Intein proteins and uses thereof

Abstract

To provide constructs, vectors, relative host cells and pharmaceutical compositions which allow an effective gene therapy, in particular of genes larger than 5Kb.SOLUTION: The present invention implements cellular large protein reconstitution by providing to a target cell two or more fragments of large protein fused to split inteins to promote intein-mediated trans-splicing and reconstitute the functional protein.SELECTED DRAWING: None

Description

[Technical field]

[0001] Technical Field The present invention relates to constructs, vectors, associated host cells and pharmaceutical compositions that enable effective gene therapy, in particular for diseases caused by mutations in genes whose coding sequences (CDS) are larger than 5 kb. [Background technology]

[0002] 2. Background of the Invention Adeno-associated virus (AAV) vector-mediated gene therapy is safe and effective in humans. Recently, AAV-based gene therapy formulations have been approved in both the United States and Europe for inherited metabolic and blinding diseases, while an ever-increasing number of clinical trials are underway for AAV-based gene therapy approaches for diseases in various therapeutic areas, ranging from ophthalmology to hematology to musculoskeletal and metabolic disorders.

[0003] However, the limited cargo capacity of AAV vectors has hindered the development of AAV-based therapies for diseases caused by mutations in genes with coding sequences (CDS) larger than 5 kb (also referred to herein as large genes).

[0004] Genetic diseases caused by mutations in large genes (listed in Table 1 below) include, among others, Duchenne muscular dystrophy caused by mutations in the DMD gene, cystic fibrosis caused by mutations in the CFTR gene, hemophilia A caused by mutations in the F8 gene, dysferlinopathy caused by mutations in the DYSF gene, polycystic kidney disease caused by mutations in the PKD gene, Wilson's disease caused by mutations in the ATP7B gene, Huntington's disease caused by mutations in the HTT gene, and Niemann-Pick disease type C caused by mutations in the NPC1 gene.

[0005] [Table 1]

[0006] In addition, several inherited retinal degenerations (IRDs) are caused by mutations in large genes, as listed below in Table 2. IRDs affect approximately 1 in 3,000 people in Europe and the United States (58).

[0007] Among the most frequent and severe forms of IRDs are retinitis pigmentosa (RP), Leber congenital amaurosis (LCA), and Stargardt disease (STGD), which are mostly inherited as monogenic conditions, have a worldwide prevalence of 1 / 2,000 people, and are the leading cause of blindness worldwide (1). The majority of mutations causing IRDs occur in genes expressed in the neuronal photoreceptors (PRs), rods, and / or cones of the retina (2).

[0008] Gene therapy holds great promise for the treatment of IRDs. The first adeno-associated virus (AAV) vector-based gene therapy formulation for a genetic form of blindness was approved in December 2017 (3). In addition, several other AAV-based formulations are currently in clinical development for gene therapy of rare and common forms of blindness (4). Although it is now well established that AAV represents the most efficient gene therapy delivery vehicle to the retina (4, 5), its limited cargo capacity precludes its use in pathologies that require the delivery of DNA sequences larger than 5 kb in size, including not only the transgene but also the cis-regulatory elements essential for its expression (6).

[0009] Table 2 below summarizes examples of disease genes that are greater than 5 kb in size.

[0010] [Table 2]

[0011] Stargardt disease (STGD; MIM#248200) is the most common form of inherited macular degeneration and is caused by mutations in the ABCA4 gene (CDS: 6822 bp), which encodes an all-trans retinal transporter located in the PR outer segment (7); Usher syndrome type IB (USH1B; MIM#276900), the most severe form of RP and hearing loss, is caused by mutations in the MYO7A gene (CDS: 6648 bp) (8), which encodes a nonconventional MYO7A, an actin-based motor expressed in both the PR and RPE within the retina (9-11).

[0012] Cone-rod dystrophy type 3, fundus flaviforme, age-related macular degeneration type 2, early-onset severe retinal dystrophy and retinitis pigmentosa type 19 are also associated with ABCA4 mutations (referred to herein as ABCA4-associated disorders).

[0013] We and others have shown that this limitation can be overcome by using either dual AAV vectors (up to 9 kb) (6, 12, 13) or triple AAV vectors (up to 14 kb) (14), each containing a fragment of the coding sequence (CDS) of a large transgene expression cassette. Dual and triple AAV vectors utilize AAV genome concatemerization and recombination to reconstitute a full-length genome in cells co-infected with multiple AAV vectors. However, in photoreceptors, which are the main therapeutic target for many inherited retinal diseases, the transgene expression efficiency achieved by either dual or triple AAV vectors is lower than that achieved by single AAV vectors (6, 14, 15). This may be due to various rate-limiting steps required for efficient transduction, including correct DNA concatemer formation, heterologous mRNA stability, and splicing efficiency across vector junctions.

[0014] In WO 2014 / 170480 and Colella et al. (15), we have shown dual AAV vectors to reconstitute large genes by either splicing (trans-splicing), homologous recombination (overlapping) or a combination of the two (hybrid), and have found dual trans-splicing and hybrid vectors to be particularly efficient for the treatment of inherited retinal degenerations. Furthermore, Maddalena et al. (14) demonstrated a triple AAV vector approach for genes up to 14 kb. However, the transgene expression efficiency achieved with either dual or triple AAV vectors is lower than that achieved with single AAV vectors (6, 13, 14). This may be due to various rate-limiting steps required for efficient transduction, including correct DNA concatemer formation, heterologous mRNA stability and splicing efficiency across vector junctions. Furthermore, the gene expression levels obtained with the triple AAV vector strategy are lower than the threshold required for a therapeutic approach.

[0015] Thus, there remains a need for constructs and vectors that can be used to reconstitute large gene expression for effective gene therapy.

[0016] Here, we found that short split inteins delivered multiple AAV vectors, each encoding one of the adjacent fragments of either a reporter protein or a large therapeutic protein, resulted in protein trans-splicing and full-length protein reconstitution both in vitro and in vivo.

[0017] Inteins are genetic elements that are transcribed and translated within a host protein and excise themselves from host proteins similar to protein introns without the need for energy supply, exogenous host-specific proteases or cofactors, and without leaving amino acid modifications in the final protein product (16, 17, 27, 28). Intein activity is context-dependent, and specific peptide sequences surround its ligation junction (called N- and C-exteins) that are necessary for efficient trans-splicing to occur, the most important of which is an amino acid containing a thiol or hydroxyl group (i.e., Cys, Ser, or Thr) as the first residue in the C-extein (18). Split inteins are a subset of inteins that are expressed as two separate polypeptides at the termini of two host proteins and catalyze their trans-splicing, resulting in the generation of a larger single polypeptide (19). Inteins, including split inteins, are widely used in biotechnological applications, including protein purification and labeling processes (19, 20) as well as for reconstitution of the widely used CRISPR / Cas9 genome editing nuclease (21, 22).

[0018] Several attempts have been made to use intein-based protein splicing to reconstitute expression of therapeutic genes, including the factor VIII gene, where Synechocystis sp. (Ssp) DnaB intein-fused factor VIII heavy and light chain genes led to factor VIII reconstitution in cell culture and animal models (23, 24). Similarly, expression of a highly functional form of the dystrophin gene has been achieved in vitro and in vivo, where a 6.3 kb Becker-type dystrophin gene was split into two AAV vectors and each half was fused to a split intein derived from Synechocystis sp. PCC 6803 (Ssp) DnaB intein or Rhodothermus marinus (Rma) DnaB intein (25). Additionally, a split intein (i.e., N. punctiforme DnaE split intein)-mediated protein trans-splicing strategy was reported to reconstitute the large pore-forming subunit of the L-type calcium channel from two separate fragments in cardiac cells. (26) U.S. Patent No. 6,544,786 further reports the delivery of a dystrophin minigene using a split intein.

[0019] We have exploited the unique ability of split inteins to mediate protein trans-splicing to fragment and then reconstitute large full-length proteins into either two or three split-intein-flanked polypeptides whose coding sequences fit into a single AAV vector. Summary of the Invention [Means for solving the problem]

[0020] Thus, the present invention achieves reconstitution of a large cellular protein by providing a target cell with two or more fragments of said large protein fused with a split intein to promote intein-mediated trans-splicing and reconstitute a functional protein.

[0021] Summary of the Invention The present invention provides gene therapy using AAV vectors for diseases caused by mutations in genes, particularly genes with coding regions exceeding 5 kb.

[0022] Based on the observation that split intein-mediated protein trans-splicing is used by unicellular organisms to reconstitute proteins, the inventors constructed multiple AAV vectors, each encoding one of the fragments of either a reporter protein or a large therapeutic protein flanked by short split inteins, resulting in protein trans-splicing and full-length protein reconstitution in vitro and in vivo.

[0023] Advantageously, the AAV-based protein trans-splicing mediated reconstitution of disease proteins achieved by the present invention resulted in higher expression of target proteins compared to AAV-based methods for large proteins known in the art, likely due to overcoming various rate-limiting steps required for efficient transduction of dual vector-based systems, including correct DNA concatemer formation, heterologous mRNA stability and splicing efficiency across vector junctions.

[0024] The present invention provides a vector system for expressing a coding sequence in a cell, said coding sequence consisting of a first part (CDS1) and a second part (CDS2) and optionally a third part (CDS3), said vector system comprising: a) a first vector, - the first part of the coding sequence (CDS1), - a first intein nucleotide sequence encoding an N-intein, the first intein nucleotide sequence being located at the 3' end of CDS1; a first vector comprising: b) a second vector, - the second part of the coding sequence (CDS2), - a second intein nucleotide sequence encoding a C-intein, the second intein nucleotide sequence being located at the 5' end of the CDS2; and a second vector comprising Includes; When the first vector and the second vector are inserted into a cell, a protein product of the coding sequence is produced by protein splicing; or The vector system comprises: a') a first vector, - the first part of the coding sequence (CDS1), - a first intein nucleotide sequence encoding a first N-intein, the first intein nucleotide sequence being located at the 3' end of CDS1; a first vector comprising: b') a second vector, - the second part of the coding sequence (CDS2), - a second intein nucleotide sequence encoding the first C-intein, the second intein nucleotide sequence being located at the 5' end of the CDS2; - a third intein nucleotide sequence encoding a second N-intein, the third intein nucleotide sequence being located at the 3' end of the CDS2; and a second vector comprising: c') a third vector, - the third part of the coding sequence (CDS3), - a fourth intein nucleotide sequence encoding a second C-intein, the fourth intein nucleotide sequence being located at the 5' end of the CDS3; and a third vector comprising Including, The first intein nucleotide sequence is different from the third intein nucleotide sequence, and the second intein sequence is different from the fourth intein nucleotide sequence, and when the first vector, the second vector, and the third vector are inserted into a cell, a protein product of the coding sequence is produced by protein trans-splicing.

[0025] Preferably, in this vector system, the first intein, the second intein, the third intein and the fourth intein encode a split intein, preferably said split intein has a maximum length of 150 amino acids, more preferably said split intein is a DnaE or DnaB intein.

[0026] According to the present invention, an intein is a segment in a protein that can excise itself and join the remaining part (the extein) with a peptide bond in a process known as protein splicing. Such segments are called "inteins" for the inner protein sequence and "exteins" for the outer protein sequence, where the upstream extein is referred to as the "N-extein" and the downstream extein is referred to as the "C-extein", and the upstream intein is referred to as the "N-intein" and the downstream intein is referred to as the "C-intein".

[0027] Thus, in the context of the present invention, an N-intein is an intein fragment located at (and fused to) the N-terminus of a first polypeptide and a C-intein is an intein fragment located at (and fused to) the C-terminus of a second polypeptide, where upon expression of these two polypeptides, the two intein fragments undergo protein trans-splicing and are joined to form a complete intein, and where upon joining of the two polypeptides, the full-length protein is reconstituted.

[0028] According to the present invention, the first intein sequence is an N-intein sequence and the second intein sequence is a C-intein sequence, and the N-intein and the C-intein are preferably derived from the same intein or split intein gene. Alternatively, the N-intein and the C-intein are derived from two different intein genes that are naturally capable of or have been modified to undergo a trans-splicing reaction. Thus, the same gene can be from the same organism or different organisms. For example, the widely used split intein is derived from the DnaE gene from different organisms. According to the present invention, when the coding sequence of the protein of interest is split into two parts, the N-intein coding sequence is fused in frame with the sequence encoding the N-terminal part of the protein of interest; the C-intein coding sequence is fused in frame with the sequence encoding the C-terminal part of the sequence of interest. Upon expression of these two fusion protein precursors, the inteins undergo autocatalytic excision to form the ligated exteins, e.g., the reconstituted protein of interest.

[0029] According to the present invention, the coding sequence of the protein of interest may be split into three parts. Thus, the first intein sequence is an N-intein sequence and the second intein sequence is a C-intein sequence, the first intein coding sequence being fused in frame at the C-terminus with the sequence coding for the N-part of the protein of interest, and the second intein coding sequence being fused in frame at the N-terminus with the sequence coding for the central part of the protein of interest. Thus, the N-intein and the C-intein are preferably derived from the same intein or split intein gene. Alternatively, the N-intein and the C-intein are derived from two different intein genes that are naturally capable of undergoing or have been modified to undergo a trans-splicing reaction. Thus, the same gene may be from the same organism or from different organisms. Within this configuration, the third intein is an N-intein coding sequence fused in frame with a sequence encoding the C-terminus of the central portion of the protein of interest, and the fourth intein is a C-intein coding sequence fused in frame with a sequence encoding the N-terminus of the C-part of the protein of interest. Thus, the third and fourth inteins are preferably derived from the same intein or split intein gene. Alternatively, the N-intein and the C-intein are derived from two different intein genes that are naturally capable of undergoing a trans-splicing reaction or have been modified to do so. Thus, the same gene can be from the same organism or from different organisms. Within the scope of the present invention, the first and second inteins and the third and fourth inteins are derived from different intein genes, and the first intein preferentially binds to the second intein, while the third intein preferentially binds to the fourth intein.

[0030] In the present invention, when the first vector, the second vector and optionally the third vector are inserted into a cell, at least two or three fusion proteins are formed, and when the two or three fusion proteins are contacted, the protein product of the coding sequence is produced, the contacting step being performed under conditions that allow the N-intein to bind to the C-intein.

[0031] In the present invention, when the first vector, the second vector and the third vector are inserted into a cell, three independent polypeptides are produced, which undergo trans-splicing to produce a full-length protein. In the development of the three AAV intein vectors, it is believed that the use of different inteins, i.e., DnaE and DnaB, is crucial, as they do not cross-react, thus preventing inappropriate trans-splicing between the polypeptides produced by the first and third vectors.

[0032] According to a preferred embodiment of the invention, a vector system for expressing a coding sequence of a gene of interest in a cell comprises two vectors, each vector comprising a portion of said coding sequence flanked by intein sequences, where the 5' end of said coding sequence is flanked at its 3' end by the sequence of an N-intein, and the 3' end of the coding sequence of the gene of interest is flanked by the sequence of a C-intein, such that expression of both vectors in a cell produces two fusion proteins which generate the full-length protein of interest as a result of a spontaneous trans-splicing reaction.

[0033] According to a further preferred embodiment of the invention, a vector system for expressing a coding sequence of a gene of interest in a cell comprises three vectors, each vector comprising a portion of the coding sequence flanked by intein sequences, where the coding sequence is split into three portions such that a 5' end of the coding sequence is flanked at its 3' end by the sequence of a first N-intein; a central portion of the coding sequence is flanked at its 5' end by a first C-intein and at its 3' end by a second N-intein; and the 3' portion of the coding sequence is flanked at its 5' end by a second C-intein, such that upon expression of all three vectors in a cell, three fusion proteins are produced, whereby a full-length protein of interest is generated as a result of a spontaneous trans-splicing reaction in which the first N-intein reacts with the first C-intein and the second N-intein reacts with the second C-intein.

[0034] The split inteins of the invention can be encoded by one gene, which is then engineered to encode two separate intein fragments, e.g., split inteins; or naturally occurring split inteins are encoded by two separate genes; for example, in cyanobacteria, DnaE, ​​the catalytic subunit alpha of DNA polymerase III, is encoded by two separate genes, dnaE-n and dnaE-c. Preferred inteins within the scope of the present invention are inteins derived from intein proteins (e.g., mini-inteins) or split inteins that undergo a trans-splicing reaction to form an intein protein, which are 150 aa or less in length.

[0035] The split inteins of the present invention can be 100% identical, 98%, 80%, 75%, 70%, 65%, 60%, 55%, 50% identical to a naturally occurring intein or SEQ ID NOs: 1-14 (homologues), where the intein retains the ability to undergo a trans-splicing reaction. Fragments or variants of naturally occurring or modified inteins that retain trans-splicing activity are within the scope of the present invention.

[0036] Advantageously, the split inteins of the present invention can be derived from the same gene isolated from different organisms. Preferred intein genes are DnaB and DnaE.

[0037] In a preferred embodiment, the intein of the present invention is a nucleotide sequence encoding a nucleotide sequence of Nostoc punctiforme (Npu), Synechocystis sp. PCC 6803 (Ssp), Fischerella sp. PCC 9605, Scytonema tolypothrichoides, Cyanobacteria bacterium SW_9_47_5, Nodularia spumigena, Nostoc flagelliforme, Crocosphaera watsonii WH 8502, Chroococcidiopsis cubana CCALA, 043, a split intein derived from the DnaE gene (e.g., DNA polymerase III subunit alpha) from cyanobacteria, including Trichodesmium erythraeum; preferably, the intein of the invention is derived from the DnaE gene isolated from nostoc punctiforme or Synechocystis sp. PCC6803.

[0038] In a further preferred embodiment, the intein of the invention is a split intein derived from the DnaB gene from cyanobacteria including R. marinus (Rma), Synechocystis sp. PC6803 (Ssp), Porphyra purpurea chloroplast (Ppu), e.g., as described in (59).

[0039] Preferably, - the first intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, or a variant thereof, or a fragment thereof, or a homolog thereof; - the second intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, or a variant thereof, or a fragment thereof, or a homolog thereof; - the third intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, or a variant thereof, or a fragment thereof, or a homolog thereof; the fourth intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, or a variant thereof, or a fragment thereof, or a homolog thereof.

[0040] Preferably, wherein when the first or third intein is SEQ ID NO:1, the second or fourth is SEQ ID NO:2; or when the first or third intein is SEQ ID NO:3, the second or fourth is SEQ ID NO:4; or when the first or third intein is SEQ ID NO:5, the second or fourth is SEQ ID NO:6; or when the first or third intein is SEQ ID NO:7, the second or fourth is SEQ ID NO:8; or when the first or third intein is SEQ ID NO:9, the second or fourth is SEQ ID NO:10; or when the first or third intein is SEQ ID NO:11, the second or fourth is SEQ ID NO:12.

[0041] Preferably, when the first intein is SEQ ID NO:1 and the second intein is SEQ ID NO:2, the third intein is not SEQ ID NO:1 and the fourth intein is not SEQ ID NO:2; preferably, when the first intein is SEQ ID NO:3 and the second intein is SEQ ID NO:4, the third intein is not SEQ ID NO:3 and the fourth intein is not SEQ ID NO:4; preferably, when the first intein is SEQ ID NO:5 and the second intein is SEQ ID NO:6, the third intein is not SEQ ID NO:5 and the fourth intein is not SEQ ID NO:6; Preferably, when the first intein is SEQ ID NO:7 and the second intein is SEQ ID NO:8, the third intein is not SEQ ID NO:7 and the fourth intein is not SEQ ID NO:8; preferably, when the first intein is SEQ ID NO:9 and the second intein is SEQ ID NO:10, the third intein is not SEQ ID NO:9 and the fourth intein is not SEQ ID NO:10; preferably, when the first intein is SEQ ID NO:11 and the second intein is SEQ ID NO:12, the third intein is not SEQ ID NO:11 and the fourth intein is not SEQ ID NO:12.

[0042] In particular embodiments, the first intein is SEQ ID NO:1, the second intein is SEQ ID NO:2, the third intein is SEQ ID NO:3, and the fourth intein is SEQ ID NO:4; or the first intein is SEQ ID NO:5, the second intein is SEQ ID NO:6, the third intein is SEQ ID NO:3, and the fourth intein is SEQ ID NO:4.

[0043] In a preferred embodiment, the first vector, the second vector and the third vector further comprise a promoter sequence operably linked to the 5' terminal portion of the first part of the coding sequence (CDS1), or the second part of the coding sequence (CDS2), or the third part of the coding sequence (CDS3).

[0044] Preferred promoters are ubiquitous, artificial or tissue-specific promoters, including fragments and variants thereof that retain transcriptional promoter activity. Particularly preferred promoters are photoreceptor-specific promoters, including photoreceptor-specific human G protein-coupled receptor kinase 1 (GRK1), interphotoreceptor retinoid-binding protein promoter (IRBP), rhodopsin promoter (RHO), vitelliform macular dystrophy 2 promoter (VMD2), rhodopsin kinase promoter (RK); and particularly preferred promoters are muscle-specific promoters, including MCK, MYODI; liver-specific promoters, including thyroxine-binding globulin (TBG), hybrid liver-specific promoter (HLP) (67); neuron-specific promoters, including hSYN1, CaMKIIa; kidney-specific promoters, including Ksp-cadherin 16, NKCC2. Ubiquitous promoters according to the invention are, for example, the ubiquitous cytomegalovirus (CMV) (32) and short CMV (33) promoters. More preferred promoters within the scope of the present invention are GRK1, TBG, CaMKIIa, Ksp-cadherin16.

[0045] In yet a preferred embodiment, the first vector, the second vector and the third vector further comprise a 5' terminal repeat (5'-TR) nucleotide sequence and a 3' terminal repeat (3'-TR) nucleotide sequence, preferably, the 5'-TR is a 5' inverted terminal repeat (5'-ITR) nucleotide sequence and the 3'-TR is a 3' inverted terminal repeat (3'-ITR) nucleotide sequence.

[0046] In a still preferred embodiment, the first vector, the second vector and the third vector further comprise a polyadenylation signal nucleotide sequence.

[0047] In yet a preferred embodiment, the coding sequence is split into a first portion and a second portion and optionally a third portion at a position consisting of a nucleophilic amino acid that does not fall within a structural or functional domain of the encoded protein product, the nucleophilic amino acid being selected from serine, threonine or cysteine.

[0048] Preferably, at least one of the first, second and third vectors further comprises at least one enhancer or regulatory nucleotide sequence operably linked to the coding sequence.

