Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof

Abstract

To provide immunogenic compositions capable of providing appropriate protection against Streptococcus pneumoniae serotypes not found in conventional vaccines.SOLUTION: The present invention provides new immunogenic compositions comprising conjugated Streptococcus pneumoniae capsular saccharide antigens (glycoconjugates) and uses thereof. Immunogenic compositions of the present invention typically comprise at least one glycoconjugate from a S. pneumoniae serotype not found in PREVNAR, SYNFLORIX and / or PREVNAR 13. The invention also relates to vaccination of human subjects, in particular infants and elderly, against pneumoccocal infections using the novel immunogenic compositions.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to novel immunogenic compositions comprising conjugated capsular saccharide antigens (glycoconjugates) and uses thereof. The immunogenic compositions of the invention typically comprise glycoconjugates in which the saccharide is derived from a serotype of Streptococcus pneumoniae. The present invention also relates to vaccination of human subjects, in particular young children and the elderly, against pneumococcal infections with said novel immunogenic compositions. [Background technology]

[0002] Infections caused by pneumococci are a major cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia and meningitis are the most common manifestations of invasive pneumococcal disease, while bacterial dissemination within the respiratory tract can lead to middle ear infections, sinusitis or recurrent bronchitis. Compared to invasive disease, non-invasive manifestations are usually less severe but are also more common.

[0003] In Europe and the United States, pneumococcal pneumonia is the most common community-acquired bacterial pneumonia, estimated to affect approximately 100 per 100,000 adults annually. The corresponding figures for febrile bacteremia and meningitis are 15-19 per 100,000 and 1-2 per 100,000, respectively. The risk for one or more of these manifestations is much higher in young children and the elderly, as well as in immunocompromised people of any age. Even in economically developed regions, invasive pneumococcal disease has a high mortality rate; for adults with pneumococcal pneumonia, the mortality rate averages 10%-20%, but can exceed 50% in high-risk groups. Pneumonia is by far the most common cause of pneumococcal deaths worldwide.

[0004] Streptococcus pneumoniae (the pneumococcus), the causative agent of pneumococcal disease, is a Gram-positive encapsulated coccus surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow serological differentiation between approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, whereas others are rarely so. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; notably, common noninvasive manifestations are otitis media, sinusitis, and bronchitis.

[0005] Pneumococcal conjugate vaccine (PCV) is a pneumococcal vaccine used to protect against disease caused by Streptococcus pneumoniae (S. pneumoniae) (the pneumococcus). Currently, there are three PCV vaccines available on the global market: PREVNAR® (called Prevenar in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine) and PREVNAR13® (13-valent vaccine).

[0006] The recent emergence of widespread microbial resistance to essential antibiotics and the increasing number of immunocompromised people underscore the need for a pneumococcal vaccine that offers even broader protection.

[0007] In particular, there are serotypes not found in PREVNAR13®, and the possibility that serotype replacement may occur over time, leaving an unmet medical need for coverage of pneumococcal disease that must be addressed. The specific serotypes causing disease > 10 ... Summary of the Invention [Problem to be solved by the invention]

[0008] The objective of the novel immunogenic compositions of the invention is to provide adequate protection against S. pneumoniae serotypes not found in PREVNAR13®. In one embodiment, the objective of the immunogenic compositions of the invention is to provide adequate protection against S. pneumoniae serotypes not found in PREVNAR® (the 7-valent vaccine), SYNFLORIX®, and / or PREVNAR13® while maintaining an immune response against the serotypes currently encompassed by said vaccines. [Means for solving the problem]

[0009] The present invention relates to an immunogenic composition comprising at least one glycoconjugate selected from the group consisting of a glycoconjugate derived from S. pneumoniae serotype 15B, a glycoconjugate derived from S. pneumoniae serotype 22F, a glycoconjugate derived from S. pneumoniae serotype 33F, a glycoconjugate derived from S. pneumoniae serotype 12F, a glycoconjugate derived from S. pneumoniae serotype 10A, a glycoconjugate derived from S. pneumoniae serotype 11A and a glycoconjugate derived from S. pneumoniae serotype 8.

[0010] In one aspect, the present invention provides an immunogenic composition comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B, at least one glycoconjugate derived from S. pneumoniae serotype 22F, and at least one glycoconjugate derived from S. pneumoniae serotype 33F.

[0011] In another aspect, the present invention provides at least one glycoconjugate derived from S. pneumoniae serotype 15B, at least one glycoconjugate derived from S. pneumoniae serotype 22F, at least one glycoconjugate derived from S. pneumoniae serotype 33F, at least one glycoconjugate derived from S. pneumoniae serotype 34F, at least one glycoconjugate derived from S. pneumoniae serotype 35F, at least one glycoconjugate derived from S. pneumoniae serotype 36F, at least one glycoconjugate derived from S. pneumoniae serotype 37F, at least one glycoconjugate derived from S. pneumoniae serotype 38F, at least one glycoconjugate derived from S. pneumoniae serotype 39F, at least one glycoconjugate derived from S. pneumoniae serotype 40F, at least one glycoconjugate derived from S. pneumoniae serotype 41F, at least one glycoconjugate derived from S. pneumoniae serotype 42F, at least one glycoconjugate derived from S. pneumoniae serotype 43F, at least one glycoconjugate derived from S. pneumoniae serotype 44F, at least one glycoconjugate derived from S. pneumoniae serotype 45F, at least one glycoconjugate derived from S. pneumoniae serotype 46F, at least one glycoconjugate derived from S. pneumoniae serotype 47F, at least one glycoconjugate derived from S. pneumoniae serotype 48F, at least one glycoconjugate derived from S. pneumoniae serotype 49F, at least one glycoconjugate derived from S. pneumoniae serotype 49F, at least one Provided is an immunogenic composition comprising at least one glycoconjugate derived from serotype 12F, at least one glycoconjugate derived from S. pneumoniae serotype 10A, at least one glycoconjugate derived from S. pneumoniae serotype 11A, and at least one glycoconjugate derived from S. pneumoniae serotype 8.

[0012] In one embodiment, the immunogenic composition is an immunogenic composition comprising an antibody against Streptococcus pneumoniae (S pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.

[0013] In another embodiment, the immunogenic composition described above further comprises glycoconjugates derived from S. pneumoniae serotypes 1, 5 and 7F.

[0014] In another embodiment, the immunogenic composition described above further comprises glycoconjugates derived from S. pneumoniae serotypes 6A and 19A.

[0015] In another embodiment, the immunogenic composition described above further comprises a glycoconjugate derived from S. pneumoniae serotype 3.

[0016] In another embodiment, the immunogenic composition described above further comprises a glycoconjugate derived from S. pneumoniae serotypes 2, 9N, 17F, 20 and / or 15C.

[0017] In one aspect the immunogenic composition as described above does not comprise capsular saccharides derived from S. pneumoniae serotypes 9N, 9A and / or 9L.

[0018] In certain embodiments, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugate composition. In certain embodiments, the immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-valent pneumococcal conjugate composition.

[0019] In some embodiments, the glycoconjugate is selected from the group consisting of DT (diphtheria toxin), TT (tetanus toxin), CRM 197 , another DT variant, PD (Haemophilus influenzae protein D), or an immunologically functional equivalent thereof.

[0020] In one aspect, the invention provides a container filled with any of the immunogenic compositions defined herein.

[0021] In one aspect, the present invention provides any of the immunogenic compositions defined herein for use as a medicament, in particular for use as a vaccine.

[0022] In one aspect, the invention provides a method for preventing, treating, or ameliorating an infection, disease, or condition associated with Streptococcus pneumoniae (S. pneumoniae) in a subject, comprising administering to the subject an immunologically effective amount of any of the immunogenic compositions defined herein. [Brief description of the drawings]

[0023] [Figure 1] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 8 (Pn-8) capsular polysaccharide. [Diagram 2] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 10A (Pn-10A) capsular polysaccharide. [Diagram 3] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 11A (Pn-11A) capsular polysaccharide. [Figure 4] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 12F (Pn-12F) capsular polysaccharide. [Diagram 5] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 15B (Pn-15B) capsular polysaccharide. [Figure 6] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 22F (Pn-22F) capsular polysaccharide. [Figure 7] FIG. 1 shows the repeating polysaccharide structure of S. pneumoniae serotype 33F (Pn-33F) capsular polysaccharide. [Figure 8]FIG. 1 shows representative process flow diagrams for activation (A) and conjugation (B) processes that can be used in the preparation of Pn-33F glycoconjugates. [Figure 9] FIG. 1 shows the effect of changing the amount of NCS in the TEMPO / NCS oxidation reaction on DO. [Figure 10] FIG. 1 shows the stability evaluation of Pn-12F glycoconjugates. [Figure 11] Figure 1 shows cross-functional OPA responses. A subset of 59 sera from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (US Study 6115A1-004; ClinicalTrials.gov Identifier: NCT00427895) was evaluated in the OPA for the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N. The percentage of samples with OPA positive titers (i.e., 1:8 or greater) is shown above each group. Geometric mean titers (GMTs) are listed on the x-axis below each group. [Figure 12] Figure 1 shows the cross-functional OPA response of 66 matched pre / post sera. A subset of 66 matched pre- and post-vaccination serum panels from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572) was evaluated in the OPA for the presence of functional antibodies to serotypes 9V, 9A, 9L, and 9N. The percentage of samples with OPA positive titers (i.e., 1:8 or greater) is shown above each group. Geometric mean titers (GMTs) are listed on the x-axis below each group. [Figure 13]Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers against serotype 9V (Pn9V) from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA positive titers (i.e., 1:8 or greater). [Figure 14] Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers against serotype 9A (Pn9A) from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA positive titers (i.e., 1:8 or greater). [Figure 15] Figure 1 shows the reverse cumulative distribution curves (RCDC) before and after immunization with pneumococcal serotype 9L (Pn9L). The reverse cumulative distribution curves of OPA titers against serotype 9L from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA positive titers (i.e., 1:8 or greater). [Figure 16]Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers against serotype 9N (Pn9N) from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA positive titers (i.e., 1:8 or greater). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] 1. Immunogenic Composition of the Present Invention Immunogenic compositions of the invention typically comprise conjugated capsular saccharide antigens (also called glycoconjugates) in which the saccharide is derived from a serovar of Streptococcus pneumoniae (S. pneumoniae).

[0025] Preferably, the number of S. pneumoniae capsular saccharides may range from 8 different serotypes (or "v", valence) to 20 different serotypes (20v). In one embodiment, there are 8 different serotypes. In one embodiment, there are 9 different serotypes. In one embodiment, there are 10 different serotypes. In one embodiment, there are 11 different serotypes. In one embodiment, there are 12 different serotypes. In one embodiment, there are 13 different serotypes. In one embodiment, there are 14 different serotypes. In one embodiment, there are 15 different serotypes. In one embodiment, there are 16 different serotypes. In one embodiment, there are 17 different serotypes. In one embodiment, there are 18 different serotypes. In one embodiment, there are 19 different serotypes. In one embodiment, there are 20 different serotypes. The capsular saccharides are conjugated to a carrier protein to form a glycoconjugate as described herein below.

[0026] Where the protein carrier is the same for two or more saccharides in the composition, the saccharides can be conjugated to the same molecule of protein carrier (the carrier molecule having two or more different saccharides conjugated thereto) [see, e.g., WO2004 / 083251 [I want to be].

[0027] However, in a preferred embodiment, the saccharides are each individually conjugated to different molecules of protein carrier (each molecule of protein carrier having only one type of saccharide conjugated to it), in which embodiment the capsular saccharides are said to be individually conjugated to the carrier protein.

[0028] For the purposes of the present invention, the term "glycoconjugate" refers to a capsular saccharide covalently linked to a carrier protein. In one embodiment, the capsular saccharide is directly linked to the carrier protein. In a second embodiment, the bacterial saccharide is linked to the protein via a spacer / linker.

[0029] 1.1 Carrier Proteins of the Invention A component of the glycoconjugates of the present invention is a carrier protein to which a saccharide is conjugated. The terms "protein carrier" or "carrier protein" or "carrier" can be used interchangeably herein. The carrier protein should be amenable to standard conjugation procedures.

[0030] In a preferred embodiment, the carrier protein of the glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin) or fragment C of TT, CRM 197(non-toxic but antigenically identical variants of diphtheria toxin), other DT mutants (CRM176, CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM9, CRM102, CRM103 or CRM107; Nicholls and Youle, Genetically Engineered Toxins, Frankel (eds.), Maecel Dekker and other mutations described by Inc. (1992); deletions or mutations of Glu-148 to Asp, Gln or Ser and / or Ala-158 to Gly and other mutations disclosed in U.S. Pat. Nos. 4,709,017 and 4,950,740; mutations of at least one or more of the residues Lys516, Lys526, Phe530 and / or Lys534 and other mutations disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Pat. No. 5,843,711, pneumococcal pneumolysin (ply) (Kuo et al. (1995) Infect Immunol. 63:2706-2713), e.g., ply detoxified in some manner, e.g., dPLY-GMBS (WO2004 / 081515, WO2006 / 032499) or dPLY-formol, PhtX, e.g., PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD or PhtE are disclosed in WO00 / 37105 and WO00 / 39299) and fusions of Pht proteins, e.g., PhtDE fusions, PhtBE fusions, Pht AE (WO01 / 98334, WO03 / 054007, WO2009 / 000826), typically from Neisseria meningitidis (Neisseria OMPC (meningococcal outer membrane protein) extracted from Neisseria meningitidis serogroup B (EP0372501), PorB (Neisseria meningitidis (N.meningitidis), PD (Haemophilus influenzae protein D; see, for example, EP 0594610B), or immunologically functional equivalents thereof, synthetic peptides (EP 0378881, EP 0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO 98 / 58668, EP 0471177), cytokines, lymphokines, growth factors or hormones (WO 91 / 01146), artificial proteins containing multiple human CD4+ T cell epitopes derived from various pathogen-derived antigens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), e.g. the N19 protein (Baraldoi et al. (2004) Infect Immunol 20:131-132). 72:4884-4887), pneumococcal surface protein PspA (WO02 / 091998), iron uptake protein (WO01 / 72337), Clostridium difficile toxin A or B (WO00 / 61761), transferrin binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A, particularly non-toxic mutants thereof, such as exotoxin A carrying a substitution at glutamic acid 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971). Other proteins such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or purified protein derivative of tuberculin (PPD) can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., as described in WO2004 / 083251), Escherichia coli LT, E. coli ST, and exotoxin A from P. aeruginosa.

[0031] In a preferred embodiment, the carrier protein of the glycoconjugate is TT, DT , DT mutant (CRM 197 and the like), H. influenzae protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO01 / 98334 and WO03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, C. difficile toxin A or B, and PsaA.

[0032] In one embodiment, the carrier protein of the glycoconjugate of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is TT (tetanus toxoid).

[0033] In another embodiment, the carrier protein of the glycoconjugate of the invention is PD (H. influenzae protein D; see, for example, EP0594610B).

[0034] In a preferred embodiment, the capsular saccharide of the invention is CRM 197 Conjugated to a protein. CRM 197 The protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM 197 was generated by nitrosoguanidine mutagenesis of the toxigenic corynebacterial phage beta (Uchida et al. (1971) Nature New Biology 233:8-11). tox- CRM is produced by Corynebacterium diphtheriae infected with 197 The protein has the same molecular weight as diphtheria toxin but differs from it by a single base change in the structural gene (guanine to adenine) that causes an amino acid substitution in the mature protein (glutamic acid to glycine) and eliminates the toxicity of diphtheria toxin. CRM 197Proteins are safe and effective T cell-dependent carriers for saccharides. CRM 197 and further details regarding its production can be found, for example, in US Pat. No. 5,614,382.

[0035] In one embodiment the capsular saccharide of the invention is CRM 197 Protein or CRM 197 (See CN103495161). In one embodiment, the capsular saccharide of the invention is conjugated to the A chain of CRM obtained via expression in recombinant E. coli. 197 (see CN103495161). In one embodiment, the capsular saccharide of the invention is all conjugated to the A chain of CRM 197 In one embodiment, the capsular saccharide of the invention is all conjugated to CRM 197 It is conjugated to the A chain of

[0036] Thus, in a frequent embodiment, the glycoconjugates of the invention comprise a CRMP as a carrier protein. 197 wherein the capsular polysaccharide is CRM 197 is covalently linked to

[0037] 1.2 Capsular saccharides of the invention Throughout this specification the term "saccharide" may include polysaccharides or oligosaccharides, including both. In a common embodiment, the saccharide is a polysaccharide, in particular a S. pneumoniae capsular polysaccharide.

[0038] Capsular polysaccharides are prepared by standard techniques known to those skilled in the art.

[0039] In the present invention, the capsular polysaccharide is, for example, a polysaccharide derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 1B, 1C, 1D, 1E, 1F, 1G, 1H, 1I, 1J, 1K, 1L, 1J, 1K ... Capsular polysaccharides can be prepared from serotypes 1A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. Typically, capsular polysaccharides are produced by growing the respective S. pneumoniae serotypes in a medium (e.g., soy-based medium) and then prepared from bacterial cultures. The bacterial strains of S. pneumoniae used to make the respective polysaccharides used in the glycoconjugates of the present invention can be obtained from established culture collections or clinical specimens.

[0040] Populations of organisms (respective S. pneumoniae serotypes) are often scaled up from seed vials to seed bottles and passaged through one or more seed fermenters of increasing capacity until a production-scale fermentation volume is reached. At the end of the growth cycle, the cells are lysed and the lysate culture is harvested for downstream (purification) processing (see, e.g., WO2006 / 110381, WO2008 / 118752, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0041] Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752).

[0042] The purified polysaccharides can be activated (e.g., chemically activated) to render them capable of reacting (e.g., with an eTEC spacer) and then incorporated into the glycoconjugates of the invention, as further described herein.

[0043] The Streptococcus pneumoniae capsular polysaccharide contains repeating oligosaccharide units that may contain up to eight sugar residues.

[0044] In one embodiment, the capsular saccharide of the invention may be shorter than the natural length saccharide chain of a single oligosaccharide unit or repeating oligosaccharide unit, hi one embodiment, the capsular saccharide of the invention is a single repeating oligosaccharide unit of the relevant serotype.

[0045] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide, which has a small number of repeating units (typically 5-15 repeating units) and is typically derived synthetically or by hydrolysis of a polysaccharide.

[0046] However, preferably, all of the capsular saccharides of the invention and in the immunogenic compositions of the invention are polysaccharides. High molecular weight capsular polysaccharides are capable of inducing certain specific antibody immune responses due to epitopes present on the antigen surface. Isolation and purification of high molecular weight capsular polysaccharides is preferably contemplated for use in the conjugates, compositions and methods of the invention.

[0047] In some embodiments, the polysaccharide purified prior to conjugation has a molecular weight between 10 kDa and 4,000 kDa, in other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 4,000 kDa. In further such embodiments, the polysaccharide is from 50 kDa to 3,500 kDa; 50 kDa to 3,000 kDa; 50 kDa to 2,500 kDa; 50 kDa to 2,000 kDa; 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 4,000 kDa; 100 kDa to 3,500 kDa; 100 kDa to 3,000 kDa; 100 kDa to 2,500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 2 ,000kDa;100kDa~1,750kDa;100kDa~1,500kDa;100kDa~1,250kDa;100kDa~1,000kDa;10 0kDa~750kDa;100kDa~500kDa;200kDa~4,000kDa;200kDa~3,500kDa;200kDa~3,000kDa;2 or 200 kDa to 500 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0048] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, polysaccharides may be subjected to sizing techniques prior to conjugation, as described herein. Mechanical or chemical sizing may be used. Chemical hydrolysis may be performed using acetic acid. Mechanical sizing may be performed using high pressure homogenizing shear. The molecular weight ranges above refer to purified polysaccharides prior to conjugation (e.g., prior to activation).

[0049] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide from serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F or 33F of Streptococcus pneumoniae, wherein the capsular polysaccharide has a molecular weight within one of the molecular weight ranges set out herein above.

[0050] As used herein, the term "molecular weight" of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) coupled with a multi-angle laser light scattering detector (MALLS).

[0051] In some embodiments pneumococcal saccharides from serotypes 9V, 18C, 11A, 15B, 22F and / or 33F of the invention are O-acetylated. In some embodiments pneumococcal saccharides from serotypes 9V, 11A, 15B, 22F and / or 33F of the invention are O-acetylated.

[0052] The purified polysaccharides described herein are chemically activated to generate saccharides capable of reacting with carrier proteins. These pneumococcal conjugates are prepared by a separate process and formulated into single dose formulations as described below.

[0053] 1.2.1 Pneumococcal polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F Capsular saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F can be prepared by standard techniques known to those skilled in the art (see, for example, WO2006 / 110381). Capsular polysaccharides can be produced by growing the respective S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed and then the lysate culture is harvested for downstream (purification) processes. Individual polysaccharides are typically purified by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, for example, WO2006 / 110352 and WO2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the invention.

[0054] In some embodiments, the purified polysaccharide from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and / or 23F prior to conjugation has a molecular weight between 10 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 4,000 kDa; 50 kDa and 3,000 kDa or 50 kDa and 2,000 kDa. In further such embodiments, the polysaccharide is from 50 kDa to 3,500 kDa; 50 kDa to 3,000 kDa; 50 kDa to 2,500 kDa; 50 kDa to 2,000 kDa; 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,500 kDa; 100kDa~3,500kDa;100kDa~3,000kDa;100kDa~2,500kDa;100kDa~2,000kDa;100kDa~1,750k 200k Da to 2,500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0055] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and prior to conjugation (e.g., prior to activation).

[0056] In some embodiments pneumococcal saccharides from serotype 9V and / or 18C of the invention are O-acetylated. In some embodiments pneumococcal saccharides from serotype 9V of the invention are O-acetylated and pneumococcal saccharides from serotype 18C of the invention are de-O-acetylated.

[0057] 1.2.2 Pneumococcus polysaccharide serotype 8 The polysaccharide repeating unit of serotype 8 consists of a linear tetrasaccharide with one glucuronic acid (GlcpA), two glucopyranose (Glcp) and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked by 1,4-bonds as shown in Figure 1.

[0058] Serotype 8 saccharides can be obtained directly from the bacteria using isolation procedures known to those of skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0059] Serotype 8 S. pneumoniae strains can be obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or from clinical specimens. This can be done.

[0060] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 8 prior to conjugation has a molecular weight between 10 kDa and 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight between 50 kDa and 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight between 70 kDa and 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight between 100 kDa and 800 kDa.

[0061] In a further embodiment, the capsular polysaccharide is from 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250kDa to 600; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 600kDa; 300kDa to 500kDa; 300kDa to 400kDa; 400kDa to 600kDa; 500kDa to 600kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0062] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and prior to conjugation (e.g., prior to activation).

[0063] 1.2.3 Pneumococcus polysaccharide serotype 10A The polysaccharide repeating unit of serotype 10A contains two galactofuranose residues (Gal f ), three galactopyranose (Gal p ), one N-acetylgalactosamine (Gal pIt consists of a branched hexasaccharide repeating unit with a β-GalpNAc moiety (β-3-Galp and β-6-Galf) and a phosphoribitol backbone (Jones, C. (2005) Carbohydrate Research 269(1):175-181). As shown in Figure 2, there are two branched monosaccharides in the β-GalpNAc moiety (β-3-Galp and β-6-Galf).

[0064] Serotype 10A saccharides can be obtained directly from the bacteria using isolation procedures known to those of skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0065] Serotype 10A Streptococcus pneumoniae strains were cultured at established culture collections (e.g., Streptococcal Reference Laboratories (Centers for Disease Control and Prevention) The antibodies can be obtained from a variety of sources, including the National Institute of Integrative Medicine, University of Maryland (University of Maryland, Atlanta, GA) or from clinical specimens.

[0066] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 10A prior to conjugation has a molecular weight of between 10 kDa and 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of between 50 kDa and 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of between 70 kDa and 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of between 100 kDa and 2,000 kDa. It has a molecular weight of 100 kDa to 800 kDa.

[0067] In a further embodiment, the capsular polysaccharide is from 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 50kDa-600kDa; 250kDa-500kDa; 250kDa-400kDa; 250kDa-350kDa; 300kDa-600kDa; 300kDa-500kDa; 300kDa-400kDa; 400kDa-600kDa; 500kDa-600kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0068] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and prior to conjugation (e.g., prior to activation).

[0069] 1.2.4 Pneumococcus polysaccharide serotype 11A The polysaccharide repeating unit of serotype 11A is a linear tetrasaccharide backbone (two galactopyranose (Gal p ) and two glucopyranose (Glc p )) and pendant phosphoglycerol (Richards et al. (1988) Adv. Exp. Med. Biol. 228:595-597). The polysaccharide is O-acetylated at multiple positions, and based on data reported in the literature (Calix et al. (2011) J Bacteriol. 193(19):5271-5278), the total amount of O-acetylation in the 11A polysaccharide is approximately 2.6 O-acetyl groups per polysaccharide repeat unit.

[0070] Serotype 11A saccharides can be obtained directly from the bacteria using isolation procedures known to those of skill in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0071] Serotype 11A Streptococcus pneumoniae strains were cultured at established culture collections (e.g., Streptococcal Reference Laboratories (Centers for Disease Control and Prevention) The antibodies can be obtained from a variety of sources, including the National Institute of Integrative Medicine, University of Maryland (University of Maryland, Atlanta, GA) or from clinical specimens.

[0072] The isolated serotype 11A capsular polysaccharide obtained by purification of serotype 11A polysaccharide from S. pneumoniae lysate, and optionally the sizing of the purified polysaccharide, can be characterized by various attributes including, for example, molecular weight (MW) and mM acetate per mM of said serotype 11A capsular polysaccharide.

[0073] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 11A prior to conjugation has a molecular weight of between 10 kDa and 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of between 50 kDa and 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of between 70 kDa and 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of between 100 kDa and 2,000 kDa. It has a molecular weight of 100 kDa to 800 kDa.

