Methods for genetically altering plant NIN gene to be responsive to cytokinin
By introducing a site chinin response element into the NIN or NLP gene sequence, the challenge of complementing NIN mutant plants is addressed, resulting in enhanced root nodule formation and improved symbiosis with nitrogen-fixing bacteria for better plant nutrition and growth.
Patent Information
- Application Number
- JP2024184200
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2018-12-06
- Filing Date
- 2024-10-18
- Publication Date
- 2025-01-28
AI Technical Summary
Existing technologies have struggled to successfully complement NIN mutant plants, which are crucial for root nodule formation in legumes, due to the lack of understanding of the NIN promoter region and its regulatory elements, hindering effective root nodule engineering strategies.
Introduction of a site chinin response element into the NIN or NLP gene sequence, derived from endogenous or heterogenous sources, to enhance the activity of NIN or NLP proteins, thereby promoting root nodule formation by modifying the genetic makeup of plants.
This approach fully complements NIN mutant plants, leading to increased root nodule formation and improved symbiotic relationships with nitrogen-fixing bacteria, enhancing plant nutrition and growth.
Smart Images
Figure 2025013892000001_ABST
Abstract
Description
Detailed Description of the Invention
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 62 / 776,325, filed December 6, 2018, which is incorporated by reference herein in its entirety.
[0002] [Publishing sequence listing as an ASCII text file] The contents of the following submissions regarding ASCII text files are incorporated herein by reference in their entirety: Computer-readable form (CRF) of the sequence listing (file name: 794542000540SEQLIST.TXT, date of recording: November 25, 2019, size: 3,802KB).
[0003] [Technical field] The present disclosure relates to genetically modified plants. In particular, the present disclosure relates to plants having NODULE INCEPTION (NIN) and NIN-LIKE PROTEIN (NLP) genes, which are genetically modified to respond to cytokinins such that the NIN or NLP protein can induce root nodule formation upon appropriate signaling.
[0004] 〔background〕 Nodule-forming plant species, such as legumes, Parasponia spp., and actinorhizal plants, have evolved to form symbiotic relationships with nitrogen-fixing bacteria. They form specialized organs called nodules to house these bacteria. The nodules provide an optimal environment for the bacteria to fix nitrogen and provide it to the plant. The plant, in turn, provides the bacteria with carbohydrates and other resources. The first step in nodule formation is the recognition of the presence of symbiotic bacteria, for example by detection of lipo-chitooligosaccharides (also known as Nod factors in the case of rhizobia) produced by the bacteria. Recognition of such symbiotic signals induces nodule organogenesis, allowing bacterial infection.
[0005] Genetic screens have identified genes involved in the nodule organogenesis process. Chief among these is the transcription factor NODULE INCEPTION (NIN), which has been shown to have a key role in nodule organogenesis across multiple plant species such as legumes and Casuarina glauca (Clavijo et al., New Phytol. 208: 887-903 (2015)). Although the essential role of NIN has long been known, attempts to complement nin mutant plants have consistently failed. This is evidenced by many examples in the literature. Clavijo et al. used the 2175 bp Medicago truncatula NIN promoter and reported that "Unfortunately, even with the ProMtNIN:MtNIN construct, it was not possible to complement the nin mutant of M. truncatula for infection" (Clavijo et al., New Phytol. 208: 887-903 (2015); cited from pg.898). In characterizing the daphne mutant of Lotus japonicus, Yoro et al. stated that "NIN is a key transcription factor in nodule development, but the functional NIN promoter region required for nodule organogenesis remains to be characterized" and opined that "Only IT formation, but not nodule formation, was rescued in the L. japonicus nin-9 mutant by introduction of the L. japonicus -based construct, ProNIN(~4kb)::NIN::TerNIN." (Quoted from Yoro et al., Plant Physiol. 165:747-758 (2014);pg.756). Finally, Vernie et al. found that expression of M. truncatula NIN using the 2.18 kb MtNIN promoter was only able to partially complement a M. truncatula nin null mutant, which when transformed produced very low numbers of non-functional nodules for a long period (50 days) after inoculation (Vernie et al., The Plant Cell, 27:3410-3424 (2015)).
[0006] The inability to complement legume nin mutant plants implies that the exact mechanism of NIN involvement in organogenesis remains to be elucidated, as key components of NIN regulation and its integration with the nodule organogenesis process were unknown. More importantly, successful nodule engineering methods require the incorporation of NIN, as NIN is a key player in nodule organogenesis. The failure to complement nin mutants over the past two decades has been a major obstacle in developing nodule engineering strategies. Successful nodule formation will require the ability to complement nin mutants, and the knowledge of NIN regulation that accompanies that ability. There is a clear need to identify NIN regulatory regions that, when combined with the NIN coding sequence, would allow full complementation of nin mutants.
[0007] 〔overview〕 To meet these needs, the present disclosure provides a means to fully complement nin mutants in legumes by introduction of a cytokinin responsive element into a regulatory region operably linked to the NIN coding sequence. The present disclosure further provides a means to introduce a cytokinin responsive element into a plant operably linked to a NIN or NLP coding sequence, which may be endogenous or heterologous.
[0008] One aspect of the disclosure includes a genetically modified plant, the plant or part thereof comprising one or more genetic modifications that increase the activity of a NODULE INCEPTION (NIN) protein or a NIN-like protein (NLP protein) in response to cytokinin signaling, compared to a wild-type (WT) plant that does not have the one or more genetic modifications, and the plant or part thereof comprises a nucleic acid encoding an NIN protein or an NLP protein. Further embodiments of this aspect include one or more genetic modifications that are the addition of one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more, twenty-one or more, twenty-two or more, twenty-three or more, twenty-four or more cytokinin response elements operably linked to the nucleic acid encoding the NIN protein or the NLP protein. Yet another embodiment of this aspect includes at least one cytokinin response element that is a type B cytokinin signaling response regulator (RR) binding site. Further embodiments of this aspect include at least one type B cytokinin signaling RR binding site having the sequence of SEQ ID NO:613 or SEQ ID NO:614.Yet another embodiment of this aspect is SEQ ID NO:551, SEQ ID NO:552, SEQ ID NO:553, SEQ ID NO:554, SEQ ID NO:555, SEQ ID NO:556, SEQ ID NO:557, SEQ ID NO:558, SEQ ID NO:559, SEQ ID NO:560, SEQ ID NO:561, SEQ ID NO:562, SEQ ID NO:563, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569, SEQ ID NO:570, SEQ ID NO:571, SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:574, SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, and at least one type B cytokinin signaling RR binding site having a sequence selected from the group of: SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO:599, SEQ ID NO:600, SEQ ID NO:601, SEQ ID NO:602, SEQ ID NO:603, SEQ ID NO:604, SEQ ID NO:605, SEQ ID NO:606, SEQ ID NO:607, SEQ ID NO:608, SEQ ID NO:609, SEQ ID NO:610, SEQ ID NO:611, SEQ ID NO:612, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:623, SEQ ID NO:624, SEQ ID NO:625 or SEQ ID NO:626.
[0009] In yet another embodiment that can be combined with any of the previous embodiments, the cytokinin response elements are within 100 nucleotides, 90 nucleotides, 86 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides, 40 nucleotides, 30 nucleotides, 25 nucleotides, 20 nucleotides, 19 nucleotides, 18 nucleotides, 17 nucleotides, 16 nucleotides, 15 nucleotides, 14 nucleotides, 13 nucleotides, 12 nucleotides, 11 nucleotides, 10 nucleotides, 9 nucleotides, 8 nucleotides, 7 nucleotides, or 6 nucleotides of each other. In a further embodiment of this aspect, the cytokinin response elements are within 11 nucleotides of each other. In yet another embodiment that can be combined with any of the previous embodiments, the nucleic acid encoding the NIN protein or NLP protein is operably linked to a promoter that is operably linked to a cytokinin response element. In further embodiments of this aspect, the promoter and the cytokinin response element are within 60,000, 55,000, 50,000, 45,000, 42,000, 40,000, 35,000, 30,000, 25,000, 20,000, 15,000, 10,000, 9,000, 8,000, 7,000, 6,000, 5,000, 4,000, 3,000, 2,000, 1,000, 500, 400, 300, 200, or 100 nucleotides of each other.
[0010] Further embodiments of this aspect, which may be combined with any of the preceding embodiments, include nucleic acids encoding NIN / NLP1 orthogroup proteins. Further embodiments of this aspect include SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33 , SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, 66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:99, No. 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150,SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, Sequence number 179, sequence number 180, sequence number 181, sequence number 182, sequence number 183, sequence number 184, sequence number 185, sequence number 186, sequence number 187, sequence number 188, sequence number 189, sequence number 190, sequence number 191, sequence number 192, sequence number 193, sequence number 194, sequence number 196, sequence number 197, sequence number 198, sequence number 199, sequence number 200, sequence number 201, sequence number 202, sequence number 203, sequence number 204, sequence number 205, sequence number 206, sequence number No. 207, SEQ ID NO: 208, SEQ ID NO: 209, SEQ ID NO: 210, SEQ ID NO: 211, SEQ ID NO: 212, SEQ ID NO: 213, SEQ ID NO: 214, SEQ ID NO: 215, SEQ ID NO: 216, SEQ ID NO: 217, SEQ ID NO: 218, SEQ ID NO: 219, SEQ ID NO: 220, SEQ ID NO: 221, SEQ ID NO: 222, SEQ ID NO: 223, SEQ ID NO: 224, SEQ ID NO: 225, SEQ ID NO: 226, SEQ ID NO: 227, SEQ ID NO: 228, SEQ ID NO: 229, SEQ ID NO: 230, SEQ ID NO: 231, SEQ ID NO: 232, SEQ ID NO: 233, SEQ ID NO: 2 34, SEQ ID NO:235, and SEQ ID NO:236. A further embodiment of this aspect is an NIN protein, comprising an NIN / NLP1 orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:22 (i.e., CsaNIN; Cannabis sativa), SEQ ID NO:78 (i.e., HluNIN; Humulus lupulus), SEQ ID NO:89 (i.e.,LjNIN; Lotus japonicus), SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula), SEQ ID NO:136 (i.e., PanNIN; Parasponia andersonii), SEQ ID NO:139 (i.e., PriNiN; Parasponia rigida), SEQ ID NO:142 (i.e., PruNIN; Parasponia rugosa), SEQ ID NO:185 (i.e., TleNIN; Trema levigata), SEQ ID NO:187 (i.e., TorNIN; Trema orientalis), SEQ ID NO:190 (i.e., TtoNIN; Trema tomentosa), and SEQ ID NO:236 (i.e., ZjuNIN; Ziziphus jujuba), NIN / NLP1 orthogroup proteins having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of: Yet another embodiment of this aspect is a NIN protein, including a NIN / NLP1 orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group of SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus) or SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula).
[0011] Further embodiments of this aspect can be combined with any of the preceding embodiments having a genetically modified plant comprising a nucleic acid encoding an NLP2-3 orthogroup protein, an NLP4 orthogroup protein, or a basal NIN / NLP orthogroup protein. Further embodiments of this aspect include SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264, SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267, SEQ ID NO:268, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:272, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:275, SEQ ID NO:276, SEQ ID NO:277, SEQ ID NO:278, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:286, SEQ ID NO:287, S No. 264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO: 268, SEQ ID NO: 269, SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO: 2 92, SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:31 9, SEQ ID NO:320, SEQ ID NO:321, SEQ ID NO:322, SEQ ID NO:323, SEQ ID NO:324, SEQ ID NO:325, SEQ ID NO:326, SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:332, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348,SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351, SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361, SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO: The present invention also includes an NLP2-3 orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:376 and SEQ ID NO:377. Further embodiments of this aspect include SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:432, SEQ ID NO:433, SEQ ID NO:434, SEQ ID NO:435, SEQ ID NO:436, SEQ ID NO:437, SEQ ID NO:438, SEQ ID NO:439, SEQ ID NO:440, SEQ ID NO:441, SEQ ID NO:442, SEQ ID NO:443, SEQ ID NO:444, SEQ ID NO:445, SEQ ID NO:446, SEQ ID NO:447, SEQ ID NO:448, SEQ ID NO:449,SEQ ID NO:450, SEQ ID NO:451, SEQ ID NO:452, SEQ ID NO:453, SEQ ID NO:455, SEQ ID NO:456, SEQ ID NO:457, SEQ ID NO:458, SEQ ID NO:459, SEQ ID NO:460, SEQ ID NO:461, SEQ ID NO:462, SEQ ID NO:463, SEQ ID NO:464, SEQ ID NO:465, SEQ ID NO:466, SEQ ID NO:467, SEQ ID NO:468, SEQ ID NO:469, SEQ ID NO:470, SEQ ID NO:471, SEQ ID NO:472, SEQ ID NO:473, SEQ ID NO:474, SEQ ID NO:475, SEQ ID NO:476, SEQ ID NO:477, SEQ ID NO:478, SEQ ID NO:479, SEQ ID NO:480, SEQ ID NO:481, SEQ ID NO:482, SEQ ID NO:483, SEQ ID NO:484, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:487, SEQ ID NO:488, SEQ ID NO:489, SEQ ID NO:490, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:493, SEQ ID NO:494, SEQ ID NO:495, SEQ ID NO:496, SEQ ID NO:497, SEQ ID NO:498, SEQ ID NO:499 , SEQ ID NO:500, SEQ ID NO:501, SEQ ID NO:502, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ ID NO:523, and SEQ ID NO:524. Further embodiments of this aspect include SEQ ID NO:637, SEQ ID NO:638, SEQ ID NO:639, SEQ ID NO:640, SEQ ID NO:641, SEQ ID NO:642, SEQ ID NO:643, SEQ ID NO:644, SEQ ID NO:645, SEQ ID NO:646, SEQ ID NO:647, SEQ ID NO:648, SEQ ID NO:649, SEQ ID NO:650, SEQ ID NO:651, SEQ ID NO:652, SEQ ID NO:653, SEQ ID NO:654, SEQ ID NO:655, SEQ ID NO:656, SEQ ID NO:657, SEQ ID NO:658, SEQ ID NO:659, SEQ ID NO:660,The present invention also includes a proximal NIN / NLP orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group of SEQ ID NO:661 or SEQ ID NO:662.
[0012] In yet another embodiment that can be combined with any of the previous embodiments, the nucleic acid encoding the NIN protein or NLP protein is endogenous. Yet another embodiment of this aspect can be combined with any of the previous embodiments and includes a nucleic acid encoding the NIN protein or NLP protein that is heterologous. Yet another embodiment of this aspect can be combined with any of the previous aspects having a nucleic acid encoding the NIN protein or NLP protein operably linked to a promoter and includes a promoter that is endogenous. Yet another embodiment of this aspect can be combined with any of the previous aspects having a nucleic acid encoding the NIN protein or NLP protein operably linked to a promoter and includes a promoter that is heterologous.
[0013] In yet another embodiment that can be combined with any of the preceding embodiments, induction of cytokinin signaling or the cytokinin signaling pathway in the root endothelium cell layer, the root endodermis cell layer (i.e., the endodermis cell layer), the root cortex cell layer (i.e., the cortex cell layer), and / or the root epidermis cell layer (i.e., the epidermis cell layer) induces root nodule organogenesis. Yet another embodiment of this aspect can be combined with any of the preceding embodiments and further comprises one or more CYCLOPS response elements operably linked to the nucleic acid. A further embodiment of this aspect comprises CYCLOPS expression in the root epidermis cell layer (i.e., the epidermis cell layer) to induce rhizobia infection.
[0014] In further embodiments that can be combined with any of the previous embodiments, the genetically modified plant is a monocotyledonous plant. Further embodiments of this aspect include a genetically modified plant selected from the group of corn, rice, wheat, barley, sorghum, millet, oat, or rye. Yet another embodiment of this aspect can be combined with any of the previous embodiments and further includes a genetically modified plant selected from the group of apple, pear, plum, apricot, peach, almond, walnut, cherry, strawberry, raspberry, blackberry, red currant, blackcurrant, melon, cucumber, pumpkin, squash, grape, hemp, hop, birch, beech, jujube, cassava, poplar, chestnut, citrus, potato, tomato, sweet potato, Trema genus, and Jatropha genus. In yet another embodiment that can be combined with any of the preceding embodiments, the WT plant is not a legume and does not form nodules for symbiosis with nitrogen fixing bacteria, or both are not legumes and do not form nodules for symbiosis with nitrogen fixing bacteria.
[0015] Further embodiments of this aspect may be combined with any of the preceding embodiments and include, with respect to the plant part, a genetically modified plant part of any one of the preceding embodiments, the plant part being a leaf, stem, root, tuber, flower, seed, kernel, grain, fruit, cell, or part thereof, the genetically modified plant part comprising one or more genetic modifications. Further embodiments of this aspect include the plant part being a fruit, tuber, kernel, or grain. Further embodiments of this aspect may be combined with any of the preceding embodiments with respect to the pollen grain or ovule, the genetically modified pollen grain or genetically modified ovule of the plant of any one of the preceding embodiments, the genetically modified pollen grain or genetically modified ovule comprising one or more genetic modifications. Further embodiments of this aspect may be combined with any of the preceding embodiments and include a genetically modified protoplast produced from the genetically modified plant of any of the preceding embodiments, the genetically modified protoplast comprising one or more genetic modifications. Further embodiments of this aspect may be combined with any of the previous embodiments and include a genetically modified tissue culture produced from a protoplast or cell from a genetically modified plant of any one of the previous embodiments, wherein the cell or protoplast is made from a plant part selected from the group of leaves, mesophyll cells, anthers, pistils, stems, petioles, roots, root tips, tubers, fruits, seeds, kernels, grain flowers, cotyledons, hypocotyls, embryos, or meristematic cells, and the genetically modified tissue culture comprises one or more genetic modifications. Further embodiments of this aspect include a genetically modified plant regenerated from a genetically modified tissue culture comprising one or more genetic modifications. Yet another embodiment of this aspect, which may be combined with any of the previous embodiments having a genetically modified plant, includes a genetically modified plant having all the physiological and morphological characteristics of the plant of any of the previous embodiments. Yet another embodiment of this aspect, which may be combined with any of the previous embodiments having a genetically modified plant, includes a genetically modified plant seed produced from a genetically modified plant of any one of the previous embodiments.Further embodiments of this aspect include seeds of plants that can be combined with any of the previous embodiments having genetically modified plants to produce plants having all the physiological and morphological characteristics of the plants of any of the previous embodiments.
[0016] Further aspects of the present disclosure include a method for producing a genetically modified plant of any of the above-mentioned embodiments having a genetically modified plant. The method includes (a) introducing one or more genetic modifications into a plant cell, tissue, or other explant; (b) regenerating the genetically modified plantlet from the plant cell, tissue, or other explant into a genetically modified plantlet; and (c) growing the genetically modified plantlet into a genetically modified plant having one or more genetic modifications that increase the activity of an NIN protein or an NLP protein in response to cytokinin signaling compared to an untransformed WT plant. Further embodiments of this aspect further include confirming successful introduction of the one or more genetic modifications by screening or selecting the plant cell, tissue, or other explant before step (b), screening or selecting the plantlet between steps (b) and (c), or screening or selecting the plant after step (c). In yet another embodiment that may be combined with any of the preceding embodiments, the transformation is carried out using a transformation method selected from the group of particle bombardment (i.e. biolistic, gene gun), Agrobacterium-mediated transformation, Rhizobium-mediated transformation, or transfection or transformation of protoplasts.
[0017] Yet another embodiment of this aspect can be combined with any of the previous embodiments and includes a genetic modification introduced using a vector. A further embodiment of this aspect encompasses a vector comprising a promoter operably linked to a nucleotide encoding an NIN or NLP protein and one or more cytokinin response elements operably linked to the promoter. Yet another embodiment of this aspect comprises a promoter and one or more cytokinin response elements selected from the group of: an NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS binding box to the transcription start site of the NIN gene operably linked to a 3C region, an NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS binding box to the transcription start site of the NIN gene operably linked to a CE region, a minimal promoter operably linked to a CYCLOPS binding box operably linked to a CE region, and a minimal promoter operably linked to a CYCLOPS binding box operably linked to one or more cytokinin response elements. In a further embodiment of this aspect, the vector comprises one or more gene editing components that target a nuclear genome sequence operably linked to an endogenous NIN protein or NLP protein. Yet another embodiment of this aspect includes a nuclear genome sequence that is edited by one or more gene editing components to introduce a cis-regulatory element selected from the group of one or more cytokinin response elements, 3C regions, or CE regions. Yet another embodiment of this aspect can be combined with any of the above-mentioned aspects having a vector that includes one or more gene editing components, and includes one or more gene editing components selected from the group of a ribonucleoprotein complex that targets a nuclear genome sequence; a vector that includes a sequence that encodes a TALEN protein (wherein the TALEN protein targets a nuclear genome sequence); a vector that includes a sequence that encodes a ZFN protein (wherein the ZFN protein targets a nuclear genome sequence); an oligonucleotide donor (ODN) (wherein the ODN targets a nuclear genome sequence); or a vector that includes a sequence that encodes a CRISPR / Cas enzyme and a target sequence (wherein the target sequence targets a nuclear genome sequence).
[0018] Further embodiments of this aspect can be combined with any of the preceding aspects having a genetic modification introduced using a vector, comprising a NIN gene promoter, a 3C region, a CE region, a CYCLOPS binding box, or one or more cytokinin response elements from a nodulating legume species. Further embodiments of this aspect include a nodulating legume species selected from the group of peanut, pigeon pea, chickpea, soybean, mucuna pruriens, bean, pea, adzuki bean, snap bean, clover, lupine, Lotus japonicus, and Medicago truncatula. Further embodiments of this aspect may be combined with any of the previously described aspects having a genetic modification introduced using a vector comprising a NIN gene promoter, a 3C region, a CE region, a CYCLOPS binding box, or one or more cytokinin response elements derived from a nodulating legume species, and include SEQ ID NO:551, SEQ ID NO:552, SEQ ID NO:553, SEQ ID NO:554, SEQ ID NO:555, SEQ ID NO:556, SEQ ID NO:557, SEQ ID NO:558, SEQ ID NO:559, SEQ ID NO:560, SEQ ID NO:561, SEQ ID NO:562, SEQ ID NO:563, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569, SEQ ID NO:570, SEQ ID NO:571, SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:574, The cytokinin response element comprises a cytokinin response element selected from the group of SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO:599, SEQ ID NO:600, SEQ ID NO:601, SEQ ID NO:602, SEQ ID NO:603, SEQ ID NO:604, SEQ ID NO:605, SEQ ID NO:606, SEQ ID NO:607, SEQ ID NO:608, SEQ ID NO:609, SEQ ID NO:610, SEQ ID NO:611 or SEQ ID NO:612.Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, comprising a cytokinin response element selected from the group of SEQ ID NO:613, SEQ ID NO:614, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:623, SEQ ID NO:624, SEQ ID NO:625, and SEQ ID NO:626.
[0019] Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, and include NIN / NLP1 orthogroup proteins and selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, No. 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, 98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151,SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179 , SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, 7, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, 34, SEQ ID NO: 235, and SEQ ID NO: 236. Yet another embodiment of this aspect can be combined with any of the preceding aspects having a genetic modification introduced using a vector, and is an NIN protein and is SEQ ID NO: 22 (i.e., CsaNIN; Cannabis, sativa), SEQ ID NO:78 (i.e., HluNIN; Humulus lupulus), SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus), SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula), SEQ ID NO:136 (i.e., PanNIN; Parasponia andersonii), SEQ ID NO:139 (i.e., PriNIN; Parasponia rigida), SEQ ID NO:142 (i.e., PruNIN; Parasponia rugosa), SEQ ID NO:185 (i.e., TleNIN; Trema levigata), SEQ ID NO:187 (i.e., TorNIN; Trema orientalis), SEQ ID NO:190 (i.e., TtoNIN; Trema tomentosa), and SEQ ID NO:236 (i.e., ZjuNIN; Ziziphus jujuba), NIN / NLP1 orthogroup proteins having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of: Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, and include an NIN protein and an NIN / NLP1 orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group of SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus) or SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula). Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, andNLP2-3 orthogroup proteins, and SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264, SEQ ID NO:265, SEQ ID NO:266, No. 267, No. 268, No. 269, No. 270, No. 271, No. 273, No. 274, No. 275, No. 276, No. 277, No. 278, No. 279, No. 280, No. 281, No. 282, No. 283, No. 284, No. 285, No. 286, No. 287, No. 288, No. 289, No. 290, No. 291, No. 292, No. 293, No. 294, No. 295, No. 296, No. 297, No. 298, 299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO:321, SEQ ID NO:322, SEQ ID NO:323, SEQ ID NO:324, SEQ ID NO:325, SEQ ID NO:326, SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:33 2, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348, SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351, SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361, SEQ ID NO:362, SEQ ID NO:363,The present invention includes a NIN or NLP protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO:376, and SEQ ID NO:377. Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the genetic modification being an NLP4 orthogroup protein and comprising SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, No. 412, SEQ ID NO: 413, SEQ ID NO: 414, SEQ ID NO: 415, SEQ ID NO: 417, SEQ ID NO: 418, SEQ ID NO: 419, SEQ ID NO: 420, SEQ ID NO: 421, SEQ ID NO: 422, SEQ ID NO: 423, SEQ ID NO: 424, SEQ ID NO: 425, SEQ ID NO: 426, SEQ ID NO: 427, SEQ ID NO: 428, SEQ ID NO: 429, SEQ ID NO: 430, SEQ ID NO: 431, SEQ ID NO: 432, SEQ ID NO: 433, SEQ ID NO: 434, SEQ ID NO: 435, SEQ ID NO: 436, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 439, SEQ ID NO: 440, SEQ ID NO: 441, SEQ ID NO: 442, SEQ ID NO: 443, SEQ ID NO: 444, SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 450, SEQ ID NO: 451, SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 455, SEQ ID NO: 456, SEQ ID NO: 457,SEQ ID NO:458, SEQ ID NO:459, SEQ ID NO:460, SEQ ID NO:461, SEQ ID NO:462, SEQ ID NO:463, SEQ ID NO:464, SEQ ID NO:465, SEQ ID NO:466, SEQ ID NO:467, SEQ ID NO:468, SEQ ID NO:469, SEQ ID NO:470, SEQ ID NO:471, SEQ ID NO:472, SEQ ID NO:473, SEQ ID NO:474, SEQ ID NO:475, SEQ ID NO:476, SEQ ID NO:477, No. 478, SEQ ID NO. 479, SEQ ID NO. 480, SEQ ID NO. 481, SEQ ID NO. 482, SEQ ID NO. 483, SEQ ID NO. 484, SEQ ID NO. 485, SEQ ID NO. 486, SEQ ID NO. 487, SEQ ID NO. 488, SEQ ID NO. 489, SEQ ID NO. 490, SEQ ID NO. 491, SEQ ID NO. 492, SEQ ID NO. 493, SEQ ID NO. 494, SEQ ID NO. 495, SEQ ID NO. 496, SEQ ID NO. 497, SEQ ID NO. 498, SEQ ID NO. 499, SEQ ID NO. 500, SEQ ID NO. 501, SEQ ID NO. 502, SEQ ID NO. 504, SEQ ID NO. 505, SEQ ID NO. 506, SEQ ID NO. 507, SEQ ID NO. 508, SEQ ID NO. 509, SEQ ID NO. 510, SEQ ID NO. 511, SEQ ID NO. 512, SEQ ID NO. 513, SEQ ID NO. The present invention also includes a NIN or NLP protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ ID NO:523, and SEQ ID NO:524.Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the proximal NIN / NLP orthogroup protein and comprising SEQ ID NO:637, SEQ ID NO:638, SEQ ID NO:639, SEQ ID NO:640, SEQ ID NO:641, SEQ ID NO:642, SEQ ID NO:643, SEQ ID NO:644, SEQ ID NO:645, SEQ ID NO:646, SEQ ID NO:647, SEQ ID NO:648, SEQ ID NO:649, SEQ ID NO:650, SEQ ID NO:651, SEQ ID NO:652, SEQ ID NO:653, SEQ ID NO:654, SEQ ID NO:655, SEQ ID NO:656, The present invention includes an NIN or NLP protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:657, SEQ ID NO:658, SEQ ID NO:659, SEQ ID NO:660, SEQ ID NO:661, or SEQ ID NO:662.