[0049] A preferred enhancer or regulatory nucleotide sequence is the β-globin IgG chimeric intron, a woodchuck hepatitis virus post-transcriptional regulatory element.

[0050] Optionally, at least one of the first vector, the second vector, and the third vector further comprises at least one degradation signal to reduce the stability of the reconstituted intein protein.

[0051] Preferably, the degradation signal is a CL1 degron or a PB29 degron. More preferably, the degradation signal is ecDHFR or a fragment thereof, preferably the ecDHFR degradation signal is a mutant DHFR functioning as an internal degron as described herein. Most preferably, the fragment retains the degradation properties of ecDHFR, preferably the properties of a mutant DHFR functioning as an internal degron, preferably the fragment is a mini-ecDHFR, where the mini-ecDHFR is a mutant functioning as an internal degron.

[0052] Preferably, the coding sequence encodes a protein capable of correcting a pathological condition or disorder, preferably the disorder is a retinal degeneration, a metabolic disorder, a blood disorder, a neurodegenerative disorder, hearing loss, a channelopathy, a pulmonary disease, a myopathy, a cardiac disease, a muscular dystrophy.

[0053] Still preferably, the coding sequence encodes a protein capable of correcting a pathological condition or disorder, preferably the disorder is a retinal degeneration, preferably the retinal degeneration is hereditary, preferably the pathological condition or disease is selected from the group consisting of Retinitis Pigmentosa (RP), Leber's Congenital Amaurosis (LCA), Stargardt's Disease (STGD), Usher's Disease (USH), Alström's Syndrome, Congenital Stationary Night Blindness (CSNB), Macular Dystrophies, Occult Macular Dystrophies, diseases caused by mutations in the ABCA4 gene. More preferably, the coding sequence is a gene selected from the group consisting of ABCA4, MYO7A, CEP290, CDH23, EYS, PCDH15, CACNA1, SNRNP200, RP1, PRPF8, RP1L1, ALMS1, USH2A, GPR98, HMCN1, or a fragment thereof, or an orthologue thereof, or a minigene thereof having a coding sequence longer than 5 kb, i.e. a coding sequence of a minimal gene fragment comprising one or more exons and the essential regulatory elements for the gene to be self-expressed in the same way as the wild-type gene fragment.

[0054] More preferably, the coding sequence encodes a protein capable of correcting muscular dystrophy, such as Duchenne muscular dystrophy, cystic fibrosis, hemophilia A, Wilson's disease, phenylketonuria, dysferlinopathy, Rett syndrome, polycystic kidney disease, Niemann-Pick disease type C, or Huntington's disease.

[0055] More preferably, the coding sequence is a gene selected from the group consisting of ABCA4, MYO7A, CEP290, CDH23, EYS, PCDH15, CACNA1, SNRNP200, RP1, PRPF8, RP1L1, ALMS1, USH2A, GPR98, HMCN1, or a fragment thereof, or an orthologue thereof, or a minigene thereof having a coding sequence longer than 5 kb, i.e. a coding sequence of a minimal gene fragment comprising one or more of the gene fragments and the essential regulatory regions for the gene to be self-expressed in the same manner as the wild-type gene fragment.

[0056] Even more preferably, the coding sequence is a coding sequence of a gene selected from the group consisting of DMD, CFTR, F8, ATP7B, PAH, DYSF, MECP2, PKD, NPC1, HTT or a fragment thereof, or an orthologue thereof, or a minigene thereof having a coding sequence longer than 5 kb, i.e. a minimal gene fragment comprising one or more of the regulatory elements necessary for the gene to be self-expressed in the same way as the wild-type gene fragment.

[0057] In a particularly preferred embodiment of the invention, the coding sequence encodes the ABCA4 gene. Preferably, said coding sequence is split at the nucleotides corresponding to aa Cys1150, Ser1168, Ser 1090 of said ABCA4 protein and a split intein is inserted at this split point.

[0058] In a further preferred embodiment, the coding sequence encodes the CEP290 gene. Preferably, said coding sequence is split at the nucleotides corresponding to aa Cys1076;Ser1275. More preferably, said coding sequence is split at the nucleotides corresponding to aa Cys 929 and 1474;Ser 453 and Cys 1474 of said CEP290 protein and two split inteins are inserted at these split points.

[0059] EGFP SEQ ID NO:15 The first amino acid of the c-extein is highlighted in the sequence. Split Cys.71 (bold) [ka]

[0060] ABCA4 SEQ ID NO:16 The first amino acid of the c-extein is highlighted in the sequence. Split Set 1 Cys.1150 (bold) Split Set 2 Ser.1168 (underlined) Split Set 3 Ser.1090 (Italic) [ka]

[0061] CFP290 SEQ ID NO:17 The first amino acid of the c-extein is highlighted in the sequence. Split Set 1 Cys.1076 (bold) Split Set 2~3 Ser.1275 (underlined) Split set 4 Cys.929 and Cys.l474 (italics) Split set 5 Ser.453 and Cys.1474 (double underlined) [ka]

[0062] F8 SEQ ID NO:18 The first amino acid of the c-extein is highlighted in the sequence. Split set 1 Cys.1312 (underlined) set Split Set 2 Ser.984 (Bold) [ka]

[0063] ecDHFR SEQ ID NO:19 [ka]

[0064] miniecDHFR SEQ ID NO:20 [ka]

[0065] In a preferred embodiment, the vector system of the present invention comprises: a) a first vector, comprising, in the 5'-3' direction: - 5' inverted terminal repeat (5'-ITR) sequence; - promoter sequence; - a 5'-terminal portion of the coding sequence (CDS1), which is operably linked to and under the control of said promoter; - a first intein nucleotide sequence encoding an N-intein; and - 3' inverted terminal repeat (3'-ITR) sequence a first vector comprising: b) a second vector, comprising, in the 5'-3' direction: - 5' inverted terminal repeat (5'-ITR) sequence; - promoter sequence; - a second intein nucleotide sequence encoding the C-intein; - the 3'-terminal part of the coding sequence (CDS2); and - 3' inverted terminal repeat (3'-ITR) sequence and a second vector comprising Contains; or a') a first vector, comprising in the 5'-3' direction: - 5' inverted terminal repeat (5'-ITR) sequence; - promoter sequence; - a 5'-terminal portion of a coding sequence (CDS1'), which is operably linked to and under the control of said promoter; - a first intein nucleotide sequence encoding a first N-intein; and - 3' inverted terminal repeat (3'-ITR) sequence a first vector comprising: b') a second vector, comprising in the 5'-3' direction: - 5' inverted terminal repeat (5'-ITR) sequence; - promoter sequence; - a second intein nucleotide sequence encoding the first C-intein; - the second part of the coding sequence (CDS2'); and - a third intein nucleotide sequence encoding a second N-intein; - 3' inverted terminal repeat (3'-ITR) sequence and a second vector comprising: c) a third vector, comprising in the 5'-3' direction: - 5' inverted terminal repeat (5'-ITR) sequence; - promoter sequence; - a fourth intein nucleotide sequence encoding a second C-intein; - the third part of the coding sequence (CDS3'); and - 3' inverted terminal repeat (3'-ITR) sequence and a third vector comprising Includes.

[0066] Preferably, the first, second and third vectors are independently viral vectors, preferably adenoviral vectors or adeno-associated viral (AAV) vectors, and preferably, the first, second and third adeno-associated viral (AAV) vectors are selected from the same or different AAV serotypes, preferably the serotypes are selected from serotype 2, serotype 8, serotype 5, serotype 7 or serotype 9, serotype 7m8, serotype sh10; serotype 2 (quad YF).

[0067] The present invention also provides a host cell transformed with a vector system as defined above.

[0068] Preferably, the vector system or the host cell is for medical use, preferably for use in gene therapy, preferably for use in the treatment and / or prevention of a condition or disease characterised by retinal degeneration, metabolic disorders, blood disorders, neurodegenerative disorders, hearing loss, channelopathies, pulmonary diseases, myopathies, cardiac diseases, muscular dystrophies.

[0069] Preferably, the retinal degeneration is hereditary and preferably the condition or disease is selected from the group consisting of retinitis pigmentosa (RP), Leber's congenital amaurosis (LCA), Stargardt's disease (STGD), Usher's disease (USH), Alström syndrome, congenital stationary night blindness (CSNB), macular dystrophy, occult macular dystrophy, diseases caused by mutations in the ABCA4 gene.

[0070] Preferably, the vector system or host cell is for use in the prevention and / or treatment of Duchenne muscular dystrophy, cystic fibrosis, hemophilia A, Wilson's disease, phenylketonuria, dysferlinopathy, Rett's syndrome, polycystic kidney disease, Niemann-Pick disease type C, Huntington's disease.

[0071] The present invention also provides a pharmaceutical composition comprising the vector system or the host cell of the invention and a pharma- ceutically acceptable vehicle. [Brief description of the drawings]

[0072] Detailed Description of the Invention BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1] AAV inteins reconstitute EGFP at levels higher than dual AAVs, down to those achieved with single AAVs, both in vitro and in mouse and pig retinas. (A) Schematic of AAV intein-mediated protein trans-splicing. ITR: AAV2 inverted terminal repeat; CDS: coding sequence; [ka] A: 3xflag tag; polyA: polyadenylation signal. (B) Western blot (WB) analysis of lysates from HEK293 transfected with either full-length or AAV intein CMV-EGFP plasmids. pEGFP: full-length EGFP plasmid; pAAV I+II: AAV-EGFP I+II intein plasmid; pAAV I: single AAV-EGFP I intein plasmid; pAAV II: single AAV-EGFP II intein plasmid; Neg: non-transfected cells. Arrows point to both full-length EGFP protein (EGFP), the N- and C-terminal halves of the EGFP protein (B and A, respectively) and the reconstituted intein excised from the full-length EGFP protein (C). WB is representative of n=3 independent experiments. (C) WB analysis of lysates from HEK293 infected with either single, intein or dual AAV2 / 2-CMV-EGFP vectors. WB is representative of n=5 independent experiments. (D) Retinal cryosections from C57BL / 6J mice subretinally injected with AAV2 / 8-CMV-EGFP intein vectors. Scale bar: 50 μm. RPE: retinal pigment epithelium; OS: outer segment; ONL: outer nuclear layer. (EF) Retinal cryosections from either C57BL / 6J mice (E) or large white pigs (F) subretinally injected with either single, intein or dual AAV2 / 8-GRK1-EGFP vectors. Scale bar: 50 μm (E); 200 μm (F). OS: outer segment; ONL: outer nuclear layer. (G) Fluorescence analysis of retinal organoids infected with AAV2 / 2-GRK1-EGFP-intein vectors at 293 days in culture. Scale bar: 100 μm. [Diagram 2]Optimization of the AAV inteins allows correct reconstitution of the large ABCA4 and CEP290 proteins. (A-B) Western blot (WB) analysis of lysates from HEK293 transfected with different sets of either AAV-shCMV-ABCA4 or -CEP290 intein plasmids (set 1 and set 5, respectively). A schematic of the different sets used is shown in FIG. 16. WBs are representative of n=3 independent experiments. (C-D) Representative images of immunofluorescence analysis of HeLa cells transfected with either AAV-shCMV-ABCA4 (C) or AAV-shCMV-CEP290 (D) intein plasmids. pABCA4 (C) or pCEP290 (D): plasmids containing full-length expression cassettes; pAAVintein: AAV-intein plasmids (either set 1 in FIG. 2C or set 5 in FIG. 2D); I+II+III: AAV I+II+III intein plasmids; I+II: AAV I+II intein plasmids; I+III: AAV I+III intein plasmids; II+III: AAV II+III intein plasmids; I: single AAV I intein plasmid; II: single AAV II intein plasmid; III: single AAV III intein plasmid; Neg: non-transfected cells. In FIG. 2C, cells were stained for either 3xFLAG and VAP-B (endoplasmic reticulum marker) and TGN46 (trans-Golgi network marker) or in FIG. 2D for acetylated tubulin (marker for microtubules). White arrows point to cells shown at higher magnification in FIG. 18. [Diagram 3]AAV inteins reconstitute the large ABCA4 and CEP290 proteins with higher efficiency than dual AAV vectors. Western blot (WB) analysis of lysates from HEK293 cells infected with either dual or intein AAV2 / 2-shCMV-ABCA4 (A) or -CEP290 (B) vectors. AAV intein: AAV-ABCA4 (set 1, A) or -CEP290 (set 5, B) intein vectors; I+II+III: AAV I+II+III intein vectors; I+II: AAV I+II intein vectors; I+III: AAV I+III intein vectors; II+III: AAV II+III intein vectors; I: single AAV I intein vector; II: single AAV II intein vector; III: single AAV III intein vector; dual AAV: dual AAV vectors; Neg: AAV-EGFP vector. (A) Arrows point to full-length ABCA4 protein and A: protein product derived from AAV I; B: protein product derived from AAV II. *Protein products with possible different post-translational modifications. (B) Arrows point to full-length CEP290 protein and A: protein product derived from AAV II+III; B: protein product derived from AAV I+II; C: protein product derived from AAV II; D: protein product derived from AAV III; E: protein product derived from AAV I. WB is representative of n=3 independent experiments. [Figure 4]AAV inteins reconstitute large proteins to therapeutic levels in mouse, pig, and human photoreceptors. (A-C) Western blot (WB) analysis of retinal lysates from either wild-type mice (A, B) or large white pigs (C) injected with either dual or intein AAV2 / 8-GRK1-ABCA4 (A, C) or -CEP290 (B) vectors (set 1 and set 5, respectively). AAV intein: AAV intein vector; dual AAV: dual AAV vector; Neg: either AAV-EGFP vector or PBS. (D) WB analysis of lysates from human iPSC-derived 3D retinal organoids infected with AAV2 / 2-GRK1-ABCA4 intein vector. AAV intein: AAV-ABCA4 intein vector; Neg: uninfected organoid; - / -: organoid from STGD1 patient. (A, C, D) Arrows point to full-length ABCA4 protein (ABCA4) and A: protein product derived from AAV I; B: protein product derived from AAV II. *Protein products with possible different post-translational modifications. (B) Arrows point to both full-length CEP290 protein (CEP290); A: protein products derived from AAV II+III and D: protein products derived from AAV III. [Diagram 5]Subretinal administration of AAV intein ameliorates the retinal phenotype in a mouse model of inherited retinal degeneration. (A) Quantification of the mean area occupied by lipofuscin in the RPE of Abca4- / - mice treated with AAV intein. Each point represents the mean measured for each eye. The mean lipofuscin area for each group is shown in the graph. + / + or + / -; Abca4+ / + or + / - eyes injected with control (PBS); - / -: Abca4- / - eyes injected with negative control (AAV I ABCA4 or AAV II ABCA4 or PBS); - / -AAV intein: Abca4- / - eyes injected with AAV intein vector (set 1). *ANOVA p-value < 0.05; ***ANOVA p-value < 0.001. (B) Representative images of retinal sections from rd16 mice that were either wild-type uninjected and subretinally injected with AAV2 / 8-GRK1-CEP290 intein vector (AAV intein, Set 5) or injected with negative control (Neg; i.e. AAV I+II or AAV II+III or PBS). Scale bar: 25 μm. The ONL thickness measured in each image is indicated by a black vertical line. RPE: retinal pigment epithelium; ONL: outer nuclear layer; INL: inner nuclear layer; GCL: ganglion cell layer. (C) Representative images of eyes from rd16 mice that were either wild-type uninjected and subretinally injected with AAV2 / 8-GRK1-CEP290 intein vector (AAV intein, Set 5) or injected with negative control (Neg; i.e. AAV I+II or AAV II+III or PBS). The white circle defines the pupil. [Figure 6]Schematic diagram of protein trans-splicing-mediated reconstitution of a large protein. The coding sequence (CDS) of a large gene is split into two halves (5' and 3') flanked by inverted terminal repeats (ITRs), which are packaged separately into two AAV capsids. When co-transduced into the same cell, various mechanisms are explored to splice the two halves together at the protein level to reconstitute full-length protein expression. The 5'-vector contains a 5'CDS, a 5' intein (n-intein) and a degron, while the 3'-vector contains a 3'CDS and a 3' intein (c-intein); both vectors contain a promoter and polyA. Pairing of the two polypeptide halves is mediated by self-recognition of the intein; the intein subsequently excises itself from the host protein, resulting in full-length protein reconstitution. The degron is now embedded within the excised intein, which is rapidly ubiquitinated and degraded by the proteasome. [Figure 7] In vitro EGFP expression from AAV intein vectors with and without degradation signals. Western blot (WB) analysis of lysates from HEK293 cells transfected with AAV intein plasmids either with (+) or without (-) ecDHFR. Arrows point to full-length EGFP protein (EGFP), excised intein with (DnaE+ecDHFR) or without (DnaE) the degron. [Figure 8] In vitro ABCA4 expression from AAV intein vectors with and without degradation signal. Western blot (WB) analysis of lysates from HEK293 cells transfected with AAV intein plasmids either with (+) or without (-) ecDHFR. Arrows point to full-length ABCA4 protein (ABCA4), excised intein with (DnaE+ecDHFR) or without (DnaE) the degron. [Figure 9]Intein DnaE-ecDHFR expression is TMP-dependent. Western blot (WB) analysis of lysates from HEK293 cells transfected with AAV_ABCA4 intein plasmid either with (pAAVintein+ecDHFR) or without (pAAVintein) ecDHFR and treated with increasing doses of Trimetrophin (1-50 μm). Arrows point to the excised intein with (DnaE+ecDHFR) or without (DnaE) the degron. [Figure 10] In vitro EGFP expression from AAV intein vectors with and without degradation signals. Western blot (WB) analysis of lysates from HEK293 cells transfected with AAV intein plasmids either with (+) or without (-) mini-ecDHFR. Arrows point to full-length EGFP protein (EGFP), excised intein with (DnaE+mini-ecDHFR) or without (DnaE) degron. [Figure 11] In vitro ABCA4 expression from AAV intein vectors with and without degradation signal. Western blot (WB) analysis of lysates from HEK293 cells transfected with AAV intein plasmids either with (+) or without (-) mini-ecDHFR. Arrows point to full-length ABCA4 protein (ABCA4), excised intein with (DnaE+mini-ecDHFR) or without (DnaE) the degron. [Figure 12] EGFP fluorescence in HEK293 cells transfected with AAV I+II intein plasmids but not with single AAV I or AAV II. Fluorescence analysis of HEK293 cells transfected with either full-length or intein CMV-EGFP plasmids. pEGFP: plasmid containing full-length EGFP expression cassette; pAAV I+II: AAV I+II intein plasmid; pAAV I: single AAV I intein plasmid; pAAV II: single AAV II intein plasmid; Neg: non-transfected cells. Scale bar: 100 μm. [Figure 13] Inteins compared to full-length proteins differ between species. Western blot (WB) analysis of lysates from HEK293 cells (A), C57BL / 6J mice (B) and large white pig retina (C) infected with either AAV-CMV-EGFP (A) or AAV-GRK1-EGFP intein vectors (B-C). AAV intein: cells infected with AAV intein vector (A) or eyes injected with it (B, C); Neg: non-infected cells (A) or eyes injected with PBS (B, C). Arrows point to both full-length EGFP protein (EGFP) and excised intein (DnaE). [Figure 14] Characterization of human iPSC-derived 3D retinal organoids. (A) Light microscopy analysis of retinal organoids at 183 days of culture. (B) Immunofluorescence analysis with antibodies against mature photoreceptor markers. Scale bar: 100 μm. (C) Fluorescence analysis of retinal organoids infected with both AAV2 / 2-CMV-EGFP and AAV2 / 2-IRBP-DsRed vectors. Scale bar: 100 μm. (D) Outer segment-like structures were observed protruding from the surface of retinal organoids at 230 days of culture. Inset shows the presence of outer segment (OS)-like structures in a radial organization. NR: neural retina; RPE: retinal pigment epithelium. (E) Scanning electron microscopy analysis reveals the presence of inner segment (IS), connecting cilia (CC) and outer segment (OS)-like structures. Scale bar: 4 μm. (F) Electron microscopy analysis reveals the presence of the outer limiting membrane (*), centrioles (C), basal bodies (BB), connecting cilia (CC) and a sketch of the outer segment (OS). The inset shows the presence of a disorganized disc membrane of the OS. Scale bar: 500 nm. D: days in culture. [Figure 15] Low intein compared to full-length protein in human 3D retinal organoids. Western blot (WB) analysis of lysates from human iPSC-derived 3D retinal organoids infected with AAV2 / 2-GRK1-EGFP intein vector. AAV intein: AAV intein vector; Neg: non-infected organoid. Arrows point to both full-length EGFP protein (EGFP) and excised intein (DnaE). [Figure 16]Schematic diagram of various sets of AAV-ABCA4 and -CEP290 inteins. (A) AAV-ABCA4-intein constructs. (Sets 1-2 as exemplified by construct) n-DnaE: n-intein from DnaE of Npu; c-DnaE: c-intein from DnaE of Npu; (Set 3) n-mDnaE: n-intein from DnaE of mature Npu (mNpu); c-mDnaE: c-intein from DnaE of mNpu. (B) AAV-CEP290-intein constructs. (Set 1) n-DnaE: n-intein from DnaE of Npu; c-DnaE: c-intein from DnaE of Npu; shpolyA: short synthetic polyA; (Set 2) n-DnaE: n-intein from DnaE of mNpu; c-DnaE: c-intein from DnaE of mNpu; (Set 3) n-mDnaE: n-intein from DnaE of mNpu; c-mDnaE: c-intein from DnaE of mNpu; (Set 4) n-DnaE: n-intein from DnaE of Npu; c-DnaE: c-intein from DnaE of Npu between AAV I and AAV II; n-DnaB: N-intein from DnaB of Rhodothermus marinus (Rma); c-DnaB: AAV II and AAV Set 5: n-mDnaE: n-intein from DnaE of mNpu; c-mDnaE: AAV I III; wpre: Woodchuck Hepatitis Virus post-transcriptional regulatory element. (Set 5) n-mDnaE: n-intein from DnaE of mNpu; c-mDnaE: AAV I III [ka] and AAV II; n-DnaB: n-intein from DnaB of Rhodothermus marinus (Rma); c-DnaB: c-intein from DnaE of Rma between AAV II and AAV III; wpre: Woodchuck Hepatitis Virus post-transcriptional regulatory element. (A-B) ITR: AAV2 inverted terminal repeat; : 3xflag tag; promoter: short CMV for in vitro experiments and human G protein-coupled receptor (GRK1) promoter for in vivo experiments; polyA: Simian virus 40 polyadenylation signal (for ABCA4, A) and bovine growth hormone polyadenylation signal (for CEP290, B). The amino acids at the breakpoints of each set are shown in the figure. The predicted protein molecular weight is shown below each AAV vector. [Figure 17] Combining heterologous N- and C-inteins does not result in detectable EGFP protein reconstitution in vitro. Fluorescence analysis of HEK293 cells transfected with either full-length or intein AAV-CMV-EGFP plasmids. N+C-DnaE: AAV I+II fused to the intein from DnaE; N+C-DnaB: AAV I+II fused to the intein from DnaB; N+C-mDnaE: AAV I+II fused to the split intein from mDnaE; N-DnaE+C-DnaB: AAV I fused to the n-intein from DnaE and AAV II fused to the c-intein from DnaB; N-DnaB+C-DnaE: AAV I fused to the n-intein from DnaB and AAV II fused to the c-intein from DnaE; N-mDnaE+C-DnaB: AAV I fused to the n-intein from mDnaE and AAV II fused to the c-intein from DnaB; N-DnaB+C-mDnaE: AAV I fused to the n-intein from DnaE and AAV II fused to the c-intein from DnaB AAV II fused to the c-intein from I and mDnaE; pEGFP: plasmid containing the full-length EGFP expression cassette; Neg: non-transfected cells. Scale bar: 100 μm. [Figure 18]CEP290 aligns along microtubules. Zoomed-in image of a single cell from Fig. 2D. Immunofluorescence analysis of HeLa cells transfected with either a plasmid containing the full-length CEP290 expression cassette (pCEP290) or a CEP290 intein plasmid (Set 5, pAAV I+II+III). Cells were stained for 3xFLAG and acetylated tubulin (markers of microtubules). Scale bar: 50 μm. Western blot (WB) analysis of lysates from HEK293 cells transfected with either the full-length plasmid or an AAV intein plasmid encoding either the short CMV-ABCA4 (Set 1, A) or -CEP290 (Set 5, B). (A) pABCA4: full-length ABCA4 expression cassette; Set 1: ABCA4(Cys.1150)-intein plasmid. (B) pCEP290: full-length CEP290 expression cassette; Set 5: CEP290 (Ser.453 and Cys.1474)-intein plasmid. Neg: AAV EGFP plasmid. WB is representative of n=3 independent experiments. [Figure 19] Transfection of AAV intein plasmids reconstitutes less ABCA4 and CEP290 proteins than transfection of a single plasmid containing the full-length expression cassette. Western blot (WB) analysis of lysates from HEK293 cells transfected with either full-length plasmids or AAV intein plasmids encoding either the short CMV-ABCA4 (A) or -CEP290 (B). (A) pABCA4: full-length ABCA4 expression cassette; set 1: ABCA4 (Cys.1150)-intein plasmid. (B) pCEP290: full-length CEP290 expression cassette; set 5: CEP290 (Ser.453 and Cys.1474)-intein plasmid. Neg: AAV EGFP plasmid. WB is representative of n=3 independent experiments. [Figure 20]Subretinal delivery of AAV intein vectors results in ABCA4 expression in mouse retina. Western blot (WB) analysis of retinal lysates from wild-type mice injected with either dual or intein AAV2 / 8-GRK1-ABCA4 vectors (set 1). AAV intein: AAV intein vector; dual AAV: dual AAV vector; Neg: AAV-EGFP vector. [Figure 21] AAV intein reconstitutes approximately 10% of endogenous Abca4. Western blot (WB) analysis of retinal lysates from either Abca4+ / - or Abca4- / - mice injected with AAV2 / 8-GRK1-ABCA4 intein vector (set 1). mAbca4: Abca4+ / - retina; AAV intein: AAV intein-injected retina; Neg: uninjected retina. Retinal lysates from Abca4+ / - loaded on gels #2 and #3 are the same. The percentage of AAV intein ABCA4 expression relative to endogenous is shown below each lane. [Figure 22] AAV intein reconstitutes full-length ABCA4 protein in human retinal organoids. Western blot analysis of lysates from human iPSC-derived 3D retinal organoids infected with AAV2 / 2-GRK1-ABCA4 intein vectors (set 1). AAV intein: AAV intein vector; Neg: non-infected organoids. - / -: organoids derived from STGD1 patients; + / +: organoids derived from healthy donors. [Figure 23] Subretinal administration of AAV intein vectors results in reduced lipofuscin accumulation in Abca4- / - mice. Representative images of transmission electron microscopy analysis showing lipofuscin granules in the RPE of wild-type mice and Abca4- / - mice injected with either negative control (Neg) or AAV intein vectors (Set 1). White arrows point to lipofuscin granules; M: mitochondria. [Figure 24]Subretinal delivery of AAV intein vectors in mice does not alter ONL thickness. Spectral domain optical coherence tomography analysis of C57BL / 6J mouse eyes subretinally injected with either AAV intein vectors, an irrelevant AAV vector (AAV neg), or PBS. Black bars represent eyes 6 months after injection of AAV-ABCA4 intein vectors (set 1) and their corresponding controls; white bars represent eyes 4.5 months after injection of AAV-CEP290 intein vectors (set 5) and their corresponding controls. Data are presented as mean ± se. Mean values ​​are shown above the corresponding bars. [Diagram 25] The AAV intein vector was able to deliver full-length wild-type F8. A) Schematic diagram of single AAV B-domain deleted variant 3 factor VIII (F8-V3) and AAV F8 intein vector. The coding sequence of the F8 gene is split into two halves (5' and 3'F8) flanked by inverted terminal repeats (ITRs), which are packaged separately into two AAV capsids. The 5'-vector contains 5'F8 and 5' intein (n-DnaE), while the 3'-vector contains 3'F8 and 3' intein (c-DnaE); both vectors contain the HLP promoter and synthetic polyA. V3, variant 3; SS, signal sequence. B) The F8 intein, unlike the single oversized AAV F8-V3, is correctly packaged into AAV capsids with a defined vector genome. Southern blot analysis of vector genomic integrity with a probe specific for the HLP promoter showed a truncated product in the oversized AAV F8-V3 that was not present in the AAV F8 intein vector. Neg, negative control. C) AAV F8 intein vector shows modest correction of the bleeding phenotype in hemophilia A knockout mice 8 weeks post-injection. aPTT analysis of plasma samples from hemophilia A knockout mice 8 weeks post-injection with AAV F8 intein (both breakpoints) shows modest phenotypic correction compared to PBS-injected controls. aPTT, activated partial thromboplastin time. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0073] Gene therapy In the last decade, gene therapy has been applied to treat diseases in hundreds of clinical trials. Various tools have been developed to deliver genes to human cells; among them, genetically engineered viruses, including adeno-associated viruses, are currently the most popular gene delivery tools. Most systems include a vector capable of accommodating a gene of interest and a helper cell that can provide viral structural proteins and enzymes to enable the generation of infectious viral particles containing the vector. Adeno-associated viruses are a family of viruses that differ in nucleotide and amino acid sequences, genome structure, pathogenicity, and host range. This diversity provides the opportunity to use viruses with different biological properties to develop various therapeutic applications. As with any delivery tool, the efficiency of adeno-associated virus-based systems, the ability to target specific tissues or cell types, expression of the gene of interest, and safety are important for the successful application of gene therapy. In recent years, a great deal of effort has been invested in these research fields. Various improvements have been made to adeno-associated virus-based vectors and helper cells to modify gene expression, target delivery, improve viral titers, and increase safety. The present invention represents an improvement on this design process in that it functions to efficiently deliver genes of interest whose size exceeds the cargo limit of a single adeno-associated virus-based vector. Viruses are the logical gene delivery tools. Viruses replicate within cells and therefore have evolved mechanisms to enter cells and express their genes using the cellular machinery. The concept of virus-based gene delivery is to engineer a virus so that it can express a gene of interest. Depending on the specific application and type of virus, most viral vectors contain mutations that hinder their ability to replicate freely in the host like wild-type viruses. Several different families of viruses have been modified to create viral vectors for gene delivery. These viruses include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes simplex viruses, picornaviruses, and alphaviruses. The present invention preferably uses adeno-associated viruses.Thus, viral-based vectors for gene delivery include, without limitation, adenoviral vectors, adeno-associated viral (AAV) vectors, pseudotyped AAV vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors.

