Methods for creating synthetic chromosomes expressing biosynthetic pathways and uses thereof

Abstract

To provide compositions and methods capable of delivering and expressing multiple genes from a biosynthetic pathway in a recipient cell using a synthetic chromosome.SOLUTION: A method comprises: transfecting a recipient cell line with synthetic chromosome production components including nucleic acid sequences that allow site-specific integration of target nucleic acid sequences; producing a synthetic platform chromosome with multiple site-specific recombination sites; transfecting the recipient cell line with a delivery vector including multiple genes having the ability to realize a biosynthetic pathway; activating site-specific recombination between the synthetic platform chromosome and the delivery vector, so that the multiple genes having the ability to realize the biosynthetic pathway are loaded onto the synthetic platform chromosome to produce a synthetic chromosome expressing the biosynthetic pathway; and isolating a recipient cell including the synthetic chromosome expressing the biosynthetic pathway.SELECTED DRAWING: None

Description

[Technical field]

[0001] The field of the invention includes methods for engineering synthetic chromosomes to allow for the delivery of multiple genes from a biosynthetic pathway to a recipient cell. [Background technology]

[0002] In the following discussion, certain objects and methods are described by way of background and introduction. Nothing contained herein should be construed as an "admission" of prior art. Applicants expressly reserve the right to demonstrate, where appropriate, that the objects and methods referenced herein do not constitute prior art under applicable statutory and regulatory provisions.

[0003] Current methods to engineer cells to incorporate and express multiple genes, e.g., genes that confer the ability to produce cellular metabolic products, such as amino acids, nucleic acids, glycoproteins, etc., rely on either viral or plasmid-based nucleic acid delivery technologies. However, in many cases, the expression and functional orchestration of multiple gene products that constitute a biochemical metabolic synthesis pathway is required for a cell to be able to produce such metabolic products. For example, many mammalian cells lack the necessary enzymes required to make essential amino acids. To enable the cell to make these amino acids, the cell must be engineered to express heterologous genes found in fungi or bacteria; however, due to the limited payload capacity of viral and plasmid nucleic acid vector delivery systems, multiple repeated transfection or transduction events are required to create an entire biochemical or biosynthetic pathway in the recipient cell. Summary of the Invention [Problem to be solved by the invention]

[0004] The ability to create fully functional mammalian synthetic chromosomes represents a powerful system for cell-based correction of genetic disorders and engineering biological pathways. Fully functional mammalian synthetic chromosomes offer several advantages over bacterial and viral delivery systems, including increased payload size, avoidance of potential host cell destruction due to extrachromosomal maintenance, avoidance of transcriptional silencing of introduced genes and potential immunological complications, and mammalian synthetic chromosomes can be derived and tailored from the species in which the synthetic chromosome is to be inserted. There is a need in the art for compositions and methods that allow for the production of metabolites by delivering and expressing multiple genes from biosynthetic pathways in cells. The present invention provides methods and compositions that address this need. [Means for solving the problem]

[0005] This Summary is provided to introduce in a concise form a selection of concepts further described below in the Detailed Description. This Summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will be apparent from the following detailed description, including the aspects illustrated in the accompanying drawings and defined in the appended claims.

[0006] The present invention encompasses compositions and methods for delivering and expressing multiple genes from one or more biosynthetic pathways in a recipient cell using synthetic chromosomes. The pathways may include 1) those known to produce a specific end product; 2) novel pathways created by the incorporation of existing genes in new combinations and / or expression of existing genes in a new cell type that produce a specific end product that may be novel to the cell type producing the end product; or 3) novel pathways created by the incorporation of new genes alone or in combination with existing genes that produce a novel end product.

[0007] Thus, in one embodiment, a method of the invention provides a method for constructing a biosynthetic pathway in a recipient cell, the method comprising the steps of: transfecting a recipient cell line with synthetic chromosome generating components comprising a nucleic acid sequence enabling site-specific integration of a target nucleic acid sequence; generating a synthetic platform chromosome having a plurality of site-specific recombination sites; transfecting a recipient cell line with a delivery vector comprising a plurality of genes capable of realizing the biosynthetic pathway, the delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the delivery vector, wherein the plurality of genes capable of realizing the biosynthetic pathway are loaded into the synthetic platform chromosome to generate a synthetic chromosome expressing the biosynthetic pathway; and isolating a recipient cell comprising the synthetic chromosome expressing the biosynthetic pathway.

[0008] In some aspects of this embodiment, the plurality of genes capable of implementing a biosynthetic pathway includes genes required for tryptophan biosynthesis, and in some aspects, the genes required for tryptophan biosynthesis are derived from Saccharomyces cerevisiae. It contains the five genes required for the synthesis of tryptophan in Saccharomyces cerevisiae.

[0009] In some aspects of this embodiment, in addition to delivering multiple genes capable of implementing a biosynthetic pathway, the delivery vector further comprises one or more of: a) one or more genes that interfere with or block the ability of tumor cells to inhibit immune cell cycle progression; b) one or more genes that encode factors that enhance immune cell activation and growth; or c) one or more genes that increase the specificity of immune cells for the developing tumor.

[0010] In yet other aspects of this embodiment, the method further comprises isolating a synthetic chromosome expressing the biosynthetic pathway; and transferring the synthetic chromosome to a second recipient cell. In some aspects, the second recipient cell is selected from universal donor T cells or patient autologous T cells. Other aspects of the invention provide synthetic chromosomes expressing the biosynthetic pathway, and yet other aspects provide second recipient cells.

[0011] In some embodiments of the invention, the nucleic acid sequences enabling site-specific integration include attP, attB, attL, and attR or mutant versions of attP, attB, attL, and attR.

[0012] Other embodiments of the invention further include transfecting a recipient cell line with a second delivery vector comprising a plurality of genes capable of implementing a second biosynthetic pathway, the second delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the second delivery vector, where the plurality of genes capable of implementing the second biosynthetic pathway are loaded onto the synthetic platform chromosome to create a synthetic chromosome expressing the second biosynthetic pathway; and isolating a recipient cell comprising the synthetic chromosome expressing the second biosynthetic pathway. Some aspects of this embodiment further include isolating the synthetic chromosome expressing the second biosynthetic pathway; and transferring the synthetic chromosome expressing the second biosynthetic pathway into a second recipient cell.

[0013] These and other aspects and uses of the present invention are described in the detailed description. [Brief description of the drawings]

[0014] [Figure 1] FIG. 1 is a simplified schematic diagram of one embodiment of the method of the present invention, in which cell physiology is enhanced by production of biosynthetic pathway metabolites from synthetic chromosomes. [Diagram 2] A diagram showing BLoVeL-TSS_TrpPath. [Diagram 3] A diagram showing BLoVeL-TSS_AroPath. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The methods described herein may, unless otherwise indicated, employ conventional techniques and descriptions of molecular biology (including recombinant techniques), cell biology, biochemistry, and cell engineering techniques, all of which are within the skill of the art. Such conventional techniques include oligonucleotide synthesis, oligonucleotide hybridization and ligation, cell transformation and transduction, recombinant system engineering, transgenic animal and plant production, and human gene therapy. For specific illustrations of suitable techniques, reference may be made to the examples herein. However, it will be appreciated that equivalent conventional procedures may also be used. Such prior art and descriptions can be found in Genome Analysis: A Laboratory Manual Series, Vols. I-IV, Green et al., eds., 1999; Genetic Variation: A Laboratory Manual, Weiner et al., eds., 2007; Sambrook and Russell, Condensed Protocols from Molecular Cloning: A Laboratory Manual, 2006; and Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 2002 (all published by Cold Spring Harbor Laboratory Press); Protein Methods, Bollag et al., John Wiley & Sons, 2003; Sons, 1996; Nonviral Vectors for Gene Therapy, Wagner et al., eds., Academic Press, 1999;"Viral Vectors", Kaplift and Loewy, eds., Academic Press, 1995; "Immunology Methods Manual", Lefkovits, ed., Academic Press, 1997; "Gene Therapy Techniques, Applications and Regulations From Laboratory to Clinic", Meager, ed., John Wiley & Sons, 1999; "Gene Therapy", M. Giacca, Springer, 2010; "Gene Therapy Protocols", "Cell and Tissue Culture: Laboratory Procedures in Biotechnology", edited by LeDoux, Springer, 2008; "Cell and Tissue Culture: Laboratory Procedures in Biotechnology", edited by Doyle and Griffiths, John Wiley & Sons, 1998; "Mammalian Chromosome Engineering-Methods and Protocols", edited by G. Hadlaczky, Humana Press, 2011; "Essential Stem Cell Methods", edited by Lanza and Klimanskaya, Academic Press, 2012; Press, 2011; "Stem Cell Therapies: Opportunities for Ensuring Quality and Safety in Clinical Delivery: Joint Workshop Abstracts" "The Quality and Safety of Clinical Offerings: Summary of a Joint Workshop," Board on Health Sciences Policy, National Academies Press, 2014; "Essentials of Stem Cell Biology," "Cell Biology", 3rd Edition, Lanza and Atala, eds., Academic Press, 2013; and "Handbook of Stem Cells", Atala and Lanza, eds., Academic Press, 2012, all of which are incorporated herein by reference in their entirety for all purposes. Before describing the present compositions, research tools and methods, it should be understood that the invention is not limited to the particular methods, compositions, targets and uses described, which may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is limited only by the appended claims.

[0016] It should be noted that as used in this specification and the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a composition" refers to a composition or mixture of compositions, and reference to "an assay" includes reference to equivalent steps and methods known to those skilled in the art, and so forth.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing the devices, compositions and methodologies that are described in the publications and that may be used in connection with the inventions described herein.