[0074] In a further embodiment, the capsular polysaccharide is from 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 600 kDa; 00kDa-500kDa; 200kDa-400kDa; 250kDa-600kDa; 250kDa-500kDa; 250kDa-400kDa; 250kDa-350kDa; 300kDa-600kDa; 300kDa-500kDa; 300kDa-400kDa; 400kDa-600kDa; 500kDa-600kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0075] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and prior to conjugation (e.g., prior to activation).

[0076] In one embodiment, the purified serotype 11A polysaccharide is reduced in size by high pressure homogenization, which achieves high shear rates by pumping the process stream through a channel with sufficiently small dimensions. The shear rate can be increased by using a higher applied homogenization pressure and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0077] The high pressure homogenization process is particularly suitable for reducing the size of purified serotype 11A polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0078] The presence of O-acetyl in purified, isolated or activated serotype 11A capsular polysaccharide or in serotype 11A polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0079] In a preferred embodiment, the purified polysaccharide derived from S. pneumoniae serotype 11A has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol acetate per μmol of said serotype 11A capsular polysaccharide.

[0080] 1.2.5 Pneumococcus polysaccharide serotype 12F The polysaccharide repeating unit of serotype 12F has two branches: Fuc p Pendant α-galactopyranose (Gal p ) and Man p α-Glc linked at C3 of NAcA p -(1→2)-α-Glc p A linear trisaccharide backbone (one N-acetylfucosamine (Fuc)) with a disaccharide branch p NAc), one N-acetylgalactosamine (Gal p NAc) and one N-acetylmannuronic acid (Man p NAcA) (Leontein et al. (1983) Carbohydrate Research 114(2):257-266)).

[0081] Serotype 12F Streptococcus pneumoniae strains were obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)). These can be obtained from recombinant human genomic DNA (e.g., genomic DNA) or clinical specimens.

[0082] Capsular saccharides from S. pneumoniae serotype 12F are prepared by standard techniques known to those skilled in the art. Typically, capsular polysaccharides are produced by growing the respective S. pneumoniae serotype in a medium (e.g., a soy-based medium) and then the polysaccharide is prepared from the bacterial culture. The population of organisms (S. pneumoniae serotype 12F) is often scaled up from seed vials to seed bottles and passaged through one or more seed fermenters of increasing volume until a production-scale fermentation capacity is reached. At the end of the growth cycle, the cells are lysed and the lysate culture is harvested for downstream (purification) processing (see, e.g., WO2006 / 110381 and WO2008 / 118752, U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838). Polysaccharides are typically purified by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752).

[0083] As further described herein, purified polysaccharides derived from serotype 12F can be activated (e.g., chemically activated) to render them reactive and then incorporated into the glycoconjugates of the invention.

[0084] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 12F prior to conjugation has a molecular weight between 10 kDa and 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight between 50 kDa and 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight between 50 kDa and 300 kDa. In another embodiment, the capsular polysaccharide has a molecular weight between 70 kDa and 300 kDa. In a further embodiment, the capsular polysaccharide is from 90 kDa to 250 kDa; 90 kDa to 150 kDa; 90 kDa to 120 kDa; 80 kDa to 120 kDa; 70 kDa to 100 kDa; 70 kDa to 110 kDa; 70 kDa to 120 kDa; 70 kDa to 130 kDa; 70 kDa to 140 kDa; 70 kDa to 150 kDa; 70 kDa to 160 kDa; 80 kDa to 110 kDa; 80 kDa to 120 kDa; 80 kDa to 130 kDa; 80 kDa and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0085] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and prior to conjugation (e.g., prior to activation).

[0086] 1.2.6 Pneumococcus polysaccharide serotype 15B As shown in FIG. 5, the polysaccharide repeating unit of serotype 15B is Glc p αGal linked to the C4 hydroxyl group of NAc p -βGalp A branched trisaccharide backbone with a disaccharide unit (one N-acetylglucosamine (Glc p NAc), one galactopyranose (Gal p ) and one glucopyranose (Glc p )) Phosphoglycerol is converted to βGal in the disaccharide branch. p Linked to the C3 hydroxyl group of the residue (Jones et al. (2005) Carbohydrate Research 340(3):403-409). The capsular polysaccharide from serotype 15C has an identical backbone structure to that of serotype 15B but lacks O-acetylation.

[0087] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation procedures known to those of skill in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). They can also be produced using synthetic protocols known to those of skill in the art.

[0088] Serotype 15B S. pneumoniae strains can be obtained from established culture collections (e.g., American Type Culture Collection (ATCC, Manassas, VA USA) (e.g., deposited strain ATCC10354) or Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA USA)) or from clinical specimens.

[0089] The bacterial cells are grown in a medium, preferably a soy-based medium. After fermentation of the bacterial cells producing S. pneumoniae serotype 15B capsular polysaccharide, the bacterial cells are lysed to obtain a cell lysate. The serotype 15B polysaccharide can then be isolated from the cell lysate using purification techniques known in the art, including the use of centrifugation, depth filtration, sedimentation, ultrafiltration, treatment with activated charcoal, diafiltration and / or column chromatography (see, e.g., U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). The purified serotype 15B capsular polysaccharide can then be used for the preparation of immunogenic conjugates.

[0090] The sizing of the isolated serotype 15B capsular polysaccharide, and optionally the purified polysaccharide, obtained by purification of serotype 15B polysaccharide from S. pneumoniae lysate can be characterized by various parameters including, for example, molecular weight (MW), mM acetate per mM of said serotype 15B capsular polysaccharide, and mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0091] Preferably, sizing of the polysaccharide to a target molecular weight range is performed prior to conjugation to the carrier protein to produce a 15B conjugate with favorable filtration characteristics and / or yield. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining important features of the polysaccharide structure, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization.

[0092] In a preferred embodiment, the purified serotype 15B polysaccharide is reduced in size by high pressure homogenization, which achieves high shear rates by pumping the process stream through a channel with sufficiently small dimensions. The shear rate can be increased by using a higher applied homogenization pressure and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0093] The high pressure homogenization process is particularly suitable for reducing the size of purified serotype 15B polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0094] In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa. In further embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0095] The polysaccharide of serotype 15B is O-acetylated, with a total amount of O-acetylation of about 0.8-0.9 O-acetyl groups per polysaccharide repeat unit. The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, for example, by proton NMR (see, for example, Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO2005 / 033148 and WO00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0096] The presence of O-acetyl in purified, isolated or activated serotype 15B capsular polysaccharide, or in serotype 15B polysaccharide-carrier protein conjugates, is expressed as mM acetate per mM of said polysaccharide, or as the number of O-acetyl groups per polysaccharide repeat unit.

[0097] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0098] The presence of glycerol phosphate side chains is determined by measuring glycerol using high performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) after liberation by treatment of the polysaccharide with hydrofluoric acid (HF). The presence of glycerol in purified, isolated, or activated serotype 15B polysaccharide or in serotype 15B polysaccharide-carrier protein conjugates is expressed as mM of glycerol per mM of serotype 15B polysaccharide.

[0099] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM glycerol per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0100] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 350 kDa and contains at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0101] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 350 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0102] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 300 kDa and contains at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0103] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 300 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0104] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 350 kDa and contains at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0105] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 350 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0106] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0107] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 350 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0108] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 300 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0109] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 350 kDa and a molecular weight of at least 0.6 mM per mM of said serotype 15B capsular polysaccharide. M acetate and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0110] 1.2.7 Pneumococcus polysaccharide serotype 22F As shown in FIG. 6, the polysaccharide repeating unit of serotype 22F is p αGlc linked to the C3 hydroxyl group of p A branched pentasaccharide backbone (one glucuronic acid (Glc p A), one glucopyranose (Glc p ), one galactofuranose (Gal f ) and two rhamnopyranoses (Rha p )) (Richards et al. (1989), Canadian Journal of Chemistry 67(6):1038-1050). p The C2 hydroxyl group of approximately 80% of the residues is O-acetylated.

[0111] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0112] Serotype 22F Streptococcus pneumoniae strains were cultured at established culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention) The antibodies can be obtained from a variety of sources, including the National Institute of Integrative Medicine, University of Maryland (University of Maryland, Atlanta, GA) or from clinical specimens.

[0113] The sizing of the isolated serotype 22F capsular polysaccharide, and optionally the purified polysaccharide, obtained by purification of serotype 22F polysaccharide from S. pneumoniae lysate can be characterized by various parameters including, for example, molecular weight (MW) and mM acetate per mM of said serotype 22F capsular polysaccharide.

[0114] Preferably, sizing of the polysaccharide to a target molecular weight range is performed prior to conjugation to the carrier protein to produce a serotype 22F conjugate with favorable filtration characteristics and / or yield. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining important features of the polysaccharide structure, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization.

[0115] In a preferred embodiment, the purified polysaccharides are reduced in size by high pressure homogenization, which achieves high shear rates by pumping the process stream through a channel with sufficiently small dimensions. The shear rate can be increased by using a higher applied homogenization pressure and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0116] The high pressure homogenization process is particularly suitable for reducing the size of purified serotype 22F polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0117] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 22F prior to conjugation has a molecular weight of between 10 kDa and 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of between 50 kDa and 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of between 70 kDa and 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of from 100 kDa to 800 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of from 200 kDa to 600 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of from 400 kDa to 700 kDa.

[0118] In a further embodiment, the capsular polysaccharide is from 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 150 kDa to 800kDa;150kDa~700kDa;150kDa~600kDa;150kDa~500kDa;150kDa~400kDa;150kDa~300kDa;200kDa~1 ,000kDa;200kDa~900kDa;200kDa~800kDa;200kDa~700kDa;200kDa~600kDa;200kDa~500kDa;200kDa~4 00kDa;200kDa~300kDa;250kDa~1,000kDa;250kDa~900kDa;250kDa~800kDa;250kDa~700kDa;250kDa~ 600kDa;250kDa~500kDa;250kDa~400kDa;250kDa~350kDa;300kDa~1,000kDa;300kDa~900kDa;300kDa~ 800kDa; 300kDa-700kDa; 300kDa-600kDa; 300kDa-500kDa; 300kDa-400kDa; 400kDa-1,000kDa; 400kDa-900kDa; 400kDa-800kDa; 400kDa-700kDa; 400kDa-600kDa; 500kDa-600kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0119] Polysaccharides may become slightly reduced in size during normal purification procedures. In addition, as described herein above, 22F polysaccharides may be subjected to sizing techniques before conjugation. The above molecular weight ranges refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0120] The degree of O-acetylation of polysaccharides can be determined by any method known in the art, for example, by proton NMR (see Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO2005 / 033148 and WO00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0121] The presence of O-acetyl in purified, isolated or activated serotype 22F capsular polysaccharide or in serotype 22F polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0122] In a preferred embodiment, the purified polysaccharide from S. pneumoniae serotype 22F has at least 0.2, 0.4, 0.6, 0.8, 1, 1.2, 1.4 or 1.6 μmol acetate per μmol of said serotype 22F capsular polysaccharide.

[0123] 1.2.8 Pneumococcus polysaccharide serotype 33F As shown in FIG. 7, the polysaccharide repeating unit of serotype 33F contains αGal in the backbone. p Terminal αGal linked to the C2 hydroxyl group of the residue pA branched pentasaccharide backbone (two galactopyranoses (Gal p ), two galactofuranose (Gal f ) and one glucopyranose (Glc p ) (Lemercinier et al. (2006), Carbohydrate Research 341(1):68-74). f It has been reported in the literature that the C2 hydroxyl group of the residue is O-acetylated.

[0124] Serotype 33F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0125] Serotype 33F Streptococcus pneumoniae strains were cultured at established culture collections (e.g., Streptococcal Reference Laboratories (Centers for Disease Control and Prevention) The antibodies can be obtained from a variety of sources, including the National Institute of Integrative Medicine, University of Maryland (University of Maryland, Atlanta, GA) or from clinical specimens.

[0126] Purified polysaccharides from serotype 33F can be activated (e.g., chemically activated) to render them reactive and then incorporated into the glycoconjugates of the invention, as further described herein.

[0127] The isolated serotype 33F capsular polysaccharide obtained by purification of serotype 33F polysaccharide from S. pneumoniae lysate and, optionally, the sizing of the purified polysaccharide can be characterized by various parameters including, for example, molecular weight and mM acetate per mM of said serotype 33F capsular polysaccharide.

[0128] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 33F prior to conjugation has a molecular weight of between 10 kDa and 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of between 50 kDa and 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of between 50 kDa and 1,750 kDa; 50 kDa and 15,00 kDa; 50 kDa and 1,250 kDa; 50 kDa and 1,000 kDa; 50 kDa and 7500 kDa; 50 kDa and 500 kDa; 100 kDa and 2,000 kDa; 100 kDa and 1,750 kDa; 100 kDa and 1,500 kDa; 100 kDa and 1,2 or 200 kDa to 500 kDa. All integers within any of the above ranges are contemplated as embodiments of the present disclosure.

[0129] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and prior to conjugation (e.g., prior to activation).

[0130] In purified, isolated, or activated serotype 33F capsular polysaccharide, or in serum The presence of O-acetyl in a type 33F polysaccharide-carrier protein conjugate is expressed as mM acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0131] In a preferred embodiment, the purified polysaccharide from S. pneumoniae serotype 33F has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol acetate per μmol of said serotype 33F capsular polysaccharide.

[0132] 1.3 Glycoconjugates of the Invention The purified saccharides are chemically activated to generate saccharides capable of reacting with a carrier protein (i.e., activated saccharides). Once activated, each capsular saccharide is separately conjugated to a carrier protein to form a glycoconjugate. In one embodiment, each capsular saccharide is conjugated to the same carrier protein. Chemical activation of the saccharides and subsequent conjugation to a carrier protein can be achieved by the activation and conjugation methods disclosed herein.

[0133] 1.3.1 Glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F Capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae are prepared by standard techniques known to those of skill in the art (see, e.g., WO2006 / 110381, WO2008 / 118752, WO2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0134] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to a carrier protein, preferably a CRMP. 197 The polysaccharide is coupled to the amino group on the carrier directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with N-[γ-maleimidobutyryloxy]succinimide ester (GMBS)) or a haloacetylated carrier protein (e.g., iodoacetimide, N-succinimidyl bromoacetate (SBA;SIB), N-succinimidyl (4-iodoacetyl) aminobenzoic acid (SIAB), sulfosuccinimidyl (4-iodoacetyl) aminobenzoic acid (sulfo-SIAB), N-succinimidyl iodoacetate (SIA) or succinimidyl 3-[bromoacetamido]propionate (SBAP)). Preferably, the cyanate ester (which may be generated by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH) and the amino-derivatized saccharide is attached to the carrier protein (e.g., CRMP) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier. 197 Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0135] Other suitable techniques for conjugation are carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NH S, EDC, TSTU are used. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which may be formed by reaction of the free hydroxyl group of the saccharide with 1,1'-carbonyldiimidazole (CDI) (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0136] In a preferred embodiment, at least one capsular polysaccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae is conjugated to a carrier protein by reductive amination (as described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071, and 2007 / 0184072, WO2006 / 110381, WO2008 / 079653, and WO2008 / 143709). In a preferred embodiment, capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae are all conjugated to the carrier protein by reductive amination.

[0137] Reductive amination involves two steps: (1) oxidation of the polysaccharide, and (2) reduction of the activated polysaccharide and carrier protein to form a conjugate. Prior to oxidation, the polysaccharide may be hydrolyzed. Mechanical or chemical hydrolysis may be used. Chemical hydrolysis may be carried out using acetic acid. The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO 4 - ) and orthoperiodate (IO 6 5- ) and various salts of periodate (e.g., sodium periodate and potassium periodate).

[0138] In one embodiment, capsular polysaccharide from serotype 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F or 23F of S. pneumoniae is incubated in the presence of metaperiodate, preferably sodium periodate (NaIO 4 In another embodiment, capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of S. pneumoniae are oxidized in the presence of orthoperiodate, preferably in the presence of periodic acid.

[0139] After the polysaccharide oxidation step, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide". The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) independently (individual lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are lyophilized simultaneously. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized independently.

[0140] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

[0141] The second step of the conjugation process is the reduction of the activated polysaccharide and carrier protein with a reducing agent (so-called reductive amination) to form the conjugate. Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, borane-pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0142] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent.In one embodiment, the reduction reaction is carried out in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent.DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0143] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH 4 ). After conjugation (reduction reaction and optionally capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography. In one embodiment, the glycoconjugate is sterile filtered.

[0144] In some embodiments, glycoconjugates derived from S. pneumoniae serotypes 9V and / or 18C include saccharides having a degree of O-acetylation of 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 75%-100%, 80%-100%, 90%-100%, 50%-90%, 60%-90%, 70%-90%, or 80%-90%. In other embodiments, the degree of O-acetylation is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, or about 100%.

[0145] In some embodiments, glycoconjugates derived from S. pneumoniae serotype 9V and / or 18C of the invention are O-acetylated. In some embodiments, glycoconjugates derived from S. pneumoniae serotype 9V are O-acetylated and glycoconjugates derived from S. pneumoniae serotype 18C are de-O-acetylated.

[0146] 1.3.2 Glycoconjugates derived from S. pneumoniae serotype 22F In one embodiment, serotype 22F glycoconjugates are obtained by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to amino groups on the carrier protein directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be produced by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via a carboxyl group on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.

[0147] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0148] In a preferred embodiment, the serotype 22F glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) coupling of the activated polysaccharide and a carrier protein (e.g., CRMP) to form a conjugate. 197 ) reduction.

[0149] Preferably, prior to oxidation, sizing of the serotype 22F polysaccharide to a target molecular weight (MW) range is performed. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining important features of the polysaccharide structure, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization (see section 1.2.7 above).

[0150] In one embodiment, the serotype polysaccharide is (a) reacting the isolated serotype 22F polysaccharide with an oxidizing agent; (b) quenching the oxidation reaction by addition of a quenching agent to obtain activated serotype 22F polysaccharide. It is activated (oxidized) by a process that includes

[0151] In a preferred embodiment, the oxidizing agent is periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO 4 - ) and orthoperiodate (IO 6 5- ) and various salts of periodate (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used to oxidize serotype 22F polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize serotype 22F polysaccharide is sodium metaperiodate.

[0152] In one embodiment, the quenching agent is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfite, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphorous acid.

[0153] In one embodiment, the quenching agent has formula (I):

[0154] [ka] (In the formula, R 1 is selected from H, methyl, ethyl, propyl, or isopropyl).

[0155] In one embodiment, the quenching agent is selected from sodium and potassium salts of sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites or phosphorous acid.

[0156] In one embodiment, the quenching agent is an amino acid, which in such an embodiment may be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.

[0157] In one embodiment, the quenching agent is a sulfite, such as a bisulfite, dithionite, metabisulfite, or thiosulfate.

[0158] In one embodiment, the quenching agent is a compound that contains two vicinal hydroxyl groups (vicinal diol), ie, two hydroxyl groups covalently linked to two adjacent carbon atoms.

[0159] Preferably, the quenching agent has the formula (II):

[0160] [ka] (In the formula, R 1 and R 2 are each independently H, methyl, ethyl, propyl or isopropyl The compound is selected from the group consisting of propyl.

[0161] In a preferred embodiment, the quenching agent is glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, or ascorbic acid. In a preferred embodiment, the quenching agent is butane-2,3-diol.

[0162] In a preferred embodiment, the isolated serotype 22F polysaccharide comprises (a) reacting the isolated serotype 22F polysaccharide with periodate; (b) quenching the oxidation reaction by the addition of butane-2,3-diol to obtain activated serotype 22F polysaccharide. The activation is achieved by a process including:

[0163] After the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is referred to hereinafter as "activated polysaccharide".

[0164] In a preferred embodiment, the activated serotype 22F polysaccharide is purified. The activated serotype 22F polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis or ultrafiltration / diafiltration. For example, the activated 22F polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.

[0165] In a preferred embodiment, the oxidation degree of the activated serotype 22F polysaccharide is 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 30, 15 to 25, 15 to 20, 20 to 30, or 20 to 25. In a preferred embodiment, the oxidation degree of the activated serotype 22F polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 14, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, 18 to 22, or 18 to 20.

[0166] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 25 kDa to 1,000 kDa, 100 kDa to 1,000 kDa, 300 kDa to 800 kDa, 300 kDa to 700 kDa, 300 kDa to 600 kDa, 400 kDa to 1,000 kDa, 400 kDa to 800 kDa, 400 kDa to 700 kDa, or 400 kDa to 600 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 300 kDa to 800 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa. In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and an oxidation degree of 10 to 25, 10 to 20, 12 to 20, or 14 to 18. In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and an oxidation degree of 10 to 20.

[0167] In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7 or about 0.8 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the activated serotype 22F polysaccharide comprises at least 0.7 mM acetate per mM serotype 22F polysaccharide.

[0168] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of between 400 kDa and 800 kDa and contains at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0169] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of between 400 kDa and 800 kDa, a degree of oxidation of between 12 and 20, and contains at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0170] The activated polysaccharide and / or carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization).

[0171] In one embodiment, the activated serotype 22F polysaccharide is optionally freeze-dried in the presence of sugar.In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.In a preferred embodiment, the sugar is sucrose.In one embodiment, the freeze-dried activated polysaccharide is then mixed with a solution containing carrier protein.

[0172] In another embodiment, the activated polysaccharide and carrier protein are freeze-dried simultaneously.In such an embodiment, the activated serotype 22F polysaccharide is mixed with carrier protein and freeze-dried in the presence of sugar, if desired.In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.In a preferred embodiment, the sugar is sucrose.The polysaccharide and carrier protein that are freeze-dried simultaneously can then be resuspended in a solution and reacted with a reducing agent.

[0173] The second step in the conjugation process is the reduction of the activated polysaccharide and carrier protein with a reducing agent (reductive amination) to form the conjugate.

[0174] The activated serotype 22F polysaccharide is (c) mixing the activated serotype 22 F polysaccharide with a carrier protein; and (d) reacting the mixed activated serotype 22F polysaccharide and carrier protein with a reducing agent to form a serotype 22F polysaccharide-carrier protein conjugate. The protein can be conjugated to a carrier protein by a process including:

[0175] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent.In one embodiment, the reduction reaction is carried out in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent.DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0176] Conjugation of the activated serotype 22F polysaccharide to a protein carrier by reductive amination in dimethylsulfoxide (DMSO) is suitable for preserving the O-acetyl content of the polysaccharide, as compared to, for example, reductive amination in an aqueous phase, which may significantly reduce the level of O-acetylation of the polysaccharide. Thus, in a preferred embodiment, steps (c) and (d) are carried out in DMSO.

[0177] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, borohydride in the presence of a Bronsted or Lewis acid. Sodium or zinc borohydride, pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe i PrN-BH 3 , benzylamine-BH 3 or an amine borane such as 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0178] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH 4 ).

[0179] After conjugation of serotype 22F polysaccharide to a carrier protein, the glycoconjugate can be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by various techniques known to those skilled in the art, including dialysis, concentration / diafiltration operations, tangential flow filtration sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0180] In some embodiments, the serotype 22F glycoconjugates of the invention comprise saccharides having a molecular weight between 10 kDa and 2,000 kDa. In other such embodiments, the saccharides have a molecular weight between 50 kDa and 1,000 kDa. In other such embodiments, the saccharides have a molecular weight between 70 kDa and 900 kDa. In other such embodiments, the saccharides have a molecular weight between 100 kDa and 800 kDa. In other such embodiments, the saccharides have a molecular weight between 200 kDa and 600 kDa. In further such embodiments, the saccharides are from 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 50kDa~800kDa;150kDa~700kDa;150kDa~600kDa;150kDa~500kDa;150kDa~400kDa;150kDa~300kDa;2 00kDa~1,000kDa;200kDa~900kDa;200kDa~800kDa;200kDa~700kDa;200kDa~600kDa;200kDa~500kDa ;200kDa~400kDa;200kDa~300kDa;250kDa~1,000kDa;250kDa~900kDa;250kDa~800kDa;250kDa~700k Da;250kDa~600kDa;250kDa~500kDa;250kDa~400kDa;250kDa~350kDa;300kDa~1000kDa;300kDa~900 kDa; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, serotype 22F glycoconjugates are prepared using reductive amination.

[0181] In some embodiments, the serotype 22F glycoconjugates of the present invention have a molecular weight of 400 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; or 3,000 kDa to 5,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa. In yet other embodiments, the serotype 22F glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa. In a further embodiment, the serotype 22F glycoconjugate of the invention is from 200 kDa to 20,000 kDa; from 200 kDa to 15,000 kDa; from 200 kDa to 10,000 kDa; from 200 kDa to 7,500 kDa; from 200 kDa to 5,000 kDa; from 200 kDa to 3,000 kDa; from 200 kDa to 1,000 kDa; from 500 kDa to 20,000 kDa; from 500 kDa to 15,000 kDa; from 500 kDa to 12,500 kDa; ~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000k Da;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;7 50kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1, 500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,00 having a molecular weight of 0 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0182] In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa.

[0183] In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0184] The molecular weight of the glycoconjugates is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0185] In a preferred embodiment, the serotype 22F glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7 or about 0.8 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.6 mM acetate per mM serotype 22F polysaccharide. In a preferred embodiment, the glycoconjugate comprises at least 0.7 mM acetate per mM serotype 22F polysaccharide.

[0186] In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.9.

[0187] In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.9.

[0188] Another method for characterizing the serotype 22F glycoconjugates of the invention is to characterize the extent of lysines conjugated (degree of conjugation) by determining the carrier protein (e.g., CRMP) that is conjugated to the saccharide. 197Evidence of lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those of skill in the art. Conjugation can be achieved by the number of lysine residues in the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material. In a preferred embodiment, the conjugation degree of the serotype 22F glycoconjugate of the present invention is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15 or 10-12. In one embodiment, the conjugation degree of the serotype 22F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14 or about 15. In a preferred embodiment, the conjugation degree of the serotype 22F glycoconjugate of the present invention is 4-7. In some such embodiments, the carrier protein is a CRM 197 It is.