[0074] An ideal adeno-associated virus-based gene delivery vector should be efficient, cell-specific, regulated, and safe. Delivery efficiency is important because it can affect the efficacy of therapy. Currently, efforts are being made to achieve cell type-specific infection and gene expression with adeno-associated virus vectors. In addition, since this therapy may require sustained or regulated expression, adeno-associated virus vectors are being developed to regulate the expression of the gene of interest. Since most viruses are pathogens or have the potential to be pathogenic, safety is a major challenge for viral gene delivery.

[0075] Adeno-associated virus (AAV) is a small virus that infects humans and some other primate species. AAV is not currently known to cause disease, and therefore it provokes a very weak immune response. AAV-based gene therapy vectors can infect both dividing and quiescent cells and persist in an extrachromosomal state without integration into the host cell genome. These characteristics make AAV a highly attractive candidate for the creation of viral vectors for gene therapy and for the creation of isogenic human disease models.

[0076] Wild-type AAV has attracted great interest from gene therapy researchers due to several characteristics. Among them, the virus appears to be non-pathogenic. It can also infect non-dividing cells and has the ability to stably integrate into the host cell genome at a specific site (designated AAVS1) on human chromosome 19. This characteristic makes it somewhat more predictable than retroviruses, which are subject to random integration and mutagenesis, sometimes followed by the development of cancer. While the AAV genome integrates most frequently at the above-mentioned sites, random integration into the genome occurs at a negligible frequency. However, in the development of AAV as a gene therapy vector, this integration ability has been eliminated by removing the rep and cap from the vector DNA. The desired gene is inserted between the inverted terminal repeats (ITRs) along with a promoter driving the transcription of the gene, and these ITRs aid in the formation of concatemers in the nucleus after the single-stranded vector DNA is converted to double-stranded DNA by the host cell DNA polymerase complex. AAV-based gene therapy vectors form episomal concatemers in the host cell nucleus. In non-dividing cells, these concatemers remain intact for the life of the host cell. In dividing cells, AAV DNA is lost throughout cell division because episomal DNA is not replicated along with the host cell DNA. Random integration of AAV DNA into the host genome is detectable but occurs only at very low frequencies. AAV also exhibits very low immunogenicity that appears to be limited to the generation of neutralizing antibodies, while AAV does not induce a clearly defined cytotoxic response. This feature, together with the ability to infect quiescent cells, gives it an advantage over adenovirus as a vector for human gene therapy.

[0077] AAV genome, transcriptome and proteome The AAV genome is made of single-stranded deoxyribonucleic acid (ssDNA) of either positive or negative strand and is approximately 4.7 kilobases in length. The genome contains inverted terminal repeats (ITRs) at both ends of the DNA strand and two open reading frames (ORFs): rep and cap. The former consists of four overlapping genes that code for the Rep protein required for the AAV life cycle, while the latter contains overlapping nucleotide sequences of the capsid proteins: VP1, VP2 and VP3, which interact together to form a capsid with icosahedral symmetry.

[0078] ITR sequence The inverted terminal repeat (ITR) sequences contain 145 bases each. They are so named because of their symmetry, which has been shown to be necessary for efficient propagation of the AAV genome. Another property of these sequences is their ability to form hairpins, which contribute to the so-called self-priming that allows primase-independent DNA second strand synthesis. ITRs have also been shown to be necessary for both integration of AAV DNA into and rescue from the host cell genome (chromosome 19 in humans) and efficient encapsidation of AAV DNA in conjunction with the generation of fully assembled deoxyribonuclease-resistant AAV particles.

[0079] For gene therapy, it appears that the ITRs are the only sequences that need to be in cis next to the therapeutic gene: the structural (cap) and packaging (rep) genes can be delivered in trans. Based on this assumption, many methods have been established to efficiently generate recombinant AAV (rAAV) vectors containing reporter or therapeutic genes. However, it has also been published that the ITRs are not the only elements required in cis for efficient replication and encapsidation. Several research groups have identified sequences, named cis-acting Rep-dependent elements (CAREs), within the coding sequence of the rep gene. CAREs have been shown to enhance replication and encapsidation when present in cis.

[0080] AAV serotype To date, dozens of different AAV variants (serotypes) have been identified and classified (60). All known serotypes are capable of infecting cells of multiple diverse tissue types. Tissue specificity is determined by the capsid serotype, and pseudotyping of AAV vectors to alter their tropism range will be important for their use in therapy. Pseudotyped AAV vectors contain the genome of one AAV serotype within the capsid of a second AAV serotype; for example, AAV2 / 8 vectors contain an AAV8 capsid and an AAV2 genome (61). Such vectors are also known as chimeric vectors.

[0081] Serotype 2 Serotype 2 (AAV2) is the one that has been most extensively investigated to date. AAV2 naturally has tropism for skeletal muscle, neurons, vascular smooth muscle cells, and hepatocytes. AAV2 has three cellular receptors: heparan sulfate proteoglycans (HSPGs), a v β5 integrin and fibroblast growth factor receptor 1 (FGFR-1) have been described. The first acts as a primary receptor, while the latter two have co-receptor activity, allowing AAV to enter cells by receptor-mediated endocytosis. These findings are discussed by Qiu, Handa, et al. HSPGs act as primary receptors, but they are abundant in the extracellular matrix, which may scavenge AAV particles and impair infection efficiency.

[0082] Studies show that serotype 2 of the virus (AAV-2) appears to kill cancer cells without apparently damaging healthy cells. "Our results suggest that adeno-associated virus type 2, which infects a large proportion of the population with no known adverse effects, can kill multiple types of cancer cells but have no effect on healthy cells," said Craig Meyers, professor of immunology and microbiology at the Penn State College of Medicine in Pennsylvania. This could lead to new anticancer drugs.

[0083] Other serotypes Although AAV2 is the most commonly used serotype for various AAV-based studies, it has been shown that other serotypes may be more effective as gene delivery vectors. For example, AAV6 appears to be much better at infecting airway epithelial cells, AAV7 shows extremely high transduction rates of mouse skeletal muscle cells (similar to AAV1 and AAV5), AAV8 excels at transducing hepatocytes and photoreceptors, and AAV1 and 5 have been shown to be extremely efficient at gene delivery to vascular endothelial cells. In the brain, most AAV serotypes show neuronal tropism, while AAV5 also transduces astrocytes. AAV6, a hybrid of AAV1 and AAV2, also shows lower immunogenicity than AAV2.

[0084] Serotypes can differ in terms of the receptors they bind. For example, AAV4 and AAV5 transduction can be inhibited by soluble sialic acid (in different forms for each of these serotypes), and AAV5 has been shown to enter cells via the platelet-derived growth factor receptor. Novel AAV mutants such as quadruple tyrosine mutants or AAV2 / 7m8 have been shown to transduce the outer retina from the vitreous in small animal models (62, 63). Another AAV mutant, named ShH10, is an AAV6 mutant with improved neurogliotropism after intravitreal administration (64). A further AAV mutant with a particularly favorable tropism for the retina is AAV2(quad YF) (65).

[0085] The gene delivery vehicle of the present invention may be administered to a patient. The administration may be "in vivo" or "ex vivo". Those skilled in the art will be able to determine the appropriate dosage rate. The term "administered" includes delivery by viral or non-viral techniques. Viral delivery mechanisms include, but are not limited to, adenoviral vectors, adeno-associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, and baculoviral vectors, as described above.

[0086] Non-viral delivery systems include DNA transfection such as electroporation, lipid-mediated transfection, compacted DNA-mediated transfection; liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.

[0087] Delivery of one or more therapeutic genes by the vector system of the present invention can be used alone or in combination with other treatments or components of treatments.

[0088] Pharmaceutical Compositions The present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of the vector / construct or host cell of the present invention comprising one or more deliverable therapeutic and / or diagnostic transgenes or viral particles produced or obtained therefrom. The pharmaceutical composition may be for human or animal use. Typically, a physician will determine the actual dosage that may be most suitable for an individual subject, which will vary according to the age, weight and response of the particular individual. The composition may optionally comprise a pharma-ceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient or diluent can be selected in view of the intended route of administration and standard pharmaceutical practice. The pharmaceutical composition may comprise, as - or in addition to - a carrier, excipient or diluent, any suitable one or more binders, one or more lubricants, one or more suspending agents, one or more coating agents, one or more solubilizing agents and other carrier agents that may aid or increase the entry of the virus into the target site (such as, for example, lipid delivery systems). Where appropriate, the pharmaceutical composition can be administered by any one or more of the following means: administration by inhalation, administration in the form of a suppository or pessary, administration locally in the form of a lotion, solution, cream, ointment or dusting powder, administration by using a skin patch, administration orally in the form of a tablet containing excipients such as starch or lactose, administration in a capsule or vaginal suppository, either alone or in admixture with excipients, administration in the form of an elixir, solution or suspension containing flavoring or coloring agents; preferably, the pharmaceutical composition can be parenterally injected, for example, intracavernosally, intravenously, intramuscularly or subcutaneously.For parenteral administration, the composition can be best used in the form of a sterile aqueous solution, which may contain other substances, for example, sufficient salts or monosaccharides to make the solution isotonic with blood.For buccal or sublingual administration, the composition can be administered in the form of a tablet or lozenge, which can be formulated in a conventional manner.

[0089] Preferred formulations are where the vector system is administered locally into the conjunctival sac or subconjunctivally, preferably 1 to 10 times daily, preferably for 1 day to 6 months, preferably for 1 day to 30 days.

[0090] Preferred administrations are administration into the anterior chamber, intravitreal injection, subretinal injection, juxtabulbar and / or retrobulbar injection, intrastromal corneal injection.

[0091] Preferably, the pharmaceutical compositions of the present invention are intended for topical application to the eye and are therefore ophthalmic compositions.

[0092] The vector system of the present invention can be administered by any convenient route, however the preferred route is topical to the ocular surface, particularly the cornea, and even more preferred is instillation into the conjunctival sac.

[0093] A particular object of the present invention is the use of the vector system to produce ophthalmic compositions for topical administration to the eye for medical use.

[0094] More generally, a preferred embodiment of the invention is a composition comprising a vector system, optionally together with one or more pharma- ceutically acceptable excipients (such as diluents or carriers), formulated for local application to localized, superficial or focal areas of the eye and / or ocular adnexa.

[0095] As used herein, the terms "vehicle," "diluent," "carrier," and "additive" are synonymous.

[0096] The ophthalmic compositions of the present invention may be in the form of a solution, emulsion or suspension (eye wash), ointment, gel, aerosol, mist or liniment together with an ophthalmic carrier that is pharma- ceutically acceptable, tolerated by the eye, and compatible with the active ingredient.

[0097] Also within the scope of the invention are certain intraocular administration routes for delayed release, such as, for example, intraocular erodible inserts or polymeric membrane "reservoir" systems placed in the conjunctival sac or contact lens.

[0098] The ophthalmic compositions of the present invention may be administered topically, for example, the compositions are delivered to and come into direct contact with the eye and / or the adnexa of the eye.

[0099] The pharmaceutical composition comprising at least the vector system of the present invention can be prepared by any conventional technique, for example as described in Remington: The Science and Practice of Pharmacy 1995, edited by E. W. Martin, Mack Publishing Company, 19th edition, Easton, Pa.

[0100] In one embodiment, the composition is formulated so that it is a liquid, where the vector system can be in solution or suspension. The composition can be formulated in any liquid form suitable for topical application, such as eye drops, artificial tears, eye washes, or contact lens absorbents, including liquid carriers such as cellulose ethers (e.g., methylcellulose).

[0101] Preferably, the liquid is an aqueous liquid. Furthermore, it is preferred that the liquid is sterile. Sterility can be imparted by any conventional method, such as filtration, irradiation or heating, or by carrying out the manufacturing process under sterile conditions.

[0102] The liquid may include one or more lipophilic media.

[0103] In one embodiment of the present invention, the composition is formulated as an ointment. Preferably, one carrier in the ointment may be a petrolatum carrier.

[0104] The pharma- ceutically acceptable vehicle can generally be any conventionally used pharma- ceutically acceptable vehicle, which must be selected depending on the particular formulation, the intended route of administration, etc. Furthermore, the pharma- ceutically acceptable vehicle can be any generally recognized excipient found, for example, in the FDA "List of Excipients" available at the internet address http: / / www.fda.gov / cder / drug / iig / default.htm.

[0105] At least one pharma- ceutically acceptable diluent or carrier may be a buffer. Depending on the purpose, it is often desirable for the composition to include a buffer, which has the capacity to buffer the solution to a pH in the range of 5-9, for example pH 5-6, pH 6-8 or pH 7-7.5.

[0106] However, in other embodiments of the present invention, the pharmaceutical composition may contain no buffer or only micromolar amounts of buffer. The buffer may be selected from the group consisting of, for example, Tris, acetate, glutamate, lactate, maleate, tartrate, phosphate, citrate, borate, carbonate, glycinate, histidine, glycine, succinate and triethanolamine buffers. Thus, the buffer may be K2HPO4, Na2HPO4 or sodium citrate.

[0107] In a preferred embodiment, the buffer is a Tris buffer, which is known by various other names, such as Tromethamine, including Tromethamine USP, THAM, Trizma, Trisamine, Trisamino, and Trometamol. The name Tris encompasses all of the above names.

[0108] The buffer may further be selected, particularly when the pharmaceutical formulation is for parenteral use, from, for example, USP compatible buffers for parenteral use.For example, the buffer may be selected from the group consisting of monobasic acids such as acetic acid, benzoic acid, gluconic acid, glyceric acid and lactic acid, dibasic acids such as aconitic acid, adipic acid, ascorbic acid, carbonic acid, glutamic acid, malic acid, succinic acid and tartaric acid, polybasic acids such as citric acid and phosphoric acid, and bases such as ammonia, diethanolamine, glycine, triethanolamine and Tris.

[0109] The compositions may contain preservatives such as thimerosal, chlorobutanol, benzalkonium chloride or chlorhexidine, buffers such as phosphates, borates, carbonates and citrates, and thickeners such as high molecular weight carboxyvinyl polymers such as those sold under the trade name Carbopol, a trademark of BF Goodrich Chemical Company, hydroxymethylcellulose and polyvinyl alcohol (all as per the prior art).