[0020] Further aspects of the present disclosure include a method of cultivating a genetically modified plant of any of the aforementioned embodiments having a genetically modified plant, the method comprising planting a genetically modified seedling, a genetically modified plantlet, a genetically modified cutting, a genetically modified tuber, a genetically modified root, or a genetically modified seed in soil to produce a genetically modified plant, or grafting the genetically modified seedling, the genetically modified plantlet, or the genetically modified cutting to a root stock or a second plant grown in soil to produce a genetically modified plant; cultivating the harvestable seed, the harvestable leaf, the harvestable root, the harvestable cutting, the harvestable tree, the harvestable fruit, the harvestable kernels, the harvestable tuber, and / or the harvestable grain; and harvesting the harvestable seed, the harvestable leaf, the harvestable root, the harvestable cutting, the harvestable tree, the harvestable fruit, the harvestable kernels, the harvestable tuber, and / or the harvestable grain.
[0021] One aspect of the disclosure includes a genetically modified plant, the plant or part thereof comprising one or more genetic modifications that increase the activity of a NODULE INCEPTION (NIN) protein or a NIN-like protein (NLP protein) in response to cytokinin signaling, compared to a wild-type (WT) plant that does not have the one or more genetic modifications, and the plant or part thereof comprises a nucleic acid encoding the NIN protein or NLP protein. Further embodiments of this aspect include one or more genetic modifications that are the addition of one or more, two or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more, twenty-one or more, twenty-two or more, twenty-three or more, twenty-four or more cytokinin response elements operably linked to the nucleic acid encoding the NIN protein or NLP protein. Yet another embodiment of this aspect includes at least one cytokinin response element that is a type B cytokinin signaling response regulator (RR) binding site. Further embodiments of this aspect include at least one type B cytokinin signaling RR binding site having a sequence of SEQ ID NO:613 or SEQ ID NO:614. Yet another embodiment of this aspect includes at least one type B cytokinin signaling RR binding site having a sequence of SEQ ID NO:679, SEQ ID NO:680, SEQ ID NO:681, SEQ ID NO:682, SEQ ID NO:683, SEQ ID NO:684, SEQ ID NO:685, or SEQ ID NO:686.Yet another embodiment of this aspect is SEQ ID NO:551, SEQ ID NO:552, SEQ ID NO:553, SEQ ID NO:554, SEQ ID NO:555, SEQ ID NO:556, SEQ ID NO:557, SEQ ID NO:558, SEQ ID NO:559, SEQ ID NO:560, SEQ ID NO:561, SEQ ID NO:562, SEQ ID NO:563, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569, SEQ ID NO:570, SEQ ID NO:571, SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:574, SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, and at least one type B cytokinin signaling RR binding site having a sequence selected from the group of: SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO:599, SEQ ID NO:600, SEQ ID NO:601, SEQ ID NO:602, SEQ ID NO:603, SEQ ID NO:604, SEQ ID NO:605, SEQ ID NO:606, SEQ ID NO:607, SEQ ID NO:608, SEQ ID NO:609, SEQ ID NO:610, SEQ ID NO:611, SEQ ID NO:612, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:623, SEQ ID NO:624, SEQ ID NO:625, SEQ ID NO:626, SEQ ID NO:679, SEQ ID NO:680, SEQ ID NO:681, SEQ ID NO:682, SEQ ID NO:683, SEQ ID NO:684, SEQ ID NO:685 or SEQ ID NO:686.
[0022] In yet another embodiment that can be combined with any of the previous embodiments, the cytokinin response elements are within 100 nucleotides, 90 nucleotides, 86 nucleotides, 80 nucleotides, 70 nucleotides, 60 nucleotides, 50 nucleotides, 40 nucleotides, 30 nucleotides, 25 nucleotides, 20 nucleotides, 19 nucleotides, 18 nucleotides, 17 nucleotides, 16 nucleotides, 15 nucleotides, 14 nucleotides, 13 nucleotides, 12 nucleotides, 11 nucleotides, 10 nucleotides, 9 nucleotides, 8 nucleotides, 7 nucleotides, 6 nucleotides, 5 nucleotides, 4 nucleotides, 3 nucleotides, 2 nucleotides, or 1 nucleotide of each other.In a further embodiment of this aspect, the cytokinin response elements are within 11 nucleotides of each other.In yet another embodiment that can be combined with any of the previous embodiments, the nucleic acid encoding the NIN protein or NLP protein is operably linked to a promoter that is operably linked to the cytokinin response element.In further embodiments of this aspect, the promoter and the cytokinin responsive element are within 110,000 nucleotides, 105,000 nucleotides, 100,000 nucleotides, 95,000 nucleotides, 90,000 nucleotides, 85,000 nucleotides, 80,000 nucleotides, 75,000 nucleotides, 70,000 nucleotides, 65,000 nucleotides, 60,000 nucleotides, 55,000 nucleotides, 50,000 nucleotides, 45,000 nucleotides, 42,000 nucleotides, 40,000 nucleotides, or 50,000 nucleotides. The length of the sequence is within 1 nucleotide, 35,000 nucleotides, 30,000 nucleotides, 25,000 nucleotides, 20,000 nucleotides, 15,000 nucleotides, 10,000 nucleotides, 9,000 nucleotides, 8,000 nucleotides, 7,000 nucleotides, 6,000 nucleotides, 5,000 nucleotides, 4,000 nucleotides, 3,000 nucleotides, 2,000 nucleotides, 1,000 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, or 100 nucleotides.
[0023] Further embodiments of this aspect, which may be combined with any of the preceding embodiments, include nucleic acids encoding NIN / NLP1 orthogroup proteins. Further embodiments of this aspect include nucleic acids encoding SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO: Column number 34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, Column number 67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151,SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181 1, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, 211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:687, SEQ ID NO:688, SEQ ID NO:689, SEQ ID NO:
[0033] The present invention also includes an NIN / NLP1 orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:690, SEQ ID NO:691, SEQ ID NO:692, or SEQ ID NO:693. Further embodiments of this aspect are NIN proteins and include those having SEQ ID NO:22 (i.e., CsaNIN; Cannabis sativa), SEQ ID NO:78 (i.e.,HluNIN; Humulus lupulus), SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus), SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula), SEQ ID NO:136 (i.e., PanNIN; Parasponia andersonii), SEQ ID NO:139 (i.e., PriNiN; Parasponia rigida), SEQ ID NO:142 (i.e., PruNIN; Parasponia rugosa), SEQ ID NO:185 (i.e., TleNIN; Trema, levigata), SEQ ID NO: 187 (i.e. TorNIN; Trema orientalis), SEQ ID NO: 190 (i.e. TtoNIN; Trema tomentosa), SEQ ID NO: 236 (i.e. ZjuNIN; Ziziphus jujuba), SEQ ID NO: 687 (i.e. AglNIN; Alnus glutinosa), SEQ ID NO: 688 (i.e. CglNIN; Casuarina glauca), SEQ ID NO: 689 (i.e. DglNIN.1; Datisca glomerata), SEQ ID NO: 690 (i.e. DglNIN.2; Datisca glomerata), SEQ ID NO: 691 (i.e. DtrNIN; Discaria trinervis), SEQ ID NO: 692 (i.e. DdrNIN; Dryas drummondii) or SEQ ID NO: 693 (i.e. PtrNIN; Purshia tridentata) to an amino acid sequence selected from the group consisting of NIN / NLP1 orthogroup proteins having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Yet another embodiment of this aspect includes a NIN / NLP1 orthogroup protein that is a NIN protein and has at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group of SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus) or SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula).
[0024] Yet another embodiment of this aspect can be combined with any of the preceding embodiments having a genetically modified plant comprising a nucleic acid encoding an NLP2-3 orthogroup protein, an NLP4 orthogroup protein, or a proximal NIN / NLP orthogroup protein. Further embodiments of this aspect include SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264, SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267, SEQ ID NO:268, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:272, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:275, SEQ ID NO:276, SEQ ID NO:277, SEQ ID NO:278, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:286, SEQ ID NO:287, No. 264, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO: 268, SEQ ID NO: 269, SEQ ID NO: 270, SEQ ID NO: 271, SEQ ID NO: 273, SEQ ID NO: 274, SEQ ID NO: 275, SEQ ID NO: 276, SEQ ID NO: 277, SEQ ID NO: 278, SEQ ID NO: 279, SEQ ID NO: 280, SEQ ID NO: 281, SEQ ID NO: 282, SEQ ID NO: 283, SEQ ID NO: 284, SEQ ID NO: 285, SEQ ID NO: 286, SEQ ID NO: 287, SEQ ID NO: 288, SEQ ID NO: 289, SEQ ID NO: 290, SEQ ID NO: 291, SEQ ID NO: 2 92, SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:31 9, SEQ ID NO:320, SEQ ID NO:321, SEQ ID NO:322, SEQ ID NO:323, SEQ ID NO:324, SEQ ID NO:325, SEQ ID NO:326, SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:332, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348,SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351, SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361, SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, 376 and SEQ ID NO: 377, orthogroup proteins having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 376 and SEQ ID NO: 377. Further embodiments of this aspect include SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:432, SEQ ID NO:433, SEQ ID NO:434, SEQ ID NO:435, SEQ ID NO:436, SEQ ID NO:437, SEQ ID NO:438, SEQ ID NO:439, SEQ ID NO:440, SEQ ID NO:441, SEQ ID NO:442, SEQ ID NO:443, SEQ ID NO:444, SEQ ID NO:445, SEQ ID NO:446, SEQ ID NO:447, SEQ ID NO:448, SEQ ID NO:449,SEQ ID NO:450, SEQ ID NO:451, SEQ ID NO:452, SEQ ID NO:453, SEQ ID NO:455, SEQ ID NO:456, SEQ ID NO:457, SEQ ID NO:458, SEQ ID NO:459, SEQ ID NO:460, SEQ ID NO:461, SEQ ID NO:462, SEQ ID NO:463, SEQ ID NO:464, SEQ ID NO:465, SEQ ID NO:466, SEQ ID NO:467, SEQ ID NO:468, SEQ ID NO:469, SEQ ID NO:470, SEQ ID NO:471, SEQ ID NO:472, SEQ ID NO:473, SEQ ID NO:474, SEQ ID NO:475, SEQ ID NO:476, SEQ ID NO:477, SEQ ID NO:478, SEQ ID NO:479, SEQ ID NO:480, SEQ ID NO:481, SEQ ID NO:482, SEQ ID NO:483, SEQ ID NO:484, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:487, SEQ ID NO:488, SEQ ID NO:489, SEQ ID NO:490, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:493, SEQ ID NO:494, SEQ ID NO:495, SEQ ID NO:496, SEQ ID NO:497, SEQ ID NO:498, SEQ ID NO:499 , SEQ ID NO:500, SEQ ID NO:501, SEQ ID NO:502, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ ID NO:523, and SEQ ID NO:524. Further embodiments of this aspect include SEQ ID NO:637, SEQ ID NO:638, SEQ ID NO:639, SEQ ID NO:640, SEQ ID NO:641, SEQ ID NO:642, SEQ ID NO:643, SEQ ID NO:644, SEQ ID NO:645, SEQ ID NO:646, SEQ ID NO:647, SEQ ID NO:648, SEQ ID NO:649, SEQ ID NO:650, SEQ ID NO:651, SEQ ID NO:652, SEQ ID NO:653, SEQ ID NO:654, SEQ ID NO:655, SEQ ID NO:656, SEQ ID NO:657, SEQ ID NO:658, SEQ ID NO:659, SEQ ID NO:660,The present invention includes a proximal NIN / NLP orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group of SEQ ID NO:661 or SEQ ID NO:662.
[0025] In yet another embodiment that can be combined with any of the previous embodiments, the nucleic acid encoding the NIN protein or NLP protein is endogenous. Yet another embodiment of this aspect can be combined with any of the previous embodiments and includes a nucleic acid encoding the NIN protein or NLP protein that is heterologous. Yet another embodiment of this aspect can be combined with any of the previous aspects that have a nucleic acid encoding the NIN protein or NLP protein operably linked to a promoter and includes a promoter that is endogenous. Yet another embodiment of this aspect can be combined with any of the previous aspects that have a nucleic acid encoding the NIN protein or NLP protein operably linked to a promoter and includes a promoter that is heterologous.
[0026] In yet another embodiment that can be combined with any of the preceding embodiments, induction of cytokinin signaling or the cytokinin signaling pathway in the root endothelium cell layer, the root endodermis cell layer (i.e., the endodermis cell layer), the root cortex cell layer (i.e., the cortex cell layer), and / or the root epidermis cell layer (i.e., the epidermis cell layer) induces root nodule organogenesis. Yet another embodiment of this aspect can be combined with any of the preceding embodiments and further comprises one or more CYCLOPS response elements operably linked to the nucleic acid. A further embodiment of this aspect comprises CYCLOPS expression in the root epidermis cell layer (i.e., the epidermis cell layer) to induce rhizobia infection.
[0027] In further embodiments that can be combined with any of the above-mentioned embodiments, the genetically modified plant is a monocotyledonous plant. Further embodiments of this aspect include a genetically modified plant selected from the group of corn, rice, wheat, barley, sorghum, millet, oat, or rye. Yet another embodiment of this aspect can be combined with any of the above-mentioned embodiments and further includes a genetically modified plant selected from the group of apple, pear, plum, apricot, peach, almond, walnut, cherry, strawberry, raspberry, blackberry, red currant, blackcurrant, melon, cucumber, pumpkin, squash, grape, hemp, hop, birch, beech, jujube, cassava, poplar, chestnut, citrus, potato, tomato, sweet potato, Trema genus, and Jatropha genus. In yet another embodiment that can be combined with any of the preceding embodiments, the WT plant is not a legume and does not form nodules for symbiosis with nitrogen fixing bacteria, or both are not legumes and do not form nodules for symbiosis with nitrogen fixing bacteria.
[0028] Further embodiments of this aspect may be combined with any of the preceding embodiments and include a genetically modified plant part of a genetically modified plant of any of the preceding embodiments with respect to the plant part, the plant part being a leaf, stem, root, tuber, flower, seed, kernel, grain, fruit, cell, or part thereof, and the genetically modified plant part comprises one or more genetic modifications. Further embodiments of this aspect include a plant part that is a fruit, tuber, kernel, or grain. Further embodiments of this aspect may be combined with any of the preceding embodiments with respect to the pollen grain or ovule, and include a genetically modified pollen grain or genetically modified ovule of a plant of any of the preceding embodiments, the genetically modified pollen grain or genetically modified ovule comprising one or more genetic modifications. Further embodiments of this aspect may be combined with any of the preceding embodiments and include a genetically modified protoplast produced from a genetically modified plant of any of the preceding embodiments, the genetically modified protoplast comprising one or more genetic modifications. Further embodiments of this aspect may be combined with any of the previous embodiments and include a genetically modified tissue culture produced from a protoplast or cell derived from a genetically modified plant of any one of the previous embodiments, wherein the cell or protoplast is produced from a plant part selected from the group of leaves, mesophyll cells, anthers, pistils, stems, petioles, roots, root tips, tubers, fruits, seeds, kernels, grains, flowers, cotyledons, hypocotyls, embryos, or meristematic cells, and the genetically modified tissue culture comprises one or more genetic modifications. Further embodiments of this aspect include a genetically modified plant regenerated from a genetically modified tissue culture comprising one or more genetic modifications. Yet another embodiment of this aspect may be combined with any of the previous embodiments having a genetically modified plant and includes a genetically modified plant having all the physiological and morphological characteristics of the plant of any of the previous embodiments. Yet another embodiment of this aspect may be combined with any of the previous embodiments having a genetically modified plant and includes a genetically modified plant seed produced from a genetically modified plant of any one of the previous embodiments.Further embodiments of this aspect include seeds of plants that can be combined with any of the previous embodiments having genetically modified plants to produce plants having all the physiological and morphological characteristics of the plants of any of the previous embodiments.
[0029] Further aspects of the present disclosure include a method of producing a genetically modified plant of any of the preceding embodiments, comprising: (a) introducing one or more genetic modifications into a plant cell, tissue, or other explant; (b) regenerating the plant cell, tissue, or other explant into a genetically modified plantlet; and (c) growing the genetically modified plantlet into a genetically modified plant having one or more genetic modifications that increase the activity of an NIN protein or an NLP protein in response to cytokinin signaling compared to an untransformed WT plant. Further embodiments of this aspect further include confirming successful introduction of the one or more genetic modifications by screening or selecting the plant cell, tissue, or other explant before step (b); screening or selecting the plantlet between steps (b) and (c); or screening or selecting the plant after step (c). In yet another embodiment that may be combined with any of the preceding embodiments, the transformation is carried out using a transformation method selected from the group of particle bombardment (i.e. biolistic, gene gun), Agrobacterium-mediated transformation, Rhizobium-mediated transformation, or transfection or transformation of protoplasts.
[0030] Further embodiments of this aspect can be combined with any of the previous embodiments and include genetic modifications introduced using a vector. Further embodiments of this aspect include a vector comprising a promoter operably linked to a nucleotide encoding an NIN or NLP protein and one or more cytokinin response elements operably linked to the promoter. Further embodiments of this aspect include a promoter and one or more cytokinin response elements, wherein the promoter and one or more cytokinin response elements are selected from the group of: NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element up to the transcription start site of the NIN gene operably linked to the 3C region, NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element through the transcription start site of the NIN gene operably linked to the CE region, a minimal promoter operably linked to a CYCLOPS response element operably linked to the CE region, and a minimal promoter operably linked to a CYCLOPS response element operably linked to one or more cytokinin response elements. In a further embodiment of this aspect, the vector comprises one or more gene editing components that target a nuclear genomic sequence operably linked to an endogenous NIN or NLP protein. Yet another embodiment of this aspect comprises a nuclear genomic sequence that is edited by one or more gene editing components to introduce a cis-regulatory element selected from the group of one or more cytokinin response elements, 3C regions, or CE regions.Yet another embodiment of this aspect can be combined with any of the previous aspects having a vector comprising one or more gene editing components selected from the group of: a ribonucleoprotein complex targeting a nuclear genomic sequence; a vector comprising a sequence encoding a TALEN protein (wherein the TALEN protein targets a nuclear genomic sequence); a vector comprising a sequence encoding a ZFN protein (wherein the ZFN protein targets a nuclear genomic sequence); an oligonucleotide donor (ODN) (wherein the ODN targets a nuclear genomic sequence); or a vector comprising a sequence encoding a CRISPR / Cas enzyme and a target sequence (wherein the target sequence targets a nuclear genomic sequence).
[0031] Further embodiments of this aspect can be combined with any of the preceding aspects having a genetic modification introduced using a vector, comprising a NIN gene promoter, a 3C region, a CE region, a CYCLOPS response element, or one or more cytokinin response elements from a nodulating legume species. Further embodiments of this aspect include a nodulating legume species selected from the group of peanut, pigeon pea, chickpea, soybean, mucuna pruriens, bean, pea, adzuki bean, snap bean, clover, lupine, Lotus japonicus, and Medicago truncatula. Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the vector comprising a NIN gene promoter, a 3C region, a CE region, a CYCLOPS response element, or one or more cytokinin response elements from a nodulating legume species, and comprising SEQ ID NO:551, SEQ ID NO:552, SEQ ID NO:553, SEQ ID NO:554, SEQ ID NO:555, SEQ ID NO:556, SEQ ID NO:557, SEQ ID NO:558, SEQ ID NO:559, SEQ ID NO:560, SEQ ID NO:561, SEQ ID NO:562, SEQ ID NO:563, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569, SEQ ID NO:570, SEQ ID NO:571, SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:574, SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO 74, SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO:599, SEQ ID NO:600, SEQ ID NO:601, SEQ ID NO:602, SEQ ID NO:603, SEQ ID NO:604, SEQ ID NO:605, SEQ ID NO:606, SEQ ID NO:607, SEQ ID NO:608, SEQ ID NO:609, SEQ ID NO:610, SEQ ID NO:611, or SEQ ID NO:612.Yet another embodiment of this aspect can be combined with any of the previous aspects having a genetic modification introduced by a vector and includes a cytokinin response element selected from the group of SEQ ID NO: 613, SEQ ID NO: 614, SEQ ID NO: 615, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623, SEQ ID NO: 624, SEQ ID NO: 625, or SEQ ID NO: 626. Yet another embodiment of this aspect can be combined with any of the previous aspects having a genetic modification introduced by a vector and includes one or more cytokinin response elements from a non-nodulating species. In yet another embodiment of this aspect that can be combined with any of the previous aspects having a genetic modification introduced by a vector, the one or more cytokinin response elements from a non-nodulating species are SEQ ID NO: 613. A further embodiment of this aspect can be combined with any of the previous aspects having a genetic modification introduced by a vector and includes one or more cytokinin response elements from a non-nodulating legume species. Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector and comprising a cytokinin response element selected from the group of SEQ ID NO:613, SEQ ID NO:614, SEQ ID NO:679, SEQ ID NO:680, SEQ ID NO:681, SEQ ID NO:682, SEQ ID NO:683, SEQ ID NO:684, SEQ ID NO:685, or SEQ ID NO:686.