[0018] When a range of values ​​is provided, it is understood that each intermediate value between the upper and lower limits of that range, and any other stated or intermediate value in that stated range, is encompassed within the scope of the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, subject to any specifically excluded limit in the stated range. When a stated range includes both limits, a range excluding only one of those included limits is also included in the invention.

[0019] In the following description, numerous specific details are set forth to provide a more thorough understanding of the present invention. However, it will be apparent to one of ordinary skill in the art upon reading this specification that the present invention may be practiced without one or more of these specific details. In other instances, well-known features and procedures well known to those skilled in the art have not been described so as not to obscure the present invention.

[0020] definition Unless expressly stated, terms used herein are intended to have their plain and ordinary meaning as understood by those of ordinary skill in the art. The following definitions are intended to aid the reader in understanding the invention and are not intended to alter or otherwise limit the meaning of such terms unless specifically indicated.

[0021] "Bound" as used herein (e.g., in reference to a nucleic acid binding domain of a polypeptide) refers to a non-covalent interaction between a polypeptide and a nucleic acid. When referring to a non-covalent interaction, the polypeptide and the nucleic acid are said to be "associated," "interacting," or "bound." A binding interaction generally occurs over a 10-6 M~10 -15 It is characterized by a dissociation constant (Kd) less than M. "Affinity" refers to the strength of binding, with higher binding affinity being associated with a lower Kd.

[0022] By "binding domain" is meant a polypeptide or protein domain capable of non-covalently binding to another molecule. A binding domain can, for example, bind to a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein), and / or a protein molecule (a protein-binding protein).

[0023] A "centromere" is any nucleic acid sequence that confers the ability of a chromosome to segregate into daughter cells through cell division. A centromere can provide for stable segregation of a nucleic acid sequence through mitosis and meiosis, including synthetic chromosomes that contain a centromere. The centromere does not necessarily have to be from the same species as the cell into which it is introduced, but preferably the centromere has the ability to promote DNA segregation in cells of that species. A "dicentric" chromosome is a chromosome that contains two centromeres. A "formerly dicentric chromosome" is a chromosome that results when a dicentric chromosome fragments. A "chromosome" is a nucleic acid molecule - and associated proteins - that has the ability to replicate and segregate within a cell during cell division. Typically, a chromosome includes a centromere region, an origin of replication, a telomere region, and a nucleic acid region that is between the centromere and telomere regions. An "acrocentric chromosome" refers to a chromosome with unequal arm lengths.

[0024] A "coding sequence" or a sequence "encoding" a peptide is a nucleic acid molecule that is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are typically determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.

[0025] The term DNA "control sequences" collectively refers to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites, enhancers, and the like, which together provide for the replication, transcription and translation of a coding sequence in a recipient cell. Not all such control sequences need be present so long as the selected coding sequence is capable of being replicated, transcribed and translated in an appropriate host cell.

[0026] The term "realizing" a biosynthetic pathway refers to replicating known biosynthetic pathways as well as creating and implementing new biosynthetic pathways. "Endogenous chromosome" refers to a chromosome found in a cell prior to the creation or introduction of a synthetic chromosome.

[0027] As used herein, "euchromatin" refers to diffusely stained, typically gene-containing chromatin, and "heterochromatin" refers to chromatin that normally remains condensed and is considered transcriptionally inactive. Highly repetitive DNA sequences (satellite DNA) are usually located in regions of heterochromatin surrounding the centromere.

[0028] The terms "heterologous DNA" or "foreign DNA" (or "heterologous RNA" or "foreign RNA") are used interchangeably and refer to DNA or RNA that is not naturally occurring as part of the genome in which it is located or that is found in a genome or cell at one or more locations and / or in an amount different from that in which it occurs naturally. Examples of heterologous DNA include, but are not limited to, DNA that encodes one or more gene products of interest. Other examples of heterologous DNA include, but are not limited to, DNA that encodes traceable marker proteins as well as regulatory DNA sequences.

[0029] As used herein, the term "metabolite" refers to a naturally occurring metabolite (e.g., cholesterol), a heterologous metabolite (e.g., tryptophan in humans), an engineered metabolite (i.e., a novel artificial metabolite such as a chimeric protein or an engineered RNA interference molecule), or any other metabolite that confers altered function to a cell, for example, by enhancing or inhibiting a biosynthetic pathway.

[0030] "Operably linked" refers to an arrangement of elements that are configured so that the components so described perform their normal function. Thus, a control sequence operably linked to a coding sequence has the ability to effect expression of that coding sequence. A control sequence need not be contiguous with the coding sequence, so long as it functions to direct expression of the coding sequence. Thus, for example, there may be intervening sequences between a promoter sequence and a coding sequence that are not translated but are transcribed, and the promoter sequence can still be considered to be "operably linked" to the coding sequence. In fact, such sequences need not be on the same contiguous DNA molecule (i.e., chromosome), and yet have an interaction that results in a regulatory change.

[0031] A "promoter" or "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a polynucleotide or polypeptide coding sequence, such as messenger RNA, ribosomal RNA, small nuclear or nucleolar RNA, or any type of RNA transcribed by any class of RNA polymerase I, II, or III.

[0032] The recipient cell is a cell that receives the building blocks to create a synthetic chromosome, a synthetic platform chromosome, or a synthetic platform chromosome that has been bioengineered to contain a given set of DNA elements. The types of recipient cells can include, but are not limited to, stem cells, mesenchymal stem cells, adult-derived stem cells, T cells, immune cells, induced pluripotent stem cells, fibroblasts, endothelial cells, mesodermal, ectodermal and endodermal cells. They can also include tumor cells, cell culture lines, primary cells, and germ cells. The cells can then be, for example, cultured, prepared for transplantation, used to create a whole transgenic animal, etc.

[0033] A "recognition sequence" is a specific nucleotide sequence that is recognized and bound by a protein, DNA, or RNA molecule, or combination thereof, including but not limited to a restriction endonuclease, modification methylase, or recombinase. For example, the recognition sequence for Cre recombinase is a 34 base pair sequence called loxP, which contains two 13 base pair inverted repeats (which serve as recombinase binding sites) flanked by an 8 base pair core (see, e.g., Sauer, Current Opinion in Biotechnology, 5:521-527, 1994). Other examples of recognition sequences include, but are not limited to, attB and attP, attR and attL, and others, which are recognized by the recombinase enzyme bacteriophage lambda integrase. The recombination site, designated attB, is an approximately 33 base pair sequence that contains two 9 base pair core-type Int binding sites and a 7 base pair overlap region; attP is an approximately 240 base pair sequence that contains a core-type Int binding site and an arm-type Int binding site as well as sites for the auxiliary proteins IHF, FIS, and Xis (see, e.g., Landy, Current Opinion in Biotechnology, 3:699-7071, 1993).

[0034] "Recombinase" is an enzyme that catalyzes the exchange of DNA segments at specific recombination sites. Integrase refers to recombinases that are usually derived from viruses or transposons, and possibly even ancient viruses. "Recombination proteins" include excision proteins, integration proteins, enzymes, cofactors, and associated proteins involved in recombination reactions with one or more recombination sites (see Landy, Current Opinion in Biotechnology, vol. 3, pp. 699-707, 1993). The recombination proteins used in the methods herein can be delivered to cells via expression cassettes on suitable vectors, such as plasmids. In other embodiments, the recombination proteins can be delivered to cells in protein form in the same reaction mixture used to deliver the desired nucleic acid or nucleic acids. In yet other embodiments, the recombinase can also be encoded in the cells and expressed as needed using a tightly regulated inducible promoter.

[0035] "Ribosomal RNA" (rRNA) is a specialized RNA that forms part of the structure of the ribosome and is involved in protein synthesis. Ribosomal RNA is produced by transcription of genes that are present in multiple copies in eukaryotic cells. In human cells, about 250 copies of rRNA genes (i.e. genes that code for rRNA) per haploid genome are distributed in clusters on at least five different chromosomes (chromosomes 13, 14, 15, 21 and 22). In human cells, multiple copies of highly conserved rRNA genes are located in a series of tandemly arranged rDNA units, which are generally about 40-45 kb long and contain a transcribed region and a non-transcribed region known as spacer (i.e. intergenic spacer) DNA, which can vary in length and sequence.

[0036] As used herein, the term "selectable marker" refers to a gene introduced into a cell, particularly in the context of the present invention, a cell in culture, that confers a trait suitable for artificial selection. Selectable markers of general use are well known to those skilled in the art. In a preferred embodiment, the selectable markers used in the human synthetic chromosome system must be non-immunogenic in humans and include, but are not limited to, human nerve growth factor receptor (detected with MAb, as described in U.S. Pat. No. 6,365,373); truncated human growth factor receptor (detected with MAb); mutant human dihydrofolate reductase (DHFR; fluorescent MTX substrate available); secreted alkaline phosphatase (SEAP; fluorescent substrate available); human thymidylate synthase (TS; confers resistance to the anticancer drug fluorodeoxyuridine); human glutathione S-transferase alpha (GSTA1; conjugates glutathione to the stem cell-selective alkylating drug busulfan; CD34 + chemoprotective selectable markers in hematopoietic stem cells; CD24 cell surface antigen in hematopoietic stem cells; human CAD gene conferring resistance to N-phosphonacetyl-L-aspartic acid (PALA); human multidrug resistance 1 (MDR-1; P-glycoprotein surface protein selectable for increased drug resistance or enriched by FACS); human CD25 (IL-2α; detectable by Mab-FITC); methylguanine-DNA methyltransferase (MGMT; selectable by carmustine); and cytidine deaminase (CD; selectable by Ara-C). Drug selectable markers such as puromycin, hygromycin, blasticidin, G418, tetracycline, etc. may also be utilized. In addition, any fluorescent marker gene may be used for positive selection using FACs sorting, as well as chemiluminescent markers (e.g., Halotag), etc.