[0110] In some embodiments of the present invention, the pharma- ceutically acceptable additive comprises a stabilizer. The stabilizer may be, for example, a detergent, an amino acid, a fatty acid, a polymer, a polyhydric alcohol, a metal ion, a reducing agent, a chelating agent, or an antioxidant, however, any other suitable stabilizer may be used in the present invention. For example, the stabilizer may be selected from the group consisting of poloxamer, Tween-20, Tween-40, Tween-60, Tween-80, Brij, a metal ion, an amino acid, polyethylene glycol, Triton, and ascorbic acid.

[0111] Furthermore, the stabilizer may be selected from the group consisting of amino acids such as glycine, alanine, arginine, leucine, glutamic acid and aspartic acid, surfactants such as polysorbate 20, polysorbate 80 and poloxamer 407, fatty acids such as phosphatidylcholine ethanolamine and acetyl tryptophanate, polymers such as polyethylene glycol and polyvinylpyrrolidone, polyhydric alcohols such as sorbitol, mannitol, glycerin, sucrose, glucose, propylene glycol, ethylene glycol, lactose and trehalose, antioxidants such as ascorbic acid, cysteine ​​HCL, thioglycerol, thioglycolic acid, thiosorbitol and glutathione, reducing agents such as some thiols, EDTA salts, chelating agents such as glutamic acid and aspartic acid.

[0112] The pharma- ceutically acceptable excipients may include one or more selected from the group consisting of isotonic salts, hypertonic salts, hypotonic salts, buffers and stabilizers.

[0113] In a preferred embodiment, other pharmaceutical excipients are present, such as a preservative, hi one embodiment, the preservative is a paraben, such as, but not limited to, methyl parahydroxybenzoate or propyl parahydroxybenzoate.

[0114] In some embodiments of the invention, the pharma- ceutically acceptable excipients include mucolytic agents (eg, N-acetylcysteine), hyaluronic acid, cyclodextrin, and petroleum.

[0115] Exemplary compounds that may be incorporated into the pharmaceutical compositions of the present invention to facilitate and facilitate transdermal delivery of the topical composition to the ocular or adnexal tissue include, but are not limited to, alcohols (ethanol, propanol, and nonanol), fatty alcohols (lauryl alcohol), fatty acids (valeric acid, caproic acid, and capric acid), fatty acid esters (isopropyl myristate and isopropyl n-hexanoate), alkyl esters (ethyl acetate and butyl acetate), polyols (propylene glycol, propanedione, and hexanetriol), sulfoxides (dimethyl sulfoxide and decylmethyl sulfoxide), amides (urea, dimethylacetamide, and pyrrolidone derivatives), surfactants (sodium lauryl sulfate, cetyltrimethylammonium bromide, poloxamers, spans, tweens, bile salts, and lecithin), terpenes (d-limonene, alpha-terpineol, 1,8-cineole, and menthone), and alkanones (N-heptane and N-nonane). Additionally, topically administered compositions may include surface adhesion molecule modulating agents, including, but not limited to, cadherin antagonists, selectin antagonists, and integrin antagonists.

[0116] In addition, the eye drops may contain a thickening agent such as hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose, methylcellulose, polyvinylpyrrolidone, etc. to improve retention of the medicine in the conjunctival sac.

[0117] In certain embodiments, the vector system for use according to the invention may be combined with ophthalmologically acceptable preservatives, surfactants, viscosity enhancers, permeation enhancers, buffers, sodium chloride and water to form an aqueous, sterile ophthalmic suspension or solution. The eye drop solution may further comprise an ophthalmologically acceptable surfactant to aid in dissolution of the vector system. The eye drop formulation may be prepared by dissolving the vector system in a physiologically acceptable isotonic aqueous buffer.

[0118] To prepare a sterile ophthalmic ointment formulation, the vector system may be combined with a preservative in a suitable vehicle such as mineral oil, liquid lanolin, or white petrolatum. Sterile ophthalmic gel formulations may be prepared by suspending the vector system in a hydrophilic base prepared from combinations following previously published formulations for similar ophthalmic preparations, such as Carbopol-940; preservatives and tonicity agents may be incorporated.

[0119] Preferably, the formulation of the present invention is an aqueous, non-irritating ophthalmic composition for topical application to the eye comprising a therapeutically effective amount of a topical therapeutic vector system; a xanthine derivative present in an amount between an amount of a water-soluble derivative of the composition and 0.05% weight / volume of the composition effective to reduce discomfort associated with the vector system upon topical application of the composition, the xanthine derivative being selected from the group consisting of theophylline, caffeine, theobromine and mixtures thereof; an ophthalmic preservative; and a buffer to provide an isotonic, aqueous, non-irritating ophthalmic composition.

[0120] Drug Delivery Devices In one embodiment, the invention includes a drug delivery device consisting of at least a vector system and a pharma- ceutically compatible polymer. For example, the composition is compounded or coated on the polymer. The composition is either chemically bound or physically mixed into the polymer. The polymer is either hydrophobic or hydrophilic. The polymeric device includes multiple physical configurations. Exemplary physical forms of the polymeric device include, but are not limited to, films, scaffolds, chambers, spheres, microspheres, stents, or other structures. The polymeric device has an inner surface and an outer surface. The device has one or more internal chambers. These chambers house one or more compositions. The device contains polymers of one or more chemically distinguishable monomers. The subunits or monomers of the device are polymerized in vitro or in vivo.

[0121] In a preferred embodiment, the invention includes a device comprising a polymer and a bioactive composition formulated in or on said polymer, wherein said composition comprises a vector system, and wherein said device is implanted or injected into ocular surface tissue, adnexal tissue in contact with ocular surface tissue, an ocular or adnexal cavity filled with bodily fluid, or an ocular or adnexal cavity.

[0122] Exemplary mucoadhesive polyanionic natural or semi-synthetic polymers from which the device may be formed include, but are not limited to, polygalacturonic acid, hyaluronic acid, carboxymethyl amylose, carboxymethyl chitin, chondroitin sulfate, heparin sulfate, and mesoglycan. In one embodiment, the device comprises a biocompatible polymer matrix, which may optionally be fully or partially biodegradable. Hydrogels are one example of a suitable polymer matrix material. Examples of materials that may form hydrogels include polylactic acid, polyglycolic acid, PLGA polymers, alginates and alginate derivatives, gelatin, collagen, agarose, natural and synthetic polysaccharides, polyamino acids such as polypeptides, particularly poly(lysine), polyesters such as polyhydroxybutyrate and poly-ε-caprolactone, polyanhydrides; polyphosphazines, polyvinyl alcohols), poly(alkylene oxides), particularly poly(ethylene oxides), poly(allylamine)s (PAM), poly(acrylates), modified styrene polymers such as poly(4-aminomethylstyrene), pluronic polyols, poloxamers, poly(uronic acids), poly(vinylpyrrolidone) and copolymers of the above, including graft copolymers. In another embodiment, the scaffold may be made of a variety of synthetic and naturally occurring polymers, including, but not limited to, collagen, fibrin, hyaluronic acid, agarose and laminin-rich gels.

[0123] One preferred material for hydrogels is alginate or modified alginate materials. Alginate molecules are composed of (1-4) linked β-D-mannuronic acid (M units) and L-guluronic acid (G units) monomers with varying ratios and sequence distribution along the polymer chain. Alginate polysaccharides are polyelectrolyte systems that have a strong affinity for divalent cations (e.g., Ca+2, Mg+2, Ba+2) and form stable hydrogels when exposed to these molecules.

[0124] The device is administered topically, subconjunctivally or into the episcleral space, subcutaneously, or intraductally. Specifically, the device is placed on or just beneath the surface of the ocular tissue. Alternatively, the device is placed within the lacrimal duct or gland. The composition, incorporated in or onto the polymer, is released or diffuses out of the device.

[0125] In one embodiment, the composition is incorporated into or coated on a contact lens or drug delivery device, and one or more molecules diffuse out of such lens or device or are released in a time-controlled manner.In this embodiment, the contact lens composition either remains on the ocular surface, for example, when the lens is needed for vision correction, or the contact lens dissolves over time, and simultaneously releases the composition into the tissues that are closely juxtaposed.Similarly, in various embodiments, the drug delivery device is optionally biodegradable or permanently placed.

[0126] For example, the composition is incorporated into or coated onto the lens. The composition is chemically bound or physically entrained in the contact lens polymer. Alternatively, a color additive is chemically bound or physically entrained in the polymer composition and released at the same rate as the therapeutic drug composition, so that a change in the intensity of the color additive is indicative of a change in the amount or dose of the therapeutic drug composition that remains bound or entrained in the polymer. Alternatively or additionally, an ultraviolet (UV) light absorbing agent is chemically bound or physically entrained in the contact lens polymer. Contact lenses are either hydrophobic or hydrophilic.

[0127] Exemplary materials used in the manufacture of hydrophobic lenses comprising a delivery vehicle for the compositions of the present invention include, but are not limited to, Amefocon A, Amsilfocon A, Akirafocon A, Alfocon A, Kabfocon A, Kabfocon B, Carbosylfocon A, Krylfocon A, Krylfocon B, Dimefocon A, Enflufocon A, Enflufocon B, Elifocon A, Flurofocon A, Flusylfocon A, Flusylfocon B, Flusylfocon C, Flusylfocon D, Flusylfocon E, Hexafocon A, Hofocon A, Hibfocon A, Itabisfluorofocon A, Itafluorofocon A, Itafocon A, Itafocon B, Corfoccon A, Corfoccon B, Corfoccon C, Corfoccon D, Rotifoccon A, Rotifoccon B, Rotifoccon C, Rotifoccon D, Rotifoccon D, Rotifoccon E, Rotifoccon F ... C, Melafokon A, Migafokon A, Nefokon A, Nefokon B, Nefokon C, Oncifokon A, Oplifokon A, Oxyfluflocon A, Pafluflocon B, Pafluflocon C, Pafluflocon D, Pafluflocon E, Pafluflocon F, Pacifocon A, Pacifocon B, Pacifocon C, Pacifocon D, Pacifocon E, Pemfokon A, Polofokon A, Polofokon B, Rofluflocon A, Rofluflocon B, Rofluflocon C, Rofluflocon D, Rofluflocon E, Rosylfocon A, Satafokon A, Sifluflocon A, Silafokon A, Stellafokon A, Sulfocon A, Sulfocon B, Terafokon A, Chisylfocon A, Trofocon A, Trifocon A, Unifokon A, Binafokon A and Willofokon A.Exemplary materials used in the manufacture of hydrophilic lenses comprising a delivery means for the compositions of the present invention include, but are not limited to, abafilcon A, acofilcon A, acofilcon B, aquafilcon A, allofilcon A, alphafilcon A, amfilcon A, astifilcon A, atrafilcon A, balafilcon A, bisfilcon A, bufilcon A, comfilcon A, clofilcon A, cyclofilcon A, dalfilcon A, deltafilcon A, deltafilcon B, dimefilcon A, droxfilcon A, elastofilcon A, epsilfilcon A, esterifilcon A, etafilcon A, focofilcon A, galyfilcon A, genfilcon A, gobafilcon A, hefilcon A, hefilcon B, hefilcon C, hilafilcon A, hilafilcon B, hyoxifilcon A, hyoxifilcon B, hyoxifilcon C ... Examples of suitable ?lcon include ?lcon A, hyoxi?lcon B, hyoxi?lcon C, hydro?lcon A, lene?lcon A, licli?lcon A, licli?lcon B, lido?lcon A, lido?lcon B, lotra?lcon A, lotra?lcon B, ma?lcon A, mesa?lcon A, meta?lcon B, mipa?lcon A, nel?lcon A, netra?lcon A, oc?lcon A, oc?lcon B, C, oc?lcon D, oc?lcon E, o?lcon A, oma?lcon A, oxy?lcon A, penta?lcon A, per?lcon A, peva?lcon A, fem?lcon A, polyma?lcon, seno?lcon A, sila?lcon A, siloxi?lcon A, sulf?lcon A, te?lcon A, tetra?lcon A, tri?lcon A, bi?lcon A, bi?lcon B, and xylo?lcon A.

[0128] Compositions formulated as gels or gel-like substances, creams or viscous emulsions are within the scope of the present invention. The compositions preferably contain at least one gelling component, polymer or other suitable agent that increases the viscosity of the composition. Any gelling component known to those skilled in the art that does not adversely affect the area under treatment and is applicable in the formulation of compositions and pharmaceutical compositions for topical administration to the skin, eyes or mucous membranes can be used. For example, the gelling component may be selected from the group of acrylic acid, carbomer, carboxypolymethylene, materials such as those sold under the trademark Carbopol by BF Goodrich (e.g., Carbopol 940), polyethylene-polypropylene glycol, materials such as those sold under the trademark Poloxamer by BASF (e.g., Poloxamer 188), cellulose derivatives such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxyethylene cellulose, methyl cellulose, carboxymethyl cellulose, propylene glycol alginate esters, polyvinylpyrrolidone, Veegum (magnesium aluminum silicate), Pemulen, Simulgel (such as Simulgel 600, Simulgel EG and Simulgel NS), Capigel, Corafax, Plasdones, and the like, and mixtures thereof.

[0129] A gel or gel-like material according to the present invention may for example comprise less than 10% w / w water, such as less than 20% w / w water, for example at least 20% w / w water, such as at least 30% w / w water, such as at least 40% w / w water, such as at least 50% w / w water, for example at least 75% w / w water, such as at least 90% w / w water, for example at least 95% w / w water. Preferably, the water is deionised water.

[0130] The gel-like material of the present invention includes hydrogels, which are colloidal gels formed as dispersions in water or other aqueous media. Thus, hydrogels are formed upon the formation of colloids, where the dispersed phase (the colloid) combines with the continuous phase (i.e., water) to produce a viscous, jelly-like product; for example, coagulated silicic acid. Hydrogels are three-dimensional networks of hydrophilic polymer chains cross-linked by either chemical or physical bonds. Due to the hydrophilic nature of the polymer chains, hydrogels absorb water and swell. The swelling process is the same as the dissolution of non-cross-linked hydrophilic polymers. By definition, water accounts for at least 10% of the total weight (or volume) of the hydrogel.

[0131] Examples of hydrogels include synthetic polymers such as polyhydroxyethylmethacrylate and chemically or physically crosslinked polyvinyl alcohol, polyacrylamide, poly(N-vinylpyrrolidone), polyethylene oxide, and hydrolyzed polyacrylonitrile. Examples of hydrogels that are organic polymers include covalently or ionically crosslinked polysaccharide-based hydrogels such as polyvalent metal salts of alginic acid, pectin, carboxymethylcellulose, heparin, hyaluronate, and hydrogels derived from chitin, chitosan, pullulan, gellan, and xanthan. The specific hydrogels used in our experiments were cellulosic compounds (i.e., hydroxypropylmethylcellulose [HPMC]) and high molecular weight hyaluronic acid (HA).

[0132] Hyaluronic acid is a polysaccharide produced by a variety of living tissues. U.S. Patent No. 5,166,331 discusses the purification of various fractions of hyaluronic acid for use as a substitute for intraocular fluid and as a topical ophthalmic drug carrier. Other U.S. patent applications that discuss the ophthalmic use of hyaluronic acid include U.S. Patent Application Nos. 11 / 859,627; 11 / 952,927; 10 / 966,764; 11 / 741,366; and 11 / 039,192. Formulations of polymers for intraocular use are known, see, for example, U.S. Patent Application Nos. 11 / 370,301; 11 / 364,687; U.S. Provisional Patent Application Nos. 60 / 721,600; 11 / 116,698 and 60 / 567,423; and 11 / 695,527. The use of various active agents, such as high viscosity hyaluronic acid, is known. See, for example, U.S. Patent Application Nos. 10 / 966,764; 11 / 091,977; 11 / 354,415; U.S. Provisional Patent Application Nos. 60 / 519,237; 60 / 530,062 and 11 / 695,527.

[0133] Sustained release formulations as described in WO2010048086 are within the scope of the present invention.

[0134] The skilled artisan is well aware of standard methods for introducing polynucleotides or vectors into host cells, such as, for example, transfection, lipofection, electroporation, microinjection, viral infection, heat shock, transformation or cell fusion after chemical permeabilization of the membrane.

[0135] As used herein, the term "host cell or genetically engineered host cell" relates to a host cell which has been transduced, transformed or transfected with a construct or vector as described above.

[0136] Representative examples of suitable host cells include bacterial cells such as E. coli, Streptomyces, Salmonella typhimurium, fungal cells such as yeast, insect cells such as Sf9, animal cells such as CHO or COS, plant cells, and the like. Selection of a suitable host is deemed to be within the scope of one skilled in the art from the teachings herein. Preferably, the host cell is an animal cell, and most preferably a human cell. The present invention further provides a host cell comprising any of the recombinant expression vectors described herein. The host cell may be a cultured cell or a primary cell, i.e., one directly isolated from an organism, e.g., a human. The host cell may be an adherent cell or a suspension cell, i.e., a cell that grows in a suspension. Suitable host cells are known in the art and include, for example, DH5α, E. coli cells, Chinese hamster ovary cells, monkey VERO cells, COS cells, HEK293 cells, and the like.

[0137] In the case of ex vivo gene therapy, host cells can be cells isolated from a patient, such as hematopoietic stem cells, which upon introduction of the transgene are reintroduced into said patient in need thereof.

[0138] AAV-based viral delivery systems Construction of AAV vectors can be carried out according to procedures and using techniques known to those skilled in the art. The theory and practice of adeno-associated viral vector construction and use in therapy are exemplified in several scientific and patent publications (the following references are incorporated herein by reference: Flotte TR. Adeno-associated virus-based gene therapy for inherited disorders. Pediatr Res. 2005 Dec;58(6):1143-7; Goncalves MA. Adeno-associated virus: from defective virus to effective vector, Virol J. 2005 May 6;2:43; Surace EM, Auricchio A. Adeno-associated viral vectors for retinal gene transfer. Prog Retin Eye Res. 2003 Nov;22(6):705-19; Mandel RJ, Manfredsson FP, Foust KD, Rising A, Reimsnider S, Nash K, Burger C. Recombinant adeno-associated viral vectors as therapeutic agents to treat neurological disorders. Mol Ther. 2006 Mar;13(3):463-83).

[0139] Suitable administration forms of pharmaceutical compositions containing AAV vectors include, but are not limited to, injectable solutions or suspensions, eye drops, and eye ointments. In a preferred embodiment, the AAV vector is administered by intrathecal injection. In a particularly preferred embodiment, the AAV vector is administered by subretinal injection into the anterior chamber or into the retrobulbar space and vitreous. Preferably, the viral vector is delivered by a subretinal approach (as described in Bennicelli J, et al Mol Ther. 2008 Jan 22; Reversal of Blindness in Animal Models of Leber Congenital Amaurosis Using Optimized AAV2-mediated Gene Transfer).

[0140] The dose of the virus used in the therapy will be determined on a case-by-case basis depending on the route of administration, the severity of the disease, the general condition of the patient and other clinical parameters. In general, a suitable dosage is within the range of 10 8 ~10 13 Even the vg (vector genome) / eye may vary.

[0141] Intein An intein is a segment in a protein that can excise itself and splice in the remaining part (an extein) with a peptide bond in a process known as protein splicing. Such segments are called "inteins" for the inner protein sequence and "exteins" for the outer protein sequence, where the upstream extein is referred to as the "N-extein" and the downstream extein as the "C-extein". The products of the protein splicing process are two stable proteins: the mature protein and the intein.

[0142] Inteins can also exist as two fragments encoded by two separately transcribed and translated genes, termed herein "split inteins."

[0143] Inteins of the present invention include, without limitation, split inteins listed in the New England Biolabs intein database disclosed in (66).

[0144] Split inteins can be produced by starting with an intein and first removing the homing endonuclease domain sequence to produce a mini-intein, which can then be split at one or more sites designed through protein sequence alignment with an intein of known crystal structure to generate a split intein, which can be assayed for trans-splicing activity according to the protocols contained in this disclosure.

[0145] Split inteins can be further improved for desirable characteristics, including activity, efficiency, versatility and stability, through site-directed mutagenesis or modification of the intein sequence based on rational design and / or through directed evolution using methods such as functional selection, phage display and ribosome display.

[0146] An example of a split intein is the intein from DnaE, ​​the catalytic subunit of DNA polymerase III in cyanobacteria, which is encoded by two separate genes, dnaE-n and dnaE-c. The intein encoded by the dnaE-n gene is referred to herein as the "N-intein." The intein encoded by the dnaE-c gene is referred to herein as the "C-intein." In general, the N portion of a split intein is referred to as the "N-intein" and the C portion of a split intein is referred to as the "C-intein." Split inteins self-associate to catalyze protein splicing activity in trans (herein "trans-splicing").

[0147] Further examples of split inteins of the invention include the intein DnaE from Nostoc punctiforme (Npu), shown in Table 3 below as SEQ ID NO: 1 encoded by the Npu-DnaE-n nucleotide sequence and SEQ ID NO: 2 encoded by the Npu-DnaE-c nucleotide sequence (27, 28); the intein DnaE from Rhodothermus marinus, shown in Table 3 below as SEQ ID NO: 4 encoded by the Rma-DnaB-n nucleotide sequence and SEQ ID NO: 5 encoded by the Rma-DnaB-c nucleotide sequence (29); marinus (Rma) (29); mutant N- and C-inteins (30) in which the N-intein is from DnaE of Npu (SEQ ID NO: 5) and the C-intein is from Synechocystis sp. strain PCC6803 (Ssp (SEQ ID NO: 6) (Synechocystis sp. strain PCC6803 N-intein and C-intein are included in the table below as SEQ ID NOs: 13 and 14, respectively). Other intein systems can also be used. For example, synthetic fast inteins based on the dnaE intein, Cfa-N and Cfa-C intein pairs have been described (e.g., (31) and WO 2017 / 132580, incorporated herein by reference). U.S. Pat. No. 8,394,604 describes the Ssp GyrB intein, the Ssp Additional inteins have been described, including DnaX intein, Ter DnaE3 intein, Ter ThyX intein, and Cne Prp8 intein. Further inteins within the scope of the present invention are those disclosed in WO2018071868, the first intein pair being listed in the table below and named as SEQ ID NO:9 (N-intein) and SEQ ID NO:10 (C-intein); the second intein pair being listed, for example, as SEQ ID NO:11 and SEQ ID NO:12.

[0148] Alternatively, the intein system can be a ligand-dependent intein that exhibits no or only minimal protein splicing activity in the absence of a ligand (e.g., small molecules such as 4-hydroxytamoxifen, peptides, proteins, polynucleotides, amino acids, and nucleotides), such as those described in U.S. Patent Application Publication No. 2014 / 0065711 A1, which is incorporated herein by reference.

