60 e.23.00 40 60 f.25.00 90 10 g.30.00 90 10

[0409] Size Exclusion Chromatography (SEC) Method-1 1. Column: TOSOH Biosciences, TSKgel G3000SW XL , 7.8×300mm, 5μM 2. Mobile phase: 150 mM phosphate buffer 3. Flow rate: 1.0ml / min for 15 minutes

[0410] Example 4 In vitro screen: Atrogin-1

[0411] Identification of siRNAs for the regulation of mouse and human / NHP atrogin-1

[0412] The bioinformatics screen carried out identified mouse atrogin-1 (Fbxo 56 siRNAs (19mers) that specifically bind to 32;NM_026346.3 In addition, mouse atrogin-1 and human atrogin-1 (FBXO32;N Six siRNAs targeting human / NHP antigens were identified. siRNA specifically targeting trodin-1 (FBXO32; NM_058229.3) The screen for As(19mers) yielded 52 candidates (Tables 2A-B). All selected siRNA target sites contained SNPs (pos.2-18). isn't it.

[0413] Tables 2A and 2B show the identified regulatory pathways for mouse and human / NHP atrogin-1. Illustrating siRNA candidates.

[0414] [Table 2-1]

[0415] [Table 2-2]

[0416] [Table 2-3]

[0417] [Table 3-1]

[0418] [Table 3-2]

[0419] [Table 3-3]

[0420] [Table 3-4]

[0421] [Table 3-5]

[0422] Transfected mouse C2C12 myoblasts, mouse C2C12 myotubes, primary human Predifferentiated myotubes of skeletal muscle cells, and human SJCRH30 rhabdomyosarcoma myoblasts Evaluation of selected atrogin-1 siRNAs in

[0423] 62 identified siRNAs targeting mouse atrogin-1 and human atrogin-1 From the 52 identified siRNAs targeting The activity of these siRNAs was evaluated in transfected Preliminary study of mouse C2C12 myoblasts, mouse C2C12 myotubes, and primary human skeletal muscle cells The results were analyzed in differentiated myotubes and human SJCRH30 rhabdomyosarcoma myoblasts.

[0424] None of the tested siRNAs targeting mouse atrogin-1 expressed mouse C2C1 2 did not show significant activity in myotubes (10 nM), however, the three siRNAs s was >75% higher than mouse atrogin-1 mRNA in C2C12 myoblasts (Table 3). In contrast, NA was down-regulated in C2C12 myotubes (Fig. 8). siRNAs targeting Murf1 were active in C2C12 myotubes, have demonstrated that siRNAs can be transfected into C2C12 myotubes. Is Trodin-1 alternatively spliced ​​in C2C12 myoblasts and myotubes? To determine whether or not different positions in the atrogin-1 mRNA were involved in the expression of was explored by 2011, which yielded similar results. Of the siRNAs tested, only four yielded a KD of >75%. For both human atrogin-1, active siRNAs were located within or targeting the coding region. siRNA targeting mouse atrogin-1 (1179) localized near the IL-1 domain. One of the siRNAs strongly cross-reacted with human atrogin-1. Although it did not show significant activity in 2C12 myotubes, it was not associated with any significant activity in myotubes of primary human skeletal muscle cells. All effective siRNAs effectively downregulated toatrogin-1. They downregulated their respective targets with subnanomolar potency.

[0425] Table 3 shows the results of transfected mouse C2C12 myoblasts, mouse C2C12 myotubes, Predifferentiated myotubes of primary human skeletal muscle cells, and human SJCRH30 rhabdomyosarcoma Illustrates the activity of selected atrogin-1 siRNAs in myoblasts. Experimental Procedure For details, see Example 2.

[0426] [Table 4-1]

[0427] [Table 4-2]

[0428] Example 5. In vitro screen: MuRF-1

[0429] Mouse Murf1 (Trim63) and / or human / NHP MuRF1 (TRI Identification of siRNAs targeting M63

[0430] A bioinformatics screen was performed to identify mouse Murf2 (Trim55;N M_001039048.2) or Murf3 (Trim54) 51 siRNAs (19mers) that specifically bind to mouse Murf1 sequences In addition, mouse Murf1 and human MuRF1 (TRIM63; NM_032 Nine siRNAs targeting human and NHPMuRF1 (588.3) were identified. Screening of 19mer siRNAs specifically targeting NM_032588.3 The search yielded 52 candidates (Table 4A-B). All selected siRNA targets The target site does not have the SNP (pos.2-18).