[0032] Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the genetic modification being an NIN / NLP1 orthogroup protein and comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO: 26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, Column number 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97 8, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151,SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:1 81, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO: No. 211, SEQ ID NO. 212, SEQ ID NO. 213, SEQ ID NO. 214, SEQ ID NO. 215, SEQ ID NO. 216, SEQ ID NO. 217, SEQ ID NO. 218, SEQ ID NO. 219, SEQ ID NO. 220, SEQ ID NO. 221, SEQ ID NO. 222, SEQ ID NO. 223, SEQ ID NO. 224, SEQ ID NO. 225, SEQ ID NO. 226, SEQ ID NO. 227, SEQ ID NO. 228, SEQ ID NO. 229, SEQ ID NO. 230, SEQ ID NO. 231, SEQ ID NO. 232, SEQ ID NO. 233, SEQ ID NO. 234, SEQ ID NO. 235, SEQ ID NO. 236, SEQ ID NO. 687, SEQ ID NO. 688, SEQ ID NO. 689 , SEQ ID NO: 690, SEQ ID NO: 691, SEQ ID NO: 692, or SEQ ID NO: 693. Yet another embodiment of this aspect may be combined with any of the previous aspects having a genetic modification introduced using a vector, and is an NIN protein,and SEQ ID NO:22 (i.e., CsaNIN; Cannabis sativa), SEQ ID NO:78 (i.e., HluNIN; Humulus lupulus), SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus), SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula), SEQ ID NO:136 (i.e., PanNIN; Parasponia andersonii), SEQ ID NO:139 (i.e., PriNIN; Parasponia rigida), SEQ ID NO:142 (i.e., PruNIN; Parasponia rugosa), SEQ ID NO:185 (i.e., TleNIN; Trema, levigata), SEQ ID NO:187 (i.e., TorNIN; Trema orientalis), SEQ ID NO:190 (i.e., TtoNIN; Trema tomentosa), and SEQ ID NO:236 (i.e., ZjuNIN; Ziziphus jujuba), SEQ ID NO:687 (i.e., AglNIN; Alnus glutinosa), SEQ ID NO:688 (i.e., CglNIN; Casuarina glauca), SEQ ID NO:689 (i.e., DglNIN.1; Datisca glomerata), SEQ ID NO:690 (i.e., DglNIN.2; Datisca glomerata), SEQ ID NO:691 (i.e., DtrNIN; Datisca trinervis), SEQ ID NO:692 (i.e., DdrNIN; Dryas drummondii), or SEQ ID NO:693 (i.e., PtrNIN; Purshia tridentata) to an amino acid sequence selected from the group consisting of NIN / NLP1 orthogroup proteins having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Further embodiments of this aspect can be combined with any of the preceding aspects having a genetic modification introduced using a vector, and include a NIN protein and a NIN / NLP1 orthogroup protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group of SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus) or SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula). Yet another embodiment of this aspect is
[0043] This may be combined with any of the preceding aspects having a genetic modification introduced using a vector, which is an NLP2-3 orthogroup protein and is SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, 261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264, SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267, SEQ ID NO:268, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:275, SEQ ID NO:276, SEQ ID NO:277, SEQ ID NO:278, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:286, SEQ ID NO:287, SEQ ID NO:288, SEQ ID NO:289, SEQ ID NO:290, SEQ ID NO:291, SEQ ID NO:292, SEQ ID NO:2 93, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO:321, SEQ ID NO:322, SEQ ID NO:323, SEQ ID NO:32 4, SEQ ID NO:325, SEQ ID NO:326, SEQ ID NO:327, SEQ ID NO:328, SEQ ID NO:329, SEQ ID NO:332, SEQ ID NO:333, SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348, SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351, SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357,The present invention includes a NIN or NLP protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361, SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO:376 and SEQ ID NO:377. Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic change introduced using a vector, the genetic change being an NLP4 orthogroup protein and comprising SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, 00, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:432, SEQ ID NO:433, SEQ ID NO:434, SEQ ID NO: No. 435, SEQ ID NO: 436, SEQ ID NO: 437, SEQ ID NO: 438, SEQ ID NO: 439, SEQ ID NO: 440, SEQ ID NO: 441, SEQ ID NO: 442, SEQ ID NO: 443, SEQ ID NO: 444, SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO: 447, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 450, SEQ ID NO: 451, SEQ ID NO: 452, SEQ ID NO: 453, SEQ ID NO: 455, SEQ ID NO: 456, SEQ ID NO: 457, SEQ ID NO: 458, SEQ ID NO: 459, SEQ ID NO: 460, SEQ ID NO: 461, SEQ ID NO: 462, SEQ ID NO: 463, 464, SEQ ID NO:465, SEQ ID NO:466, SEQ ID NO:467, SEQ ID NO:468, SEQ ID NO:469, SEQ ID NO:470, SEQ ID NO:471, SEQ ID NO:472, SEQ ID NO:473, SEQ ID NO:474, SEQ ID NO:475, SEQ ID NO:476, SEQ ID NO:477, SEQ ID NO:478, SEQ ID NO:479, SEQ ID NO:480, SEQ ID NO:481, SEQ ID NO:482, SEQ ID NO:483, SEQ ID NO:484, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:487, SEQ ID NO:488, SEQ ID NO:489, SEQ ID NO:490, SEQ ID NO:491, SEQ ID NO:49 2, SEQ ID NO:493, SEQ ID NO:494, SEQ ID NO:495, SEQ ID NO:496, SEQ ID NO:497, SEQ ID NO:498, SEQ ID NO:499, SEQ ID NO:500, SEQ ID NO:501, SEQ ID NO:502, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, The present invention includes an NIN or NLP protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:522, SEQ ID NO:523, and SEQ ID NO:524.Further embodiments of this aspect may be combined with any of the preceding aspects having genetic modifications introduced using a vector, the proximal NIN / NLP orthogroup protein and comprising SEQ ID NO:637, SEQ ID NO:638, SEQ ID NO:639, SEQ ID NO:640, SEQ ID NO:641, SEQ ID NO:642, SEQ ID NO:643, SEQ ID NO:644, SEQ ID NO:645, SEQ ID NO:646, SEQ ID NO:647, SEQ ID NO:648, SEQ ID NO:649, SEQ ID NO:650, SEQ ID NO:651, SEQ ID NO:652, SEQ ID NO:653, SEQ ID NO:654, SEQ ID NO:655, SEQ ID NO:656, The present invention includes an NIN or NLP protein having at least 70% sequence identity, at least 75% sequence identity, at least 80% sequence identity, at least 85% sequence identity, at least 90% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:657, SEQ ID NO:658, SEQ ID NO:659, SEQ ID NO:660, SEQ ID NO:661, or SEQ ID NO:662.
[0033] Further aspects of the present disclosure include a method of cultivating a genetically modified plant of any of the preceding embodiments having a genetically modified plant, the method comprising planting a genetically modified seedling, a genetically modified plantlet, a genetically modified cutting, a genetically modified tuber, a genetically modified root, or a genetically modified seed in soil to produce a genetically modified plant, or grafting the genetically modified seedling, the genetically modified plantlet, or the genetically modified cutting to a rootstock or a second plant grown in soil to produce a genetically modified plant; cultivating the harvestable seed, the harvestable leaf, the harvestable root, the harvestable cutting, the harvestable tree, the harvestable fruit, the harvestable kernels, the harvestable tuber, and / or the harvestable grain; and harvesting the harvestable seed, the harvestable leaf, the harvestable root, the harvestable root, the harvestable cutting, the harvestable tree, the harvestable fruit, the harvestable kernels, the harvestable tuber, and / or the harvestable grain.
[0034] BRIEF DESCRIPTION OF THE DRAWINGS This patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0035] Figures 1A-1I show the phenotype of Medicago truncatula daphne-like (FN8113) mutant roots and the phenotype of M. truncatula A17 wild-type (WT) roots inoculated with Sinorhizobium meliloti (rhizobia) strain RCR2011.pHC60. Figure 1A shows a stereo transmitted light macroscopic image of an infection thread in an A17 WT root (scale bar 2 mm). Figure 1B shows a stereo fluorescent macroscopic image of an infection thread in an A17 WT root (scale bar 2 mm). Figure 1D shows a stereo transmitted light macroscopic image of an infection thread in a daphne-like mutant root (scale bar 2 mm). Figure 1E shows a stereo fluorescent macroscopic image of an infection thread in a daphne-like mutant root (scale bar 2 mm). Comparison of Figures 1A-1B with Figures 1D-1E shows that daphne-like mutant roots (Figures 1D-1E) have an excessive number of infection threads compared to WT (Figures 1A-1B). Figures 1C and 1F show confocal images of WT (Figure 1C; scale bar 10 μm) and daphne-like mutant roots stained with propidium iodide at 7 days post-inoculation (dpi) (Figure 1C; scale bar 10 μm) and show that bacterial colonies (arrowheads) and infection threads (arrows) are comparable in daphne-like mutant and WT roots. Figure 1G shows a longitudinal section of a daphne-like mutant root stained with toluidine blue at 3 weeks post-inoculation (wpi), showing that infection threads (arrows) can sometimes reach the cortical cell layer and induce some cell division (arrowheads) (scale bar (50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; arrows indicate infection threads; arrowheads indicate cell division). Figure 1H shows the layout of the NIN locus in a daphne-like mutant, which has a 2.49 MB chromosome 2 insertion (flanking sequences shown between the arrows are SEQ ID NO:633 and SEQ ID NO:634) 4120 bp upstream of the NIN gene (thick grey arrow) start codon ("ATG" on thin black arrow). The chromosome 5 sequences are, from left to right, SEQ ID NO:632, SEQ ID NO:635, and SEQ ID NO:636. Images shown in Figures 1A-1G are representative images from multiple replicates. Figure 1I shows the mean ± SD of data from confocal images of roots stained with propidium iodide at 14 days post inoculation (dpi) (representative images of these roots are shown in Figures 1C and 1F).
[0036] Figures 2A-2M show the construction of ProNIN using Agrobacterium rhizogenes-mediated transformation. 5kb :NIN, Construct ProNIN 2.2kb Figure 2A shows partial complementation of the infection process in M. truncatula nin-1 mutant roots by introducing the construct ProNIN5kb(Δcyclops):NIN. 5kb Figure 2B shows a longitudinal section of a nin-1 mutant root transformed with NIN, showing an infection thread (arrow) that can reach the cortical cell layer (Scale bar 50 µm; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; arrows indicate the infection thread). 5kb Figure 2C shows stereo transmitted light macroscopic images of nin-1 mutant roots transformed with ProNIN, revealing excessive infection thread formation (scale bar 2 mm). 5kb : Stereo fluorescence macroscopic images of nin-1 mutant roots transformed with NIN, showing excessive infection thread formation (scale bar FIG. 2D shows the ProNIN stained with propidium iodide. 5kbFigure 2E shows confocal images of nin-1 mutant roots transformed with ProNIN roots, revealing infection thread formation (long white lines) initiated in curled root hairs (scale bar 10 μm). 2.2kb Figure 2F shows a stereo transmitted light macroscopic image of a nin-1 mutant root transformed with ProNIN, revealing numerous curled root hairs (scale bar 2 mm). 2.2kb : A stereofluorescence macroscopic image of nin-1 roots transformed with NIN, revealing numerous curled root hairs (scale bar 2 mm). Figure 2G shows the results of the transformation of nin-1 roots with ProNIN stained with propidium iodide. 2.2kb A: Confocal images of nin-1 mutant roots transformed with NIN roots, revealing bacterial curl colonies (compact white shapes) inside the curled root hairs, but showing no infection thread formation (Scale bar 10 μm). Figure 2H shows a stereo transmitted light macroscopic image of nin-1 mutant roots transformed with an empty vector, lacking infection threads (Scale bar 2 mm). Figure 2I shows a stereofluorescence macroscopic image of a nin-1 mutant root transformed with an empty vector, which does not have an infection thread (scale bar 2 mm). Figure 2J shows a confocal image of a nin-1 mutant root transformed with an empty vector, stained with propidium iodide, which shows excessive curling of root hairs without bacterial colonies (scale bar 10 μm). Figure 2K shows a stereofluorescence macroscopic image of a nin-1 root transformed with ProNIN5kb(Δcyclops):NIN, which shows numerous curled root hairs (scale bar 2 mm). Figure 2L shows a stereofluorescence macroscopic image of a nin-1 root transformed with ProNIN5kb(Δcyclops):NIN, which shows numerous curled root hairs (scale bar 2 mm). Figure 2M shows confocal images of nin-1 mutant roots transformed with ProNIN5kb (Δcyclops):NIN roots stained with propidium iodide, which exhibit bacterial curl colonies (dense white shapes) inside the curled root hairs but no infection thread formation (Scale bar 10 µm). Figures 2A-2M show images of roots collected at 4 wpi inoculation with S. meliloti RCR2011.pHC60 constitutively expressing GFP. Images shown in Figures 2A-2M are representative images from multiple replicates.
[0037] Figure 3 shows mVISTA alignments of genomic DNA sequences from eight legume species, including 2 kb downstream from the NIN gene start codon and the NIN 5' upstream region. The x-axis provides the distance from the M. truncatula NIN start codon in Kb (running from right to left), while the y-axis provides the percentage conservation level relative to the M. truncatula sequence (running from bottom to top for each legume species). Peaks indicate the level of sequence identity with M. truncatula in ratios of 50% to 100%, with identities less than 50% not recorded. The sequence 2 kb downstream from the NIN start codon is depicted to the right of the thin black arrow labeled "ATG" and the 5' non-coding upstream DNA sequence is depicted to the left of the thin black arrow. Two dark grey rectangles indicate the location of the three conserved regions (3C regions; left) and the -5 kb promoter region (right), and the grey vertical arrow indicates the location of the CYCLOPS binding site within the -5 kb promoter region.
[0038] Figure 4A and Figure 4B show a representative schematic of elements in the M. truncatula NIN 5' upstream region and experimental results demonstrating that the cytokinin response element containing (CE) region is essential for nodule organogenesis. Figure 4A shows the 3C region present in the NIN 5' upstream region as a box located -15Kb to -20Kb upstream of the NIN coding sequence start site (NIN gene = thick grey arrow; start codon = "ATG" on thin black arrow). The central region of the 3C region is the 1Kb CE region, which contains a 472bp conserved region that is divided into three parts or domains named D1, D2, and D3 (shown in grey box). Figure 4A also shows the location of the insertion in the daphne-like mutant and the location of the CYCLOPS binding site, shown as labeled arrows located between -2.2Kb and -5Kb upstream of the NIN coding sequence start site. Figure 4B shows the number of nodules formed in A17 WT M. truncatula roots transformed with an empty vector (top bar) and M. truncatula nin-1 mutant roots transformed with an empty vector or with constructs carrying the NIN gene driven by different parts of the NIN 5' upstream region (bottom six bars; each bar is labeled with the specific construct used). The ratio of nodulated roots to all roots tested (indicated by the arrow labeled "Nodulated roots / transgenic roots") is provided to the left of the graph. The graph shows the number of nodules per nodulated root, data are mean ± SD, and the number of nodules was counted at 4 wpi using S. meliloti 2011.pHC60 strain.
[0039] Figures 5A-5D show MAFFT alignments of the cytokinin response element encompassing (CE) region (corresponding to the second or middle region of the larger 3C region) and the conserved portion of the CYCLOPS binding site of eight legume species; Medicago truncatula (SEQ ID NO: 663), Trifolium pratense (SEQ ID NO: 664), Cicer arietinum (SEQ ID NO: 665), Lotus japonicus (SEQ ID NO: 666), Glycine max (SEQ ID NO: 667), and Cicer arietinum (SEQ ID NO: 668). 5B shows a MAFFT alignment of the conserved portion (i.e., without the flanking regions) of the CE region of Arachis duranensis (SEQ ID NO:670), Cajanus cajan (SEQ ID NO:668), Lupinus angustifolius (SEQ ID NO:669), and Arachis duranensis (SEQ ID NO:670). The conserved portion of the CE region contains approximately 10 putative type B cytokinin signaling response regulator (RR) binding sites (SEQ ID NO:613, bold), and one AP2 binding element (SEQ ID NO:631, enclosed in a black box in FIG. 5B). The conserved portion of the CE region is divided into three domains, named D1, D2, and D3, the extent and boundaries of which are indicated by the black arrows below the alignment and the vertical black lines through the alignment. FIG. 5A shows an alignment of the 5' portion of the conserved portion of the CE region, including all of domain D1 and part of domain D2. Figure 5B shows an alignment of the central portion of the conserved portion of the CE region, including a portion of domain D2 and a portion of domain D3. Figure 5C shows an alignment of the 3' portion of the conserved portion of the CE region, including a portion of domain D3. Figure 5D shows a MAFFT alignment of the CYCLOPS binding sites of eight legume species; Medicago truncatula (SEQ ID NO: 671), Arachis duranensis (SEQ ID NO: 672), Cicer arietinum (SEQ ID NO: 673), Lotus japonicus (SEQ ID NO: 674), Glycine max (SEQ ID NO: 675), Lupinus angustifolius (SEQ ID NO: 676), Cajanus cajan (SEQ ID NO: 677), and Trifolium pratense (SEQ ID NO: 678). The two dashed boxes represent the palindrome of an essential cis-element, referred to as the CYC-box, within the CYCLOPS response element (also called the CYCLOPS-responsive cis-element or CYC-RE), represented by a black arrow above the alignment.
[0040] Figures 6A-6H show the expression of the construct ProNIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). 3C-5kb :NIN, ProNIN CE-5kb :NIN or ProNIN CE-35Smin Figures 6A and 6C show that the complementation of the nodule formation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introduction of ProNIN. 3C-5kb : When transformed with NIN (Figure 6A; scale bar 2 mm), or ProNIN CE-5kb Figure 6C shows that nin-1 transgenic roots form nodules when transformed with ProNIN (scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that they are actively fixing nitrogen. Figure 6E and Figure 6G show that nin-1 transgenic roots form nodules when transformed with ProNIN (scale bar 2 mm). CE-5kb : When transformed with NIN (Figure 6E; scale bar 2 mm), or ProNIN CE-35Smin Figure 6B and 6D show that nodules are formed on daphne-like transgenic roots when transformed with ProNIN (Figure 6G; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. 3C-5kb : When transformed with NIN (Figure 6B; scale bar 200 μ), or ProNIN CE-5kb Figure 6D shows longitudinal sections of nodules formed in nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN (scale bar 200 μm). These have a normal nodule distribution including the meristem (M), infection zone (IF), and fixation zone (FX). Figure 6F and Figure 6H show that the nodules formed in nin-1 transgenic roots when transformed with ProNIN (scale bar 200 μm) have a normal nodule distribution including the meristem (M), infection zone (IF), and fixation zone (FX). CE-5kb When transformed with :NIN (Figure 6F; scale bar 200 μM) or ProNIN CE-35Smin: Longitudinal sections of nodules formed on daphne-like transformed roots stained with toluidine blue when transformed with NIN (Figure 6H; scale bar 200 µM) are shown, which have normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX). In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum, and nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates.
[0041] Figures 7A and 7B show that M. truncatula ProNIN expression was increased when inoculated with S. meliloti carrying the PronifH:GFP reporter. CE-5kb : nifH expression is induced in nodules of NIN transgenic nin-1 roots. Figure 7A shows a confocal image of a 4 wpi transgenic nodule, showing that nifH (light grey) is switched on in the fixation zone (FX) (IF = infected zone; scale bar 200 μm). Figure 7B shows a magnified image of Figure 7A, showing nifH switched on in the fixation zone (S = symbiotic; scale bar 50 μm). Images shown in Figures 7A-7B are representative images from multiple replicates.
[0042] 8A-8B show qRT-PCR analysis of relative NIN and NF-YA1 expression in response to cytokinin induction compared to water control in A17 WT and daphne-like. Figure 8A shows the effect of 10-7 M benzylaminopurine (BAP; labeled "10 -7Figure 8B shows qRT-PCR analysis of the relative expression of NF-YA1 in A17 WT and daphne-like after 16 h of application of 10-7 M BAP for cytokinin induction or water as a control. Figure 8A-8B show the average of three biological replicates with error bars displaying SEM.
[0043] 9A to 9C show the ProNIN CE(ΔD1 / D2 / D3)-5kb Figure 9A shows the phenotype of M. truncatula nin-1 mutant roots transformed with the ProNIN:NIN construct. CE(ΔD1)-5kb 9B shows a longitudinal section of an inoculated nin-1 root transformed with ProNIN (scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; infection threads are indicated by arrows). CE(ΔD2)-5kb 9C shows a longitudinal section of an inoculated nin-1 root transformed with ProNIN (IF = infection zone; FX = fixation zone; M = meristem; scale bar 200 μM). CE(ΔD3)-5kb 9A-9C are representative images from multiple replicates.
[0044] Figures 10A-10E show the expression trends of NIN and NF-YA1 in M. truncatula A17 WT nodule primordia and daphne-like mutant primordia inoculated with S. meliloti RCR2011. Figures 10A-10B show the RNA in situ localization of NIN (Figure 10A) and NF-YA1 (Figure 10B) in A17 nodule primordia at a stage of nodule primordium development when pericycle cells have divided and some antipodal divisions have occurred in the inner cortical cell layers (C4 and C5). Figures 10C-10D show the RNA in situ localization of NIN (Figure 10C) and NF-YA1 (Figure 10D) in A17 nodule primordia at a later stage of nodule primordium development when cortical cells have divided more extensively. Figure 10E shows RNA in situ localization of NIN in daphne-like mutant primordia 2 days after inoculation with S. meliloti RCR2011. In Figures 10A-10E, hybridization signals are depicted as dark dots and indicated by arrowheads. Arrows indicate infection threads (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 10A-10E are representative images from multiple replicates.
[0045] Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endothelium 48 h after inoculation with S. meliloti RCR2011. 5kb : GUS (Figure 11A) and ProNIN CE-5kb 11A-11B show M. truncatula A17 WT roots transformed with GUS (Fig. 11B). In Fig. 11A-11B, GUS expression is in the epidermis, endodermis, and endothelium, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Fig. 11C-11D show the expression of ProNIN 5kb : GUS (Figure 11C) and ProNIN CE-5kb11D: M. truncatula daphne-like mutant roots transformed with GUS (Fig. 11C). In Fig. 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Fig. 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figs. 11E-11F show the expression of ProNIN 5kb : GUS (Figure 11E) and ProNIN CE-5kb : M. truncatula nin-1 mutant roots transformed with GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates.
[0046] Figures 12A and 12B show the localization of CRE1 and RR1 RNA in non-inoculated M. truncatula A17 WT roots. Figure 12A shows the RNA in situ localization of CRE1 in non-inoculated roots, where hybridization signals are depicted as dark dots and indicated by arrowheads (scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; vb = vascular bundles). Figure 12B shows the RNA in situ localization of RR1 in non-inoculated roots, where hybridization signals are depicted as dark dots and indicated by arrowheads (scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; vb = vascular bundles). Images shown in Figures 12A-12B are representative images from multiple replicates.
[0047] Figure 13 shows a model of NIN function during nodule primordium initiation. In the root hair curl, bacterial colonies are shown as grey dots, and in the root hair axis, infection threads are shown as light grey lines (root hairs are shown as perpendicular projections from the cell epidermis). Note: "-2.2Kb" and "-5Kb" indicate portions of the NIN 5' upstream region (ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endodermis; pc=endothelium).
[0048] Detailed Description The following description describes example methods, parameters, etc., however, it should be recognized that such description is not intended as a limitation on the scope of the present disclosure, but instead is provided as a description of example embodiments.
[0049] <Genetically modified plants and seeds> One aspect of the disclosure includes a genetically modified plant, the plant or part thereof comprising one or more genetic modifications that increase the activity of a NODULE INCEPTION (NIN) protein or a NIN-like protein (NLP protein) in response to cytokinin signaling compared to a wild-type (WT) plant that does not have the one or more genetic modifications, the plant or part thereof comprising a nucleic acid encoding the NIN protein or NLP protein. Further embodiments of this aspect include one or more genetic modifications, the one or more genetic modifications being the addition of one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, twenty or more, twenty-one or more, twenty-two or more, twenty-three or more, or twenty-four or more cytokinin response elements operably linked to the nucleic acid encoding the NIN protein or NLP protein. Yet another embodiment of this aspect includes one or more genetic modifications that are 8 or more, 16 or more, or 24 or more cytokinin response elements operably linked to a nucleic acid encoding an NIN or NLP protein. Yet another embodiment of this aspect includes at least one cytokinin response element that is a type B cytokinin signaling response regulator (RR) binding site. Further embodiments of this aspect include at least one type B cytokinin signaling RR binding site having a sequence of SEQ ID NO:613 or SEQ ID NO:614. Yet another embodiment of this aspect includes at least one type B cytokinin signaling RR binding site having a sequence of SEQ ID NO:679, SEQ ID NO:680, SEQ ID NO:681, SEQ ID NO:682, SEQ ID NO:683, SEQ ID NO:684, SEQ ID NO:685, or SEQ ID NO:686.Yet another embodiment of this aspect is SEQ ID NO:551, SEQ ID NO:552, SEQ ID NO:553, SEQ ID NO:554, SEQ ID NO:555, SEQ ID NO:556, SEQ ID NO:557, SEQ ID NO:558, SEQ ID NO:559, SEQ ID NO:560, SEQ ID NO:561, SEQ ID NO:562, SEQ ID NO:563, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569, SEQ ID NO:570, SEQ ID NO:571, SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:574, SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, The present invention further comprises at least one type B cytokinin signaling RR binding site having a sequence selected from the group of: SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO:599, SEQ ID NO:600, SEQ ID NO:601, SEQ ID NO:602, SEQ ID NO:603, SEQ ID NO:604, SEQ ID NO:605, SEQ ID NO:606, SEQ ID NO:607, SEQ ID NO:608, SEQ ID NO:609, SEQ ID NO:610, SEQ ID NO:611, SEQ ID NO:612, SEQ ID NO:615, SEQ ID NO:616, SEQ ID NO:617, SEQ ID NO:618, SEQ ID NO:619, SEQ ID NO:620, SEQ ID NO:621, SEQ ID NO:622, SEQ ID NO:623, SEQ ID NO:624, SEQ ID NO:625, SEQ ID NO:626, SEQ ID NO:679, SEQ ID NO:680, SEQ ID NO:681, SEQ ID NO:682, SEQ ID NO:683, SEQ ID NO:684, SEQ ID NO:685, or SEQ ID NO:686. Further embodiments of this aspect include tandemly or inversely oriented cytokinin response elements.
