Method and kit for identifying molecular markers of disease

Abstract

To provide a comprehensive method for identifying and quantifying molecular markers associated with a specific disease to facilitate disease diagnosis, prognosis, therapy monitoring or outcome prediction assessment.SOLUTION: The present invention provides a method for identifying at least one RNA fragment comprising a 3' phosphate or 2' / 3' cyclic phosphate as a molecular marker of a disease contained in a biological sample of a subject suffering from the disease and a kit for implementing the method.SELECTED DRAWING: Figure 12A

Description

[Technical field]

[0001] The present specification relates to methods and kits for the transcriptome-wide identification of RNA fragments containing 3' phosphates or 2' / 3' cyclic phosphates as molecular markers of disease. [Background technology]

[0002] Biomarkers are biological molecules whose measurement provides meaningful information about the presence or progression of disease and the effectiveness of treatment. 1,2 RNA-based biomarkers stand out among diverse molecular markers as highly promising candidates for disease diagnostic, prognostic, and therapeutic monitoring purposes in a variety of conditions, including cancer, neurodegenerative diseases, and infectious diseases. 3 To refine the development of biomarkers, extensive research has been conducted to investigate various RNA types, including messenger RNA (mRNA), microRNA (miRNA), transfer RNA (tRNA), long noncoding RNA (lncRNA), and circular RNA (circRNA). 4-6 RNA offers several important advantages for this purpose compared to protein-based biomarkers, including that it is typically abundant, easy to detect through cost-effective methods, and is present in a wide range of biological fluids (e.g., urine, blood, saliva). 7 Besides this, RNAs show different expression patterns in many pathological conditions compared to healthy conditions. 3,8 This highlights their potential as unique disease markers. In addition, RNA molecules can undergo extensive post-transcriptional modifications, 9 , organ-, tissue-, and cell-type-specific, further enhancing its uniqueness 10-12 Among the known modifications, the presence of 3′ phosphate or 2′ / 3′ cyclic phosphate groups (referred to as 3′P RNA) on RNA molecules results from RNA processing events, i.e., mainly from the enzymatic cleavage of non-coding RNAs such as rRNA, snRNA, and tRNA, but also from the selective degradation of protein-coding RNAs.13,14 This process generates RNA fragments ranging from 10 to 200 nucleotides in length, providing a vast collection of disease-specific markers. Unfortunately, the true potential of these RNA products is often overlooked due to the limitations of current detection methods, which rely on the presence of a 3′OH group for subsequent processing steps such as polyadenylation or ligation. By using complex and time-consuming techniques, preliminary studies have only shown that they are capable of detecting the RNA in vivo, acting within cells or biological fluids. 17 are beginning to elucidate the importance of 3′P RNA as a unique marker of essential biological processes. 15,16 Altered expression of specific 3′P RNA fragments has been observed in cancer, viral infection, and neurodegeneration. 18,19 This new understanding highlights the importance of exploring their role in human health and disease. Depending on the type of sample, 5%–50% of the total 3′P RNA is tRNA fragments (tRFs), meaning fragments derived from cleavage of mature tRNAs. For example, a specific subset of tRNAs cleaved by angiogenin, a nuclease belonging to the ribonuclease A superfamily, secreted from neuronal cells, was recently found to have strong prognostic value in serum samples from patients with amyotrophic lateral sclerosis. 20 Furthermore, it has recently been discovered that specific tRNA fragments suppress abnormal protein synthesis and predict the progression of leukemia in myelodysplastic syndromes. 21 , suggesting a role for 3′P tRNA fragments as potential markers of disease. 22-25 .

[0003] Despite the great efforts made to date, the field still lacks reliable, simple and accurate methods for effectively screening and quantifying 3'P RNA fragments. The lack of such robust screening techniques is a major obstacle in identifying this type of RNA molecule, limiting its applicability for important purposes such as disease diagnosis, prognosis and treatment monitoring. Summary of the Invention [Problem to be solved by the invention]

[0004] The purpose of this disclosure is to provide a comprehensive method for identifying and quantifying molecular markers associated with specific diseases to facilitate disease diagnosis, prognosis, treatment monitoring, or outcome prediction evaluation. Specifically, we focus on molecular markers represented by RNA fragments that are phosphorylated at the 3' end. By utilizing innovative methods, we aim to enable more accurate and reliable diagnosis, prognosis, treatment monitoring, and outcome prediction evaluation.

[0005] It is a further object of the present disclosure to provide kits for carrying out the methods for identifying molecular markers of disease and for using them in diagnosis, outcome prediction, prognosis, and treatment monitoring. [Means for solving the problem]

[0006] According to the present invention, the above objects are achieved by what is particularly pointed out in the following claims, which are understood to form an integral part of this disclosure.

[0007] The present invention relates to a method for identifying molecular markers of a disease as defined in claim 1 and to a kit for carrying out said method as defined in claim 11.

[0008] [Brief description of the drawings] The invention will now be described in detail, purely by way of illustrative and non-limiting example, with reference to the accompanying drawings, in which: [Brief description of the drawings]

[0009] [Figure 1] Metaprofile showing the frequency of P sites around the translation start and stop. Libraries were generated by Dart-RNA sequencing after ribosome purification and extraction of 3′P ribosome-protected fragments from CHO cell pellets. [Diagram 2] Dart-RNAseq analysis of mouse liver tissue. Read length distribution of control and SMA mouse liver tissue. [Diagram 3] Percentage of reads mapping to various transcript types. [Figure 4] Base-by-base coverage of 3′P-tRFs_Val_AAC in control (black line) and SMA (grey line) mouse liver tissues. [Diagram 5] Heatmap showing the frequency of cleavage associated with the 5′ start and 3′ end of reads aligning to tRNA_Val_AAC in control and SMA liver tissues. [Figure 6] Schematic diagram of the secondary structure of the full-length transcript of the U2 pseudogene. The Sm binding site and the region to which the 3′P Gm22973 fragment maps are highlighted in dark black. The names associated with each stem-loop are provided for reference. [Figure 7] A. 3′P-qPCR expression analysis of 3′P-tRFs_Val_AAC / CAC and 3′P-tRFs_Val_TAC in control and SMA liver tissues. Results are shown as relative log2 fold change. B. Representative images (left) of Northern blot analysis of total full-length tRNA Val AAC (top) and total 3′PtRF_Val_AAC fragments (bottom) from control and SMA liver tissues. On the right, a histogram showing the relative expression (fold change) of 3′P-tRFs_Val_AAC based on quantification of bands in the gel is displayed on the right. Data are expressed as mean ± standard error of the mean (sem). Comparison between two groups was performed using Student's t-test; n=3; *P<0.05, and ns: no significant difference. [Figure 8]A. 3′P-qPCR expression analysis of the 3′P-Gm22973 fragment in control and SMA liver tissues. B. 3′P-qPCR expression analysis of the full-length Gm22973 transcript in control and SMA liver tissues. C. Histogram showing the results of 3′P-qPCR expression analysis of 3′P-U2 in control and SMA liver tissues. D. Bar graph showing full-length qPCR expression analysis of the U2 snRNA transcript in control and SMA liver tissues. Data are presented as mean ± standard error of the mean (sem). Comparisons between groups were made using Student's t-test; N=3; *P<0.05; **P<0.01, and ns: no significant difference. [Figure 9] Percentage of reads mapping to different transcript types in dart-RNAseq analysis of immortalized human keratinocytes (HKC) and SCC cell lines. [Figure 10] Principal component analysis (PCA) of Dart-RNAseq results from HKC and SCC samples. [Figure 11] A. 3′P-qPCR analysis and relative expression of 5′_tRFs_Glu_CTC in keratinocytes (HKC) and cSCC. B. 3′P-qPCR analysis and relative expression of 3′_tRFs_Asp_GTC in keratinocytes and cSCC. Data are presented as mean ± standard error of the mean (sem). Comparison between two groups was performed using Student's t-test; n=3; ***P<0.001. [Figure 12] Schematic diagram of the Dart-RNAseq method. A. Dart-RNAseq two-step PCR. B. Dart-RNAseq one-step PCR. [Figure 13] Schematic diagram of the 3′P-qPCR assay. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] [Definition] By "3'P RNA" is meant an RNA fragment that contains a 3' phosphate or a 2' / 3' cyclic phosphate.

[0011] "Dart-RNAseq analysis" refers to a method developed by the present inventors and disclosed herein for identifying 3'P RNA as a molecular marker of a disease or pathological condition in a biological sample.

[0012] "3'P-qPCR assay" refers to a method developed by the inventors and disclosed herein for diagnosing, assessing the risk of developing, or prognosing a disease or condition by determining the profile of molecular markers represented by 3'P RNA in a biological sample.

[0013] "PCR" or "polymerase chain reaction" refers to the selective amplification of DNA or RNA targets using the polymerase chain reaction. During PCR, short single-stranded (ss) synthetic oligonucleotides, or primers, are extended on the target template using repeated cycles of thermal denaturation, primer annealing, and primer extension.

[0014] "qPCR" or "quantitative polymerase chain reaction" refers to a PCR-based technique that combines the amplification of a target DNA or RNA sequence with quantification of the concentration of that DNA / RNA species in the reaction. This method allows for the calculation of the starting template concentration.

[0015] By "sequencing platform adapter construct" is meant a nucleic acid structure utilized by commercially available sequencing platforms, such as Illumina® (e.g., HiSeg™, MiSeg™, and NovaSeq™ sequencing systems); Element Bioscience™ (e.g., LoopSeq for AVITI™ sequencing systems); Singular genomics (e.g., G4 systems); Life Technologies™ (e.g., SOLD sequencing systems); Roche (e.g., 454 GS FLX+ and / or GS Junior sequencing systems); MGI (e.g., E25, G400, G99, G50, and T7, T10, T20 systems).

[0016] The sequencing platform adaptor structure comprises one or more nucleic acid domains.

[0017] By "nucleic acid domain" is meant an oligonucleotide molecule having a length and sequence suitable for a sequencing platform of interest, i.e., a polynucleotide used by the sequencing platform of interest can specifically bind to the nucleic acid domain.

[0018] The nucleic acid domain can have a length of 4 to 200 nucleotides (nt), 4 to 100 nucleotides, 6 to 75, 8 to 50, or 10 to 40 nucleotides.

[0019] The nucleotide sequence of the nucleic acid domain useful for sequencing on the sequencing platform of interest may vary and / or change over time. The adaptor sequence is typically provided by the manufacturer of the sequencing platform (e.g., available in the technical documentation accompanying the sequencing system and / or on the manufacturer's website). Based on such information, the sequence of the adaptor, reverse transcription primer, and / or amplification primer may be designed to include the whole or part of one or more nucleic acid domains, and configured to allow sequencing of the nucleic acid insert (3'P RNA in this example) to be analyzed on the platform of interest.

[0020] The nucleic acid domain may be selected from: a "capture domain" that specifically binds to a surface-attached sequencing platform oligonucleotide (e.g., a P5 or P7 oligonucleotide attached to the surface of a flow cell in an Illumina® sequencing system). a "sequencing primer binding domain" (e.g., a domain to which the Read 1 or Read 2 primer of the Illumina® platform may bind); a "barcode domain" (e.g., a domain that uniquely identifies the sample source of the nucleic acid being sequenced, allowing for sample multiplexing by marking each molecule from a given sample with a specific barcode or "tag"); a "barcode sequencing primer binding domain" (a domain to which the primers used to sequence the barcode bind); a "molecular identification domain" (e.g., a molecular index tag, such as a randomized tag of 4, 6, or other number of nucleotides) to uniquely mark a molecule of interest and determine expression levels based on the number of instances in which the unique tag is sequenced; or any combination of such domains. In some embodiments, a barcode domain (e.g., a sample index tag) and a unique molecular identification (UMI) domain (e.g., a molecular index tag) may be included within the same nucleic acid domain.

[0021] "Spacer allowing the arrest of a retrotranscriptase enzyme activity" refers to a chemical modification that can be used to mimic the presence of naturally occurring abasic sites resulting from depurination or other mechanisms. The modification involves replacing the deoxyribose sugar with a modified sugar molecule that lacks the 2'-hydroxyl group. This modification prevents normal base pairing and hydrogen bonding interactions between nucleotides in an oligonucleotide. It is the 1,2'-dideoxyribose modification (chemical structure: The blocking spacer may be selected from among a dSpacer having JPEG2025028815000002.jpg35166, also known as an abasic site), tetrahydrofuran (THF), or an apurinic / apyrimidinic (AP) site. Alternatively, it may be a biotinylated blocking spacer, "IntBiotin-dT", i.e., deoxythymidine (dT) conjugated with a biotin molecule, having the following structure: JPEG2025028815000003.jpg66166

[0022] "Nucleobase," "nitrogenous base," or simply "base" refers to nitrogen-containing biological compounds that form nucleosides, which are in turn the building blocks of nucleotides.

[0023] "p-value" means a statistical measure of the significance of an outcome or observation. The p-value can be determined by various statistical parameters. The most well-known statistical parameter is the null hypothesis, which represents no effect or no relationship between variables. The p-value helps evaluate the evidence against the null hypothesis and aids in the decision to reject or not reject it. Specifically, the p-value represents the probability of obtaining a test statistic that is the same as or more extreme than the statistic observed in the data, assuming that the null hypothesis is true. A very small p-value (typically below a pre-determined significance level, such as 0.05 or 0.01) suggests that the observed data is unlikely to have occurred under the null hypothesis alone. In such cases, the evidence against the null hypothesis is considered strong, and the null hypothesis is rejected in favor of the alternative hypothesis. Conversely, a relatively large p-value (above a selected significance level, usually 0.05) indicates that the observed data is not unusual or extreme under the null hypothesis. In this situation, there is not enough evidence to reject the null hypothesis and it is retained.

[0024] Other statistical parameters that define a p-value are known to those skilled in the art and include: - Test statistic: A test statistic is a numerical summary of the data used to evaluate the hypothesis being tested. The choice of test statistic depends on the nature of the data and the research question. Examples of commonly used test statistics include the t-statistic, chi-squared statistic, F-statistic, and z-score. - Alternative hypothesis: The alternative hypothesis represents the opposite of the null hypothesis and reflects the effect or relationship the researcher is trying to detect. It is typically formulated as a statement that represents a particular effect size or difference between groups. - Significance level: The significance level, commonly denoted as α (alpha), is a pre-determined threshold for determining statistical significance. It represents the maximum acceptable probability of rejecting the null hypothesis when it is true. Commonly used significance levels are 0.05 (5%) and 0.01 (1%).

[0025] Various statistical software packages and libraries provide built-in functions to calculate p-values ​​for various tests, making the process easier for researchers. P-values ​​should be interpreted in conjunction with effect sizes, confidence intervals, and other relevant measures to draw meaningful conclusions about the data and research question at hand.

[0026] There are differences in how p-values ​​are calculated and interpreted between the 3′P-qPCR assay and the Dart-RNAseq analysis methods.

[0027] In 3′P-qPCR, p-values ​​are typically calculated using statistical tests such as Student's t-test or analysis of variance (ANOVA). The p-value in 3′P-qPCR assesses the likelihood that the observed difference in RNA expression between two groups (e.g., treated and control) occurred by chance alone. A low p-value indicates that the observed difference in RNA expression is statistically significant, suggesting that there is a real difference between the groups being compared. The significance threshold (usually expressed as alpha, α) is typically set at 0.05. If the p-value is below this threshold, the results are considered statistically significant.

[0028] In Dart-RNAseq analysis, p-values ​​are usually associated with differential expression analysis, which aims to identify genes that show significant changes in expression between two conditions or groups. p-values ​​are usually calculated using statistical methods such as edgeR, DESeq2, or limma, which use count-based models and account for the inherent variation in next-generation sequencing (NGS) data. The p-value represents the probability that the observed RNA expression difference is due to random variation alone. A low p-value indicates that the observed expression difference is statistically significant, suggesting that there is a true difference between the conditions being compared. The significance threshold (α) for p-values ​​is also usually set below 0.05 to determine that the expression difference is statistically significant.