[0149] [Table 3]

[0150] [Table 4]

[0151] [Table 5]

[0152] As described herein, inteins derived from the same gene from different organisms that retain trans-splicing activity are within the scope of the present invention. As non-limiting examples, DNA-E split inteins have been shown to be effective in the synthesis and characterization of Nostoc punctiforme (Npu), Synechocystis sp. PCC 6803 (Ssp), Fischerella sp. PCC 9605, Scytonema tolypothrichoides, Cyanobacteria bacterium SW_9_47_5, Nodularia spumigena, Nostoc flagelliforme, Crocosphaera watsonii WH 8502, Chroococcidiopsis cubana CCALA, and the like. Split inteins can be derived from the DnaE genes (e.g., DNA polymerase III subunit alpha) of cyanobacteria, including Trichodesmium erythraeum, R. marinus (Rma), Synechocystis sp. PC6803 (Ssp), and Porphyra purpurea chloroplast (Ppu), which are described, for example, in (59).

[0153] Thus, a split intein of the invention can be 100% identical, 98%, 80%, 75%, 70%, 65%, 50% identical to a naturally occurring intein, where the intein retains the ability to undergo a trans-splicing reaction. Fragments of naturally occurring or modified inteins that retain trans-splicing activity are within the scope of the invention.

[0154] For example, alignment of Npu (Nostoc punctiforme) DnaE with Synechocystis sp. PCC6803 N-intein: [Table 6] and alignment of Npu (Nostoc punctiforme) DnaE with Synechocystis sp. PCC6803 C-intein: [Table 7] Please refer to.

[0155] Thus, split intein mutants and fragments of the inteins of the invention that retain trans-splicing activity are also within the scope of the invention.

[0156] Interestingly, inteins have been reported to have conserved functional features that ensure their splicing activity. In detail, four intein motifs have been identified (for their consensus sequences see below): blocks A to H (Pietrokovski 1994 and Perler 1997) and blocks N2 and N4 (Pietrokovski 1998). Intein blocks A, N2, B, N4, F and G are involved in protein splicing. Blocks C, D, E, H are in the endonuclease domain that are absent in split inteins. Thus, split inteins retain conserved motifs essential for trans-splicing activity (disclosed in the Intein Database, [Perler, FB (2002). InBase, the Intein Database. Nucleic Acids Res. 30, 383-384]). [ka]

[0157] However, none of the residues are invariant; Ser and Cys in block A, His in block B, His, Asn and Ser / Cys / Thr in block G are the most conserved residues in the splicing motif.

[0158] Alignment of the intein of the present invention: CLUSTAL W alignment of all N-inteins listed: [ka] CLUSTAL 2.1 multiple sequence alignment of all listed C-inteins [ka]

[0159] In summary, intein activity is context-dependent, with specific peptide sequences surrounding its ligation junction (called N- and C-exteins) necessary for efficient trans-splicing to occur, the most important of which is an amino acid containing a nucleophilic thiol or hydroxyl group (i.e., Cys, Ser, or Thr) as the first residue in the C-extein.

[0160] We used intein-mediated protein trans-splicing to reconstitute large proteins in vivo. Split inteins encoded by intein gene sequences are produced as precursor polypeptides that can reassemble due to their structural complementarity and catalyze the protein trans-splicing reaction.

[0161] In the context of protein trans-splicing, the N-intein gene is fused in-frame with a sequence encoding the N-terminal portion of a protein of interest; the C-intein gene is fused in-frame with a sequence encoding the C-terminal portion of the sequence of interest. Expression of these two fusion protein precursors results in autocatalytic excision of the intein to form the ligated exteins, i.e., the reconstituted protein of interest.

[0162] Thus, reconstitution of a protein of interest requires splitting the protein into two or three fragments and cloning their coding sequences separately into an AAV vector, fused to an N- or C-intein and under the control of a promoter. The split points of each protein are selected taking into account the amino acid requirements at the junction point (e.g., the presence of an amino acid containing a nucleophilic thiol or hydroxyl group (i.e., Cys, Ser, or Thr) as the first residue in the C-extein, as well as the maintenance of the integrity of critical protein domains to favor correct protein folding and stability of each intein-polypeptide precursor polypeptide and the resulting reconstituted protein.

[0163] Of particular note, we have chosen junction points within two proteins of interest: the protein ABCA4 is split at amino acids Cys1150, Ser1168, and Ser1090, and the split intein is inserted at these split points, and the CEP290 protein is split at aa Cys1076, Ser1275, Cys929 and 1474; Ser 453 and Cys 1474.

[0164] Decomposition Signal Regulated protein degradation protects cells from misfolded, aggregated, or otherwise abnormal proteins, and also controls the levels of proteins that have evolved to be short-lived in vivo, and is largely mediated by the ubiquitin (Ub)-proteasome system (UPS) and the autophagy-lysosomal pathway (of which molecular chaperones are part). Degradation signals are characteristics of proteins that are targeted by proteolytic pathways, resulting in a reduced half-life. In particular, N-degrons and C-degrons are degradation signals whose main determinants are the N- and C-terminal residues, respectively, of cellular proteins. N-degrons and C-degrons contain varying degrees of contiguous sequence motifs and also contain internal lysine residues that function as polyubiquitination sites.

[0165] Within the meaning of the present invention, an internal degron is defined as a degradation signal that is located neither at the N-terminus nor at the C-terminus, but within the protein sequence, and whose functionally essential elements do not include either the N-terminal or the C-terminal residues and mediate protein degradation.

[0166] The degron pathway comprises a collection of protein degradation systems whose unifying feature is their ability to recognize proteins that contain N- or C-degrons or internal degrons, thereby causing their degradation by the 26S proteasome or autophagy.

[0167] E. coli dihydrofolate reductase (ecDHFR) is a 159-residue enzyme that catalyzes the reduction of dihydrofolate to tetrahydrofolate, an essential cofactor for several steps in prokaryotic primary metabolism. Numerous DHFR inhibitors have been developed as drugs, and one such inhibitor, trimethoprim (TMP), inhibits ecDHFR much more potently than mammalian DHFR. This broad therapeutic window renders TMP "biologically silent" in mammalian cells. The specificity of the ecDHFR-TMP interaction, combined with the commercial availability and attractive pharmacological properties of TMP, make this protein-ligand pair ideal for development as a degradation system (69). Thus, the presence of a DHFR amino acid sequence, preferably an ecDHFR amino acid sequence, in a protein serves as a targeting signal for the proteasome system, resulting in protein degradation. In the presence of TMP, the protein is stabilized.

[0168] Advantageously, the ecDHFR-derived degron signal with point mutations developed by Iwamoto et al. contains three amino acid mutations, R12Y, Y100I, and G67S, which confer functional activity (e.g., degradation of fusion proteins) only when placed within the N-terminus or internal positions (69).

[0169] Further refinement of the ecDHFR-derived degron was performed by the inventors, who identified the shortest active peptide, advantageously allowing longer coding sequences to fit into the same AAV vector.

[0170] Within the scope of the present invention, an ecDHFR-derived degron was fused to the inactive N-terminus of an intein. After protein trans-splicing, the degron is located within the reconstituted intein and mediates its degradation.

[0171] The ecDHFR of the present invention is WT ecDHFR, mutant DHFR, full length ecDHFR, or the shorter scDHFR.

[0172] DHFR can be 105-159 aa long, where truncations are made at the C-terminal end.

[0173] ecDHFR from E. coli, wild type Nucleotide sequence: (623nt) SEQ ID NO:27 [ka] Amino acid sequence: 159aa-WT SEQ ID NO:28 [ka]

[0174] ecDHFR from E. coli, internal degron mutant (159aa) Mutation position in bold - SEQ ID NO:29 [ka]

[0175] ecDHFR from E. coli, wild type, minimal active fragment Nucleotide sequence: SEQ ID NO:30 [ka] Amino acid sequence SEQ ID NO:31 [ka]

[0176] ecDHFR from E. coli, internal degron mutant pe, minimal active fragment (104 aa) (Mutation positions are in bold) SEQ ID NO:32 [ka]

[0177] array The coding sequence of the present invention may be operably linked to a promoter sequence, optionally followed by an intron sequence, capable of regulating its expression in mammalian cells, preferably mammalian retinal cells, particularly photoreceptor cells or hepatic cells, muscle cells, cardiac cells, neuronal cells, renal cells, endothelial cells. Exemplary promoters include, without limitation, ubiquitous, artificial or tissue-specific promoters, including photoreceptor-specific human G protein-coupled receptor kinase 1 (GRK1), interphotoreceptor retinoid binding protein promoter (IRBP), rhodopsin promoter (RHO), vitelliform macular dystrophy 2 promoter (VMD2), rhodopsin kinase promoter (RK), muscle-specific promoters including MCK, MYODI, liver-specific promoters including thyroxine-binding globulin (TBG), hybrid liver-specific promoter (HLP) (67), neuron-specific promoters including hSYN1, CaMKIIa, kidney-specific promoters including Ksp-cadherin 16, NKCC2, and the like, including fragments and variants thereof that retain transcriptional promoter activity. Ubiquitous promoters according to the present invention are, for example, the ubiquitous cytomegalovirus (CMV) (32) and the short CMV (33) promoter.

[0178] Optionally, the promoter sequence includes an enhancer sequence, such as a ?-globin IgG chimeric intron.

[0179] For the purposes of the present invention, the coding sequences of EGFP (YP_009062989), ABCA4 and CEP290, each preferably selected from the sequences contained herein, or sequences encoding the same amino acid sequence due to the degeneracy of the genetic code, are operably linked to a promoter sequence capable of regulating their expression in mammalian retinal cells, in particular photoreceptor cells.

[0180] Exemplary polyadenylation signals include, without limitation, the bovine growth hormone polyadenylation signal (bGHpA), the human β-globin polyadenylation signal or shorter synthetic versions (68), the SV40 polyadenylation signal, or other naturally occurring or artificial polyadenylation signals.

[0181] The present invention provides for the use of nucleotide sequences of degradation signals to reduce the stability of reconstituted intein proteins. Advantageously, one or more sequences can be repeated to retain maximum effect.

[0182] Suitable degradation signals, according to the present invention, include (i) the short degron CL1, a C-terminal destabilizing peptide that shares structural similarity with misfolded proteins and is therefore recognized by the ubiquitination system, (ii) ubiquitin, whose fusion at the N-terminus of a donor protein mediates both direct proteolysis or degradation via the N-end rule pathway, (iii) the N-terminal PB29 degron, a nine amino acid long peptide that, similar to the CL1 degron, is predicted to fold into a structure recognized by enzymes of the ubiquitination pathway, and mutant ecDHFR and fragments thereof as described herein and in (69), particularly the ecDHFR-derived degron signal with point mutations including the three amino acid mutations R12Y, Y100I and G67S that confer functional activity (e.g., degradation of fusion proteins) only when placed within the N-terminus or internal positions.

[0183] Exemplary degradation signals are described in WO201613932, which is incorporated herein by reference.

[0184] As one of skill in the art will readily appreciate, there may be any number of variant sequences of proteins found in nature, in addition to variants that may be artificially created in the laboratory by one of skill in the art. The polynucleotides and polypeptides of the subject invention include those specifically exemplified herein, as well as any naturally occurring variants thereof, and any variants that may be artificially created, so long as such variants retain the desired functional activity. Also within the scope of the subject invention are polypeptides having the same amino acid sequence of the polypeptides exemplified herein, except for amino acid substitutions, additions, or deletions within the sequence of the polypeptide, so long as such variant polypeptides retain substantially the same relevant functional activity as the polypeptides specifically exemplified herein. For example, conservative amino acid substitutions within the polypeptide that do not affect the function of the polypeptide would be within the scope of the subject invention. Thus, it should be understood that the polypeptides disclosed herein include variants and fragments of the specifically exemplified sequences as discussed above. The subject invention further includes nucleotide sequences that encode the polypeptides disclosed herein. These nucleotide sequences can be readily constructed by one of skill in the art armed with the protein and amino acid sequence information provided herein. As will be understood by those skilled in the art, the degeneracy of the genetic code allows one of skill in the art to construct various nucleotide sequences that code for a particular polypeptide or protein. The selection of a particular nucleotide sequence may depend, for example, on the codon usage of a particular expression system or host cell. Polypeptides with amino acid substitutions other than those specifically exemplified in the subject polypeptides are also contemplated within the scope of the present invention. For example, amino acids in the polypeptides of the present invention can be substituted with non-natural amino acids, so long as the polypeptides with the substituted amino acids retain substantially the same activity as the polypeptides without the amino acid substitutions.Examples of unnatural amino acids include, but are not limited to, ornithine, citrulline, hydroxyproline, homoserine, phenylglycine, taurine, iodotyrosine, 2,4-diaminobutyric acid, a-aminoisobutyric acid, 4-aminobutyric acid, 2-aminobutyric acid, gamma-aminobutyric acid, epsilon-aminohexanoic acid, 6-aminohexanoic acid, 2-aminoisobutyric acid, 3-aminopropionic acid, norleucine, norvaline, sarcosine, homocitrulline, cysteic acid, tau-butylglycine, tau-butylalanine, phenylglycine, cyclohexylalanine, beta-alanine, fluoroamino acids, designer amino acids such as beta-methylamino acids, C-methylamino acids, N-methylamino acids, and amino acid analogs in general. Unnatural amino acids also include amino acids with derivatized side groups. Additionally, any of the amino acids in a protein may be in the D (dextrorotatory) or L (levorotatory) form. Amino acids can be broadly grouped into the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions, in which a polypeptide having an amino acid of one class is replaced with another amino acid of the same class, fall within the scope of the invention so long as the polypeptide having the substitution still retains substantially the same biological activity as the polypeptide without the substitution. Table 4 provides a list of examples of amino acids that fall into each class.

[0185] [Table 8]

[0186] Polynucleotides having the same nucleotide sequences of the polynucleotides exemplified herein, except for nucleotide substitutions, additions, or deletions within the sequence of the polynucleotides, are also within the scope of the present invention, so long as those variant polynucleotides retain substantially the same relevant functional activity as the polynucleotides specifically exemplified herein (e.g., they encode proteins having the same amino acid sequence or functional activity as encoded by the exemplified polynucleotides).Thus, it should be understood that the polynucleotides disclosed herein include variants and fragments of the specifically exemplified sequences, as discussed above.

[0187] The present invention also contemplates polynucleotide molecules having sequences that are sufficiently homologous to the polynucleotide sequences of the present invention to permit hybridization with the sequences under standard stringent conditions and standard methods (Maniatis, T. et al, 1982). The polynucleotides described herein can also be defined in terms of more specific ranges of identity and / or similarity with those exemplified herein. Sequence identity will typically be greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and can be greater than 95%. Sequence identity and / or similarity may be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more when compared to the sequences exemplified herein. Unless otherwise specified, as used herein, percent sequence identity and / or similarity of two sequences may be determined using the algorithm of Karlin and Altschul (1990), modified as in Karlin and Altschul (1993). Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al. (1990). BLAST searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain sequences with a desired percent sequence identity. To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (NBLAST and XBLAST) can be used. See the NCBI / N1H website.

[0188] [Table 9]

[0189] [Table 10]

[0190] [Table 11]

[0191] EGFP p915_pAAV2.1-TBG-5'EGFP intein (SEQ ID NO: 33) 5'ITR: dashed underline (sequence A at the 5' end of the sequence) TBG promoter: bold (sequence B) 5'EGFP: underline (sequence C) N-intein Npu DnaE: double underlined (sequence D) 3xflag: italics (array E) WPRE: Italic underline (Arrangement F) Bgh PolyA: bold underlined (sequence G) 3'ITR: dashed underline (sequence H at the 3' end of the sequence) [ka]

[0192] p917_pAAV2.1-TBG-3'EGFP intein 5'ITR (sequence A) TBG promoter (sequence B) C-Intein Npu DnaE (Sequence I) SEQ ID NO: 34 [ka] 3'EGFP (sequence L) SEQ ID NO: 35 [ka] 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0193] p914_pAAV2.1-CMV-5'EGFP intein 5'ITR (sequence A) CMV promoter (sequence M) SEQ ID NO: 36 [ka] 5'EGFP (sequence C) N-intein Npu DnaE (sequence D) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0194] p916_pAAV2.1-CMV-3'EGFP intein 5'ITR (sequence A) CMV promoter (sequence M) C-intein Npu DnaE (sequence I) 3'EGFP (sequence L) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0195] p932_pAAV2.1-GRK1-5'EGFP intein 5'ITR (sequence A) GRK1 promoter (sequence N) SEQ ID NO: 37 [ka] 5'EGFP (sequence C) N-intein Npu DnaE (sequence D) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0196] p933_pAAV2.1-GRK1-3'EGFP intein 5'ITR (sequence A) GRK1 promoter (sequence N) C-intein Npu DnaE (sequence I) 3'EGFP (sequence L) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0197] p36 pAAV2.1-CMV-5'EGFPIntein_ecDHFR 5'ITR (sequence A) CMV promoter (sequence M) 5'EGFP (sequence C) N-intein Npu DnaE (sequence D) 3xflag(array E) ecDHFR (Sequence O) SEQ ID NO: 38 [ka] WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0198] p37 pAAV2.1-CMV-5'EGFP intein_miniecDHFR 5'ITR (sequence A) CMV promoter (sequence M) 5'EGFP (sequence C) N-intein Npu DnaE (sequence D) 3xflag(array E) MiniecDHFR (sequence P) SEQ ID NO: 39 [ka] WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0199] p902_pAAV2.1-CMV-5'EGFP intein DnaB 5'ITR (sequence A) CMV promoter (sequence M) 5'EGFP (sequence C) N-intein RmaDnaB (sequence Q) SEQ ID NO: 40 [ka] N-intein Npu DnaE (sequence D) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0200] p903_pAAV2.1-CMV-3'EGFP intein DnaB 5'ITR (sequence A) CMV promoter (sequence M) C-Intein Rma DnaB (sequence R) SEQ ID NO: 41 [ka] 3'EGFP (sequence L) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0201] p1256_pAAV2.1-CMV-5'EGFPIntein-mDnaE 5'ITR (sequence A) CMV promoter (sequence M) 5'EGFP (sequence C) N-intein mDnaE (sequence S) SEQ ID NO: 42 [ka] 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0202] p1257 pAAV2.1-CMV-3'EGFPIntein-mDnaE 5'ITR (sequence A) CMV promoter (sequence M) C-Intein mDnaE (sequence T) SEQ ID NO: 43 [ka] 3'EGFP (sequence L) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0203] CEP290 p1005 pAAV2.1-CMV260-5'CEP290 intein (set 1) 5'ITR (sequence A) CMV260 (sequence U) SEQ ID NO: 44 [ka] 5' CEP290: SEQ ID NO: 45 [ka] [ka] N-intein DnaE (sequence D) 3xflag(array E) shPolyA (Sequence V) SEQ ID NO: 46 aattcaataaaagatctttattttcattagatctgtgtgttggttttttgtgtgcggcc 3'ITR (sequence H)

[0204] p1093 pAAV2.1-CMV260-3'CEP290 intein (set 1) 5'ITR (sequence A) CMV260 (U array) 3'CEP290: SEQ ID NO:47 [ka] [ka] [ka] C-Intein DnaE (sequence I) 3xflag(array E) shPolyA(sequence V) 3'ITR (sequence H)

[0205] p1065 pAAV2.1-CMV260-5'CEP290 intein (set 2) 5'ITR (sequence A) CMV260 (U array) 5'CEP290: SEQ ID NO:48 [ka] [ka] [ka] N-intein DnaE (sequence D) 3xflag(array E) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0206] p1067 pAAV2.1-CMV260-3'CEP290 intein (set 2) 5'ITR (sequence A) CMV260 (U array) 3'CEP290: SEQ ID NO: 49 [ka] [ka] [ka] C-Intein DnaE (sequence I) 3xflag(array E) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0207] p1087 pAAV2.1-CMV260-5'CEP290 intein (set 3) 5'ITR (sequence A) CMV260 (U array) 5'CEP290: SEQ ID NO:50 [ka] [ka] N-intein mDnaE (sequence S) 3xflag(array E) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0208] p1088 pAAV2.1-CMV260-3'CEP290 intein (set 3) 5'ITR (sequence A) CMV260 (U array) 3'CEP290: SEQ ID NO:51 [ka] [ka] C-intein mDnaE (sequence T) 3xflag(array E) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0209] p1182 pAAV2.1-CMV260-5'CEP290 intein (set 4) 5'ITR (sequence A) CMV260 (U array) 5'CEP290: SEQ ID NO:52 [ka] [ka] N-intein DnaE (sequence D) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0210] p1183 pAAV2.1-CMV260-CEP290 main intein (set 4) 5'ITR (sequence A) CMV260 (U array) C-Intein DnaE (sequence I) CEP290 body: sequence number 53 [ka] N-intein Rma DnaB (sequence Q) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0211] p1181 pAAV2.1-CMV260-3'CEP290 intein (set 4 / set 5) 5'ITR (sequence A) CMV260 (U array) C-intein Rma DnaB (sequence R) 3'CEP290: SEQ ID NO:54 [ka] [ka] 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0212] p1179 pAAV2.1-CMV260-5'CEP290 intein (set 5) 5'ITR (sequence A) CMV260 (U array) 5'CEP290: SEQ ID NO:55 [ka] N-intein mDnaE (sequence S) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0213] p1180 pAAV2.1-CMV260-CEP290 main intein (set 5) 5'ITR (sequence A) CMV260 (U array) C-intein mDnaE (sequence T) CEP290 body: sequence number 56 [ka] [ka] N-intein Rma DnaB (sequence Q) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0214] p1152 pAAV2.1-GRK1-5'CEP290 intein (set 5) 5'ITR (sequence A) GRK1 promoter (sequence N) 5'CEP290: SEQ ID NO:57 [ka] N-intein mDnaE (sequence S) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0215] p1153 pAAV2.1-GRK1-CEP290 main intein (set 5) 5'ITR (sequence A) GRK1 promoter (sequence N) C-intein mDnaE (sequence T) CEP290 body: sequence number 58 [ka] [ka] N-intein Rma DnaB (sequence Q) 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0216] P1156 pAAV2.1-GRK1-3'CEP290 intein (set 5) 5'ITR (sequence A) GRK1 promoter (sequence N) C-intein Rma DnaB (sequence R) 3'CEP290: SEQ ID NO:59 [ka] [ka] 3xflag(array E) WPRE(array F) Bgh PolyA (sequence G) 3'ITR (sequence H)