[0037] "Site-specific recombination" refers to site-specific recombination that occurs between two specific sites on a single nucleic acid molecule or between two different molecules, and requires the presence of an exogenous protein, such as an integrase or recombinase. Specific site-specific recombination systems can be used to specifically delete, invert, or insert DNA, with the exact events being controlled by the orientation of those specific sites, the particular system, and the presence of accessory proteins or factors. In addition, segments of DNA can be exchanged between chromosomes (chromosome arm exchange).

[0038] A "synthetic chromosome" (also called an "artificial chromosome") is a nucleic acid molecule, typically a DNA molecule, that has the capacity to accept and express a heterologous gene and that stably replicates and segregates together with an endogenous chromosome in a cell. A "mammalian synthetic chromosome" refers to a chromosome that has one or more active mammalian centromeres. A "human synthetic chromosome" refers to a chromosome that contains a centromere that functions in a human cell, and is preferably produced in a human cell. For exemplary artificial chromosomes, see, e.g., U.S. Pat. Nos. 8,389,802; 7,521,240; 6,025,155; 6,077,697; 5,891,691; 5,869,294; 5,721,118; 5,712,134; 5,695,967; and 5,288,625, as well as WO 97 / 40183 and WO 98 / 08964.

[0039] The terms "subject," "individual," or "patient" may be used interchangeably herein and may refer to mammals, and in some embodiments, humans. A "vector" is a replicon to which another DNA segment can be added, such as a plasmid, a phage, a viral construct, a cosmid, a bacterial artificial chromosome, a P-1 derived artificial chromosome, or a yeast artificial chromosome. In some cases, a vector can be a chromosome, such as when exchanging arms from one endogenous chromosome to a synthetic chromosome that has been engineered to contain a recombination site. Vectors are used to transduce and express DNA segments in cells.

[0040] invention The present invention encompasses compositions and methods that allow the production of metabolic products by delivering and expressing multiple genes from a biosynthetic pathway in a cell. The large carrying capacity of synthetic chromosomes allows the delivery and expression of multiple gene products, specifically multiple genes from one or more biosynthetic pathways, thereby circumventing the limitations of viral and plasmid-based nucleic acid delivery. The present invention provides methods and compositions in which the coordinated expression and function of multiple genes in a biochemical pathway allows the production of a metabolic product (or more than one metabolic product) required for its synthesis, thereby enhancing and enhancing the cellular physiology of the recipient cell. Pathways may include 1) those known to produce a specific end product; 2) novel pathways created by the incorporation of existing genes in a new combination and / or expression of existing genes in a new cell type that produces a specific end product that may be novel to the cell type producing the end product; or 3) novel pathways created by the incorporation of new genes alone or in combination with existing genes that produce a new end product. Thus, the methods and compositions of the invention are capable of engineering cells to synthesize metabolites that are absent or synthesized at suboptimal levels in cells, and are applicable to all methods of synthetic chromosome production, including "top-down" approaches, "bottom-up" approaches, engineering of naturally occurring minichromosomes, and inducible de novo chromosome generation by targeted amplification of specific chromosomal segments, all of which are discussed in more detail below.

[0041] Figure 1 is a simplified schematic diagram of one embodiment of a method of the invention for functionally enhancing the biosynthetic capacity of a cell. Figure 1 shows a synthetic platform chromosome within a cell. A delivery vector carrying genes of a biosynthetic pathway is delivered to the cell, and the genes from the biosynthetic pathway are "loaded" onto the synthetic platform chromosome (described in more detail below). The genes loaded onto the synthetic chromosome are then expressed within the cell. Proteins expressed by transcription and translation of genes from the synthetic chromosome then work in concert to produce one or more metabolic products through a biosynthetic complex (i.e., a series of enzymatic reactions).

[0042] One example of the utility of using synthetic platform chromosomes to enhance cellular function is the engineering of immune system cells to synthesize the essential amino acid tryptophan. During tumor growth, tumor cells take up large amounts of tryptophan from the local tumor environment, leading to starvation and subsequent arrest of immune cells that inhibit tumor cell growth, rendering the starved immune cells incapable of inhibiting the growing tumor cells. Tryptophan is an essential amino acid - i.e., an amino acid that humans cannot synthesize de novo - and dietary intake of tryptophan cannot alleviate tryptophan starvation induced by tumor cells. However, immune cells containing synthetic chromosomes expressing heterologous genes leading to tryptophan biosynthesis have a selective advantage and avoid death due to "tryptophan starvation" during interactions with tumor cells or within the tumor cell environment. For example, the yeast Saccharomyces cerevisiae expresses five genes (TRP1-5) required for the synthesis of tryptophan. Each of these genes can be isolated and controlled from a mammalian promoter (either constitutively expressed or expressed from a regulatable promoter) and placed into a bacterial vector capable of carrying large amounts of DNA, such as a bacterial artificial chromosome (BAC) engineered to deliver or "load" multiple genes onto a synthetic platform chromosome (described below). The synthetic chromosome containing the tryptophan biosynthetic genes may then be subsequently introduced into immune cells (e.g., universal donor T cells or patient autologous T cells) for immuno-oncological cell-based therapy.

[0043] In addition to conferring resistance to death by "tryptophan starvation," the large carrying capacity of synthetic chromosomes further allows for the engineering of genes in other biosynthetic pathways to block tumor cell inhibition, including, but not limited to, 1) the expression of genes that impede or block the ability of tumor cells to inhibit immune cell cycle progression, such as anti-PD-1 (programmed cell death protein 1) or anti-CTLA-4 (central T cell activation and inhibition 4) molecules; 2) factors that enhance immune cell activation and growth (e.g., interleukin 2 or other such cytokines); and / or 3) the addition of factors that increase the specificity of engineered immune cells to the developing tumor, such as factors that increase immune cell homing to tumors or immune cell binding to specific tumor markers. Thus, engineering the tryptophan biochemical pathway with additional pathways and / or factors is distinct from synthetic platform chromosomes for immune cell-based anti-cancer therapeutics (i.e., "immuno / onc synthetic chromosomes or immuno / onc SynCs").

[0044] Preparation of synthetic chromosomes The synthetic chromosomes are made in cultured cells. In some embodiments, the cells that are engineered and / or produce the synthetic chromosomes may be cells that are naturally present in the subject (human patient, animal or plant) in which the genes or regulatory sequences from the synthetic chromosomes will ultimately be expressed. Such cells may be primary cell lines established for the production of individual-specific synthetic chromosomes. In other embodiments, the cells that are engineered and / or produce the synthetic chromosomes are from established cell lines. A wide variety of cell lines for tissue culture are known in the art.Examples of cell lines include, but are not limited to, human cell lines such as 293-T (fetal kidney), 721 (melanoma), A2780 (ovarian), A172 (glioblastoma), A253 (carcinoma), A431 (epithelial), A549 (carcinoma), BCP-1 (lymphoma), BEAS-2B (lung), BR293 (breast), BxPC3 (pancreatic cancer), Cal-27 (tongue), COR-L23 (lung), COV-434 (ovarian), CML T1 (leukemia), DUI45 (prostate), DuCaP (prostate), FM3 (lymph node), H1299 (lung), H69 (lung), HCA2 (fibroblast), HEK0293 (fetal kidney), HeLa (cervical), HL-60 (myeloblast), HMEC (epithelial), HT-29 (colon), HUVEC (umbilical vein epithelial), Jurkat (T cell leukemia), JY (lymphoblastoid), K562 (lymphoblastoid), K BM-7 (lymphoblastoid), Ku812 (lymphoblastoid), KCL22 (lymphoblastoid), KGI (lymphoblastoid), KYO1 (lymphoblastoid), LNCap (prostate), Ma-Mel (melanoma), MCF-7 (breast), MDF-10A (breast), MDA-MB-231, -468 and -435 (breast), MG63 (osteosarcoma), MOR / 0.2R (lung), MONO-MAC6 (white blood cells), MRC5 (lung), NCI-H69 (lung), NALM-1 (peripheral blood), NW-145 (melanoma), OPCN / OPCT (prostate), Peer (leukemia), Raji (B lymphoma), Saos-2 (osteosarcoma), Sf21 (ovary), Sf9 (ovary), SiHa (cervical cancer), SKBR3 (breast cancer), SKOV-2 (ovarian carcinoma), T-47D (breast), T84 (lung), U373 (glioma) Examples of cell lines include: U87 (glioblastoma), U937 (lymphoma), VCaP (prostate), WM39 (skin), WT-49 (lymphoblastoid), YAR (B cell), embryonic cell lines, pluripotent cell lines, adult derived stem cells, reprogrammed cell lines, general purpose animal cell lines of any species or broadly fetal or reprogrammed cells, patient autologous cell lines, and in some preferred embodiments, the HT1080 human cell line is utilized.These and other cell lines are available from a variety of sources known to those of skill in the art (see, for example, the American Type Culture Collection (ATCC), Manassas, Va.).