[0189] Serotype 22F glycoconjugates of the invention may also be characterized by the ratio of saccharide to carrier protein (w / w). In some embodiments, the ratio of serotype 22F polysaccharide to carrier protein (w / w) in the glycoconjugate is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the saccharide to carrier protein ratio (w / w) is 0.5-2.0, 0.5-1.5, 0.8-1.2, 0.5-1.0, 1.0-1.5 or 1.0-2.0. In further embodiments, the saccharide to carrier protein ratio (w / w) is 0.8-1.2. In preferred embodiments, the ratio of serotype 22F capsular polysaccharide to carrier protein in the conjugate is 0.9-1.1. In some such embodiments, the carrier protein is Protein is CRM 197 It is.

[0190] Serotype 22F glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides may be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0191] In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 40% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 25% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 20% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In a preferred embodiment, the serotype 22F glycoconjugate comprises less than about 15% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide.

[0192] Serotype 22F glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from small pores in the media elute more quickly than small molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically by sugar assay. K d For the determination of V, the column is calibrated to determine the fraction where the molecule is completely excluded (V 0 ), (K d = 0), the fraction representing maximum retention (V i ), (K d = 1). The fraction at which a particular sample attribute is reached (V e ) is K d =(V e -V 0 ) / (V i -V 0 ) by the formula d and related.

[0193] In a preferred embodiment, at least 30% of the serotype 22F glycoconjugates have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 22F glycoconjugates have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 22F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 22F glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 22F glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d has.

[0194] 1.3.3 Glycoconjugates derived from S. pneumoniae serotype 33F In one embodiment, serotype 33F glycoconjugates are obtained by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is coupled to amino groups on a carrier protein directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (which may be produced by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via the carboxyl group on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348, and WO96 / 129094.

[0195] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0196] In certain embodiments, the serotype 33F glycoconjugates of the present invention are prepared using reductive amination. In such embodiments, the serotype 33F glycoconjugates of the present invention can be prepared using reductive amination in aqueous phase (RAC / aqueous). Reductive amination in aqueous phase has been successfully applied to produce pneumococcal conjugate vaccines (see, for example, WO2006 / 110381). However, preferably, when reductive amination is used, the serotype 33F glycoconjugates are prepared by reductive amination in DMSO (RAC / DMSO). Considering the challenges associated with retaining O-acetyl functionality using the RAC / aqueous process, reductive amination in DMSO is preferred. RAC / DMSO has been successfully applied to produce pneumococcal conjugate vaccines (see, for example, WO2006 / 110381).

[0197] In a preferred embodiment, the serotype 33F glycoconjugates of the invention are prepared using eTEC conjugation (hereinafter "serotype 33F eTEC-linked glycoconjugates") as described in Examples 1, 2 and 3 and WO2014 / 027302. The 33F glycoconjugates comprise saccharides covalently conjugated to a carrier protein via one or more eTEC spacers, where the saccharides are covalently conjugated to the eTEC spacer via a carbamate bond and the carrier protein is covalently conjugated to the eTEC spacer via an amide bond. The eTEC-linked glycoconjugates of the invention are represented by the general formula (III):

[0198] [ka] (wherein the atoms that make up the eTEC spacer are contained in the central box).

[0199] The eTEC spacer is a linear chain of seven atoms (i.e., -C(O)NH(CH 2 )2 SCH 2 C(O)-), providing stable thioether and amide bonds between the saccharide and the carrier protein. Synthesis of eTEC-linked glycoconjugates involves reaction of an activated hydroxyl group of a saccharide with an amino group of a thioalkylamine reagent, such as cystamine or cysteine ​​amine or a salt thereof, to form a carbamate bond with the saccharide, resulting in a thiolated saccharide. Generation of one or more free sulfhydryl groups is achieved by reaction with a reducing agent to obtain an activated thiolated saccharide. Reaction of the free sulfhydryl group of the activated thiolated saccharide with an activated carrier protein bearing one or more α-haloacetamide groups on an amine-containing residue generates a thioether bond to form a conjugate, in which the carrier protein is linked to the eTEC spacer by an amide bond.

[0200] In the serotype 33F glycoconjugates of the present invention, the saccharide may be a polysaccharide or an oligosaccharide. The carrier protein may be selected from any suitable carrier described herein or known to those of skill in the art. In common embodiments, the saccharide is a polysaccharide. In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the eTEC-bound glycoconjugate comprises S. pneumoniae serotype 33F capsular polysaccharide.

[0201] In a particularly preferred embodiment, the eTEC-linked glycoconjugate is linked to a CRM via an eTEC spacer. 197 (serotype 33F eTEC-bound glycoconjugate).

[0202] In some embodiments, serotype 33F glycoconjugates of the invention comprise saccharides having a molecular weight between 10 kDa and 2,000 kDa. In other such embodiments, the saccharides have a molecular weight between 50 kDa and 2,000 kDa. In further such embodiments, the saccharides have a molecular weight between 50 kDa and 1,750 kDa; 50 kDa and 1,500 kDa; 50 kDa and 1,250 kDa; 50 kDa and 1,000 kDa; 50 kDa and 750 kDa; 50 kDa and 500 kDa; 100 kDa and 2,000 kDa; 100 kDa and 1,750 kDa; 100 kDa and 1,500 kDa; 100 kDa and 1,25 or 200 kDa to 500 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0203] In some embodiments, the serotype 33F glycoconjugate of the present invention is 50 In another embodiment, the serotype 33F glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa. In another embodiment, the serotype 33F glycoconjugate has a molecular weight of 200 kDa to 10,000 kDa. In yet another embodiment, the serotype 33F glycoconjugate has a molecular weight of 1,000 kDa to 3,000 kDa.

[0204] In a further embodiment, the serotype 33F glycoconjugates of the invention are from 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,00 0kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa a~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa a;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000 kDa;1,000kDa~5,000kDa;1,000kDa~4,000kDa;1,000kDa~2,500kDa;2,000kDa~15,000kDa;2,000kDa~12,500kDa;2,000kDa~10,000kDa;2,000kDa~ 3,00 0kDa~12,500kDa;3,000kDa~10,000kDa;3,000kDa~9,000kDa;3,000kDa~8,000kDa;3,000kDa~7,000kDa;3,000kDa~6,000kDa;3,000kDa~5,000kDa;or has a molecular weight of 3,000 kDa to 4,000 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0205] Another method for characterizing the serotype 33F glycoconjugates of the invention is to characterize the extent of lysines conjugated (degree of conjugation) by determining the carrier protein (e.g., CRMP) that is conjugated to the saccharide. 197 ) is due to the number of lysine residues in the

[0206] In a preferred embodiment, the conjugation degree of the serotype 33F glycoconjugate of the present invention is 2 to 20, 4 to 16, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15 or 10 to 12. In one embodiment, the conjugation degree of the serotype 33F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20. In preferred embodiments, the degree of conjugation of the serotype 33F glycoconjugates of the invention is between 4 and 16. In some such embodiments, the carrier protein is a CRM 197 It is.

[0207] In a preferred embodiment, the carrier protein comprises a CRM containing 39 lysine residues. 197 In some such embodiments, the CRM 197 may contain between 4 and 16 of the 39 lysine residues covalently linked to saccharides. Another way to express this parameter is between about 10% and about 41% of the CRM 197 In another such embodiment, the CRM 197may contain 2 to 20 of the 39 lysine residues covalently linked to saccharides. Another way to express this parameter is about 5% to about 50% of the CRM 197 In some embodiments, the CRM 197 may comprise about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, or about 16 of the 39 lysine residues covalently linked to saccharides.

[0208] In frequent embodiments, the carrier protein is covalently conjugated to the eTEC spacer via an amide bond to one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein comprises 2-20 lysine residues covalently conjugated to saccharides. In other such embodiments, the carrier protein comprises 4-16 lysine residues covalently conjugated to saccharides.

[0209] Serotype 33F glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the saccharide to carrier protein ratio (w / w) is between 1.0 and 2.5. In further embodiments, the saccharide to carrier protein ratio (w / w) is between 0.4 and 1.7. In some such embodiments, the carrier protein is a CRM. 197 It is.

[0210] The frequency of attachment of saccharide chains to lysines on the carrier protein is another parameter for characterizing the serotype 33F glycoconjugates of the invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 4 saccharide repeat units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every 10 saccharide repeat units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every 15 saccharide repeat units of the polysaccharide. In a further embodiment, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every 25 saccharide repeat units of the polysaccharide.

[0211] In a common embodiment, the carrier protein is a CRM 197 And CRM 197 The covalent bond between the eTEC spacer and the polysaccharide occurs at least once every 4, 10, 15 or 25 saccharide repeat units of the polysaccharide.

[0212] In other embodiments, the conjugates may be arranged to have a repeating saccharide structure, such as every 5-10 saccharide repeat units; every 2-7 saccharide repeat units; every 3-8 saccharide repeat units; every 4-9 saccharide repeat units; every 6-11 saccharide repeat units; every 7-12 saccharide repeat units; every 8-13 saccharide repeat units; every 9-14 saccharide repeat units; every 10-15 saccharide repeat units; every 2-6 saccharide repeat units; every 3-7 saccharide repeat units; every 4-8 saccharide repeat units; every 6-10 saccharide repeat units; every 7-11 saccharide repeat units; every 8-12 saccharide repeat units; every 9-13 saccharide repeat units; every 10-14 saccharide repeat units; every 10-20 saccharide repeat units. At least one covalent bond between the carrier protein and the saccharide is present for every saccharide repeating unit; every 4-25 saccharide repeating units, or every 2-25 saccharide repeating units. In a common embodiment, the carrier protein is a CRM. 197 It is.

[0213] In another embodiment, at least one bond between the carrier protein and the saccharide is present every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units of the polysaccharide. 197 Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0214] An important consideration during conjugation is the development of conditions that allow for the retention of potentially sensitive non-saccharide-substituted functional groups of the individual components, such as O-acyl, phosphate or glycerol phosphate side chains that may form part of the saccharide epitope.

[0215] In one embodiment, serotype 33F glycoconjugates of the invention comprise saccharides having a degree of O-acetylation between 10% and 100%. In some such embodiments, the saccharides have a degree of O-acetylation between 50% and 100%.

[0216] In other such embodiments, the saccharides have a degree of O-acetylation of between 75% and 100%. In further embodiments, the saccharides have a degree of O-acetylation greater than or equal to 70% (70% or greater).

[0217] In a preferred embodiment, the serotype 33F glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugates comprise at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugates comprise at least 0.6 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the glycoconjugates comprise at least 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0218] In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.9.

[0219] In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0. The ratio of tate to mM is at least 0.9.

[0220] Serotype 33F glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with the glycoconjugate (i.e., non-covalently bound, adsorbed, or entrapped within or with it).

[0221] In some embodiments, the serotype 33F glycoconjugates of the present invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides. Preferably, the serotype 33F glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, even more preferably less than 5% free saccharides. In a preferred embodiment, the serotype 33F glycoconjugates comprise less than about 25% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides. In a preferred embodiment, the serotype 33F glycoconjugates comprise less than about 20% free serotype 33F polysaccharides relative to the total amount of serotype 33F polysaccharides. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide.

[0222] In certain preferred embodiments, the present invention provides serotype 33F glycoconjugates having one or more of the following characteristics, alone or in combination: the polysaccharide has a molecular weight of between 50 kDa and 2,000 kDa; the glycoconjugate has a molecular weight of between 500 kDa and 10,000 kDa; the carrier protein comprises 2 to 20 lysine residues covalently linked to the saccharide; the saccharide to carrier protein ratio (w / w) is between 0.2 and 4.0; the glycoconjugate comprises at least one covalent bond between the carrier protein and the polysaccharide for every 4, 10, 15 or 25 saccharide repeat units of the polysaccharide; the saccharide has a degree of O-acetylation between 75% and 100%; the conjugate comprises less than about 15% free polysaccharide relative to the total polysaccharide; the carrier protein is a CRM 197 It is.

[0223] Serotype 33F glycoconjugates were analyzed based on their molecular size distribution (K d) can also be used to determine the relative molecular size distribution of the conjugates, as described above. In one embodiment, at least 15% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In one embodiment, at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80% or 90% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0224] In a preferred embodiment, at least 35% of the serotype 33F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 33F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 33F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0225] In a preferred embodiment, 40% to 90% of serotype 33F glycoconjugates have a K lower than or equal to 0.3 in the CL-4B column. d Preferred In an embodiment, 50% to 90% of the serotype 33F glycoconjugates have a K value less than or equal to 0.3 in the CL-4B column. dIn a preferred embodiment, 65% to 80% of serotype 33F glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d has.

[0226] 1.3.4 Glycoconjugates derived from S. pneumoniae serotype 15B In one embodiment, serotype 15B glycoconjugates are obtained by activating polysaccharides with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form cyanate esters. The activated polysaccharides can be coupled to amino groups on carrier proteins directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain thiolated polysaccharides, which can be coupled to carriers via thioether bonds obtained after reaction with maleimide-activated carrier proteins (e.g., with GMBS) or haloacetylated carrier proteins (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be produced by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.

[0227] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0228] In a preferred embodiment, the serotype 15B glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0229] Preferably, prior to oxidation, sizing of the serotype 15B polysaccharide to a target molecular weight (MW) range is performed. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining important features of the polysaccharide structure, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization (see section 1.2.6 above).

[0230] The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO 4 - ) and orthoperiodate (IO6 5- Periodate salts, such as sodium periodate and potassium periodate, are also included. In an embodiment, the periodate used to oxidize the serotype 15B capsular polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize the serotype 15B capsular polysaccharide is sodium metaperiodate.

[0231] In a preferred embodiment, the polysaccharide is reacted with 0.01-10.0, 0.05-5.0, 0.1-1.0, 0.5-1.0, 0.7-0.8, 0.05-0.5, or 0.1-0.3 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.15 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.25 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.5 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.6 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.7 molar equivalents of the oxidizing agent.

[0232] In a preferred embodiment, the duration of the reaction is from 1 hour to 50 hours, from 10 hours to 30 hours, from 15 hours to 20 hours, from 15 hours to 17 hours or about 16 hours.

[0233] In a preferred embodiment, the reaction temperature is maintained at 15° C. to 45° C., 15° C. to 30° C., or 20° C. to 25° C. In a preferred embodiment, the reaction temperature is maintained at about 23° C.

[0234] In a preferred embodiment, the oxidation reaction is carried out in a buffer selected from sodium phosphate, potassium phosphate, 2-(N-morpholino)ethanesulfonic acid (MES) or Bis-Tris, hi a preferred embodiment, the buffer is potassium phosphate.

[0235] In a preferred embodiment, the buffer has a concentration of 1 mM to 500 mM, 1 mM to 300 mM, or 50 mM to 200 mM. In a preferred embodiment, the buffer has a concentration of about 100 mM.

[0236] In a preferred embodiment, the oxidation reaction is carried out at a pH of 4.0 to 8.0, 5.0 to 7.0, or 5.5 to 6.5 In a preferred embodiment, the pH is about 6.0.

[0237] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is obtained by reacting 0.5 mg / mL to 5 mg / mL of isolated serotype 15B capsular polysaccharide with 0.2 to 0.3 molar equivalents of periodate at a temperature between 20° C. and 25° C.

[0238] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is purified. The activated serotype 15B capsular polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis or ultrafiltration / diafiltration. For example, the activated capsular polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.

[0239] In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2-20, 2-15, 2-10, 2-5, 5-20, 5-15, 5-10, 10-20, 10-15, or 15-20. In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2-10, 4-8, 4-6, 6-8, 6-12, 8-12, 9-11, 10-16, 12-16, 14-18, 16-20, 16-18, or 18-20.

[0240] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, or 100 kDa to 350 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa.

[0241] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0242] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM glycerol per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6 or 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide. In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0243] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 250 kDa and contains at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0244] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 250 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0245] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0246] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 250 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0247] In one embodiment, the activated serotype 15B capsular polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit. In a preferred embodiment, the sugar is sucrose. The lyophilized activated capsular polysaccharide is then mixed with a carrier protein. It can be mixed with the solution.

[0248] In another embodiment, the activated serotype 15B capsular polysaccharide is mixed with a carrier protein and, optionally, lyophilized in the presence of a saccharide. In a preferred embodiment, the saccharide is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit. In a preferred embodiment, the saccharide is sucrose. The simultaneously lyophilized polysaccharide and carrier protein can then be resuspended in a solution and reacted with a reducing agent.

[0249] Activated serotype 15B capsular polysaccharide is (a) mixing activated serotype 15B capsular polysaccharide with a carrier protein; and (b) the mixed activated serotype 15B capsular polysaccharide and carrier protein can be conjugated to a carrier protein by a process comprising the step of reacting the mixed activated serotype 15B capsular polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide-carrier protein conjugate.

[0250] Conjugation of the activated serotype 15B capsular polysaccharide to a protein carrier by reductive amination in dimethylsulfoxide (DMSO) is suitable for preserving the O-acetyl content of the polysaccharide, as compared to, for example, reductive amination in aqueous solution, where the level of O-acetylation of the polysaccharide is significantly lower. In a preferred embodiment, steps (a) and (b) are carried out in DMSO.

[0251] In a preferred embodiment, step (a) comprises dissolving lyophilized serotype 15B capsular polysaccharide in a solution comprising a carrier protein and DMSO. In a preferred embodiment, step (a) comprises dissolving co-lyophilized serotype 15B capsular polysaccharide and carrier protein in DMSO.

[0252] When steps (a) and (b) are carried out in an aqueous solution, steps (a) and (b) are preferably carried out in a buffer selected from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, bicine or HEPB at a pH of 6.0 to 8.5, 7.0 to 8.0 or 7.0 to 7.5. In a preferred embodiment, the buffer is PBS. In a preferred embodiment, the pH is about 7.3. In a preferred embodiment, the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1 mg / mL to 10 mg / mL, 0.5 mg / mL to 5 mg / mL, or 0.5 mg / mL to 2 mg / mL. In a preferred embodiment, the concentration of activated serotype 15B capsular polysaccharide in step (b) is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 mg / mL.

[0253] In preferred embodiments, the initial input ratio (wt / wt) of activated serotype 15B capsular polysaccharide to carrier protein is 5:1 to 0.1:1, 2:1 to 0.1:1, 2:1 to 1:1, 1.5:1 to 1:1, 0.1:1 to 1:1, 0.3:1 to 1:1, or 0.6:1 to 1:1.

[0254] In a preferred embodiment, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.6:1 to 1:1. In another preferred embodiment, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.6:1 to 1.5:1. Such an initial input ratio allows for low levels of free glycoconjugates. It is particularly suitable for obtaining polysaccharides.

[0255] In preferred embodiments, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1.

[0256] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of Bronsted or Lewis acid, pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-BH3 or an amine borane such as 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride. In a preferred embodiment, the reducing agent is sodium 2-picoline borane.

[0257] In a preferred embodiment, the amount of reducing agent used in step (b) is about 0.1 to 10.0 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 2.0 molar equivalents. In a preferred embodiment, the amount of reducing agent used in step (b) is about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 molar equivalents.

[0258] In a preferred embodiment, the duration of step (b) is from 1 hour to 60 hours, from 10 hours to 50 hours, from 40 hours to 50 hours, or from 42 hours to 46 hours. In a preferred embodiment, the duration of step (b) is about 44 hours.

[0259] In a preferred embodiment, the reaction temperature in step (b) is maintained at 10° C. to 40° C., 15° C. to 30° C., or 20° C. to 26° C. In a preferred embodiment, the reaction temperature in step (b) is maintained at about 23° C.

[0260] In a preferred embodiment, the process for the preparation of glycoconjugates comprising Streptococcus pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein comprises the step of: 4 The method further comprises the step of capping (quenching) any unreacted aldehyde by the addition of (step (c)).

[0261] In a preferred embodiment, NaBH used in step (c) 4 The amount of NaBH used in step (c) is 0.1 to 10 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 3.0 molar equivalents. In a preferred embodiment, the amount of NaBH used in step (c) is 0.1 to 10 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 3.0 molar equivalents. 4 is about 2 molar equivalents.

[0262] In a preferred embodiment, the duration of step (c) is from 0.1 hours to 10 hours, from 0.5 hours to 5 hours, or from 2 hours to 4 hours. In a preferred embodiment, the duration of step (c) is about 3 hours.

[0263] In a preferred embodiment, the reaction temperature in step (c) is maintained at 15° C. to 45° C., 15° C. to 30° C., or 20° C. to 26° C. In a preferred embodiment, the reaction temperature in step (c) is maintained at about 23° C.

[0264] In preferred embodiments, the yield of the conjugation step is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%. In an embodiment, the yield of the conjugation step (step b) is greater than 60%. In a preferred embodiment, the yield of the conjugation step (step b) is greater than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate x 100 / the amount of activated polysaccharide used in the conjugation step.

[0265] In a preferred embodiment, the process for the preparation of a glycoconjugate comprising S. pneumoniae serotype 15B capsular polysaccharide covalently linked to a carrier protein comprises: (a) sizing the purified serotype 15B polysaccharide by high pressure homogenization; (b) reacting the sized serotype 15B polysaccharide with an oxidizing agent; (c) mixing the activated serotype 15B polysaccharide with a carrier protein; (d) reacting the mixed activated serotype 15B polysaccharide and carrier protein with a reducing agent to form a serotype 15B polysaccharide-carrier protein conjugate; and (e) NaBH 4 Capping (quenching) any unreacted aldehyde by the addition of Includes.

[0266] In a preferred embodiment, the yield of the conjugation step (step d) of the above process is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90%. In a preferred embodiment, the yield of the conjugation step (step d) is greater than 60%. In a preferred embodiment, the yield of the conjugation step (step d) is greater than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate x 100 / the amount of activated polysaccharide used in the conjugation step.

[0267] After conjugation of serotype 15B capsular polysaccharide to a carrier protein, the polysaccharide-protein conjugate can be purified (enriched in terms of the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art, including dialysis, concentration / diafiltration operations, tangential flow filtration, sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0268] In one embodiment, the carrier protein is as defined in Section 1.1. In one embodiment, the carrier protein is DT (diphtheria toxin), TT (tetanus toxin), CRM 197 , other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof. In one embodiment, the carrier protein is CRM 197 It is.

[0269] In some embodiments, the serotype 15B glycoconjugates of the invention are coupled to a carrier protein (e.g., CRM 197 In other such embodiments, the saccharide has a molecular weight of 10 kDa to 1,500 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 250 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,00 0 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 100 kDa to 250 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In some embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 1,000 kDa to 20,000 kDa. In preferred embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 3,000 kDa to 20,000 kDa, 5,000 kDa to 10,000 kDa, 5,000 kDa to 20,000 kDa, 8,000 kDa to 20,000 kDa, 8,000 kDa to 16,000 kDa, or 10,000 kDa to 16,000 kDa.

[0270] In further embodiments, the serotype 15B glycoconjugates of the present invention are of about 1,000 kDa, about 1,500 kDa, about 2,000 kDa, about 2,500 kDa, about 3,000 kDa, about 3,500 kDa, about 4,000 kDa, about 4,500 kDa, about 5,000 kDa, about 5,500 kDa, about 6,000 kDa, about 6,500 kDa, about 7,000 kDa, about 7,500 kDa, about 8,000 kDa, about 8,500 kDa, about 9,000 kDa, about 9,500 kDa, about 10,0 ... The polypeptide has a molecular weight of about 0,500 kDa, about 11,000 kDa, about 11,500 kDa, about 12,000 kDa, about 12,500 kDa, about 13,000 kDa, about 13,500 kDa, about 14,000 kDa, about 14,500 kDa, about 15,000 kDa, about 15,500 kDa, about 16,000 kDa, about 16,500 kDa, about 17,000 kDa, about 17,500 kDa, about 18,000 kDa, about 18,500 kDa, about 19,000 kDa, about 19,500 kDa, or about 20,000 kDa.

[0271] In further embodiments, the serotype 15B glycoconjugates of the invention are from 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,000 kDa. having a molecular weight of Da to 20,000 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0272] In further embodiments, the serotype 15B glycoconjugates of the invention are from 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 3,000 kDa to 4,000 kDa. Da; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0273] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In one embodiment, the serotype 15B glycoconjugate is prepared using reductive amination. .

[0274] The serotype 15B glycoconjugates of the invention can also be characterized by the ratio of saccharide to carrier protein (wt / wt). In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein (wt / wt) in the conjugate is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.4 to 2. In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, 1.0 to 2.0. In a preferred embodiment, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.7 to 0.9.

[0275] Serotype 15B glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0276] In a preferred embodiment, the serotype 15B glycoconjugates of the present invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20% or 15% free serotype 15B capsular polysaccharides relative to the total amount of serotype 15B capsular polysaccharides. In a preferred embodiment, the serotype 15B glycoconjugates of the present invention comprise less than about 25% free serotype 15B capsular polysaccharides relative to the total amount of serotype 15B capsular polysaccharides. In a preferred embodiment, the serotype 15B glycoconjugates of the present invention comprise less than about 20% free serotype 15B capsular polysaccharides relative to the total amount of serotype 15B capsular polysaccharides. In a preferred embodiment, the serotype 15B glycoconjugates of the present invention comprise less than about 15% free serotype 15B capsular polysaccharides relative to the total amount of serotype 15B capsular polysaccharides.

[0277] Serotype 15B glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 20% of the serotype 15B glycoconjugates of the invention have a Kd of less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 30% of the immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 40% of the serotype 15B glycoconjugates of the invention have a Kd of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 15 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 15B glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 70% of the serotype 15B glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0278] In a preferred embodiment, 40% to 90% of serotype 15B glycoconjugates have a K lower than or equal to 0.3 in the CL-4B column. d Preferred In an embodiment, 50% to 90% of the serotype 15B glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 15B glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d has.