[0217] pzac-GRK1-5'ABCA4 intein (set 1) SEQ ID NO: 60 5'ITR (sequence A) GRK1: Bold 5'ABCA4: Underline N-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka]

[0218] pzac-GRK1-3'ABCA4 intein (set 1) SEQ ID NO: 61 5'ITR (sequence A) GRK1: Bold 3'ABCA4: Underline C-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0219] pzac-CMV260-5'ABCA4 intein (set 1) SEQ ID NO:62 5'ITR (sequence A) CMV260: Bold 5'ABCA4: Underline N-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0220] pzac-CMV260-3'ABCA4 intein (set 1) SEQ ID NO: 63 5'ITR (sequence A) CMV260: Bold 3'ABCA4: Underline C-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0221] p38 pAAV2.1-CMV260-5'ABCA4 intein_ecDHFR (set 1) 5'ITR (sequence A) CMV260 (U array) 5'ABCA4 (from set 1) N-intein Npu DnaE (sequence D) 3xflag(array E) ecDHFR(sequence O) WPRE(array F) SV40 polyA (sequence W) 3'ITR (sequence H)

[0222] p39 pAAV2.1-CMV260-5'ABCA4 intein_miniecDHFR (set 1) 5'ITR (sequence A) CMV260 (U array) 5'ABCA4 (from set 1) N-intein Npu DnaE (sequence D) 3xflag(array E) miniecDHFR(sequence P) WPRE(array F) SV40 polyA (sequence W) 3'ITR (sequence H)

[0223] p40 pAAV2.1-GRK1-5'ABCA4 intein_ecDHFR (set 1) 5'ITR (sequence A) GRK1 (sequence N) 5'ABCA4 (from set 1) N-intein Npu DnaE (sequence D) 3xflag(array E) ecDHFR(sequence O) WPRE(array F) SV40 polyA (sequence W) 3'ITR (sequence H)

[0224] p41 pAAV2.1-GRK1-5'ABCA4 intein_miniecDHFR (set 1) SEQ ID NO: 64 5'ITR (sequence A) GRK1: Bold 5'ABCA4: Underline N-intein Npu DnaE: double underlined 3xflag:italic mini-ecDHFR: bold underline SV40: Bold underline 3'ITR (sequence H) [ka] [ka]

[0225] pzac-CMV260-5'ABCA4 intein (set 2) SEQ ID NO: 65 5'ITR (sequence A) CMV260: Bold 5'ABCA4: Underline N-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0226] pzac-CMV260-3'ABCA4 intein (set 2) SEQ ID NO: 66 5'ITR (sequence A) CMV260: Bold 3'ABCA4: Underline C-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0227] pzac-CMV260-5'ABCA4 intein (set 3) SEQ ID NO: 67 5'ITR (sequence A) CMV260: Bold 5'ABCA4: Underline N-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0228] pzac-CMV260-3'ABCA4 intein (set 3) SEQ ID NO: 68 5'ITR (sequence A) CMV260: Bold 3'ABCA4: Underline C-intein Npu DnaE: double underlined 3xflag:italic SV40: Bold underline 3'ITR (sequence H) [ka] [ka] [ka]

[0229] p836 (IRBP_DsRed) SEQ ID NO: 69 5'ITR (sequence A) IRBP Bold WPRE:italic underline DsRed underline BghpA: bold and underlined 3'ITR (sequence H) [ka]

[0230] P1232 pAAV2.1_HLP_5'F8 Intein (Set 1) 5'ITR (sequence A) HLP promoter (sequence J) SEQ ID NO: 70 [ka] F8 signal sequence (sequence K) SEQ ID NO: 71 [ka] 5'F8: SEQ ID NO: 72 [ka] [ka] [ka] N-intein Npu DnaE (sequence D) 3xflag(array E) shPolyA(sequence V) 3'ITR (sequence H)

[0231] p1389 pAAV2.1_HLP_3'F8 intein (set 1) 5'ITR (sequence A) HLP promoter (sequence J) F8 signal sequence (sequence K) C-intein Npu DnaE (sequence I) 3'F8: SEQ ID NO: 73 [ka] [ka] [ka] 3xflag(array E) shPolyA(sequence V) 3'ITR (sequence H)

[0232] p1207 pAAV2.1_HLP_5'F8 intein (set 2) 5'ITR (sequence A) HLP promoter (sequence J) F8 signal sequence (sequence K) 5'F8 (set 2): SEQ ID NO: 74 [ka] [ka] N-intein Npu DnaE (sequence D) 3xflag(array E) shPolyA(sequence V) 3'ITR (sequence H)

[0233] p1388 pAAV2.1_HLP_3'F8 intein (set 2) 5'ITR (sequence A) HLP promoter (sequence J) F8 signal sequence (sequence K) C-intein Npu DnaE (sequence I) 3'F8: SEQ ID NO: 75 [ka] [ka] 3xflag(array E) shPolyA(sequence V) 3'ITR (sequence H)

[0234] The invention will now be illustrated by way of non-limiting examples.

[0235] Materials and Methods Construction of AAV vector plasmids Plasmids used to generate AAV vectors were derived from either pAAV2.1 (36) or pZac (37) plasmids containing the ITRs of AAV serotype 2. AAV intein plasmids were designed as detailed in Fig. 1A and fig. S5. EGFP protein was split at amino acid (aa) C71. ABCA4 protein was split at aaC1150 (set 1), aaS1168 (set 2), and aaC1090 (set 3) in the large cytoplasmic domain CD1 (34, 35). AaC1150 (set 1) and S1168 (set 2) are within regions not associated with known ABCA4 function, whereas C1090 is included in the ABCA4 nucleotide-binding domain spanning aa929 to aa1148. All CEP290 split points were within the coiled-coil domain (36): when CEP290 was split into two polypeptides, this occurred at either aa C1076 (set 1) or S1275 (sets 2-3), and when it was split into three polypeptides, this was at either aa C929 and C1474 (set 4) or aa S453 and C1474 (set 5).

[0236] The inteins contained in the plasmids were either the intein of DnaE from Nostoc punctiforme (Npu) (27, 28) or an intein composed of mutant N- and C-inteins from Npu and DnaE of Synechocystis sp. strain PCC6803 (Ssp), respectively (30) or the intein of DnaB from Rhodothermus marinus (Rma) (29). The plasmids used in this study were under the control of either the ubiquitous cytomegalovirus (CMV) (38) and short CMV (39) promoters or the photoreceptor-specific human G protein-coupled receptor kinase 1 (GRK1)40 promoter. The plasmids encoding EGFP and CEP290 contained the bovine growth hormone polyadenylation signal (bGHpA), while the plasmid encoding ABCA4 contained the simian virus 40 (SV40) polyadenylation signal.

[0237] AAV vector generation and characterization AAV vectors were generated by triple transfection of HEK293 cells by the TIGEM AAV Vector Core as previously described ( 14 , 41 ), and no difference in vector yield was observed between AAV vectors containing or not containing an intein sequence.

[0238] Cell transfection and AAV infection HEK293 cells were maintained and transfected using the calcium phosphate method (1 μg of each plasmid / well in a 6-well plate format) as previously described (14). For the experiments described in Fig. S9, the amount of plasmid encoding the full-length gene was used corresponding to the same number of molecules contained in 1 μg of AAV intein plasmid. The total amount of transfected DNA in each well was kept the same by adding scrambled plasmid when necessary.

[0239] HeLa cells used for the experiments in Fig. 2C and Fig. 2D were transfected using Lipofectamine LTX (Invitrogen) (either 1 μg or 0.5 μg of each plasmid / well in a 24-well plate format). AAV infection was performed as previously described (14).

[0240] iPSC and retinal differentiation culture Human induced pluripotent stem cells (iPSCs) were derived from fibroblasts cultured from skin biopsies using the method described in (42). STGD1 cell lines carry either the ABCA4 compound heterozygous variants c.4892T>C and c.4539+2001G>A or the compound heterozygous variants c.[2919-?_3328+?del;4462T>C] and c.5196+1137G>A, also described in (43). c.[2919-?_3328+?del;4462T>C] is an allele consisting of two variations. c.2919-?3328+?del constitutes a deletion of exons 20, 21, and 22 and an unknown segment of introns 19 and 22. This deletion was found in cis configuration with c.4462T>C. iPSCs were maintained in mTeSR™ medium (Part No. 85850; Stem cell technologies) in 6-well plates coated with Matrigel (Part No. 354277; Corning® Matrigel® hESC Qualified Matrix; Corning, NY). Cells were passaged at approximately 80% confluence using 0.5 mM EDTA (Part No. AM9260G; Ambion) for 2–6 min. Retinal differentiation was based on a combination of previously described protocols (44, 45). Briefly, iPSCs were seeded (9,000 cells / well) in V-bottom 96-well plates containing RevitaCell Supplement (Part No. A-2644501; Gibco, ThermoFisher) and 1% Matrigel to induce the formation of aggregates. The aggregates were then cultured to generate 3D retinal organoids as reported in (46).

[0241] Western blot analysis and ELISA Samples (HEK293 cells, retinas, and retinal organoids) were lysed in RIPA buffer to extract EGFP, ABCA4, and CEP290 proteins. Lysis buffer was supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail Tablets; Roche, Basel, Switzerland) and 1 mM phenylmethylsulfonyl. After lysis, ABCA4 samples were denatured for 15 min at 37°C in 1× Laemmli sample buffer supplemented with 2 M urea. EGFP and CEP290 samples were denatured for 5 min at 99°C in 1× Laemmli sample buffer. Lysates were resolved by electrophoresis on either 12% (for EGFP samples) or 6% (for ABCA4 and CEP290 samples) SDS-polyacrylamide gels. Antibodies used for immunoblotting were as follows: anti-3xflag (1:1000, A8592; Sigma-Aldrich, Saint Louis, MO, USA) for detection of EGFP, ABCA4 and CEP290 proteins; anti-ABCA4 (1:500, LS-C87292; LifeSpan BioSciences, Inc., Seattle, USA) for detection of ABCA4; anti-filamin A (1:1000, part number 4762; Cell Signaling Technology, Danvers, MA, USA); anti-β-actin (1:1000, NB600-501; Novus Biological LLC, Littleton, CO, USA) for detection of filamin A. anti-dysferlin (1:500, dysferlin, clone Ham1 / 7B6, MONX10795; Tebu-bio, Le Perray-en-Yveline, France) for detection of dysferlin, which was used as a loading control for in vivo experiments. Quantification of EGFP, ABCA4 and CEP290 bands detected by Western blot was performed using ImageJ software (freely downloadable at http: / / rsbweb.nih.gov / ij / ).

[0242] For the experiment shown in Figure 21, retinal lysates from both Abca4- / - mice injected with AAV intein vectors and control littermate Abca4+ / - mice were lysed in 30 μl of lysis buffer as described above, and 25 or 5 μl of lysates, respectively, were used for Western blot using anti-ABCA4 antibody (LS-C87292; epitope conservation: 100% for human ABCA4; 86% for mouse Abca4). The amount of ABCA4 in the retinal lysate, measured by quantification of band intensity using ImageJ software, was then normalized by the volume of retinal lysate loaded onto the acrylamide gel. For the experiment in Figure 9, HEK293 cells were treated daily with increasing doses of trimethoprim (T7883, Sigma-Aldrich) as reported in this figure.

[0243] ELISA was performed on either cells or mouse and pig retinal lysates using the Max Discovery Green Fluorescent Protein Kit ELISA (Bioo Scientific Corporation, Austin, TX, USA).

[0244] Southern blot analysis of rAAV vector DNA 1.5~6×10 10DNA was extracted from 100 viral particles (measured as GC). To digest unpackaged genomes, the vector solution was incubated with 30 μl of DNase (Roche) in a total volume of 300 μl containing 50 mM Tris, pH 7.5 and 1 mM MgCl2 for 2 h at 37°C. DNase was then inactivated with 50 mM EDTA, followed by incubation with proteinase K and 2.5% N-lauryl sarkosyl solution for 1 h at 50°C to dissolve the capsids. DNA was extracted twice with phenol chloroform and precipitated with 2 volumes of ethanol 100% and 10% sodium acetate (3 M) and 1 μg of glycogen (20 μg). Alkaline agarose gel electrophoresis was performed as previously described (Sambrook, J., and Russell, DW 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York, USA. 999 pp). A marker was generated by double digestion of pF8-V3 with SmaI, yielding a band of 5102 bp. A probe specific for the HLP promoter was used.

[0245] Activated partial thromboplastin time (aPTT) Nine parts of blood were collected by retro-orbital bleeding into one part of buffered trisodium citrate 0.109 M (BD, Franklin Lakes, NJ, USA). Plasma was isolated by centrifuging the samples at 13000 rpm for 15 min.

[0246] The aPTT was measured on a Coatron M4 (Teco, Buende, Germany) using the aPTT program according to the manufacturer's manual.

[0247] Immunoprecipitation and liquid chromatography / mass spectrometry analysis Cells were seeded onto 100 mm plates (1 × 10 7Cells (1000 x 1000 cells / plate) were transfected in suspension with either AAV-EGFP or ABCA4 intein plasmids (20 μg of each plasmid / plate) using the calcium phosphate method. Cells were harvested 72 h post-transfection, and both EGFP and ABCA4 proteins were immunoprecipitated using anti-flag M2 magnetic beads (M8823; Sigma-Aldrich) according to the manufacturer's instructions. Proteins were eluted from the beads by incubation in sample buffer supplemented with 4 M urea for 15 min at 37°C. Proteins were then loaded onto 12% (for EGFP) or 6% (for ABCA4) SDS-polyacrylamide gel electrophoresis. Protein sequencing was performed using 26 and 30 protein bands (from HEK293 cells transfected twice and three times independently with AAV-EGFP and ABCA4 intein plasmids, respectively) excised after staining with Coomassie blue (Creative proteomics, Shirley, NY). Briefly, three gel slides were used for digestion with each of the following enzymes: trypsin, chymotrypsin, Glu-C, Arg-C, Asp-N, and Lys-N. In addition, pepsin was used to digest ABCA4. The resulting peptides were identified and quantified using nanoscale liquid chromatography coupled to tandem mass spectrometry (nanoLC-MS / MS) analysis. The acquired mass spectrometry data was analyzed using PEAKS STUDIO 8.5. We achieved 100% protein sequence coverage for both EGFP and ABCA4 proteins.

[0248] Animal models Animals were housed in the TIGEM animal facility (Naples) and maintained under a 12-h light / dark cycle. C57BL / 6J mice were purchased from Envigo (Italy).

[0249] Albino Abca4 mice were generated by successive crosses and backcrosses with BALB / c mice (homozygous for Rpe65 Leu450). - / -Mice were generated and maintained inbred. BXD24 / TyJ-Cep290 rd16 / J (designated rd16) mice were imported from The Jackson Laboratory (JAX stock no. 000031). rd16 mice carry an 897-bp in-frame deletion encompassing exons 35-39 (46). Mice were maintained by crossing homozygous females with homozygous males. Hemophilic B6;129S-F8 mice tm1Kaz / J (designated F8tm1) were imported from The Jackson Laboratory (JAX stock number 004424). F8tm1 mice carry a neomycin resistance cassette that replaces a 293 bp sequence including 7 bp at the 3' end of exon 16 and 286 bp at the 5' end of intron 16. The mouse colony was maintained by crossing homozygous females with hemizygous males.

[0250] The Large White sows used in this study (Azienda Agricola Pasotti, Imola, Italy) were registered as purebreds in the LWHerd Book of the Italian National Pig Breeders' Association and were housed at the Centro di Biotecnologie AORN Antonio Cardarelli (Naples, Italy) and maintained under a 12-h light / dark cycle.

[0251] Subretinal injection of AAV vectors in mice and pigs This study complied with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research and the Italian Ministry of Health regulations for animal procedures. All procedures involving mice were approved by the Italian Ministry of Health; Department of Public Health, Animal Health, Nutrition and Food Safety on March 6, 2015.

[0252] Subretinal injections in mice and pigs were performed as previously described (e.g., 14). Mouse eyes were injected with either 1 μl or 0.5 μl (for rd16 pups) of vector solution. AAV2 / 8 doses varied between mouse experiments as described in the Results section. Pig eyes were injected with two adjacent subretinal blebs of 100 μl of AAV2 / 8 vector solution. AAV2 / 8 doses were 2×10 11 Each vector / eye of GC, thus co-injection of two AAV vectors gave a total dose of 4 × 10 11 Became GC / eye.

[0253] Histology, light and fluorescence microscopy To assess EGFP expression in tissue sections and retinal organoids, eyes from both C57BL / 6J mice and Large White pigs were fixed and sectioned as described previously. EGFP-positive cryosections mounted in Vectashield with DAPI (Vector Lab Inc., Peterborough, UK) were analyzed under a confocal LSM-700 microscope (Carl Zeiss, Oberkochen, Germany) with appropriate excitation and detection settings and acquired at 40x magnification. Due to the prevalence of red-green color blindness, the original images have been recolored in Figure 14 to avoid the coexistence of red and green colors.

[0254] To assess the thickness of the outer nuclear layer in rd16 mice injected with the AAV CEP290 intein vector, eyes were fixed overnight in 4% paraformaldehyde (PFA), followed by dehydration in successive ethanols, and then embedded in paraffin blocks. Serial transverse sections (10 μm) were cut from rd16 mice along the horizontal meridian, distributed sequentially on slides, and stained with hematoxylin and eosin (H&E). Sections were then analyzed under a microscope (Leica Microsystems GmbH; DM5000) and acquired at 20x magnification. For the analysis, one image from the temporal injection side of the slice in the central region of the eye was used for each eye. In each image, three ONL thickness measurements were taken using the "freehand line" tool in ImageJ software by an operator blinded to the genotype / treatment group.

[0255] Immunofluorescence analysis HeLa cells transfected with either ABCA4 or CEP290 AAV intein plasmids were fixed in 4% PFA for 10 min 24 h post-transfection. Cells were blocked with blocking buffer (0.05% saponin, 0.5% BSA, 50 mM NH4Cl, 0.02% NaN3 in PBS, pH 7.2) for 30 min and then incubated as follows: - ABCA4 protein was detected by incubation for 1 h with anti-FLAG M2 antibody (F1804, Sigma-Aldrich); endoplasmic reticulum was stained by incubation with anti-VAP-B antibody [made in the Antonella De Matteis lab (47)], and trans-Golgi network was stained by incubation with TGN46 (AHP-499, Serotech). After washing with PBS, cells were incubated for 30 min with secondary antibodies: goat anti-mouse Alexa Fluor 568 for anti-FLAG, anti-VAP-B and anti-TGN46 antibodies, respectively; goat anti-rabbit Alexa Fluor 488, donkey anti-sheep Alexa Fluor 633. - CEP290 protein was detected by overnight incubation with anti-FLAG antibody (F7425, Sigma-Aldrich) and microtubules were stained by incubation with anti-acetylated tubulin antibody (T6793, Sigma-Aldrich). After washing with PBS, cells were incubated for 1 h with the appropriate secondary antibodies: goat anti-rabbit Alexa Fluor 594 and donkey anti-mouse Alexa Fluor 488 for anti-FLAG and anti-acetylated tubulin antibodies, respectively.

[0256] Nuclei were stained with DAPI. Due to the prevalence of red-green color blindness, the original images have been recolored in both Figures 2C-D and 18 to avoid the coexistence of red and green colors.

[0257] Antibodies used for immunofluorescence of human retinal organoids are as follows: Anti-human cone arrestin (CAR) (50, 51) (1:10000, “Luminaire founders” hCAR; a gift from Dr. Cheryl M. Craft, Doheny Eye Institute, Los Angeles, CA, USA); anti-opsin, red / green (1:200, AB5405; Merck Millipore, Darmstadt, Germania); anti-recoverin (1:500, AB5585; Merck Millipore); anti-CRX (A-9, 1:250, sc377138; Santa Cruz Biotechnology, Dallas, Texas, USA); anti-rhodopsin (1D4, 1:200, ab5417, Abeam, Cambridge, MA, USA).

[0258] Transmission and scanning electron microscopy analysis Abca4 cells were cultured 3 months after AAV subretinal injection for electron microscopy (EM) analysis. - / -Mice were dark adapted overnight and then the eyes were enucleated. Eyes were fixed in 0.2% glutaraldehyde (GA)-2% PFA in 0.1 M PHEM buffer pH 6.9 for 18 h and then rinsed with 0.1 M PHEM buffer. Eyes were then dissected under a light microscope to select the temporal injection area of ​​the eyecup. This part of the eyecup was then embedded in 12% gelatin injected with 2.3 M sucrose. Cryosections (60 nm) were frozen in liquid nitrogen and cut using a Leica Ultramicrotome EM FC7 (Leica Microsystems). To avoid bias in data attribution to the various experimental groups, measurements of the area occupied by lipofuscin granules in the retinal pigment epithelium were performed using iTEM software (Olympus SYS, Hamburg, Germany) by an operator blinded to the genotype / treatment group. The area of ​​each lipofuscin granule in each field was calculated by dividing the area of ​​each lipofuscin granule by the area of ​​the retinal pigment epithelium by the area of ​​the retinal pigment epithelium using at least 20 different images (25 μm 2 The area was measured using the "freehand polygon" tool in the iTEM software.

[0259] For scanning electron microscopy (SEM) analysis, retinal organoids were fixed in GA, stained with OsO4, dehydrated in ethanol, and dried using a critical point drying procedure. The dried specimens were then mounted on SEM specimen stubs and covered with a thin layer of gold. The surface three-dimensional organization of the specimens was analyzed, and images were acquired using a JEOL 6700F scanning electron microscope (JEOL Ltd., Tokyo, Japan).

[0260] For ultrastructural analysis, retinal organoids were fixed overnight in a mixture of 2% PFA and 1% GA in 0.2 M PHEM buffer pH 7.3. After fixation, specimens were postfixed as previously described. They were then dehydrated, embedded in epoxy resin, and polymerized at 60°C for 72 hours. 60 nm serial thin sections were cut on a Leica EM UC7 microtome.

[0261] EM images were acquired using an FEI Tecnai-12 electron microscope equipped with a VELETTA CCD digital camera (FEI, Eindhoven, The Netherlands).

[0262] Electrophysiological recordings and spectral domain optical coherence tomography Functional and morphological analyses were performed as previously described ( 14 ).