[0045] The engineering of synthetic chromosomes to express multiple genes in a biochemical or biosynthetic pathway is applicable to all of the "top-down", "bottom-up", minichromosome engineering, and inducible de novo chromosome generation methods used in the art. The "bottom-up" approach to synthetic chromosome formation relies on cell-mediated de novo chromosome formation following transfection of permissive cell lines with cloned alpha satellite sequences containing a centromere and one or more selectable marker genes appropriate for a typical host cell, with or without telomeric and genomic DNA. (For protocols and detailed descriptions of these methods, see, e.g., Harrington et al., Nat. Genet. 15:345-55 (1997); Ikeno et al., Nat. Biotechnol. 16:431-39 (1998); Masumoto et al., Chromosoma 107:406-16 (1998); Ebersole et al., Hum. Mol. Genet. 9:1623-31 (2000); Henning et al., Proceedings of the National Academy of Sciences of the United States of America (PNAS USA 96:592-97, 1999; Grimes et al., EMBO Rep. 2:910-14, 2001; Mejia et al., Genomics 79:297-304, 2002; and Grimes et al., Mol. Ther. 5:798-805, 2002.) Both synthetic and naturally occurring alpha satellite arrays cloned into yeast artificial chromosome, bacterial artificial chromosome, or P1-derived artificial chromosome vectors have been used in the art to generate de novo synthetic chromosomes. The products of bottom-up assembly may be linear or circular, contain simplified and / or concatemerized input DNA with alpha satellite DNA-based centromeres, and can typically range in size from 1 to 10 Mb.The bottom-up derived synthetic chromosomes are also engineered to incorporate nucleic acid sequences that allow for site-specific integration of target DNA sequences into the synthetic chromosome.

[0046] "Top-down" approaches to generating synthetic chromosomes involve sequential rounds of random and / or targeted truncation of pre-existing chromosome arms to truncate synthetic chromosomes containing centromeres, telomeres, and origins of DNA replication. (For protocols and detailed descriptions of these methods, see, e.g., Heller et al., PNAS USA 93:7125-30 (1996); Saffery et al., PNAS USA 98:5705-10 (2001); Choo, Trends Mol. Med. 7:235-37 (2001); Barnett et al., Nuc. Ac. Res. 21:27-36 (1993); Farr et al., PNAS USA 97:1-10 (2003)). USA 88:7006-10, 1991; and Katoh et al., Biochem. Biophys. Res. Commun. 321:280-90, 2004.) "Top-down" synthetic chromosomes are optimally constructed to lack naturally occurring expressed genes and are engineered to contain DNA sequences that allow for site-specific integration of a target DNA sequence into the truncated chromosome, for example, mediated by a site-specific DNA integrase.

[0047] A third method for making synthetic chromosomes known in the art is the engineering of naturally occurring minichromosomes, which typically involves radiation-induced fragmentation of chromosomes engineered to contain a functional, e.g., human neocentromere, with centromere function but lacking alpha satellite DNA sequences, and no non-essential DNA. (For protocols and detailed descriptions of these methods, see, e.g., Auriche et al., EMBO Rep. 2:102-07 (2001); Moralli et al., Cytogenet. Cell Genet. 94:113-20 (2001); and Carine et al., Somat. Cell Mol. Genet. 15:445-460 (1989).) As with other methods of generating synthetic chromosomes, engineered minichromosomes can be engineered to contain DNA sequences that allow for site-specific integration of target DNA sequences.

[0048] A fourth preferred approach to generate synthetic chromosomes involves inducible de novo chromosome generation by targeted amplification of specific chromosomal segments. This approach involves large-scale amplification of pericentric / ribosomal DNA regions located in acrocentric chromosomes. Amplification is initiated by co-transfecting excess DNA specific for the percentric region of the chromosome, such as ribosomal RNA, together with DNA sequences that allow site-specific integration of the target DNA sequence (such as attP, attB, attL, attR), and optionally a selectable marker, all of which are integrated into the pericentric region of the chromosome. (For protocols and detailed descriptions of these methods, see, e.g., Csonka et al., J. Cell Sci. 113:3207-16 (2002); Hadlaczky et al., Curr. Opin. Mol. Ther. 3:125-32 (2001); and Lindenbaum and Perkins et al., Nuc. Ac. Res. 32:21:el72 (2004). In this process, targeting of the pericentric regions of acrocentric chromosomes by co-transfected DNA induces large-scale chromosomal DNA amplification, duplication / activation of centromeric sequences, and subsequent cleavage and division of the dicentric chromosome, resulting in the "break-off" of a satellite DNA-based synthetic chromosome containing multiple site-specific integration sites.

[0049] An integral part of the synthetic platform chromosome technology is a site-specific recombination system that allows one to "load" or place a gene of choice onto the synthetic chromosome. In a preferred embodiment of the invention, the synthetic platform chromosome contains multiple site-specific recombination sites into each of which one or several genes of interest can be inserted. The Cre / lox recombination system uses the CRE recombinase from the E. coli phage P1 (see, for example, Sauer, Methods in Enzymology, 1999). Enzymology 225:890-900 (1993) and U.S. Pat. No. 5,658,772; the yeast FLP / FRT system using the FLP recombinase from the 2μ episome of Saccharomyces cerevisiae (see, e.g., Cox, PNAS USA 80:4223 (1983) and U.S. Pat. No. 5,744,336); resolvases such as the Gin recombinase of phage Mu (Maeser et al., Mol Gen Genetics 2002, 1996, 1999, 1017-1020); Genet. 230:170-176, 1991), Cin, Hin, αδ, Tn3; Pin recombinase of E. coli (see, for example, Enomoto et al., J Bacterid. 6:663-668, 1983); R / RS system of pSRl plasmid of Zygosaccharomyces rouxii (see, for example, Araki et al., J. Mol. Biol. 225:25-37, 1992); Any known recombination system can be used, including site-specific recombinases from Drosophilarium (see, e.g., Chen et al., Nucleic Acids Res. 314:4471-4481, 1986) and Kluyveromyces waltii (see, e.g., Chen et al., J. Gen. Microbiol. 138:337-345, 1992); and other systems known to those of skill in the art; however, recombination systems that operate without the need for additional factors - or that do not require additional factors by virtue of mutations - are preferred.In one exemplary embodiment, a method is provided for inserting nucleic acids into a synthetic platform chromosome by sequence-specific recombination using the recombinase activity of bacteriophage lambda integrase.

[0050] Integrase (termed "Int") encoded by phage lambda is the prototype member of the integrase family. Int directs the integration and excision of the phage into and from the E. coli genome by recombination between pairs of attachment sites termed attB / attP and attL / attR. Each att site contains two inverted 9-base pair core Int binding sites and a 7-base pair overlap region identical to the wild-type att site. Int performs ordered, sequential pairwise strand exchange during integration and excision recombination, similar to Cre recombinase and the Flp-FRT recombinase system. The natural target sequence pairs of Int, attB and attP or attL and attR, are located on the same or different DNA molecules, resulting in intramolecular or intermolecular recombination, respectively. For example, intramolecular recombination occurs between inverted attB and attP, or attL and attR sequences, respectively, resulting in inversion of the intervening DNA segment. While wild-type Int requires additional protein factors for integration and excision recombination and requires negative supercoiling for integration recombination, mutant Int proteins do not require accessory proteins to perform intramolecular integration and excision recombination in cotransfection assays in human cells (see Lorbach et al., J Mol. Biol. 25(296):1175-1181, 2000) and are preferred for the methods of the present invention.

[0051] Delivery vectors for delivering multiple genes in a biosynthetic pathway The choice of delivery vector used to deliver or "load" multiple genes in a biosynthetic pathway into a synthetic platform chromosome will depend on a variety of factors, including the type of cell in which propagation is desired. Selection of an appropriate delivery vector is well within the skill of one of ordinary skill in the art, and many vectors are commercially available. To prepare a delivery vector, multiple genes are inserted into the vector, typically using ligation of the gene sequence into a restriction enzyme site cleaved in the vector. Alternatively, the desired nucleotide sequence may be inserted by homologous recombination or site-specific recombination. Typically, homologous recombination is achieved by adding homologous regions to the vector adjacent to the desired nucleotide sequence (e.g., cre-lox, att sites, etc.). Nucleic acids containing such sequences can be added, for example, by ligation of oligonucleotides or by polymerase chain reaction using primers that contain both the homologous region and a portion of the desired nucleotide sequence. Exemplary delivery vectors that may be used include, but are not limited to, those derived from recombinant bacteriophage DNA, plasmid DNA, or cosmid DNA. For example, plasmid vectors such as pBR322, pUC19 / 18, pUC118, 119, and M13 mp-based vectors may be used. Bacteriophage vectors include λgt10, λgt11, λgt18-23, λZAP / R, and EMBL-based bacteriophage vectors. Cosmid vectors that can be used include, but are not limited to, pJB8, pCV103, pCV107, pCV108, pTM, pMCS, pNNL, pHSG274, COS202, COS203, pWE15, pWE16, and charomid 9-based vectors. Additional vectors include functional fertility plasmid (F-plasmid)-based bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), and P1-derived artificial chromosomes (PACs), which are DNA constructs derived from the DNA of P1 bacteriophage.Alternatively, and preferably, recombinant viral vectors may be engineered, including but not limited to those derived from viruses such as herpesvirus, retrovirus, vaccinia virus, poxvirus, adenovirus, lentivirus, adeno-associated virus, or bovine papilloma virus. BAC vectors are preferred delivery vectors for the present invention due to their ability to carry large amounts of nucleic acid, i.e., multiple genes. Alternatively, multiple genes may be loaded into a synthetic platform chromosome by sequential loading using multiple delivery vectors; i.e., a first gene may be loaded into a synthetic platform chromosome by a first delivery vector, a second gene may be loaded into a synthetic platform chromosome by a second delivery vector, and so on. Perkins and Greene, U.S. Provisional Patent Application No. 62 / 321,711, filed April 12, 2016, describes sequential loading of multiple delivery vectors while reusing a single selectable marker.