[0279] In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugates comprise at least 0.5, 0.6 or 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugates comprise at least 0.6 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the glycoconjugates comprise at least 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0280] In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0281] In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0282] In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.5, 0.6 or 0.7 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.6 mM glycerol per mM serotype 15B capsular polysaccharide. In a preferred embodiment, the serotype 15B glycoconjugates of the invention comprise at least 0.7 mM glycerol per mM serotype 15B capsular polysaccharide.

[0283] Another method for characterizing the serotype 15B glycoconjugates of the present invention is to The extent of the gated lysine (degree of conjugation) can be characterized as the extent of the carrier protein (e.g., CRMP) conjugated to the saccharide. 197 Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation can be achieved by the number of lysine residues in the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material.

[0284] In a preferred embodiment, the conjugation degree of the serotype 15B glycoconjugate of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the conjugation degree of the serotype 15B glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the conjugation degree of the serotype 15B glycoconjugate of the present invention is 2 to 5.

[0285] 1.3.5 Glycoconjugates derived from S. pneumoniae serotype 12F In the glycoconjugates derived from S. pneumoniae serotype 12F of the invention, the saccharide is selected from the group consisting of polysaccharides and oligosaccharides and the carrier protein is selected from any suitable carrier described herein or known to one of skill in the art. In some preferred embodiments, the saccharide is a polysaccharide derived from serotype 12F S. pneumoniae.

[0286] In one embodiment, glycoconjugates derived from S. pneumoniae serotype 12F are prepared using CDAP. The polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then attached, either directly or via a spacer (linker) group, to a carrier protein (preferably a carrier protein such as a CRMP). 197For example, the spacer may be cystamine or cysteamine to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (optionally produced by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharide is coupled to a carrier protein (e.g., CRM) using carbodiimide (e.g., EDAC or EDC) chemistry via a carboxyl group on the protein carrier. 197 ) is conjugated to

[0287] Other techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which may be formed by reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, and subsequent reaction with the protein to form a carbamate bond. The reaction may include the reaction of a primary hydroxyl group with CDI to form a carbamate intermediate and coupling the CDI carbamate intermediate with an amino group on a protein.

[0288] In one embodiment, capsular polysaccharide from serotype 12F S. pneumoniae is conjugated to a carrier protein by reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) reduction of the activated saccharide and the carrier protein to form the conjugate.

[0289] Prior to oxidation, the serotype 12 F polysaccharide is optionally hydrolyzed (sized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.

[0290] In one embodiment, the oxidizing agent is periodate. The term "periodate" includes both periodate and periodic acid (see below).

[0291] In a preferred embodiment, the oxidizing agent is 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and N-chlorosuccinimide (NCS) as a co-oxidizing agent. In such an embodiment, glycoconjugates derived from Streptococcus pneumoniae serovar 12F are prepared using 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical as described in Example 7 and WO2014 / 097099, and primary alcohols of sugars are oxidized to aldehydes using N-chlorosuccinimide (NCS) as a co-oxidizing agent (hereinafter referred to as "TEMPO / NCS oxidation"). Thus, in one aspect, glycoconjugates derived from S. pneumoniae serotype 12F can be obtained by a method comprising the steps of: a) reacting 12F saccharides with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce activated saccharides; and b) reacting the activated saccharides with a carrier protein containing one or more amine groups (hereinafter "TEMPO / NCS-reductive amination"). In one aspect, glycoconjugates derived from S. pneumoniae serotype 12F can be obtained by said method. In one embodiment, the oxidation degree of the activated 12F saccharide is 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 3 to 40, 3 to 30, 3 to 20, 3 to 10, 4 to 40, 4 to 30, 4 to 20, 4 to 10, 5 to 30, 5 to 25, 5 to 20, 5 to 10, 6 to 50, 6 to 40, 6 to 30, 6 to 20, 6 to 15, 6 to 14, 6 to 13, 6 to 12, 6-11, 6-10, 7-40, 7-30, 7-20, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 8-40, 8-30, 8-20, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 9-40, 9-30, 9-20, 9-15, 10-40, 10-30, 10-20, or 10-15.In further embodiments, the degree of oxidation of the activated saccharide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. Preferably, the carrier protein is a CRM. 197 It is.

[0292] In one embodiment, prior to step a), the 12F sugars are hydrolyzed to a molecular weight in the range of 100 kDa to 400 kDa. For example, in one aspect, the molecular weight is 100 kDa to 350 kDa, 100 kDa to 300 kDa, 100 kDa to 250 kDa, 100 kDa to 200 kDa, 100 kDa to 150 kDa, 200 kDa to 400 kDa, 200 kDa to 350 kDa, 200 kDa to 300 kDa, 200 kDa to 250 kDa. a, 300 kDa to 400 kDa, or 300 kDa to 350 kDa.

[0293] In a further embodiment, the method further comprises purifying the activated polysaccharide prior to step b). In a further embodiment, the method further comprises adding a reducing agent after step b). In one embodiment, the reducing agent is NaCNBH 3 In a further embodiment, the method comprises the step of: 3 After the addition of NaBH 4 In a further embodiment, the method further comprises adding NaBH 4 The method includes a purification step after the addition of

[0294] In another aspect, the disclosure provides a glycoconjugate derived from S. pneumoniae serotype 12F, produced or obtainable by any of the methods disclosed above. For example, in one aspect, the disclosure provides a glycoconjugate derived from S. pneumoniae serotype 12F comprising a saccharide conjugated to a carrier protein, produced or obtainable by a method comprising: a) reacting the saccharide with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated saccharide; and b) reacting the activated saccharide with a carrier protein comprising one or more amine groups.

[0295] In one embodiment, the glycoconjugates derived from S. pneumoniae serotype 12F of the invention have a molecular weight of about 50 kDa to about 20,000 kDa. In another embodiment, the glycoconjugates derived from S. pneumoniae serotype 12F have a molecular weight of about 200 kDa to about 10,000 kDa. In another embodiment, the glycoconjugates derived from S. pneumoniae serotype 12F have a molecular weight of about 500 kDa to about 5,000 kDa. In one embodiment, the glycoconjugates derived from S. pneumoniae serotype 12F have a molecular weight of about 1,000 kDa to about 3,000 kDa. In other embodiments, the glycoconjugates derived from S. pneumoniae serotype 12F have a molecular weight of about 600 kDa to about 2,800 kDa; about 700 kDa to about 2,700 kDa; about 1,000 kDa to about 2,000 kDa; about 1,800 kDa to about 2,500 kDa; about 1,100 kDa to about 2,200 kDa; about 1,900 kDa to about 2,700 kDa; about 1,200 kDa to about 2,400 kDa; about 1,700 kDa to about 2,600 kDa; about 1,300 kDa to about 2,600 kDa; or about 1,600 kDa to about 3,000 kDa.

[0296] In further embodiments, the serotype 12F glycoconjugates of the invention are from 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,000 kDa Da to 20,000 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0297] Another method for characterizing the serotype 12F glycoconjugates of the invention is to characterize the extent of lysines conjugated (degree of conjugation) by determining the carrier protein (e.g., 197 ) is due to the number of lysine residues in the

[0298] In a preferred embodiment, the conjugation degree of the serotype 12F glycoconjugate of the present invention is 2 to 20, 4 to 16, 4 to 15, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15 or 10 to 12. In one embodiment, the conjugation degree of the serotype 12F glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19 or about 20.

[0299] The number of lysine residues in a carrier protein that are conjugated to a saccharide can also be expressed as a molar ratio. 197 In glycoconjugates in which 4 to 15 lysine residues are covalently linked to the saccharide, the CRM of the conjugated lysine residues in the glycoconjugate is 197 The molar ratio of CRM to is about 10:1 to about 40:1. 197 In an immunogenic composition in which 2 to 20 lysine residues are covalently linked to a saccharide, the CRM of the conjugated lysine in the glycoconjugate is 197 In one embodiment, the molar ratio of conjugated lysine to carrier protein in the S. pneumoniae serotype 12F derived glycoconjugates of the invention is from about 10:1 to about 25:1. In some such embodiments, the carrier protein is CRM 197 In some embodiments, the CRM 197 may contain about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 lysine residues of the 39 covalently linked to saccharides. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0300] In one embodiment, the saccharide to carrier protein ratio (w / w) is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.4, about 1.6, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, about 4.0, about 4.1, about 4.2, about 4 2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In another embodiment, the saccharide to carrier protein ratio (w / w) is 1.1 to 1.7 in a glycoconjugate derived from S. pneumoniae serotype 12F. In other embodiments, the ratio of saccharide to carrier protein (w / w) is between 0.8 and 1.8 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, or about 1.8). In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0301] The frequency of attachment of saccharide chains to lysines on the carrier protein is another parameter for characterizing the serotype 12F glycoconjugates of the present disclosure. For example, in one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 100 saccharide repeating units of the polysaccharide. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 50 saccharide repeating units of the polysaccharide. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 25 saccharide repeat units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 4 saccharide repeat units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 10 saccharide repeat units of the polysaccharide. In a further embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 15 saccharide repeat units of the polysaccharide. In a frequent embodiment, the carrier protein is a CRM. 197 And CRM 197 The covalent bond between and the polysaccharide occurs at least once for every 4, 10, 15 or 25 saccharide repeating units of the polysaccharide.

[0302] In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and a saccharide every 5-10 saccharide repeat units; every 2-7 saccharide repeat units; every 3-8 saccharide repeat units; every 4-9 saccharide repeat units; every 6-11 saccharide repeat units; every 7-12 saccharide repeat units; every 8-13 saccharide repeat units; every 9-14 saccharide repeat units; every 10-15 saccharide repeat units; every 2-6 saccharide repeat units; every 3-7 saccharide repeat units; every 4-8 saccharide repeat units; every 6-10 saccharide repeat units; every 7-11 saccharide repeat units; every 8-12 saccharide repeat units; every 9-13 saccharide repeat units; every 10-14 saccharide repeat units; every 10-20 saccharide repeat units; every 4-25 saccharide repeat units, or every 2-25 saccharide repeat units. In a common embodiment, the carrier protein is a CRM 197 It is.

[0303] In another embodiment, the CRM 197At least one bond between the and the saccharide is present every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units of the polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0304] In one embodiment, the S. pneumoniae serotype 12F derived glycoconjugates of the invention comprise at least one covalent bond between the carrier protein and the polysaccharide for every 25 saccharide repeat units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide is present at least once for every 4 saccharide repeat units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide is present at least once for every 10 saccharide repeat units of the polysaccharide. In a further embodiment, a covalent bond between the carrier protein and the polysaccharide is present at least once for every 15 saccharide repeat units of the polysaccharide. In some such embodiments, the serotype 12F glycoconjugates are conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0305] Serotype 12F glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides may be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0306] In some embodiments, the serotype 12F glycoconjugates of the invention contain less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In one embodiment, the glycoconjugates derived from S. pneumoniae serotype 12F contain less than about 50% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 12F comprises less than about 45% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate comprises less than about 30% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate derived from S. pneumoniae serotype 12F comprises less than about 20% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In a further embodiment, the glycoconjugate comprises less than about 10% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate derived from S. pneumoniae serotype 12F comprises less than about 5% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to a carrier protein by TEMPO / NCS-reductive amination.

[0307] In some embodiments, the serotype 12F glycoconjugates of the invention comprise saccharides having a molecular weight between 10 kDa and 2,000 kDa. In other such embodiments, the saccharides have a molecular weight between 50 kDa and 2,000 kDa. In further such embodiments, the saccharides have a molecular weight between 50 kDa and 1,750 kDa; 50 kDa and 1,500 kDa; 50 kDa and 1,250 kDa; 50 kDa and 1,000 kDa; 50 kDa and 750 kDa; 50 kDa and 500 kDa; 100 kDa and 2,000 kDa; 100 kDa and 1,750 kDa; 100 kDa and 1,500 kDa; 100 kDa and 1,250 kDa; 100 In some such embodiments, the serotype 12F glycoconjugate has a molecular weight of from 200 kDa to 1,000 kDa; from 100 kDa to 750 kDa; from 100 kDa to 500 kDa; from 200 kDa to 2,000 kDa; from 200 kDa to 1,750 kDa; from 200 kDa to 1,500 kDa; from 200 kDa to 1,250 kDa; from 200 kDa to 1,000 kDa; from 200 kDa to 750 kDa; or from 200 kDa to 500 kDa; or from 200 kDa to 400 kDa. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0308] Serotype 12F glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 35% of the serotype 12F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the serotype 12F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 12F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column.d In a preferred embodiment, at least 70% of the serotype 12F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0309] In a preferred embodiment, 40% to 90% of serotype 12F glycoconjugates have a K value less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 50% to 90% of serotype 12F glycoconjugates have a K value less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 12F glycoconjugates have a K value less than or equal to 0.3 in the CL-4B column. d has.

[0310] 1.3.6 Streptococcus pneumoniae serotypes Glycoconjugates derived from 10A In one embodiment, serotype 10A glycoconjugates are obtained by activating polysaccharides with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form cyanate esters. The activated polysaccharides can be coupled to amino groups on carrier proteins directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain thiolated polysaccharides, which can be coupled to carriers via thioether bonds obtained after reaction with maleimide-activated carrier proteins (e.g., with GMBS) or haloacetylated carrier proteins (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be produced by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.

[0311] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0312] In a preferred embodiment, the serotype 10A glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0313] Prior to oxidation, the serotype 10A polysaccharide is optionally hydrolyzed (sized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.

[0314] In one embodiment, the serotype polysaccharide is (a) reacting the isolated serotype 10A polysaccharide with an oxidizing agent; (b) quenching the oxidation reaction by addition of a quenching agent to obtain activated serotype 10A polysaccharide. It is activated (oxidized) by a process that includes

[0315] In a preferred embodiment, the oxidizing agent is periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO 4 - ) and orthoperiodate (IO 6 5- Periodate salts include both periodate and various salts of periodate (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate salt used to oxidize serotype 10A polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize the serotype 10A polysaccharide is sodium metaperiodate.

[0316] In one embodiment, the quenching agent is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfite, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphorous acid.

[0317] In one embodiment, the quenching agent has formula (I):

[0318] [ka] (In the formula, R 1 is selected from H, methyl, ethyl, propyl or isopropyl It is a 1,2-amino alcohol.

[0319] In one embodiment, the quenching agent is selected from sodium and potassium salts of sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites or phosphorous acid.

[0320] In one embodiment, the quenching agent is an amino acid, which in such an embodiment may be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.

[0321] In one embodiment, the quenching agent is a sulfite, such as a bisulfite, dithionite, metabisulfite, or thiosulfate.

[0322] In one embodiment, the quenching agent is a compound that contains two vicinal hydroxyl groups (vicinal diol), ie, two hydroxyl groups covalently linked to two adjacent carbon atoms.

[0323] Preferably, the quenching agent has the formula (II):

[0324] [ka] (In the formula, R 1 and R 2 are each independently selected from H, methyl, ethyl, propyl, or isopropyl. It is a compound of the formula:

[0325] In a preferred embodiment, the quenching agent is glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, ascorbic acid. In a preferred embodiment, the quenching agent is butane-2,3-diol.

[0326] In a preferred embodiment, the isolated serotype 10A polysaccharide is prepared by the steps of: (a) reacting the isolated serotype 10A polysaccharide with periodate; (b) quenching the oxidation reaction by the addition of butane-2,3-diol to obtain activated serotype 10A polysaccharide. The activation occurs through a process including:

[0327] After the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is referred to hereinafter as "activated polysaccharide".

[0328] In a preferred embodiment, the activated serotype 10A polysaccharide is purified. The activated serotype 10A polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis or ultrafiltration / diafiltration. For example, the activated 10A polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.

[0329] In a preferred embodiment, the oxidation degree of the activated serotype 10A polysaccharide is 2-30, 2-25, 2-20, 2-15, 2-10, 2-5, 5-30, 5-25, 5-20, 5-15, 5-10, 10-30, 10-25, 10-20, 10-15, 15-30, 15-25, 15-20, 20-30, or 20-25. In a preferred embodiment, the oxidation degree of the activated serotype 10A polysaccharide is 2-10, 4-8, 4-6, 6-8, 6-12, 8-14, 9-11, 10-16, 12-16, 14-18, 16-20, 16-18, 18-22, or 18-20.

[0330] In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 400 kDa, 50 kDa to 350 kDa, 50 kDa to 300 kDa, 50 kDa to 250 kDa, 50 kDa to 200 kDa, 100 kDa to 300 kDa, 100 kDa to 250 kDa, or 100 kDa to 200 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 300 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and an oxidation degree of 5 to 20, 5 to 15, 8 to 14, 8 to 12, or 9 to 11. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and an oxidation degree of 9 to 11.

[0331] The activated polysaccharide and / or carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization).

[0332] In one embodiment, the activated serotype 10A polysaccharide is optionally freeze-dried in the presence of a sugar.In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.In a preferred embodiment, the sugar is sucrose.In one embodiment, the freeze-dried activated polysaccharide is then mixed with a solution containing a carrier protein.

[0333] In another embodiment, the activated polysaccharide and carrier protein are freeze-dried simultaneously. In such an embodiment, the activated serotype 10A polysaccharide is mixed with the carrier protein and freeze-dried, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit. In a preferred embodiment, the sugar is sucrose. The polysaccharide and carrier protein that have been freeze-dried simultaneously can then be resuspended in a solution and reacted with a reducing agent.

[0334] The second step in the conjugation process is the reduction of the activated polysaccharide and carrier protein with a reducing agent (reductive amination) to form the conjugate.

[0335] The activated serotype 10A polysaccharide is (c) mixing the activated serotype 10A polysaccharide with a carrier protein; and (d) reacting the mixed activated serotype 10A polysaccharide and carrier protein with a reducing agent to form a serotype 10A polysaccharide-carrier protein conjugate. The protein can be conjugated to a carrier protein by a process including:

[0336] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent.In one embodiment, the reduction reaction is carried out in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent.DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0337] In one embodiment, the reducing agent is sodium cyanoborohydride in the presence of a Bronsted or Lewis acid, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride, an amine borane such as pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0338] At the end of the reduction reaction, any remaining unreacted aldehyde groups in the conjugate These can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH 4).

[0339] After conjugation of serotype 10A polysaccharide to a carrier protein, the glycoconjugate can be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art, including dialysis, concentration / diafiltration operations, tangential flow filtration sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0340] In some embodiments, serotype 10A glycoconjugates of the invention comprise saccharides having a molecular weight between 10 kDa and 2,000 kDa. In other such embodiments, the saccharides have a molecular weight between 50 kDa and 2,000 kDa. In further such embodiments, the saccharides have a molecular weight between 50 kDa and 1,750 kDa; 50 kDa and 1,500 kDa; 50 kDa and 1,250 kDa; 50 kDa and 1,000 kDa; 50 kDa and 750 kDa; 50 kDa and 500 kDa; 100 kDa and 2,000 kDa; 100 kDa and 1,750 kDa; 100 kDa and 1,500 kDa; 100 kDa and 1,250 kDa; 100 In some such embodiments, the serotype 10A glycoconjugates have a molecular weight of from 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In some such embodiments, the serotype 10A glycoconjugates are prepared using reductive amination.

[0341] In some embodiments, the serotype 10A glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 500 kDa to 15,000 kDa, 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; or 3,000 kDa to 8,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 1,000 kDa to 10,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa. In yet other embodiments, the serotype 10A glycoconjugate has a molecular weight of between 2,000 kDa and 8,000 kDa or between 3,000 kDa and 7,000 kDa.In further embodiments, the serotype 10A glycoconjugates of the invention are from 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa. Da~20,000kDa;500kDa~15,000kDa;500kDa~12,500kDa;500kDa~10,000kDa;500kDa~7,500k Da;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,00 0kDa;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa ~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;75 0kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa~15,000k Da;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa; having a molecular weight of 1,000kDa to 5,000kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; or 2,000kDa to 3,000kDa.

[0342] In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa or 7,000 kDa to 8,000 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.

[0343] Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. Molecular weights of glycoconjugates are measured by SEC-MALLS.

[0344] Another method for characterizing the serotype 10A glycoconjugates of the invention is to characterize the extent of lysines conjugated (degree of conjugation) by determining the carrier protein (e.g., CRMP) that is conjugated to the saccharide.197 Evidence of lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those of skill in the art. Conjugation can be achieved by the number of lysine residues in the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material.

[0345] In a preferred embodiment, the conjugation degree of the serotype 10A glycoconjugate is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15 or 10-12. In a preferred embodiment, the conjugation degree of the serotype 10A glycoconjugate is 6-8. In a preferred embodiment, the carrier protein is a CRM 197 It is.

[0346] Serotype 10A glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (w / w). In some embodiments, the saccharide to carrier protein ratio (w / w) is between 0.5 and 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5 or 1.0 to 2.0. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is 0.8 to 1.4. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is 0.8 to 1.2 (e.g., about 0.8, about 0.9, about 1.0, about 1.1 or about 1.2). In some such embodiments, the carrier protein is CRM 197 It is.

[0347] Serotype 10A glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0348] In some embodiments, serotype 10A glycoconjugates of the invention comprise less than about 50% free saccharides, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free saccharides relative to the total amount of 10A saccharides. Preferably, the serotype 10A glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.

[0349] Serotype 10A glycoconjugates were analyzed based on their molecular size distribution (K d) can also be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 30% of the serotype 10A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the serotype 10A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 10A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 10A glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 10A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0350] 1.3.7 Glycoconjugates derived from S. pneumoniae serotype 11A In one embodiment, serotype 11A glycoconjugates are obtained by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to amino groups on the carrier protein directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be produced by CDAP chemistry) is coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via a carboxyl group on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.

[0351] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979), Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate to an amino group on the protein.

[0352] In a preferred embodiment, the serotype 11A glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0353] Prior to oxidation, the serotype 11A polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical sizing can be performed using high pressure homogenizing shear.

[0354] The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO 4 - ) and orthoperiodate (IO 6 5-), and various salts of periodate (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide serotype 11A of S. pneumoniae is lyophilized in the presence of metaperiodate, preferably sodium periodate (NaIO 4 In another embodiment, the capsular polysaccharide from serotype 11A is oxidized in the presence of an orthoperiodate, preferably periodic acid.

[0355] After the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide". The activated polysaccharide can be purified and lyophilized (freeze-dried).

[0356] The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are lyophilized simultaneously. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized independently.

[0357] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

[0358] The second step of the conjugation process is the reduction (reductive amination) of the activated polysaccharide and carrier protein with a reducing agent to form the conjugate. Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, borane-pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0359] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent.In one embodiment, the reduction reaction is carried out in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent.DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0360] In one embodiment, 0.1-3.0, 0.15-2.0, 0.2-2.0, or 0.5-1.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In one embodiment, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.

[0361] In one embodiment, the reducing agent is sodium triacetoxyborohydride, and in further embodiments, 1.0 to 6.0 molar equivalents, 2.0 to 5.0 molar equivalents, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.

[0362] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH 4 In one embodiment, capping is accomplished by reacting the reduction reactant with 0.5 to 5.0 molar equivalents of NaBH4, such as about 1, 1.5, 2, 2.5, or 3 molar equivalents of NaBH 4 This is achieved by mixing with

[0363] After conjugation (reduction reaction and optionally capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography.

[0364] In one embodiment, the glycoconjugate is sterile filtered.

[0365] In some embodiments, the serotype 11A glycoconjugates of the invention are coupled to a carrier protein (e.g., CRM 197 In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 400 kDa; 50 kDa to 300 kDa; 50 kDa to 200 kDa; 50 kDa to 100 kDa; 100 kDa to 2, 000kDa;100kDa~1,750kDa;100kDa~1,500kDa;100kDa~1,250kDa;100kDa~1,000kDa;100kDa~750kDa; 100kDa~500kDa;100kDa~400kDa;100kDa~300kDa;100kDa~200kDa;200kDa~2,000kDa;200kDa~1,750kDa a;having a molecular weight of 200kDa to 1,500kDa;200kDa to 1,250kDa;200kDa to 1,000kDa;200kDa to 750kDa;or 200kDa to 500kDa;200kDa to 400kDa or 200kDa to 300kDa.

[0366] In some embodiments, the serotype 11A glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In still other embodiments, the serotype 11A glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.

[0367] In a further embodiment, the serotype 11A glycoconjugates of the invention are selected from the group consisting of: 200 kDa to 20,000 kDa; 200 kDa to 17,500 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 17,500 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,000 kDa; ,500kDa;500kDa~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;5 00kDa~1,500kDa;500kDa~1,000kDa;700kDa~20,000kDa;700kDa~17,500kDa;700kDa~15,000kDa;700kDa~12,500kDa;700kDa~10,000kDa;700kDa~ 7,500kDa;700kDa~6,000kDa;700kDa~5,000kDa;700kDa~4,500kDa;700kDa~4,000kDa;700kDa~3,500kDa;700kDa~3,000kDa;700kDa~2,000kDa;7 00kDa~1,500kDa;1,000kDa~20,000kDa;1,000kDa~17,500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,5 00kDa;1,000kDa~6,000kDa;1,000kDa~5,000kDa;1,000kDa~4,000kDa;1,000kDa~2,500kDa;2,000kDa~20,000kDa;2,000kDa~17,500kDa;2,000kDa Da~15,000kDa;2,000kDa~12,500kDa;2,000kDa~10,000kDa;2,000kDa~7,500kDa;2,000kDa~6,000kDa;2,000kDa~5,000kDa;2,000kDa~4,000kDa;Or has a molecular weight of 2,000 kDa to 3,000 kDa;

[0368] In further embodiments, the serotype 11A glycoconjugates of the invention are from 3,000 kDa to 20,000 kDa; 3,000 kDa to 17,500 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa. In further embodiments, the serotype 11A glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 17,500 kDa; 5,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. a; having a molecular weight of 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa.

[0369] In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.