[0431] Tables 4A and 4B show the identified siRs for regulation of mouse and human / NHPMuRF. Illustrate the NA candidate.

[0432] [Table 5-1]

[0433] [Table 5-2]

[0434] [Table 5-3]

[0435] [Table 6-1]

[0436] [Table 6-2]

[0437] [Table 6-3]

[0438] [Table 6-4]

[0439] [Table 6-5]

[0440] Preliminary transfected mouse C2C12 myotubes and primary human skeletal muscle cells Activity of selected MuRF1 siRNAs in differentiated myotubes

[0441] 60 identified siRNAs targeting mouse Murf1 and 10 targeting human MuRF1 From the 25 siRNAs identified, 35 and 25 siRNAs, respectively, were selected for synthesis. The activity of these siRNAs was confirmed in transfected mouse C2C12 myotubes. The results were analyzed in pre-differentiated primary human skeletal muscle cells (Table 5). Of the siRNAs that inhibited Murf1, 14 displayed >70% knockdown of Murf1, whereas C2C12 myotubes showed <20% knockdown of Murf2 and Murf3. At least 6 of the 14 siRNAs were cross-reactive with human MuRF1. Of the siRNAs tested targeting F1, eight resulted in >70% knockdown of Murf1. In pre-differentiated myotubes of primary human skeletal muscle cells, Murf2 and Mu Only one of these eight siRNAs showed <20% knockdown of rf3. All effective siRNAs showed significant cross-reactivity with mouse Muf1. They downregulated their respective targets with nanomolar potency.

[0442] Figure 5 shows the results of transfected mouse C2C12 myotubes and primary human skeletal muscle cells. FIG. 1 illustrates the activity of selected MuRF1 siRNAs in pre-differentiated myotubes. Cells were grown, transfected, and RNA was isolated and analyzed as described in Example 5. did.

[0443] [Table 7-1]

[0444] [Table 7-2]

[0445] Example 6. 2017-PK-279-WT-CD71 vs. IgG2A isotype, HPR T vs. MSTN siRNA design and synthesis

[0446] MSTN: 21 strands with 19 base complementarity and a 3' dinucleotide overhang The duplex of the primer was designed against mouse MSTN. The sequence of the guide / antisense strand (5' ~3') is UUAUUAUUUGUUCUUUGCCUU (SEQ ID NO:14 226) Modifications of the base, sugar, and phosphate were used to optimize duplex capacity. All siRNA single strands were converted to standard phosphoramidites ( The solid phase was fully assembled using phospharamidite (phospharamidite) chemistry and then subjected to HPLC. The purified single strand was duplexed to obtain double stranded siRNA. The strand has two conjugation handles, a C6-NH 2 and containing C6-SH at the 3' end Both conjugation handles were phosphorothioate reverse abasic phosphorothioate linkers. via the siRNA passenger strand.

[0447] HPRT: 21 strands with 19 base complementarity and a 3' dinucleotide overhang The duplex of the primer was designed against mouse MSTN. The sequence of the guide / antisense strand (5' ~3') is UUAAAAUCUACAGUCAUAGUU (SEQ ID NO:14 227) Modifications of bases, sugars, and phosphates were used to optimize duplex capacity. All siRNA single strands were converted to standard phosphoramidites ( The solid phase was fully assembled using phospharamidite (phospharamidite) chemistry and then subjected to HPLC. The purified single strand was duplexed to obtain double stranded siRNA. The chain is made up of two conjugation handles, a C6-NH 2 and contains a 5'-terminal C6-SH Both conjugation handles contain phosphorothioate reverse abasic phosphorothioate linkers. via the siRNA passenger strand.

[0448] Negative control siRNA sequence (scrambled): 19 bases of complementarity and 3' dinucleotide The published (Burke et al. (201...

Claims

[Claim 1] The invention described in the specification.

Images