[0052] Each of the genes from the biosynthetic pathway can be isolated and controlled from a mammalian promoter, either constitutively expressed or expressed from a regulatable promoter. A selectable marker operable in the expression host can be optionally present to facilitate the selection of cells containing the delivery vector. In addition, the delivery vector can contain additional elements; for example, the delivery vector can have one or two replication systems; thus allowing the delivery vector to be maintained in an organism, for example in mammalian cells for expression and in prokaryotic hosts for cloning and amplification.

[0053] Using lambda integrase-mediated site-specific recombination - or any other recombinase-mediated site-specific recombination - the target gene is transferred or "loaded" from the delivery vector into the synthetic platform chromosome. Because the synthetic platform chromosome contains multiple site-specific recombination sites, multiple genes may be loaded onto a single synthetic platform chromosome. The recombinase that mediates site-specific recombination may be delivered to the cell by encoding the gene for the recombinase in the delivery vector, or purified or encapsulated recombinase protein may be delivered to the recipient cell using standard techniques. Each of the multiple target genes may be under the control of its own promoter; alternatively, expression of the multiple target genes may be coordinately regulated by viral-based elements or human internal ribosome entry site (IRES) elements (see, e.g., Jackson et al., Trends Biochem Sci. 15:477-83, 1990; and Oumard et al., Mol. Cell. Biol. 20:2755-2759, 2000). In addition, the use of IRES-type elements linked to a fluorescent marker downstream from the target gene, e.g., green, red or blue fluorescent protein (GFP, RFP, BFP), allows for identification of synthetic platform chromosomes expressing the integrated target gene or genes. Alternatively or additionally, primers can be designed for detection of integration by PCR, allowing rapid screening of site-specific recombination events on the synthetic chromosome.

[0054] Delivery of constructs to synthetic chromosome producing cells The components appropriate for synthetic chromosome generation and the delivery vector(s) can be delivered to a recipient cell by any method known in the art. The terms transfection and transformation refer to the uptake of exogenous nucleic acid, e.g., an expression vector, by a host cell, regardless of whether any coding sequences are actually expressed. For example, Agrobacterium-mediated transformation, protoplast transformation (including polyethylene glycol (PEG)-mediated transformation, electroporation, protoplast fusion, and microcell fusion), lipid-mediated delivery, liposomes, electroporation, sonoporation, microinjection, particle bombardment, and silicon carbide whisker-mediated transformation, and combinations thereof (see, e.g., Paszkowski et al., EMBO Journal). J., vol. 3, pp. 2717-2722, 1984; Potrykus et al., Mol. Gen. Genet., vol. 199, pp. 169-177, 1985; Reich et al., Biotechnology, vol. 4, pp. 1001-1004, 1986; Klein et al., Nature, vol. 327, pp. 70-73, 1987; U.S. Pat. No. 6,143,949; Paszkowski et al., Plant Cell Culture and Somatic Genetics, vol. 1, pp. 2717-2722, 1984. 6, "Molecular Biology of Plant Nuclear Genes", Schell and Vasil, eds., Academic Publishers, 1989; and Frame et al., Plant J., vol. 6, pp. 941-948, 1994); direct uptake using calcium phosphate (Wigler et al., Proc. Natl. Acad. Sci. USA, vol. 76, pp. 1373-1376, 1979); polyethylene glycol (PEG)-mediated DNA uptake; lipofection (see, for example, Strauss, Methods in Molecular Biology, vol. 10, pp. 1372-1373, 1995); (Meth. Mol. Biol. 54:307-327, 1996); microcell fusion (Lambert, Proc. Natl. Acad. Sci. USA 88:5907-5911, 1991; U.S. Pat. No. 5,396,767; Sawford et al., Somatic Cell and Molecular Genetics, 1999; Cell Mol. Genet. 13:279-284, 1987; Dhar et al., Somatic Cell Mol. Genet. 10:547-559, 1984; and McNeill-Killary et al., Meth. EnzymoL 254:133-152, 1995); lipid-mediated carrier systems (e.g., Teifel et al., Biotechniques 19:79-80, 1995; Albrecht et al., Ann. Hematol. 72:72-74, 1996;73-79, 1996; Holmen et al., In Vitro Cell Dev. Biol. Anim. 31, 347-351, 1995; Remy et al., Bioconjug. Chem. 5, 647-654, 1994; Le Bolch et al., Tetrahedron Letters. Numerous methods of transfection using the methods described herein (see, for example, J. Lett., 36:6681-6684, 1995; and Loeffler et al., Meth. Enzymol., 217:599-618, 1993); or other suitable methods are known to those skilled in the art. Methods for delivery of synthetic chromosomes are also described in U.S. Patent Application Serial No. 09 / 815,979. Successful transfection is generally recognized by detection of the presence of heterologous nucleic acid in the transfected cells, such as some visualization of the heterologous nucleic acid, expression of a selectable marker, or some indication of operation of the synthetic platform chromosome or delivery vector in the host cell. For a description of delivery methods useful in the practice of the present invention, see U.S. Pat. Nos. 5,011,776; 5,747,308; 4,966,843; 5,627,059; 5,681,713; Kim and Eberwine, Anal. Bioanal. Chem., Vol. 397, No. 8, pp. 3173-3178, 2010.

[0055] Visualization, isolation, and transfer of recipient immune cells The preparation and loading of the synthetic platform chromosomes of the present invention can be monitored by various methods. Lindenbaum and Perkins et al., Nucleic Acid Research, Vol. 32, No. 21, p. el72, 2004, describe the preparation of a mammalian satellite DNA-based artificial chromosome expression (ACE) system using prior art technology. In this prior art system, conventional single-color and dual-color FISH analysis and high-resolution FISH were performed using PCR-generated or nick-translated probes. For detection of telomere sequences, mitotic spreads were hybridized with commercially available peptide nucleic acid probes. Microscopy was performed using fluorescence microscopy. Alternatively, Perkins and Greene, PCT / US16 / 17179, filed February 9, 2016, describes compositions and methods that allow real-time monitoring of synthetic chromosome formation by standardized fluorescent techniques using two labeled tags: one labeled tag specific to an endogenous chromosome in the cell line used to generate the synthetic platform chromosome, and one differently labeled tag specific to a sequence on the synthetic chromosome to be generated.

[0056] Isolation and transfer of synthetic chromosomes typically involves microcell mediated cell transfer (MMCT) techniques or dye-dependent chromosome staining followed by flow cytometry-based sorting. In MMCT techniques, donor cells are chemically induced to multinucleate their chromosomes, which are then packaged into microcells and finally fused to recipient cells. Confirmation that synthetic chromosomes have been transferred to recipient cells is achieved by intact delivery of the transferred chromosomes, as confirmed by drug selection and FISH. Alternatively, flow cytometry-based transfer may be used. For flow cytometry-based transfer, mitotically arrested chromosomes are isolated, stained with DNA-specific dyes, and flow sorted based on size and different dye staining. The flow sorted chromosomes are then delivered to recipient cells by standard DNA transfection techniques, and intact chromosome delivery is determined by FISH. In yet another alternative, in addition to visualizing and monitoring synthetic chromosome production as described in Perkins and Greene, PCT / US16 / 17179, filed February 9, 2016, synthetic chromosome tags can be used to isolate synthetic chromosomes from synthetic chromosome-producing cells by flow cytometry, as well as monitor transfer of the synthetic chromosomes into recipient cells (i.e., immune cells).

[0057] (Example) Example 1: De novo construction of satellite DNA-based artificial chromosomes For de novo construction of synthetic chromosomes, exogenous DNA sequences were introduced into the HT1080 synthetic chromosome-producing cell line, where they integrated into the pericentromeric heterochromatic regions of the acrocentric chromosomes, triggering large-scale amplification of the short arm (rDNA / centromere region) of the acrocentric chromosome. During the amplification event, the centromere was duplicated to become a dicentric chromosome with two active centromeres. Subsequent mitotic events led to breakage and separation of the dicentric chromosome, leading to a breakaway of approximately 20-120 Mb size that mainly contained satellite repeat sequences and contained a subdomain of the co-amplified transfected transgene that may also contain an amplified rDNA copy. The newly constructed synthetic chromosomes were validated by observation of fluorescent chromosome painting (or FISH) using endogenous chromosome tags and synthetic chromosome tags engineered into the HT1080 synthetic chromosome-producing cell line.

[0058] The day before transfection, approximately 2.0–8.0 × 10 cells of the HT1080 synthetic chromosome producing cell line were cultured. 4Adherent cell density was split into 24-well tissue culture dishes, and vectors containing foreign DNA were purified (e.g., using Qiagen EndoFree Plasmid Maxi Kit), linearized, and the concentration of vector determined for transfection. Cultured HT1080 cells were fed for 3-5 hours prior to transfection. 225ng of pSTV28HurDNA vector and 12.5ng p15A7248lacEF1attPPuro vector were used per 24-well semi-confluent tissue culture dish for transfection of HT1080 cells using standard transfection reagents, e.g., ThermoFisher Lipofectamine LTX, Promega Viafect, or Invitrogen calcium phosphate transfection kit. The pSTV28HurDNA vector contains a ribosomal DNA sequence. The p15A7248lacEF1attPPuro vector contains components of the site-specific recombination system, LacO repeats, and ampicillin and puromycin resistance genes. Cells were maintained for 1-3 days after transfection when they were trypsinized and replated in 10 cm dishes. Selection medium was added to the 10 cm dishes at the time of plating or 1-3 days after plating. Selective conditions were maintained for 10-21 days with medium changes every 2-3 days. Antibiotic-resistant clones were picked when colonies reached a diameter of 2-3 mm. Well-separated colonies were preferred. Cells were detached using cloning cylinders and trypsin and transferred to 24-well plates for growth.