[0370] In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6 or 5 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate comprises at least 1.8, 2.2 or 2.6 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the glycoconjugate comprises at least 0.6 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugates of the invention comprise at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, 3, 3.4, 3.8, 4.2 or 4.6 mM acetate per mM serotype 11A polysaccharide and less than about 5 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugates of the invention comprise at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6 or 3.0 mM acetate per mM serotype 11A polysaccharide and less than about 3.4 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM acetate per mM serotype 11A polysaccharide and less than about 3.3 mM acetate per mM serotype 11A polysaccharide, any of the above numbers being contemplated as embodiments of the present disclosure.

[0371] In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0372] In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0373] In a preferred embodiment, the serotype 11A glycoconjugate of the invention has at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 120, 1 In a preferred embodiment, the serotype 11A glycoconjugate comprises at least 0.2, 0.3, or 0.4 mM glycerol per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 mM glycerol per mM serotype 11A polysaccharide and less than about 1.0 mM glycerol per mM serotype 11A polysaccharide. In preferred embodiments, the serotype 11A glycoconjugates of the invention comprise at least 0.3, 0.4, 0.5, 0.6, or 0.7 mM glycerol per mM serotype 11A polysaccharide and less than about 0.8 mM glycerol per mM serotype 11A polysaccharide, any of the above numbers being contemplated as embodiments of the present disclosure.

[0374] Another method for characterizing the serotype 11A glycoconjugates of the invention is to characterize the extent of lysines conjugated (degree of conjugation) by determining the carrier protein (e.g., CRMP) that is conjugated to the saccharide. 197 ) is due to the number of lysine residues in the

[0375] Evidence for lysine modifications of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those of skill in the art. Conjugation can be performed using the same or similar RNA as the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material.

[0376] In preferred embodiments, the conjugation degree of the serotype 11A glycoconjugate of the present invention is 1-15, 1-13, 1-10, 1-8, 1-6, 1-5, 1-4, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the conjugation degree of the serotype 11A glycoconjugate of the present invention is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the conjugation degree of the serotype 11A glycoconjugate of the present invention is 1-6 or 2-5. In some such embodiments, the carrier protein is a CRM 197 It is.

[0377] Serotype 11A glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of saccharide to carrier protein (w / w) is 0.7-2.5, 0.8-2.0, 0.7-2.0, 0.8-1.5, 0.7-1.5, 0.7-1.4, 0.8-1.4, 0.7-1.45, or 0.8-1.45. In further embodiments, the ratio of saccharide to carrier protein (w / w) is 0.8-1.6 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, or about 1.6). In some such embodiments, the carrier protein is CRM. 197In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.

[0378] The serotype 11A glycoconjugates and immunogenic compositions of the invention are not covalently conjugated to a carrier protein, but nevertheless, the glycoconjugate compositions The glycoconjugate may contain free saccharides present in the glycoconjugate. The free saccharides may be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0379] In some embodiments, the serotype 11A glycoconjugates of the invention comprise less than about 50% free serotype 11A capsular polysaccharide relative to the total amount of serotype 11A capsular polysaccharide, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free serotype 11A capsular polysaccharide relative to the total amount of serotype 11A capsular polysaccharide. Preferably, the serotype 11A glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.

[0380] Serotype 11A glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 30% of the serotype 11A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the serotype 11A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 60% of the serotype 11A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 65% of the serotype 11A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0381] 1.3.8 Glycoconjugates derived from S. pneumoniae serotype 8 In one embodiment, serotype 8 glycoconjugates are obtained by activating polysaccharides with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form cyanate esters. The activated polysaccharides can be coupled to amino groups on carrier proteins directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain thiolated polysaccharides, which can be coupled to carriers via thioether bonds obtained after reaction with maleimide-activated carrier proteins (e.g., with GMBS) or haloacetylated carrier proteins (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic dihydrazide (ADH), and the amino-derivatized saccharides are conjugated to carrier proteins via carboxyl groups on the protein carriers using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.

[0382] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which is achieved by reaction of the free hydroxyl group of the saccharide with CDI (Bethell et al. (1979), J. Biol. Chern. 254:2572-2574; Hearn et al. (1981), J. Chromatogr. 218:5). 09-518), followed by reaction with a protein to form a carbamate bond, which may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0383] In a preferred embodiment, the serotype 8 glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0384] Prior to oxidation, the serotype 8 polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.

[0385] The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO 4 - ) and orthoperiodate (IO 6 5-), and various salts of periodate (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide serotype 8 of S. pneumoniae is treated with 1,2-dichlorophenyl ether (1,2-dichlorophenyl ether) in the presence of metaperiodate, preferably sodium periodate (NaIO 4 In another embodiment, the capsular polysaccharide from serotype 8 is oxidized in the presence of an orthoperiodate, preferably periodic acid.

[0386] After the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide". The activated polysaccharide can be purified and lyophilized (freeze-dried).

[0387] The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are lyophilized simultaneously. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized independently.

[0388] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

[0389] The second step of the conjugation process is the reduction (reductive amination) of the activated polysaccharide and carrier protein with a reducing agent to form the conjugate. Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, borane-pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0390] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent.In one embodiment, the reduction reaction is carried out in DMSO (dimethylsulfoxide) or DMF (dimethylformamide) solvent.DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0391] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 1.0, or 0.25 to 0.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In one embodiment, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9 or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.

[0392] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In further embodiments, 1.0 to 6.0 molar equivalents, 2.0 to 5.0 molar equivalents, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.

[0393] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH 4 In one embodiment, capping is performed by reacting the reduction reactant with 0.5 to 5.0 molar equivalents of NaBH 4 , for example, about 1.0, 1.5, 2.0, 2.5 or 3.0 molar equivalents of NaBH 4 This is achieved by mixing with

[0394] After conjugation (reduction reaction and optionally capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography.

[0395] In one embodiment, the glycoconjugate is sterile filtered.

[0396] In some embodiments, the serotype 8 glycoconjugates of the invention are coupled to a carrier protein (e.g., CRMP 197 In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 In one embodiment, the serotype 8 glycoconjugate has a molecular weight of from 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.

[0397] In some embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In still other embodiments, the serotype 8 glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.

[0398] In a further embodiment, the serotype 8 glycoconjugate of the invention has a molecular weight of 200 kD a~20,000kDa;200kDa~15,000kDa;200kDa~10,000kDa;200kDa~7,500kDa;200kDa~5,000kDa;200kDa~3,000kDa;200k Da~1,000kDa;500kDa~20,000kDa;500kDa~15,000kDa;500kDa~12,500kDa;500kDa~10,000kDa;500kDa~7,500kDa;500 kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;500kDa~1,500kDa;500kDa ~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa a~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa ~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,000kDa~5,000 kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; or 2,000kDa to 3,000kDa.

[0399] In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa or 7,000 kDa to 8,000 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.

[0400] In one embodiment, the serotype 8 glycoconjugates are prepared using reductive amination.

[0401] Another method for characterizing the serotype 8 glycoconjugates of the invention is to characterize the extent of lysines conjugated (degree of conjugation) by determining the carrier protein (e.g., 197 ) is due to the number of lysine residues in the

[0402] Evidence for lysine modification of a carrier protein resulting from covalent attachment to a polysaccharide is provided to those skilled in the art. can be obtained by amino acid analysis using known routine methods. In frequent embodiments, the carrier protein is covalently conjugated to the activated polysaccharide via an amine linkage to one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein comprises 2-20 lysine residues covalently conjugated to the saccharide. In other such embodiments, the carrier protein comprises 4-16 or 6-14 lysine residues covalently conjugated to the saccharide.

[0403] In preferred embodiments, the conjugation degree of the serotype 8 glycoconjugate of the present invention is 2-20, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the conjugation degree of the serotype 8 glycoconjugate of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the conjugation degree of the serotype 8 glycoconjugate of the present invention is 4-16 or 6-14. In some such embodiments, the carrier protein is a CRM 197 It is.

[0404] In a preferred embodiment, the carrier protein is a CRM containing 39 lysine residues. 197 In some such embodiments, the CRM 197 may contain 4 to 16 or 6 to 14 lysine residues of the 39 covalently linked to saccharides. Another way of expressing this parameter is about 10% to about 41% or about 15% to about 36% of the CRMs. 197 In another such embodiment, the CRM197 may contain 2 to 20 of the 39 lysine residues covalently linked to saccharides. Another way of expressing this parameter is from about 5% to about 50% of the CRM 197 In some such embodiments, the CRM is a lysine covalently linked to a saccharide. 197 may comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 lysine residues of the 39 covalently linked to saccharides.

[0405] Serotype 8 glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of saccharide to carrier protein (w / w) is 0.7 to 2.5. In further embodiments, the ratio of saccharide to carrier protein (w / w) is 0.8 to 1.5 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, or about 1.5). In some such embodiments, the carrier protein is CRM. 197 In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.

[0406] The serotype 8 glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0407] In some embodiments, serotype 8 glycoconjugates of the invention comprise less than about 50% free saccharides, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free saccharides relative to the total amount of serotype 8 saccharides. Preferably, the serotype 8 glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.

[0408] Serotype 8 glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from small pores in the media elute more quickly than small molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically by sugar assay. K d For the determination of V, the column is calibrated to determine the fraction where the molecule is completely excluded (V 0 ), (K d = 0), the fraction representing maximum retention (V i ), (K d = 1). The fraction at which a particular sample attribute is reached (V e ) is K d =(V e -V 0 ) / (V i -V 0 ) by the formulad and related.

[0409] In a preferred embodiment, at least 40% of the serotype 8 glycoconjugates of the present invention have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 8 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 8 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 8 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d has.

[0410] In a preferred embodiment, 40% to 90% of the serotype 8 glycoconjugates have a K lower than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 50% to 90% of the serotype 8 glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 8 glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d has.

[0411] 1.4 Combinations of Glycoconjugates of the Invention In one embodiment, the immunogenic composition of the invention comprises any of the glycoconjugates disclosed herein.

[0412] In one embodiment, the immunogenic compositions of the invention include glycoconjugates derived from S. pneumoniae serotype 15B (such as those described in Section 1.3.4 above), glycoconjugates derived from S. pneumoniae serotype 22F (such as those described in Section 1.3.2 above), glycoconjugates derived from S. pneumoniae serotype 33F (such as those described in Section 1.3.3 above), glycoconjugates derived from S. pneumoniae serotype 12F (such as those described in Section 1.3.5 above), glycoconjugates derived from S. pneumoniae serotype 21F (such as those described in Section 1.3.6 above), glycoconjugates derived from S. pneumoniae serotype 22F (such as those described in Section 1.3.7 above), glycoconjugates derived from S. pneumoniae serotype 23F (such as those described in Section 1.3.8 above), glycoconjugates derived from S. pneumoniae serotype 23F (such as those described in Section 1.3.9 above), glycoconjugates derived from S. pneumoniae serotype 23F (such as those described in Section 1.3.1 ...2 above), glycoconjugates derived from S. pneumoniae serotype 23F (such as those described in Section 1.3.3 above), glycoconjugates derived from S. pneumoniae serotype 23F (such as those described in Section 1.3.4 above), glycoconjugates derived from S. pneumoniae serotype The glycoconjugate comprises at least one glycoconjugate selected from the group consisting of a glycoconjugate derived from S. pneumoniae serotype 10A (such as the glycoconjugates described above in Section 1.3.6), a glycoconjugate derived from S. pneumoniae serotype 11A (such as the glycoconjugates described above in Section 1.3.7), and a glycoconjugate derived from S. pneumoniae serotype 8 (such as the glycoconjugates described above in Section 1.3.8).

[0413] In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 15B, such as those described in Section 1.3.4 above. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 22F, such as those disclosed in Section 1.3.2 above. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 33F, such as those disclosed in Section 1.3.3 above. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 12F, such as those disclosed in Section 1.3.5 above. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 10A, such as those disclosed in Section 1.3.6 above. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 11A, such as those disclosed in Section 1.3.7 above. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 8, such as those disclosed in Section 1.3.8 above.

[0414] In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate of two each of S. pneumoniae serotypes selected from the group consisting of 15B and 22F, 15B and 33F, 15B and 12F, 15B and 10A, 15B and 11A, 15B and 8, 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and 8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A, 12F and 11A, 12F and 8, 10A and 11A, 10A and 8, and 11A and 8.

[0415] In one embodiment, the immunogenic composition of the invention comprises an immunogen that is capable of inhibiting each of the three following S. pneumoniae serotypes: 15B and 22F and 33F, 15B and 22F and 12F, 15B and 22F and 10A, 15B and 22F and 11A, 15B and 22F and 8, 15B and 33F and 12F, 15B and 33F and 10A, 15B and 33F and 11A, 15B and 33F and 8, 15B and 12F and 10A, 15B and 12F and 11A, 15B and 12F and 8, 15B and 10A and 11A, 15B and 10A and 8, 15B and 11A and 8, 22F and 33F and 12F, 22F and 33F and 10A, 22F and 33F and 11A, 22F and 33F and 8, 22F and 12F and 10A, 22F and 12F and 11A, 22F and 12F and 8, 22F and 10A and 11A, 22F and 10A and 8, 22F and 11A and 8, 33F and 12F and 10A, 33F and 12F and 11A, 33F and 12F and 8, 33F and 10A and 11A, 33F and 10A and 8, 33F and 11A and 8, 12F and 10A and 11A, 12F and 10A and 8, 12F and 11A and 8 or 10A and 11A and at least one glycoconjugate of 8.

[0416] In one embodiment, the immunogenic composition of the invention comprises an immunogen that is capable of inhibiting each of the four following S. pneumoniae serotypes: 15B and 22F and 33F and 12F, 15B and 22F and 33F and 10A, 15B and 22F and 33F and 11A, 15B and 22F and 33F and 8, 15B and 22F and 12F and 10A, 15B and 22F and 12F and 11A, 15B and 22F and 12F and 8, 15B and 22F and 10A and 11A, 15B and 22F and 10A and 8, 15B and 22F and 11A and 8, 15B and 33F and 12F and 10A, 15B and 33F and 12F and 11A, 15B and 33F and 12F and 8, 15B and 33F and 10A and 11A, 15B and 33F and 10A and 8, 15B and 33F and 11A and 8, 15B and 12F and 10A and 11A, 15B and 12F and 10A and 8, 15B and 12F and 11A and 8, 15B and 10A and 11A and 8, 22F and 33F and 12F and 10A, 22F and 33F and 12F and 11A, 22F and 33F and 12F and 8, 22F and 33F and 10A and 11A, 22F and 33F and 10A and 8, 22F and 33F and 11A and 8, 22F and 12F and 10A and 11A, 22F and 12F and 10A and 8, 22F and 12F and 11A and 8, 22F and 10A and 11A and 8, 33F and 12F and 10A and 11A, 33F and 12F and 10A and 8, 33F and 12F and 11A and 8, 33F and 10A and 11A and 8 or 12F and 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0417] In one embodiment, the immunogenic composition of the invention comprises an immunogen that is capable of inhibiting each of the five following S. pneumoniae serotypes: 15B and 22F and 33F and 12F and 10A, 15B and 22F and 33F and 12F and 11A, 15B and 22F and 33F and 12F and 8, 15B and 22F and 33F and 10A and 11A, 15B and 22F and 33F and 10A and 8, 15B and 22F and 33F and 11A and 8, 15B and 22F and 12F and 10A and 11A, 15B and 22F and 12F and 10A and 8, 15B and 22F and 12F and 11A and 8, 15B and 22F and 10A and 11A and 8, 15B and 33F and 12F and 10A and 11A, 15B and 33F and 12F and 10A and 8, 15B and 33F and 12F and 11A and 8, 15B and 33F and 10A and 11A and 8, 15B and 12F and 10A and 11A and 8, 22F and 33F and 12F and 10A and 11A, 22F and 33F and 12F and 10A and 8, 22F and 33F and 12F and 11A and 8, 22F and 33F and 10A and 11A and 8, 22F and 12F and 10A and 11A and 8 or 33F and 12F and 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0418] In one embodiment, the immunogenic composition of the invention comprises each of the six following S. pneumoniae serotypes: 15B and 22F and 33F and 12F and 10A and 11A, 15B and 22F and 33F and 12F and 10A and 8, 15B and 22F and 33F and 12F and 11A and 8, 15B and 22F and 33F and 10A and 11A and 8, 15B and 22F and 12F and 10A and 11A and 8, 15B and 33F and 12F and 10A and 11A and 8 or 22F and 33F and 12F and 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0419] In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate of each of the seven following S. pneumoniae serotypes: 15B, 22F, 33F, 12F, 10A, 11A, and 8.

[0420] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A and / or 8 of any of the immunogenic compositions defined in this section are disclosed in Sections 1.3.2 to 1.3.8 above.

[0421] In one embodiment, any of the above immunogenic compositions further comprise a glycoconjugate derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F (such as the glycoconjugates described in Section 1.3.1 above).

[0422] In one embodiment, any of the above immunogenic compositions further comprise a glycoconjugate derived from S. pneumoniae serotypes 1, 5, and 7F (such as the glycoconjugates described in Section 1.3.1 above).

[0423] In one embodiment, any of the above immunogenic compositions further comprise a glycoconjugate derived from S. pneumoniae serotypes 6A and 19A (such as the glycoconjugates described in Section 1.3.1 above).

[0424] In one embodiment, any of the above immunogenic compositions further comprises a glycoconjugate derived from S. pneumoniae serotype 3 (such as the glycoconjugates described in Section 1.3.1 above).

[0425] Preferably, all glycoconjugates of the above immunogenic composition are individually conjugated to a carrier protein.

[0426] In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 22F is 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 33F is conjugated to a CRMP. 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 15B is conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 12F is conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 10A is conjugated to a CRM 197In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 11A is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate is a glycoconjugate derived from S. pneumoniae serotype 8. uGate is a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 1, 5 and 7F are conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 6A and 19A are conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 3 is conjugated to CRM 197 is conjugated to

[0427] In one embodiment, the glycoconjugates of any of the above immunogenic compositions are all CRM 197 are individually conjugated to

[0428] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are individually conjugated to PD.

[0429] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 18C of any of the above immunogenic compositions is conjugated to TT.

[0430] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 19F of any of the above immunogenic compositions is conjugated to DT.

[0431] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are individually conjugated to PD, the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

[0432] In one embodiment, the immunogenic composition comprises between 8 and 20 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition comprises glycoconjugates derived from 12, 13, 14, 15, 16, 17, 18, 19, or 20 different serotypes.

[0433] In one embodiment, the immunogenic composition comprises glycoconjugates derived from 16 or 20 different serotypes.

[0434] In one embodiment, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 14, 15, 16, 17, 18 or 19 valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 16 valent pneumococcal conjugate composition. In the above, the immunogenic composition is a 19-valent pneumococcal conjugate composition.

[0435] 1. In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 15B, such as the glycoconjugates described in section 1.3.4 above.

[0436] 2. In another embodiment, the immunogenic composition of the invention comprises, in addition to point 1 above, at least one glycoconjugate derived from S. pneumoniae serotype 22F, such as those disclosed in section 1.3.2 above.

[0437] 3. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1 or 2 above, at least one glycoconjugate derived from S. pneumoniae serotype 33F, such as those disclosed in section 1.3.3 above.

[0438] 4. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2 or 3 above, at least one glycoconjugate derived from S. pneumoniae serotype 12F, such as those disclosed in section 1.3.5 above.

[0439] 5. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3 or 4 above, at least one glycoconjugate derived from S. pneumoniae serotype 10A, such as those disclosed in section 1.3.6 above.

[0440] 6. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4 or 5 above, at least one glycoconjugate derived from S. pneumoniae serotype 11A, such as those disclosed in section 1.3.7 above.

[0441] 7. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4, 5 or 6 above, at least one glycoconjugate derived from S. pneumoniae serotype 8, such as those disclosed in section 1.3.8 above.

[0442] 8. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4, 5, 6 or 7 above, glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, such as the glycoconjugates described in section 1.3.1 above.

[0443] 9. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4, 5, 6, 7 or 8 above, a glycoconjugate derived from S. pneumoniae serotypes 1, 5 and 7F, such as the glycoconjugates described in section 1.3.1 above.

[0444] 10. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4, 5, 6, 7, 8 or 9 above, a glycoprotein as described in section 1.3.1 above. conjugates, including glycoconjugates derived from S. pneumoniae serotypes 6A and 19A.

[0445] 11. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, a glycoconjugate derived from S. pneumoniae serotype 3, such as the glycoconjugates described in section 1.3.1 above.

[0446] In one embodiment, the immunogenic compositions of the invention comprise glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0447] In one embodiment, the immunogenic compositions of the invention comprise glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0448] In one embodiment, the immunogenic compositions of the invention comprise conjugated S. pneumoniae saccharides derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0449] In one embodiment, the immunogenic compositions of the invention comprise conjugated S. pneumoniae saccharides derived from serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0450] In one embodiment, the glycoconjugates of the immunogenic compositions of the invention consist of glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic compositions of the invention consist of glycoconjugates derived from serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates derived from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates derived from serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.

[0451] Preferably, all glycoconjugates of the immunogenic composition of the invention (eg, any of points 1 to 11 above) are individually conjugated to a carrier protein.

[0452] In one embodiment, glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F according to any of points 8 to 11 above are individually conjugated to PD.

[0453] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 18C according to any of points 8 to 11 above is conjugated to TT.

[0454] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 19F according to any of points 8 to 11 above is conjugated to a DT.

[0455] In one embodiment of any of points 8 to 11 above, glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT and a glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

[0456] In one embodiment of any of points 1 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 22F is a CRM 197 In one embodiment of any of points 2 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 33F is conjugated to CRM 197 In one embodiment of any of points 3 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 15B is conjugated to CRM 197 In one embodiment of any of points 4 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 12F is conjugated to CRM 197 In one embodiment of any of points 5 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 10A is conjugated to CRM 197In one embodiment of any of points 6 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 11A is conjugated to CRM 197 In one embodiment of any of points 7 to 11 above, the glycoconjugate derived from S. pneumoniae serotype 8 is conjugated to CRM 197 In one embodiment of any of points 8 to 11 above, glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are conjugated to CRM 197 In one embodiment of any of points 9 to 11 above, glycoconjugates derived from S. pneumoniae serotypes 1, 5 and 7F are conjugated to CRM 197 In one embodiment of any of points 10 to 11 above, glycoconjugates derived from S. pneumoniae serotypes 6A and 19A are conjugated to CRM 197 In one embodiment of point 11 above, the glycoconjugate derived from S. pneumoniae serotype 3 is conjugated to CRM 197 is conjugated to

[0457] In one embodiment, the glycoconjugate of the immunogenic composition according to points 1 to 11 above is 197 are individually conjugated to

[0458] In one embodiment, the immunogenic composition of the invention is directed to Streptococcus pneumoniae. In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from 12, 13, 14, 15, 16, 17, 18, 19 or 20 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition of the invention comprises glycoconjugates derived from 16 or 20 different serotypes.

[0459] In one embodiment, the immunogenic composition of points 1 to 11 above is an 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19- or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition of points 1 to 11 above is a 15-, 16-, 17-, 18- or 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition of points 1 to 11 above is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition of points 1 to 11 above is a 19-valent pneumococcal conjugate composition.

[0460] After conjugation of the capsular polysaccharide to the carrier protein, the glycoconjugate is purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration / diafiltration operations, precipitation / elution, column chromatography, and depth filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic composition of the present invention.

[0461] 1.5 Further Combinations of Glycoconjugates of the Invention In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate derived from S. pneumoniae serotype 9V.

[0462] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate of two each of S. pneumoniae serotypes selected from the group consisting of 9V and 4, 9V and 6B, 9V and 14, 9V and 18C, 9V and 19F, 9V and 23F.

[0463] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises a glycoconjugate of at least one of the following seven S. pneumoniae serotypes: 9V, 4, 6B, 14, 18C, 19F and 23F, respectively.

[0464] In one embodiment, any of the immunogenic compositions defined in section 1.4 above comprises a serovar IgE antibody against each of the eight following S. pneumoniae serotypes: 9V and 1 and 4 and 6B and 14 and 18C and 19F and 23F, 9V and 4 and 5 and 6B and 14 and 18C and 19F and 23F, or 9V and 4 and 6B and 7F and 14 and 18C and 19F and 23F The glycoconjugate further comprises at least one of the following:

[0465] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises a glycoconjugate of at least one of the following ten S. pneumoniae serotypes: 9V, 1, 5, 4, 6B, 7F, 14, 18C, 19F and 23F, respectively.

[0466] In one embodiment, any of the immunogenic compositions defined in section 1.4 above is administered to a subject comprising one or more of the following eleven S. pneumoniae serotypes: 9V and 1 and 4 and 5 and 6A and 6B and 7F and 14 and 18C and 19F and 23F or 9V and 1 and 4 and 5 and 6B and 7F and 14 and 18C and 19A and 19F and 23F The glycoconjugate further comprises at least one of the following:

[0467] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises a glycoconjugate of at least one of the following twelve S. pneumoniae serotypes: 9V, 1, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F and 23F, respectively.

[0468] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises a glycoconjugate of at least one of the following thirteen S. pneumoniae serotypes: 9V, 1, 3, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F and 23F, respectively.

[0469] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate derived from S. pneumoniae serotype 2.

[0470] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate derived from S. pneumoniae serotype 17F.

[0471] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate derived from S. pneumoniae serotype 20.

[0472] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate derived from S. pneumoniae serotype 15C.

[0473] In one embodiment, any of the immunogenic compositions defined in section 1.4 above further comprises at least one glycoconjugate derived from S. pneumoniae serotype 9N.

[0474] Preferably, all of the glycoconjugates of the immunogenic composition are individually conjugated to a carrier protein.

[0475] In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serovar 9V is 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 14, 18C, 19F and 23F are conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the antibody is conjugated to Streptococcus pneumoniae serotype 1, Glycoconjugates derived from 5 and 7F were synthesized using the CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 6A and 19A are conjugated to a CRM 197In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 3 is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 2 is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 17F is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 20 is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 15C is conjugated to CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 9N is conjugated to CRM 197 is conjugated to

[0476] In one embodiment, all of the glycoconjugates of the immunogenic composition are 197 are individually conjugated to

[0477] In another embodiment, the glycoconjugate derived from S. pneumoniae serotype 9V of any of the above immunogenic compositions is individually conjugated to a PD.