[0263] Pupillary light response Pupillary light responses were recorded from rd16 mice in dark conditions using a TRC-50IX retinal camera connected to a charge-coupled device Nikon D1H digital camera (Topcon Biomedical Systems, Oakland, NJ). Mice were exposed to a 10 lux light stimulus for approximately 10 seconds, and one photograph was taken for each eye using IMAGEnet software (Topcon Biomedical Systems). Pupil diameter was normalized by eye diameter (temporal to nasal) for each eye.

[0264] statistical analysis One-way ANOVA test (parametric test) or Kruskal-Wallis rank sum test (nonparametric test) was performed to determine whether there were statistically significant differences on the dependent variables between two or more groups on the independent variables. P values ​​are as follows: ELISA assay for EGFP protein quantification, quantification in vitro (p Kruskal-Wallis = 0.006036), quantification in mouse retina (p ANOVA = 0.00585) and quantification in pig retina (p Kruskal-Wallis = 0.009005); Figure 5A (p ANOVA = 0.00585); Figure 5B (p Kruskal-Wallis = 5.547E-5); Figure 5C (p ANOVA = 5.81E-10); ERG analysis (p ANOVA or p Kruskal-Wallis > 0.05 at all luminances analyzed for both a-wave and b-wave amplitude); OCT analysis in Figure S14 (p ANOVA = 0.52 for ABCA4 and p ANOVA = 0.965 for CEP290). Statistically significant differences between groups as determined by multiple pairwise comparisons between group means are: ELISA assay for EGFP protein quantification, quantification in vitro (single AAV vs. dual AAV = 0.012; AAV intein vs. dual AAV = 0.012; single AAV vs. AAV intein = 0.222), quantification in mouse retina (single AAV vs. dual AAV = 0.0044; AAV intein vs. dual AAV = 0.3754; single AAV vs. AAV intein = 0.0561) and quantification in pig retina (single AAV vs. dual AAV = 0.012; AAV intein vs. dual AAV = 0.012; single AAV vs. AAV intein = 0.841); Figure 5A: + / + vs. - / - AAV intein = 0.4530; + / + vs. - / - = 0.0002; Figure 5B: wild type vs. rd16 AAV intein=0.00131; Figure 5C: wild type vs rd16 AAV intein 1E-07; wild type vs rd16 neg<1E-06. EXAMPLES

[0265] Example 1. AAV-EGFP intein reconstitutes full-length protein in vitro We tested the efficiency of intein-mediated protein trans-splicing in the retina; we generated two AAV vectors encoding either the N- or C-terminal half of a reporter EGFP protein fused to the N- and C-terminal halves, respectively, of the DnaE split intein from Nostoc punctiforme [Npu (Figure 1A)]. The EGFP protein was split at amino acid (aa) C71. Inclusion of appropriate regulatory elements in each AAV vector, i.e., promoter and bovine growth hormone polyadenylation signal (bGHpA) and triple flag tag (3xflag), allowed detection of both halves as well as the full-length reconstituted EGFP protein (Figure 1A).

[0266] AAV-EGFP Dna E intein plasmid was used to transfect human embryonic kidney 293 (HEK293) cells to assess the production of single N- and C-terminal halves as well as full-length EGFP protein. As shown in Figure 12, EGFP fluorescence was detected in cells cotransfected with AAV-EGFP intein plasmid but not with single N- and C-terminal AAV-EGFP intein plasmids, compared to that observed in cells transfected with a single AAV plasmid encoding full-length EGFP. As shown in Figure 1B, Western blot (WB) analysis of HEK293 cell lysates confirmed the presence of trans-spliced ​​EGFP protein of the expected size (~28 kDa) along with the DnaE intein spliced ​​out from the mature protein (~17 kDa) only after cotransfection of both AAV-EGFP intein plasmids. In addition, quantification of band intensity indicated that the amount of EGFP protein from the AAV intein plasmid was 76 ± 37% (n = 3 independent experiments) of that observed from the single AAV plasmid. To define the accuracy of the protein reconstitution, EGFP was immunopurified from HEK293 cells transfected with the AAV-EGFP intein plasmid and liquid chromatography-mass spectrometry (LC-MS) analysis was performed to define its protein sequence. Proteolytic digestion of this sample yielded 3539 peptides, 7 of which contained the breakpoint (Table 5), covering the entire protein and confirming that the amino acid sequence of EGFP reconstituted by the AAV intein plasmid corresponds exactly to wild-type EGFP.

[0267] [Table 12]

[0268] Example 2. AAV-EGFP intein is more efficient than dual AAV vectors in vitro To confirm the reconstitution of EGFP protein from the AAV intein vector, HEK293 cells were infected with either the AAV2 / 2-CMV-EGFP DnaE intein or single and dual AAV vectors containing the same expression cassettes. Multiplicity of infection (moi), 5 × 10 4 genome copies (GC) of each vector per cell, which means comparable doses among the three systems assuming complete DNA or protein recombination of the dual vectors. To precisely quantify EGFP levels, cell lysates were harvested at 72 h postinfection. EGFP expression was assessed by both WB and enzyme-linked immunosorbent assay (ELISA): As shown in Figure 1C, EGFP expression achieved with the AAV intein vector was approximately half that achieved with single AAV (single AAV = 0.735 ± 0.2 ng EGFP / μg total lysate, n = 5 independent experiments; AAV intein = 0.403 ± 0.04 ng EGFP / μg total lysate, n = 5 independent experiments) and 10-fold higher than that achieved with dual AAV vectors (dual AAV = 0.046 ± 0.01 ng EGFP / μg total lysate, n = 5 independent experiments). Furthermore, the intensity of full-length EGFP compared to the excised intein was quantified by WB; their relative abundance was found to be 1:0.2 (n=6 independent experiments, FIG. 13A).

[0269] Example 3. Subretinal administration of AAV-EGFP intein vectors results in efficient full-length protein reconstitution in mouse and pig retina To examine whether AAV intein-mediated trans-splicing reconstitutes full-length protein expression in the retina, 4-week-old C57BL / 6J mice were transfected with AAV2 / 8-CMV-EGFP DNA E-inte vectors (dose of each vector / eye: 5.8 × 10 9After 1 month, eyes were enucleated and analyzed by microscopic analysis. EGFP fluorescence was detected in the retinal pigment epithelium and, most importantly, in the photoreceptors in all eyes (Figure 1D). To compare transgene expression from AAV inteins in photoreceptors with single and dual AAVs, AAV2 / 8 vectors encoding EGFP under the control of the photoreceptor-specific human G protein-coupled receptor kinase 1 (GRK1) promoter were subretinally injected into 4-week-old C57BL / 6J mice (dose of each vector / eye: 5 × 10 9 One month after injection, eyes were enucleated and analyzed by either fluorescence microscopy, ELISA or WB.

[0270] As seen in Figure 1E, EGFP fluorescence was detected in the photoreceptor cell layer in eyes injected with either vector set. Precise quantification of EGFP protein amount by ELISA confirmed that AAV intein reconstituted EGFP protein with lower efficiency than single AAV and about 3-fold higher efficiency than dual AAV (single AAV=8.41±2.48ng EGFP / retina, n=5 eyes; AAV intein=3.72±0.85ng EGFP / retina, n=7 eyes; dual AAV=1.38±0.43ng EGFP / retina, n=7 eyes). The relative amount of full-length EGFP to the excised intein after quantifying WB band intensity was 1:3 (n=14 eyes analyzed, Figure 13B).

[0271] We next assessed the efficiency of AAV intein vectors in transducing photoreceptors in the porcine retina, an excellent preclinical model for evaluating viral vector transduction due to its size and organization (48). Thus, large white pigs were subretinally injected with single, intein, and dual AAV2 / 8-GRK1-EGFP vectors (dose of each vector / eye: 2 × 10 11GC, delivered from two adjacent subretinal blebs). Eyes were enucleated one month after injection and analyzed by either fluorescence microscopy, ELISA or WB. Notably, AAV intein-mediated EGFP protein reconstitution in the photoreceptor cell layer was higher than that mediated by dual AAV and indistinguishable from single AAV vectors as judged by EGFP fluorescence (Figure 1F). Precise quantification of EGFP in retinal lysates confirmed that AAV intein reconstituted protein to the same extent as achieved by single AAV and approximately 3-fold more than achieved by dual AAV vectors (single AAV=247.5±45.1ng EGFP / retina, n=5 eyes; AAV intein=227.0±15.7ng EGFP / retina, n=5 eyes; dual AAV=82.3±9.6ng EGFP / retina, n=5 eyes). After quantification of WB band intensity, the relative amount of full-length EGFP to the excised intein was 1:2 (n=8 eyes, FIG. 13C).

[0272] Example 4. Full-length EGFP is reconstituted by AAV-mediated protein trans-splicing in 3D human retinal organoids. As a further preclinical model representative of the human retina, we generated 3D retinal organoids from human induced pluripotent stem cells (iPSCs) ((49, 50)). Six-month-old organoids (Figure 14A) contained cells stained with mature photoreceptor markers as shown in Figure 14B; these organoids were successfully transduced with AAV2 vectors containing photoreceptor-specific promoters, namely the AAV2 / 2 CMV EGFP and AAV2 / 2 IRBP DsRed vectors, as shown by fluorescence analysis in Figure 14C. Light (Figure 14D) and electron microscopy (Figures 14E-F) show the presence of photoreceptor outer segment blastemas. AAV-GRK1-EGFP intein vectors (dosage of each vector / organoid: 1 × 10 12Nine-month-old 3D human retinal organoids incubated with intein-glucose (GC) for 30 days show EGFP fluorescence (Figure 1G). WB analysis of retinal organoid lysates (Figure 15) confirms that full-length EGFP expression is approximately 5-fold higher compared to excised intein after band intensity quantification (n=4 organoids).

[0273] Example 5. Intein-mediated trans-splicing of large proteins (optimal ABCA4 and CEP90 split sites must be identified for efficient AAV intein-mediated protein trans-splicing) To test whether protein trans-splicing can be exploited as a mechanism for reconstitution of large therapeutic proteins, we developed AAV-ABCA4 and -CEP290 intein vectors.

[0274] ABCA4 and CEP290 were fragmented into either two (AAV I, AAV II) or three (AAV I, AAV II, AAV III) fragments and their coding sequences were cloned separately into a single AAV vector fused with split intein N- and C-terminal coding sequences as shown in Figure 16. The AAV intein vectors contained either the ubiquitous short CMV promoter [(shCMV), for all sets] or the GRK1 promoter (set 1 for ABCA4 and set 5 for CEP290).

[0275] The split points for each protein were selected taking into account the requirements of amino acid residues at the junctions for efficient protein trans-splicing18,51) as well as the maintenance of the integrity of critical protein domains, which should favor the correct folding and stability of each independent polypeptide, and therefore the integrity of the final reconstituted protein. Additional split inteins were also considered. A CEP290 set (sets 4 and 5, Figure S16B) was created in which the protein was split into three polypeptides, allowing for the inclusion of the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element [WPRE, (52)] to increase transgene expression. To prevent undesired trans-splicing between AAV I and AAV III, which could reduce the yield of full-length protein, sets 4 and 5 contained two different split inteins at the two split junctions, specifically the DnaB intein from Rhodothermus marinus, which we have shown not to cross-react (Figure S17), and either wild-type or mutant DnaE inteins.

[0276] We compared the ability of each set of AAV intein plasmids to reconstitute ABCA4 and CEP290 after transfection of HEK293 cells. WB analysis of cell lysates 72 hours post-transfection showed that each set of AAV intein plasmids reconstituted full-length ABCA4 and CEP290 proteins of the expected size (approximately 250 kDa and approximately 290 kDa, respectively), but with varying efficiencies (Figures 2A-B). Sets 1 and 5 were found to be the most efficient at reconstituting ABCA4 and CEP290 proteins, respectively, and were therefore used in all subsequent experiments.

[0277] To define the accuracy of the protein reconstitution, we immunopurified ABCA4 from HEK293 cells transfected with Set 1 and performed LC-MS analysis to define its protein sequence. Proteolytic digestion of this sample yielded 3108 peptides, 22 of which contained the breakpoint (Table 6), covering the entire protein and confirming that the amino acid sequence of ABCA4 reconstituted by the AAV intein plasmid corresponds exactly to that of wild-type ABCA4. The amino acid sequence of ABCA4 reconstituted by the AAV intein is consistent with that of wild-type ABCA4. An alignment was performed between the wild-type ABCA4 sequence and peptides identified in the liquid chromatography-mass spectrometry analysis of ABCA4 reconstituted from the AAV intein.

[0278] [Table 13]

[0279] [Table 14]

[0280] We next determined the subcellular localization of the protein products of the various intein-containing plasmids compared to that of the full-length protein. Full-length ABCA4 is known to localize to the endoplasmic reticulum (ER) when expressed in cultured cell lines (53, 54). The two ABCA4 polypeptides from Set 1 were found to colocalize to the ER, whereas no colocalization to the trans-Golgi network was observed (Figure 2C). Similar localization was observed in cells cotransfected with both AAV intein plasmids as well as in cells transfected with a plasmid encoding the full-length ABCA4 protein, thus confirming the predominant localization in the ER of exogenously expressed ABCA4 in cell lines.

[0281] It has been reported that the full-length protein exhibits a mixed distribution pattern with predominantly punctate and minor filamentous patterns (55). Analysis of the domains involved in the intracellular targeting of CEP290 showed that the N-terminal domain (aa1-362) targets the protein to vesicular structures by virtue of its ability to interact with membranes, whereas the C-terminal proximal region of CEP290, which encompasses most of the myosin tail homology domain of the protein, mediates microtubule binding (aa580-2479) and, when expressed as a truncated form, has a prominent filamentous distribution consistent with acetylated tubulin (Ac-Tub). Consistent with Drivas et al., immunofluorescence analysis of HeLa cells transfected with either AAV I, II or III intein plasmids alone or co-transfected with AAV I+II, AAV I+III and AAV II+III showed that products from AAV I and AAV II had a predominantly punctate pattern, while products from AAV III (including the myosin tail homology domain of the protein) showed a filamentous pattern and were the only ones to fully co-localize to Ac-tub (Figure 2D). Thus, products from AAV I+II had a predominantly punctate pattern, while products from AAV I+III and AAV II+III had a combined microtubule filamentous and punctate pattern. Cells co-transfected with the three AAV CEP290 intein plasmids showed predominantly punctate signals partially aligned along microtubules, comparable to the signal observed in cells transfected with a plasmid encoding the full-length CEP290 protein (Figure 2D and Figure 18).

[0282] We then compared the protein amounts obtained with the best set of AAV-ABCA4 and -CEP290 intein plasmids to those obtained from single AAV plasmids encoding the corresponding full-length proteins. For this purpose, HEK293 cells were transfected with the same equimolar amounts of either single or AAV intein plasmids and cell lysates were analyzed by WB 72 hours after transfection (Figure 19). Quantification of band intensity showed that the expression levels of ABCA4 and CEP290 from the AAV intein plasmids were 61±4% (n=3 independent experiments) and 58±4% (n=3 independent experiments) of the expression levels observed with the corresponding single AAV plasmids, respectively.

[0283] Example 6. AAV intein vectors mediate expression of large therapeutic proteins in vitro and in the retina We compared the efficiency of AAV intein-mediated large protein reconstitution with dual AAV vectors both in vitro and in mouse and pig retina. HEK293 cells were infected with either AAV2 / 2 dual or intein vectors encoding either ABCA4 (set 1) or CEP290 (set 5) (moi: 5×10 4 GC / cell for each vector) and cell lysates were analyzed by WB after 72 hours. As shown in Figure 3A and Figure 3B, both AAV-ABCA4 and -CEP290 intein vectors mediated large protein reconstitution with higher efficiency than dual AAV vectors. As expected, in addition to full-length proteins, shorter polypeptides were observed, either derived from single AAV intein vectors (in the case of both ABCA4 and CEP290) or from trans-splicing occurring between AAV II and AAV III (in the case of CEP290) (Figure 3A and Figure 3B).

[0284] Additionally, 4-week-old wild-type mice were subretinal injected with AAV-GRK1-ABCA4 or -CEP290 intein (sets 1 and 5, respectively) in comparison to dual vectors (dose of each ABCA4 vector / eye: 3.3 × 10 9 GC, dose of each CEP290 vector / eye: 1.1 × 10 9 Animals were sacrificed 4–7 weeks after injection, and protein expression in retinal lysates was assessed by WB. Full-length protein was detected in 10 of 11 (91%) AAV-ABCA4 intein-injected eyes (Figure 4A and Figure 20) and 5 of 10 (50%) AAV-CEP290 intein-injected eyes (Figure 4B). Conversely, full-length protein expression was evident in 5 of 9 (56%) and 0 of 5 eyes injected with ABCA4 and CEP290 dual AAV vectors, respectively. Similar to what was observed in vitro, polypeptides derived from single AAV intein vectors (in the case of both ABCA4 and CEP290) and trans-splicing occurring between AAV II and AAV III (in the case of CEP290) were detected (Figure 4A and Figure 4B).

[0285] To examine the efficiency of AAV intein-mediated protein reconstitution relative to endogenous intein, 1- to 4-month-old Abca4 - / - Mice were inoculated with AAV-GRK1-ABCA4 intein vectors (Set 1) (dose of each ABCA4 vector / eye: 5.5 × 10 9 After one month, unaffected mice and Abca4 mice injected with AAV intein were treated with subretinal injection of Abca4. - / - ABCA4 expression in retinal lysates from mice was analyzed by WB using an antibody that recognizes both mouse and human ABCA4 (Figure 21). The amount of AAV intein ABCA4 expression was found to be 8.6±1.3% of endogenous ABCA4.

[0286] To confirm efficient large protein reconstitution in clinically relevant porcine retina, large white pigs were transfected with either AAV2 / 8-GRK1-ABCA4 intein (Set 1) or dual vectors (dose of each vector / eye: 2 × 1011 GC, delivered from two adjacent subretinal blebs) were injected subretinal and protein expression was analyzed by WB 1 month after injection. Notably, the AAV intein was found to reconstitute full-length ABCA4 protein with higher efficiency than the dual AAV vector (Figure 4C).

[0287] Finally, human retinal organoids derived from iPSCs of either healthy individuals or STGD1 patients at 121 days of culture [when photoreceptor maturation begins (20)] were cultured with AAV2 / 2-GRK1-ABCA4 intein vectors (Set 1) (dose of each vector / organoid: 1 × 10 12 Organoids were infected with ABCA4 (GC) between 20 and 40 days after infection. Organoids were lysed and analyzed by WB. ABCA4 was detected at the expected size in all infected organoids (Figure 4D and Figure S22; n = 3 and n = 4 from normal control and STGD1 organoids, respectively).

[0288] Example 7. Subretinal administration of AAV intein vectors ameliorates retinal phenotypes in STGD1 and LCA10 mouse models To determine whether photoreceptor transduction achieved with AAV intein vectors could be of therapeutic value, we investigated the mechanism by which STGD1 (Abca4 - / - ) and LCA10(rd16) mouse models.

[0289] 1 month old Abca4 - / - Mice were inoculated with AAV2 / 8-GRK1-ABCA4 intein vectors (Set 1) (dose of each vector / eye: 4.3–4.8 × 10 9 Three months later, the eyes were enucleated and transmission electron microscopy of retinal ultrathin sections was performed to confirm that Abca4 - / - The amount of lipofuscin accumulated in the retinal pigment epithelium (RPE) of mice was measured (56, 57). Notably, RPE lipofuscin accumulation was significantly increased in Abca4 mice injected with an AAV intein vector. - / -was significantly reduced in eyes injected with the negative control but not in eyes injected with the negative control (p-value=0.0163; FIG. 5A and FIG. 23).

[0290] In parallel, inject 4-6 day-old rd16 mice with AAV2 / 8-GRK1-CEP290 intein vectors (set 5) (dose of each vector / eye: 5.5 × 10 8 GC) was injected subretinaly. Microscopic analysis of retinal sections one month after injection showed that the thickness of the outer nuclear layer (ONL), which contains the photoreceptor nuclei, was significantly reduced in rd16 mice compared to wild-type mice as a result of progressive retinal degeneration (55) (p-value = 0.00048; Figure 5B). Notably, the ONL thickness of rd16 retinas injected with AAV intein vectors was significantly thicker than that of rd16 retinas injected with the negative control (approximately 60%, p-value = 0.00281) (Figure 5B). Accordingly, in retinal function tests based on pupillary light response (PLR), rd16 mice injected with AAV intein vectors showed significantly greater pupil constriction than rd16 eyes injected with the negative control (approximately 20%, p-value = 0.00073) (Figure 5C).

[0291] Furthermore, we investigated the safety of AAV intein vectors in the retina. To this end, wild-type C57BL / 6J mice were injected with AAV2 / 8-GRK1-ABCA4 or -CEP290 intein vectors (sets 1 and 5, respectively) (dose of each ABCA4 vector / eye: 4.3 × 10 9 GC; Dose of each CEP290 vector / eye: 1.1 × 10 9Either ABCA4 or CEP290 (GC) was injected subretinal and retinal electrical activity was measured by full-field electroretinogram (ERG) at 6 and 4.5 months post-injection, respectively. In both studies, a-wave and b-wave amplitudes were comparable between mouse eyes injected with AAV intein vectors (n=14-15 and n=11 for ABCA4 and CEP290, respectively) and eyes injected with negative control AAV vectors (n=8 and n=5 for ABCA4 and CEP290, respectively) or PBS (n=6-7 and n=6 for ABCA4 and CEP290, respectively). Similarly, ONL thickness measured by optical coherence tomography was also comparable between AAV intein-, negative control-, and PBS-injected eyes (Figure 24).

[0292] Example 8. Safe AAV intein-mediated large gene delivery Although no obvious signs of toxicity were observed in wild-type mice injected with AAV inteins, we evaluated the inclusion of a degron in the trans-splicing system that, when embedded in the excised intein, leads to rapid ubiquitination and subsequent proteasomal destruction of the fusion protein (Figure 6). Most of the described degrons are functional at the N- or C-terminal positions (i.e., CL1, SMN, CIITA, ODC), and these degrons cannot be fused to the N- or C-intein because this would lead to degradation of a single host protein, thus removing the polypeptide that needs to participate in the protein trans-splicing (PTS) reaction. We therefore selected a mutant form of E. coli dihydrofolate reductase (ecDHFR) (69) that contains three amino acid mutations, R12Y, Y100I, and G67S, that confer functional activity only at the N- or internal positions.