[0050] In yet another embodiment that may be combined with any of the preceding embodiments, the cytokinin response elements are within 100 nucleotides, 95 nucleotides, 90 nucleotides, 85 nucleotides, 80 nucleotides, 75 nucleotides, 70 nucleotides, 65 nucleotides, 60 nucleotides, 59 nucleotides, 58 nucleotides, 57 nucleotides, 56 nucleotides, 55 nucleotides, 54 nucleotides, 53 nucleotides, 52 nucleotides, 51 nucleotides, 50 nucleotides, 49 nucleotides, 48 nucleotides, 47 nucleotides, 46 nucleotides, 45 nucleotides, 44 nucleotides, 43 nucleotides, 42 nucleotides, 41 nucleotides, 40 nucleotides, 39 nucleotides, 38 nucleotides, 39 ... Within 7, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide. In a further embodiment of this aspect, the cytokinin response elements are within 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide of each other. In yet another embodiment which may be combined with any of the preceding embodiments,The nucleic acid encoding the NIN or NLP protein is operably linked to a promoter that is operably linked to a cytokinin response element. In further embodiments of this aspect, the promoter and the cytokinin response element are within 110,000 nucleotides, 109,000 nucleotides, 108,000 nucleotides, 107,000 nucleotides, 106,000 nucleotides, 105,000 nucleotides, 104,000 nucleotides, 103,000 nucleotides, 102,000 nucleotides, 101,000 nucleotides, 100,000 nucleotides, 99,000 nucleotides, 104,000 nucleotides, 105,000 nucleotides, 106,000 nucleotides, 107,000 nucleotides, 108,000 nucleotides, 109,000 nucleotides, 109,000 nucleotides, 101,000 nucleotides, 10 ... nucleotides, 98,000 nucleotides, 97,000 nucleotides, 96,000 nucleotides, 95,000 nucleotides, 94,000 nucleotides, 93,000 nucleotides, 92,000 nucleotides, 91,000 nucleotides, 90,000 nucleotides, 89,000 nucleotides, 88,000 nucleotides, 87,000 nucleotides, 86,000 nucleotides, 85,000 nucleotides, 84,000 nucleotides Within 83,000 nucleotides, within 82,000 nucleotides, within 81,000 nucleotides, within 80,000 nucleotides, within 79,000 nucleotides, within 78,000 nucleotides, within 77,000 nucleotides, within 76,000 nucleotides, within 75,000 nucleotides, within 74,000 nucleotides, within 73,000 nucleotides, within 72,000 nucleotides, within 71,000 nucleotides, within 70,000 nucleotides, within 69,000 nucleotides within, 68,000 nucleotides within, 67,000 nucleotides within, 66,000 nucleotides within, 65,000 nucleotides within, 64,000 nucleotides within, 63,000 nucleotides within, 62,000 nucleotides within, 61,000 nucleotides within, 60,000 nucleotides within, 59,000 nucleotides within, 58,000 nucleotides within, 57,000 nucleotides within, 56,000 nucleotides within, 55,000 nucleotides within, 54,000 nucleotides within,Within 53,000 nucleotides, within 52,000 nucleotides, within 51,000 nucleotides, within 50,000 nucleotides, within 49,000 nucleotides, within 48,000 nucleotides, within 47,000 nucleotides, within 46,000 nucleotides, within 45,000 nucleotides, within 44,000 nucleotides, within 43,000 nucleotides, within 42,000 nucleotides, within 41,000 nucleotides, within 40,000 nucleotides, within 39,000 nucleotides, Within 38,000 nucleotides, within 37,000 nucleotides, within 36,000 nucleotides, within 35,000 nucleotides, within 34,000 nucleotides, within 33,000 nucleotides, within 32,000 nucleotides, within 31,000 nucleotides, within 30,000 nucleotides, within 29,000 nucleotides, within 28,000 nucleotides, within 27,000 nucleotides, within 26,000 nucleotides, within 25,000 nucleotides, within 24,000 nucleotides, Within 23,000 nucleotides, Within 22,000 nucleotides, Within 21,000 nucleotides, Within 20,000 nucleotides, Within 19,000 nucleotides, Within 18,000 nucleotides, Within 17,000 nucleotides, Within 16,000 nucleotides, Within 15,000 nucleotides, Within 14,000 nucleotides, Within 13,000 nucleotides, Within 12,000 nucleotides, Within 11,000 nucleotides, Within 10,000 nucleotides, Within 9,000 nucleotides, Within 8 In yet another embodiment of this aspect, the nucleic acid sequence is within 1,000 nucleotides, 7,000 nucleotides, 6,000 nucleotides, 5,000 nucleotides, 4,000 nucleotides, 3,000 nucleotides, 2,000 nucleotides, 1,000 nucleotides, 900 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, or 100 nucleotides. ...00 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, or 100 nucleotides. In yet another embodiment of this aspect, the nucleic acid sequence is within 1,000 nucleotides, 7,000 nucleotides, 6,000 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, or 100 nucleotides.The present embodiment includes a cytokinin response element located between the end of the coding sequence of the gene located 5' upstream and the transcription or translation start site of the nucleic acid encoding the NIN or NLP protein. Further embodiments of this aspect include a cytokinin response element located within the nucleic acid encoding the NIN or NLP protein (i.e., within the transcribed gene sequence). Further embodiments of this aspect include a cytokinin response element located within one or more introns of the nucleic acid encoding the NIN or NLP protein.
[0051] Further embodiments of this aspect, which may be combined with any of the preceding embodiments, include nucleic acids encoding NIN / NLP1 orthogroup proteins. Further embodiments of this aspect include SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, Column number 34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, Column number 67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151,SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, Column number 184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO: for an amino acid sequence selected from the group consisting of SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:687, SEQ ID NO:688, SEQ ID NO:689, SEQ ID NO:690, SEQ ID NO:691, SEQ ID NO:692, or SEQ ID NO:693, 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity,These include NIN / NLP1 orthogroup proteins having at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Further embodiments of this aspect are NIN proteins and include those set forth in SEQ ID NO:22 (i.e., CsaNIN; Cannabis sativa), SEQ ID NO:78 (i.e., HluNIN; Humulus japonicus), SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus), SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula), SEQ ID NO:136 (i.e., PanNIN; Parasponia andersonii), SEQ ID NO:139 (i.e., PriNIN; Parasponia rigida), SEQ ID NO:142 (i.e., PruNIN; Parasponia rugosa), SEQ ID NO:185 (i.e., TleNIN; Trema levigata; a truncated form of NIN), SEQ ID NO:187 (i.e., TorNIN; Trema orientalis; a truncated form of NIN), SEQ ID NO:190 (i.e., TtoNIN; Trema tomentosa; a truncated form of NIN), SEQ ID NO: 236 (i.e., ZjuNIN; Ziziphus jujuba), SEQ ID NO: 687 (i.e., AglNIN; Alnus glutinosa), SEQ ID NO: 688 (i.e., CglNIN; Casuarina glauca), SEQ ID NO: 689 (i.e., DglNIN.1; Datisca glomerata), SEQ ID NO: 690 (i.e., DglNIN.2; Datisca glomerata), SEQ ID NO: 691 (i.e., DtrNIN; Discaria trinervis), SEQ ID NO: 692 (i.e., DdrNIN; Dryas drummondii), or SEQ ID NO: 693 (i.e., PtrNIN; Purshia tridentata),at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% or at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Another embodiment of this aspect is a NIN protein and is selected from the group consisting of SEQ ID NO: 89 (i.e., LjNIN; Lotus japonicus) or SEQ ID NO: 108 (i.e., MtNIN; Medicago sativa). at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity,NIN / NLP1 orthogroup proteins having at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity.
[0052] Yet another embodiment of this aspect, which may be combined with any of the preceding embodiments, includes a nucleic acid encoding an NLP2-3 orthogroup protein, an NLP4 orthogroup protein, or a proximal NIN / NLP orthogroup protein. Further embodiments of this aspect include SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264. , SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267, SEQ ID NO:268, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:275, SEQ ID NO:276, SEQ ID NO:277, SEQ ID NO:278, SEQ ID NO:279, SEQ ID NO:280, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:286, SEQ ID NO:287, SEQ ID NO:288, SEQ ID NO:289, SEQ ID NO:290, SEQ ID NO:291, SEQ ID NO:292, SEQ ID NO:2 93, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO:306, SEQ ID NO:307, SEQ ID NO:308, SEQ ID NO:309, SEQ ID NO:310, SEQ ID NO:311, SEQ ID NO:312, SEQ ID NO:313, SEQ ID NO:314, SEQ ID NO:315, SEQ ID NO:316, SEQ ID NO:317, SEQ ID NO:318, SEQ ID NO:319, SEQ ID NO:320, SEQ ID NO: No. 321, SEQ ID NO. 322, SEQ ID NO. 323, SEQ ID NO. 324, SEQ ID NO. 325, SEQ ID NO. 326, SEQ ID NO. 327, SEQ ID NO. 328, SEQ ID NO. 329, SEQ ID NO. 332, SEQ ID NO. 333, SEQ ID NO. 334, SEQ ID NO. 335, SEQ ID NO. 336, SEQ ID NO. 337, SEQ ID NO. 338, SEQ ID NO. 339, SEQ ID NO. 340, SEQ ID NO. 341, SEQ ID NO. 342, SEQ ID NO. 343, SEQ ID NO. 344, SEQ ID NO. 345, SEQ ID NO. 346, SEQ ID NO. 347, SEQ ID NO. 348, SEQ ID NO. 349, SEQ ID NO. 350,at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, at least 99% sequence identity, at least 100% sequence identity, at least 101% sequence identity, at least 102% sequence identity, at least 103% sequence identity, at least 104% sequence identity, at least 105% sequence identity, at least 106% sequence identity, at least 107% sequence identity, at least 108% sequence identity, at least 109% sequence identity, at least 110% sequence identity, at least 111% sequence identity, at least 112% sequence identity, at least 113% sequence identity, at least 114% sequence identity, at least 115% sequence identity, at least 116% sequence identity, at least 117% sequence identity, at least 118% sequence identity, at least 119% sequence identity, at least 120% sequence identity, at least 121% sequence identity, at least 122% sequence identity, at least The present invention includes an NLP2-3 orthogroup protein having 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Further embodiments of this aspect include SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404, SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412,SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:432, SEQ ID NO:433, SEQ ID NO:434, SEQ ID NO:435, SEQ ID NO:436, SEQ ID NO:437, SEQ ID NO:438, SEQ ID NO:439, SEQ ID NO:440, SEQ ID NO:441, SEQ ID NO:442, SEQ ID NO:443, SEQ ID NO:444, Sequence number 445, sequence number 446, sequence number 447, sequence number 448, sequence number 449, sequence number 450, sequence number 451, sequence number 452, sequence number 453, sequence number 455, sequence number 456, sequence number 457, sequence number 458, sequence number 459, sequence number 460, sequence number 461, sequence number 462, sequence number 463, sequence number 464, sequence number 465, sequence number 466, sequence number 467, sequence number 468, sequence number 469, sequence number 470, sequence number 471, sequence number 472, sequence number 473, sequence number 474, sequence number 475, sequence number 476, sequence number No. 477, SEQ ID NO: 478, SEQ ID NO: 479, SEQ ID NO: 480, SEQ ID NO: 481, SEQ ID NO: 482, SEQ ID NO: 483, SEQ ID NO: 484, SEQ ID NO: 485, SEQ ID NO: 486, SEQ ID NO: 487, SEQ ID NO: 488, SEQ ID NO: 489, SEQ ID NO: 490, SEQ ID NO: 491, SEQ ID NO: 492, SEQ ID NO: 493, SEQ ID NO: 494, SEQ ID NO: 495, SEQ ID NO: 496, SEQ ID NO: 497, SEQ ID NO: 498, SEQ ID NO: 499, SEQ ID NO: 500, SEQ ID NO: 501, SEQ ID NO: 502, SEQ ID NO: 504, SEQ ID NO: 505, SEQ ID NO: 506, SEQ ID NO: 507, SEQ ID NO: 508, at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity to an amino acid sequence selected from the group consisting of: SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ ID NO:523 and SEQ ID NO:524;The present invention includes an NLP4 orthogroup protein having at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Further embodiments of this aspect include a nucleic acid sequence having at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, at least 99% sequence identity, at least 100% sequence identity, at least 101% sequence identity, at least 102% sequence identity, at least 103% sequence identity, at least 104% sequence identity, at least 105% sequence identity, at least 106% sequence identity, at least 107% sequence identity, at least 108% sequence identity, at least 109 ... 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity,The NIN / NLP orthogroup proteins include those having at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity.
[0053] In yet another embodiment that can be combined with any of the previous embodiments, the nucleic acid encoding the NIN protein or NLP protein is endogenous. Yet another embodiment of this aspect can be combined with any of the previous embodiments and includes a nucleic acid encoding the NIN protein or NLP protein that is heterologous. Yet another embodiment of this aspect can be combined with any of the previous aspects having a nucleic acid encoding the NIN protein or NLP protein operably linked to a promoter and includes a promoter that is endogenous. Yet another embodiment of this aspect can be combined with any of the previous aspects having a nucleic acid encoding the NIN protein or NLP protein operably linked to a promoter and includes a promoter that is heterologous.
[0054] In yet another embodiment that can be combined with any of the preceding embodiments, induction of cytokinin signaling or the cytokinin signaling pathway in the root endothelium cell layer, the endodermal cell layer (i.e., the endodermal cell layer), the cortical cell layer (i.e., the cortical cell layer), and / or the epidermal cell layer (i.e., the epidermal cell layer) induces root nodule organogenesis. Further embodiments of this aspect include a cytokinin signaling pathway induced by a cytokinin analogue exogenously applied or secreted by a microorganism. Further embodiments of this aspect that can be combined with any of the preceding embodiments further include one or more CYCLOPS response elements operably linked to the nucleic acid. The CYCLOPS response element of the present disclosure can be a complete CYCLOPS response element or an essential CYCLOPS response element (CYC-box), as shown in FIG. 5D. Further embodiments of this aspect include CYCLOPS expression in the root epidermal cell layer (i.e., the epidermal cell layer) to induce rhizobia infection.
[0055] In further embodiments that may be combined with any of the preceding embodiments, the genetically modified plant is a monocotyledonous plant. Further embodiments of this aspect include corn (e.g., maize, Zea mays), rice (e.g., indica rice, japonica rice, aromatic rice, glutinous rice, Oryza sativa, Oryza glaberrima), wild rice (e.g., Zizania spp., Porteresia spp.), wheat (e.g., common wheat, spelt, durum wheat, einkorn, emmer wheat, kamut wheat, Triticum aestivum, Triticum spelta, Triticum durum, Triticum urartu, Triticum monococcum, Triticum turanicum, Triticum spp.), barley (e.g., Hordeum vulgare), sorghum (e.g., Sorghum bicolor), millet (e.g., finger millet, fonio, foxtail millet, pearl millet, barnyard millet, Eleusine coracana, Panicum sumatrense, Panicum milaceum, Setaria italica, Pennisetum glaucum, Digitaria spp., Echinocloa spp.), teff (e.g., Eragrostis tef), oats (e.g., Avena sativa), triticale (e.g., X Triticosecale Wittmack, Triticosecale schlanstedtense Wittm., Triticosecale neoblaringhemii A.Camus, Triticosecale neoblaringhemii A.Camus), rye (e.g., Secale cereale, Secale cereanum) or sugarcane (e.g., Saccharum officinarum, Saccharum spp.).Further embodiments of this aspect that can be combined with any of the preceding embodiments include apples (e.g., Malus pumila, Malus x domestica, Pyrus malus), pears (e.g., Pyrus communis, Pyrus x bretschneideri, Pyrus pyrifolia, Pyrus sinkiangensis, Pyrus pashia, Pyrus spp.), plums (e.g., Mirabelle plum, Greengage, Insititsia plum, Prunus domestica, Prunus salicina, Prunus mume), apricots (e.g., Prunus armeniaca, Prunus brigantine, Prunus mandshurica), peaches (e.g., Prunus persica), almonds (e.g., Prunus dulcis, Prunus amygdalus), walnuts (e.g., Persian walnut, European walnut, black walnut, Juglans regia, Juglans. nigra, Juglans cinerea, Juglans californica), cherries (e.g. Prunus avium, Prunus cerasus, Prunus yedoensis var. nudiflora), strawberries (Fragaria × ananassa, Fragaria chiloensis, Fragaria virginiana, Fragaria vesca), raspberries (e.g. European red raspberry, black raspberry, Rubus idaeus L., Rubus occidentalis, Rubus strigosus), blackberries (e.g. evergreen blackberry, Himalayan blackberry, Rubus fruticosus, Rubus ursinus, Rubus laciniatus, Rubus argutus, Rubus armeniacus, Rubus plicatus, Rubus ulmifolius, Rubus allegheniensis, subgenus Rubus section Eubatus Moriferi & Ursini), red currants (e.g. white currant, Ribes rubrum), black currants (e.g. blackcurrant, Ribes nigrum), gooseberries (e.g. Ribes uva-crispa, Ribes grossulari, Ribes hirtellum), melons (e.g. watermelon, winter melon, cassava, cantaloupe, honeydew, muskmelon, Citrullus lanatus, Benincasa hispida, Cucumis melo, Cucumis melo cantalupensis, Cucumis melo inodorus, Cucumis melo reticulatus), cucumbers (e.g. slicing cucumbers, pickled cucumber, English cucumber, Cucumis sativus), pumpkins (e.g. Cucurbita pepo, Cucurbita maxima), squash (e.g., loofah, Cucurbita argyrosperma, Cucurbita ficifolia, Cucurbitamaxima, Cucurbita moschata), grapes (e.g. Vitis vinifera, Vitis amurensis, Vitis labrusca, Vitis mustangensis, Vitis riparia, Vitis rotundifolia), hemp (e.g. Indian hemp, Cannabis sativa), hops (e.g. Humulus lupulus), birch (e.g. Betula spp.), beech (e.g. Fagus sylvatica, Fagus grandifolia, Fagus spp.), jujube (e.g. Ziziphus jujube), cassava (e.g. Manioc, Yucca, Manihot esculenta), poplar (e.g., hybrid poplar, Populus trichocarpa, Populus tremula, Populus alba, Populus spp.), chestnut (e.g., Castanea mollissima, Castanea crenata, Castanea dentata, Castanea spp.), swamp oak (e.g. Casuarina glauca), rose gum (e.g. Eucalyptus grandis), oak (e.g. cork oak, Quercus suber, Quercus spp.), citrus (e.g. lemon, lime, orange, grapefruit, pomelo, citron, trifoliate orange, bergamot, bitter orange, blood orange, unshu mandarin, clementine, mandarin, yuzu, finger lime, kaffir lime, kumquat, Citrus clementina, Citrus sinensis, Citrus trifoliata, Citrus japonica, Citrus maxima, Citrus australasica, Citrus reticulata, Citrus aurantifolia, Citrus hystrix, Citrus × paradisi, Citrus × clementina, Citrus genus), potato (e.g., russet potato, yellow potato, red potato, Solanum tuberosum), tomato (e.g., Solanum lycopersicum), sweet potato (e.g., Ipomoea batatas), yam (e.g., Diascorea genus, Oxalis tuberosa), Arabidopsis (Arabidopsis thaliana), Trema genus (e.g., Trema cannabina, Trema cubense, Trema discolor, Trema domingensis, Trema integerrima, Trema lamarckiana, Trema micrantha, Trema orientalis, Trema philippinensis, Trema strigilosa, Trema tomentosa, Trema levigata, and Jatropha (e.g., Jatropha curcas). In yet another embodiment that can be combined with any of the preceding embodiments, the WT plant is not a legume and does not form nodules for symbiosis with nitrogen fixing bacteria, or both are not legumes and do not form nodules for symbiosis with nitrogen fixing bacteria.
[0056] Further embodiments of this aspect may be combined with any of the preceding embodiments and include a genetically modified plant part of the genetically modified plant of any of the preceding embodiments, the plant part being a leaf, stem, root, tuber, flower, seed, kernel, grain, fruit, cell, or part thereof, and the genetically modified plant part comprising one or more genetic modifications. Further embodiments of this aspect include the plant part being a fruit, tuber, kernel, or grain. Further embodiments of this aspect may be combined with any of the preceding embodiments and include a genetically modified pollen grain or a genetically modified ovule of the plant of any of the preceding embodiments, the genetically modified pollen grain or the genetically modified ovule comprising one or more genetic modifications. Further embodiments of this aspect may be combined with any of the preceding embodiments and include a genetically modified protoplast produced from the genetically modified plant of any of the preceding embodiments, the genetically modified protoplast comprising one or more genetic modifications. Further embodiments of this aspect may be combined with any of the previous embodiments and include a genetically modified tissue culture produced from a protoplast or cell from a genetically modified plant of any one of the previous embodiments, the cell or protoplast being produced from a plant part selected from the group of leaves, mesophyll cells, anthers, pistils, stems, petioles, roots, root tips, tubers, fruits, seeds, kernels, grains, flowers, cotyledons, hypocotyls, embryos, or meristematic cells, and the genetically modified tissue culture comprises one or more genetic modifications. Further embodiments of this aspect include a genetically modified plant regenerated from a genetically modified tissue culture comprising one or more genetic modifications. Yet another embodiment of this aspect may be combined with any of the previous embodiments having a genetically modified plant and includes a genetically modified plant having all the physiological and morphological characteristics of the plant of any of the previous embodiments. Yet another embodiment of this aspect may be combined with any of the previous embodiments having a genetically modified plant and includes a genetically modified plant seed produced from a genetically modified plant of any one of the previous embodiments.Further embodiments of this aspect include seeds of plants that can be combined with any of the previous embodiments having genetically modified plants to produce plants having all the physiological and morphological characteristics of the plants of any of the previous embodiments.
[0057] <Methods for producing and cultivating genetically modified plants> Further aspects of the present disclosure include a method of producing a genetically modified plant of any of the preceding embodiments, comprising: (a) introducing one or more genetic modifications into a plant cell, tissue, or other explant; (b) regenerating the plant cell, tissue, or other explant into a genetically modified plantlet; and (c) growing the genetically modified plantlet into a genetically modified plant having one or more genetic modifications that increase the activity of an NIN protein or an NLP protein in response to cytokinin signaling compared to an untransformed WT plant. Further embodiments of this aspect further include confirming successful introduction of the one or more genetic modifications by screening or selecting the plant cell, tissue, or other explant before step (b), screening or selecting the plantlet between steps (b) and (c), or screening or selecting the plant after step (c). In yet another embodiment that may be combined with any of the preceding embodiments, the transformation is carried out using a transformation method selected from the group of particle bombardment (i.e. biolistic, gene gun), Agrobacterium-mediated transformation, Rhizobium-mediated transformation, or transfection or transformation of protoplasts.
[0058] Further embodiments of this aspect can be combined with any of the previous embodiments and include genetic modifications introduced using a vector. Further embodiments of this aspect include a vector comprising a promoter operably linked to a nucleotide encoding an NIN protein or an NLP protein, and one or more cytokinin response elements operably linked to the promoter. Further embodiments of this aspect include a promoter and one or more cytokinin response elements, wherein the promoter and one or more cytokinin response elements are selected from the group of: NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element up to the transcription start site of the NIN gene operably linked to the 3C region, NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element through the transcription start site of the NIN gene operably linked to the CE region, a minimal promoter operably linked to a CYCLOPS response element operably linked to the CE region, and a minimal promoter operably linked to a CYCLOPS response element operably linked to one or more cytokinin response elements. The CYCLOPS response element of the present disclosure may be a complete CYCLOPS response element or an essential CYCLOPS response element (CYC-box), as shown in Figure 5D. In a further embodiment of this aspect, the vector comprises one or more gene editing components that target a nuclear genome sequence operably linked to an endogenous NIN protein or NLP protein. Yet another embodiment of this aspect comprises a nuclear genome sequence that is edited by one or more gene editing components to introduce a cis-regulatory element selected from the group of one or more cytokinin response elements, 3C regions, or CE regions.Yet another embodiment of this aspect can be combined with any of the above aspects having a vector comprising one or more gene editing components, comprising one or more gene editing components selected from the group of a ribonucleoprotein complex targeting a nuclear genomic sequence, a vector comprising a sequence encoding a TALEN protein (wherein the TALEN protein targets a nuclear genomic sequence), a vector comprising a sequence encoding a ZFN protein (wherein the ZFN protein targets a nuclear genomic sequence), an oligonucleotide donor (ODN) (wherein the ODN targets a nuclear genomic sequence), or a vector comprising a sequence encoding a CRISPR / Cas enzyme and a target sequence (wherein the target sequence targets a nuclear genomic sequence).
[0059] Further embodiments of this aspect can be combined with any of the preceding aspects having genetic modifications introduced using a vector, including the NIN gene promoter, a 3C region, a CE region, a CYCLOPS response element, or one or more cytokinin response elements from a nodulating legume species. Further embodiments of this aspect include peanuts (e.g., Arachis duranensis, Arachis hypogaea, Arachis ipaensis), pigeon peas (e.g., Cajanus cajan), chickpeas (e.g., Cicer arietinum), soybeans (e.g., Glycine max, Glycine soja), mucuna pruriens (e.g., Mucuna pruriens), beans (e.g., Phaseolus vulgaris), peas (e.g., Pisum sativum), adzuki beans (e.g., Vigna angularis, Vigna angularis var. angularis), green beans (e.g., Vigna radiata var. radiata), clover (e.g., Trifolium pratense, Trifolium subterraneum), lupines (e.g., Lupinus angustifolius), Sesbania spp. (e.g., Sesbania rostrata), Lotus spp. (e.g., Licorice, L. spp.), and the like. The nodulating legume species is selected from the group consisting of: Bifidobacterium japonicus, and Medicago trula.Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector that includes a 5' upstream NIN sequence, a 3C region, a CE region, a CYCLOPS response element, or one or more cytokinin response elements from a nodulating legume species, and is selected from the group consisting of SEQ ID NO:551, SEQ ID NO:552, SEQ ID NO:553, SEQ ID NO:554, SEQ ID NO:555, SEQ ID NO:556, SEQ ID NO:557, SEQ ID NO:558, SEQ ID NO:559, SEQ ID NO:560, SEQ ID NO:561, SEQ ID NO:562, SEQ ID NO:563, SEQ ID NO:564, SEQ ID NO:565, SEQ ID NO:566, SEQ ID NO:567, SEQ ID NO:568, SEQ ID NO:569, SEQ ID NO:570, SEQ ID NO:571, SEQ ID NO:572, SEQ ID NO:573, SEQ ID NO:574, SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:5 and / or SEQ ID NO:575, SEQ ID NO:576, SEQ ID NO:577, SEQ ID NO:578, SEQ ID NO:579, SEQ ID NO:580, SEQ ID NO:581, SEQ ID NO:582, SEQ ID NO:583, SEQ ID NO:584, SEQ ID NO:585, SEQ ID NO:586, SEQ ID NO:587, SEQ ID NO:588, SEQ ID NO:589, SEQ ID NO:590, SEQ ID NO:591, SEQ ID NO:592, SEQ ID NO:593, SEQ ID NO:594, SEQ ID NO:595, SEQ ID NO:596, SEQ ID NO:597, SEQ ID NO:598, SEQ ID NO:599, SEQ ID NO:600, SEQ ID NO:601, SEQ ID NO:602, SEQ ID NO:603, SEQ ID NO:604, SEQ ID NO:605, SEQ ID NO:606, SEQ ID NO:607, SEQ ID NO:608, SEQ ID NO:609, SEQ ID NO:610, SEQ ID NO:611 or SEQ ID NO:612. Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector and includes a cytokinin response element selected from the group of SEQ ID NO: 613, SEQ ID NO: 614, SEQ ID NO: 615, SEQ ID NO: 616, SEQ ID NO: 617, SEQ ID NO: 618, SEQ ID NO: 619, SEQ ID NO: 620, SEQ ID NO: 621, SEQ ID NO: 622, SEQ ID NO: 623, SEQ ID NO: 624, SEQ ID NO: 625, and SEQ ID NO: 626. Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector and includes one or more cytokinin response elements from a non-nodulating species.In yet another embodiment of this aspect, which can be combined with any of the previous aspects having a genetic modification introduced by a vector, the one or more cytokinin response elements from a non-nodulating species are SEQ ID NO: 613. Further embodiments of this aspect, which can be combined with any of the previous aspects having a genetic modification introduced by a vector, include one or more cytokinin response elements from a non-nodulating non-legume species. Further embodiments of this aspect, which can be combined with any of the previous aspects having a genetic modification introduced by a vector, include a cytokinin response element selected from the group of SEQ ID NO: 613, SEQ ID NO: 614, SEQ ID NO: 679, SEQ ID NO: 680, SEQ ID NO: 681, SEQ ID NO: 682, SEQ ID NO: 683, SEQ ID NO: 684, SEQ ID NO: 685, or SEQ ID NO: 686.