[0478] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are individually conjugated to PD.

[0479] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 18C of any of the above immunogenic compositions is conjugated to TT.

[0480] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 19F of any of the above immunogenic compositions is conjugated to DT.

[0481] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are individually conjugated to PD, the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

[0482] In one embodiment, the immunogenic composition comprises 7 to 25 different serotypes of Streptococcus pneumoniae. In one embodiment, the immunogenic composition comprises glycoconjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 different serotypes. In one embodiment, the immunogenic composition comprises glycoconjugates from 16 or 20 different serotypes. In one embodiment, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 14, 15, 16, 17, 18 or 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 20-valent pneumococcal conjugate composition.

[0483] After conjugation of the capsular polysaccharide to the carrier protein, the glycoconjugate is purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration / diafiltration operations, precipitation / elution, column chromatography, and depth filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic composition of the present invention.

[0484] 1.6 Specific Combinations of Glycoconjugates of the Invention In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotype 9N.

[0485] In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotype 9A.

[0486] In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotype 9L.

[0487] In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotypes 9N and 9A.

[0488] In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotypes 9N and 9L.

[0489] In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotypes 9A and 9L.

[0490] In one embodiment, either of the immunogenic compositions defined in sections 1.4 or 1.5 above does not comprise capsular saccharides derived from S. pneumoniae serotypes 9N, 9A and 9L.

[0491] 2. Dosage of Immunogenic Composition The amount of glycoconjugate in each dose was found to have a significant effect in a typical vaccine recipient. An amount is selected that will induce an immune protective response without adverse side effects, such amount varying depending on the particular immunogen used and the manner in which it is presented.

[0492] 2.1 Amount of glycoconjugate The amount of a particular glycoconjugate in an immunogenic composition can be calculated based on the total polysaccharide (conjugated and unconjugated) of that conjugate. For example, a glycoconjugate containing 20% ​​free polysaccharide has about 80 μg of conjugated polysaccharide and about 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of glycoconjugate may vary depending on the pneumococcal serotype. The concentration of saccharides can be determined by uronic acid assay.

[0493] The "immunogenic amounts" of the various polysaccharide components in the immunogenic composition may vary and may each comprise about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg, or about 100 μg of any particular polysaccharide antigen.

[0494] Generally, each dose contains between 0.1 μg and 100 μg of polysaccharide for a given serotype, particularly between 0.5 μg and 20 μg, more particularly between 1.0 μg and 10 μg, and even more particularly preferably between 2.0 μg and 5.0 μg. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0495] In one embodiment, each dose comprises about 1.0 μg, about 1.2 μg, about 1.4 μg, about 1.6 μg, about 1.8 μg, about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0 μg, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg or about 6.0 μg of polysaccharide for each particular glycoconjugate.

[0496] In one embodiment, each dose contains about 1.1 μg of glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and / or 33F. , about 1.2 μg, about 1.3 μg, about 1.4 μg, about 1.5 μg, about 1.6 μg, about 1.7 μg, about 1.8 μg, about 1.9 μg, about 2.0 μg, about 2.1 μg, about 2.2 μg, about 2.3 μg, about 2.4 μg, about 2.5 μg, about 2.6 μg, about 2.7 μg, about 2.8 μg, about 2.9 μg, or about 3.0 μg of polysaccharide.

[0497] In one embodiment, each dose comprises about 1.1 μg, about 1.2 μg, about 1.3 μg, about 1.4 μg, about 1.5 μg, about 1.6 μg, about 1.7 μg, about 1.8 μg, about 1.9 μg, about 2.0 μg, about 2.1 μg, about 2.2 μg, about 2.3 μg, about 2.4 μg, about 2.5 μg, about 2.6 μg, about 2.7 μg, about 2.8 μg, about 2.9 μg, or about 3.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F.

[0498] In one embodiment, each dose contains about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, or about 4.0 μg of a glycoconjugate derived from S. pneumoniae serotype 6B. g, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide.

[0499] In one embodiment, each dose contains from about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and from about 3.0 μg to about 6.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0500] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.0 μg to about 4.8 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0501] In one embodiment, each dose contains about 2.2 μg of polysaccharide derived from each glycoconjugate derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.4 μg of polysaccharide derived from S. pneumoniae serotype 6B.

[0502] In one embodiment, each dose contains from about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and from about 3 μg to about 6 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0503] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.0 μg to about 4.8 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0504] In one embodiment, each dose contains about 2.2 μg of polysaccharide from each of the glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.4 μg of polysaccharide from the glycoconjugate from S. pneumoniae serotype 6B.

[0505] In one embodiment, each dose contains about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, as well as about 1.5 μg to about 3.0 μg of Streptococcus pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. For glycoconjugates derived from Leptococcus pneumoniae (S. pneumoniae) serotype 6B, the polysaccharide content ranges from about 3.0 μg to about 6.0 μg.

[0506] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.0 μg to about 4.8 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0507] In one embodiment, each dose contains about 2.2 μg of polysaccharide derived from each of the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.4 μg of polysaccharide derived from S. pneumoniae serotype 6B.

[0508] In one embodiment, each dose contains from about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and from about 3.0 μg to about 6.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0509] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.0 μg to about 4.8 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0510] In one embodiment, each dose contains about 2.2 μg of polysaccharide from each of the glycoconjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, and about 4.4 μg of polysaccharide from the glycoconjugate from S. pneumoniae serotype 6B.

[0511] 2.2 Amount of support Generally, each dose comprises 10 μg to 150 μg of carrier protein, in particular 15 μg to 100 μg of carrier protein, more in particular 25 μg to 75 μg of carrier protein, and even more in particular 40 μg to 60 μg of carrier protein. In one embodiment, the carrier protein is CRM. 197 It is.

[0512] In one embodiment, each dose is about 25 μg, about 26 μg, about 27 μg, about 28 μg, about 29 μg, about 30 μg, about 31 μg, about 32 μg, about 33 μg, about 34 μg, about 35 μg, about 36 μg, about 37 μg, about 38 μg, about 39 μg, about 40 μg, about 41 μg, about 42 μg, about 43 μg, about 44 μg, about 45 μg, about 46 μg, about 47 μg, about 48 μg, about 49 μg, about 50 μg, about 51 μg, about 52 μg, about 53 μg, about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, In one embodiment, the carrier protein comprises about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, about 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg, or about 75 μg of carrier protein. 197 It is.

[0513] 3. Further antigens The immunogenic compositions of the invention comprise Streptococcus pneumoniae (S. pneumoniae) saccharide antigens (glycoconjugates). They may also further comprise antigens derived from other pathogens, in particular bacteria and / or viruses. Preferred further antigens are selected from diphtheria toxoid (D), tetanus toxoid (T), pertussis antigens (P), typically acellular (Pa), Hepatitis B virus (HBV) surface antigen (HBsAg), Hepatitis A virus (HAV) antigens, conjugated Haemophilus influenzae type b capsular saccharide (Hib), inactivated poliovirus vaccine (IPV).

[0514] In one embodiment, the immunogenic composition of the invention comprises DT-Pa. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-Hib, DT-Pa-IPV or DT-Pa-HBsAg. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-HBsAg-IPV-Hib.

[0515] Pertussis antigens: Bordetella pertussis causes whooping cough. Pertussis antigens in vaccines are cellular (whole cell, in the form of inactivated B. pertussis cells) or acellular. Preparation of cellular pertussis antigens is well documented (for example, it can be obtained by heat inactivation of phase I cultures of B. pertussis). However, preferably, the present invention uses acellular antigens. When acellular antigens are used, it is preferred to use one, two or (preferably) three of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) fibrillar hemagglutinin (FHA); (3) pertactin (also known as 69 kilodalton outer membrane protein). FHA and pertactin can be treated with formaldehyde prior to use according to the present invention. PT is detoxified, preferably by treatment with formaldehyde and / or glutaraldehyde. Acellular pertussis antigens are preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they may be added in a non-adsorbed state. If pertactin is added, it is preferably already adsorbed onto an aluminum hydroxide adjuvant. PT and FHA can be adsorbed onto an aluminum hydroxide adjuvant or aluminum phosphate. Adsorption of all of PT, FHA and pertactin onto aluminum hydroxide is most preferred.

[0516] Inactivated poliovirus vaccine: Poliovirus causes acute poliomyelitis. Rather than using an oral poliovirus vaccine, a preferred embodiment of the invention uses IPV. Before administration to a patient, the poliovirus needs to be inactivated, which can be achieved by treatment with formaldehyde. Acute poliomyelitis can be caused by one of three types of poliovirus. Although the three types are similar and cause the same symptoms, they are antigenically distinct and infection with one type does not protect against infection with the other types. Thus, it is preferred to use three poliovirus antigens in the present invention: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). The viruses are preferably grown, purified, and inactivated separately, then mixed and used in conjunction with the present invention. Obtain the bulk trivalent mixture for use.

[0517] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxin can be treated (e.g., with formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoids can be obtained by growing C. diphtheriae in a growth medium, followed by treatment with formaldehyde, ultrafiltration, and precipitation. The toxoided material can then be processed by processes including sterile filtration and / or dialysis. Diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide adjuvant.

[0518] Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus toxoid can be processed to obtain a protective toxoid. The toxoid is used in tetanus vaccines. A preferred tetanus toxoid is one prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing C.tetani in a growth medium, followed by treatment with formaldehyde, ultrafiltration, and precipitation. The material can then be processed by processes including sterile filtration and / or dialysis.

[0519] Hepatitis A virus antigen: Hepatitis A virus (HAV) is one of the known agents that cause viral hepatitis. The preferred HAV component is based on an inactivated virus, and inactivation can be achieved by formalin treatment.

[0520] Hepatitis B virus (HBV) is one of the known agents that cause viral hepatitis. The main component of the capsid is a protein known as HBV surface antigen, or more commonly, HBsAg, a polypeptide of 226 amino acids, typically with a molecular weight of about 24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to normal vaccinees, it stimulates the production of anti-HBsAg antibodies that protect against HBV infection.

[0521] For vaccine production, HBsAg has been produced in two ways: purification of the antigen in particulate form from the plasma of chronic hepatitis B carriers or expression of the protein by recombinant DNA techniques (e.g., recombinant expression in yeast cells). Unlike native HBsAg (i.e., as in plasma purified products), yeast-expressed HBsAg is generally not glycosylated, and this is the most preferred form of HBsAg for use with the present invention.

[0522] Conjugated Haemophilus influenzae type b antigens: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular saccharide antigens, the preparation of which is well documented. The Hib saccharide can be conjugated to a carrier protein to enhance its immunogenicity, especially in children. Typical carrier proteins are tetanus toxoid, diphtheria toxoid, CRM 197 , H. influenzae protein D, and an outer membrane protein complex from serogroup B Neisseria meningitidis. The saccharide portion of the conjugate may comprise full-length polyribosyl ribitol phosphate (PRP) and / or fragments of full-length PRP prepared from Hib bacteria. The Hib conjugate may or may not be adsorbed to an aluminium salt adjuvant.

[0523] In one embodiment, the immunogenic composition of the invention further comprises a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

[0524] In one embodiment, the immunogenic composition of the invention further comprises a conjugated N. meningitidis serogroup A capsular saccharide (MenA), a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY) and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

[0525] In one embodiment, the immunogenic composition of the invention further comprises a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY) and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

[0526] 4. Adjuvants In some embodiments, the immunogenic composition disclosed herein may further comprise at least one, two or three adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An antigen may act primarily as a delivery system, primarily as an immune modulator, or have both strong characteristics. Suitable adjuvants include those suitable for use in mammals, including humans.

[0527] Examples of known suitable delivery system-type adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.

[0528] In one embodiment, the immunogenic composition disclosed herein comprises an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In a preferred embodiment, the immunogenic composition disclosed herein comprises aluminum phosphate or aluminum hydroxide as an adjuvant. In one embodiment, the immunogenic composition disclosed herein comprises 0.1 mg / mL to 1 mg / mL or 0.2 mg / mL to 0.3 mg / mL of elemental aluminum in the form of aluminum phosphate. In one embodiment, the immunogenic composition disclosed herein comprises about 0.25 mg / mL of elemental aluminum in the form of aluminum phosphate.

[0529] Examples of known suitable immunomodulatory adjuvants that can be used in humans include, but are not limited to, saponin extract from the bark of the Aquilla tree (QS21, QuilA), MPL (monophosphoryl lipid A), 3DMPL (3 These include TLR4 agonists such as -O-deacylated MPL or GLA-AQ, LT / CT mutants, cytokines such as various interleukins (eg, IL-2, IL-12) or GM-CSF, and others.

[0530] Examples of known suitable immunomodulatory adjuvants that have both delivery and immunomodulatory characteristics that can be used in humans include, but are not limited to, ISCOMS (see, e.g., Sjolander et al. (1998) J. Leukocyte Biol. 64:713; WO90 / 03184, WO96 / 11711, WO00 / 48630, WO98 / 36772, WO00 / 41720, WO2006 / 134423 and WO2007 / 026190) or GLA-EM, which is a combination of a TLR4 agonist and an oil-in-water emulsion.

[0531] For veterinary applications, such as, but not limited to, animal testing, one of skill in the art can select from a wide variety of adjuvants, including complete Freund's adjuvant (CFA), incomplete Freund's adjuvant (IFA), Emulsigen, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-isoglutamine (CGP11637, referred to as nor-MDP), N-acetyl- ... RIBI, which contains l-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP19835A, called MTP-PE), and three components extracted from bacteria in a 2% squalene / Tween 80 emulsion, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS), can be used.

[0532] Additional exemplary adjuvants for enhancing the efficacy of the pneumococcal vaccines disclosed herein include, but are not limited to, (1) SAF containing, for example, (a) 10% squalane, 0.4% Tween 80, 5% Pluronic block polymer L121, and thr-MDP microfluidized or vortexed into a submicron emulsion to generate a larger particle size emulsion, and (b) 2% squalene, 0.(1) oil-in-water emulsion formulations, such as the RIBI™ adjuvant system (RAS) (Ribi Immunochem, Hamilton, MT), which contains 2% Tween 80 and one or more bacterial cell wall components, such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™), with or without other specific immunostimulants, such as muramyl peptides (see below) or bacterial cell wall components; (2) QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA), ABISCO® (Isconova, Sweden), or ISCOMATRIX® (Commonwealth Serum Co., Ltd.), which may be used; (3) saponin adjuvants such as Freund's complete adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 99 / 44636)), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-IF), and / or other adjuvants derived therefrom, such as riboflavin (RI-1, RI-2, RI-4, RI-5, RI-6, RI-7, RI-12 (e.g., WO 99 / 44636)), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-IF), and / or other adjuvants derived therefrom, such as riboflavin (RI-1, RI-2, RI-4, RI-5, RI-6, RI-7, RI-12 (e.g., WO 99 / 44636)), interferons (e.g., gamma interferon), macrophage colony stimulating factor (MC ... (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL), optionally in the substantial absence of alum, when used in conjunction with a pneumococcal saccharide (see, e.g., WO00 / 56358); (6) combinations of 3dMPL with, for example, QS21 and / or oil-in-water emulsions (see, e.g., EP0835318, EP0735898, EP0761231); (7) polyoxyethylene ethers or the like. are polyoxyethylene esters (see, e.g., WO 99 / 52549); (8) polyoxyethylene sorbitan ester surfactants in combination with octoxynol (e.g., WO 01 / 21207) or polyoxyethylene alkyl ether or ester surfactants in combination with at least one additional non-ionic surfactant such as octoxynol (e.g., WO 01 / 21152); (9) saponin and immunostimulatory oligonucleotides ( (10) immune stimulants and metal salt particles (see, for example, WO00 / 23105); (11) saponins and oil-in-water emulsions (see, for example, WO99 / 11241); (12) saponins (e.g., QS21) + 3dMPL + IM2 (optionally + sterol) (see, for example, WO98 / 57659); (13) other substances that act as immune stimulants to enhance the efficacy of the composition. Examples of muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), and N-acetyl-muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE).

[0533] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and thus these terms are used interchangeably unless otherwise indicated. An immunostimulatory CpG oligodeoxynucleotide contains one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally within the context of certain preferred bases. The methylation state of a CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide that contains a 5' unmethylated cytosine linked to a 3' guanine by a phosphate bond, and activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, immunostimulatory oligonucleotides may contain one or more methylated CpG dinucleotides, which activate the immune system through TLR9, although not as strongly as when the CpG motif is not methylated.CpG immunostimulatory oligonucleotides may contain one or more palindromes, which in turn may include CpG dinucleotides.CpG oligonucleotides are described in several issued patents, published patent applications, and other publications, such as U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.

[0534] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO2010 / 125480.

[0535] Different classes of CpG immunostimulatory oligonucleotides have been identified, referred to as A, B, C and P classes, and are described in more detail in WO2010 / 125480, p. 3, line 22 to p. 12, line 36. The methods of the present invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.

[0536] In one embodiment of the invention, the immunogenic compositions disclosed herein comprise an A class CpG oligonucleotide. Preferably, the "A class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of A class oligonucleotides include 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). G*G*G3' (SEQ ID NO: 2), where "*" indicates a phosphorothioate bond and "_" indicates a phosphodiester bond.

[0537] In one embodiment of the invention, the immunogenic composition disclosed herein comprises a CpG oligonucleotide of the B class. In one embodiment, the CpG oligonucleotide for use in the invention comprises at least one of the formula: 5'X 1 X 2 CGX 3 X 4 3', where X1, X2, X3 and X4 are nucleotides. 2 is adenine, guanine, or thymine. 3 is cytosine, adenine, or thymine.

[0538] The B class CpG oligonucleotide sequences of the present invention are those broadly described above and those disclosed in WO96 / 02555, WO98 / 18810 and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068. Exemplary sequences include, but are not limited to, those disclosed in these latter applications and patents.

[0539] In one embodiment, the "B class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGTCGTTTTTCGGTGCTTTT3' (SEQ ID NO: 3), or 5'TCGTCGTTTTTCGGTCGTTTT3' (SEQ ID NO: 4), or 5'TCGTCGTTTTGTCGTTTTGTCGTT3' (SEQ ID NO:5), or 5'TCGTCGTTTCGTCGTTTTGTCGTT3' (SEQ ID NO: 6), or 5'TCGTCGTTTTGTCGTTTTTTTCGA3' (SEQ ID NO: 7) has.

[0540] In any of these sequences, all of the linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may replace the 5'T; examples of halogen replacements include, but are not limited to, bromo-uridine or iodo-uridine replacements.

[0541] Some non-limiting examples of B class oligonucleotides include: 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T3' (SEQ ID NO: 8), or 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T3' (SEQ ID NO: 9), or 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*G*T*C*G*T*T3' (SEQ ID NO: 10), or 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T3' (SEQ ID NO: 11), or 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A3' (Sequence number 12) (wherein "*" indicates a phosphorothioate bond).

[0542] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a C-class CpG oligonucleotide. The CpG oligonucleotide has the following nucleic acid sequence: 5'TCGCGTCGTTCGGCGCGCGCCG3' (SEQ ID NO: 13), or 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 14), or 5'TCGGACGTTCGGCGCGCGCCG3' (SEQ ID NO: 15), or 5'TCGGACGTTCGGCGCGCCG3' (SEQ ID NO: 16), or 5'TCGCGTCGTTCGGCGCGCCG3' (SEQ ID NO: 17), or 5'TCGACGTTCGGCGCGCGCCG3' (SEQ ID NO: 18), or 5'TCGACGTTCGGCGCGCCG3' (SEQ ID NO: 19), or 5'TCGCGTCGTTCGGCGCCG3' (SEQ ID NO: 20), or 5'TCGCGACGTTCGGCGCGCGCCG3' (SEQ ID NO: 21), or 5'TCGTCGTTTTCGGCGCGCGCCG3' (SEQ ID NO: 22), or 5'TCGTCGTTTTCGGCGGCCGCCG3' (SEQ ID NO: 23), or 5'TCGTCGTTTTACGGCGCCGTGCCG3' (SEQ ID NO: 24), or 5'TCGTCGTTTTCGGCGCGCGCCGT3' (SEQ ID NO: 25) has.

[0543] In any of these sequences, all of the linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif making a semi-soft CpG oligonucleotide.

[0544] Some non-limiting examples of C class oligonucleotides include: 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 26), or 5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 27), or 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 28), or 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 29), or 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 30), or 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 31), or 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 32), or 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G3' (SEQ ID NO: 33), or 5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 34), or 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 35), or 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 36), or 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G3' (SEQ ID NO: 37), or 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T3' (Sequence number 38) (where "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond). In any of these sequences, ethyl-uridine or a halogen may replace the 5' T; examples of halogen substitutions include, but are not limited to, Bromo-uridine or iodo-uridine substitutions are included.

[0545] In one embodiment of the invention, the immunogenic composition disclosed herein comprises a P class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the invention is a P class CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, one of which is a 5' palindromic region at least 6 nucleotides long and is connected directly or via a spacer to a 3' palindromic region at least 8 nucleotides long, and comprises at least one YpR dinucleotide. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In one embodiment, the P class CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another embodiment, the TLR activation domain is within the 5' palindromic region. In another embodiment, the TLR activation domain is immediately 5' to the 5' palindromic region.

[0546] In one embodiment, a "P class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).

[0547] In the above sequences, all bonds may be phosphorothioate bonds. In another embodiment, one or more bonds may be phosphodiester, preferably between the "C" and "G" of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may replace the 5'T; examples of halogen replacement include, but are not limited to, bromo-uridine or iodo-uridine replacement.

[0548] Non-limiting examples of P class oligonucleotides include: 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G3' (Sequence number 40) (where "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond).

[0549] In one embodiment, the oligonucleotide comprises at least one phosphorothioate bond. In another embodiment, all internucleotide bonds of the oligonucleotide are phosphorothioate bonds. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0550] In one embodiment, all internucleotide linkages of the CpG oligonucleotides disclosed herein are phosphodiester linkages ("soft" oligonucleotides described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the invention are rendered resistant to degradation (e.g., stabilized). "Stabilized oligonucleotides" refer to oligonucleotides that are relatively resistant to degradation in vivo (e.g., by exo- or endonucleases). Nucleic acid stabilization can be achieved by backbone modifications. Oligonucleotides with phosphorothioate linkages are the most It produces high activity and protects oligonucleotides from degradation by intracellular exo- and endonucleases.

[0551] Immunostimulatory oligonucleotides may have a chimeric backbone with a combination of phosphodiester and phosphorothioate bonds.For the purpose of the present invention, chimeric backbone refers to a partially stabilized backbone, in which at least one internucleotide bond is phosphodiester or phosphodiester-like, at least one other internucleotide bond is stabilized internucleotide bond, and at least one phosphodiester or phosphodiester-like bond is different from at least one stabilized bond.When phosphodiester bonds are preferentially located within CpG motifs, such molecules are called "semi-soft" as described in WO2007 / 026190.

[0552] Other modified oligonucleotides contain combinations of phosphodiester, phosphorothioate, methylphosphonate, methyl phosphorothioate, phosphorodithioate, and / or p-ethoxy linkages.

[0553] Mixed backbone modified ODNs can be synthesized as described in WO2007 / 026190. The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) can also contribute to the stimulatory activity of the oligonucleotide. To facilitate uptake into cells, the CpG oligonucleotides of the present invention preferably have a minimum length of 6 nucleotide residues. Since larger oligonucleotides are degraded in cells, any size oligonucleotide greater than 6 nucleotides (even many kb long) can induce an immune response if sufficient immune stimulatory motifs are present. In certain embodiments, the CpG oligonucleotides are 6-100 nucleotides long, preferably 8-30 nucleotides long. In important embodiments, the nucleic acids and oligonucleotides of the present invention are not plasmids or expression vectors.

[0554] In one embodiment, the CpG oligonucleotides disclosed herein contain substitutions or modifications, such as in the base and / or sugar, as described in paragraphs 134-147 of WO2007 / 026190.

[0555] In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem.Rev. 90:543; S.Agrawal (ed.), Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu.Rev.Pharmacol.Toxicol.36:107-129; and Hunziker et al. (1995) Mod.Synth.Methods7:331-417. The oligonucleotide according to the present invention may have one or more modifications, where each modification is located at a specific phosphodiester internucleoside bridge and / or a specific β-D-ribose unit and / or a specific natural nucleoside base position, compared to the oligonucleotide of the same sequence composed of natural DNA or RNA.

[0556] In some embodiments of the invention, the CpG-containing nucleic acid can simply be mixed with the immunogenic carrier according to methods known to those of skill in the art (see, eg, WO03 / 024480).

[0557] In certain embodiments of the invention, any of the immunogenic compositions disclosed herein contains between 2 μg and 100 mg of CpG oligonucleotide, preferably between 0.1 mg and 50 mg of CpG oligonucleotide, preferably between 0.2 mg and 10 mg of CpG oligonucleotide, preferably between 0.3 mg and 5 mg of CpG oligonucleotide, preferably between 0. Preferably, the immunogenic composition comprises 3 mg to 5 mg of CpG oligonucleotide, more preferably 0.5 to 2 mg of CpG oligonucleotide, and even more preferably 0.75 to 1.5 mg of CpG oligonucleotide. In a preferred embodiment, any immunogenic composition disclosed herein comprises about 1 mg of CpG oligonucleotide.

[0558] 5. Preparation The immunogenic compositions of the present invention can be formulated in liquid form (i.e., solution or suspension) or in lyophilized form. Liquid formulations can advantageously be administered directly from their packaged form and therefore are ideal for injection without the need for reconstitution in an aqueous medium, as is otherwise required for the lyophilized compositions of the present invention.

[0559] Formulation of the immunogenic composition of the present invention can be achieved using art-recognized methods.For example, individual pneumococcal conjugates can be formulated with a physiologically acceptable vehicle to prepare the composition.Examples of such vehicles include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol) and dextrose solutions.