[0029] Importantly, the calculation and interpretation of p-values ​​in 3′P-qPCR and Dart-RNAseq analyses depends on the specific statistical methods and algorithms used. In addition, when analyzing large datasets in Dart-RNAseq analyses, it is important to consider other factors, such as multiple testing corrections (e.g., Bonferroni corrections), to control for false discovery rates.

[0030] For clarity, when p values ​​were calculated in 3′P-qPCR assays, they were named “3′P-qPCR p values,” and when p values ​​were calculated in Dart-RNAseq analyses, they were named “Dart-RNAseq p values.”

[0031] "Multimapping score" refers to a metric that quantifies the alignment ambiguity or the number of transcriptome locations to which a read may be mapped. It evaluates the level of uncertainty or multiple mapping potential associated with a given read. In sequencing data analysis (similar to Dart-RNAseq analysis), reads are short sequences derived from sequenced fragments of an RNA molecule. The goal is to align or map these reads to a reference transcriptome to determine their origin or location. However, due to various factors such as read length, repetitive regions, or highly similar sequences in the transcriptome, some reads may map to multiple locations with the same or similar alignment score. The multimapping score provides a measure of the ambiguity associated with read mapping. It indicates the number of transcriptome locations to which a read may be mapped with similar alignment scores. A higher multimapping score means a higher level of ambiguity, indicating that a read may originate from multiple transcriptome regions or transcripts with comparable alignment quality. Multi-mapping score is generally used in sequencing data analysis pipeline to evaluate the reliability of read mapping result and to filter out the reads with excessively ambiguous mapping.By considering multi-mapping score, those skilled in the art can make appropriate judgments about the reliability of read alignment and subsequent downstream analysis.

[0032] "Normalized counts based on sequencing depth" or "a normalized parameter based on the number of counts" refers to counts that make read count data comparable between samples for differences in sequencing depth and library size between samples, allowing for meaningful statistical analysis. It is calculated by dividing the raw read counts for each gene or transcript by a normalization factor, which is typically based on the total number of reads in a sample or the median read count across all samples in a dataset. Normalization is important in sequencing data analysis because it allows accurate comparison between samples and identification of differentially expressed genes or transcripts. Without normalization, differences in sequencing depth and library size can bias results and make it difficult to distinguish true biological changes from technical variations. Normalized counts are typically used for downstream analyses such as differentially expressed gene analysis, pathway analysis, and clustering. Normalization is performed by: (i) calculating reads per million mapped reads per 1000 bases (RPKM), which normalizes read counts by gene length and total number of mapped reads in the sample, and expressing the results as reads per million mapped reads per 1000 bases of gene length; or (ii) calculating transcripts per million (TPM), which, like RPKM, normalizes read counts by gene length and total number of mapped reads, but also takes into account the number of isoforms or transcript variants of each gene. Other normalization methods are available for sequencing data analysis, such as "trimmed mean of M-values" (TMM), "quantile normalization," or "DESeq normalization." The choice of normalization method may depend on the specific analysis pipeline, data characteristics, and purpose.

[0033] "Ct value" refers to the cycle number at which the fluorescent signal of a target RNA reaches a detectable threshold level.

[0034] "Fold change" refers to a measure of the relative change in gene expression levels between two conditions or samples. In other words, it is a measure of the up- or down-regulation of a target RNA in response to a specific treatment, condition, or experimental setting. This helps understand the relative differences in RNA expression levels and evaluate the impact of experimental variables on RNA expression patterns.

[0035] Fold change is usually calculated by comparing the expression levels of a target RNA between two conditions or samples (often referred to as a "treatment" and a "control" group).

[0036] Importantly, calculation of fold change may also include a normalization step to correct for technical variations and make data comparable between samples or conditions. Specific normalization methods may differ between 3′P-qPCR and Dart-RNAseq analysis experiments. Overall, while both methods provide information about gene expression changes, calculation and interpretation of fold change may differ between these methods due to their different principles and data output formats.

[0037] For clarity, when fold change (FC) was calculated in 3′P-qPCR assay, it was named “3′P-qPCR fold change” and when fold change (FC) was calculated in Dart-RNAseq data analysis, it was named “Dart-RNAseq fold change.”

[0038] In 3′P-qPCR, the fold change can be calculated according to the following equation: JPEG2025028815000004.jpg23166 here Ct(control) 標的is the Ct value of the target RNA determined in the control sample, Ct(processing) 標的 is the Ct value of the target RNA determined in the biological sample, Ct(control) ref is the reference Ct value determined in the control sample, Ct(processing) ref is the Ct value of the reference determined in the biological sample.

[0039] There are other mathematical methods known to those skilled in the art for calculating 3'P-qPCR fold changes. Below are some examples:

[0040] - Efficiency Correction Method: This method takes into account the difference in PCR amplification efficiency between the 3′P RNA (target gene) and the RNA-based adapter (reference gene). It involves calculating the relative amplification efficiency (E) of each RNA and using it to correct the Ct value before calculating the fold change. The formula for determining the fold change by this method is as follows: Fold change = (E_ 標的 )^(Ct(reference)-Ct(target)) where: E = Amplification efficiency = 10^ -1 / Tilt, Slope = slope of standard curve, plotted with Ct on the y-axis and log(amount) on the x-axis.

[0041] - Standard Curve Method: This method utilizes a standard curve generated from a series of known template concentrations to determine the relative expression of a target gene. The Ct values ​​of the target gene in each sample are interpolated onto the standard curve to obtain the corresponding template concentration (g / L). The template can be a treatment or a control condition. The "fold change based on the standard curve" is then calculated by comparing the template concentrations between the treatment and control conditions according to the following equation: 26 : Fold change based on standard curve = (g / L of treatment condition) / (g / L of control condition).

[0042] - Comparative Ct Method: Also known as the 2^-ΔCt method, this method directly compares the Ct values ​​of the target gene without the use of a reference gene. The Ct values ​​of the target gene in each condition / sample are normalized to a calibration sample, typically a reference condition or control sample. The fold change is calculated as 2^(-ΔCt), where ΔCt represents the difference between the Ct value of each condition / sample and the Ct value of the calibration sample.

[0043] - Relative Expression Software Tool (REST) 27 :REST is a widely used software tool that calculates fold changes based on PCR efficiency and Ct values. It uses a mathematical model to estimate fold changes and provides statistical analysis including confidence intervals and p-values.

[0044] In Dart-RNAseq analysis, fold change is calculated by comparing the read counts or expression levels of genes between two conditions or samples. Fold change is determined by calculating the ratio of the expression level of the gene in the treatment group to the expression level of the gene in the control group according to the following equation: JPEG2025028815000005.jpg14166 here n count 処理 is the "count-based normalization parameter" of the target gene determined in the biological sample, n count 対照 is the "count-based normalization parameter" of the target gene determined in the control sample.

[0045] Expression levels in Dart-RNAseq analysis are often based on a "count-based normalization parameter" expressed as reads per million mapped reads per 1000 bases of transcript (RPKM) or fragments per million mapped reads per 1000 bases of transcript (FPKM). Dart-RNAseq fold change values ​​are usually log-transformed, such as log2 fold change or log10 fold change. Log-transformed fold change values ​​are commonly used to better represent the magnitude of change and to linearize the data distribution.

[0046] "Ribonucleotide having a modified nucleobase conferring nuclease resistance" refers to a ribonucleotide with improved stability and resistance to nuclease activity. A variety of modifications have been developed to confer nuclease resistance to ribonucleotides. These modifications can involve chemical alterations to the nucleobase structure, such as the addition of specific functional groups or the substitution of specific atoms. Examples of modified nucleobases that confer nuclease resistance include, but are not limited to, the following:

[0047] - 2′-O-methyl (2′-OMe) ribonucleotides: In this modification, the 2′-hydroxyl group of the ribose sugar is replaced with a methyl group. This modification improves nuclease resistance and stability without significantly affecting RNA folding or function.

[0048] - 2′-Fluoro (2′-F) ribonucleotides: In this modification, the 2′-hydroxyl group of the ribose sugar is replaced with a fluorine atom, improving resistance to nucleases and increasing RNA stability.

[0049] - Locked Nucleic Acids (LNA): LNA introduces a methylene bridge between the 2' oxygen and the 4' carbon of the ribose sugar, effectively "locking" the ribose in the C3'-endo conformation. LNA improves nuclease resistance and also enhances binding affinity to complementary RNA or DNA sequences.

[0050] - Phosphorothioate bond: In this modification, one of the non-bridging oxygen atoms of the phosphodiester backbone is replaced with a sulfur atom. This modification improves nuclease resistance by introducing a chiral center and changing the conformation of the backbone.

[0051] - Peptide Nucleic Acid (PNA): PNA is a synthetic nucleic acid analogue in which the sugar-phosphate backbone is replaced with a peptide-like backbone. PNA exhibits superior nuclease resistance due to its non-ionic nature and unique backbone structure.

[0052] - 2′-O-(2-methoxyethyl) (2′-MOE) ribonucleotides: In this modification, the 2′-hydroxyl group is replaced with a 2-methoxyethyl group, which increases nuclease resistance and improves stability while maintaining the hybridization properties of RNA.

[0053] "5-methylcytosine" (5mC) means a modified ribonucleotide in which a methyl group is added to the 5-position of cytosine.

[0054] "Minor Groove Binder" or MGB refers to a crescent-shaped molecule that selectively binds non-covalently to the minor groove of DNA (the shallow groove of the DNA helix).

[0055] "Spacer Molecule" means a flexible molecule or a string of molecules used to link two molecules of interest.

[0056] [Detailed Description of the Invention] In the following description, numerous specific details are given to provide a thorough understanding of the embodiments. The embodiments may be practiced without one or more of the specific details, or with other methods, components, materials, etc. In some cases, well-known structures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the embodiments.

[0057] The phrase "one embodiment" or "an embodiment" used throughout this specification means that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least one embodiment. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0058] The headings provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.

[0059] A major problem in developing RNA biomarkers is the lack of technologies to identify robust candidates and simple, cost-effective techniques to detect them. 28 To facilitate biomarker discovery, the inventors developed a method (named "Dart-RNAseq") that allows for the identification of 3'P RNA as a disease biomarker, and subsequently confirmed that a targeted quantitative PCR assay (named "3'P-qPCR assay") can accurately identify the biomarker and provide a method for diagnosing, assessing the risk of developing, or determining the prognosis of a disease of interest.

[0060] The Dart-RNAseq method, shown diagrammatically in FIG. 12, essentially requires: a 5′ phosphorylation of 3′P RNA; b. first ligation of the 3′P RNA with an RNA-based adaptor, optionally the RNA-based adaptor comprising at least a portion of one nucleic acid domain of a sequencing platform adaptor structure and may comprise a unique molecular identifier or other barcode to mark each 3′P RNA from a particular source (i.e., a unique type of cell or a single cell); c. A second ligation step, called intramolecular circularization, results in circular RNA; d. Single-step retrotranscription using a DNA primer that anneals to a portion of the RNA-based adapter sequence to obtain a cDNA copy of the circular RNA, which may include none or at least one of the nucleic acid domains of the sequencing platform adapter structure; e. PCR amplification carried out in one step (see FIG. 12, panel B) or in two successive steps (see FIG. 12, panel A), wherein: - the one-step PCR is performed using a primer that anneals to at least a portion of the RNA-based adapter sequence and encompasses all of the nucleic acid domains of the sequencing platform adapter structure; - said two successive steps include: a first PCR step is performed using a primer that anneals to at least a portion of the RNA-based adapter sequence (to amplify the cDNA copy of the circular RNA) and encompasses one or more nucleic acid domains of the sequencing platform adapter structure; and a second PCR step is performed using a primer that anneals to said first PCR primer sequence and encompasses one or more nucleic acid domains of said sequencing platform adapter structure; f. sequencing the amplification products; g. Repeating steps (a) through (f) on at least one biological sample of a healthy, treated, or untreated subject as a control; h. Identifying at least one 3′P RNA molecule as a molecular marker for the disease by determining that it meets certain specific conditions and thresholds.

[0061] The 3′P-qPCR assay is shown diagrammatically in FIG. 13 and is based on the optimized design of hybrid primers for the amplification, detection, and evaluation of sequence-specific 3′P RNA disease marker(s). The 3′P-qPCR assay requires steps “a-e” described for the Dart-RNAseq analysis, but with different types of RNA-based adapter sequences and PCR primers. Specifically, step “e” of the Dart-RNAseq analysis is replaced with two qPCR amplifications performed in parallel, where the first qPCR is performed using a primer pair that partially anneals to a defined RNA-based adapter sequence and the 3′P RNA, and the second primer pair anneals to the RNA-based adapter. Because at least one of the forward or reverse primers of the first qPCR is mapped to the junction between the RNA-based adapter and the 3′P RNA, the assay has strong specificity for the 3′ and 5′ ends of the 3′P RNA and has nucleotide-by-nucleotide resolution on the 3′ and 5′ annealing sequences. After qPCR amplification, several parameters of 3′P RNA are evaluated and compared to some specific thresholds to determine the diagnosis, prognosis, treatment monitoring, or outcome predictive evaluation of a disease or condition. 3′P-qPCR assays have the advantage of reducing time and cost compared to other fluorescent and antibody-based methods, and sequencing methods. Moreover, the assays can be designed for high-throughput experiments by screening various samples for a specific 3′P RNA marker or by testing a panel of 3′P RNA markers for a specific sample on a standard 96-well plate.