[0293] To test the efficiency of ecDHFR in reducing the amount of excised intein, we created an AAV vector (pAAV2.1-CMV-5'EGFPintein_ecDHFR) encoding the N-terminal half of Npu DnaE and the N-terminal half of EGFP fused to ecDHFR. Therefore, this degron would be at the C-terminal end, where it should be inactive. The AAV-EGFP-ecDHFR intein plasmid was used in combination with vector II (encoding the C-terminal half of EGFP fused to the C-terminal half of Npu DnaE (pAAV2.1-CMV-3'EGFPintein)) to transfect HEK293 cells and evaluate the production of full-length EGFP protein and excised intein. WB analysis detected comparable protein levels of trans-spliced ​​EGFP protein compared to AAV intein. In addition, the amount of excised intein was significantly reduced in HEK293 cell lysates after co-transfection of AAV-EGFP-ecDHFR intein plasmid (Figure 7). We then decided to apply the same strategy to the large ABCA4 protein (pAAV2.1-CMV260-5'ABCA4 intein_ecDHFR). As for EGFP, we found that the amount of full-length ABCA4 from the AAV-ABCA4-ecDHFR intein plasmid was comparable compared to AAV-ABCA4-intein (Figure 8A). Importantly, a complete disappearance of the excised intein was observed (Figure 8B).

[0294] To prove that we were observing ecDHFR-mediated DnaE degradation, cells were treated with trimethoprim (TMP), an antibiotic that can bind to ecDHFR and prevent the degradation of this protein, allowing the fusion protein to escape degradation (69). When HEK293 cells cotransfected with the AAV-ABCA4-ecDHFR intein plasmid were treated with increasing doses of TMP, we found that the DnaE intein was not further degraded and that TMP stabilized ecDHFR in a dose-dependent manner, meaning that the reduction of DnaE intein was mediated by ecDHFR (Figure 9).

[0295] One of the limitations of including a degron in a vector (in addition to an intein) is that it further reduces the cloning capacity of AAV, thus resulting in an oversized AAV vector for some applications. Indeed, ecDHFR is 159 aa long. Therefore, we designed a shorter ecDHFR variant of 105 aa that retains amino acids reported to be critical for its activity at the N-position or at internal positions. We tested this mini-ecDHFR with both EGFP and ABCA4 intein plasmids (pAAV2.1-CMV-5'EGFP intein_mini-ecDHFR; pAAV2.1-CMV260-5'ABCA4 intein_mini-cDHFR). When co-transfected with either the AAV-EGFP- or ABCA4-mini-ecDHFR intein plasmids, we found a similar level of full-length protein expression (Figures 10 and 11A) and a strong reduction of DnaE intein compared to the AAV intein plasmid (Figures 10 and 11B).

[0296] These results suggest that inclusion of either ecDHFR or mini-ecDHFR in the PTS system mediates selective intein degradation without significant effects on the efficiency of protein trans-splicing and therapeutic protein production.

[0297] Example 9. Intein-mediated protein trans-splicing in the liver To test the efficiency of intein-mediated protein trans-splicing in the liver, we generated two AAV vectors encoding either the N- or C-terminal half of a reporter EGFP protein fused to the N- and C-terminal halves of the DnaE split intein from Nostoc punctiforme, respectively.

[0298] Five-week-old C57 / BL6 mice were inoculated with AAV2 / 8 vectors containing the liver-specific human thyroxine-binding globulin (TBG) promoter (dose of each vector / kg: 5 × 10 11 AAV intein was injected retro-orbitally with GC. Four weeks after injection, livers were harvested and lysed with anti-3xflag antibody for analysis by Western blot to detect EGFP-3xflag and intein-3xflag. Quantification of EGFP band intensity showed that AAV intein transduced liver more efficiently than dual AAV, resulting in approximately 6-7 times higher protein amounts.

[0299] Example 10. AAV intein vectors can be used to deliver the large F8 gene affected in hemophilia A The F8 gene, mutated in hemophilia A, is too large (~7 kb) in its wild-type conformation to be delivered by a single AAV. Therefore, only the B-domain deleted (BDD) conformation of this gene has been employed in the context of AAV gene therapy. Recently, a 5 kb expression cassette containing BDD-F8 and both a short liver-specific promoter and polyA signal has been packaged into AAV5 and shown to deliver therapeutic levels of FVIII in mice and cynomolgus monkeys (70) as well as HemA patients (71). However, the genome of this vector is somewhat oversized and packaged into AAV capsids as a library of heterologous truncated genomes, which when reconstituted in target cells results in efficient transduction. The efficiency of oversized AAV vectors is low compared to the normal size, and the quality of such products with heterologous truncated genomes may hinder their further development towards commercialization.

[0300] To overcome the AAV cargo capacity constraint, we designed a protein trans-splicing strategy involving two separate AAV vectors carrying full-sized genomes each encoding the two halves of the large FVIII protein flanked by split Npu DnaE inteins.

[0301] The wild-type F8 gene was split into two different split points within the B domain, namely set 1 and set 2. F8 intein vectors under the liver-specific hybrid liver promoter (HLP) with a short synthetic polyA were generated (Figure 25A). This vector genome was properly packaged into AAV capsids, unlike its oversized AAV BDD-F8 control, as shown by Southern blot (Figure 25B).

[0302] To determine the therapeutic suitability of this strategy, AAV2 / 8 F8 intein vectors were injected retro-orbitally into 7- to 8-week-old hemophilia A knockout mice (dose of each vector / animal: 4–5 × 10 11AAVs were injected systemically with 100 µg / mL GC. Plasma aPTT (activated partial thromboplastin time) analysis 8 weeks post-injection showed a slight correction of the bleeding phenotype, although not to the same level as the oversized single AAV BDD-F8 control (Figure 25C).

[0303] References 1.MM Sohocki, et al. Hum. Mutat. 17, 42-51 (2001). 2. T. Dryja, in The Online Metabolic & Molecular Bases of Inherited Diseases C. Scriver, A. Beaudet, W. Sly, D. Valle, Eds. (McGraw-Hill, New York, NY, 2001), vol 4, pp. 5903-5933. 3.FDA approves hereditary blindness gene therapy. Nat Biotechnol 36, 6 (2018). 4. I. Trapani, A. Auricchio, Trends Mol Med, (2018). 5.A. Auricchio, AJ Smith, RR Ali, Hum Gene Ther 28, 982-987 (2017). 6.I. Trapani et al., EMBO Mol Med 6, 194-211 (2014). 7. R. Allikmets, Nat. Genet. 17, 122 (1997). 8.JM Millan, et al. J. Ophthalmol. 2011, 417217 (2011). 9. T. Hasson, et al. Proc. Natl. Acad. Sci. USA 92, 9815-9819 (1995). 10.X. Liu, et al. Cell. Motil. Cytoskeleton 37, 240-252 (1997). 11.D. Gibbs, et al. Invest. Ophthalmol. Vis. Ski. 51,1130-1135 (2010). 12.D. Duan, Y. Yue, JF Engelhardt, Mol Ther 4, 383-391 (2001). 13.Z. Yan, Y. et al., Proc Natl Acad Sci USA 97, 6716-6721 (2000). 14.A. Maddalena et al., Mol Ther 26, 524-541 (2018). 15.Q. Colella et al., Gene Ther 21, 450-456 (2014). 16.O. Novikova, N. Topilina, M. Belfort, J Biol Chem 289, 14490-14497 (2014). 17.KV Mills, MA Johnson, FB Perler, J Biol Chem 289, 14498-14505 (2014). 18.NH Shah, et al., J Am Chem Soc 135, 5839-5847 (2013). 19.Y. Li, Biotechnol Lett 37, 2121-2137 (2015). 20.NH Shah, TW Muir, Chem Sci 5, 446-461 (2014). 21.C. Schmelas, D. Grimm, Biotechnol J 13, el700432 (2018). 22.L. Villiger et al., Nat Med 24, 1519-1525 (2018). 23.F. Zhu et al, Sci China Life, 2010; 24.F. Zhu et al Sci China Life, 2013 25.Li at al., Hum Gene Ther, 2008 26 P. Subramanyam et al., Proc Natl Acad Sci, 2013 27.H. Iwai, S. Zuger, J. Jin, PH Tam, FEBS Lett 580, 1853-1858 (2006). 28.J. Zettler, V. Schutz, HD Mootz, FEBS Lett 583, 909-914 (2009). 29.J. Li, W. Sun, B. Wang, X. Xiao, XQ Liu, Hum Gene Ther 19, 958-964 (2008). 30.SW Lockless, TW Muir, Proc Natl Acad Sci USA 106, 10999-11004 (2009). 31.Stevens et al., J Am Chem Soc. 2016 Feb. 24; 138(7):2162-5 32.SJ Reich, et al. Hum. Gene. Ther. 14, 37-44 (2003) 33.N. Esumi, et al. J. Biol. Chem. 279, 19064-19073 (2004). 34.Y. Tsybovsky, K. Palczewski, Protein Expr Purif 97, 50-60 (2014). 35.S. Bungert, LL Molday, RS Molday, J Biol Chem 276, 23539-23546 (2001). 36.TG Drivas, EL Holzbaur, J. Bennett, J Clin Invest 123, 4525-4539 (2013). 37.G. Gao et al., Hum Gene Ther 11, 2079-2091 (2000). 38.LP Pellissier et al., Mol Ther Methods Clin Dev 1,14009 (2014). 39.LP Pellissier et al., Mol Ther Methods Clin Dev 1,14009 (2014). 40.SC Khani et al., Invest Ophthalmol Vis Sci 48, 3954-3961 (2007). 41.M. Doria, A. Ferrara, A. Auricchio, Hum Gene Ther Methods 24, 392-398 (2013). 42.R. Sangermano et al., Ophthalmology 123, 1375-1385 (2016) 43.R. Sangermano et al., Ophthalmology 123, 1375-1385 (2016). 44.T. Nakano et al., Cell Stem Cell 10, 771-785 (2012). 45.X. Zhong et al., Nat Commun 5, 4047 (2014). 46.X. Zhong et al., Nat Commun 5, 4047 (2014). 47.M. Jansen et al., Traffic 12, 218-231 (2011). 48.C. Mussolino et al., Gene Ther 18, 637-645 (2011). 49.T. Nakano et al., Cell Stem Cell 10, 771-785 (2012). 50.X. Zhong et al., Nat Commun 5, 4047 (2014). 51.M. Cherian, SH Chan, F. Perler, J Mol Biol 426, 4018-4029 (2014). 52.JE Donello, JE Loeb, TJ Hope, J Virol 72, 5085-5092 (1998). 53.N. Zhang et al., Hum Mol Genet 24, 3220-3237 (2015). 54.H. Sun, PM Smallwood, J. Nathans, Nat Genet 26, 242-246 (2000). 55.TG Drivas, EL Holzbaur, J. Bennett, J Clin Invest 123, 4525-4539 (2013) 56.NL Mata et al., Invest Ophthalmol Vis Sci 42, 1685-1690 (2001). 57.J. Weng et al., Cell 98, 13-23 (1999). 58.Smith AJ et al., Gene Ther. 2012 Feb;19(2):154-61. 59.Liu XQ et al., Proc Natl Acad Sci USA. 1997 Jul 22;94(15):7851-6 60.Srivastava A, Curr Opin Virol. 2016 Dec;21:75-80. 61.Auricchio et al. (2001) Hum. Mol. Genet. 10(26):3075-81 62.Dalkara D et al., Sci Transl Med. 2013 Jun 12;5(189):189ra76. 63.Petrs-Silva H et al., Mol Ther. 2011 Feb;19(2):293-301. 64.Klimczak RR et al., PLoS One. 2009 Oct 14;4(10):e7467. 65.Hickey DG et al. Gene Ther. 2017 Dec;24(12):787-800. 66.Pearls, FB (2002). InBase, the Intein Database. Nucleic Acids Res. 30, 383-3 Blood 20 Feb 2013, 121(17):3335-3344 68.Levitt N, (1989). Genes Dev. 1989 Jul;3(7):1019-25 69.Iwamoto M et al, Chem Biol. 2010 September 24; 17(9): 981-9 70.Bunting, S., et al., Gene Therapy with BMN 270 Results in Therapeutic Levels of FVIII in Mice and Primates and Normalization of Bleeding in Hemophilic Mice. Mol Ther, 2018. 26(2): p. 496-5 71.Rangarajan, S., et al., AAV5-Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med, 2017. 377(26): p. 2519-2

Claims

1. A vector system for expressing a coding sequence in a cell, said coding sequence consisting of a first part (CDS1) and a second part (CDS2) and optionally a third part (CDS3), said vector system comprising: a) a first vector, - the first part of the coding sequence (CDS1), a first intein nucleotide sequence encoding an N-intein, the first intein nucleotide sequence being located at the 3' end of CDS1; and a first vector comprising: b) a second vector, - the second part of the coding sequence (CDS2), a second intein nucleotide sequence encoding a C-intein, the second intein nucleotide sequence being located at the 5' end of CDS2; and a second vector comprising Including; when the first vector and the second vector are inserted into a cell, a protein product of the coding sequence is produced by protein splicing; or The vector system comprises: a) a first vector, - the first part of the coding sequence (CDS1), a first intein nucleotide sequence encoding a first N-intein, the first intein nucleotide sequence being located at the 3′ end of CDS1; and a first vector comprising: b') a second vector, - the second part of the coding sequence (CDS2), - a second intein nucleotide sequence encoding the first C-intein, the second intein nucleotide sequence being located at the 5' end of the CDS2; a third intein nucleotide sequence encoding a second N-intein, the third intein nucleotide sequence being located at the 3′ end of CDS2; and a second vector comprising: c') a third vector, - the third part of the coding sequence (CDS3), a fourth intein nucleotide sequence encoding a second C-intein, the fourth intein nucleotide sequence being located at the 5' end of the CDS3; and a third vector comprising Including, wherein the first intein nucleotide sequence is different from the third intein nucleotide sequence and the second intein sequence is different from the fourth intein nucleotide sequence, and when the first vector, the second vector and the third vector are inserted into a cell, a protein product of the coding sequence is produced by protein splicing.

2. 2. The vector system of claim 1, wherein the first intein, the second intein, the third intein and the fourth intein encode a split intein, preferably the split intein has a maximum length of 150 amino acids, more preferably the split intein is a DnaE or DnaB intein.

3. - the first intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13 or a variant thereof, or a fragment thereof, or a homolog thereof; - the second intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 or a variant thereof, or a fragment thereof, or a homolog thereof; - the third intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13 or a variant thereof, or a fragment thereof, or a homolog thereof; 3. The vector system according to claim 1 or 2, wherein the fourth intein nucleotide sequence encodes an intein selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 or a mutant thereof, or a fragment thereof, or a homologue thereof.

4. The vector system according to any one of claims 1 to 3, wherein the first vector, the second vector and the third vector further comprise a promoter sequence operably linked to a 5'-terminal portion of the first portion of the coding sequence (CDS1), or the second portion of the coding sequence (CDS2), or the third portion of the coding sequence (CDS3).

5. The vector system according to any one of claims 1 to 4, wherein the first vector, the second vector and the third vector further comprise a 5' terminal repeat (5'-TR) nucleotide sequence and a 3' terminal repeat (3'-TR) nucleotide sequence, preferably, the 5'-TR is a 5' inverted terminal repeat (5'-ITR) nucleotide sequence and the 3'-TR is a 3' inverted terminal repeat (3'-ITR) nucleotide sequence.

6. The vector system according to any one of claims 1 to 5, wherein the first vector, the second vector and the third vector further comprise a polyadenylation signal nucleotide sequence, and / or at least one of the first vector, the second vector or the third vector further comprises a nucleotide sequence encoding a degradation signal.

7. 7. The vector system of claim 6, wherein the degradation signal is selected from the group consisting of CL1, PB29, SMN, CIITA, ODc, ecDHFR, or fragments thereof.

8. 8. The vector system of claim 1, wherein the coding sequence is split into the first, second and optionally third parts at a position consisting of a nucleophilic amino acid that does not fall within a structural or functional domain of the encoded protein product, wherein the nucleophilic amino acid is selected from serine, threonine or cysteine.

9. 9. The vector system of claim 1, wherein at least one of the first vector, the second vector and the third vector further comprises at least one enhancer or regulatory nucleotide sequence operably linked to the coding sequence.

10. 10. The vector system according to any one of claims 1 to 9, wherein the coding sequence encodes a protein capable of correcting a pathological condition or disorder, preferably wherein the disorder is a retinal degeneration, a metabolic disorder, a blood disorder, a neurodegenerative disorder, hearing loss, a channelopathy, a pulmonary disease, a myopathy, a cardiac disease.

11. 11. The vector system according to any one of claims 1 to 10, wherein said coding sequence encodes a protein capable of correcting a pathological condition or disorder, preferably said disorder is a retinal degeneration, preferably said retinal degeneration is hereditary, preferably said pathological condition or disease is selected from the group consisting of Retinitis Pigmentosa (RP), Leber's Congenital Amaurosis (LCA), Stargardt's Disease (STGD), Usher's Disease (USH), Alström's Syndrome, Congenital Stationary Night Blindness (CSNB), Macular Dystrophy, Occult Macular Dystrophy, diseases caused by mutations in the ABCA4 gene.

12. 11. The vector system of any one of claims 1 to 10, wherein the coding sequence encodes a protein capable of correcting Duchenne muscular dystrophy, cystic fibrosis, hemophilia A, Wilson's disease, phenylketonuria, dysferlinopathy, Rett's syndrome, polycystic kidney disease, Niemann-Pick disease type C, Huntington's disease.

13. The vector system according to any one of claims 1 to 11, wherein the coding sequence is a coding sequence of a gene selected from the group consisting of ABCA4, MYO7A, CEP290, CDH23, EYS, PCDH15, CACNA1, SNRNP200, RP1, PRPF8, RP1L1, ALMS1, USH2A, GPR98, and HMCN1.

14. The vector system according to any one of claims 1 to 12, wherein the coding sequence is a coding sequence of a gene selected from the group consisting of DMD, CFTR, F8, ATP7B, PAH, DYSF, MECP2, PKD, NPC1, and HTT.

15. a) a first vector, comprising, in the 5'-3' direction: - a 5' inverted terminal repeat (5'-ITR) sequence; - a promoter sequence; a 5'-terminal part of the coding sequence (CDS1), which is operably linked to and under the control of said promoter; a first intein nucleotide sequence encoding an N-intein; and - 3' inverted terminal repeat (3'-ITR) sequence and a first vector comprising: b) a second vector, comprising in the 5'-3' direction: - a 5' inverted terminal repeat (5'-ITR) sequence; - a promoter sequence; - a second intein nucleotide sequence encoding the C-intein; - the 3'-end part of the coding sequence (CDS2); and - 3' inverted terminal repeat (3'-ITR) sequence and a second vector comprising contains; or a) a first vector, comprising in the 5'-3' direction: - a 5' inverted terminal repeat (5'-ITR) sequence; - a promoter sequence; a 5'-terminal part of the coding sequence (CDS1'), which is operably linked to and under the control of said promoter; - a first intein nucleotide sequence encoding a first N-intein; and - 3' inverted terminal repeat (3'-ITR) sequence and a first vector comprising: b') a second vector, comprising in the 5'-3' direction: - a 5' inverted terminal repeat (5'-ITR) sequence; - a promoter sequence; a second intein nucleotide sequence encoding the first C-intein; - a second part of the coding sequence (CDS2'); and - a third intein nucleotide sequence encoding a second N-intein; - 3' inverted terminal repeat (3'-ITR) sequence and a second vector comprising: c') a third vector, comprising in the 5'-3' direction: - a 5' inverted terminal repeat (5'-ITR) sequence; - a promoter sequence; a fourth intein nucleotide sequence encoding a second C-intein; - a third part of the coding sequence (CDS3'); and - 3' inverted terminal repeat (3'-ITR) sequence and a third vector comprising The vector system according to any one of claims 1 to 14, comprising:

16. 16. The vector system according to any one of claims 1 to 15, wherein the coding sequence encodes the ABCA4 gene, preferably the coding sequence is split at nucleotides corresponding to aa Cys1150, Ser1168, Ser1090 of the ABCA4 protein and a split intein is inserted at the split point, or wherein the coding sequence encodes the CEP290 gene, preferably the coding sequence is split at nucleotides corresponding to aa Cys1076; Ser1275 of the CEP290 protein, preferably the coding sequence encoding the CEP290 gene is split at nucleotide sequences corresponding to aa Cys 929 and 1474; Ser 453 and Cys 1474 of the CEP290 protein and two split inteins are inserted at the split point.

17. 17. The vector system of any one of claims 1 to 16, wherein the first, second and third vectors are independently viral vectors, preferably adenoviral vectors or adeno-associated viral (AAV) vectors, preferably the first, second and third adeno-associated viral (AAV) vectors are selected from the same or different AAV serotypes, preferably the serotypes are selected from serotype 2, serotype 8, serotype 5, serotype 7 or serotype 9, serotype 7m8, serotype sh10; serotype 2 (quad Y-F).

18. A host cell transformed with the vector system according to any one of claims 1 to 17.

19. A vector system according to any one of claims 1 to 17 or a host cell according to claim 18 for medical use.

20. 20. The vector system according to any one of claims 1 to 19 or the host cell according to claim 18 for use in gene therapy, preferably for use in the treatment and / or prevention of a pathology or disease characterised by retinal degeneration, metabolic disorders, blood disorders, neurodegenerative disorders, hearing loss, channelopathies, pulmonary diseases, myopathies, cardiac diseases.

21. 21. The vector system or host cell for use according to claim 20, wherein said retinal degeneration is hereditary, preferably said pathology or disease is selected from the group consisting of Retinitis Pigmentosa (RP), Leber's Congenital Amaurosis (LCA), Stargardt's Disease (STGD), Usher's Disease (USH), Alström's Syndrome, Congenital Stationary Night Blindness (CSNB), Macular Dystrophies, Occult Macular Dystrophy, diseases caused by mutations in the ABCA4 gene.

22. 21. A vector system or host cell for use as claimed in claim 20 for use in the prevention and / or treatment of Duchenne muscular dystrophy, cystic fibrosis, hemophilia A, Wilson's disease, phenylketonuria, dysferlinopathy, Rett syndrome, polycystic kidney disease, Niemann-Pick disease type C, Huntington's disease.

23. A pharmaceutical composition comprising a vector system according to any one of claims 1 to 17 or a host cell according to claim 18, and a pharma- ceutically acceptable vehicle.

Images