[0059] Example 2: Construction of Saccharomyces cerevisiae tryptophan pathway delivery vector The BLoVeL-TTS vector is used as a backbone delivery vector to insert five genes (Trp1-Trp5) of the Saccharomyces cerevisiae tryptophan pathway into the synthetic platform chromosome. These five tryptophan genes are separated by DNA sequences encoding either 2A peptides or IRES elements to form a single transcript containing the five genes, resulting in roughly equal expression levels of proteins required for tryptophan synthesis. 2A self-cleaving peptides that can be utilized include, but are not limited to: Porcine Tesshovirus 1 2A (P2A), Thosea asigna virus 2A (T2A), Equine Rhinitis A virus 2A (E2A), Foot and Mouth Disease virus 2A (F2A), Cytoplasmic Polyhedrosis Virus (BmCPV 2A), and Flacheria Infection Virus 2A (BmIFV2A) (see below). The data show that the addition of a short three amino acid peptide (glycine-serine-glycine) to the N-terminus of the autocleaving peptide improves autocleavage, therefore this example also encompasses minor modifications that improve the efficiency of 2A autocleaving peptide activity.

[0060] [Table 1] Available internal ribosome entry site (IRES) elements include, but are not limited to, viral and cellular IRES elements. Viral IRES elements are divided into four types. Type I includes enteroviruses (EV, PV, HRV), type II includes cardioviruses (EMCV) and aphthoviruses (foot and mouth disease virus, FMDV), type III is used for hepatitis A virus (HAV), and hepatitis C virus (HCV)-like IRESes fit into group IV (see Pacheco and Martinez-Salas, J Biomed Biotechnol. 2 Feb. 2010, p. 458927, doi:10.1155 / 2010 / 458927, PMID:20150968; and Hellen and Sarnow, Genes Dev. 15(13):1593-612, 2001).

[0061] BLoVeL-TTS is digested with Eco53KI to linearize the delivery vector backbone. The five Trp genes are PCR amplified from Saccharomyces cerevisiae s288c genomic DNA using primers designed for IN-Fusion cloning (Takara) of the five genes and the promoter of choice into the linearized BLoVeL-TTS vector, or synthesized.

[0062] [Table 2] Promoters can be selected from those found in nature or artificially assembled promoters. Whether a constitutive or inducible promoter is preferred for a particular pathway and application depends on the desired expression control. For example, promoters that can provide a feedback mechanism to induce or repress transcription depending on the level of a particular metabolite in the cell can be utilized.

[0063] Saccharomyces cerevisiae The five Trp genes in the S. cerevisiae biosynthetic pathway are synthesized with the following modifications: 1) Trp1, Trp2, Trp3, Trp4 genes are synthesized without a stop codon; 2) a P2A spacer is encoded upstream of the Trp2 gene and a glycine-serine-glycine spacer plus a 15 bp T2A spacer downstream of the final Trp2 amino acid codon; 3) a T2A spacer is encoded upstream of the Trp3 gene and a glycine-serine-glycine spacer plus a 15 bp E2A spacer downstream of the final Trp3 amino acid codon; 4) an E2A spacer is encoded upstream of the Trp4 gene and a glycine-serine-glycine spacer plus a 15 bp F2A spacer downstream of the final Trp4 amino acid codon; and 5) an F2A spacer is encoded upstream of the Trp5 gene and a polyadenylation signal is encoded downstream of the Trp5 gene.

[0064] PCR primers are designed to PCR amplify the five synthetic DNA elements as well as the human EF1α promoter (amplified from pEF1hrGFP) for IN-Fusion cloning into the linearized BLoVeL-TSS vector backbone. The resulting construct, BLoVeL-TSS_TrpPath, is shown in Figure 2. (The following elements are present in BLoVeL-TSS_TrpPath: sopA, sopB, and sopC = plasmid partitioning proteins; SV40pAn = SV40 polyA; TTS = transcription termination signal; attB = site-specific recombination site; lox = site-specific recombination site; eGFP = fluorescent protein; Bsr = blasticidin resistance gene; repE = replication initiation site; Ori2 = replication origin; CmR = chloramphenicol resistance gene; polyAn = polyA; EF1αPr = promoter; TRP1, TRP2, TRP3 TRP4, and TRP5 = tryptophan genes 1-5; P2A, T2A, E2A, and F2A = self-cleaving peptides). Now that the BLoVeL-TSS_TrpPath delivery vector has been constructed, it is transfected into cells containing the synthetic platform chromosome.

[0065] Example 3: Loading of Saccharomyces cerevisiae tryptophan pathway genes into synthetic platform chromosomes Using the BLoVeL-TTS vector as a delivery vector, insert five genes (Trp1-Trp5) from the Saccharomyces cerevisiae tryptophan pathway into the synthetic platform chromosome. On day 0, the recipient cell line (e.g., HT1080) containing the synthetic platform chromosome (hSynC) is seeded at approximately 4E4 cells per well of a 24-well dish such that the wells are approximately 70% confluent on day 1. Incubate the cells overnight at 37 °C, 5% CO2 in the appropriate medium (e.g., DMEM + 10% FC3 for HT1080). On day 1, transfect HT1080 cells with both the delivery vector (e.g., BLoVeL-TSS_TrpPath) and the plasmid encoding the recombinant protein (e.g., pCXLamIntR) according to the manufacturer's instructions (Fisher Scientific, Lipofectamine LTX, containing Plus reagent). Transfections are performed in duplicate to allow comparison of drug selection and direct cell sorting. Lipofectamine LTX is diluted in Opti-MEM medium (Gibco; 1.5 μl LTX / 50 μl Opti-MEM for each well of a 24-well dish to be transfected) and 250 ng DNA (e.g., 125 ng BLoVeL-TSS_TrpPath plasmid and 125 ng pCXLamIntR / well) is added to 50 μl of diluted LTX in Opti-MEM. 0.25 μl of PLUS reagent is added to each approximately 50 μl DNA-LTX-Opti_MEM sample and each sample is incubated for 5 minutes at room temperature. Then, during this 5 minute incubation, the medium is removed from the cells plated on day 0 and replaced with fresh medium. The DNA-lipid complexes are added to the cells and incubated in the appropriate medium at 37° C., 5% CO2.

[0066] On days 2-24, drug selection is performed. Cells from one of the wells of a duplicate 24-well plate are trypsinized and transferred to a 10 cm dish containing fresh medium containing drug selection (e.g., 5 μg / ml puromycin or 3 μg / ml blasticidin). Cells are then incubated in the appropriate medium at 37° C., 5% CO2 and monitored for colony formation. Medium is changed approximately every 72 hours. Once individual colonies have formed (approximately 10 days), each colony is isolated by glass cylinder, trypsinized, and transferred to a well of a 24-well dish. These "clones" are then grown in culture (approximately 2 weeks; Promega Wizard SV genomic DNA purification) until enough cells are available to place the clones in cryogenic storage and isolate genomic DNA for PCR analysis.

[0067] Alternatively, cells from duplicate wells may be trypsinized and placed in 6 cm dishes with fresh medium without drug selection and incubated at 37°C, 5% CO2 in the appropriate medium. On the third or fourth day, cells in the 6 cm dishes are trypsinized and run through a cell sorter to single-cell sort fluorescent cells that have integrated the vector and express the fluorescent protein on the delivery vector (e.g., GFP; BLoVeL-TSS_TrpPath). Note that the sorter identifies in-frame GFP-positive recombinants after integration into the synthetic chromosome, which is one of the unique aspects of the method of the present invention. Integration of the delivery vector containing the gene / DNA element of interest is identified by the production of a unique PCR product spanning the recombination site between the synthetic platform chromosome and the delivery vector (BLoVeL-TSS_TrpPath) using appropriate PCR primers. A negative control PCR reaction of water and host genomic DNA (e.g., HT1080) is performed along with the test genomic DNA sample. The PCR primers used to amplify the junction PCR product from the BLoVeL-TSS_TrpPath vector integration are: Junction 1 - expected product size 392 bp (ACCGAGCTGCAAGAACTCTTCCTC [SEQ ID NO: 5] and ctcgccgcagccgtgtaa [SEQ ID NO: 6]); Junction 2 - expected product size 401 bp (gcgctaatgctctgttacaggt [SEQ ID NO: 7] and GGAAAGCTGCCAGTGCCTTG [SEQ ID NO: 8]).

[0068] After identification of candidate clones with the correct junction PCR product size, further PCR reactions are performed to confirm the presence of the DNA elements of interest (e.g., TRP1, TRP2, TRP3, TRP4, and TRP5) that were originally loaded into the delivery vector and are now on the synthetic chromosome. In addition, a test for tryptophan production is performed, which can be determined in a number of ways. First, the cells can be tested for their ability to grow in cell culture medium that does not contain the amino acid tryptophan, and growth of these cells can be compared to cells growing in cell culture medium containing tryptophan. Another test for tryptophan synthesis can be to assay tryptophan levels in lysed cell pellets with the Bridge-it L-Tryptophan Fluorescent Assay Kit (Mediomics, LLC). Tryptophan levels are measured in triplicate in independent cultures carrying the TRP1, TRP2, TRP3, TRP4, and TRP5 genes and compared to cultures of cells without the synthetic chromosome containing BLoVeL-TSS_TrpPath.