[0062] In one embodiment, the present invention relates to a method for identifying at least one RNA fragment containing a 3' phosphate or a 2' / 3' cyclic phosphate (3'P RNA) contained in a biological sample of a subject suffering from a disease as a molecular marker of the disease, comprising: The method includes the following steps: (a) phosphorylating at the 5' end of at least one 3'P RNA contained in the biological sample to obtain at least one phosphorylated RNA fragment (step 1 in FIG. 12); (b) ligating the 3′ end of the at least one phosphorylated RNA fragment to the 5′ end of an RNA-based adaptor to obtain at least one first ligation product (step 2 in FIG. 12 ); wherein said RNA based adapter has formula (I): 5′OH-N x -C1-L1-A z -PR1-N y -C2-B-OH 3′ (I) where - N is a ribonucleotide, - x and y are independently integers selected from 1 to 20; - L1 is an oligoribonucleotide sequence having a length between 15 and 30; - A is an abasic site or a spacer allowing the inhibition of retrotranscriptase activity, z is an integer from 1 to 5; - PR1 is a first portion of a first nucleic acid domain of a sequencing platform adaptor structure having a length between 10 and 80; - B is absent or is a ribonucleotide having a 2'-fluoro base or a ribonucleotide having a modified nucleobase which confers nuclease resistance, and - C1 and C2 are absent or are barcode sequences containing up to 20 nucleotides, with the exception that at least one of C1 and C2 is absent; (c) self-ligating the at least one first ligation product to form at least one circular RNA molecule (step 3 in FIG. 12 ); (d) performing reverse transcription of said at least one circular RNA molecule to obtain at least one single-stranded cDNA molecule comprising the sequence of said at least one 3′P RNA (step 4 in FIG. 12 ); wherein the reverse transcription is carried out using a reverse transcription primer having the formula (II): 5′OH-R2-N z -D1-OH 3′ (II) where - D1 is a reverse complementary deoxyoligoribonucleotide of L1, wherein the complementarity of D1 to L1 is between 60% and 100%; - N is a ribonucleotide, z is an integer from 1 to 20; and - R2 is a second nucleic acid domain of the sequencing platform adaptor structure having a length between 10 and 50; (e) performing PCR amplification of said at least one single-stranded cDNA molecule to obtain at least one amplification product; wherein the PCR amplification is performed in one of the following ways: (i) Two successive steps (steps 5 and 6 in FIG. 12A ), in which: - a first PCR amplification is carried out using a first primer pair, the first forward primer and the first reverse primer having formula (III) and (IV), respectively: 5′OH-T1-T2-OH 3′ (III) 5′OH-T3-OH 3′ (IV) where ◆ T1 is a second portion of the first nucleic acid domain of the sequencing platform adaptor structure, the second portion having a length between 10 and 50; ◆ T2 is a first DNA oligonucleotide sequence having a length between 10 and 30, which anneals to at least a portion of the first portion of the first nucleic acid domain of the sequencing platform adaptor structure (PR1 in Formula I); and ◆ T3 is a second DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of the second nucleic acid domain of the sequencing platform adapter structure (R2 in Formula II); - a second PCR amplification is carried out using a second primer pair, the second forward primer and the second reverse primer having the formulas (V) and (VI), respectively: 5′OH-Q1-Q2-Q3-OH 3′ (V) 5′OH-Q4-Q5-Q6-OH 3′ (VI) where Q1 is a third nucleic acid domain of the sequencing platform adaptor structure having a length between 10 and 50; Q2 is a fourth nucleic acid domain of the sequencing platform adapter structure having a length between 6 and 20; ◆ Q3 is a third DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of the first nucleic acid domain of the sequencing platform adapter structure (T1+PR1 in Formulas I and III); ◆ Q4 is a fifth nucleic acid domain of the sequencing platform adapter structure having a length between 10 and 50; Q5 is a sixth nucleic acid domain of the sequencing platform adapter structure having a length between 6 and 20; ◆ Q6 is a fourth DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of the second nucleic acid domain of the sequencing platform adapter structure (R2 in Formula II); or (ii) one single step using a third primer pair (step 5 of FIG. 12B ), where the third forward primer and the third reverse primer have formulas (VII) and (VIII), respectively; 5′OH-Q1-Q2-Q7-OH 3′ (VII) 5′OH-Q4-Q5-Q6-OH 3′ (VIII) where ◆ Q1, Q2, Q4, Q5 and Q6 have the meanings given above; and ◆ Q7 is a DNA oligonucleotide sequence having a length between 10 and 50, comprising at its 5′ end a second portion of the first nucleic acid domain of the sequencing platform adaptor structure (corresponding to T1 in formula (III)) and annealing at its 3′ end to at least a portion of the first portion of the first nucleic acid domain of the sequencing platform adaptor structure (PR1 in formula (I)); (f) sequencing said at least one amplification product to obtain the sequence of said at least one 3′P RNA contained in said at least one single-stranded cDNA molecule; (g) repeating steps (a) through (f) on at least one control sample; wherein said control sample is a biological sample from a healthy, treated or untreated subject; (h) calculating, for the at least one 3′P RNA contained in the amplification products obtained from the biological sample and the control sample: (i) counts, (ii) Dart-RNAseq p-value, (iii) cleavage pattern, and (iv) Dart-RNAseq fold change of count-based normalization parameter in the comparison of the biological sample to the control sample according to the following equation: JPEG2025028815000006.jpg17166 here - n count 処理 is a normalization parameter based on the 3′P RNA counts determined in the biological sample; - n count 対照 is a normalization parameter based on the 3′P RNA counts determined in the control sample; wherein said at least one 3'P RNA is said at least one molecular marker of said disease in which: - the count is >200, - the Dart RNAseq p-value is ≦0.05; - the cleavage pattern comprises a cleavage frequency per base along the length of the 3'P RNA of ≦40% and a cleavage frequency per base at the 5' and 3' ends of the 3'P RNA of ≧60%; and - said Dart RNAseq fold change is > 2 or < 0.5.

[0063] In one embodiment, step (h) further comprises at least one of the following operations: - mapping the sequence of the at least one 3'P RNA contained in the amplification products obtained from the biological sample and the control sample onto a reference genome or transcriptome and calculating a multi-mapping score of the at least one 3'P RNA; - calculating the length of said at least one 3'P RNA, and - calculating a normalized count based on the sequencing depth of the at least one 3'P RNA.

[0064] In one embodiment, said at least one 3′P RNA is said at least one molecular marker of said disease in which: - said length is >15 and <200 nucleotides, or - the normalized count based on sequencing depth is >5; or - said multi-mapping score is ≦100.

[0065] The amplification product obtained at the end of phase (e) comprises at least one DNA molecule having the composition shown in Figure 12A or 12B. The sense strand of the DNA molecule comprises, from the 5' to the 3' end, the following elements: the third (Q1), the fourth (Q2), the first (T1+PR1) nucleic acid domain of the sequencing platform adaptor structure (the first nucleic acid domain is provided by the combination of the first PR1 portion and the second T1 portion), y deoxyribonucleotides (N y ), barcode sequence or none (C2), none or deoxyribonucleotides (B), sequence of 3′P RNA, x deoxyribonucleotides (N x ), none or a barcode sequence (C1), a deoxyribonucleotide (D1), z deoxyribonucleotides (N z ), the second (R2), sixth (Q5), and fifth (Q4) nucleic acid domains of the sequencing platform adaptor structure.

[0066] In one embodiment, the sequencing platform is selected from those marketed by Illumina (e.g., HiSeg™, MiSeg™, and NovaSeq™ sequencing systems); Element Bioscience (e.g., LoopSeq for AVITI™ sequencing systems); Singular genomics (e.g., G4 system); Life Technologies (e.g., SOLD sequencing system); Roche (e.g., 454 GS FLX+ and / or GS Junior sequencing systems); MGI (e.g., E25, G400, G99, G50, and T7, T10, T20 systems). Preferably, the sequencing platform is selected from those marketed by Illumina.

[0067] In one embodiment, the combination of the third (Q1), fourth (Q2), and first (T1+PR1) nucleic acid domains of the sequencing platform adaptor structure has a sequence selected from the following: (i) the P1 adaptor by Life Technologies ("Applied Biosystems SOLiD TM 4 System Library Preparation Guide, April 2010. https: / / tools.thermofisher.com / content / sfs / manuals / SOLiD4_Library_Preparation_man.pdf), (ii) GS Adapter A by Roche (reported in “GS FLX Titanium General Library Preparation Method Manual”, April 2009, USM-00048.B, https: / / dna.uga.edu / wp-content / uploads / sites / 51 / 2013 / 12 / GS-FLX-Titanium-General-Library-Preparation-Method-Manual-Roche.pdf), and (iii) MGI 5′ adapters by MGI (reported in “MGIEasy RNA Directional Library Prep Set User Manual”, Catalog No: 1000006385(16RXN), 1000006386(96RXN), Kit Version: V2.1, Manual Version: 5.0).

[0068] In one embodiment, the combination of the second (R2), sixth (Q5), and fifth (Q4) nucleic acid domains of the sequencing platform adaptor structure has a sequence selected from the following: (i) a P2 adaptor by Life Technologies ("Applied Biosystems SOLiD TM 4 System Library Preparation Guide, April 2010. https: / / tools.thermofisher.com / content / sfs / manuals / SOLiD4_Library_Preparation_man.pdf), (ii) GS Adapter B by Roche (reported in “GS FLX Titanium General Library Preparation Method Manual”, April 2009, USM-00048.B, https: / / dna.uga.edu / wp-content / uploads / sites / 51 / 2013 / 12 / GS-FLX-Titanium-General-Library-Preparation-Method-Manual-Roche.pdf), and (iii) MGI 3′ adapters by MGI (reported in “MGIEasy RNA Directional Library Prep Set User Manual”, Catalog No: 1000006385(16RXN), 1000006386(96RXN), Kit Version: V2.1, Manual Version: 5.0).

[0069] It is certainly clear that an expert in the field would know how to "cut and paste" sequences of sequencing platform adapter structures used by commercially available sequencing platforms to appropriately generate the sequences of the RNA-based adapters, reverse transcription primers and PCR primers (and, consequently, of the various nucleic acid domains identified above), so that the DNA molecule obtained at the end of step (e) has the sequence shown in Figure 12 and can be sequenced by a sequencing platform selected from those available to the expert.

[0070] In one embodiment, when said sequencing (step f) is performed on an Illumina based sequencing platform: - the sequence of the first nucleic acid domain PR1+T1 of said sequencing platform adapter structure is selected from the sequence SP1; - the second nucleic acid domain R2 of the sequencing platform adapter structure is selected from the sequence SP2; - the third nucleic acid domain Q1 of the sequencing platform adaptor structure is sequence P5; - the fourth nucleic acid domain Q2 of the sequencing platform adapter structure is selected from sequence i5 (i.e. index 5); - the fifth nucleic acid domain Q4 of the sequencing platform adapter structure is sequence P7; - said sixth nucleic acid domain Q5 of said sequencing platform adapter structure is selected from the sequence i7 (i.e. index 7).

[0071] The sequences SP1, SP2, i5, i7, P5 and P7 are part of the general knowledge of the person skilled in the art and are fully disclosed in "Illumina Adapter Sequences", document number 1000000002694 v11, May 2019; https: / / www.science.smith.edu / cmbs / wp-content / uploads / sites / 36 / 2020 / 01 / illumina-adapter-sequences-1000000002694-11.pdf.

[0072] In one embodiment, when the sequencing (step f) is performed on a sequencing platform by Element Bioscience: - the sequence of the first nucleic acid domain PR1+T1 of said sequencing platform adapter structure is selected from the sequence Read Primer 1; - the second nucleic acid domain R2 of the sequencing platform adaptor structure is selected from sequence read primer 2; - the third nucleic acid domain Q1 of the sequencing platform adaptor structure is a sequence outer adaptor; - the fourth nucleic acid domain Q2 of said sequencing platform adapter structure is selected from sequence index 2; - the fifth nucleic acid domain Q4 of the sequencing platform adaptor structure is a sequence outer adaptor; - said sixth nucleic acid domain Q5 of said sequencing platform adaptor structure is selected from sequence adaptors.

[0073] The sequences outer adaptor, index 2, lead primer 1, lead primer 2, adaptor, and outer adaptor are part of the common knowledge of the skilled artisan and are described in detail in "Amplicon LoopSeq TM for AVITI TM "Document number MA-00023 Rev.C, June 2023, go.elementbiosciences.com / amplicon-loopseq-aviti-workflow-guide and Element Elevate TM Library Prep” Document number MA-00004 Rev.B, June 2023, Full disclosure at go.elementbiosciences.com / elevate-library-prep-workflow-guide.

[0074] In one embodiment, when said sequencing (step f) is carried out on a sequencing platform by Singular Genomics: - the sequence of the first nucleic acid domain PR1+T1 of said sequencing platform adapter structure is selected from the sequence SP1; - the second nucleic acid domain R2 of the sequencing platform adapter structure is selected from the sequence SP2; - the third nucleic acid domain Q1 of the sequencing platform adapter structure is sequence S1; - the fourth nucleic acid domain Q2 of said sequencing platform adapter structure is selected from sequence index 1; - the fifth nucleic acid domain Q4 of the sequencing platform adapter structure is S2; - said sixth nucleic acid domain Q5 of said sequencing platform adapter structure is selected from sequence index 2.

[0075] The sequences S1, S2, SP1, SP2, index 1, and index 2 are part of the common knowledge of those skilled in the art and are described in "ADAPTING LIBRARIES FOR THE G4 TM ― INSERT ONLY” Document No. 600024 Rev.0, May 2023, Full disclosure at https: / / singulargenomics.com / wp-content / uploads / 2023 / 06 / Adapting-Library-Insert-600024.pdf.

[0076] In one embodiment, the first and second DNA oligonucleotide sequences T2 and T3 anneal to at least 6 nucleotides of the first portion (PR1) and second nucleic acid domain (R2) of the first nucleic acid domain of the sequencing platform adaptor structure, respectively.

[0077] In one embodiment, the third and fourth DNA oligonucleotide sequences Q3 and Q6 anneal to at least 6 nucleotides of the second portion (T1) of the first nucleic acid domain and the second nucleic acid domain (R2) of the sequencing platform adapter structure, respectively.

[0078] In one embodiment, prior to carrying out step (a), the biological sample and / or the control sample is subjected to a small RNA enrichment procedure, i.e. all RNA fragments smaller than 200 nucleotides (preferably between 10 and 200 nucleotides) are size-selected using any method known to the skilled person (e.g. silica column-based methods).

[0079] In one embodiment, the biological sample is selected from urine, whole blood, saliva, plasma, skin, fibroblasts, neural cells, liver, muscle, primary and immortalized cell lines, induced pluripotent stem cells (iPS cells), non-human embryonic stem cells (ES cells).

[0080] In one embodiment, the phosphorylation step (a) is carried out using a phosphorylating enzyme selected from T4 PNK 3'minus, T4 PNK, and recombinant T4 PNK (eg, Optikinase™).

[0081] In one embodiment, the ligation step (b) is carried out using a first ligase enzyme selected from RtcB, Archease, Arabidopsis Thaliana tRNA ligase, and a eukaryotic tRNA ligase.

[0082] In one embodiment, the self-ligation step (c) is carried out using a second ligase enzyme selected from T4 Rnl1, T4 Rnl2, T4 Rnl2tr, T4 Rnl2 K227Q, Mth Rnl, and an ATP-independent ligase that catalyzes intramolecular ligation (e.g., CircLigase™, CircLigaseII™).

[0083] In one embodiment, the reverse transcription step (d) is carried out using a reverse transcriptase (RT) selected from modified M MLV-RT enzymes (Moloney Murine Leukemia Virus Reverse Transcriptase) and AMV-RT enzymes (Avian Myeoloblastosis Virus Reverse Transcriptase), preferably selected from Maxima H Minus™, Superscript™ I-II-III-IV, Sunscript™.

[0084] In one embodiment, the PCR amplification step (e) is carried out using a DNA polymerase enzyme selected from modified Taq DNA polymerases, preferably those with high-fidelity activity (e.g., Q5® High-Fidelity DNA Polymerase, Platinum® Taq, KAPA HiFi HotStart).

[0085] The Dart-RNAseq analysis method described above allows the identification of several molecular markers for spinal muscular atrophy and cutaneous squamous cell carcinoma; the 3'P RNA markers for spinal muscular atrophy have the sequences shown in SEQ ID NOs: 1 to 83; the 3'P RNA markers for cutaneous squamous cell carcinoma have the sequences shown in SEQ ID NOs: 84 to 172.