[0060] Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the genetic modification being an NIN / NLP1 orthogroup protein and comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO: 26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, Column number 62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97 8, SEQ ID NO:99, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151,SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, Column number 184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO: at least 7 amino acid sequences selected from the group consisting of SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:232, SEQ ID NO:233, SEQ ID NO:234, SEQ ID NO:235, SEQ ID NO:236, SEQ ID NO:687, SEQ ID NO:688, SEQ ID NO:689, SEQ ID NO:690, SEQ ID NO:691, SEQ ID NO:692 or SEQ ID NO:693; 0% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity,These include NIN or NLP proteins having at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Yet another embodiment of this aspect, which may be combined with any of the preceding aspects having a genetic modification introduced using a vector, is a NIN protein and is selected from the group consisting of SEQ ID NO:22 (i.e., CsaNIN; Cannabis sativa), SEQ ID NO:78 (i.e., HluNIN; Humulus lupulus), SEQ ID NO:89 (i.e., LjNIN; Lotus japonicus), SEQ ID NO:108 (i.e., MtNIN; Medicago truncatula), SEQ ID NO:136 (i.e., PanNIN; Parasponia andersonii), SEQ ID NO:139 (i.e., PriNIN; Parasponia rigida), SEQ ID NO:142 (i.e., PruNIN; Parasponia rugosa), SEQ ID NO:185 (i.e., TleNIN; Trema levigata; a truncated form of NIN), SEQ ID NO:187 (i.e., TorNIN; Trema orientalis; a truncated form of NIN), SEQ ID NO:190 (i.e., TtoNIN; Trema tomentosa; a truncated form of NIN), SEQ ID NO:236 (i.e., ZjuNIN; Ziziphus jujuba), SEQ ID NO:687 (i.e., AglNIN; Alnus glutinosa), SEQ ID NO:688 (i.e., CglNIN; Casuarina glauca), SEQ ID NO:689 (i.e., DglNIN.1; Datisca glomerata), SEQ ID NO:690 (i.e., DglNIN.2; Datisca glomerata), SEQ ID NO:691 (i.e., DtrNIN; Discaria trinervis), SEQ ID NO:692 (i.e., DdrNIN; Dryas drummondii), or SEQ ID NO:693 (i.e.,PtrNIN; Purshia tridentata), at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity,
[0023] Another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, and is an NIN protein and is SEQ ID NO: 89 (i.e., LjNIN; Lotus japonicus) or SEQ ID NO: 108 (i.e., MtNIN; Medicago sativa). at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity to an amino acid sequence selected from the group consisting of:These include NIN / NLP1 orthogroup proteins having at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Yet another embodiment of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the genetic modification being an NLP2-3 orthogroup protein and comprising SEQ ID NO:237, SEQ ID NO:238, SEQ ID NO:239, SEQ ID NO:241, SEQ ID NO:242, SEQ ID NO:243, SEQ ID NO:244, SEQ ID NO:245, SEQ ID NO:246, SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:254, SEQ ID NO:255, SEQ ID NO:256, SEQ ID NO:257, SEQ ID NO:258, SEQ ID NO:259, SEQ ID NO:260, SEQ ID NO:261, SEQ ID NO:262, SEQ ID NO:263, SEQ ID NO:264, SEQ ID NO:265, SEQ ID NO:266, SEQ ID NO:267, SEQ ID NO:268, SEQ ID NO:269, SEQ ID NO:270, SEQ ID NO:271, SEQ ID NO:273, SEQ ID NO:274, SEQ ID NO:275, SEQ ID NO:276, SEQ ID NO:277, SEQ ID NO:278, SEQ ID NO:279, SEQ ID NO:28 0, SEQ ID NO:281, SEQ ID NO:282, SEQ ID NO:283, SEQ ID NO:284, SEQ ID NO:285, SEQ ID NO:286, SEQ ID NO:287, SEQ ID NO:288, SEQ ID NO:289, SEQ ID NO:290, SEQ ID NO:291, SEQ ID NO:292, SEQ ID NO:293, SEQ ID NO:294, SEQ ID NO:295, SEQ ID NO:296, SEQ ID NO:297, SEQ ID NO:298, SEQ ID NO:299, SEQ ID NO:300, SEQ ID NO:301, SEQ ID NO:302, SEQ ID NO:303, SEQ ID NO:304, SEQ ID NO:305, SEQ ID NO: No. 306, SEQ ID NO: 307, SEQ ID NO: 308, SEQ ID NO: 309, SEQ ID NO: 310, SEQ ID NO: 311, SEQ ID NO: 312, SEQ ID NO: 313, SEQ ID NO: 314, SEQ ID NO: 315, SEQ ID NO: 316, SEQ ID NO: 317, SEQ ID NO: 318, SEQ ID NO: 319, SEQ ID NO: 320, SEQ ID NO: 321, SEQ ID NO: 322, SEQ ID NO: 323, SEQ ID NO: 324, SEQ ID NO: 325, SEQ ID NO: 326, SEQ ID NO: 327, SEQ ID NO: 328, SEQ ID NO: 329, SEQ ID NO: 332, SEQ ID NO: 333,SEQ ID NO:334, SEQ ID NO:335, SEQ ID NO:336, SEQ ID NO:337, SEQ ID NO:338, SEQ ID NO:339, SEQ ID NO:340, SEQ ID NO:341, SEQ ID NO:342, SEQ ID NO:343, SEQ ID NO:344, SEQ ID NO:345, SEQ ID NO:346, SEQ ID NO:347, SEQ ID NO:348, SEQ ID NO:349, SEQ ID NO:350, SEQ ID NO:351, , SEQ ID NO:352, SEQ ID NO:353, SEQ ID NO:354, SEQ ID NO:355, SEQ ID NO:356, SEQ ID NO:357, SEQ ID NO:358, SEQ ID NO:359, SEQ ID NO:360, SEQ ID NO:361, SEQ ID NO:362, SEQ ID NO:363, SEQ ID NO:364, SEQ ID NO:365, SEQ ID NO:366, SEQ ID NO:367, SEQ ID NO:368, SEQ ID NO:369, SEQ ID NO:371, SEQ ID NO:372, SEQ ID NO:373, SEQ ID NO:374, SEQ ID NO:375, SEQ ID NO:376 and SEQ ID NO:377. sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the genetic modification being an NLP4 orthogroup protein and comprising SEQ ID NO:378, SEQ ID NO:379, SEQ ID NO:380, SEQ ID NO:381, SEQ ID NO:382, SEQ ID NO:383, SEQ ID NO:384, SEQ ID NO:385, SEQ ID NO:386, SEQ ID NO:387, SEQ ID NO:388, SEQ ID NO:389, SEQ ID NO:390, SEQ ID NO:391, SEQ ID NO:392, SEQ ID NO:393, SEQ ID NO:394, SEQ ID NO:395, SEQ ID NO:396, SEQ ID NO:397, SEQ ID NO:398, SEQ ID NO:399, SEQ ID NO:400, SEQ ID NO:401, SEQ ID NO:402, SEQ ID NO:403, SEQ ID NO:404,SEQ ID NO:405, SEQ ID NO:406, SEQ ID NO:408, SEQ ID NO:409, SEQ ID NO:410, SEQ ID NO:411, SEQ ID NO:412, SEQ ID NO:413, SEQ ID NO:414, SEQ ID NO:415, SEQ ID NO:417, SEQ ID NO:418, SEQ ID NO:419, SEQ ID NO:420, SEQ ID NO:421, SEQ ID NO:422, SEQ ID NO:423, SEQ ID NO:424, SEQ ID NO:425, SEQ ID NO:426, SEQ ID NO:427, SEQ ID NO:428, SEQ ID NO:429, SEQ ID NO:430, SEQ ID NO:431, SEQ ID NO:432, SEQ ID NO:433, SEQ ID NO:434, SEQ ID NO:435, SEQ ID NO:436, SEQ ID NO:437, SEQ ID NO:438, SEQ ID NO:439, SEQ ID NO:440, SEQ ID NO:441, SEQ ID NO:442, SEQ ID NO:443, SEQ ID NO:444, SEQ ID NO:445, SEQ ID NO:446, SEQ ID NO:447, SEQ ID NO:448, SEQ ID NO:449, SEQ ID NO:450, SEQ ID NO:451, SEQ ID NO:452, SEQ ID NO:453, SEQ ID NO:455, SEQ ID NO:456, SEQ ID NO:457, SEQ ID NO:458, SEQ ID NO:459, SEQ ID NO:460, SEQ ID NO:461, SEQ ID NO:462, SEQ ID NO:463, SEQ ID NO:464, SEQ ID NO:465, SEQ ID NO:466, SEQ ID NO:467, SEQ ID NO:468, SEQ ID NO:469, Column number 470, SEQ ID NO:471, SEQ ID NO:472, SEQ ID NO:473, SEQ ID NO:474, SEQ ID NO:475, SEQ ID NO:476, SEQ ID NO:477, SEQ ID NO:478, SEQ ID NO:479, SEQ ID NO:480, SEQ ID NO:481, SEQ ID NO:482, SEQ ID NO:483, SEQ ID NO:484, SEQ ID NO:485, SEQ ID NO:486, SEQ ID NO:487, SEQ ID NO:488, SEQ ID NO:489, SEQ ID NO:490, SEQ ID NO:491, SEQ ID NO:492, SEQ ID NO:493, SEQ ID NO:494, SEQ ID NO:495, SEQ ID NO:496, SEQ ID NO:497, SEQ ID NO:498, SEQ ID NO:499, SEQ ID NO:500, SEQ ID NO: at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity to an amino acid sequence selected from the group consisting of: SEQ ID NO:501, SEQ ID NO:502, SEQ ID NO:504, SEQ ID NO:505, SEQ ID NO:506, SEQ ID NO:507, SEQ ID NO:508, SEQ ID NO:509, SEQ ID NO:510, SEQ ID NO:511, SEQ ID NO:512, SEQ ID NO:513, SEQ ID NO:514, SEQ ID NO:515, SEQ ID NO:516, SEQ ID NO:517, SEQ ID NO:518, SEQ ID NO:519, SEQ ID NO:520, SEQ ID NO:521, SEQ ID NO:522, SEQ ID NO:523, and SEQ ID NO:524;at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity, at least 86% sequence identity, at least 87 % sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity. Further embodiments of this aspect may be combined with any of the preceding aspects having a genetic modification introduced using a vector, the proximal NIN / NLP orthogroup protein and comprising SEQ ID NO:637, SEQ ID NO:638, SEQ ID NO:639, SEQ ID NO:640, SEQ ID NO:641, SEQ ID NO:642, SEQ ID NO:643, SEQ ID NO:644, SEQ ID NO:645, SEQ ID NO:646, SEQ ID NO:647, SEQ ID NO:648, SEQ ID NO:649, SEQ ID NO:650, SEQ ID NO:651, SEQ ID NO:652, SEQ ID NO:653, SEQ ID NO:654, SEQ ID NO:655, SEQ ID NO:656, SEQ ID NO:657, SEQ ID NO:658, SEQ ID NO:659, SEQ ID NO:660 at least 70% sequence identity, at least 71% sequence identity, at least 72% sequence identity, at least 73% sequence identity, at least 74% sequence identity, at least 75% sequence identity, at least 76% sequence identity, at least 77% sequence identity, at least 78% sequence identity, at least 79% sequence identity, at least 80% sequence identity, at least 81% sequence identity, at least 82% sequence identity, at least 83% sequence identity, at least 84% sequence identity, at least 85% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 661 or SEQ ID NO: 662;NIN or NLP proteins having at least 86% sequence identity, at least 87% sequence identity, at least 88% sequence identity, at least 89% sequence identity, at least 90% sequence identity, at least 91% sequence identity, at least 92% sequence identity, at least 93% sequence identity, at least 94% sequence identity, at least 95% sequence identity, at least 96% sequence identity, at least 97% sequence identity, at least 98% sequence identity, or at least 99% sequence identity.
[0061] Further embodiments of this aspect that can be combined with any of the preceding embodiments include, prior to step (a), knocking out an endogenous NIN or NLP gene to generate a nin knockout mutant, and confirming successful complementation of the nin knockout mutant with any one of the constructs comprising nucleotides encoding the NIN or NLP protein of the preceding embodiments by screening or selecting a plant cell, tissue, or other explant prior to step (b), screening or selecting a plantlet between steps (b) and (c), or screening or selecting a plantlet after step (c).
[0062] Further aspects of the present disclosure include a method of cultivating a genetically modified plant of any of the aforementioned embodiments having a genetically modified plant, the method comprising planting a genetically modified seedling, a genetically modified plantlet, a genetically modified cutting, a genetically modified tuber, a genetically modified root, or a genetically modified seed in soil to produce a genetically modified plant, or grafting the genetically modified seedling, the genetically modified plantlet, or the genetically modified cutting to a root stock or a second plant grown in soil to produce a genetically modified plant; cultivating the harvestable seed, the harvestable leaf, the harvestable root, the harvestable cutting, the harvestable tree, the harvestable fruit, the harvestable kernels, the harvestable tuber, and / or the harvestable grain; and harvesting the harvestable seed, the harvestable leaf, the harvestable root, the harvestable cutting, the harvestable tree, the harvestable fruit, the harvestable kernels, the harvestable tuber, and / or the harvestable grain.
[0063] Molecular Biology Methods for Producing Genetically Modified Plants and Plant Cells One embodiment of the present invention provides a genetically modified plant or plant cell comprising one or more modified cis-regulatory elements and / or introduced cis-regulatory elements. For example, the present disclosure provides a genetically modified plant having the addition of one or more cytokinin response elements operably linked to a nucleic acid encoding an NIN protein or an NLP protein, where the one or more cytokinin response elements have been introduced by genetic modification of the plant, the nucleic acid encoding an NIN protein or an NLP protein has been introduced by genetic modification of the plant, or both the one or more cytokinin response elements and the nucleic acid encoding an NIN protein or an NLP protein have been introduced by genetic modification of the plant.
[0064] The transformation and generation of genetically modified monocotyledonous and dicotyledonous plant cells are well known in the art.See, for example, Weising, et al., Ann. Rev. Genet. 22:421-477 (1988); U.S. Patent No. 5,679,558; Agrobacterium Protocols, ed: Gartland, Humana Press Inc. (1995); Wang, et al. Acta Hort. 461:401-408 (1998), and Broothaerts, et al. Nature 433:629-633 (2005). The choice of method varies depending on the type of plant to be transformed, the specific application, and / or the desired result. The appropriate transformation technique can be easily selected by those skilled in the art.
[0065] Any methodology known in the art for deleting, inserting or otherwise modifying the DNA of a cell (e.g., genomic and organelle DNA) can be used in the practice of the invention disclosed herein. As an example, the CRISPR / Cas-9 system and related systems (e.g., TALEN, ZFN, ODN, etc.) can be used to insert a heterologous gene into a target site in genomic DNA or to substantially edit an endogenous gene to express a heterologous gene. For example, the Agrobacterium Disarmed Ti plasmids containing genetic constructs for target gene deletion or insertion in T. tumefaciens are used to transform plant cells, and transformed plants can then be regenerated from the transformed plant cells using procedures described in the art (e.g., EP 0116718, EP 0270822, PCT Publication WO 84 / 02913 and published European Patent Application ("EP") 0242246). The Ti plasmid vectors each contain a gene located between the border sequences, or at least to the left of the right border sequence, of the T-DNA of the Ti plasmid. Of course, other types of vectors can be used for direct gene transfer (e.g., as described in EP 0233247), pollen-mediated transformation (e.g., as described in EP 0270356, PCT Publication WO 85 / 01856, and U.S. Pat. No. 4,684,611), plant RNA virus-mediated transformation (e.g., as described in EP 0 067 553 and U.S. Pat. No. 4,407,956), liposome-mediated transformation (e.g., as described in U.S. Pat. No. 4,536,475), as well as methods for transforming certain strains of maize (e.g., U.S. Pat. No. 6,140,553; Fromm et al., Bio / Technology (1990) 8, 833-839; Gordon-Kamm et al., The Plant Cell, (1990) 2, 603-618), rice (Shimamoto et al., Nature, (1989) 338, 274-276; Datta et al., Bio / Technology, (1990) 8, 736-740), and other methods, such as those typically used to transform monocotyledonous plants (PCT Publication WO 92 / 09696). For the transformation of cotton, the methods described in PCT Patent Publication WO 00 / 71733 can be used.For soybean transformation, refer to methods known in the art, such as those of Hinchee et al. (Bio / Technology, (1988) 6, 915) and Christou et al. (Trends Biotech, (1990) 8, 145) or WO00 / 42207. Heterologous genes can be derived from closely related plant species, distantly related plant species, or basal plants (e.g., Physcomitrella genus) (Possart et al., The Plant Cell, (2017) 29, 310-330; Frangedakis et al., New Phytol, (2017) 216, 591-604).
[0066] The genetically modified plants of the present invention can be used in conventional breeding schemes to produce more genetically modified plants with the same characteristics, or to introduce the genetic modification into other varieties of the same or related plant species. The seeds obtained from the modified plants preferably contain the genetic modification as a stable insertion in chromosomal DNA or as a modification to an endogenous gene or promoter. Plants containing genetic modifications according to the present invention include plants that contain or are derived from the rootstock of a plant (e.g., a fruit tree or ornamental plant) containing the genetic modification of the present invention. Thus, any non-transgenic graft plant part that is inserted into a transformed plant or plant part is included in the present invention.
[0067] The cis-regulatory elements responsive to cytokinin signaling of the present invention contain B-type cytokinin response regulator (RR) binding sites (ie, cytokinin responsive elements). These cytokinin-responsive elements have been identified and experimentally characterized in Arabidopsis thaliana in in vitro and in vivo studies (Sakai et al., Science, (2001) 294, 1519-1521; Hosoda et al., Plant Cell, (2002) 14, 2015-2029; Imamura et al., Plant Cell Phys, (2003), 22, 122-131, Zhao et al., Nature Letters (2010), 465, 1089-1093) and shown to be conserved in rice (Ross et al., J. Exp. Bot., (2004) 55, 1721-1731). The core conserved element in B-type RR binding sites is the nucleic acid sequence GAT, flanked by 5'-(A / G) and 3'-(C / T). The cytokinin responsive element (i.e., cytokinin response element) of the present invention can be isolated from plants or synthetic materials. The cytokinin response element isolated from plants is isolated from the 5' upstream region of the NIN gene from nodulating legume species and can contain larger regions (e.g., 3C region, CE region) as shown in Figure 4A and Figures 5A-5C. The design of synthetic cytokinin response elements is described in Zurcher et al., Plant Phys, (2013) 161, 1066-1075, which is incorporated herein by reference.
[0068] The introduced cytokinin response element of the present invention can be inserted into the host cell DNA so that the inserted cytokinin response element portion is upstream (i.e., 5') of the appropriate 3'-end transcriptional regulatory signal (e.g., transcript formation and polyadenylation signal). This is preferably accomplished by inserting the cytokinin response element into the plant cell genome (nucleus or chloroplast). In some embodiments, one or more introduced cytokinin response elements are stably integrated into the nuclear genome. Stable integration exists when the nucleic acid sequence remains integrated into the nuclear genome and continues to be expressed (e.g., detectable mRNA transcripts or proteins are produced) over the next plant generation. Stable integration into and / or editing of the nuclear genome can be achieved by any method known in the art (e.g., particle bombardment, Agrobacterium-mediated transformation, CRISPR / Cas9, electroporation of protoplasts, microinjection, etc.). In some embodiments, the cytokinin response element of the present invention is inserted into the host cell DNA together with the NIN or NLP gene. Preferred polyadenylation and transcript formation signals include those from the nopaline synthesis gene (Depicker et al., J. Molec Appl Gen, (1982) 1, 561-573), the octopine synthesis gene (Gielen et al., EMBO J, (1984) 3:835 845), the SCSV or Malic enzyme terminator (Schunmann et al., Plant Funct Biol, (2003) 30:453-460), and the T DNA gene 7, which acts as a 3' untranslated DNA sequence in transformed plant cells (Velten and Schell, Nucleic Acids Res, (1985) 13, 6981 6998).
[0069] The introduced cytokinin response element is preferably operably linked to a plant-expressible promoter. As used herein, "plant-expressible promoter" refers to a promoter that ensures the expression of the genetic modification of the present invention in plant cells. The plant-expressible promoter can be the 5' upstream region of a plant gene (such as the 5' upstream region of the NIN gene from a nodulating legume species), which can include a 3C region, a CE region, and / or a CYCLOPS response element. The CYCLOPS response element of the present disclosure can be a complete CYCLOPS response element or an essential CYCLOPS response element (CYC-box), as shown in Figure 5D. In addition, the plant-expressible promoter can be a constitutive promoter. In addition, the plant-expressible promoter can be a tissue-specific promoter, such as a promoter that directs higher levels of expression in some cells or tissues of a plant (e.g., in root sheath cells).
[0070] In a preferred embodiment, the promoter and other components (i.e., NIN gene promoter) from the 5' upstream region of the NIN gene from a nodulating legume species are used.Non-limiting examples include the NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element up to the transcription start site of the NIN gene operably linked to the 3C region, the NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element up to the transcription start site of the NIN gene operably linked to the CE region, the NIN gene promoter comprising a 5' upstream sequence comprising a CYCLOPS response element up to the transcription start site of the NIN gene operably linked to one or more cytokinin response elements, the NIN gene promoter operably linked to the 3C region, the NIN gene promoter operably linked to the CE region, and the NIN gene promoter operably linked to one or more cytokinin response elements.
[0071] Examples of constitutive promoters often used in plant cells include the cauliflower mosaic (CaMV) 35S promoter (KAY et al. Science, 236, 4805, 1987), the minimal CaMV 35S promoter (Benfey & Chua, Science, (1990) 250, 959-966), various other derivatives of the CaMV 35S promoter, the maize ubiquitin promoter (CHRISTENSEN & QUAIL, Transgenic Res, 5, 213-8, 1996), the trefoil promoter (Ljubql, MAEKAWA et al. Mol Plant Microbe Interact. 21, 375-82, 2008), the vein mosaic cassava virus promoter (International Application WO97 / 48819), and the Arabidopsis UBQ10 promoter, Norris et al. Plant Mol. Biol. 21, 895-906, 1993). In a preferred embodiment, a minimal CaMV35S promoter containing a cytokinin response element is used. Non-limiting examples include a minimal CaMV35S promoter operably linked to a CYCLOPS response element operably linked to a CE region, a minimal CaMV35S promoter operably linked to a CYCLOPS response element operably linked to one or more cytokinin response elements, a minimal CaMV35S promoter operably linked to a CE region, and a minimal CaMV35S promoter operably linked to one or more cytokinin response elements.
[0072] Further examples of promoters that direct constitutive expression in plants are known in the art and include, for example, the strong constitutive 35S promoter ("35S promoter") of the cauliflower mosaic virus (CaMV) from isolates CM1841 (Gardner et al., Nucleic Acids Res, (1981) 9, 2871-2887), CabbB S (Franck et al., Cell (1980) 21, 285 294) and CabbB JI (Hull and Howell, Virology, (1987) 86, 482 493); promoters from the ubiquitin family (e.g., the maize ubiquitin promoter from Christensen et al., Plant Mol Biol, (1992) 18, 675-689), the gos2 promoter (de Pater et al., The Plant J (1992) 2, 2871-2887), the strong constitutive 35S promoter ("35S promoter") of the cauliflower mosaic virus (CaMV) from isolates CM1841 (Gardner et al., Nucleic Acids Res, (1981) 9, 2871-2887), CabbB S (Franck et al., Cell (1980) 21, 285 294), and CabbB JI (Hull and Howell, Virology, (1987) 86, 482 493), the ubiquitin promoter (the ubiquitin promoter from the maize actin promoters such as the emu promoter (Last et al., Theor Appl Genet, (1990) 81, 581-588), the promoter described by An et al. (The Plant J, (1996) 10, 107), the rice actin promoter described by Zhang et al. (The Plant Cell, (1991) 3, 1155-1165); promoters of the cassava vein mosaic virus (WO97 / 48819, Verdaguer et al. (Plant Mol Biol, (1998) 37, 1055-1067), the Subterranean Clover Stunt virus (Subterranean Clover Stunt Virus) (WO96 / 06932, in particular the S4 or S7 promoters), the alcohol dehydrogenase promoter, e.g., pAdh1S (GenBank accession numbers X04049, X00581), and the TR1' and TR2' promoters (the "TR1' promoter" and "TR2' promoter", respectively) which drive expression of the 1' and 2' genes of T DNA, respectively (Velten et al., EMBO J, (1984) 3, 2723 2730). .