[0069] Example 4: Adding an aromatic amino acid pathway to the tryptophan pathway The yeast tryptophan pathway may also require the ARO pathway to provide precursors for the tryptophan biosynthetic pathway in human cells. The precursor molecule that enters the tryptophan biosynthetic pathway is chorismate, which is produced by the aromatic amino acid pathway (also called the shikimate pathway). In S. cerevisiae, four genes are involved in the conversion of phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) to chorismate:

[0070] [Table 3] After identification of cells containing the TRP1, TRP2, TRP3, TRP4 and TRP5 genes, the selectable marker cassette (eGFP-BSR) is removed using CRE-lox recombination. The cell line containing the synthetic chromosome is transfected with a CRE expression plasmid. On day 0, cells are seeded at 2E5 cells per 6 cm cell culture dish and incubated overnight at 37°C, 5% CO2. On day 1, the CRE expression plasmid (e.g., PSF-CMV-CRE-CRE recombinase expression vector; Sigma Aldrich) is transfected into the cell line (containing the TRP1, TRP2, TRP3, Trp4 and TRP5 genes) with Lipofectamine LTX according to the manufacturer's protocol. Lipofectamine LTX is diluted in Opti-MEM medium (Gibco; 7.25 μl LTX / 500 μl Opti-MEM for each 6-well dish to be transfected) and 1.25 μg DNA is added to 500 μl diluted LTX in Opti-MEM (e.g., PSF-CMV-CRE-CRE recombinase expression vector per 6 cm dish). 1.25 μl of PLUS reagent is then added to each approximately 500 μl DNA-LTX-Opti_MEM sample and incubated for 5 minutes at room temperature. Then, during this 5 minute incubation, the medium is removed from the cells plated on day 0 and replaced with fresh medium. The DNA-lipid complex is added to the cells and incubated in the appropriate medium at 37° C., 5% CO2. On day 2, CRE transfected cells are harvested from the 6 cm dishes by trypsinization and non-fluorescent cells are collected by gating. Non-fluorescent cells have undergone CRE-lox recombination, resulting in the removal of the eGFP-BSR cassette. Non-fluorescent cells may be single-cell sorted into 96-well dishes and / or bulk sorted into tubes and then plated into cell culture dishes (e.g., 6 cm dishes). Cells are then monitored for fluorescence as they grow in culture. Single cell clones that do not show fluorescence are expanded in culture for cryogenic storage and genomic DNA isolation.Confirmation of the correct CRE-lox recombination event by PCR is determined using the following primers for the BLoVeL-TSS based vector: Lox cassette forward: . (AGCCGTGTAACCGAGCATAGtgaagcctgcttttttatactaacttgagcgaa [SEQ ID NO: 9]) Lox cassette reverse: (CTGTTTCCTTCAGCCTGCATGGCCTTGACTAGAGGGTCGACGG [SEQ ID NO: 10]) Candidates showing a 462 bp product indicate correct excision of the eGFP-BSR cassette, whereas a 1,819 bp product indicates that no excision has occurred. Candidates with correct PCR products are further tested by PCR to confirm the presence of the DNA element of interest.

[0071] The four ARO genes of the Saccharomyces cerevisiae biosynthetic pathway are synthesized with the following modifications: 1) ARO1, ARO2, and ARO3 genes are synthesized without a stop codon; 2) a P2A spacer is encoded upstream of the ARO2 gene, and a glycine-serine-glycine spacer + a 15 bp T2A spacer is encoded downstream of the last ARO2 amino acid codon; 3) a T2A spacer is encoded upstream of the ARO3 gene, and a glycine-serine-glycine spacer + a 15 bp E2A spacer is encoded downstream of the last ARO3 amino acid codon; and 4) an E2A spacer is encoded upstream of the ARO4 gene, and a polyadenylation signal is encoded downstream of the ARO4 gene. The newly synthesized polyadenylation site was copied from pGLuc-Basic_2(NEB). PCR primers are designed to amplify these four synthetic DNA elements as well as the EF1α promoter (amplified from pEF1hrGFP) for IN-Fusion cloning into the linearized BLoVeL-TSS delivery vector backbone. The resulting construct, BLoVeL-TSS_AroPath, is shown in FIG. 3. (In BLoVeL-TSS_AroPath, the following elements are present: sopA, sopB, and sopC = plasmid partition proteins; SV40pAn = SV40 polyA; TTS = transcription termination signal; attB = site-specific recombination site; lox = site-specific recombination site; eGFP = fluorescent protein; Bsr = blasticidin resistance gene; repE = replication origin; Ori2 = replication origin; CmR = chloramphenicol resistance gene; polyAn = polyA; EF1αPr = promoter; ARO1, ARO2, ARO3, and ARO4 = aromatic amino acid genes 1-4; P2A, T2A, and E2A = self-cleaving peptides). The BLoVeL-TSS_AroPath vector is transfected into cells containing a synthetic chromosome already loaded with the TRP1, TRP2, TRP3, Trp4, and TRP5 genes.

[0072] On day 0, recipient cell lines (e.g., HT1080) containing the synthetic chromosome (hSynC) are seeded at approximately 4E4 cells per well of a 24-well dish until wells are approximately 70% confluent on day 1 and incubated overnight at 37°C, 5% CO2 in the appropriate medium (e.g., DMEM+10% FC3 for HT1080). On day 1, HT1080 cells are transfected with both the delivery vector (e.g., BLoVeL-TSS_AroPath) and the plasmid encoding the recombinant protein (e.g., pCXLamIntR) according to the manufacturer's instructions (Fisher Scientific, Lipofectamine LTX, with Plus reagent). Transfections are typically performed in duplicate to allow comparison of drug selection and direct cell sorting. Lipofectamine LTX is diluted in Opti-MEM medium (Gibco; 1.5 μl LTX / 50 μl Opti-MEM for each well of a 24-well dish to be transfected) and 250 ng DNA (e.g., 125 ng BLoVeL-TSS_AroPath plasmid and 125 ng pCXLamIntR / well) is added to 50 μl of diluted LTX in Opti-MEM. 0.25 μl of PLUS reagent is added to each approximately 50 μl DNA-LTX-Opti_MEM sample and incubated for 5 minutes at room temperature. Then, during this 5 minute incubation, the medium is removed from the cells plated on day 0 and replaced with fresh medium. The DNA-lipid complexes are added to the cells and incubated in the appropriate medium at 37° C., 5% CO2.

[0073] On days 2-24, drug selection is performed. Cells from one of the wells of a duplicate 24-well plate are trypsinized and transferred to a 10 cm dish containing fresh medium containing drug selection (e.g., 5 μg / ml puromycin or 3 μg / ml blasticidin). Cells are then incubated in the appropriate medium at 37° C., 5% CO2 and monitored for colony formation. Medium is changed approximately every 72 hours. Once individual colonies have formed (approximately 10 days), each colony is isolated by glass cylinder, trypsinized, and transferred to a well of a 24-well dish. These "clones" are then grown in culture (approximately 2 weeks; Promega Wizard SV genomic DNA purification) until enough cells are available to place the clones in cryogenic storage and isolate genomic DNA for PCR analysis.

[0074] Alternatively, cells from duplicate wells may be trypsinized and placed in a 6 cm dish with fresh medium without drug selection and incubated at 37°C, 5% CO2 in the appropriate medium. On day 3 or 4, cells from the 6 cm dish are trypsinized and run through a cell sorter to single-cell sort fluorescent cells that have integrated the vector and express the fluorescent protein on the target vector (GFP; BLoVeL-TSS_AroPath). Integration of the delivery vector containing the gene / DNA element of interest is identified by the production of a unique PCR product spanning the recombination site between the synthetic chromosome and the delivery vector (BLoVeL-TSS_AroPath) using appropriate PCR primers. A negative control PCR reaction with water and host genomic DNA (e.g. HT1080) is performed alongside the test genomic DNA sample. The PCR primers used to amplify unique junction PCR products from BLoVeL-TSS_AroPath delivery vector integrations are: Junction 1 - expected product size 401 bp (gcgctaatgctctgttacaggt [SEQ ID NO: 7] and GGAAAGCTGCCAGTGCCTTG [SEQ ID NO: 8]). After identification of candidate clones with the correct junction PCR product size, further PCR reactions are performed to confirm the presence of the DNA elements of interest that were originally loaded into the delivery vector (TRP1, TRP2, TRP3, Trp4 and TRP5 genes) and are now on the synthetic chromosome (e.g., ARO1, ARO2, ARO3 and ARO4). Note that the second junction PCR is no longer unique upon second loading into the synthetic chromosome: junction shared by both BLoVeL-TSS_AroPath and BLoVeL-TSS_TrpPath targeted integration events - expected product size 392bp (accgagctgcaagaactcttcctc [SEQ ID NO:5] and ctcgccgcagccgtgtaa [SEQ ID NO:6]). In addition, a test for chorismate production is performed. This can be determined in a number of ways.For example, cells may be tested for their ability to grow in cell culture medium that does not contain the amino acid tryptophan and growth compared to cells growing in cell culture medium that contains tryptophan. These cells now have both tryptophan and aromatic amino acid biosynthetic pathways. The latter pathway should produce the chorismate substrate for tryptophan production by the former pathway. Another test for tryptophan synthesis can be to assay tryptophan levels in lysed cell pellets with the Bridge-it L-Tryptophan Fluorescent Assay Kit (Mediomics, LLC). Tryptophan levels are measured in triplicate for independent cultures bearing tryptophan and compared to cultures of cells not carrying the synthetic chromosome containing BLoVeL-TSS_AroPath as well as cultures lacking both BLoVeL-TSS-AroPath and BLoVeL-TSS-TrpPath integration events.