[0086] In one embodiment, the present invention relates to a kit suitable for carrying out the Dart-RNAseq analysis method described above for identifying at least one 3′P RNA as a molecular marker for a disease, comprising: The kit comprises: (a) at least one RNA-based adaptor having formula (I): 5′OH-N x -C1-L1-A z -PR1-N y -C2-B-OH 3′ (I) where - N is a ribonucleotide, - x and y are independently integers selected from 1 to 20; - L1 is an oligoribonucleotide sequence having a length between 15 and 30; - A is an abasic site or a spacer allowing the inhibition of retrotranscriptase activity, z is an integer from 1 to 5; - PR1 is a portion of a first nucleic acid domain of a sequencing platform adaptor structure having a length between 10 and 80; - B is absent, is a ribonucleotide having a 2'-fluoro base or is a ribonucleotide having a modified nucleobase which confers nuclease resistance, and - C1 and C2 are absent or are barcode sequences containing up to 20 nucleotides, with the exception that at least one of C1 and C2 is absent; (b) a reverse transcription primer having the formula (II): 5′OH-R2-N z -D1-OH 3′ (II) where - D1 is a reverse complementary deoxyoligoribonucleotide of L1, wherein the complementarity of D1 to L1 is between 60% and 100%; and - R2 is a second nucleic acid domain of the sequencing platform adaptor structure having a length between 10 and 50; - N is a ribonucleotide, - z is an integer independently selected from 1 to 20; and either: (c) a first and a second primer pair, - said first primer pair comprises a first forward primer and a first reverse primer having formulas (III) and (IV), respectively: 5′OH-T1-T2-OH 3′ (III) 5′OH-T3-OH 3′ (IV) where ◆ T1 is a second portion of the first nucleic acid domain of the sequencing platform adaptor structure, the second portion having a length between 10 and 50; ◆ T2 is a first DNA oligonucleotide sequence having a length between 10 and 30 and anneals to at least a portion of a first portion (PR1) of the first nucleic acid domain of the sequencing platform adaptor structure; and ◆ T3 is a second DNA oligonucleotide sequence having a length between 10 and 50 and anneals to at least a portion of the second (R2) nucleic acid domain of the sequencing platform adaptor structure; - said second primer pair comprises a second forward primer and a second reverse primer having formulas (V) and (VI), respectively: 5′OH-Q1-Q2-Q3-OH 3′ (V) 5′OH-Q4-Q5-Q6-OH 3′ (VI) where Q1 is a third nucleic acid domain of the sequencing platform adaptor structure having a length between 10 and 50; Q2 is a fourth nucleic acid domain of the sequencing platform adapter structure having a length between 6 and 20; ◆ Q3 is a third DNA oligonucleotide sequence having a length between 10 and 50 and anneals to at least a portion of the first nucleic acid domain (T1+PR1) of the sequencing platform adapter structure; ◆ Q4 is a fifth nucleic acid domain of the sequencing platform adapter structure having a length between 10 and 50; Q5 is a sixth nucleic acid domain of the sequencing platform adapter structure having a length between 6 and 20; ◆ Q6 is a fourth DNA oligonucleotide sequence having a length between 10 and 50 and anneals to at least a portion of the second nucleic acid domain (R2) of the sequencing platform adapter structure; or (d) at least one primer pair, wherein the forward and reverse primers have formulas (VII) and (VIII), respectively: 5′OH-Q1-Q2-Q7-OH 3′ (VII) 5′OH-Q4-Q5-Q6-OH 3′ (VIII) where ◆ Q1, Q2, Q4, Q5 and Q6 have the meanings given above; and ◆ Q7 is a DNA oligonucleotide sequence having a length between 10 and 50, comprising at its 5' end a second portion (T1) of the first nucleic acid domain of the sequencing platform adapter structure, and annealing at its 3' end to at least a portion of the first portion (PR1 of formula (I)) of the first nucleic acid domain of the sequencing platform adapter structure.

[0087] In one embodiment, the kit comprises: (a) at least one RNA-based adapter having a sequence selected from the sequences set forth in SEQ ID NOs: 173 to 177; (b) a reverse transcription primer having the sequence set forth in SEQ ID NO: 178; and either: (c) one first primer pair comprising a first forward primer and a first reverse primer having the sequences set forth in SEQ ID NOs: 179 and 180, respectively, and at least one second primer pair comprising a second forward primer and a second reverse primer having formulas (IX) and (X), respectively: 5′OH-AATGATACGGCGACCACCGAGATCTACAC(i5)ACACTCTTTCCCTACACGACGCTCTTCCGATCT-OH 3′ (IX) 5′OH-CAAGCAGAAGACGGCATACGAGAT(i7)GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-OH 3′ (X) where (i5) is selected from Illumina sequence i5 (i.e., index 5), and (i7) is selected from sequence i7 (i.e., index 7) by Illumina; or (d) at least one primer pair comprising a forward primer and a reverse primer having formulas (IX) and (X) shown above.

[0088] In one embodiment, the kit further comprises at least one of the following:

[0089] (e) Reagents for RNA extraction and isolation from said biological samples. These include lysis buffers, silica-based spin columns, and collection tubes for efficient extraction of RNA less than 200 nucleotides with minimal contamination. Examples of lysis buffers are as follows: Tris-HCl (pH 7.5): 10 mM; EDTA (pH 8.0): 0 mM to 1 mM; Sodium chloride (NaCl): 10 mM to 0.5 M; Sodium dodecyl sulfate (SDS): 0.5%; Sodium dodecyl cholate (SDC): 0% to 0.5%; Proteinase K: 0 μg / ml to 100 μg / ml; HEPES: 0 nM to 100 mM.

[0090] (f) PNK enzyme (for phosphorylation of the 5′ end of 3′P RNA, and optionally PNK solution and buffer).

[0091] (g) a first ligase enzyme (e.g., RtcB) (necessary for carrying out the first ligation reaction, and optionally a ligation solution and buffer).

[0092] (h) A second ligase enzyme (e.g., T4 RNA ligase) (for intramolecular circularization of the first ligation product, and optionally a ligation solution and buffer).

[0093] (i) Reverse transcriptase (RT), and optionally nucleotides (dNTPs), solutions, and buffers.

[0094] Examples of RT enzymes that can be used in this kit are: - Moloney murine leukemia virus reverse transcriptase (M-MLV RT) (this enzyme is a DNA polymerase enzyme that catalyzes the synthesis of complementary DNA (cDNA) from an RNA template during the process of reverse transcription. It has both RNA-dependent DNA polymerase activity and ribonuclease H activity); - Avian Myeloblastosis Virus Reverse Transcriptase (AMV RT) (this enzyme is another RNA-dependent DNA polymerase derived from the avian myeloblastosis virus); - HIV-1 reverse transcriptase (this enzyme comes from the human immunodeficiency virus type 1); - Thermoscript reverse transcriptase (this enzyme is a modified form of M-MLV RT that shows improved stability and activity at high temperatures); - SuperScript reverse transcriptase (this enzyme is a proprietary enzyme developed by Thermo Fisher Scientific. Several variations are available, including SuperScript II and SuperScript III. These enzymes have been modified for improved thermostability, increased cDNA yields, and reduced RNase H activity); - Transcriptor reverse transcriptase (this enzyme is a reverse transcriptase from Roche Diagnostics. It exhibits high thermostability and is suitable for reverse transcription reactions carried out at high temperatures).

[0095] (j) PCR Master Mix: A ready-to-use mixture that contains all the components necessary for PCR amplification, including Taq DNA polymerase, dNTPs, and reaction buffers. The PCR master mix may also contain stabilizers, enhancers, and other additives that improve PCR performance. - Taq DNA polymerases: Platinum Taq DNA polymerase, AccuPrime Taq DNA polymerase, GoTaq DNA polymerase, GoTaq Green and GoTaq Flexi DNA polymerase, KAPA Taq DNA polymerase, Phusion Taq DNA polymerase, Q5 High-Fidelity DNA polymerase. These are hot-start DNA polymerases that typically remain inactive during reaction setup and are activated during the first denaturation step. - dNTPs (deoxynucleotide triphosphates): A mixture of all four nucleotides (dATP, dCTP, dGTP, and dTTP), each at a concentration of about 200-400 μM. - Buffer: A reaction buffer optimized for the particular DNA polymerase used, typically containing salts and stabilizers to maintain optimal enzyme activity and reaction conditions. - MgCl2: Magnesium chloride at a concentration of about 1.5-5 mM, which acts as a cofactor for DNA polymerase enzyme. - Primers: specific forward and reverse primers that target the DNA region of interest. The concentration of each primer can vary, but typically ranges from 200 to 900 nM. - Stabilizers and enhancers: various additives such as BSA (bovine serum albumin) or glycerol may be included to improve the stability and performance of the qPCR reaction.

[0096] (k) Nuclease-free water. This is molecular grade water that is free of nucleases that can degrade RNA or interfere with reactions. This is used for reconstituting lyophilized components, diluting samples, and preparing control reactions.

[0097] (l) Reaction tubes and plates. These tubes or plates are designed to provide optimal thermal conductivity and compatibility with the qPCR instrument being used.

[0098] (m) Instructions and protocols, including step-by-step protocols, guidelines for optimizing reaction conditions, and recommendations for data analysis.

[0099] The present specification also discloses an in vitro or ex vivo method for diagnosing, prognosing, monitoring treatment, or predicting treatment outcome in a subject by determining a profile of at least one molecular marker for said disease or condition contained in a biological sample of said subject (see FIG. 13, where a schematic diagram of said method is provided), wherein said at least one molecular marker is an RNA fragment containing a 3′ phosphate or a 2′ / 3′ cyclic phosphate (3′P RNA); The method includes the following steps: (a') phosphorylating the 5' end of at least one 3'P RNA contained in the biological sample to obtain at least one phosphorylated RNA fragment (step 1 in Figure 13); (b') ligating the 3' end of the at least one phosphorylated RNA fragment to the 5' end of an RNA-based adaptor to obtain at least one first ligation product (step 2 in Figure 13); wherein said RNA based adapter has formula (Ia): 5′OH-E1-A z -E2-OH 3′ (Ia) where - E1 is a first oligoribonucleotide sequence having a length between 15 and 30; - A is an abasic site or a spacer allowing the inhibition of retrotranscriptase activity, z is an integer from 1 to 5; - E2 is a second oligoribonucleotide sequence having a length between 15 and 30; (c') self-ligating the at least one first ligation product to form at least one circular RNA molecule (step 3 in Figure 13); (d') performing reverse transcription of said at least one circular RNA molecule to obtain at least one single-stranded cDNA molecule comprising the sequence of said at least one 3'P RNA (step 4 of Figure 13); wherein the reverse transcription is carried out using a reverse transcription primer having the formula (IIa): 5′OH-G-F1-OH 3′ (IIa) where - F1 is a reverse complementary deoxyoligoribonucleotide of E1, wherein the complementarity of F1 to E1 is between 60% and 100%; and - G is a first DNA oligonucleotide having a length between 10 and 30; (e') performing a first and a second qPCR amplification in parallel of the at least one single-stranded cDNA molecule to obtain a first and a second amplification product (step 5 of Figure 13); where: - the first qPCR amplification is performed using a first primer pair that anneals to at least a portion of the 3'P RNA sequence, the first primer pair being selected from primer pair set 1, set 2, and set 3, wherein each primer pair comprises a forward primer and a reverse primer, the forward primer and reverse primer of primer pair set 1 have sequences shown in formulas (IIIa) and (IVa), respectively, the forward primer and reverse primer of primer pair set 2 have sequences shown in formulas (IIIa') and (IVa'), respectively, and the forward primer and reverse primer of primer pair set 3 have sequences shown in formulas (IIIa") and (IVa"), respectively: Set 1 5′OH-H2-N-OH 3′ (IIIa) 5′OH-H1-M-OH 3′ (IVa) Set 2 5′OH-H2-N-OH 3′ (IIIa′) 5′OH-H1-OH 3′ (IVa′) Set 3 5′OH-H2-OH 3′ (IIIa″) 5′OH-H1-M-OH 3′ (IVa″) Where: ◆ H1 is a second DNA oligonucleotide that anneals to E1, where the complementarity of H1 to E1 is between 30% and 100%; and ◆ M is a third DNA oligonucleotide having a length between 6 and 30 and anneals to at least 6 nucleotides of the 3' end of the 3'P RNA sequence; ◆ H2 is a fourth DNA oligonucleotide that anneals to E2, where the complementarity of H2 to E2 is between 30% and 100%; and ◆ N is a fifth DNA oligonucleotide having a length between 6 and 30 and anneals to at least 6 nucleotides of the 5′ end of the 3′P RNA sequence; - the second qPCR amplification is carried out using a second primer pair that anneals to the RNA-based adapter sequence, the second primer pair comprising a second forward primer and a second reverse primer having formulas (Va) and (VIa), respectively: 5′OH-H2-OH 3′ (Va) 5′OH-I1-OH 3′ (VIa) Where: ◆ H2 has the meaning given above, and ♦ I1 is a sixth DNA oligonucleotide that anneals to G, where the complementarity of I1 to G is between 60% and 100%; and (f') repeating steps (a') through (e') on at least one control sample; wherein said control sample is a biological sample from a healthy, treated or untreated subject; (g') determining the Ct values ​​of the at least one 3'P RNA and of the RNA-based adapter in the first and second amplification products for either the biological sample or the control sample; (h') calculating the 3'P-qPCR fold change of the Ct value determined in step (g') according to the following equation: JPEG2025028815000007.jpg19166 here - Ct(A) 3′P is the Ct value of the 3′P RNA determined in the biological sample, - Ct(B) 3′P is the Ct value of the 3'P RNA determined in the control sample, - Ct(A) adp is the Ct value of the RNA based adapter determined in the biological sample, - Ct(B) adp is the Ct value of the RNA based adapter determined in the control sample; wherein a 3'P-qPCR fold change value of ≧2 or ≦0.5 indicates a diagnosis, prognosis, treatment monitoring, or predictive assessment of treatment outcome for said disease or condition.

[0100] The method further comprises in step (h') calculating a 3'P-qPCR p-value of the 3'P-qPCR fold change, wherein a 3'P-qPCR p-value <0.5 indicates a diagnosis, prognosis, treatment monitoring, or treatment outcome predictive assessment of the disease or condition.

[0101] The RNA-based adapter of formula (Ia) is between 50 and 100 nucleotides in length.

[0102] Spacer A included in the RNA-based adapter of formula (Ia) is selected from 1,2′-dideoxyribose modified (dSpacer), tetrahydrofuran (THF), an apurinic / apyrimidinic (AP) site, or a biotinylated blocking spacer.

[0103] The reverse transcription primer of formula (IIa) is between 10 and 100 nucleotides in length.

[0104] The primers used for the two qPCR amplifications (both the first and second primer pairs) have at least one of the following features: - They include 1 to 20 modified nucleotides; preferably, the modifications include one of the following: phosphorothioate modifications, locked nucleic acids (LNA), 2'-O-methyl modifications, 5-methylcytosine modifications, minor groove binders, spacer molecules, PNA. These modifications can be used alone or in combination to optimize primer performance, including primer specificity, stability, and melting temperature. - They are between 15 and 25 nucleotides in length; - They have minimum free energies between -3 and -150 kcal / mol; - they do not encompass strong or moderate secondary structures and / or form dimers; - They have a melting temperature between 57 and 70 °C; - They have a melting temperature difference between the forward and reverse primers of said pair of less than or equal to 3°C.

[0105] At least one of the forward and reverse primers of the first primer pair used in the first qPCR amplification anneals to at least 6, preferably 10 nucleotides of the 3'P RNA at the 3' and 5' ends, respectively.

[0106] The phosphorylation step (a') is carried out using a phosphorylating enzyme selected from T4 PNK 3'minus, T4 PNK, and recombinant T4 PNK (eg, Optikinase™).

[0107] The ligation step (b') is carried out using a first ligase enzyme selected from RtcB, Archease, Arabidopsis thaliana tRNA ligase, and eukaryotic tRNA ligase.

[0108] The self-ligation step (c') is carried out using a second ligase enzyme selected from T4 Rnl1, T4 Rnl2, T4 Rnl2tr, T4 Rnl2 K227Q, Mth Rnl, and an ATP-independent ligase that catalyzes intramolecular ligation (e.g., CircLligase™, CircLligaseII™).

[0109] The reverse transcription step (d') is carried out using a reverse transcriptase (RT) selected from modified M MLV-RT enzymes (Moloney Murine Leukemia Virus Reverse Transcriptase) and AMV-RT enzymes (Avian Myeoloblastosis Virus Reverse Transcriptase), preferably selected from Maxima H Mminus™, Superscript™ I-II-III-IV, Sunscript™.

[0110] The qPCR amplification step (e') is carried out using a DNA polymerase enzyme selected from modified Taq DNA polymerase enzymes, which preferably remain inactive during reaction set-up and are activated during an initial denaturation step.

[0111] Examples of Taq DNA polymerase enzymes that can be used in 3′P-qPCR assays are: Platinum Taq DNA polymerase, AccuPrime Taq DNA polymerase, GoTaq DNA polymerase, GoTaq Green and GoTaq Flexi DNA polymerase, KAPA Taq DNA polymerase, Phusion Taq DNA polymerase, Q5 High-Fidelity DNA polymerase.

[0112] The disease is spinal muscular atrophy (SMA) or cutaneous squamous cell carcinoma (cSCC).