[0073] Non-limiting examples of tissue-specific promoters include the NFR1 or NFR5 / NFP promoter, in particular the lotus NFR5 promoter (SEQ ID NO: 24) and the lotus NFR1 promoter (SEQ ID NO: 25), the maize allothionein promoter (DE FRAMOND et al, FEBS 290, 103-106, 1991 application EP452269), the chitinase promoter (SAMAC et al. Plant Physiol 93, 907-914, 1990), the maize ZRP2 promoter (U.S. Pat. No. 5,633,363), the tomato LeExtl promoter (Bucher et al. Plant Physiol. 128, 911-923, 2002), the glutamine synthetase soybean root promoter (HIREL et al. Plant Mol. Biol. 20, 207-218, 1992), RCC3 promoter (PCT Application WO2009 / 016104), rice antiquitine promoter (PCT Application WO2007 / 076115), LRR receptor kinase promoter (PCT Application WO02 / 46439), and Arabidopsis pCO2 promoter (HEIDSTRA et al, Genes Dev. 18, 1964-1969, 2004). These plant promoters can be combined with enhancer elements, can be combined with minimal promoter elements, or can contain repetitive elements to ensure the desired expression profile.
[0074] In some embodiments, genetic elements can be utilized to increase expression in plant cells. For example, introns at the 5' or 3' end of the introduced gene or the coding sequence of the introduced gene, such as the hsp70 intron. Other such genetic elements include, but are not limited to, promoter enhancer elements, duplicated or triple promoter regions, 5' leader sequences that are different from another introduced gene or different from the endogenous (plant host) gene leader sequence, 3' trailer sequences that are different from another introduced gene or different from the endogenous (plant host) trailer sequence used in the same plant.
[0075] The term recombinant or modified nucleic acid refers to a polynucleotide created by the combination of two other isolated segments of sequence, accomplished by the artificial manipulation of isolated polynucleotide segments by genetic engineering techniques or chemical synthesis, whereby polynucleotide segments of desired functions can be linked together to produce a combination of desired functions.
[0076] As used herein, the term "up-regulation" refers to increased expression (e.g., of mRNA, polypeptide, etc.) compared to expression in a wild-type organism (e.g., a plant) as a result of genetic modification, with particular emphasis on up-regulation in response to a stimulus, such as cytokinin signaling. In some embodiments, the increase in expression is a small increase, about 10% more than expression in the wild-type. In some embodiments, the increase in expression is an increase of 50% or more (e.g., 60%, 70%, 80%, 100%, etc.) compared to expression in the wild-type. In some embodiments, an endogenous gene is up-regulated. In some embodiments, an exogenous gene is up-regulated by being expressed. Upregulation of genes in plants can be achieved by any method known in the art, including, but not limited to, constitutive promoters with added inducible response elements, inducible promoters, high expression promoters with added inducible response elements (e.g., the PsaD promoter), enhancers, transcriptional and / or translational regulatory sequences, codon optimization, modified transcription factors, and / or mutated or modified genes that control expression of genes that are upregulated in response to stimuli such as cytokinin signaling.
[0077] When a recombinant nucleic acid is intended to express, clone, or replicate a particular sequence, the DNA construct prepared for introduction into a host cell usually contains a replication system (e.g., a vector) recognized by the host that contains the intended DNA fragment encoding the desired polypeptide, and may also contain transcription initiation regulatory sequences and translation initiation regulatory sequences operably linked to the polypeptide-encoding segment. In addition, such a construct may contain a cellular localization signal (e.g., a plasma membrane localization signal). In a preferred embodiment, such a DNA construct is introduced into the genomic DNA, chloroplast DNA, or mitochondrial DNA of the host cell.
[0078] In some embodiments, non-integrated expression systems can be used to induce the expression of one or more introduced genes.Expression systems (expression vectors) can include, for example, replication origins or autonomously replicating sequences (ARS) and expression control sequences, promoters, enhancers and necessary processing information sites (such as ribosome binding sites, RNA splice sites, polyadenylation sites, transcription terminator sequences, and mRNA stabilization sequences).Signal peptides can also be included from secretory polypeptides of the same or related species, which allow proteins to cross and / or remain in cell membranes, cell walls, or be secreted from cells, if necessary.
[0079] The selection marker useful in carrying out the methodology of the present invention disclosed herein can be a positive selection marker. Typically, positive selection refers to the case where genetically modified cells can survive in the presence of a toxic substance only if the recombinant polynucleotide of interest is present in the cell. Negative selection markers and screenable markers are also well known in the art and are contemplated by the present invention. Those skilled in the art will recognize that any available related markers can be utilized in carrying out the present invention disclosed herein.
[0080] Screening and molecular analysis of the recombinant strains of the present invention can be performed using nucleic acid hybridization techniques. Hybridization procedures are useful for identifying polynucleotides, such as those modified using the techniques described herein, that have sufficient homology with the subject regulatory sequence to be useful as taught herein. A specific hybridization technique is not essential to the present invention. As improvements in hybridization techniques are made, they can be easily applied by those skilled in the art. Hybridization probes can be labeled with any suitable label known to those skilled in the art. Hybridization and washing conditions (e.g., temperature and salt concentration) can be altered to change the stringency of detection threshold. For further guidelines regarding hybridization conditions, see, for example, Sambrook et al. (1989) vide infra or Ausubel et al. (1995) Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY.
[0081] Furthermore, screening and molecular analysis of genetically modified strains, as well as the production of desired isolated nucleic acids, can be carried out using polymerase chain reaction (PCR). PCR is the repetitive, enzymatic, preparatory synthesis of nucleic acid sequences. This procedure is well known to those skilled in the art and is commonly used (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al. (1985) Science 230:1350-1354). PCR is based on the enzymatic amplification of a DNA fragment of interest flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with their 3' ends pointing towards each other. Repeated cycles of thermal denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers by DNA polymerase result in the amplification of the segment defined by the 5' ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA template produced in the previous cycle. This results in an exponential accumulation of specific target fragments, up to millions of times in a few hours. The amplification process can be fully automated by using a thermostable DNA polymerase, such as Taq polymerase, which is isolated from the thermophilic bacterium Thermus aquaticus. Other enzymes that can be used are known to those skilled in the art.
[0082] The nucleic acids and proteins of the present invention may also encompass homologues of the sequences specifically disclosed for the NIN and NLP proteins. Homology (e.g., sequence identity) may be 50% to 100%. In some instances, such homology is greater than 80%, greater than 85%, greater than 90%, or greater than 95%. The degree of homology or identity required for any intended use of the sequence is easily identified by those skilled in the art. As used herein, the percent sequence identity of two nucleic acids is determined using algorithms known in the art, as disclosed by Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268 and modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990) J. Mol. Biol. 215:402-410. To obtain nucleotide sequences with a desired percent sequence identity, BLAST nucleotide searches are performed using the NBLAST program (score=100, word length=12). To obtain gapped alignments for comparison purposes, Gapped BLAST is used as described in Altschul et al. (1997) Nucl. Acids. Res. 25:3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) are used. See www.ncbi.nih.gov.
[0083] A preferred host cell is a plant cell. A recombinant host cell, in this context, is one that has been genetically modified to contain an isolated nucleic acid molecule, and contains one or more deleted or otherwise non-functional genes that are normally present and functional in the host cell, or contains one or more genes that produce at least one recombinant protein. The nucleic acid encoding the protein of the present invention can be introduced by any means known in the art that is appropriate for the particular type of cell, including, but not limited to, transformation, lipofection, electroporation, or any other methodology known to those skilled in the art.
[0084] Having generally described the invention, the invention will be better understood by reference to specific embodiments, which are included herein to further illustrate the invention and are not intended to limit the scope of the invention, which is defined by the claims.
[0085] [Example] The present disclosure will be described in more detail in the following examples, but these examples are not intended to limit the scope of the present disclosure as claimed in any way.The accompanying drawings are intended to be considered as an integral part of the specification and description of the present disclosure.The following examples are provided for illustration, but are not provided to limit the disclosure as claimed.
[0086] Example 1: An upstream cytokinin-responsive cis-element is required for expression of NIN in the pericycle to allow full complementation The following examples show that NIN is required for nodule primordium formation in M. truncatula. We describe the identification of a cis-regulatory cytokinin-responsive element located in the 5'-upstream region, the importance of which was demonstrated by complementing the M. truncatula nin-1 mutant.
[0087] material and method Plant material and growth, hairy root transformation and rhizobia inoculation: M. truncatula ecotype Jemalong A17 was used as wild-type plants. Agrobacterium rhizogenes (A. rhizogenes) msu440-mediated hairy root transformation was performed as described by Limpens et al., 2004 (Limpens et al., J. Exp. Bot., (2004) 55, 983-992). M. truncatula plants were grown in perlite saturated with low nitrate [0.25 mM Ca(NO3)2] containing Farhaeus (Fa) medium at 21°C and a 16-h light / 8-h dark regime. After 1 week of growth, plants were inoculated with Sinorhizobium meliloti (S. meliloti) RCR2011 (strain RCR2011.pHC60) constitutively expressing GFP or carrying the PronifH:GFP reporter, which were used for experimental purposes but were not required for complementation (OD 600 = 0.1, 2 mL per plant). Plants growing on Fa plates were spot inoculated with 0.5 μL of the rhizobial suspension per root.
[0088] Constructs: Using genomic DNA of M. truncatula as template, various segments of DNA of the NIN gene (including the 3'UTR) and promoter region were generated by PCR using Phusion high-fidelity DNA polymerase (Finnzymes) and the primers listed in Table 1. The DNA segments used for pENTR-D-TOPO cloning (Invitrogen) were amplified with a forward primer containing an additional 5'-CACC sequence. The forward primer containing an attB4 site (GGGGGACAACTTTGTATAGAAAAGTTGNN, SEQ ID NO: 627) and the reverse primer with an attB1 site (GGGGACTGCTTTTTTGTACAAACTTGN, SEQ ID NO: 628) were used to generate DNA segments for cloning into the vector pDONOR P4-P1 by BP recombination (Invitrogen). A forward primer with attB2 (GGGGGACAGCTTTCTTGTACAAAGTGGAA, SEQ ID NO: 629) and a reverse primer with attB3 (GGGGACAACTTTGTATAATAAAGTTGC, SEQ ID NO: 630) were used to amplify a DNA fragment for cloning into vector pDONOR P2-P3. Two rounds of PCR were used to create three deletions corresponding to three domains (D1, D2, and D3) in the cytokinin response element-containing (CE) region, as well as a deletion of a putative CYCLOPS binding site in the -5 kb region (see, for example, Figures 5A-5C). In the first round of PCR, the two DNA fragments separated by the deletions were amplified with specific primers to introduce a 15 bp overhang.The following specific primers were used in the first round of PCR: ProNIN-ΔD1-R and ProNIN-ΔD1-F (to create a deletion in the D1 domain), ProNIN-ΔD2-R and ProNIN-ΔD2-F (to create a deletion in the D2 domain), ProNIN-ΔD3-R and ProNIN-ΔD3-F (to create a deletion in the D3 domain), and ProNIN-ΔCYCLOPS-R and ProNIN-ΔCYCLOPS-F (to create a deletion in the CYCLOPS binding site) (Table 1). Subsequently, the PCR products were purified and mixed, and 5 μL of the mixture made in the first round of PCR was used as a template for the second round of PCR. In the second round of PCR, primers ProNIN-CE-F and ProNIN-CE-R, ProNIN-5kb-F and ProNIN-0kb-R, or ProNIN-2.2kb-F and ProNIN-0kb-R (Table 1) were used to generate single amplicons with deletions in the CE, -2.2kb, or -5kb regions. The entry vector was recombined into the modified Gateway binary vector pKGW-R-MGW (Ovchinnikova et al., Spp. Mol. Plant. Microbe. Interact., (2011) 24, 1333-1344) using multisite LR recombination (Invitrogen). Constructs generated using the primers listed in Table 1 were ProNIN. 2.2kb :NIN, ProNIN 5kb :NIN, ProNIN 5kb(Δcyclops) :NIN, ProNIN 3C-5kb :NIN, ProNIN CE-5kb :NIN, ProNIN CE-35Smin :NIN, ProNIN CE(ΔD1)-5kb :NIN, ProNIN CE(ΔD2)-5kb :NIN, and ProNIN CE(ΔD3)-5kb :It was NIN. [Table 1]
[0089] Histological analysis and microscopy: Transgenic roots carrying ProNIN:GUS constructs were incubated in GUS buffer [3% sucrose, 10 mM EDTA, 2 mM k-ferrocyanide, 2 mM k-ferricyanide, 0.5 mg / mL X-Gluc in 0.1 M phosphate buffer (pH = 7)] for 1-2 h at 37 °C. Embedding of plant tissues in plastic, sectioning, and staining were performed as described by Xiao et al. (Xiao et al., Development, (2014) 141, 3517-3528). Sections were analyzed using a DM5500B microscope equipped with a DFC425C camera (Leica). Bright-field and fluorescent images of transgenic roots and root nodules were taken using a stereomacroscope (M165 FC, Leica). Confocal images were taken using an SP8 (Leica) microscope. Excitation wavelengths of 488 nm and 543 nm were used for GFP and propidium iodide, respectively.
[0090] RNA isolation and qRT-PCR: RNA was isolated from 1-week-old M. truncatula A17 and daphne-like roots using the EZNA Plant RNA mini kit (Omega Bio-tek, Norcross, GA, USA). 1 μg of isolated RNA was used for cDNA synthesis using the iScript cDNA synthesis kit (Bio-Rad). Real-time qPCR was performed in 10 μl reactions using SYBR Green Supermix (Bio-Rad) and a CFX Real-Time System (Bio-Rad). Gene expression levels were determined using the primers listed in Table 1 with "qPCR" in the primer name. Gene expression levels were normalized using ACTIN2 as a reference gene.
[0091] Induction of expression with cytokinin: To determine whether gene expression was induced by cytokinin, roots of M. truncatula A17 (WT) and daphne-like roots were cultured for 10 min at 4 °C for 1 h. -7The cells were treated with either M benzylaminopurine (BAP) or water for 16 h. qRT-PCR analysis of the genes NIN and NF-YA1 was then performed using the primers listed in Table 1. This experiment was repeated for a total of three biological replicates.
[0092] Quantification of colonies, infection threads, and nodules: To quantify the number of curled root hairs containing colonies or infection threads, more than 20 transgenic roots (5-10 cm long) were cut into approximately 1 cm pieces, randomly selected and counted. To quantify the number of nodules per root, transgenic roots 5-10 cm long were selected.
[0093] RNA in situ hybridization: Roots of M. truncatula were fixed with 4% paraformaldehyde mixed with 3% glutaraldehyde in 50 mM phosphate buffer (pH=7.4) and embedded in paraffin (Paraplast X-tra, McCormick Scientific). Root sections of 7 μm were prepared by RJ2035 microtome (Leica). RNA in situ hybridization was performed using the Invitrogen ViewRNA™ ISH Tissue 1-Plex Assay kit (ThermoFisher Scientific) according to the instructions in the user manual (available at cdn.panomics.com under the directory downloads / 17400RevF%20140822_ViewRNA%20ISH%20Tissue%201-Plex.pdf). RNA ISH probe sets were designed and synthesized at the request of ThermoFisher Scientific. The catalog numbers of the probes were VF1-20312 for Mt NIN, VF1-6000865 for Mt CRE1, VF1-6000866 for Mt RR1, and VF-20311 for Mt NF-YA1. A typical probe set consisted of about 20 pairs of oligonucleotide probes (20 nt long) that hybridized to specific regions across the target mRNA. Each probe consisted of a region of about 20 nucleotides, a short linker region, and a tail sequence. The two tail sequences (double Z) together formed a site for signal amplification. Such a design ensured increased background control by reducing the chance of non-specific hybridization events being amplified. For nodulation-specific genes, non-inoculated roots were used as negative controls. For ISH with CRE1 and RR1 performed on non-inoculated roots, the ENOD2 (nodule-specific gene) probe set was used as a negative control. Images were taken with an AU5500B microscope equipped with a DFC425c camera (Leica).
[0094] Map-based cloning of daphne-like: A segregating F2 population was generated (118 plants) from a cross between M. truncatula FN8113 (cv Jemand A17) and M. truncatula Jemalong A20. This population showed an approximately 3:1 ratio of Nod+:Nod- plants (118 F2 plants; 84 Nod+:34 Nod-). The 3:1 ratio indicated that FN8113 carries a single recessive mutation responsible for its Nod- phenotype. DNA was extracted using standard CTAB DNA miniprep methods. Simple sequence repeat (SSR) markers based on Mun et al. (Mun et al., Genetics, (2006) 172, 2541-2555) were first used to determine the overall chromosomal location of the FN8113 locus. The mutation was shown to map to the end of chromosome 5, where NIN is located. An additional SSR marker for the FN8113 locus on chromosome 5 was then developed and used for chromosome walking. PCR was performed using 100 ng of genomic DNA and analyzed on a 2.5% agarose gel. The SSR marker JH5.17 on the BAC clone CU424494 (Table 1) showed the closest linkage to the FN8113 locus. No crossover was found at the distal end of chromosome 5. Whole genome sequencing (Illumina Hiseq2000, paired-end) was then used to identify mutations in the genomic region identified from gene mapping. This revealed a translocation of approximately 2.49 Mbp region from chromosome 2 to chromosome 5, which had been inserted 4120 bp upstream of the NIN start codon (-4120). In addition, a small deletion of 15 bp between -4121 and -4135 was detected (Figure 1H). No mutations were found in the NIN coding sequence. The genomic sequence of the mutated region is provided as SEQ ID NO:525.Clean DNA sequence reads were mapped to the M. truncatula genome published by Young et al. (Young et al., Nature, (2011) 480, 520-524) using the bwa_mem algorithm (Li and Durbin, Bioinformatics, (2010) 26, 589-595). Clipped reads and mismapped mate pairs revealed interchromosomal translocations, and mutation-spanning reads were further confirmed by aligning to the genome using BLASTN.
[0095] Alignment of NIN upstream regions: Most of this work was performed using Geneious v8.1.9 (https: / / www.geneious.com) (Kearse et al., Bioinformatics, (2012) 28, 1647-1649). M. truncatula NIN protein sequences were BLASTed against a custom BLAST database using Geneious v8.1.9 (Altschul et al., J. Mol. Biol., (1990) 215, 403-410; Kearse et al., Bioinformatics, (2012) 28, 1647-1649). A diverse selection of legume species with good quality publicly available genome sequences was used: Medicago truncatula (Young et al., Nature, (2011) 480, 520-524), Lotus japonicus (Sato et al., DNA Res., (2008) 15, 227-239), Arachis duranensis (Bertioli et al., Nat. Genet., (2016) 48, 438-446), Cicer arietinum (Varshney et al., Nat. Biotechnol., (2013) 31, 240-246), Glycine max (Schmutz et al., Nature, (2010) 463, 178-183), Lupinus angustifolius (Hane et al., Plant Biotechnol. J., (2013) 31, 240-246), and others. (2017) 15, 318-330), Cajanus cajan (Varshney et al., Nat. Biotechnol., (2012) 30, 83-89), and Trifolium pratense (De Vega et al., Sci. Rep., (2015) 5). Selected NIN scaffolds (Table 2) and up to 80 kb upstream and 10 kb downstream of the NIN were extracted from the genomes of these legume species.The selected sequences were custom aligned using the mVISTA web-based alignment tool (http: / / genome.lbl.gov / vista / mvista; Frazer et al., Nucleic Acids Res., (2004) 32, 273-279). The alignment program chosen was the Shuffle-Lagann global alignment program that detects rearrangements (Brudno et al., Bioinformatics, (2003) 19, i54-i62). Apart from this larger scale alignment, individual alignments were performed using MAUVE as a Geneious plugin (Darling et al., Genome Res., (2004) 14, 1394-1403), which allowed to determine more precisely the conserved sequences relative to the NIN start codon in all species. A complete overview of the detected conserved regions can be found in Table 2.
[0096] [Table 2] Alignment of CE regions and prediction of binding sites: The detected conserved sequences of CE regions for the selected scaffolds (Table 2) were analyzed using the Geneious plugin (Katoh, Alignment was performed using MAFFTv7.017 as a template (Nucleic Acids Res., (2002) 30, 3059-3066). Conserved binding sites were predicted using PlantPAN2.0 (Chow et al., Nucleic Acids Res., (2016) 44, D1154-D1164). Some sites were added manually based on homology to previously published putative B-type RR binding sequences (Heyl and Schmulling, Curr. Opin. Plant Biol., (2003) 6, 480-488; Hosoda et al., Plant Cell, (2002) 14, 2015-2029; Imamura et al., Plant Cell Physiol., (2003) 44, 122-131).
[0097] result Isolation of a novel M. truncatula nin mutant with segregated infection and nodulation: Nod-mutant FN8113 was identified by screening a population of plants obtained from fast neutron irradiation mutagenized M. truncatula seeds (Noble Research Institute, LLC., Ardmore USA). This mutant was named daphne-like because its phenotype was remarkably similar to that of the L. japonicus daphne mutant. As shown in Figure 1D and Figure 1E, 3 weeks after inoculation with S. meliloti, daphne-like showed excessive infection thread formation compared to WT (Figure 1A and 1B), whereas nodulation was strongly impaired compared to the wild type. Root hair curling of daphne-like (Figure 1F) was similar to that of WT in that trapped bacteria formed colonies and infection threads were formed (Figure 1C). The number of infection threads in WT and daphne-like roots was quantified 2 weeks after inoculation; this showed that the number of infection threads in daphne-like was more than 10-fold higher than that in WT (Fig. 1I). The majority of infection threads were terminated in daphne-like root hairs. However, longitudinal sections of roots showed that some infection threads (indicated by arrows) could reach the cortical cell layer (Fig. 1G). Fig. 1G also shows that some cortical cells could divide locally around the infection threads (indicated by arrowheads), but cell division in the inner root cell layer was not induced. In the inner root cell layer, nodule primordia are initiated in WT plants.
[0098] The 5 kb upstream region of Mt NIN contains distinct regulatory sequences for root hair curling and infection: The daphne-like phenotype indicated that the NIN regulatory sequences required for primordium formation are located 4120 bp upstream of its start codon. Furthermore, the phenotype indicated that the regulatory sequences located within this 4120 bp region are sufficient for proper root hair curling and infection thread formation. To confirm this, the 5 kb region upstream of the start codon was used to drive expression of NIN. ProNIN 5kbNIN was introduced into roots of M. truncatula nin-1 (null mutant) (Marsh et al., Plant Physiol., (2007) 144, 324-335) by A. rhizogenes-mediated root transformation. At 4 weeks postinoculation (4wpi), 41 of 44 analyzed transgenic roots showed excessive infection thread formation (Fig. 2B-2D). Despite numerous infections, these roots did not form nodules, except for one root in which four nodules were observed (Fig. 2B-2D). Longitudinal sections of infected transgenic roots confirmed that cell division was not induced in the endothelium, endodermis, or inner cortical cell layers (Fig. 2A). Fig. 2A also shows that infection threads were arrested in the epidermis, but sometimes reached the cortex. These data demonstrate that the 5 kb promoter region is sufficient for infection thread formation but lacks the regulatory sequences for primordium formation.
[0099] A single putative CYCLOPS / Mt IPD3 binding site was previously known to be located approximately -3 kb upstream of the initiation codon (Figures 4A and 5D, Table 2) (Singh et al., Cell Host Microbe, (2014) 15, 139-152). Therefore, we created a construct using the -2.2 kb upstream region to drive expression of NIN (ProNIN 2.2kb We developed a novel NIN construct (ProNIN:NIN construct) to determine whether the function of NIN in the epidermis is entirely dependent on the putative CYCLOPS binding site (Figures 5A-5C). This construct was then expressed as ProNIN by transforming nin-1 using A. rhizogenes-mediated hairy root transformation. 5kb nin-1 null mutants transformed with the empty vector had excessive root hair curling, but failed to form infection threads and microcolonies. 2.2kbAll 37 analyzed roots transformed with the NIN constructs showed tight root hair curls that trapped bacterial colonies; however, infection threads were rare (Figures 2E-2G). 2.2kb In :NIN transgenic roots, 298 curled root hairs containing bacterial colonies were analyzed. However, only about 3% had infection threads. These data indicate that root hair curling and the construction of infection chambers are independent of the putative CYCLOPS binding site. In contrast, about 70% of the curled root hairs were found to be harboring ProNIN 5kb :Infection threads were formed in NIN transgenic roots (n=324). These results indicated that the -5kb to -2.2kb region contains regulatory sequences important for infection thread formation. The observed phenotypes were reminiscent of those of L. japonicus and M. truncatula cyclops-3lipd3-2 mutants (Yano et al., Proc. Natl. Acad. Sci. USA, (2008) 105, 20540-20545; Horvath et al., Mol. Plant-Microbe Interact., (2011) 24, 1345-1358). L. japonicus and M. truncatula cyclops-3lipd3-2 mutants have a phenotype in which bacteria colonize tightly curled root hairs, but infection threads fail to form. Taken together, these results indicate that the -2.2 kb upstream region is sufficient to activate NIN expression in the epidermis at an expression level that results in tight root hair curling. This tight curling allows rhizobia to colonize inside the pockets of the curl. However, additional regulatory sequences located between -5 kb upstream and -2.2 kb upstream, possibly involving putative CYCLOPS binding sites, are required for efficient infection thread formation. To test this, we tested nin-1 roots transformed with NIN driven by a -5kb promoter in which the putative CYCLOPS binding site was deleted (ProNIN5kb(ΔCYCLOPS):NIN) (Figure 2K-2M). By deleting the putative CYCLOPS binding site, the number of curled root hairs with microcolonies that formed infection threads was reduced from 70% to 7% (n=434). This result indicated that the putative CYCLOPS binding site within the NIN promoter is essential for efficient infection thread formation.