[0560] The present disclosure provides immunogenic compositions comprising any combination of the glycoconjugates disclosed herein and a pharma- ceutically acceptable excipient, carrier, or diluent.

[0561] In one embodiment, the immunogenic compositions of the invention are in liquid form, preferably in aqueous liquid form.

[0562] The immunogenic compositions of the disclosure may include one or more of the following: a buffer, a salt, a divalent cation, a non-ionic surfactant, a cryoprotectant such as a sugar, an antioxidant such as a free radical scavenger or chelating agent, or any combination thereof.

[0563] In one embodiment, the immunogenic composition of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is phosphate, succinic acid, histidine, or citrate. In a particular embodiment, the buffer is succinic acid at a final concentration of 1 mM to 10 mM. In one particular embodiment, the final concentration of the succinate buffer is about 5 mM.

[0564] In one embodiment, the immunogenic composition of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride and combinations thereof. In one particular embodiment, the salt is sodium chloride. In one particular embodiment, the immunogenic composition of the present invention comprises 150 mM sodium chloride.

[0565] In one embodiment, the immunogenic composition of the invention comprises a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN™ 20), polysorbate 40 (TWEEN™ 40), polysorbate 60 (TWEEN™ 60), polysorbate 65 (TWEEN™ 65), polysorbate 80 (TWEEN™ 80), polysorbate 85 (TWEEN™ 85), TRITON™ N-101, TRITON™ X-100, oxtoxynol 40, nonoxynol-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H15), polyoxyethylene-35-ricinoleate (CREMOPHOR® EL), soy lecithin, and poloxamer. In one particular embodiment, the surfactant is polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% weight / weight (w / w) polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% weight / weight (w / w) polysorbate 80. In some such embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% weight / weight (w / w) polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w / w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% polysorbate 80 (w / w).

[0566] In certain embodiments, the immunogenic compositions of the invention have a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, and even more preferably a pH of 5.8 to 6.0.

[0567] In one embodiment, the invention provides a container filled with any of the immunogenic compositions disclosed herein. In one embodiment, the container is selected from the group consisting of a vial, a syringe, a flask, a fermentor, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.

[0568] In one embodiment, the container of the present invention is made from glass, metal (e.g., steel, stainless steel, aluminum, etc.) and / or polymer (e.g., thermoplastic, elastomer, thermoplastic elastomer). In one embodiment, the container of the present invention is made from glass.

[0569] In one embodiment, the invention provides a syringe filled with any of the immunogenic compositions disclosed herein, hi certain embodiments, the syringe is siliconized and / or made from glass.

[0570] A typical dose of the immunogenic composition of the invention for injection has a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, even more preferably about 0.5 mL.

[0571] Thus, the container or syringe defined above is filled with a volume of between 0.1 mL and 2 mL, more preferably between 0.2 mL and 1 mL, even more preferably about 0.5 mL of any of the immunogenic compositions defined herein.

[0572] 6 Uses of the immunogenic compositions of the present invention In one embodiment, the immunogenic compositions disclosed herein are for use as a medicament.

[0573] The immunogenic compositions described herein can be used in a variety of therapeutic or prophylactic methods for preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject. In particular, the immunogenic compositions described herein can be used to prevent, treat, or ameliorate a Streptococcus pneumoniae (S. pneumoniae) infection, disease, or condition in a subject.

[0574] Thus, in one aspect, the invention provides a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention. The method includes administering

[0575] In some such embodiments, the infection, disease or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection and brain abscess.

[0576] In one embodiment, the invention provides a method for inducing an immune response against Streptococcus pneumoniae (S. pneumoniae) in a subject, the method comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention.

[0577] In one embodiment, the immunogenic composition disclosed herein is for use as a vaccine. In such an embodiment, the immunogenic composition described herein can be used to prevent S. pneumoniae infection in a subject. Thus, in one aspect, the invention provides a method of preventing S. pneumoniae infection in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the invention. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, septicemia, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cow, or dog.

[0578] In one aspect, the immunogenic compositions disclosed herein are for use in a method of preventing, treating, or ameliorating an infection, disease, or condition associated with S. pneumoniae in a subject. In some such embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, septicemia, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.

[0579] In one embodiment, the immunogenic composition disclosed herein is for use as a vaccine. In such an embodiment, the immunogenic composition described herein can be used to prevent S. pneumoniae infection in a subject. Thus, in one aspect, the immunogenic composition disclosed herein is for use in a method to prevent S. pneumoniae infection in a subject. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, septicemia, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cow, or dog.

[0580] The immunogenic compositions of the present invention can be used to prevent or treat humans susceptible to pneumococcal infection by administering the immunogenic compositions via systemic or mucosal routes. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular, intraperitoneal, intradermal, or subcutaneous routes. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular, intraperitoneal, intradermal, or subcutaneous injection. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular or subcutaneous injection.

[0581] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates in Section 1.3.4 above) when administered to a subject is capable of inducing the formation of antibodies capable of binding to S. pneumoniae serotypes 15B, 15A and / or 15C as measured by a standard ELISA assay. In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates in Section 1.3.4 above) when administered to a subject is capable of inducing the formation of antibodies capable of binding to S. pneumoniae serotypes 15B and 15C as measured by a standard ELISA assay.

[0582] In the ELISA (enzyme-linked immunosorbent assay) method, antibodies from the serum of vaccinated subjects are incubated with polysaccharide adsorbed to a solid support, and bound antibodies are detected using an enzyme-conjugated secondary detection antibody.

[0583] In one embodiment, the standard ELISA assay is a standardized (WHO) ELISA assay as defined by the WHO in the "Training manual for Enzyme linked immunosorbent assay for the quantitation of Streptococcus pneumoniae serotype specific IgG (Pn PS ELISA)" (accessible at http: / / www.vaccine.uab.edu / ELISA%20protocol.pdf; accessed on March 31, 2014).

[0584] The ELISA measures type-specific IgG anti-S. pneumoniae capsular polysaccharide (PS) antibodies present in human serum. When dilutions of human serum are added to type-specific capsular PS-coated microtiter plates, antibodies specific for that capsular PS bind to the microtiter plate. Plate-bound antibodies are detected using a goat anti-human IgG alkaline phosphatase-labeled antibody followed by p-nitrophenyl phosphate substrate. The optical density of the colored end product is proportional to the amount of anti-capsular PS antibodies present in the serum.

[0585] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates in Section 1.3.4 above) is capable of eliciting IgG antibodies in humans capable of binding to S. pneumoniae serotype 15B polysaccharide at a concentration of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4 or 0.5 μg / ml as determined by an ELISA assay.

[0586] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates in Section 1.3.4 above) is capable of eliciting IgG antibodies in humans capable of binding to S. pneumoniae serotype 15C polysaccharide at a concentration of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4 or 0.5 μg / ml as determined by an ELISA assay.

[0587] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates in Section 1.3.4 above) is capable of eliciting IgG antibodies in humans capable of binding to S. pneumoniae serotype 15B and 15C polysaccharides at a concentration of at least 0.05, 0.1, 0.2, 0.3, 0.35, 0.4 or 0.5 μg / ml as determined by an ELISA assay.

[0588] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates of Section 1.3.4 above), when administered to a subject, is capable of inducing the formation of antibodies capable of killing S. pneumoniae serotype 15B in an opsonophagocytosis assay as disclosed herein.

[0589] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates of Section 1.3.4 above), when tested in an OPA assay disclosed herein (such as the OPA assay of Example 12), has an OPA titer that is higher than the OPA titer obtained with unconjugated native S. pneumoniae serotype 15B capsular polysaccharide.

[0590] In one embodiment, an immunogenic composition of the disclosure comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates of Section 1.3.4 above), when administered to a subject, is capable of inducing the formation of antibodies capable of killing S. pneumoniae serotype 15C in an opsonophagocy...

Claims

1. Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 15B, glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F, glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F, glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F 10. An immunogenic composition comprising at least one glycoconjugate selected from the group consisting of a glycoconjugate derived from S. pneumoniae serotype 10A, a glycoconjugate derived from S. pneumoniae serotype 11A, and a glycoconjugate derived from S. pneumoniae serotype 8.

2. 2. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B.

3. 3. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 22F.

4. 4. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 33F.

5. 5. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 12F.

6. 6. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 10A.

7. 7. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 11A.

8. 8. The immunogenic composition of claim 1, comprising at least one glycoconjugate derived from S. pneumoniae serotype 8.

9. 1. An immunogenic composition comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B, at least one glycoconjugate derived from S. pneumoniae serotype 22F, and at least one glycoconjugate derived from S. pneumoniae serotype 33F.

10. At least one glycoconjugate derived from S. pneumoniae serotype 15B, at least one glycoconjugate derived from S. pneumoniae serotype 22F , at least one glycoconjugate derived from S. pneumoniae serotype 33F, at least one glycoconjugate derived from S. pneumoniae serotype 12F, at least one glycoconjugate derived from S. pneumoniae serotype 10A, at least one glycoconjugate derived from S. pneumoniae serotype 11A, and at least one glycoconjugate derived from S. pneumoniae serotype 8.

11. An immunogenic composition comprising at least one glycoconjugate derived from S. pneumoniae serotype 15B.

12. 12. The immunogenic composition of claim 11, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 22F.

13. 13. The immunogenic composition of any one of claims 11 to 12, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 33F.

14. 14. The immunogenic composition of any one of claims 11 to 13, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 12F.

15. 15. The immunogenic composition of any one of claims 11 to 14, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 10A.

16. 16. The immunogenic composition of any one of claims 11 to 15, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 11A.

17. 17. The immunogenic composition of any one of claims 11 to 16, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 8.

18. 18. The immunogenic composition of any one of claims 1 to 17, further comprising glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.

19. 19. The immunogenic composition of any one of claims 1 to 18, further comprising glycoconjugates derived from S. pneumoniae serotypes 1, 5 and 7F.

20. 20. The immunogenic composition of any one of claims 1 to 19, further comprising glycoconjugates derived from S. pneumoniae serotypes 6A and 19A.

21. 21. Any one of claims 1 to 20, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 3. The immunogenic composition described in

22. 22. The immunogenic composition of any one of claims 1 to 21, which is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 valent pneumococcal conjugate composition.

23. 22. The immunogenic composition of any one of claims 1 to 21, which is a 14, 15, 16, 17, 18 or 19 valent pneumococcal conjugate composition.

24. 22. The immunogenic composition of any one of claims 1 to 21, which is a 16-valent pneumococcal conjugate composition.

25. 22. The immunogenic composition of any one of claims 1 to 21, which is a 19-valent pneumococcal conjugate composition.

26. 22. The immunogenic composition of any one of claims 1 to 21, which is a 20-valent pneumococcal conjugate composition.

27. The glycoconjugate is a CRM １９７ 27. The immunogenic composition of any one of claims 1 to 26, wherein the antibody is individually conjugated to:

28. All glycoconjugates are CRM １９７ 27. The immunogenic composition of any one of claims 1 to 26, wherein the antibody is individually conjugated to:

29. 27. The immunogenic composition of any one of claims 19 to 26, wherein glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD.

30. 30. The immunogenic composition of any one of claims 18 to 26 or 29, wherein the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT.

31. 31. The immunogenic composition of any one of claims 18 to 26 or 29 to 30, wherein the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

32. 32. The immunogenic composition of any one of claims 2, 9 to 31, wherein the serotype 15B glycoconjugate has a molecular weight of 1000 kDa to 20,000 kDa.

33. 33. The immunogenic composition of any one of claims 2, 9 to 32, wherein the serotype 15B glycoconjugate has a molecular weight of 10,000 kDa to 16,000 kDa.

34. 34. The immunogenic composition of any one of claims 2, 9 to 33, wherein the ratio (w / w) of serotype 15B capsular polysaccharide to carrier protein in the serotype 15B glycoconjugate is 0.5 to 3.

35. 34. The immunogenic composition of any one of claims 2, 9 to 33, wherein the ratio (w / w) of serotype 15B capsular polysaccharide to carrier protein in the serotype 15B glycoconjugate is between 0.7 and 0.

9.

36. 36. The immunogenic composition of any one of claims 2, 9 to 35, wherein the serotype 15B glycoconjugate comprises less than about 50% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide.

37. At least 40% of serotype 15B glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. ｄ 37. The immunogenic composition of any one of claims 2, 9 to 36, having the following structure:

38. 38. The immunogenic composition of any one of claims 2, 9 to 37, wherein the serotype 15B glycoconjugate comprises at least 0.1 mM acetate per mM serotype 15B capsular polysaccharide.

39. 38. The immunogenic composition of any one of claims 2, 9 to 37, wherein the serotype 15B glycoconjugate comprises at least 0.7 mM acetate per mM serotype 15B capsular polysaccharide.

40. 40. The immunogenic composition of any one of claims 2, 9 to 39, wherein the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.

6.

41. 41. The immunogenic composition of any one of claims 2, 9 to 40, wherein the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.

6.

42. 42. The immunogenic composition of any one of claims 2, 9 to 41, wherein the serotype 15B glycoconjugate comprises at least 0.1 mM glycerol per mM serotype 15B capsular polysaccharide.

43. 43. The immunogenic composition of any one of claims 2, 9-42, wherein the serotype 15B glycoconjugate comprises at least 0.5 mM glycerol per mM serotype 15B capsular polysaccharide.

44. 44. The immunogenic composition of any one of claims 2, 9-43, wherein the serotype 15B glycoconjugate comprises at least 0.7 mM glycerol per mM serotype 15B capsular polysaccharide.

45. 45. The immunogenic composition of any one of claims 2, 9 to 44, wherein the serotype 15B glycoconjugate has a degree of conjugation of 2 to 15.

46. 46. ​​The immunogenic composition of any one of claims 2, 9 to 45, wherein the serotype 15B glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 1,500 kDa.

47. The carrier protein of the serotype 15B glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ , other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

48. The carrier protein of the serotype 15B glycoconjugate is CRM １９７ 48. The immunogenic composition of any one of claims 2, 9 to 47, wherein

49. 49. The immunogenic composition of any one of claims 2, 9 to 48, wherein the serotype 15B glycoconjugate is prepared using reductive amination.

50. 50. The immunogenic composition of any one of claims 3, 9, 10, 12 to 49, wherein the serotype 22F glycoconjugate has a molecular weight of 400 kDa to 15,000 kDa.

51. 50. The immunogenic composition of any one of claims 3, 9, 10, 12 to 49, wherein the serotype 22F glycoconjugate has a molecular weight of 1,000 kDa to 8,000 kDa.

52. 52. The immunogenic composition of any one of claims 3, 9, 10, 12 to 51, wherein the ratio (w / w) of serotype 22F capsular polysaccharide to carrier protein in the serotype 22F glycoconjugate is 0.5 to 3.

53. 53. The immunogenic composition of any one of claims 3, 9, 10, 12 to 52, wherein the ratio (w / w) of serotype 22F capsular polysaccharide to carrier protein in the serotype 22F glycoconjugate is 0.9 to 1.

1.

54. 54. The immunogenic composition of any one of claims 3, 9, 10, 12 to 53, wherein the serotype 22F glycoconjugate comprises less than about 50% free serotype 22F capsular polysaccharide compared to the total amount of serotype 22F capsular polysaccharide.

55. At least 30% of serotype 22F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. ｄ 55. The immunogenic composition of any one of claims 3, 9, 10, 12 to 54, having the following structure:

56. 55. The immunogenic composition of any one of claims 3, 9, 10, 12-54, wherein the serotype 22F glycoconjugate comprises at least 0.1 mM acetate per mM serotype 22F capsular polysaccharide.

57. 57. The immunogenic composition of any one of claims 3, 9, 10, 12-56, wherein the serotype 22F glycoconjugate comprises at least 0.7 mM acetate per mM serotype 22F capsular polysaccharide.

58. 58. The immunogenic composition of any one of claims 3, 9, 10, 12 to 57, wherein the ratio of mM acetate per mM serotype 22F capsular polysaccharide in the serotype 22F glycoconjugate to mM acetate per mM serotype 22F capsular polysaccharide in the isolated polysaccharide is at least 0.

6.

59. 59. The immunogenic composition of any one of claims 3, 9, 10, 12 to 58, wherein the ratio of mM acetate per mM serotype 22F capsular polysaccharide in the serotype 22F glycoconjugate to mM acetate per mM serotype 22F capsular polysaccharide in the activated polysaccharide is at least 0.

6.

60. 60. The immunogenic composition of any one of claims 3, 9, 10, 12 to 59, wherein the serotype 22F glycoconjugate has a degree of conjugation of 2 to 15.

61. 61. The immunogenic composition of any one of claims 3, 9, 10, 12 to 60, wherein the serotype 22F glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 2,000 kDa.

62. The carrier protein of the serotype 22F glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ 62. The immunogenic composition of any one of claims 3, 9, 10, 12 to 61, wherein the immunogenic composition is selected from the group consisting of: other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

63. The carrier protein of the serotype 22F glycoconjugate is CRM １９７ 63. The immunogenic composition of any one of claims 3, 9, 10, 12 to 62, wherein

64. 64. The immunogenic composition of any one of claims 3, 9, 10, 12 to 63, wherein the serotype 22F glycoconjugate is prepared using reductive amination. Immunogenic compositions of the present invention.

65. 65. The immunogenic composition of any one of claims 4, 9, 10, 13 to 64, wherein the serotype 33F glycoconjugate has a molecular weight of 50 kDa to 20,000 kDa.

66. 66. The immunogenic composition of any one of claims 4, 9, 10, 13 to 65, wherein the serotype 33F glycoconjugate has a molecular weight of 1,000 kDa to 5,000 kDa.

67. 67. The immunogenic composition of any one of claims 4, 9, 10, 13 to 66, wherein the ratio (w / w) of serotype 33F capsular polysaccharide to carrier protein in the serotype 33F glycoconjugate is 0.2 to 4.

68. 68. The immunogenic composition of any one of claims 4, 9, 10, 13 to 67, wherein the ratio (w / w) of serotype 33F capsular polysaccharide to carrier protein in the serotype 33F glycoconjugate is between 0.4 and 1.

7.

69. 69. The immunogenic composition of any one of claims 4, 9, 10, 13 to 68, wherein the serotype 33F glycoconjugate comprises less than about 40% free serotype 33F capsular polysaccharide compared to the total amount of serotype 33F capsular polysaccharide.

70. At least 35% of serotype 33F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. ｄ 70. The immunogenic composition of any one of claims 4, 9, 10, 13 to 69, having the formula:

71. 71. The immunogenic composition of any one of claims 4, 9, 10, 13 to 70, wherein the serotype 33F glycoconjugate comprises at least 0.1 mM acetate per mM serotype 33F capsular polysaccharide.

72. 72. The immunogenic composition of any one of claims 4, 9, 10, 13 to 71, wherein the serotype 33F glycoconjugate comprises at least 0.7 mM acetate per mM serotype 33F capsular polysaccharide.

73. Acetate per mM of serotype 33F capsular polysaccharide in serotype 33F glycoconjugate 73. The immunogenic composition of any one of claims 4, 9, 10, 13 to 72, wherein the ratio of mM of serotype 33F capsular polysaccharide to mM of acetate per mM of serotype 33F capsular polysaccharide in the isolated polysaccharide is at least 0.

6.

74. 74. The immunogenic composition of any one of claims 4, 9, 10, 13 to 73, wherein the ratio of mM acetate per mM serotype 33F capsular polysaccharide in the serotype 33F glycoconjugate to mM acetate per mM serotype 33F capsular polysaccharide in the activated polysaccharide is at least 0.

6.

75. 75. The immunogenic composition of any one of claims 4, 9, 10, 13 to 74, wherein the serotype 33F glycoconjugate has a degree of conjugation of 2 to 20.

76. 76. The immunogenic composition of any one of claims 4, 9, 10, 13 to 75, wherein the serotype 33F glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 2,000 kDa.

77. 77. The immunogenic composition of any one of claims 4, 9, 10, 13 to 76, wherein the serotype 33F glycoconjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 2 to 25 saccharide repeat units.

78. The carrier protein of the serotype 33F glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ 80. The immunogenic composition of any one of claims 4, 9, 10, 13 to 77, wherein the antibody is selected from the group consisting of: , other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

79. The carrier protein of the serotype 33F glycoconjugate is CRM １９７ 79. The immunogenic composition of any one of claims 4, 9, 10, 13 to 78, wherein

80. 80. The immunogenic composition of any one of claims 4, 9, 10, 13 to 79, wherein the serotype 33F glycoconjugate is prepared using reductive amination.

81. 80. The immunogenic composition of any one of claims 4, 9, 10, 13-79, wherein the serotype 33F glycoconjugate is prepared using eTEC conjugation.

82. The serotype 33F glycoconjugate has the general formula (I): 【Chemical 1】 81. The immunogenic composition of claim 80, represented by the formula: (wherein the atoms that make up the eTEC spacer are contained in the central box).

83. 83. The immunogenic composition of any one of claims 5, 10, 14 to 82, wherein the serotype 12F glycoconjugate has a molecular weight of 50 kDa to 20,000 kDa.

84. 84. The immunogenic composition of any one of claims 5, 10, 14 to 83, wherein the serotype 12F glycoconjugate has a molecular weight of 500 kDa to 5,000 kDa.

85. 85. The immunogenic composition of any one of claims 5, 10, 14 to 84, wherein the ratio (w / w) of serotype 12F capsular polysaccharide to carrier protein in the serotype 12F glycoconjugate is 0.2 to 4.

86. 86. The immunogenic composition of any one of claims 5, 10, 14 to 85, wherein the ratio (w / w) of serotype 12F capsular polysaccharide to carrier protein in the serotype 12F glycoconjugate is between 0.8 and 1.

8.

87. 87. The immunogenic composition of any one of claims 5, 10, 14 to 86, wherein the serotype 22F glycoconjugate comprises less than about 50% free serotype 12F capsular polysaccharide compared to the total amount of serotype 12F capsular polysaccharide.

88. At least 35% of serotype 12F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. ｄ 88. The immunogenic composition of any one of claims 5, 10, 14 to 87, having the following structure:

89. 89. The immunogenic composition of any one of claims 5, 10, 14 to 88, wherein the serotype 12F glycoconjugate has a degree of conjugation of 2 to 20.

90. 90. The immunogenic composition of any one of claims 5, 10, 14 to 89, wherein the serotype 12F glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 2,000 kDa.

91. 91. The immunogenic composition of any one of claims 5, 10, 14 to 90, wherein the serotype 12F glycoconjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 2 to 25 saccharide repeat units.

92. The carrier protein of the serotype 12F glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ 92. The immunogenic composition of any one of claims 5, 10, 14 to 91, wherein the immunogenic composition is selected from the group consisting of: other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

93. The carrier protein of the serotype 12F glycoconjugate is CRM １９７ 92. The immunogenic composition of any one of claims 5, 10, 14 to 91, wherein

94. 94. The immunogenic composition of any one of claims 5, 10, 14-93, wherein the serotype 12F glycoconjugate is prepared using reductive amination.

95. 95. The immunogenic composition of any one of claims 5, 10, 14-94, wherein the serotype 12F glycoconjugate is prepared using TEMPO / NCS reductive amination.

96. 96. The immunogenic composition of any one of claims 6, 10, 15 to 95, wherein the serotype 10A glycoconjugate has a molecular weight of 50 kDa to 20,000 kDa.

97. 97. The immunogenic composition of any one of claims 6, 10, 15 to 96, wherein the serotype 10A glycoconjugate has a molecular weight of 1,000 kDa to 10,000 kDa.

98. 98. The immunogenic composition of any one of claims 6, 10, 15 to 97, wherein the ratio (w / w) of serotype 10A capsular polysaccharide to carrier protein in the serotype 10A glycoconjugate is 0.5 to 3.

99. 99. The immunogenic composition of any one of claims 6, 10, 15 to 98, wherein the ratio (w / w) of serotype 10A capsular polysaccharide to carrier protein in the serotype 10A glycoconjugate is between 0.8 and 1.

2.

100. 100. The immunogenic composition of any one of claims 6, 10, 15-99, wherein the serotype 10A glycoconjugate comprises less than about 50% free serotype 10A capsular polysaccharide compared to the total amount of serotype 10A capsular polysaccharide.

101. At least 30% of serotype 10A glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. ｄ 101. The immunogenic composition of any one of claims 6, 10, 15 to 100, having the following structure:

102. 102. The immunogenic composition of any one of claims 6, 10, 15 to 101, wherein the serotype 10A glycoconjugate has a degree of conjugation of 2 to 15.

103. 103. The immunogenic composition of any one of claims 6, 10, 15 to 102, wherein the serotype 10A glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 2,000 kDa.

104. The carrier protein of the serotype 10A glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ 104. The immunogenic composition of any one of claims 6, 10, 15 to 103, wherein the antibody is selected from the group consisting of: other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

105. The carrier protein of the serotype 10A glycoconjugate is CRM １９７ 105. The immunogenic composition of any one of claims 6, 10, 15 to 104, wherein

106. 106. The immunogenic composition of any one of claims 6, 10, 15 to 105, wherein the serotype 10A glycoconjugate is prepared using reductive amination.

107. 107. The immunogenic composition of any one of claims 7, 10, 16 to 106, wherein the serotype 11A glycoconjugate has a molecular weight of 50 kDa to 20,000 kDa.

108. 108. The immunogenic composition of any one of claims 7, 10, 16 to 107, wherein the serotype 11A glycoconjugate has a molecular weight of 500 kDa to 20,000 kDa.

109. 109. The immunogenic composition of any one of claims 7, 10, 16 to 108, wherein the ratio (w / w) of serotype 11A capsular polysaccharide to carrier protein in the serotype 11A glycoconjugate is 0.2 to 4.

110. 110. The immunogenic composition of any one of claims 7, 10, 16 to 109, wherein the ratio (w / w) of serotype 11A capsular polysaccharide to carrier protein in the serotype 11A glycoconjugate is between 0.8 and 1.

6.