[0113] At least one molecular marker for spinal muscular atrophy (SMA) is selected from 3'P RNAs having sequences set forth in SEQ ID NOs: 1-83.

[0114] At least one molecular marker for cutaneous squamous cell carcinoma (cSCC) is selected from 3'P RNAs having sequences set forth in SEQ ID NOs: 84-172.

[0115] Also disclosed herein are kits for the diagnosis, prognosis, treatment monitoring, or predictive evaluation of treatment outcome for spinal muscular atrophy (SMA) or cutaneous squamous cell carcinoma (cSCC).

[0116] A kit for the diagnosis, prognosis, treatment monitoring, or predictive evaluation of treatment outcome for spinal muscular atrophy (SMA), comprising: (a′) an RNA-based adapter having the sequence set forth in SEQ ID NO: 185; (b') a reverse transcription primer having the sequence set forth in SEQ ID NO: 186; (c') seven first primer pairs for performing a first qPCR amplification, wherein the first forward and reverse primers of the seven primer pairs have the sequences shown in the following sequence pairs: SEQ ID NOs: 187 and 188, SEQ ID NOs: 187 and 189, SEQ ID NOs: 190 and 191, SEQ ID NOs: 192 and 193, and SEQ ID NOs: 198 and 199, SEQ ID NOs: 200 and 201, SEQ ID NOs: 202 and 203; (d') A second primer pair for performing a second qPCR amplification, wherein the second forward primer and the second reverse primer have the sequences shown in SEQ ID NOs: 204 and 205, respectively.

[0117] A kit for the diagnosis, prognosis, treatment monitoring, or predictive evaluation of treatment outcome for cutaneous squamous cell carcinoma (cSCC), comprising: (a') an RNA-based adapter having the sequence set forth in SEQ ID NO: 185; (b') a reverse transcription primer having the sequence shown in SEQ ID NO: 186; (c') two first primer pairs for performing a first qPCR amplification, the first forward and reverse primers of the two primer pairs having the sequences shown in the following sequence pairs, respectively: SEQ ID NOs: 194 and 195, SEQ ID NOs: 196 and 197; (d') A second primer pair for performing a second qPCR amplification, wherein the second forward primer and the second reverse primer have the sequences shown in SEQ ID NOs: 204 and 205, respectively.

[0118] The kit further comprises at least one of the following:

[0119] (e') Reagents for RNA extraction and isolation from said biological samples. These include lysis buffers, silica-based spin columns, and collection tubes for efficient extraction of RNA less than 200 nucleotides while minimizing contamination. Examples of lysis buffers are as follows: Tris-HCl (pH 7.5): 10 mM; EDTA (pH 8.0): 0 mM to 1 mM; Sodium chloride (NaCl): 10 mM to 0.5 M; Sodium dodecyl sulfate (SDS): 0.5%; Sodium dodecyl cholate (SDC): 0% to 0.5%; Proteinase K: 0 μg / ml to 100 μg / ml; HEPES: 0 nM to 100 mM.

[0120] (f′) PNK enzyme (for phosphorylation of the 5′ end of 3′P RNA), and optionally PNK solution and buffer.

[0121] (g') A first ligase enzyme (e.g., RtcB) (necessary to carry out the first ligation reaction), and optionally ligation solutions and buffers.

[0122] (h') A second ligase enzyme (e.g., T4 RNA ligase) (for intramolecular circularization of the first ligation product), and optionally ligation solutions and buffers.

[0123] (i′) Reverse transcriptase (RT), and optionally nucleotides (dNTPs), solutions, and buffers.

[0124] Examples of RT enzymes that can be used in this kit are: - Moloney murine leukemia virus reverse transcriptase (M-MLV RT) (this enzyme is a DNA polymerase enzyme that catalyzes the synthesis of complementary DNA (cDNA) from an RNA template during the process of reverse transcription. It has both RNA-dependent DNA polymerase activity and ribonuclease H activity); - Avian myeloblastosis virus reverse transcriptase (AMV RT) (this enzyme is another RNA-dependent DNA polymerase derived from the avian myeloblastosis virus); - HIV-1 reverse transcriptase (this enzyme comes from the human immunodeficiency virus type 1); - Thermoscript reverse transcriptase (this enzyme is a modified form of M-MLV RT that shows improved stability and activity at high temperatures); - SuperScript reverse transcriptase (this enzyme is a proprietary enzyme developed by Thermo Fisher Scientific. Several variations are available, including SuperScript II and SuperScript III. These enzymes have been modified for improved thermostability, increased cDNA yields, and reduced RNase H activity); - Transcriptor reverse transcriptase (this enzyme is a reverse transcriptase from Roche Diagnostics. It exhibits high thermostability and is suitable for reverse transcription reactions carried out at high temperatures).

[0125] (j') qPCR Master Mix: A ready-to-use mixture that contains all the components necessary for PCR amplification, including Taq DNA polymerase, dNTPs, reaction buffers, and fluorescent dyes or probes for detecting amplification in real time. The qPCR master mix may also contain stabilizers, enhancers, and other additives that improve PCR performance. A qPCR master mix may therefore contain: - a Taq DNA polymerase selected from: Platinum Taq DNA polymerase, AccuPrime Taq DNA polymerase, GoTaq DNA polymerase, GoTaq Green and GoTaq Flexi DNA polymerase, KAPA Taq DNA polymerase, Phusion Taq DNA polymerase, Q5 High-Fidelity DNA polymerase, which is a hot-start DNA polymerase that typically remains inactive during reaction setup and is activated during the initial denaturation step. - dNTPs (deoxynucleotide triphosphates): A mixture of all four nucleotides (dATP, dCTP, dGTP, and dTTP), each at a concentration of about 200-400 μM. - Buffer: A reaction buffer optimized for the particular DNA polymerase used, typically containing salts and stabilizers to maintain optimal enzyme activity and reaction conditions. - MgCl2: Magnesium chloride at a concentration of about 1.5-5 mM, which acts as a cofactor for DNA polymerase enzyme. - Primers: specific forward and reverse primers that target the DNA region of interest. The concentration of each primer can vary, but typically ranges from 200 to 900 nM. - Stabilizers and enhancers: various additives such as BSA (bovine serum albumin) or glycerol may be included to improve the stability and performance of the qPCR reaction.

[0126] (k') Positive and negative controls to validate the RT-qPCR assay. The positive control includes a known amount of target 3'P RNA to determine the assay sensitivity and allow for establishing a standard curve. The negative control ensures the absence of contamination or non-specific amplification.

[0127] (l′) Nuclease-free water. This is molecular grade water that does not contain nucleases that can degrade RNA or interfere with the reactions. It is used for reconstituting lyophilized components, diluting samples, and preparing control reactions.

[0128] (m′) Reaction tubes and plates. These tubes or plates are designed to provide optimal thermal conductivity and compatibility with the qPCR instrument being used.

[0129] (n′) Instructions and protocols, including step-by-step protocols, guidelines for optimizing reaction conditions, and recommendations for data analysis.

[0130] The following provides the protocol description for carrying out the dart-RNAseq analysis method that is applied to the Illumina sequencing platform.The following description should not be interpreted as limiting the present invention, because other sequencing platforms known in the art can be used, as exemplified above, and therefore the sequence of the RNA-based adapter and primer used in the dart-RNAseq analysis method can have various meanings known to those skilled in the art.

[0131] A description of the protocol for performing the 3′P-qPCR assay is also provided.

[0132] [Outline of Dart-RNAseq analysis] [Enrichment of small RNA] Before starting Dart-RNAseq analysis, small RNA (smRNA) enrichment is performed using column-based or bead-based methods. Cell lines, snap-frozen tissues, and whole blood can be used as sources for Dart-RNAseq analysis.

[0133] For enrichment of smRNA several commercially available kits can be used, such as mirVana (ThermoFisher), miRNeasy (Qiagen), RNA Clean and Concentrator (Zymo), Agencourt beads (Beckman), etc.

[0134] [Step (a). Phosphorylation] Immediately after enrichment of small RNAs (<200 nucleotides), the 3′P RNA undergoes 5′ phosphorylation by T4 polynucleotide kinase (T4 PNK 3′Minus) according to the protocol shown in Table 1.

[0135] JPEG2025028815000008.jpg52166

[0136] Incubate the reaction in a thermal cycler at 37 °C for 1 hour.

[0137] The reaction is purified via the RNA Clean & Concentrator™-5 kit following the protocol for small RNA with final elution in 6 μL of nuclease-free water (NFW).

[0138] [Step (b). Ligation] The 3′P RNA, phosphorylated at both ends, is ligated via RtcB ligase to an RNA-based adapter (having a sequence selected from SEQ ID NOs: 173-177) that contains two to three abasic sites, eight degenerate nucleotides, a fluorouridine at the 3′ end, and a partial SP1 sequence.

[0139] The RNA-based adapter has formula (I) disclosed above. The components of formula (I) correspond as follows: SEQ ID NO: 173 is as follows: x A: 1-4 nucleotides; L1: 5-28 nucleotides; z : 29-31; PR1 (first nucleic acid domain of the Illumina adaptor structure): 32-51 nucleotides; N y A: 52-55 nucleotides; B: 56 nucleotides; SEQ ID NO: 174 is as follows: x A: 1-4 nucleotides; L1: 5-28 nucleotides; z : 29-31; PR1 (first portion of the first nucleic acid domain of the Illumina adaptor structure): 32-51 nucleotides; N y : 52-55 nucleotides; C2: 56-63; B: 64 nucleotides; SEQ ID NO: 175 is as follows: x A: 1-4 nucleotides; L1: 5-28 nucleotides; z : 29-31; PR1 (first portion of the first nucleic acid domain of the Illumina adaptor structure): 32-51 nucleotides; N y : 52-55 nucleotides; C2: 56-63; B: 64 nucleotides; SEQ ID NO: 176 is as follows: xC1: 1-4 nucleotides; C2: 5-12 nucleotides; L1: 13-36 nucleotides; A z : 37-39; PR1 (first portion of the first nucleic acid domain of the Illumina adaptor structure): 40-59 nucleotides; N y A: 60-63 nucleotides; B: 64 nucleotides; SEQ ID NO: 177 is as follows: x C1: 1-4 nucleotides; C2: 5-12 nucleotides; L1: 13-36 nucleotides; A z : 37-39; PR1 (first portion of the first nucleic acid domain of the Illumina adaptor structure): 40-59 nucleotides; N y A: 60-63 nucleotides; B: 64 nucleotides.

[0140] RtcB ligase joins the 5′OH end of the RNA-based adapter to the 3′P / 3′cP end of the small RNA, if present, according to the protocol shown in Table 2.

[0141] JPEG2025028815000009.jpg65166

[0142] The amount of RNA-based adapter depends on the amount of starting smRNA, as shown in Table 3 below.

[0143] JPEG2025028815000010.jpg52166

[0144] Incubate in a thermal cycler at 37 °C for 1 hour.

[0145] Nuclease-free water is added to a final volume of 50 μL, then the reaction is purified through the RNA Clean & Concentrator™-5 kit following the protocol for small RNA with a final elution in 8 μL of nuclease-free water.

[0146] [Step (c). Cyclization] The RtcB ligation product undergoes circularization through ligation of the 5′P and 3′OH ends by T4 RNA ligase 1. The reaction conditions are shown in Table 4.

[0147] JPEG2025028815000011.jpg52166

[0148] Incubate at 25 °C for 2 hours.

[0149] Add nuclease-free water to a final volume of 50 μL, then purify the reaction through the RNA Clean & Concentrator™-5 kit following the protocol for small RNA, with a final elution in 10 μL nuclease-free water. Optional stopping point (store at -80° C.).

[0150] [Step (d). Reverse transcription (Superscript III)] For the generation of single stranded cDNA, a reverse transcription reaction is carried out using a reverse transcription primer (SEQ ID NO: 178) having the formula (II) disclosed above. The components of formula (II) correspond to SEQ ID NO: 178 as follows: R2 (second nucleic acid domain of the Illumina adaptor structure): 1 to 34 nucleotides; N z :35-38; D1:39-59 nucleotides.

[0151] The reagents are mixed in the amounts shown in Table 5 below.

[0152] JPEG2025028815000012.jpg45166

[0153] Heat the circular RNA primer mix at 70° C. for 5 minutes, then incubate on ice for at least 1 minute. Add the reagents in the amounts shown in Table 6 to the annealed RNA.

[0154] JPEG2025028815000013.jpg37166

[0155] Incubate at 50° C. for 40 minutes, then heat the mixture to 80° C. for 5 minutes.

[0156] [Step (e). PCR amplification] [First PCR] KAPA master mix or Phusion master mix can be used. The first PCR amplification is carried out using the first primer pair (SEQ ID NO: 179 and 180) having formulas (III) and (IV) disclosed above. The elements constituting formula (III) correspond to SEQ ID NO: 179 as follows: T1 (second part of the first nucleic acid domain of the Illumina adapter structure): 1-13 nucleotides; T2: 14-33 nucleotides. Element T3 of formula (IV) corresponds to the entire sequence of SEQ ID NO: 180.

[0157] The reagents are mixed in the amounts shown in Table 7 and the reaction conditions shown in Table 8 are applied.

[0158] JPEG2025028815000014.jpg57166

[0159] JPEG2025028815000015.jpg102166

[0160] The reaction is purified using Ampure XP beads at a ratio of 1.6. The final product is eluted in a total volume of 40 μL of nuclease-free water.

[0161] [Second PCR] KAPA master mix or Phusion master mix may be used. The second PCR amplification is carried out using a second primer pair having the above formula (IX) and formula (X), respectively. The elements constituting formula (IX) are preferably as follows: Q1 is the third nucleic acid domain of the Illumina adaptor structure and has the nucleotide sequence shown in SEQ ID NO: 181; Q2 is the fourth nucleic acid domain of the Illumina adaptor structure and has a sequence selected from the sequence i5 (10 nucleotides) by Illumina; Q3 has the nucleotide sequence shown in SEQ ID NO: 182. The elements constituting formula (X) are preferably as follows: Q4 is the fifth nucleic acid domain of the Illumina adaptor structure and has the nucleotide sequence shown in SEQ ID NO: 183; Q5 is the sixth nucleic acid domain of the Illumina adaptor structure and has a sequence selected from the sequence i7 (10 nucleotides) by Illumina; Q6 has the nucleotide sequence shown in SEQ ID NO: 184.

[0162] The reagents are mixed in the amounts shown in Table 9 and the reaction conditions shown in Table 10 are applied.

[0163] JPEG2025028815000016.jpg46166

[0164] JPEG2025028815000017.jpg103166

[0165] The entire 100 μl PCR reaction is purified using Agencourt XP beads (1.6x ratio) or NucleoSpin Gel and PCR CleanUp kit.

[0166] Agencourt XP beads: follow manufacturer's instructions and elute sample in 40 μl nuclease-free water.

[0167] Nucleospin Gel column: Follow standard protocol in section 5.1 of the manufacturer's manual. Elute each sample in 20 μl of NFW. Run the final PCR on a native 10% acrylamide gel and excise the band at approximately 200 nucleotides (Figure 8).

[0168] The quality of the final library is checked with a bioanalyzer or similar (e.g., tapestation, QIAxcel), testing the length distribution of the PCR products, and defining the average length of the library, which should be between 190 nucleotides and 300 nucleotides.

[0169] The final concentration of the library is tested by qPCR using P5 (AATGATACGGCGACCACCGAGATCTACAC - SEQ ID NO: 206) and P7 primers (CAAGCAGAAGACGGCATACGAGAT - SEQ ID NO: 207). The concentration should be higher than 0.5 nM.

[0170] The quality check of the library is done as follows:

[0171] 1.1 Assess each size-selected library using the Agilent High Sensitivity DNA Kit on an Agilent 2100 Bioanalyzer.

[0172] 1.2 Use the library profile results to determine whether each sample is suitable for sequencing. Successful library generation should yield a major peak at ~200 bp.