[0075] The above merely illustrates the principles of the present invention. It will be understood that those skilled in the art can devise various modifications that embody the principles of the present invention, but which are not explicitly described or shown herein, and are within the spirit and scope of the present invention. Furthermore, all examples and conditional language described herein are intended primarily to aid the reader in understanding the principles of the present invention and the concepts that the inventors have contributed to the expansion of the art, and should not be construed as being limited to such specifically described examples and conditions. Furthermore, all statements herein that describe the principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. In addition, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Thus, it is not intended that the scope of the present invention be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims. In the following claims, unless the term "means" is used, no feature or element recited therein should be construed as a means-plus-function limitation pursuant to 35 U.S.C. 35 U.S.C. 112, 16th paragraph. (Additional Note) The technical ideas that can be understood from the above-described embodiment and modified examples will be described. [Item 1] 1. A method for constructing a biosynthetic pathway in a recipient cell, comprising: transfecting a recipient cell line with synthetic chromosome constructs comprising a nucleic acid sequence that allows for site-specific integration of a target nucleic acid sequence; generating a synthetic platform chromosome having a plurality of site-specific recombination sites; transfecting said recipient cell line with a delivery vector comprising a plurality of genes capable of implementing a biosynthetic pathway, said delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the delivery vector, whereby the plurality of genes capable of implementing a biosynthetic pathway are loaded into the synthetic platform chromosome to generate a synthetic chromosome expressing the biosynthetic pathway; and isolating a recipient cell comprising said synthetic chromosome expressing said biosynthetic pathway. [Item 2] 2. The method of claim 1, wherein the plurality of genes capable of implementing a biosynthetic pathway includes genes required for tryptophan biosynthesis. [Item 3] 3. The method of claim 2, wherein the genes required for tryptophan biosynthesis include five genes required for the synthesis of tryptophan in Saccharomyces cerevisiae. [Item 4] 3. The method of claim 2, wherein the delivery vector further comprises one or more genes that a) interfere with or block the ability of tumor cells to inhibit immune cell cycle progression, b) encode one or more factors that enhance immune cell activation and growth, or c) increase the specificity of immune cells to the developing tumor. [Item 5] 5. The method of claim 4, wherein the delivery vector comprises at least two of a), b) or c). [Item 6] 6. The method of claim 5, wherein the delivery vector comprises all three of a), b) and c). [Item 7] isolating the synthetic chromosome expressing the biosynthetic pathway; and 7. The method of any one of items 1 to 6, further comprising a step of transferring the synthetic chromosome to a second recipient cell. [Item 8] 8. A second recipient cell according to item 7. [Item 9] 8. The method of claim 7, wherein the second recipient cells are selected from universal donor T cells or patient autologous T cells. [Item 10] 10. The second recipient cell according to item 9. [Item 11] 2. The method of claim 1, wherein the nucleic acid sequence enabling site-specific integration comprises attP, attB, attL, and attR or mutant versions of attP, attB, attL, and attR. [Item 12] 2. The method of claim 1, wherein the delivery vector is a BAC. [Item 13] 2. A synthetic chromosome expressing the biosynthetic pathway described in item 1. [Item 14] A recipient cell comprising a synthetic chromosome expressing the biosynthetic pathway described in item 1. [Item 15] transfecting the recipient cell line with a second delivery vector comprising a plurality of genes capable of implementing a second biosynthetic pathway, the second delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the second delivery vector, wherein the plurality of genes capable of implementing a second biosynthetic pathway are loaded into the synthetic platform chromosome to create a synthetic chromosome expressing the second biosynthetic pathway; and 2. The method of claim 1, further comprising the step of isolating a recipient cell comprising the synthetic chromosome expressing the second biosynthetic pathway. [Item 16] 16. A synthetic chromosome expressing the second biosynthetic pathway according to item 15. [Item 17] isolating the synthetic chromosome expressing the second biosynthetic pathway; and 16. The method of claim 15, further comprising transferring the synthetic chromosome expressing the second biosynthetic pathway to a second recipient cell. [Item 18] 16. The second recipient cell according to item 15. [Item 19] 16. The method of claim 15, wherein the second recipient cells are selected from universal donor T cells or patient autologous T cells. [Item 20] 20. The second recipient cell according to item 19. [Item 21] 1. A method for constructing a biosynthetic pathway in a recipient immune cell, comprising: transfecting a recipient cell line with synthetic chromosome constructs comprising a nucleic acid sequence that allows for site-specific integration of a target nucleic acid sequence; generating a synthetic platform chromosome having a plurality of site-specific recombination sites; transfecting said recipient cell line with a delivery vector comprising a plurality of genes capable of implementing a biosynthetic pathway, said delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the delivery vector, whereby the plurality of genes capable of implementing a biosynthetic pathway are loaded into the synthetic platform chromosome to create a synthetic chromosome expressing the biosynthetic pathway; isolating a recipient cell containing the synthetic chromosome expressing the biosynthetic pathway; isolating the synthetic chromosome expressing the biosynthetic pathway; and transferring said synthetic chromosome to a second recipient cell.

Claims

1. 1. A method for constructing a biosynthetic pathway in a recipient cell, comprising: transfecting a recipient cell line with synthetic chromosome constructs comprising a nucleic acid sequence that allows for site-specific integration of a target nucleic acid sequence; generating a synthetic platform chromosome having a plurality of site-specific recombination sites; transfecting said recipient cell line with a delivery vector comprising a plurality of genes capable of implementing a biosynthetic pathway, said delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the delivery vector, whereby the plurality of genes capable of implementing a biosynthetic pathway are loaded into the synthetic platform chromosome to create a synthetic chromosome expressing the biosynthetic pathway; and Isolating recipient cells containing said synthetic chromosomes expressing said biosynthetic pathway. The method includes:

2. 2. The method of claim 1, wherein the plurality of genes capable of implementing a biosynthetic pathway includes genes required for tryptophan biosynthesis.

3. 3. The method of claim 2, wherein the genes necessary for tryptophan biosynthesis include five genes necessary for the synthesis of tryptophan in Saccharomyces cerevisiae.

4. 3. The method of claim 2, wherein the delivery vector further comprises: a) one or more genes that interfere with or block the ability of tumor cells to inhibit immune cell cycle progression; b) one or more genes that encode factors that enhance immune cell activation and growth; or c) one or more genes that increase the specificity of immune cells for developing tumors.

5. 5. The method of claim 4, wherein the delivery vector comprises at least two of a), b), or c).

6. 6. The method of claim 5, wherein the delivery vector comprises all three of a), b) and c).

7. isolating the synthetic chromosome expressing the biosynthetic pathway; and transferring said synthetic chromosome into a second recipient cell. The method of any one of claims 1 to 6, further comprising:

8. The second recipient cell of claim 7.

9. The method of claim 7, wherein the second recipient cells are selected from universal donor T cells or patient autologous T cells.

10. The second recipient cell of claim 9.

11. 2. The method of claim 1, wherein the nucleic acid sequences enabling site-specific integration comprise attP, attB, attL, and attR or mutant versions of attP, attB, attL, and attR.

12. The method of claim 1 , wherein the delivery vector is a BAC.

13. A synthetic chromosome expressing the biosynthetic pathway of claim 1.

14. A recipient cell comprising a synthetic chromosome expressing the biosynthetic pathway of claim 1.

15. transfecting said recipient cell line with a second delivery vector comprising a plurality of genes capable of implementing a second biosynthetic pathway, said second delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the second delivery vector, wherein the plurality of genes capable of implementing a second biosynthetic pathway are loaded into the synthetic platform chromosome to create a synthetic chromosome expressing the second biosynthetic pathway; and Isolating recipient cells containing the synthetic chromosome expressing the second biosynthetic pathway. The method of claim 1 further comprising:

16. 16. A synthetic chromosome expressing the second biosynthetic pathway of claim 15.

17. isolating the synthetic chromosome expressing the second biosynthetic pathway; and transferring said synthetic chromosome expressing said second biosynthetic pathway into a second recipient cell. The method of claim 15 further comprising:

18. The second recipient cell of claim 15.

19. 16. The method of claim 15, wherein the second recipient cells are selected from universal donor T cells or patient autologous T cells.

20. The second recipient cell of claim 19.

21. 1. A method for constructing a biosynthetic pathway in a recipient immune cell, comprising: transfecting a recipient cell line with synthetic chromosome constructs comprising a nucleic acid sequence that allows for site-specific integration of a target nucleic acid sequence; generating a synthetic platform chromosome having a plurality of site-specific recombination sites; transfecting said recipient cell line with a delivery vector comprising a plurality of genes capable of implementing a biosynthetic pathway, said delivery vector comprising at least one site-specific recombination site; activating site-specific recombination between the synthetic platform chromosome and the delivery vector, whereby the plurality of genes capable of implementing a biosynthetic pathway are loaded into the synthetic platform chromosome to generate a synthetic chromosome expressing the biosynthetic pathway; isolating a recipient cell containing the synthetic chromosome expressing the biosynthetic pathway; isolating the synthetic chromosome expressing the biosynthetic pathway; and transferring said synthetic chromosome into a second recipient cell. The method includes:

Images