[0100] A conserved region containing putative cytokinin response elements is located approximately 18 kb upstream of the Mt NIN coding region: ProNIN, as described above. 5kbDaphne-like as well as nin-1 transformed with NIN were able to induce infection thread formation but were unable to induce nodule primordium formation. To identify the distant regulatory region located upstream of the -5 kb region, we compared the genomic DNA sequences spanning from the start of the NIN coding region to the first upstream gene in eight legume species (M. truncatula, L. japonicus, Arachis duranensis, Cicer arietinum, Glycine max, Lupinus angustifolius, Cajanus cajan, and Trifolium pratense). Far upstream of the NIN start codon, we identified a DNA sequence with three conserved regions (3Cs) (Figs. 3 and 4A, Table 2). In M. truncatula, the 3Cs were located 15–20 kb upstream of the NIN start codon, whereas in L. japonicus, the 3Cs were located between 42–49 kb upstream (Table 2). The level of similarity observed in the conserved portion of 3C was similar to that observed in the NIN coding region (Figure 3). The second region in 3C was the most conserved and contained approximately 10 putative B-type cytokinin signaling response regulator (RR) binding sites (Figures 3, 4A, and 5A-5C) (Sheen, Science, (2002) 296, 1650-1652; Heyl and Schmulling, Curr. Opin. Plant Biol., (2003) 6, 480-488; Hosoda et al., Plant Cell, (2002) 14, 2015-2029; Imamura et al., Plant Cell Physiol., (2003) 44, 122-131). Therefore, we designated this region the cytokinin response element-containing (CE) region.
[0101] The CE region contains regulatory elements necessary for nodule organogenesis: since the (upstream)-5 kb region was found to be sufficient for infection, to determine whether the 3C region (approximately 4 kb) contains regulatory sequences for nodule primordium formation, 3C was fused to the (upstream)-5 kb region (ProNIN 3C-5kb:NIN). ProNIN 3C-5kb NIN was introduced into nin-1 by A. rhizogenes-mediated hairy root transformation. As shown in Figure 4B, 21 of 26 transgenic roots analyzed formed approximately eight nodules per root. As described above, the CE region (approximately 1 kb) was found to contain several putative cytokinin response elements. To determine whether the CE region was sufficient to induce primordium formation, nin-1 was transformed with the CE region fused to the -5 kb region driving NIN (ProNIN CE-5kb As shown in Figure 4B, 18 of 37 transgenic roots formed approximately eight nodules per root. This data demonstrates that the CE region contains regulatory sequences required for primordium formation. Furthermore, the root-expressing ProNIN CE-5kb The number of nodules formed on roots expressing :NIN was similar to that on wild-type roots transformed with an empty vector (control) (Figure 4B). Thus, these data further demonstrate that the autoregulation of nodulation (AON) mechanism is also activated (Soyano et al., Proc. Natl. Acad. Sci. USA, (2014) 111, 14607-14612).
[0102] The pink nodules are ProNIN 3C-5kb :NIN or ProNIN CE-5kb :NIN was formed on nin-1 roots transformed with either PronifH or ProNIN. Figures 6A and 6C demonstrate that pink nodules formed on nin-1 transgenic roots. The pink coloration is derived from leghemoglobin and is a characteristic of nodules that are actively fixing nitrogen. Figures 6B and 6D show longitudinal sections of these same nodules, showing normal nodule zonation, including the meristem (M), infection zone (IF), and fixation zone (FX). By inoculating S. meliloti harboring the PronifH:GFP reporter, ProNIN CE-5kbNodules induced on NIN transgenic nin-1 roots showed that nifH was expressed in the anchoring zone (Figures 7A and 7B). Thus, CE in combination with the -5 kb region was sufficient to induce wild-type-like nodule organogenesis.
[0103] The daphne-like CE region containing the 2.49 Mbp insertion was unable to contribute to the correct expression of NIN, further demonstrating the importance of cytokinin-responsive CE regions: pink nodules were associated with ProNIN CE-5kb:NIN transformed daphne-like roots (Figure 6E). Fifteen of 17 transgenic roots analyzed at 4 weeks postinoculation formed an average of about seven nodules per root, and the excessive infection phenotype in the daphne-like background was rescued in 11 of these 17 transgenic roots. Figure 6F shows longitudinal sections of these same nodules, showing normal nodule zonation, including the meristem (M), infection zone (IF), and fixation zone (FX). This result indicated that the daphne-like phenotype was likely caused by the 2.49 Mbp insertion that prevented the function of the CE region. We therefore tested whether the CE region was sufficient to complement nodule organogenesis in daphne-like. To do this, a minimal CaMV 35S promoter (-46bp) (Benfey and Chua, Science, (1990), 250:959-966) fused to the CE region (ProNINCE-35Smin:NIN) was used to transform daphne-like roots. Figure 6G demonstrated that pink nodules were formed on the transgenic roots, whereas Figure 6H shows longitudinal sections of these same nodules, showing normal nodule zonation. Thirty-seven of the 45 transgenic daphne-like roots formed an average of four nodules per root four weeks after inoculation. This indicated that the CE region was sufficient to induce nodule organogenesis, but in combination with the -5kb region, more nodules (approximately seven per root) could be formed. Since nodulation ability could be rescued in daphne-like by the CE region driving NIN expression, it was likely that the CE region in daphne-like could not control NIN expression and could not be induced by cytokinin. Therefore, we compared the induction of NIN expression by cytokinin and water (as a control) in wild-type (Jemingald A17) and daphne-like. Compared with the control, the expression level of NIN increased 37-fold and the expression level of NF-YA1 increased 116-fold in wild-type 16 h after application of 10-7 M benzylaminopurine (BAP).On the other hand, the expression levels of NIN and NF-YA1 did not change in daphne-like (Figures 8A-B), indicating that the CE region is required for the induction of NIN expression by cytokinin and that the CE region of daphne-like could not contribute to the correct expression of NIN.
[0104] A domain containing six putative cytokinin-responsive elements is essential for nodule primordium formation: Cytokinin has been known to be a positive regulator of nodule primordium formation (Suzaki et al., 2003). et al., Front. Plant Sci., (2013) 4, 1-6). Therefore, we performed experiments to determine whether the putative cytokinin response elements in the CE region are essential for primordium formation. To this end, several deletions were created in the CE region. The CE region contains a 472 bp region, which is highly conserved in all eight studied legume species (Figure 3, Figure 4A, and Figure 5A-5C). The 472 bp region was divided into three parts, domains 1-3 (D1-D3). D1 and D3 were found to contain six and three putative cytokinin response elements, respectively. Meanwhile, D2 contained a putative AP2 binding site and a single cytokinin response element (Figure 4A and Figure 5A-5C). AP2 family transcription factors, including ERN (Ethylene response factor Required for Nodulation), are involved in regulating nodule formation (Andriankaja et al., Plant Cell, (2007) 19, 2866-2885; Middleton et al., Plant Cell Online, (2007) 19, 1221-1234; Wang et al., Plant Cell, (2014) 26, 4782-4801). To examine their respective contributions to nodule primordium formation, D1, D2 or D3 were deleted separately from the 1 kb CE region (Figure 4A and Figure 5A-5C) and these modified CE regions were fused to the -5 kb region to drive the expression of NIN. The three constructs were introduced into nin-1 by A. rhizogenes-mediated root transformation. As shown in Figure 4B and Figure 9A, deletion of D1 eliminated the ability to form nodules. In contrast, deletion of D2 had no significant effect on nodule formation (Figure 4B and Figure 9B). Deletion of D3 caused a decrease in the relative number of nodulated roots from 49% to 21%, and also reduced the average number of nodules per root from 8 to 5.4 (Figure 4B and Figure 9C). These results indicated that at least the regulatory sequence in D1 is essential for NIN-controlled nodule primordium formation.Furthermore, these data indicated that the putative cytokinin-responsive element in D1 was responsible for NIN-regulated nodule primordium formation. In contrast, the putative AP2-binding site in D2 was not essential for nodule organogenesis.
[0105] NIN expression is induced in the inner root cell layer in a non-cell-autonomous manner: a 2.2 kb upstream region of Mt NIN was known to be activated in the epidermis 24 h after application of Nod factors (Vernie et al., Plant Cell, (2015) 27, 3410-3424). However, this promoter region lacked regulatory sequences shown to be necessary for nodule organogenesis (see above). Therefore, expression of NIN in the inner root cell layer during primordium formation was assessed by in situ hybridization. Analysis was performed using the primitive stage (stage used in Figures 10A and 10B) when the pericycle cells had divided and several antipodal divisions had occurred in the inner cortical cell layers (C4 and C5). Analysis was also performed at a slightly later stage (stage used in Figures 10C and 10D) when the cortical cells had divided more extensively. At both stages, the infection thread had not yet reached the primordium. As shown in Figure 10A, at younger stages, NIN mRNA occurred in the endothelium and epidermis, but was barely detectable in dividing cortical cells. The highest expression level occurred in endothelium-derived cells. As shown in Figure 10C, at older stages, when cortical cells had divided more extensively, the expression level of NIN in cortical-derived cells was similar to that in the endothelium. The above data indicate that NIN expression was strongly induced first in the endothelium and then spread to other inner cell layers.
[0106] NF-YA1 is a direct target of NIN (Soyano et al., PLos Genet. (2013) 9). Like NIN, NF-YA1 is expressed in the epidermis, where it controls rhizobia infection (Laporte et al., J. Exp. Bot., (2014) 65, 481-494). To test whether NIN also controls NF-YA1 expression in the primordia, we performed RNA in situ hybridization using NF-YA1 as a probe. Since NF-YA1 was first induced in the paye cycle, the results demonstrated that NF-YA1 and NIN have similar expression (Figure 10B and Figure 10D). These similar expression patterns indicate that NF-YA1 may be regulated by NIN in the pericycle and other root nodule primordium cells. Furthermore, the results show that rhizobia present in the epidermis induce the expression of NIN and NF-YA1 in pericycle-derived cells.
[0107] The CE region is required for induction of NIN expression in the endothelium: To determine whether the CE region is required for NIN expression in the inner cell layer, we investigated the mechanism of NIN expression in the inner cell layer by using ProNIN CE-5kb :GUS and ProNIN 5kb We compared the expression patterns of GUS. CE-5kb :GUS and ProNIN 5kb :GUS, A17 WT The constructs were introduced into M. truncatula. Analysis was performed at an early stage of primordium development when the endothelium cells had divided and several antithetical divisions had occurred in the inner cortical cell layer. As shown in Figure 11A and Figure 11B, both constructs were expressed in the epidermis, endothelium, and endodermis, while lower signals were detected in some cortical cells. This suggests that ProNIN 5kb This was an unexpected result, as it showed that NIN is not sufficient for primordium formation in the nin-1 background. 5kb:GUS expression was induced by endogenous NIN produced in the WT background. The results further indicate that expression of NIN in the inner layer is regulated by a positive feedback loop involving NIN itself, and that the essential cis-regulatory elements required for this were located in the -5 kb promoter region.
[0108] To confirm the above, ProNIN CE-5kb :GUS and ProNIN 5kb GUS was introduced into daphne-like by A. rhizogenes-mediated transformation. In daphne-like, we showed that infection threads were formed, NIN was directed to the epidermis, and the production of the mobile signal was unaffected. However, nodule primordium formation was impaired, and there was no NIN production in the inner cell layers. Indeed, ProNIN 5kb The GUS transgenic roots showed GUS expression only in the epidermis and exodermis layers (Fig. 11C), whereas no expression was observed in the pericycle cells. In contrast, the ProNIN CE-5kb The GUS transgenic roots showed GUS expression in the epidermis, exodermis and endothelium (Fig. 11D). Furthermore, the expression of ProNIN in the daphne-like endothelium was significantly increased in the roots. CE-5kb Expression of GUS was weak, consistent with the involvement of NIN in a feedback loop that positively regulates its own expression. In this case, cell division was not induced in the endothelium due to the absence of NIN. To further demonstrate that the CE region is required for expression of NIN in the endothelium, RNA in Using situ hybridization, we examined the expression of NIN in daphne-like primordia (Figure 10E). This showed that, unlike the WT (Figure 10A), NIN was expressed in the epidermis and exodermis layers, but not in the endothelium (Figure 10E). This result indicated that the CE region is required for the expression of NIN in the endothelium. Taken together, the results demonstrate that CE-regulated expression of NIN in the endothelium precedes cell division in WT roots. These results indicate that the CE region is required for the initial induction of NIN expression in the endothelium.
[0109] Induction of NIN in the perithelium depends on NIN expression in the epidermis: The above results indicate that a migratory signal generated by Nod factor signaling in the epidermis induces NIN expression in the perithelium. In this case, NIN expression in the perithelium would depend on NIN induction in the epidermis. To test this, we used ProNIN CE-5kb :GUS and ProNIN 5kb GUS was introduced into nin-1 by hairy root transformation. In both cases, GUS was only present in the epidermis and exodermis layers, but not in the pericycle 3 weeks after inoculation (Figures S11E and S11F). Thus, these data suggest that NIN was required in the epidermis to induce expression of NIN in pericycle cells.
[0110] CRE1 and RR1 are expressed in the pericycle of uninoculated roots: The occurrence of multiple B-type RR response regulatory elements in the CE region indicated that the cytokinin signaling machinery is important for NIN transcriptional activation in the pericycle. To determine whether this is the case, we assessed the expression pattern of the cytokinin receptor CRE1 and its putative target, the B-type response regulator RR1. RR1 is expressed during nodule formation (Gonzalez-Rizzo et al., Plant Cell Online, (2006) 18, 2680-2693). Using RNA in situ hybridization, we found that CRE1 was actively transcribed in pericycle and vascular cells of uninoculated roots, but not in endodermal or cortical cells (Figure 12A). Also, B-type RR1 mRNA was present at the highest level in the pericycle and to a lesser extent in vascular cells of roots (Figure 12B). Thus, both CRE1 and RR1 are already expressed in the endothelium before rhizobia signaling is initiated, indicating that initially only the endothelium layer responds to cytokinins.
[0111] Summary: The data presented above indicate that a distant upstream regulatory region (CE) is required for the regulation of NIN expression leading to nodule organogenesis in M. truncatula. The data further indicate that regulatory sequences for the infection process are located within a 5 kb region immediately upstream of the start codon. The CE region contains several cytokinin response elements, and domain 1 (D1), which contains six cytokinin response elements, is essential for nodule primordium formation. The CE region is even more important for cytokinin-induced expression of NIN, since daphne-like mutants carrying an insertion that disrupts CE function lose this ability. Nodule primordium formation begins with the induction of NIN in the pericycle and then extends to cortical cells. Furthermore, the above data demonstrate that the cytokinin-binding genes CRE1 and RR1 are expressed in the pericycle. Taken together, the results indicate that cytokinin perception is involved in the induction of NIN at the onset of primordium formation.
[0112] During the infection process, NIN is involved in the mechanism by which root hair growth stops once the appropriate curl is formed. The regulatory sequences required for this process are located within the -2.2 kb promoter region, which lacks a putative CYCLOPS binding site. Thus, the above data indicate that in addition to CYCLOPS (IPD3 in M. truncatula), another transcription factor is involved in regulating the expression of NIN in the epidermis. Furthermore, assuming that induced expression of the -2.2 kb region is not sufficient for efficient infection thread formation, the above data indicate that the expression level of NIN in the epidermis remains below the threshold level required for infection thread formation, whereas a threshold level of expression of NIN can be reached by induced expression of the -5 kb promoter region, which contains a putative CYCLOPS binding site (Figure 13).
[0113] A model for the function of NIN during nodule primordium initiation is shown in Figure 13. After perception of Nod factors, NIN is rapidly induced in the epidermis. The -5 kb regulatory region of the NIN promoter is sufficient for both tight root curling and infection thread formation, whereas expression driven by the -2.2 kb region is sufficient only for tight root curling and formation of bacterial colonies inside the curl. A mobile signal is generated in the epidermis in a NIN-dependent manner, which then migrates to the endothelium, where it causes accumulation of cytokinin in the inner root cell layer. The CRE1 receptor in the endothelium perceives cytokinin and activates B-type RR1, further activating expression of NIN. Induction of NIN in the endothelium requires the presence of the CE region and involves a positive feedback loop involving NIN itself. The conclusion that induction of NIN in the endothelium involves a positive feedback loop involving NIN itself is supported by the results of the analysis of ProNIN in the M. truncatula wild-type background. 5kbThis finding is supported by the finding that, although GUS expression is induced in nodule primordia, the promoter region is not sufficient to trigger primordium formation. This result is similar to studies in L. japonicus, where the promoter region of NIN, which does not trigger primordium formation, is sufficient to drive GUS expression in primordia (Yoro et al., Plant Physiol., (2014) 165, 747-758; Heckmann et al., Mol. Plant-Microbe Interact, (2011) 24, 1385-1395; Kosuta et al., Plant J., (2011) 67, 929-940). NIN then directly activates the expression of NF-YA1, further stimulating cell division. This data indicates that induction of NIN in the pericycle precedes mitotic activation of pericycle cells. NIN-induced responses in the perithelium then contribute to cell division and expression of NIN in endothelial and perithelial cells.
[0114] The conclusion that induction of NIN expression in the inner root layer is required for nodule primordium formation is consistent with the observation that nodule organogenesis is restored in the L. japonicus daphne mutant by NIN driven by a heterologous Arabidopsis enhancer active in the endodermis and cortex (Yoro et al., Plany Physiol., (2014) 165, 747-758). The above results demonstrate that deletion of a region in the CE containing six cytokinin response elements blocks primordium formation, indicating that cytokinin signaling in the endodermis induces NIN expression. This is further supported by expression of the cytokinin receptor (CRE1) and B-type response regulator (RR1) in the endodermis before rhizobia signaling is initiated. These findings are consistent with previous studies showing that the CRE1 promoter region driving GUS expression is specifically expressed in endodermis / perithecia cells opposite the protoxylem poles (Boivin et al., Plant Cell Environ., (2016) 39, 2198-2209), the site where nodule primordia form (Heidstra et al., Development, (1997) 124, 1781-1787). Furthermore, the importance of the CE region for cytokinin-induced NIN expression was suggested by a daphne-like mutant that lost this ability.
[0115] The CE region is conserved in the eight legume species examined, which belong to different clades of the Papilionoideae subfamily of the Fabaceae, representing the Genistoids, IRLC, Robinioids, Milletioids and Dalbergioids clades. Thus, these data indicate that the regulation of NIN expression by cytokinins is conserved in this subfamily.
[0116] The above results indicate that after induction of NIN in the endothelium, its expression spreads to the endodermis and endodermal layer. In young nodule primordia where cortical cells have undergone antipodal division (Figures 10A and 10B), the expression of NIN and NF-YA1 is highest in the endothelium and is barely detectable in dividing cortical and endodermal cells. The above results indicate that the NIN-induced response in the endothelium contributes to cell division in the endodermis and cortical cells (Figure 13). At later stages of development, NIN is expressed in dividing cortical cells (Figures 10C and 10D).
[0117] Cell division in nodule primordia correlates with the accumulation of auxin, which occurs before the first cell division (Mathesius et al., Plant J., (1998) 14, 23-34; Suzaki et al., Development, (2012) 4006, 3997-4006). Auxin accumulation (DR5 expression) is dependent on NIN, as it does not occur in nin null mutants (Suzaki et al., Development, (2012) 4006, 3997-4006). Furthermore, ectopic expression of both NIN and NF-YA1 is sufficient to induce abnormal cell division during lateral root development (Soyano et al., PLos Genet. (2013) 9), indicating that their expression causes local accumulation of auxin. The above data indicate that cytokinin signaling in the pericycle induces the expression of NIN, leading to the local accumulation of auxin and subsequently inducing mitotic activity (Figure 13). This conclusion is supported by previous studies showing that the STY gene is a target of NF-YA1 (Hossain et al. al., Mpmi, (2016) 29, 950-964). The STY gene encodes a transcription factor that has been shown to regulate the YUCCA auxin biosynthetic genes in Arabidopsis (Eklund et al., Plant Cell, (2010) 22, 349-363; Eklund et al., Development, (2010) 137, 1275-1284; Sohlberg et al., Plant J., (2006) 47, 112-123).