[0173] 1.3 Perform qPCR analysis using P5 and P7 primers for each final Dart-RNAseq library. Successful library generation should result in a final concentration of at least 0.1 nM.

[0174] [Step (f). Sequencing of the amplification products] Sequencing of the amplified products is illustrated by, but not limited to, the following steps:

[0175] 1. Library denaturation and cluster generation: In this step, the library is denatured to separate the two DNA strands and then loaded onto a flow cell or sequencing chip. The library molecules are immobilized and amplified into clusters through bridge amplification or other cluster generation methods. Each cluster represents a cluster of identical DNA fragments.

[0176] 2. Actual Sequencing: Once the clusters are formed, sequencing is performed. The specific sequencing method may depend on the platform used (in this case Illumina). Sequencing-by-synthesis methods are commonly used, in which fluorescently labeled nucleotides are added sequentially and their incorporation is detected.

[0177] 3. Base calling and image analysis: During sequencing, fluorescent or other detection signals are captured and converted into base calls. Base calls represent the nucleotide sequence of the DNA template. Image analysis software processes the raw data to generate base calls for each cluster.

[0178] 4. Data processing and analysis: After sequencing, the raw data is processed to remove sequencing errors, adapter sequences, and low-quality reads. The resulting high-quality reads are then aligned to the reference transcriptome to generate the final sequence information.

[0179] 5. Data interpretation: The final step is to interpret the sequenced data and extract meaningful biological information. This is performed as described in the "NGS data analysis" section of the "Materials and methods" section.

[0180] [Step (g). Control] Steps (a) to (f) are performed on at least one control sample, where the control sample is a biological sample from a healthy, treated or untreated subject.

[0181] [Step (h). Identification of 3′P RNA as a disease biomarker] The identification of 3′P RNA as a disease biomarker is carried out as follows: a. mapping the sequence of at least one 3′P RNA contained in an amplification product obtained from a biological sample of a subject having a disease or undergoing treatment and a control onto a reference genome or transcriptome; and b. For at least one 3′P RNA contained in the amplification products obtained from the biological sample and the control sample, calculating: (i) the number of counts, (ii) the Dart-RNAseq p-value, (iii) the Dart-RNAseq fold change of the number of counts or the Dart-RNAseq fold change of the normalization parameter based on the number of counts in the biological sample compared to the control sample, (iv) the cleavage pattern, (v) the normalized counts based on the sequencing depth, (vi) the multi-mapping score, and (vii) the length of the 3′P RA sequence.

[0182] 3'P RNA is a molecular marker for a disease if the 3'P RNA contained in an amplification product of a biological sample from a subject having the disease satisfies the following conditions: - Count>200, - Dart RNAseq p-value: ≤ 0.05; - Dart RNAseq fold change ≥2 or ≤0.5, and - The cleavage pattern is a cleavage frequency of ≦40% per base along the length of the 3′P RNA and a cleavage frequency of ≧60% per base at the 5′ and 3′ ends of the 3′P RNA.

[0183] Further conditions useful for determining whether 3′P RNA is a molecular marker for disease are as follows: - normalized count based on sequencing depth >5, - multi-mapping score ≤ 100, - Length >15 and <200 nucleotides.

[0184] [Outline of 3′P-qPCR assay] [Step (a′). Small RNA phosphorylation] Immediately after enrichment of small RNAs (<200 nucleotides), the 3′P RNA is subjected to 5′ phosphorylation by T4 PNK 3′Minus according to the protocol shown in Table 11.

[0185] JPEG2025028815000018.jpg52166

[0186] Incubate the reaction in a thermal cycler at 37 °C for 1 hour.

[0187] The reaction is purified via the RNA Clean & Concentrator™-5 kit following the protocol for small RNA with final elution in 6 μL of nuclease-free water (NFW).

[0188] [Step (b′). 3′P ligation] The small RNA phosphorylated at the 5' end is ligated via RtcB ligase to an RNA-based adaptor (SEQ ID NO: 185) having the formula (Ia) disclosed above and containing three abasic sites. The components of formula (Ia) correspond to SEQ ID NO: 185 as follows: E1: 1-24 nucleotides, A z E1: 25-27, E2: 28-48 nucleotides. RtcB ligase joins the 5′OH end of the RNA-based adapter to the 3′P / 3′cP end of the small RNA, if present, according to the protocol shown in Table 12.

[0189] JPEG2025028815000019.jpg66166

[0190] The amount of RNA-based adapter (Linker_qPCR, SEQ ID NO: 185) depends on the smRNA starting material and is as shown in Table 13 below.

[0191] JPEG2025028815000020.jpg59166

[0192] Incubate in a thermal cycler at 37 °C for 1 hour.

[0193] Nuclease-free water is added to a final volume of 50 μL, then the reaction is purified through the RNA Clean & Concentrator™-5 kit following the protocol for small RNA with a final elution in 8 μL of nuclease-free water.

[0194] [Step (c′). Cyclization] The RtcB ligation product undergoes circularization through ligation of the 5′P and 3′OH ends by T4 RNA ligase 1. The reaction conditions are shown in Table 14.

[0195] JPEG2025028815000021.jpg52166

[0196] Incubation: 2 hours at 25°C.

[0197] Add nuclease-free water to a final volume of 50 μL, then purify the reaction through the RNA Clean & Concentrator™-5 kit following the protocol for small RNA, with a final elution in 10 μL nuclease-free water. Optional stopping point (store at -80° C.).

[0198] [Step (d′). Reverse transcription (Superscript III)] For the generation of single-stranded cDNA, the reagents are mixed in the amounts shown in Table 15. The reverse transcription primer (SEQ ID NO: 186) has the formula (IIa) disclosed above. The components of formula (IIa) correspond to SEQ ID NO: 186 as follows: G: 1-19 nucleotides, F1=20-35 nucleotides.

[0199] JPEG2025028815000022.jpg42166

[0200] Heat the circular RNA primer mix to 70° C. for 5 minutes, then incubate on ice for at least 1 minute. Add the reagents shown in Table 16 in the amounts shown to the annealed RNA.

[0201] JPEG2025028815000023.jpg37166

[0202] Incubate at 50° C. for 40 minutes, then heat the mixture to 80° C. for 5 minutes.

[0203] [Step (e′).3′P-qPCR] A first and a second qPCR amplification of at least one single stranded cDNA molecule is performed in parallel, wherein: (i) A first qPCR amplification is performed using a first primer pair selected from Set 1, Set 2, and Set 3. Elements H1 and H2 of formula (IIIa, IIIa′, IIIa″, IVa, IVa′, and IVa″) have fixed sequences independent of the disease under investigation, while elements M and N must have specific sequences that anneal to the 3′P RNA marker under analysis; (ii) A second qPCR amplification is performed using a second primer pair comprising a second forward primer and a second reverse primer (SEQ ID NOs: 204 and 205) having formulas (Va) and (VIa), respectively.

[0204] qPCR amplification was performed with SYBR™ Green PCR Master Mix for all qPCR amplification steps.

[0205] JPEG2025028815000024.jpg52166

[0206] JPEG2025028815000025.jpg44166

[0207] The melting temperature must be adjusted depending on the particular primers used in the amplification.

[0208] [Step (f′). Control] Steps (a') to (e') are performed on at least one control sample, where the control sample is a biological sample from a healthy, treated or untreated subject.

[0209] [Step (g′). Determination of Ct value] Quantitative analysis of qPCR is obtained through analysis of the quantification of cycle values ​​(Ct or threshold cycle) given by the qPCR instrument. As the cycle value (Ct) increases, the fluorescence detected also increases. When the fluorescence crosses any line, the instrument records the cycle value up to that time, known as the Ct value. The amount of 3′P RNA in a given sample is then determined using relative or comparative quantification.

[0210] At least one 3'P RNA Ct value is determined for the first and second amplification products of each biological sample.

[0211] [Step (h′).3′P-qPCR fold change calculation] Relative or comparative quantification uses the difference in Ct as a determinant of the difference in concentration of 3'P RNA in a biological sample and a control sample.

[0212] Calculation of 3′P-qPCR fold change of Ct values ​​of at least 1 3′P RNA is performed according to the following formula: JPEG2025028815000026.jpg19166 here - Ct(A) 3′Pis the Ct value of 3′P RNA determined in the biological sample, - Ct(B) 3′P is the Ct value of 3′P RNA determined in the control sample, - Ct(A) adp is the Ct value of the RNA-based adapter determined in the biological sample, - Ct(B) adp is the Ct value of the RNA-based adapter determined in the control sample; A 3′P-qPCR fold change value of ≧2 or ≦0.5 indicates diagnosis, prognosis, treatment monitoring, or predictive evaluation of a disease or condition. EXAMPLES

[0213] To investigate the potential of 3'P RNA fragments as biomarkers, the inventors focused on two case studies: (i) spinal muscular atrophy (SMA) and (ii) cutaneous squamous cell carcinoma (cSCC). The specific embodiments disclosed in this disclosure should not be construed as limiting the scope of protection of this application, since the methods disclosed herein can be used to identify molecular markers of various diseases, and to diagnose, predict, and monitor various diseases.

[0214] The diagnosis of SMA is well established through the genetic detection of SMN1 mutations and SMN1 protein deletions; however, markers of disease progression and treatment response are very poor, although three drug treatments have been approved to date. 29 .

[0215] Regarding SMA, Dart-RNAseq analysis of liver tissue from an early-stage SMA mouse model revealed a global downregulation of 3′P RNAs, many of which were classified as tRNA fragments (tRFs). Previous reports have found that tRFs have potential as biomarkers for a variety of diseases, including cancer and neurological disorders. 5,19,30~32As a proof of concept, we used our method to screen only a subpopulation of tRFs with 3′P, ensuring better resolution for this specific category of fragments. Among them, 3′P-tRFs_Val showed a three-fold decrease in SMA livers compared to controls and had distinct cleavage sites at the anticodon loop and CCA tRNA terminus, forming a 39-nucleotide fragment also known as 3′tRNA half. 33 Among the upregulated RNAs, 3′P Gm22973 was identified, which is a fragment arising from the Gm22973 transcript, also known as the U2 snRNA pseudogene in the mouse transcriptome. Interestingly, loss of function of the SMN protein in SMA pathology was associated with alterations in snRNP assembly, suggesting a correlation between SMA and overexpression of the 3′P-Gm22973 fragment.

[0216] Cutaneous squamous cell carcinoma is characterized by the abnormal proliferation of squamous cells. Although most cSCCs can be cured by surgery, some will recur and metastasize, leading to high rates of death (>50%). Although the incidence of cSCC is increasing year by year, there are still no reliable molecular markers for cancer progression, recurrence, and metastasis. 34 Here, we aim to combine a low-input 3′P RNA next-generation sequencing (NGS) method with a targeted 3′P-qPCR assay to profile and quantify 3′P RNA fragments.

[0217] For cSCC, immortalized squamous cell carcinoma cells and healthy keratinocyte cells were analyzed. The expression of cSCC-specific 3′P RNA fragments was investigated.

[0218] 3'P tRFs derived from the 5' end of tRNA glutamic acid (5'_tRFs_Glu_CTC) and the 3' end of tRNA aspartic acid_GTC (3'_tRFs_Asp_GTC) were identified as potential disease markers. Overall, 3'P-qPCR enabled the inventors to successfully confirm the Dart-RNAseq data in selected cSCC target samples and also to discriminate between highly conserved tRNA sequences.

[0219] In conclusion, we show herein that the combination of Dart-RNAseq analysis and 3′P-qPCR assays is useful to screen, identify and validate potential new disease markers and to identify novel disease biomarkers that are yet to be uncovered in 3′P RNA-omics.

[0220] [result] [3′P RNA fragments in spinal muscular atrophy] To address the low input requirements necessary for biomarker studies, we designed a method, named Dart-RNAseq, which is based on our previously developed circAID technology (a protocol for 3′P RNA nanopore sequencing). 35) by introducing two main improvements. The first is a ligation step with a specific adapter that contains: (i) an internal retrotranscription stop site, (ii) a 12-nucleotide sequence as a unique molecular identifier (UMI) for PCR duplicate identification, and (iii) a barcode sequence (8-nucleotides) for pooling multiple samples in one run. The second is retrotranscription combined with a two-step PCR, which makes the workflow ideal for NGS sequencing. This approach allows sequencing and profiling of 3′P RNA across the entire transcriptome. We tested this workflow by adding an exogenous nuclease (ribonuclease I) to crude cell lysates of CHO cells, followed by ribosome isolation and RNA extraction. This procedure, called ribosome profiling, is used to identify ribosome footprints (RPFs). 36 Our results confirm the enrichment of RPFs in coding sequences with distinct three-nucleotide periodicity of ribosomal P sites and validate the ability of our method to sequence 3′P RNA generated by enzymatic cleavage with ribonuclease I (Figure 1). We term this method Dart-RNAseq.

[0221] To identify suitable starting material for biomarker screening, we analyzed publicly available RNA-sequencing datasets. RNA-sequencing dataset of SMA models 37 Screening revealed that the liver of early-stage (P5) SMA mice expresses angiogenin, a well-known enzyme that forms 3′P tRFs. 38,39We observed that P5 SMA and healthy livers showed elevated levels of tRNAs. Dart-RNAseq analysis of P5 SMA and healthy livers was performed starting with 500 ng of size-selected small RNA (<200 nucleotides long). The read length distribution of the sequencing output of total RNA fragments ranged from 15 to 70 nucleotides, with two major peaks around 20 and 35 nucleotides (Figure 2). The majority of reads mapped onto non-coding RNAs, mainly rRNA (25% in control and 23% in SMA), and tRNA (29% in control and 25% in SMA) (Figure 3).

[0222] Surprisingly, Dart-RNAseq differential expression analysis (SMA vs. control) showed an overall decrease in 3′P RNA in P5 liver compared to controls (Table 19 - Number of up- and down-regulated 3′P RNA fragments detected), suggesting that angiogenin overexpression is not the main cause of 3′P RNA fragments in these samples, but other nucleases must also be involved. All 3′P RNA fragments highlighted in the table are filtered for Dart-RNAseq log2FC>1 or log2FC<-1 and Dart-RNAseq p-value<0.05.

[0223] JPEG2025028815000027.jpg44166

[0224] More specifically, we found 50 downregulated 3′P RNAs (p-value < 0.05; Dart-RNAseq log2FC < -1), of which 38 were tRNA fragments. In contrast, only three fragments were upregulated (Dart-RNAseq p-value < 0.05; Dart-RNAseq log2FC > 1). To select the most robust hits for further investigation, we applied a more stringent filtering step based on: (i) read counts (> 300), (ii) Dart-RNAseq fold change (log2FC > 2 or log2FC < -2), (iii) Dart-RNAseq p-value < 0.05, and (iv) fragment length > 15 nucleotides, (iv) shape of cleavage pattern. To measure the last parameter, we plotted the read counts for each fragment as a function of nucleotide position. Only fragments with a per base cleavage frequency below 40% along their entire length and at least 60% per base cleavage frequency at the 5′ and 3′ ends (Figure 5) were considered. Only fragments longer than 15 nucleotides and either uniquely mapping on the target or with a low multi-mapping score (≤100 multi-mapping reads - see Materials and Methods) were included in the analysis. We targeted three down-regulated fragments, all derived from tRNA valine (tRFs Val-AAC, tRFs Val-CAC, and tRFs Val-TAC), and one up-regulated fragment, derived from Gm22973 (U2 snRNA pseudogene). Notably, tRFs Val was the only fragment showing a clear cleavage at nucleotide 37 of the anticodon loop (Figure 4), generating a 39-nucleotide fragment terminating at nucleotide 75 of the CCA tail, defined as the 3′ tRNA half. 33The Gm22973 fragment arises from the full-length Gm22973 transcript. Interestingly, the detected 3′P RNA fragment aligns to the Sm protein-binding RNA binding site (Figure 6). Sm proteins are a group of proteins that bind to snRNAs to form small nuclear ribonucleoproteins (snRNPs) involved in splicing. Of note, SMN is involved in recruiting and assembling Sm proteins into snRNPs, and loss of SMN protein causes altered assembly in SMA. 40 .