111. 111. The immunogenic composition of any one of claims 7, 10, 16 to 110, wherein the serotype 11A glycoconjugate comprises less than about 50% free serotype 11A capsular polysaccharide compared to the total amount of serotype 11A capsular polysaccharide.

112. At least 30% of serotype 11A glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. ｄ 112. The immunogenic composition of any one of claims 7, 10, 16 to 111, having the following structure:

113. 113. The immunogenic composition of any one of claims 7, 10, 16 to 112, wherein the serotype 11A glycoconjugate comprises at least 0.3 mM acetate per mM serotype 11A capsular polysaccharide.

114. 114. The immunogenic composition of any one of claims 7, 10, 16 to 113, wherein the serotype 11A glycoconjugate comprises at least 1.8 mM acetate per mM serotype 11A capsular polysaccharide.

115. 115. The immunogenic composition of any one of claims 7, 10, 16 to 114, wherein the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.

6.

116. 116. The immunogenic composition of any one of claims 7, 10, 16 to 115, wherein the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.

6.

117. 117. The immunogenic composition of any one of claims 7, 10, 16 to 116, wherein the serotype 11A glycoconjugate comprises at least 0.1 mM glycerol per mM serotype 11A capsular polysaccharide.

118. 118. The immunogenic composition of any one of claims 7, 10, 16 to 117, wherein the serotype 11A glycoconjugate comprises at least 0.4 mM glycerol per mM serotype 11A capsular polysaccharide.

119. 119. The immunogenic composition of any one of claims 7, 10, 16 to 118, wherein the serotype 11A glycoconjugate has a degree of conjugation of 1 to 15.

120. 120. The immunogenic composition of any one of claims 7, 10, 16 to 119, wherein the serotype 11A glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 2,000 kDa.

121. The carrier protein of the serotype 11A glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ 121. The immunogenic composition of any one of claims 7, 10, 16 to 120, wherein the antibody is selected from the group consisting of: other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

122. The carrier protein of the serotype 11A glycoconjugate is CRM １９７ 122. The immunogenic composition of any one of claims 7, 10, 16 to 121, wherein

123. 123. The immunogenic composition of any one of claims 7, 10, 16 to 122, wherein the serotype 11A glycoconjugate is prepared using reductive amination.

124. 124. The immunogenic composition of any one of claims 8, 10, 17 to 123, wherein the serotype 8 glycoconjugate has a molecular weight of 50 kDa to 20,000 kDa.

125. 125. The immunogenic composition of any one of claims 8, 10, 17 to 124, wherein the serotype 8 glycoconjugate has a molecular weight of 1,000 kDa to 15,000 kDa.

126. 126. The immunogenic composition of any one of claims 8, 10, 17 to 125, wherein the ratio (w / w) of serotype 8 capsular polysaccharide to carrier protein in the serotype 8 glycoconjugate is 0.2 to 4.

127. 127. The immunogenic composition of any one of claims 8, 10, 17 to 126, wherein the ratio (w / w) of serotype 8 capsular polysaccharide to carrier protein in the serotype 8 glycoconjugate is between 0.8 and 1.

5.

128. 128. The immunogenic composition of any one of claims 8, 10, 17 to 127, wherein the serotype 8 glycoconjugate comprises less than about 50% free serotype 8 capsular polysaccharide compared to the total amount of serotype 8 capsular polysaccharide.

129. At least 30% of serotype 8 glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. ｄ 129. The immunogenic composition of any one of claims 8, 10, 17 to 128, having the following structure:

130. 130. The immunogenic composition of any one of claims 8, 10, 17 to 129, wherein the serotype 8 glycoconjugate has a degree of conjugation of 2 to 20.

131. 131. The immunogenic composition of any one of claims 8, 10, 17 to 130, wherein the serotype 8 glycoconjugate comprises saccharides having a molecular weight of between 10 kDa and 2,000 kDa.

132. The carrier protein of the serotype 8 glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin), CRM １９７ 132. The immunogenic composition of any one of claims 8, 10, 17 to 131, wherein the immunogenic composition is selected from the group consisting of: other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof.

133. The carrier protein of the serotype 8 glycoconjugate is CRM １９７ 133. The immunogenic composition of any one of claims 8, 10, 17 to 132, wherein

134. 134. The immunogenic composition of any one of claims 8, 10, 17 to 133, wherein the serotype 8 glycoconjugate is prepared using reductive amination.

135. 135. The immunogenic composition of any one of claims 1 to 134, wherein each dose comprises 0.1 to 100 μg of polysaccharide of each serotype.

136. 135. The immunogenic composition of any one of claims 1 to 134, wherein each dose comprises 1 to 10 μg of polysaccharide of each serotype.

137. 137. The immunogenic composition of any one of claims 1 to 136, wherein each dose comprises about 1.0 μg, about 1.2 μg, about 1.4 μg, about 1.6 μg, about 1.8 μg, about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0 μg, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide for each particular glycoconjugate.

138. 135. The immunogenic composition of any one of claims 1 to 134, wherein each dose comprises from about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F, if present, and from about 3.0 μg to about 6.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B, if present.

139. 139. The immunogenic composition of any one of claims 1 to 138, wherein each dose comprises from 10 μg to 150 μg of carrier protein.

140. The carrier protein is a CRM １９７ 140. The immunogenic composition of any one of claims 1 to 139, wherein

141. Each dose may be about 25 μg, about 26 μg, about 27 μg, about 28 μg, about 29 μg, about 30 μg, about 31 μg, about 32 μg, about 33 μg, about 34 μg, about 35 μg, about 36 μg, about 37 μg, about 38 μg, about 39 μg, about 40 μg, about 41 μg, about 42 μg, about 43 μg, about 44 μg, about 45 μg, about 46 μg, about 47 μg, about 48 μg, about 49 μg, about 50 μg, about 51 μg, about 52 μg, about 53 μg, about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, about 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg, about 75 μg, about 76 μg, about 77 μg, about 78 μg, about 79 μg, about 80 μg, about 81 μg, about 82 μg, about 83 μg, about 84 μg, about 85 μg, about 86 μg, about 87 μg, about 88 μg, about 89 μg, about 90 μg, about 91 μg, about 92 μg, about 93 μg, about 94 μg, about 95 μg, about 96 μg, about 9 141. The immunogenic composition of any one of claims 1 to 140, comprising about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, about 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg or about 75 μg of carrier protein.

142. 142. The immunogenic composition of any one of claims 1 to 141, further comprising an antigen derived from another pathogen.

143. 143. The immunogenic composition of any one of claims 1 to 142, further comprising an antigen selected from diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P), which is typically acellular (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular saccharide (Hib), inactivated poliovirus vaccine (IPV).

144. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa.

145. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa-Hib.

146. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa-IPV.

147. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa-HBsAg.

148. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa-HBsAg-IPV.

149. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa-HBsAg-Hib.

150. 143. The immunogenic composition of any one of claims 1 to 142, further comprising DT-Pa-HBsAg-IPV-Hib.

151. 151. The immunogenic composition of any one of claims 1 to 150, further comprising a conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY).

152. 152. The immunogenic composition of any one of claims 1 to 151, further comprising a conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).

153. 153. The immunogenic composition of any one of claims 1 to 152, further comprising a conjugated Neisseria meningitidis (N. meningitidis) serogroup A capsular saccharide (MenA).

154. 154. The immunogenic composition of any one of claims 1 to 153, further comprising a conjugated Neisseria meningitidis serogroup W135 capsular saccharide (MenW135).

155. 151. The immunogenic composition of any one of claims 1 to 150, further comprising conjugated Neisseria meningitidis serogroup Y capsular saccharide (MenY) and conjugated Neisseria meningitidis serogroup C capsular saccharide (MenC).

156. 151. The immunogenic composition of any one of claims 1 to 150, further comprising a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

157. 151. The immunogenic composition of any one of claims 1 to 150, further comprising a conjugated N. meningitidis serogroup A capsular saccharide (MenA), a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

158. at least one adjuvant, most preferably an adjuvant disclosed herein 158. The immunogenic composition of any one of claims 1 to 157, further comprising any one of:

159. 158. The immunogenic composition of any one of claims 1 to 157, further comprising at least one adjuvant selected from the group consisting of alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.

160. 158. The immunogenic composition of any one of claims 1 to 157, further comprising at least one adjuvant selected from the group consisting of aluminum phosphate, aluminum sulfate, and aluminum hydroxide.

161. 158. The immunogenic composition of any one of claims 1 to 157, further comprising aluminum phosphate as an adjuvant.

162. 158. The immunogenic composition of any one of claims 1 to 157, further comprising aluminum sulfate as an adjuvant.

163. 158. The immunogenic composition of any one of claims 1 to 157, further comprising aluminum hydroxide as an adjuvant.

164. 158. The immunogenic composition of any one of claims 1 to 157, comprising 0.1 mg / mL to 1 mg / mL elemental aluminum in the form of aluminum phosphate as an adjuvant.

165. 158. The immunogenic composition of any one of claims 1 to 157, comprising 0.2mg / mL to 0.3mg / mL elemental aluminum in the form of aluminum phosphate as an adjuvant.

166. 158. The immunogenic composition of any one of claims 1 to 157, comprising about 0.25 mg / mL elemental aluminum in the form of aluminum phosphate as an adjuvant.

167. 167. The immunogenic composition of any one of claims 1 to 166, comprising a CpG oligonucleotide as an adjuvant, preferably any of the CpG oligonucleotides disclosed herein.

168. 168. The immunogenic composition of any one of claims 1 to 167, formulated in liquid form.

169. 168. The immunogenic composition of any one of claims 1 to 167, formulated in lyophilized form.

170. 168. The immunogenic composition of any one of claims 1 to 167, formulated in aqueous liquid form.

171. 171. The immunogenic composition of any one of claims 1 to 170, comprising one or more of the following, or any combination of two or more thereof: a buffer, a salt, a divalent cation, a non-ionic surfactant, a cryoprotectant such as a sugar, and an antioxidant such as a free radical scavenger or chelator.

172. 171. The immunogenic composition of any one of claims 1 to 170, comprising a buffer.

173. The immunogenic composition of claim 171, wherein the buffer has a pKa of about 3.5 to about 7.

5.

174. 174. The immunogenic composition of claim 172 or 173, wherein the buffer is phosphate, succinate, histidine or citrate.

175. The immunogenic composition of claim 172, wherein the buffer is a succinate buffer at a final concentration of 1 mM to 10 mM.

176. The immunogenic composition of claim 172, wherein the buffer is a succinate buffer at a final concentration of about 5 mM.

177. 177. The immunogenic composition of any one of claims 1 to 176, comprising a salt.

178. 178. The immunogenic composition of claim 177, wherein the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride, or a combination thereof.

179. The immunogenic composition of claim 177, wherein the salt is sodium chloride.

180. 178. The immunogenic composition of claim 177, comprising 150 mM sodium chloride.

181. 181. The immunogenic composition of any one of claims 1 to 180, comprising a surfactant.

182. The surfactant is polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 65, polysorbate 80, polysorbate 85, Triton N-1 182. The immunogenic composition of claim 181, wherein the immunogenic agent is selected from the group consisting of PEG-100, Triton X-100, oxytocinol 40, nonoxynol-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660, hydroxystearic acid, polyoxyethylene-35-ricinoleate, soy lecithin, and poloxamer.

183. The immunogenic composition of claim 181, wherein the surfactant is selected from the group consisting of polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 65, polysorbate 80, polysorbate 85 and poloxamer.

184. The immunogenic composition of claim 181, wherein the surfactant is polysorbate 80.

185. 185. The immunogenic composition of claim 184, wherein the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% weight / weight (w / w) polysorbate 80.

186. 185. The immunogenic composition of claim 184, wherein the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% weight / weight (w / w) polysorbate 80.

187. 185. The immunogenic composition of claim 184, wherein the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% weight / weight (w / w) polysorbate 80.

188. The final concentration of polysorbate 80 in the formulation was 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.11%, 0.12%, 0.13%, 0.14%, 0.15%, 0.16%, 0.17%, 0.18%, 0.19 185. The immunogenic composition of claim 184, wherein the polysorbate 80 is 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09% or 0.1% (w / w).

189. 189. The immunogenic composition of any one of claims 1 to 188, having a pH of 5.5 to 7.

5.

190. 189. The immunogenic composition of any one of claims 1 to 188, having a pH of 5.6 to 7.

0.

191. 189. The immunogenic composition of any one of claims 1 to 188, having a pH of 5.8 to 6.

0.

192. 281. A container filled with any of the immunogenic compositions of any one of claims 1-191 or 228-280.

193. 193. The container of claim 192, wherein the container is selected from the group consisting of a vial, a syringe, a flask, a fermentor, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable pen.

194. 194. The container of claim 192 or 193, which is siliconized.

195. 195. A container according to any one of claims 192 to 194, made from glass, metal (e.g., steel, stainless steel, aluminum, etc.) and / or polymer (e.g., thermoplastic, elastomer, thermoplastic elastomer).

196. 195. A container according to any one of claims 192 to 194, made from glass.

197. 281. A syringe filled with any of the immunogenic compositions of any one of claims 1-191 or 228-280.

198. 198. The syringe of claim 197, which is siliconized and / or made from glass.

199. 200. The container or syringe of any one of claims 192 to 198, filled with the immunogenic composition in a volume of 0.1 mL to 2 mL.

200. 199. The container or syringe of any one of claims 192 to 198, filled with a volume of about 0.5 ml of the immunogenic composition.

201. 281. The immunogenic composition of any one of claims 1 to 191 or 228 to 280 for use as a medicament.

202. 281. The immunogenic composition of any one of claims 1 to 191 or 228 to 280 for use as a vaccine.

203. 280. The immunogenic composition of any one of claims 1-191 or 228-280 for use in a method for preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject.

204. Claims for use in a method for preventing a bacterial infection, disease or condition in a subject The immunogenic composition of any one of claims 1 to 191 or 228 to 280.

205. An immunogenic composition according to any one of claims 1 to 191, 228 to 280 or 201 to 204 for use in a method for protecting or treating a human susceptible to pneumococcal infection by administering the immunogenic composition by a systemic or mucosal route.

206. 206. The immunogenic composition of claim 205, which is administered by intramuscular, intraperitoneal, intradermal or subcutaneous route.

207. The immunogenic composition of claim 205, which is administered by intramuscular, intraperitoneal, intradermal or subcutaneous injection.

208. A method for preventing, treating, or ameliorating an infection, disease, or condition associated with Streptococcus pneumoniae (S. pneumoniae) in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of any one of claims 1-191 or 228-280.

209. A method for preventing infection by Streptococcus pneumoniae (S. pneumoniae) in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition described in any one of claims 1 to 191 or 228 to 280.

210. 208. The immunogenic composition of any one of claims 1 to 191, 228 to 280 or 201 to 207 for use as a vaccine, wherein the subject to be vaccinated is a human under the age of 1 year.

211. 208. The immunogenic composition of any one of claims 1 to 191, 228 to 280 or 201 to 207 for use as a vaccine, wherein the subject to be vaccinated is a human under the age of 2.

212. 208. The immunogenic composition of any one of claims 1 to 191, 228 to 280 or 201 to 207 for use as a vaccine, wherein the subject to be vaccinated is an adult aged 50 or over.

213. 216. The immunogenic composition of any one of claims 1 to 191, 228 to 280, 201 to 207, or 210 to 212 for use as a vaccine, wherein the subject to be vaccinated is an immunocompromised human.

214. 216. The immunogenic composition of any one of claims 1 to 191, 228 to 280, 201 to 207, or 210 to 212 for use in a single dose schedule.

215. 213. The immunogenic composition of any one of claims 1 to 191, 228 to 280, 201 to 207, or 210 to 212 for use in a multiple dose schedule.

216. 216. The immunogenic composition of claim 215, wherein said multiple dose schedule consists of a series of two doses separated by intervals of about one month to about two months.

217. 216. The immunogenic composition of claim 215, wherein said multiple dose schedule consists of a series of three doses separated by intervals of about one month to about two months.

218. 216. The immunogenic composition of claim 215, wherein said multiple dose schedule consists of a series of three doses separated by intervals of about one month to about two months, followed by a fourth dose about ten months to about thirteen months after the first dose.

219. 216. The immunogenic composition of claim 215, wherein the multiple dose schedule consists of at least one dose in the first year of life, followed by at least one infant dose.

220. 216. The immunogenic composition of claim 215, wherein said multiple dose schedule consists of a series of two or three doses separated by intervals of about one month to about two months beginning at two months of age, followed by an infant dose at 12 to 18 months of age.

221. 216. The immunogenic composition of claim 215, wherein said multiple dose schedule consists of a four dose series of vaccine at 2, 4, 6 and 12-15 months of age.

222. 222. The immunogenic composition of any one of claims 2-191, 201-207, or 210-221, which, when administered to a subject, is capable of inducing the formation of antibodies capable of binding to S. pneumoniae serotypes 15B and 15C as measured by a standard ELISA assay.

223. 222. The immunogenic composition of any one of claims 2-191, 201-207, or 210-221, which, when administered to a subject, is capable of inducing the formation of antibodies capable of killing S. pneumoniae serotype 15B in an opsonophagocytosis assay.

224. 222. The immunogenic composition of any one of claims 2-191, 201-207, or 210-221, which, when administered to a subject, is capable of inducing the formation of antibodies capable of killing S. pneumoniae serotypes 15B and 15C in an opsonophagocytosis assay.

225. 22. A method of treating or preventing a S. pneumoniae infection, disease or condition associated with S. pneumoniae serotypes 15A, 15B and / or 15C in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 2-191, 201-207, or 210-221.

226. 22. A method for preventing S. pneumoniae infection associated with S. pneumoniae serotypes 15B and / or 15C in a subject, comprising administering a prophylactically effective amount of the immunogenic composition of any one of claims 2-191, 201-207, or 210-221.

227. Protecting a subject against infection by Streptococcus pneumoniae (S. pneumoniae), and / or preventing infection by Streptococcus pneumoniae (S. pneumoniae), and / or reducing the severity of or delaying the onset of at least one symptom associated with infection caused by Streptococcus pneumoniae (S. pneumoniae), and / or protecting a subject against infection by serotypes 15A, 15B and / or 15C (preferably 15B and / or 15C, more preferably 15B) ...serotypes 15A, 15B and / or 15C 222. The immunogenic composition of any one of claims 2 to 191, 201 to 207, or 210 to 221 for use in a method for preventing infection by serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) Streptococcus pneumoniae and / or for reducing the severity of or delaying the onset of at least one symptom associated with infection caused by serotype 15A, 15B, and / or 15C (preferably 15B and / or 15C, more preferably 15B) Streptococcus pneumoniae.

228. 192. The immunogenic composition of any one of claims 1 to 191, which does not comprise capsular saccharides derived from S. pneumoniae serotype 9N.

229. 192. The immunogenic composition of any one of claims 1 to 191, wherein the composition does not comprise capsular saccharides derived from S. pneumoniae serotype 9A.

230. 192. The immunogenic composition of any one of claims 1 to 191, wherein the composition does not comprise capsular saccharides derived from S. pneumoniae serotype 9L.

231. 192. The immunogenic composition of any one of claims 1 to 191, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9N and 9A.

232. 192. The immunogenic composition of any one of claims 1 to 191, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9N and 9L.

233. 192. The immunogenic composition of any one of claims 1 to 191, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9A and 9L.

234. 192. The immunogenic composition of any one of claims 1 to 191, which does not comprise capsular saccharides from S. pneumoniae serotypes 9N, 9A and 9L.

235. 18. The immunogenic composition of any one of claims 1 to 17, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 9V.

236. 236. The immunogenic composition of claim 235, further comprising glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 14, 18C, 19F and 23F.

237. 237. The immunogenic composition of claim 235 or 236, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 1.

238. 238. Any of claims 235 to 237, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 5. The immunogenic composition described in any one of claims 1 to 4.

239. 239. The immunogenic composition of any one of claims 235 to 238, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 7F.

240. 240. The immunogenic composition of any one of claims 235 to 239, further comprising glycoconjugates derived from S. pneumoniae serotypes 1, 5 and 7F.

241. 241. The immunogenic composition of any one of claims 235 to 240, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 6A.

242. 242. The immunogenic composition of any one of claims 235 to 241, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 19A.

243. 241. The immunogenic composition of any one of claims 235 to 240, further comprising glycoconjugates derived from S. pneumoniae serotypes 6A and 19A.

244. 244. The immunogenic composition of any one of claims 235 to 243, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 3.

245. 245. The immunogenic composition of any one of claims 1-191 or 235-244, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 2.

246. 246. The immunogenic composition of any one of claims 1-191 or 235-245, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 17F.

247. 247. The immunogenic composition of any one of claims 1-191 or 235-246, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 20.

248. 245. The immunogenic composition of any one of claims 1-191 or 235-244, further comprising glycoconjugates derived from S. pneumoniae serotypes 2, 17F and 20.

249. 249. The immunogenic composition of any one of claims 1-191 or 235-248, further comprising at least one glycoconjugate derived from S. pneumoniae serotype 15C.

250. 250. The immunogenic composition of any one of claims 235 to 249, which does not comprise capsular saccharides derived from S. pneumoniae serotype 9N.

251. 250. The immunogenic composition of any one of claims 235-249, wherein the composition does not comprise capsular saccharides derived from S. pneumoniae serotype 9A.

252. 250. The immunogenic composition of any one of claims 235-249, wherein the composition does not comprise capsular saccharides derived from S. pneumoniae serotype 9L.

253. 250. The immunogenic composition of any one of claims 235-249, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9N and 9A.

254. 250. The immunogenic composition of any one of claims 235-249, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9N and 9L.

255. 250. The immunogenic composition of any one of claims 235-249, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9A and 9L.

256. 250. The immunogenic composition of any one of claims 235-249, wherein the composition does not comprise capsular saccharides from S. pneumoniae serotypes 9N, 9A and 9L.

257. 257. The immunogenic composition of any one of claims 235 to 256, which is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24-valent pneumococcal conjugate composition.

258. 257. The immunogenic composition of any one of claims 235 to 256, which is a 14, 15, 16, 17, 18, 19 or 20 valent pneumococcal conjugate composition.

259. 257. The immunogenic composition of any one of claims 235 to 256, which is a 16-valent pneumococcal conjugate composition.

260. 257. The immunogenic composition of any one of claims 235 to 256, which is a 20-valent pneumococcal conjugate composition.

261. The glycoconjugate is a CRM １９７ 261. The immunogenic composition of any one of claims 235 to 260, wherein the immunogenic composition is individually conjugated to:

262. All glycoconjugates are CRM １９７ 261. The immunogenic composition of any one of claims 235 to 260, wherein the immunogenic composition is individually conjugated to:

263. 261. The immunogenic composition of any one of claims 235 to 260, wherein glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are individually conjugated to PD.

264. Claims 236-260: A glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT.

263. The immunogenic composition of any one of claims 263 to 264.

265. 265. The immunogenic composition of any one of claims 236-260 or 264, wherein a glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

266. 266. The immunogenic composition of any one of claims 235 to 265, wherein the serotype 15B glycoconjugate, if present, is as described in any one of claims 32 to 49.

267. 267. The immunogenic composition of any one of claims 235 to 266, wherein the serotype 22F glycoconjugate, if present, is as described in any one of claims 50 to 64.

268. 268. The immunogenic composition of any one of claims 235 to 267, wherein the serotype 33F glycoconjugate, if present, is as described in any one of claims 65 to 82.

269. 269. The immunogenic composition of any one of claims 235 to 268, wherein the serotype 12F glycoconjugate, if present, is as described in any one of claims 83 to 95.

270. 269. The immunogenic composition of any one of claims 235 to 269, wherein the serotype 10A glycoconjugate, if present, is as described in any one of claims 96 to 106.

271. 271. The immunogenic composition of any one of claims 235 to 270, wherein the serotype 11A glycoconjugate, if present, is as described in any one of claims 107 to 123.

272. 272. The immunogenic composition of any one of claims 235 to 271, wherein the serotype 8 glycoconjugate, if present, is as described in any one of claims 124 to 134.

273. 273. The immunogenic composition of any one of claims 228 to 272, wherein each dose comprises from 0.1 μg to 100 μg of polysaccharide of each serotype.

274. 274. The immunogenic composition of any one of claims 228 to 273, wherein each dose comprises 10 μg to 150 μg of carrier protein.

275. 275. The immunogenic composition of any one of claims 228 to 274, further comprising antigens derived from other pathogens.

276. 275. The immunogenic composition of any one of claims 228 to 274, further comprising an antigen of any one of claims 143 to 157.

277. 277. The immunogenic composition of any one of claims 228 to 276, further comprising at least one adjuvant, most preferably any adjuvant disclosed herein.

278. Selected from the group consisting of aluminum phosphate, aluminum sulfate, and aluminum hydroxide 277. The immunogenic composition of any one of claims 228 to 276, further comprising at least one adjuvant administered thereto.

279. 277. The immunogenic composition of any one of claims 228 to 276, further comprising aluminum phosphate as an adjuvant.

280. 277. The immunogenic composition of any one of claims 228 to 276, formulated as described in any one of claims 168 to 191.

281. 28. A method for inducing an immune response to S. pneumoniae serotypes 15A, 15B and / or 15C in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 2-191, 222-224 or 227-280.

282. A method for inducing an immune response to S. pneumoniae serotype 22F in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 3-191, 222-224 or 227-280.

283. A method for inducing an immune response to S. pneumoniae serotype 33F in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 4-191, 222-224 or 227-280.

284. 28. A method for inducing an immune response to S. pneumoniae serotype 12F in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 5-191, 222-224, or 227-280.

285. 28. A method for inducing an immune response to S. pneumoniae serotype 10A in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 6-191, 222-224, or 227-280.

286. 28. A method for inducing an immune response against S. pneumoniae serotype 11A in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 7-191, 222-224 or 227-280.

287. 28. A method for inducing an immune response against S. pneumoniae serotype 8 in a subject, comprising administering a therapeutically or prophylactically effective amount of the immunogenic composition of any one of claims 8-191, 222-224, or 227-280.

Images