[0118] [Sequence Listing Free Text] The contents of SEQ ID NO:7 are as follows: <210> 7 <400> 7 000 The contents of SEQ ID NO:97 are as follows: <210> 97 <400> 97 000 The contents of sequence number 107 are as follows: <210> 107 <400> 107 000 The contents of SEQ ID NO:110 are as follows: <210> 110 <400> 110 000 The contents of SEQ ID NO:111 are as follows: <210> 111 <400> 111 000 The contents of SEQ ID NO:112 are as follows: <210> 112 <400> 112 000 The contents of SEQ ID NO:113 are as follows: <210> 113 <400> 113 000 The contents of SEQ ID NO:114 are as follows: <210> 114 <400> 114 000 The contents of SEQ ID NO:115 are as follows: <210> 115 <400> 115 000 The contents of sequence number 116 are as follows: <210> 116 <400> 116 000 The contents of SEQ ID NO:117 are as follows: <210> 117 <400> 117 000 The contents of SEQ ID NO:118 are as follows: <210> 118 <400> 118 000 The contents of SEQ ID NO:119 are as follows: <210> 119 <400> 119 000 The contents of SEQ ID NO:120 are as follows: <210> 120 <400> 120 000 The contents of SEQ ID NO:121 are as follows: <210> 121 <400> 121 000 The contents of SEQ ID NO:122 are as follows: <210> 122 <400> 122 000 The contents of SEQ ID NO:123 are as follows: <210> one two three <400> one two three 000 The contents of SEQ ID NO:124 are as follows: <210> 124 <400> 124 000 The contents of SEQ ID NO:125 are as follows: <210> 125 <400> 125 000 The contents of SEQ ID NO:126 are as follows: <210> 126 <400> 126 000 The contents of SEQ ID NO:127 are as follows: <210> 127 <400> 127 000 The contents of sequence number 128 are as follows: <210> 128 <400> 128 000 The contents of SEQ ID NO:129 are as follows: <210> 129 <400> 129 000 The contents of sequence number 130 are as follows: <210> 130 <400> 130 000 The contents of sequence number 176 are as follows: <210> 176 <400> 176 000 The contents of SEQ ID NO:195 are as follows: <210> 195 <400> 195 000 The contents of sequence number 240 are as follows: <210> 240 <400> 240 000 The contents of sequence number 249 are as follows: <210> 249 <400> 249 000 The contents of sequence number 272 are as follows: <210> 272 <400> 272 000 The contents of sequence number 330 are as follows: <210> 330 <400> 330 000 The contents of sequence number 331 are as follows: <210> 331 <400> 331 000 The contents of sequence number 370 are as follows: <210> 370 <400> 370 000 The contents of sequence number 407 are as follows: <210> 407 <400> 407 000 The contents of sequence number 416 are as follows: <210> 416 <400> 416 000 The contents of sequence number 454 are as follows: <210> 454 <400> 454 000 The contents of sequence number 503 are as follows: <210> 503 <400> 503 000 The contents of sequence number 613 are as follows: <210> 613 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 613 ngatn 5 The contents of sequence number 614 are as follows: <210> 614 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A, T, or G <220> <221> misc_feature <222> 5 <223> n = T or C <400> 614 natcn 5 The contents of sequence number 631 are as follows: <210> 631 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <400> 631 tgccggc 7 The contents of sequence number 679 are as follows: <210> 679 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 679 ngatn 5 The contents of sequence number 680 are as follows: <210> 680 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 680 naatn 5 The contents of sequence number 681 are as follows: <210> 681 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 681 nggtn 5 The contents of sequence number 682 are as follows: <210> 682 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 682 ngacn 5 The contents of sequence number 683 are as follows: <210> 683 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 683 nagtn 5 The contents of sequence number 684 are as follows: <210> 684 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 684 nggcn 5 The contents of sequence number 685 are as follows: <210> 685 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 685 naacn 5 The contents of sequence number 686 are as follows: <210> 686 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Construct <220> <221> misc_feature <222> 1 <223> n = A or G <220> <221> misc_feature <222> 5 <223> n = A, T, or C <400> 686 nagcn 5 [Brief description of the drawings]
[0119] [Figure 1A]Figures 1A-1I show the phenotype of Medicago truncatula daphne-like (FN8113) mutant roots and the phenotype of M. truncatula A17 wild-type (WT) roots inoculated with Sinorhizobium meliloti (rhizobia) strain RCR2011.pHC60. Figure 1A shows a stereo transmitted light macroscopic image of an infection thread in an A17 WT root (scale bar 2 mm). [Figure 1B] Figure 1B shows a stereofluorescence macroscopic image of an infection thread in an A17 WT root (scale bar 2 mm). [Figure 1C] Figures 1C and 1F show confocal images of WT (Figure 1C; Scale bar 10 μm) and daphne-like mutant roots stained with propidium iodide (Figure 1F; Scale bar 10 μm) at 7 days post-inoculation (dpi), showing that bacterial colonies (arrowheads) and infection threads (arrows) are comparable in daphne-like mutant and WT roots. [Figure 1D] FIG. 1D shows a stereo transmitted light macroscopic image of an infection thread in a daphne-like mutant root (scale bar 2 mm). [Figure 1E] Figure 1E shows a stereofluorescence macroscopic image of an infection thread in a daphne-like mutant root (scale bar 2 mm). Comparison of Figures 1A-1B with Figures 1D-1E shows that the daphne-like mutant root (Figures 1D-1E) has an excessive number of infection threads compared to the WT (Figures 1A-1B). [Figure 1F] Figures 1C and 1F show confocal images of WT (Figure 1C; Scale bar 10 μm) and daphne-like mutant roots stained with propidium iodide (Figure 1F; Scale bar 10 μm) at 7 days post-inoculation (dpi), showing that bacterial colonies (arrowheads) and infection threads (arrows) are comparable in daphne-like mutant and WT roots. [Figure 1G]Figure 1G shows a longitudinal section of a daphne-like mutant root at 3 weeks post-inoculation (wpi) stained with toluidine blue, showing that infection threads (arrows) can sometimes reach the cortical cell layer and induce some cell division (arrowheads) (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; arrows indicate infection threads; arrowheads indicate cell division). [Figure 1H] Figure 1H shows a schematic of the NIN locus in a daphne-like mutant with a 2.49 MB chromosome 2 insertion (flanking sequences shown between the arrows are SEQ ID NO:633 and SEQ ID NO:634) 4120 bp upstream of the NIN gene (thick grey arrow) start codon ("ATG" on thin black arrow). Chromosome 5 sequences, from left to right, are SEQ ID NO:632, SEQ ID NO:635, and SEQ ID NO:636. Images shown in Figures 1A-1G are representative images from multiple replicates. [Figure 1I] Figure 1I shows the mean ± SD of data from confocal images of roots 14 days post-inoculation (dpi) stained with propidium iodide (representative images of these roots are shown in Figures 1C and 1F). [Figure 2A] Figures 2A-2M show partial complementation of the infection process in M. truncatula nin-1 mutant roots by introducing the construct ProNIN5kb:NIN, the construct ProNIN2.2kb:NIN, or the construct ProNIN5kb(Δcyclops):NIN using Agrobacterium rhizogenes-mediated transformation. Figure 2A shows a longitudinal section of a nin-1 mutant root transformed with ProNIN5kb:NIN, stained with toluidine blue, showing an infection thread (arrow) that can reach the cortical cell layer (Scale bar 50 µm; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; arrows indicate infection threads). [Figure 2B] Figure 2B shows a stereo transmitted light macroscopic image of a nin-1 mutant root transformed with ProNIN5kb:NIN, revealing excessive infection thread formation (scale bar 2 mm). [Figure 2C] Figure 2C shows stereofluorescence macroscopic images of nin-1 mutant roots transformed with ProNIN5kb:NIN, revealing excessive infection thread formation (scale bar 2 mm). [Figure 2D] Figure 2D shows confocal images of nin-1 mutant roots transformed with ProNIN5kb:NIN roots stained with propidium iodide, revealing infection thread formation initiated (long white lines) in curled root hairs (scale bar 10 μm). [Figure 2E] FIG. 2E shows a stereo transmitted light macroscopic image of a nin-1 mutant root transformed with ProNIN2.2kb:NIN, revealing numerous curled root hairs (scale bar 2 mm). [Figure 2F] Figure 2F shows a stereofluorescence macroscopic image of nin-1 roots transformed with ProNIN2.2kb:NIN, revealing numerous curled root hairs (scale bar 2 mm). [Figure 2G] Figure 2G shows a confocal image of nin-1 mutant roots transformed with ProNIN2.2kb:NIN roots stained with propidium iodide, revealing bacterial curl colonies (dense white shapes) inside the curled root hairs but no infection thread formation (scale bar 10 μm). [Figure 2H] FIG. 2H shows a stereo transmitted light macroscopic image of a nin-1 mutant root transformed with an empty vector and lacking an infection thread (scale bar 2 mm). [Figure 2I] FIG. 2I shows a stereofluorescence macroscopic image of a nin-1 mutant root that had been transformed with an empty vector and does not have an infection thread (scale bar 2 mm). [Figure 2J] Figure 2J shows a confocal image of a nin-1 mutant root transformed with an empty vector stained with propidium iodide, revealing excessive root hair curling without bacterial colonies (scale bar 10 μm). [Figure 2K]Figure 2K shows a stereo transmitted light macroscopic image of nin-1 roots transformed with ProNIN5kb(Δcyclops):NIN, revealing numerous curled root hairs (scale bar 2 mm). [Figure 2L] Figure 2L shows a stereofluorescence macroscopic image of nin-1 roots transformed with ProNIN5kb(Δcyclops):NIN, revealing numerous curled root hairs (scale bar 2 mm). [Figure 2M] Figure 2M shows confocal images of nin-1 mutant roots transformed with ProNIN5kb (Δcyclops):NIN roots stained with propidium iodide, which exhibit bacterial curl colonies (dense white shapes) inside the curled root hairs but no infection thread formation (Scale bar 10 µm). Figures 2A-2M show images of roots collected at 4 wpi inoculation with S. meliloti RCR2011.pHC60 constitutively expressing GFP. Images shown in Figures 2A-2M are representative images from multiple replicates. [Diagram 3] Figure 3 shows mVISTA alignments of genomic DNA sequences from eight legume species, including 2 kb downstream from the NIN gene start codon and the NIN 5' upstream region. The x-axis provides the distance from the M. truncatula NIN start codon in Kb (running from right to left), while the y-axis provides the percentage conservation level relative to the M. truncatula sequence (running from bottom to top for each legume species). Peaks indicate the level of sequence identity with M. truncatula in ratios of 50% to 100%, with identities less than 50% not recorded. The sequence 2 kb downstream from the NIN start codon is depicted to the right of the thin black arrow labeled "ATG" and the 5' non-coding upstream DNA sequence is depicted to the left of the thin black arrow. Two dark grey rectangles indicate the location of the three conserved regions (3C regions; left) and the -5 kb promoter region (right), and the grey vertical arrow indicates the location of the CYCLOPS binding site within the -5 kb promoter region. [Figure 4A]Figure 4A and Figure 4B show a representative schematic of elements in the M. truncatula NIN 5' upstream region and experimental results demonstrating that the cytokinin response element containing (CE) region is essential for nodule organogenesis. Figure 4A shows the 3C region present in the NIN 5' upstream region as a box located -15Kb to -20Kb upstream of the NIN coding sequence start site (NIN gene = thick grey arrow; start codon = "ATG" on thin black arrow). The central region of the 3C region is the 1Kb CE region, which contains a 472bp conserved region that is divided into three parts or domains named D1, D2, and D3 (shown in grey box). Figure 4A also shows the location of the insertion in the daphne-like mutant and the location of the CYCLOPS binding site, shown as labeled arrows located between -2.2Kb and -5Kb upstream of the NIN coding sequence start site. [Figure 4B] Figure 4B shows the number of nodules formed in A17 WT M. truncatula roots transformed with an empty vector (top bar) and M. truncatula nin-1 mutant roots transformed with an empty vector or with constructs carrying the NIN gene driven by different parts of the NIN 5' upstream region (bottom six bars; each bar is labeled with the specific construct used). The ratio of nodulated roots to all roots tested (indicated by the arrow labeled "Nodulated roots / transgenic roots") is provided to the left of the graph. The graph shows the number of nodules per nodulated root, data are mean ± SD, and the number of nodules was counted at 4 wpi using S. meliloti 2011.pHC60 strain. [Figure 5A]Figures 5A-5D show MAFFT alignments of the cytokinin response element encompassing (CE) region (corresponding to the second or middle region of the larger 3C region) and the conserved portion of the CYCLOPS binding site of eight legume species. Figures 5A-5C show MAFFT alignments of the conserved portion (i.e., without the flanking regions) of the CE region of eight legume species; Medicago truncatula (SEQ ID NO: 663), Trifolium pratense (SEQ ID NO: 664), Cicer arietinum (SEQ ID NO: 665), Lotus japonicus (SEQ ID NO: 666), Glycine max (SEQ ID NO: 667), Cajanus cajan (SEQ ID NO: 668), Lupinus angustifolius (SEQ ID NO: 669), and Arachis duranensis (SEQ ID NO: 670). The conserved portion of the CE region contains approximately 10 putative type B cytokinin signaling response regulator (RR) binding sites (SEQ ID NO:613, bold), and one AP2 binding element (SEQ ID NO:631, enclosed in a black box in FIG. 5B). The conserved portion of the CE region is divided into three domains, designated D1, D2, and D3, the extent and boundaries of which are indicated by the black arrows below the alignment and the vertical black lines through the alignment. FIG. 5A shows an alignment of the 5' portion of the conserved portion of the CE region, including all of domain D1 and part of domain D2. [Figure 5B] FIG. 5B shows an alignment of the central portion of the conserved portion of the CE region, including part of domain D2 and part of domain D3. [Figure 5C] FIG. 5C shows an alignment of the 3′ portion of the conserved portion of the CE region, including part of domain D3. [Figure 5D]Figure 5D shows a MAFFT alignment of CYCLOPS binding sites from eight legume species; Medicago truncatula (SEQ ID NO: 671), Arachis duranensis (SEQ ID NO: 672), Cicer arietinum (SEQ ID NO: 673), Lotus japonicus (SEQ ID NO: 674), Glycine max (SEQ ID NO: 675), Lupinus angustifolius (SEQ ID NO: 676), Cajanus cajan (SEQ ID NO: 677), and Trifolium pratense (SEQ ID NO: 678). The two dashed boxes show the palindromic sequences of essential cis elements, represented by black arrows above the alignment, within the CYCLOPS response elements (also referred to as CYCLOPS response cis elements or CYC-REs), referred to as CYC-boxes. [Figure 6A]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6B]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6C]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6D]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6E]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6F]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6G]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 6H]Figures 6A-6H show complementation of the no-nodulation phenotype of M. truncatula nin-1 and daphne-like mutant roots by introducing constructs ProNIN3C-5kb:NIN, ProNINCE-5kb:NIN, or ProNINCE-35Smin:NIN using A. rhizogenes-mediated transformation (35min = minimal CaMV 35S promoter). Figures 6A and 6C show that nodules form in nin-1 transgenic roots when transformed with ProNIN3C-5kb:NIN (Figure 6A; scale bar 2 mm) or when transformed with ProNINCE-5kb:NIN (Figure 6C; scale bar 2 mm). The nodules in the colored images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6E and Figure 6G show that nodules are formed on daphne-like transgenic roots when transformed with ProNINCE-5kb:NIN (Figure 6E; scale bar 2 mm) or when transformed with ProNINCE-35Smin:NIN (Figure 6G; scale bar 2 mm). The nodules in the color images can be seen as pink, indicating that the nodules are actively fixing nitrogen. Figure 6B and Figure 6D show longitudinal sections of nodules formed on nin-1 transgenic roots stained with toluidine blue when transformed with ProNIN3C-5kb:NIN (Figure 6B; scale bar 200 μm) or when transformed with ProNINCE-5kb:NIN (Figure 6D; scale bar 200 μm), which have a normal nodule distribution including meristem (M), infection zone (IF), and fixation zone (FX). Figures 6F and 6H show longitudinal sections of nodules formed in daphne-like transformed roots stained with toluidine blue when transformed with ProNINCE-5kb:NIN (Figure 6F; scale bar 200 μM) or ProNINCE-35Smin:NIN (Figure 6H; scale bar 200 μM), which have the normal nodule zonation including the meristem (M), infection zone (IF), and fixation zone (FX).In Figures 6A-6H, S. meliloti RCR2011 strain containing constitutively expressed GFP was used as inoculum and root nodules were collected at 4 wpi. Figures 6A-6H are representative images from multiple replicates. [Figure 7A] Figures 7A and 7B show that nifH expression is induced in nodules of M. truncatula ProNINCE-5kb:NIN transgenic nin-1 roots when inoculated with S. meliloti carrying the PronifH:GFP reporter. Figure 7A shows a confocal image of a 4 wpi transgenic nodule, showing that nifH (light grey) is switched on in the fixed zone (FX) (IF = infected zone; scale bar 200 μm). [Figure 7B] Figure 7B shows a magnified image of Figure 7A, showing nifH switched on in the anchoring zone (S = symbiosis; scale bar 50 µm). Images shown in Figures 7A-7B are representative images from multiple replicates. [Figure 8A] Figures 8A-8B show qRT-PCR analysis of relative NIN and NF-YA1 expression in response to cytokinin induction compared to water control in A17 WT and daphne-like. Figure 8A shows qRT-PCR analysis of relative expression of NIN in A17 WT and daphne-like after application of 10-7M benzylaminopurine (BAP; indicated by the label "10-7 BAP") for cytokinin induction or water (indicated by the label "HO") as a control for 16 hours. [Figure 8B] Figure 8B shows qRT-PCR analysis of the relative expression of NF-YA1 in A17 WT and daphne-like after 16 h of application of 10-7 M BAP for cytokinin induction or water as a control. Figures 8A-8B show the average of three biological replicates with error bars displaying SEM. [Figure 9A]Figures 9A-9C show the phenotype of M. truncatula nin-1 mutant roots transformed with ProNINCE(ΔD1 / D2 / D3)-5kb:NIN constructs. Figure 9A shows a longitudinal section of an inoculated nin-1 root transformed with ProNINCE(ΔD1)-5kb:NIN (Scale bars 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; infection threads are indicated by arrows). [Figure 9B] FIG. 9B shows a longitudinal section of an inoculated nin-1 root transformed with ProNINCE(ΔD2)-5kb:NIN (IF=infection zone; FX=fixation zone; M=meristem; scale bar 200 μM). [Figure 9C] Figure 9C shows cross sections of nin-1 root nodules transformed with ProNINCE(ΔD3)-5kb:NIN (IF = infected zone; FX = fixed zone; scale bar 200 μm). Cross sections in Figures 9A-9C are stained with toluidine blue. Images shown in Figures 9A-9C are representative images from multiple replicates. [Figure 10A]Figures 10A-10E show the expression trends of NIN and NF-YA1 in M. truncatula A17 WT nodule primordia and daphne-like mutant primordia inoculated with S. meliloti RCR2011. Figures 10A-10B show the RNA in situ localization of NIN (Figure 10A) and NF-YA1 (Figure 10B) in A17 nodule primordia at a stage of nodule primordium development when pericycle cells have divided and some antipodal divisions have occurred in the inner cortical cell layers (C4 and C5). Figures 10C-10D show the RNA in situ localization of NIN (Figure 10C) and NF-YA1 (Figure 10D) in A17 nodule primordia at a later stage of nodule primordium development when cortical cells have divided more extensively. Figure 10E shows RNA in situ localization of NIN in daphne-like mutant primordia 2 days after inoculation with S. meliloti RCR2011. In Figures 10A-10E, hybridization signals are depicted as dark dots and indicated by arrowheads. Arrows indicate infection threads (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 10A-10E are representative images from multiple replicates. [Figure 10B]Figures 10A-10E show the expression trends of NIN and NF-YA1 in M. truncatula A17 WT nodule primordia and daphne-like mutant primordia inoculated with S. meliloti RCR2011. Figures 10A-10B show the RNA in situ localization of NIN (Figure 10A) and NF-YA1 (Figure 10B) in A17 nodule primordia at a stage of nodule primordium development when pericycle cells have divided and some antipodal divisions have occurred in the inner cortical cell layers (C4 and C5). Figures 10C-10D show the RNA in situ localization of NIN (Figure 10C) and NF-YA1 (Figure 10D) in A17 nodule primordia at a later stage of nodule primordium development when cortical cells have divided more extensively. Figure 10E shows RNA in situ localization of NIN in daphne-like mutant primordia 2 days after inoculation with S. meliloti RCR2011. In Figures 10A-10E, hybridization signals are depicted as dark dots and indicated by arrowheads. Arrows indicate infection threads (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 10A-10E are representative images from multiple replicates. [Figure 10C]Figures 10A-10E show the expression trends of NIN and NF-YA1 in M. truncatula A17 WT nodule primordia and daphne-like mutant primordia inoculated with S. meliloti RCR2011. Figures 10A-10B show the RNA in situ localization of NIN (Figure 10A) and NF-YA1 (Figure 10B) in A17 nodule primordia at a stage of nodule primordium development when pericycle cells have divided and some antipodal divisions have occurred in the inner cortical cell layers (C4 and C5). Figures 10C-10D show the RNA in situ localization of NIN (Figure 10C) and NF-YA1 (Figure 10D) in A17 nodule primordia at a later stage of nodule primordium development when cortical cells have divided more extensively. Figure 10E shows RNA in situ localization of NIN in daphne-like mutant primordia 2 days after inoculation with S. meliloti RCR2011. In Figures 10A-10E, hybridization signals are depicted as dark dots and indicated by arrowheads. Arrows indicate infection threads (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 10A-10E are representative images from multiple replicates. [Figure 10D]Figures 10A-10E show the expression trends of NIN and NF-YA1 in M. truncatula A17 WT nodule primordia and daphne-like mutant primordia inoculated with S. meliloti RCR2011. Figures 10A-10B show the RNA in situ localization of NIN (Figure 10A) and NF-YA1 (Figure 10B) in A17 nodule primordia at a stage of nodule primordium development when pericycle cells have divided and some antipodal divisions have occurred in the inner cortical cell layers (C4 and C5). Figures 10C-10D show the RNA in situ localization of NIN (Figure 10C) and NF-YA1 (Figure 10D) in A17 nodule primordia at a later stage of nodule primordium development when cortical cells have divided more extensively. Figure 10E shows RNA in situ localization of NIN in daphne-like mutant primordia 2 days after inoculation with S. meliloti RCR2011. In Figures 10A-10E, hybridization signals are depicted as dark dots and indicated by arrowheads. Arrows indicate infection threads (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 10A-10E are representative images from multiple replicates. [Figure 10E]Figures 10A-10E show the expression trends of NIN and NF-YA1 in M. truncatula A17 WT nodule primordia and daphne-like mutant primordia inoculated with S. meliloti RCR2011. Figures 10A-10B show the RNA in situ localization of NIN (Figure 10A) and NF-YA1 (Figure 10B) in A17 nodule primordia at a stage of nodule primordium development when pericycle cells have divided and some antipodal divisions have occurred in the inner cortical cell layers (C4 and C5). Figures 10C-10D show the RNA in situ localization of NIN (Figure 10C) and NF-YA1 (Figure 10D) in A17 nodule primordia at a later stage of nodule primordium development when cortical cells have divided more extensively. Figure 10E shows RNA in situ localization of NIN in daphne-like mutant primordia 2 days after inoculation with S. meliloti RCR2011. In Figures 10A-10E, hybridization signals are depicted as dark dots and indicated by arrowheads. Arrows indicate infection threads (Scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium). Images shown in Figures 10A-10E are representative images from multiple replicates. [Figure 11A]Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endodermis 48 hours after inoculation with S. meliloti RCR2011. Figures 11A-11B show M. truncatula A17 WT roots transformed with ProNIN5kb:GUS (Figure 11A) and ProNINCE-5kb:GUS (Figure 11B). In Figures 11A-11B, GUS expression is in the epidermis, endodermis, and endodermis, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Figures 11C-11D show M. truncatula daphne-like mutant roots transformed with ProNIN5kb:GUS (Figure 11C) and ProNINCE-5kb:GUS (Figure 11D). In Figure 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figure 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figures 11E-11F show M. truncatula nin-1 mutant roots transformed with ProNIN5kb:GUS (Figure 11E) and ProNINCE-5kb:GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endothelium; pc=endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates. [Figure 11B]Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endodermis 48 hours after inoculation with S. meliloti RCR2011. Figures 11A-11B show M. truncatula A17 WT roots transformed with ProNIN5kb:GUS (Figure 11A) and ProNINCE-5kb:GUS (Figure 11B). In Figures 11A-11B, GUS expression is in the epidermis, endodermis, and endodermis, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Figures 11C-11D show M. truncatula daphne-like mutant roots transformed with ProNIN5kb:GUS (Figure 11C) and ProNINCE-5kb:GUS (Figure 11D). In Figure 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figure 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figures 11E-11F show M. truncatula nin-1 mutant roots transformed with ProNIN5kb:GUS (Figure 11E) and ProNINCE-5kb:GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endothelium; pc=endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates. [Figure 11C]Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endodermis 48 hours after inoculation with S. meliloti RCR2011. Figures 11A-11B show M. truncatula A17 WT roots transformed with ProNIN5kb:GUS (Figure 11A) and ProNINCE-5kb:GUS (Figure 11B). In Figures 11A-11B, GUS expression is in the epidermis, endodermis, and endodermis, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Figures 11C-11D show M. truncatula daphne-like mutant roots transformed with ProNIN5kb:GUS (Figure 11C) and ProNINCE-5kb:GUS (Figure 11D). In Figure 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figure 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figures 11E-11F show M. truncatula nin-1 mutant roots transformed with ProNIN5kb:GUS (Figure 11E) and ProNINCE-5kb:GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endothelium; pc=endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates. [Figure 11D]Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endodermis 48 hours after inoculation with S. meliloti RCR2011. Figures 11A-11B show M. truncatula A17 WT roots transformed with ProNIN5kb:GUS (Figure 11A) and ProNINCE-5kb:GUS (Figure 11B). In Figures 11A-11B, GUS expression is in the epidermis, endodermis, and endodermis, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Figures 11C-11D show M. truncatula daphne-like mutant roots transformed with ProNIN5kb:GUS (Figure 11C) and ProNINCE-5kb:GUS (Figure 11D). In Figure 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figure 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figures 11E-11F show M. truncatula nin-1 mutant roots transformed with ProNIN5kb:GUS (Figure 11E) and ProNINCE-5kb:GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endothelium; pc=endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates. [Figure 11E]Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endodermis 48 hours after inoculation with S. meliloti RCR2011. Figures 11A-11B show M. truncatula A17 WT roots transformed with ProNIN5kb:GUS (Figure 11A) and ProNINCE-5kb:GUS (Figure 11B). In Figures 11A-11B, GUS expression is in the epidermis, endodermis, and endodermis, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Figures 11C-11D show M. truncatula daphne-like mutant roots transformed with ProNIN5kb:GUS (Figure 11C) and ProNINCE-5kb:GUS (Figure 11D). In Figure 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figure 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figures 11E-11F show M. truncatula nin-1 mutant roots transformed with ProNIN5kb:GUS (Figure 11E) and ProNINCE-5kb:GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endothelium; pc=endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates. [Figure 11F]Figures 11A-11F show that the CE region is required for rhizobial-induced NIN expression in the endodermis 48 hours after inoculation with S. meliloti RCR2011. Figures 11A-11B show M. truncatula A17 WT roots transformed with ProNIN5kb:GUS (Figure 11A) and ProNINCE-5kb:GUS (Figure 11B). In Figures 11A-11B, GUS expression is in the epidermis, endodermis, and endodermis, indicated by arrowheads (lower GUS expression is also in some cortical cells; not indicated by arrowheads). Figures 11C-11D show M. truncatula daphne-like mutant roots transformed with ProNIN5kb:GUS (Figure 11C) and ProNINCE-5kb:GUS (Figure 11D). In Figure 11C, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figure 11D, GUS expression is in the epidermis, outer cortex, and endothelium (weaker expression in the endothelium), indicated by arrowheads. Figures 11E-11F show M. truncatula nin-1 mutant roots transformed with ProNIN5kb:GUS (Figure 11E) and ProNINCE-5kb:GUS (Figure 11F). In Figures 11E-11F, GUS expression is in the epidermis and outer cortex, indicated by arrowheads. In Figures 11A-11F, scale bars 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endothelium; pc=endothelium). Images shown in Figures 11A-11F are representative images from multiple replicates. [Figure 12A] Figures 12A and 12B show the localization of CRE1 and RR1 RNA in non-inoculated M. truncatula A17 WT roots. Figure 12A shows the RNA in situ localization of CRE1 in non-inoculated roots, with hybridization signals depicted as dark dots and indicated by arrowheads (scale bar 50 μm; ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endodermis; pc=endothelium; vb=vascular bundles). [Figure 12B]Figure 12B shows RNA in situ localization of RR1 in non-inoculated roots, with hybridization signals shown as dark dots and indicated by arrowheads (scale bar 50 μm; ep = epidermis; C4 = cortical cell layer 4; C5 = cortical cell layer 5; ed = endodermis; pc = endothelium; vb = vascular bundles). Images shown in Figures 12A-12B are representative images from multiple replicates. [Figure 13] Figure 13 shows a model of NIN function during nodule primordium initiation. In the root hair curl, bacterial colonies are shown as grey dots, and in the root hair axis, infection threads are shown as light grey lines (root hairs are shown as perpendicular projections from the cell epidermis). Note: "-2.2Kb" and "-5Kb" indicate portions of the NIN 5' upstream region (ep=epidermis; C4=cortical cell layer 4; C5=cortical cell layer 5; ed=endodermis; pc=endothelium).
Claims
[Claim 1] The plant or part thereof comprises one or more genetic modifications that increase the activity of a NODULE INCEPTION (NIN) protein or a NIN-like protein (NLP protein) in response to cytokinin signaling compared to a wild-type (WT) plant that does not have the one or more genetic modifications; A genetically modified plant, wherein the plant or the part thereof comprises a nucleic acid encoding the NIN protein or the NLP protein.
Citation Information
Cited By
Method for manufacturing high-strength and high-thermal-conductivity iron-based alloy additive manufactured bodies
CN120828139A
Method for producing high-strength and high-thermal-conductivity additively-manufactured body of iron-based alloy
EP4644020A1