[0225] To precisely quantify 3′P RNA fragments with specific 5′ and 3′ ends, we designed a dedicated 3′P-qPCR assay based on adapter ligation, circularization, and selective amplification. The adapter and final qPCR steps have different characteristics from those used in Dart-RNAseq (see Methods). We designed primers at the adapter-fragment junctions, which anneal to the target sequence at least six nucleotides at both ends of the fragment of interest. The isodecoders of downregulated valine (3′P tRFs Val-AAC, tRFs Val-CAC, and tRFs Val-TAC) had identical cleavage patterns and were selected as good candidates for initial validation. We designed primers at the adapter-fragment junctions for each of the three selected candidates (from 3′P tRFs Val-AAC / CAC, 3′P tRFs Val-TAC). In this process, we were able to identify 3′P tRFs Val TAC. As expected, we could not distinguish between 3′P tRFs Val-AAC and tRFs Val-CAC, since the last 10 nucleotides at the 5′ and 3′ ends of both fragments are completely identical. After 3′P-qPCR, we observed a two-fold downregulation of 3′P tRFs Val-AAC / CAC in SMA liver tissues compared to controls (Figure 7A), consistent with the Dart-RNAseq data. Conversely, no significant downregulation was observed for 3′P tRFs Val-TAC, revealing that a targeted qPCR approach is necessary for the evaluation of specific fragments. To further validate our results, we performed Northern blot analysis. The 3′P tRFs Val-AAC / CAC fragment band in the gel showed a two-fold lower intensity in SMA mouse liver samples compared to healthy mouse liver, confirming the 3′P-qPCR results (Figure 7B). Overall, our data suggest that 3′P tRFs Val AAC / CAC is a good disease marker among the biological models under study.

[0226] We next sought to validate the Gm22973-derived fragment identified by sequencing. This RNA is upregulated in SMA liver samples and shows only one mutation at position 15 compared to another fragment present in our sequencing output and mapping on the U2 transcript, but the fragment is not significantly altered between control and SMA samples. Of note, the U2-derived fragment is much more abundant compared to the pseudogene-derived fragment (U2 fragment count: 24000; Gm22973 fragment count: 600, both average counts in SMA samples). To discriminate between the two types of fragments, which differ by only one nucleotide, we designed two sets of primers. The forward primer is located at the adapter-fragment junction and is common to the two fragments, while the reverse primer differs by the last nucleotide at the 3′ end, which maps to the position of the mismatch between the Gm22973-derived fragment and the U2-derived fragment. We observed a fourfold increase with Gm22973-specific primers but no change with the U2-derived fragment ( Fig. 8A and C ), indicating that our 3′P-qPCR approach has single-nucleotide resolution in detecting the specific 3′P RNA fragment of interest.

[0227] We further sought to assess whether the increased abundance in SMA samples reflected changes in the full-length pseudogene transcript or was only associated with specific fragments. To do so, we performed standard qPCR on the full-length Gm22973 and U2 transcripts. We observed that the increase in the Gm22973 fragment also reflected high expression of the full-length pseudogene in SMA samples (Figure 8B), whereas the full-length U2 transcript was decreased (Figure 8D). Taken together, our data suggest that the full-length Gm22973 transcript and derived fragment products are potential disease markers.

[0228] To further explore whether the methods applied to mouse samples could also be used for SMA cells of human origin, we applied Dart-RNAseq to human fibroblasts obtained from SMA type I and II patients, as well as healthy controls.

[0229] After differential expression analysis, we identified a list of 3′P RNAs that were differentially expressed between normal vs. SMA1, normal vs. SMA2, and SMA1 vs. SMA2 (Table 20), among which we identified tRFs Val-AAC / CAC as targeting, although it has a different fragment sequence compared to the mouse data.

[0230] Our results confirmed the cross-species robustness of the method and highlighted the potential of tRFs Val-AAC / CAC and other 3′P RNAs (listed in Table 20) as biomarkers for SMA.

[0231] JPEG2025028815000028.jpg225166JPEG2025028815000029.jpg238166JPEG2025028815000030.jpg211166

[0232] Finally, we assessed changes in 3′P RNA profiles following treatment with risdiplam and nusinersen, two drugs designed to regulate the SMN2 gene and increase SMN protein production. This analysis aimed to determine how these treatments alter 3′P RNA expression, thereby providing insight into the molecular effects and the potential for 3′P RNA to serve as a marker of treatment response.

[0233] The 3'P RNA molecular markers of therapeutic response identified are set forth in Table 21 below.

[0234] JPEG2025028815000031.jpg49166

[0235] [3′P RNA fragments in cutaneous squamous cell carcinoma] To identify potential molecular markers of malignant skin lesions, we first performed Dart-RNAseq analysis on four replicate samples of HSC-1, a human skin squamous cell carcinoma cell line, and compared the results with those obtained from four control samples of keratinocytes. Application of dart-RNAseq showed similar mapping results to those obtained with SMA samples. The majority of reads mapped onto non-coding RNAs, of which 25% were tRNAs (Figure 9). Principal component analysis (PCA) based on 3′P tRFs clearly clustered cSCC and keratinocyte samples (Figure 10), suggesting that this subgroup of 3′P RNAs could be used as an indicator of disease status. Differential expression analysis of normal versus tumor samples indicates that 105 tRNA fragments out of 1930 hits were significantly downregulated and 77 out of 1108 tRNA fragments were significantly upregulated. Interestingly, tRFs were up- or downregulated according to the charge of the encoded amino acid (i.e., downregulated 3′P tRFs encoded negative amino acids, whereas upregulated ones encoded positive amino acids), suggesting a possible codon usage preference in cSCCs compared to control cells. When checking the type of tRFs, we observed a clear downregulation of 5′ and 3′ long tRFs, whereas 3′P short tRFs were mainly upregulated (Table 22 - Total up- and downregulated 3′P tRNA fragments counts (tRFs, lane 1) and reported counts per tRF subtype (lanes 2–6)). All 3′P tRNA fragments highlighted in the table were filtered for dart-RNAseq log2FC>1 or log2FC<-1 and Dart-RNAseq p-value<0.05.

[0236] JPEG2025028815000032.jpg66166

[0237] The best hits for further investigation with 3′P-qPCR were selected based on the filtering steps previously described: (i) read count (>200), (ii) Dart-RNAseq fold change (log2FC>1 or log2Fc<-1), (iii) Dart-RNAseq p-value <0.05, and (iv) sharp cleavage pattern. As a first validation, we designed primers for 3′P tRFs derived from the 5′ end of tRNA glutamate (5′_tRFs_Glu_CTC) and the 3′ end of tRNA aspartate_GTC (3′_tRFs_Asp_GTC). By 3′P-qPCR assay we confirmed the downregulation of both tRFs in cSCC cell lines compared to healthy keratinocytes (Figure 11). The identified 3′P RNA molecular markers of cSCC are listed in Table 23.

[0238] JPEG2025028815000033.jpg221166JPEG2025028815000034.jpg225166JPEG2025028815000035.jpg178166

[0239] After confirming that 3′P tRFs were differentially expressed in cSCC in vitro models, we investigated their presence in human plasma samples. To this end, we analyzed plasma samples from nine healthy donors and nine cSCC patients by Dart-RNAseq. The identified 3′P RNA molecular markers of cSCC in plasma are listed below in Table 24.

[0240] JPEG2025028815000036.jpg48166

[0241] [material and method] [Mouse liver tissue] Liver tissue was harvested from a "Taiwanese" mouse model of severe SMA at early symptoms (postnatal day 5 - P5). Phenotypically normal littermates (Smn±; SMN2tg / 0) were used as controls. After dissection, liver tissue was snap frozen and stored at -80°C until use.

[0242] [Cell line] Human skin squamous cell carcinoma cell line (HSC-1, accession number JCRB1015) was purchased from JRB (https: / / cellbank.nibiohn.go.jp / english / ) and cultured in 10 cm plates in Dulbecco's modified Eagle medium containing 20% ​​fetal bovine serum. Cells were harvested after treatment with 0.02% EDTA and 0.05% trypsin for 3 min under 95% air and 5% carbon dioxide (CO2). Cells were subcultured every 2 weeks.

[0243] Human epidermal keratinocytes were purchased from ATCC (catalog number PCS-200-011). Human epidermal keratinocytes were cultured according to the supplier's instructions.

[0244] Human derived fibroblasts for SMA experiments were purchased from the Coriell Institute (see Table 25 below) and cultured according to the supplier's instructions. Fibroblasts were treated with nusinersen (Biogen) or risdiplam (Sanbio, catalog number 29028-1). Treatments with nusinersen and risdiplam were performed at 75-80% confluency. For nusinersen treatment, the drug was used at a final concentration of 10 nM and transfected using the Lipofectamine™ LTX Reagent and PLUS™ Reagent kit (Invitrogen, catalog number A12621) according to the manufacturer's recommendations. For risdiplam treatment, cells were treated with a final concentration of 0.5 μM. Treatments were repeated twice, 24 hours apart.

[0245] JPEG2025028815000037.jpg66166

[0246] [Human plasma] Patient plasma was purchased from Proteogenex (Proteogenex, Inc., California, USA). All blood products were collected under IRB approval by certified phlebotomists, and blood processing was performed under strict standard operating procedures (confidential documentation available upon request). Below is a list of healthy donors and SCC patients.

[0247] JPEG2025028815000038.jpg134166

[0248] [RNA extraction] Total RNA and small RNA enrichment were performed by MirVana Kit (ThermoFisher Cat. No. AM1561) according to the manufacturer's instructions. Briefly, mouse liver tissue was ground under liquid nitrogen using a mortar and pestle. The powder was then transferred into a 1.5 mL tube, where cells were disrupted by adding MirVana lysis buffer and miRNA additive, followed by column purification. Cell lines were lysed and processed according to the MirVana Kit specifications. After RNA purification, total RNA was quantified by Nanodrop, and small RNA fraction was quantified by QuBit miRNA assay (ThermoFisher Cat. No. Q32880). RNA integrity was confirmed by Total RNA nano chip (Agilent Cat. No. 5067-1511).

[0249] [Dart-RNAseq analysis] [5′ phosphorylation and adapter ligation] The small RNA fraction was used as input for library preparation. Specifically, 500 ng of small RNA was subjected to 5′ phosphorylation using T4 PNK 3′ minus (NEB, Cat. No. M0236S) according to the manufacturer's instructions. Small RNA was purified using RNA Clean & Concentrator™-5 column (Zymo Research, Cat. No. R1013) and ligated to RNA adapter via RtcB (NEB Cat. No. M0458S) according to the following conditions: 500 ng small RNA, 0.7 pmol adapter, 15 pmol RtcB, 1×RtcB buffer (50 mM Tris-HCl, 75 mM KCl, 10 mM DTT), 150 μM GTP, 1.8 mM MnCl2, final volume 10 μL. The reaction was incubated at 37° C. for 1 hour and then purified by RNA Clean & Concentrator™-5 column. The RNA-based adapters (RNA-based adapters described in Table 24) contain: (i) a portion of the SP1 sequence required for Illumina sequencing, (ii) eight degenerate nucleotides used as unique molecular identifiers (UMIs), (iii) three abasic sites to allow pausing of the RT enzyme and generation of single-stranded cDNA, and (iv) a terminal fluorouridine to prevent ribonuclease degradation.

[0250] [Cyclization] Circularization of adapter-ligated RNA (RNA:adapter) was performed in a total volume of 20 μl containing 10 U of T4 RNA ligase 1 (NEB, Cat. No. M0204L), 1× T4 RNA ligase buffer (50 mM Tris-HCl, 1 mM MgCl2, 1 mM DTT), 20% PEG8000, 50 μM ATP for 2 hours at 25° C. Circular RNA was purified by using an RNA Clean & Concentrator™-5 column (Zymo research, Cat. No. R1013).

[0251] [RT and PCR amplification] For the generation of single-stranded cDNA, the circular RNA underwent reverse transcription using Superscript III enzyme (Thermo Fisher catalog number 18080093) according to the following conditions: 200 uM dNTP mix, 10 uM RT primer (listed in Table 25), 1× RT buffer, 5 mM DTT. The RT primer contains the full-length SP2 sequence required for Illumina sequencing, and four degenerate nucleotides for the UMI. The mixture was incubated at 70° C. for 5 min to allow circular RNA denaturation, then heated on ice for 2 min, at 50° C. for 40 min, and at 80° C. for 5 min to heat inactivate the RT enzyme. After the formation of linear single-stranded cDNA, the RT reaction mixture was amplified by two-step PCR. The first PCR amplification involved the cDNA amplification and the introduction of the full-length SP1 sequence by the forward primer. The second PCR amplification step is required for the integration of the unique dual index (UDI) adapter, required for Illumina sequencing.

[0252] Briefly, the first PCR step was performed according to the following conditions: 20 uL RT reaction, 0.8 uM SP1 forward primer and 0.8 SP2 reverse primer, 1x Phusion high fidelity master mix (Thermo Fisher, Cat. No. F531S), final volume 100 uL. The PCR mixture was amplified in 0.2 tubes in a thermal cycler as follows: 98°C for 1 min, followed by 8 cycles of 98°C for 30 s, 61°C for 30 s, 72°C for 10 s. The reaction was then purified by 1.6 volumes of Agencourt AMPure XP beads (Agencourt, Cat. No. A63882) according to the manufacturer's instructions.

[0253] The purified DNA was used for the second PCR step: 40uL of PCR1, 1.5uM UDI adapters (Eurofins, set no. 48 / 1), 1x Phusion high fidelity master mix (Thermo Fisher, catalog no. F531S), final volume 100uL. The PCR mixture was amplified in 0.2 tubes in a thermal cycler as follows: 98°C for 1 min, followed by 6 cycles of 98°C for 30 s, 60°C for 30 s, and 72°C for 10 s. The reaction was then purified by NucleoSpin Gel and PCR CleanUp kit. All sequences used for Dart-RNAseq library preparation are listed in Table 24 (SEQ ID NOs. 173-182).

[0254] [Gel purification and sequencing of libraries] The final library was loaded onto a 10% TBE gel (Thermo Fisher, Cat. No. EC6275BOX), run at 200V for 1 hour, stained with Sybr™ Gold (Invitrogen, Cat. No. S11494), and scanned using a Chemidoc (GE Healthcare, Piscataway, NJ). To remove adapter dimer contamination, the correct band at 200 nucleotides was isolated from the gel, crushed and soaked overnight in Buffer II (Immagina Biotechnology srl, Cat. No. #KGE002) at room temperature under constant rotation. The water-soluble gel debris was filtered using Millipore ultrafree MC tubes and then precipitated with isopropanol (Sigma, Cat. No. I9516) at -80°C for 2 hours or overnight. After precipitation, the samples were centrifuged at 12000g for 30 minutes at 4°C. The pellet was washed once with 70% ethanol, centrifuged at 12000g for 5 min at 4°C, air dried, and resuspended in 12uL of nuclease-free water. To assess correct length, each size-selected library was checked using the Agilent High Sensitivity DNA Kit on an Agilent 2100 Bioanalyzer, while qPCR using P5 and P7 primers was used for high-resolution library quantification. The final pool was sequenced using 100 cycles of single reads on an Illumina Novaseq.

[0255] [NGS data analysis] NGS data obtained from cell lines or mouse liver tissues were trimmed by removing 3′-end adapters using Cutadapt. UMIs were extracted using UMI-tools extract (Smith, 2017). Trimmed reads less than 10 nucleotides in length were discarded. Remaining reads were then aligned to the corresponding genome. The generated BAM files, used for subsequent analysis using the tRAX pipeline (Holmes AD et al., 2022), were published on bioRxiv (a free online archiving and distribution service for unpublished preprints in the life sciences). Differential expression analysis was performed using DEseq2. 41 .

[0256] Hits from the differential expression analysis were selected according to the following filters: - Lead count: ≥ 200 counts - Dart-RNAseq Log2 FC: ≥1 for upregulation and ≤-1 for downregulation compared to control or untreated samples. - Dart-RNAseq p-value: ≤ 0.05, or any statistical parameter that ensures a statistically robust threshold across samples. - Cleavage pattern: the fragment of interest must show distinct cleavage sites, i.e., a cleavage frequency per base along the fragment length of ≦40% and a cleavage frequency per base of ≧60% at the 5′ and 3′ ends of the fragment. - Multi-mapping score: ○ (for all fragments): Only fragments with ≦100 multimaps are accepted ○ (for tRNA fragments): Only fragments with ≦100 multimaps are accepted. Of these, we further classify tRFs as follows: · transcript-specific (reads that map uniquely to the corresponding tRNA transcript sequence); · isodecoder specific (reads that map uniquely to a transcript with a corresponding anticodon); · isotype-specific (reads that map only to transcripts of the corresponding tRNA isotype); · Non-amino specific (reads mapping to multiple tRNA isotypes); Specifically, the following tRFs are preferred: transcript specific > isodecoder specific > isotype specific. Non-amino specific ones will not be considered.

[0257] [3′P-qPCR] 3′P-qPCR shares all steps of Dart-RNAseq analysis up to retrotranscription, but uses different RNA-based adapters. The minimum amount of small RNA input material tested was 100 ng (quantified by QuBit miRNA assay). The specific RNA-based adapters and RT primers used for 3′P-qPCR are shown in Table 27. For 3′P-qPCR amplification, each primer pair was designed according to the following rules: - The forward and reverse primers have a length ranging from 15 to 23 nucleotides and must be designed at the junction between the adapter and the 3′P RNA of interest to maintain specificity at the 5′ and 3′ ends of the 3′P RNA. - The forward and reverse primers should anneal with at least 6 nucleotides to the 3'P RNA of interest to confer sequence specificity. - The melting temperature should be in the range of 58°C to 63°C, with a maximum difference of 1.5°C between the forward and reverse primers of each primer pair. - The forward and reverse primers should have minimal secondary structure and avoid the possibility of hetero- and homo-dimer formation.

[0258] The list of primers used for validation of 3′P RNA fragments is listed in Table 28. All qPCR amplifications were performed with SYBR™ Green PCR Master Mix (Thermo Fisher, Cat. No. 4309155). The Ct value of each 3′P RNA is normalized using the total amount of RNA-based adapters. Primers for normalization are listed in Table 28.

[0259] JPEG2025028815000039.jpg218166JPEG2025028815000040.jpg120166

[0260] JPEG2025028815000041.jpg210166JPEG2025028815000042.jpg68166

[0261] [References] 1. Slamon, DJ et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med 344, 783-92 (2001). 2. Goossens, N., Nakagawa, S., Sun, X. & Hoshida, Y. Cancer biomarker discovery and validation. Transl Cancer Res 4, 256-269 (2015). 3. Sparano, JA et al. Adjuvant Chemotherapy Guided by a 21-Gene Expression Assay in Breast Cancer. New England Journal of Medicine 379, 111-121 (2018). 4. Wang, K. et al. Circular RNA mediates cardiomyocyte death via miRNA- dependent upregulation of MTP18 expression. Cell Death Differ 24, 1111-1120 (2017). 5. Honda, S. et al. Sex hormone-dependent tRNA halves enhance cell proliferation in breast and prostate cancers. Proceedings of the National Academy of Sciences 112, E3816-E3825 (2015). 6. Tang, J. et al. A novel biomarker Linc00974 interacting with KRT19 promotes proliferation and metastasis in hepatocellular carcinoma. Cell Death Dis 5, e1549-e1549 (2014). 7. Pardini, B., Sabo, A. A., Birolo, G. & Calin, G. A. Noncoding RNAs in Extracellular Fluids as Cancer Biomarkers: The New Frontier of Liquid Biopsies. Cancers (Basel) 11, 1170 (2019). 8. Paik, S. et al. Gene Expression and Benefit of Chemotherapy in Women With Node-Negative, Estrogen Receptor-Positive Breast Cancer. Journal of Clinical Oncology 24, 3726-3734 (2006). 9. Roundtree, I. A., Evans, M. E., Pan, T. & He, C. Dynamic RNA Modifications in Gene Expression Regulation. Cell 169, 1187-1200 (2017). 10. Frye, M., Harada, B. T., Behm, M. & He, C. RNA modifications modulate gene expression during development. Science (1979) 361, 1346-1349 (2018). 11. Meyer, K. D. & Jaffrey, S. R. Rethinking m 6 A Readers, Writers, and Erasers. Annu Rev Cell Dev Biol 33, 319-342 (2017). 12. Zhou, J. et al. Dynamic m6A mRNA methylation directs translational control of heat shock response. Nature 526, 591-594 (2015). 13. Shigematsu, M., Morichika, K., Kawamura, T., Honda, S. & Kirino, Y. Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging. PLoS Genet 15, e1008469 (2019). 14. Shigematsu, M., Kawamura, T. & Kirino, Y. Generation of 2′,3′-Cyclic Phosphate-Containing RNAs as a Hidden Layer of the Transcriptome. Front Genet 9, (2018). 15. Sidrauski, C. & Walter, P. The Transmembrane Kinase Ire1p Is a Site-Specific Endonuclease That Initiates mRNA Splicing in the Unfolded Protein Response. Cell 90, 1031-1039 (1997). 16. Trotta, C. R. et al. The Yeast tRNA Splicing Endonuclease: A Tetrameric Enzyme with Two Active Site Subunits Homologous to the Archaeal tRNA Endonucleases. Cell 89, 849-858 (1997). 17. Zhu, L. et al. Exosomal tRNA-derived small RNA as a promising biomarker for cancer diagnosis. Mol Cancer 18, 74 (2019). 18. Maute, R. L. et al. tRNA-derived microRNA modulates proliferation and the DNA damage response and is down-regulated in B cell lymphoma. Proceedings of the National Academy of Sciences 110, 1404-1409 (2013). 19. Goodarzi, H. et al. Endogenous tRNA-Derived Fragments Suppress Breast Cancer Progression via YBX1 Displacement. Cell 161, 790-802 (2015). 20. Hogg, M. C. et al. 5′ValCAC tRNA fragment generated as part of a protective angiogenin response provides prognostic value in amyotrophic lateral sclerosis. Brain Commun 2, (2020). 21. Guzzi, N. et al. Pseudouridine-modified tRNA fragments repress aberrant protein synthesis and predict leukaemic progression in myelodysplastic syndrome. Nat Cell Biol 24, 299-306 (2022). 22. Schimmel, P. The emerging complexity of the tRNA world: mammalian tRNAs beyond protein synthesis. Nat Rev Mol Cell Biol 19, 45-58 (2018). 23. Yu, M. et al. tRNA-derived RNA fragments in cancer: current status and future perspectives. J Hematol Oncol 13, 121 (2020). 24. Wang, Q. et al. Identification and Functional Characterization of tRNA-derived RNA Fragments (tRFs) in Respiratory Syncytial Virus Infection. Molecular Therapy 21, 368-379 (2013). 25. Ivanov, P. et al. G-quadruplex structures contribute to the neuroprotective effects of angiogenin-induced tRNA fragments. Proceedings of the National Academy of Sciences 111, 18201-18206 (2014). 26. Boulter, N. et al. A simple, accurate and universal method for quantification of PCR. BMC Biotechnol 16, 27 (2016). 27. Pfaffl, M. W. Relative expression software tool (REST(C)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30, 36e-336 (2002). 28. Xi, X. et al. RNA Biomarkers: Frontier of Precision Medicine for Cancer. Noncoding RNA 3, 9 (2017). 29. Mercuri, E., Sumner, C. J., Muntoni, F., Darras, B. T. & Finkel, R. S. Spinal muscular atrophy. Nat Rev Dis Primers 8, 52 (2022). 30. Oberbauer, V. & Schaefer, M. tRNA-Derived Small RNAs: Biogenesis, Modification, Function and Potential Impact on Human Disease Development. Genes (Basel) 9, 607 (2018). 31. Kumar, P., Mudunuri, S. B., Anaya, J. & Dutta, A. tRFdb: a database for transfer RNA fragments. Nucleic Acids Res 43, D141-D145 (2015). 32. Kumar, P., Anaya, J., Mudunuri, S. B. & Dutta, A. Meta-analysis of tRNA derived RNA fragments reveals that they are evolutionarily conserved and associate with AGO proteins to recognize specific RNA targets. BMC Biol 12, 78 (2014). 33. Shen, Y. et al. Transfer RNA-derived fragments and tRNA halves: biogenesis, biological functions and their roles in diseases. J Mol Med 96, 1167-1176 (2018). 34. Fania, L. et al. Cutaneous Squamous Cell Carcinoma: From Pathophysiology to Novel Therapeutic Approaches. Biomedicines 9, 171 (2021). 35. Del Piano, A. et al. Phospho-RNA sequencing with circAID-p-seq. Nucleic Acids Res 50, e23-e23 (2022). 36. Clamer, M. et al. Active Ribosome Profiling with RiboLace. Cell Rep 25, 1097-1108.e5 (2018). 37. Doktor, T. K. et al. RNA-sequencing of a mouse-model of spinal muscular atrophy reveals tissue-wide changes in splicing of U12-dependent introns. Nucleic Acids Res 45, 395-416 (2017). 38. Ivanov, P., Emara, M. M., Villen, J., Gygi, S. P. & Anderson, P. Angiogenin- Induced tRNA Fragments Inhibit Translation Initiation. Mol Cell 43, 613-623 (2011). 39. Saikia, M. et al. Angiogenin-Cleaved tRNA Halves Interact with Cytochrome c, Protecting Cells from Apoptosis during Osmotic Stress. Mol Cell Biol 34, 2450-2463 (2014). 40. Singh, R. N., Howell, M. D., Ottesen, E. W. & Singh, N. N. Diverse role of survival motor neuron protein. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms 1860, 299-315 (2017). 41. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550 (2014).

Claims

1. A method for identifying at least one RNA fragment containing a 3' phosphate or a 2' / 3' cyclic phosphate (3'P RNA) as a molecular marker of a disease from a biological sample of a subject suffering from said disease, comprising: The method includes the following steps: (a) phosphorylating at the 5' end said at least one 3'P RNA contained in said biological sample to obtain at least one phosphorylated RNA fragment; (b) ligating the 3′ end of the at least one phosphorylated RNA fragment to a 5′ end of an RNA-based adapter to obtain at least one first ligation product; wherein said RNA based adapter has formula (I): 5′OH-N ｘ -C1-L1-A ｚ -PR1-N ｙ -C2-B-OH 3′ (I) where - N is a ribonucleotide, x and y are independently integers selected from 1 to 20; - L1 is an oligoribonucleotide sequence having a length between 15 and 30; - A is an abasic site or a spacer making it possible to block retrotranscriptase enzyme activity, z is an integer from 1 to 5, - PR1 is a first portion of a first nucleic acid domain of a sequencing platform adaptor structure, the length of which is between 10 and 80; - B is absent or is a ribonucleotide having a 2' fluoro base or a ribonucleotide having a modified nucleobase which confers nuclease resistance, and - C1 and C2 are absent or are barcode sequences containing up to 20 nucleotides, with the exception that at least one of C1 and C2 is absent; (c) self-ligating the at least one first ligation product to form at least one circular RNA molecule; (d) performing reverse transcription of said at least one circular RNA molecule to obtain at least one single-stranded cDNA molecule comprising the sequence of said at least one 3'P RNA; wherein the reverse transcription is carried out using a reverse transcription primer having the formula (II): __________________________ ｚ ...... .. . where - D1 is a reverse complementary deoxyoligoribonucleotide of L1, where the complementarity of D1 to L1 is between 60% and 100%; - N is a ribonucleotide, z is an integer from 1 to 20, and - R2 is a second nucleic acid domain of said sequencing platform adaptor structure, the length of which is between 10 and 50; (e) performing PCR amplification of said at least one single-stranded cDNA molecule to obtain at least one amplification product; wherein the PCR amplification is performed in one of the following ways: (i) two successive steps, where: A first PCR amplification is carried out using a first primer pair, the first forward primer and the first reverse primer having the formulas (III) and (IV), respectively: 5'OH-T1-T2-OH 3' (III) 5'OH-T3-OH 3' (IV) where ◆ T1 is a second portion of the first nucleic acid domain of the sequencing platform adaptor structure, the second portion having a length between 10 and 50; ◆ T2 is a first DNA oligonucleotide sequence having a length between 10 and 30 and anneals to at least a portion of the first portion of the first nucleic acid domain of the sequencing platform adaptor structure; and ◆ T3 is a second DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of said second nucleic acid domain of said sequencing platform adaptor structure; A second PCR amplification is carried out using a second primer pair, the second forward primer and the second reverse primer having the formulas (V) and (VI), respectively: 5'OH-Q1-Q2-Q3-OH 3' (V) 5'OH-Q4-Q5-Q6-OH 3' (VI) where ◆ Q1 is a third nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 10 and 50; ◆ Q2 is a fourth nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 6 and 20; ◆ Q3 is a third DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of the first nucleic acid domain of the sequencing platform adapter structure; ◆ Q4 is a fifth nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 10 and 50; ◆ Q5 is a sixth nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 6 and 20; ◆ Q6 is a fourth DNA oligonucleotide sequence having a length between 10 and 50 and anneals to at least a portion of said second nucleic acid domain of said sequencing platform adapter structure; or (ii) one single step using a third primer pair, the third forward primer and the third reverse primer having formulas (VII) and (VIII), respectively; 5'OH-Q1-Q2-Q7-OH 3' (VII) 5'OH-Q4-Q5-Q6-OH 3' (VIII) where ◆ Q1, Q2, Q4, Q5 and Q6 have the meanings given above; and ◆ Q7 is a DNA oligonucleotide sequence having a length between 10 and 50, comprising at its 5' end a second portion of said first nucleic acid domain of said sequencing platform adaptor structure, and annealing at its 3' end to at least a portion of said first portion of said first nucleic acid domain of said sequencing platform adaptor structure (PR1 in formula (I)); (f) sequencing said at least one amplification product to obtain the sequence of said at least one 3'P RNA contained in said at least one single-stranded cDNA molecule; (g) repeating steps (a) through (f) for at least one control sample; wherein said control sample is a biological sample from a healthy, treated or untreated subject; (h) calculating, for the at least one 3′P RNA contained in the amplification products obtained from the biological sample and the control sample: (i) counts, (ii) Dart-RNAseq p-value, (iii) cleavage pattern, and (iv) Dart-RNAseq fold change, a count-based normalization parameter in the comparison of the biological sample to the control sample according to the following equation: where - n count 処理 is a normalization parameter based on the 3′P RNA counts determined in the biological sample; - n count 対照 is a normalization parameter based on the 3′P RNA counts determined in the control sample; wherein said at least one 3'P RNA is said at least one molecular marker of said disease in which: - the count is >200, - the Dart RNAseq p-value is ≦0.05; the cleavage pattern is such that the cleavage frequency per base along the length of the 3'P RNA is ≦40% and the cleavage frequency per base at the 5' and 3' ends of the 3'P RNA is ≧60%; and - the Dart RNAseq fold change is > 2 or < 0.5; Including, method.

2. 2. The method of claim 1, The step (h) further includes at least one of the following operations: - mapping the sequence of said at least one 3'P RNA contained in said amplification products obtained from said biological sample and said control sample onto a reference genome or transcriptome and calculating a multi-mapping score of said at least one 3'P RNA, - calculating the length of said at least one 3'P RNA, and - calculating a normalized count based on the sequencing depth of said at least one 3'P RNA; The at least one 3'P RNA is the at least one molecular marker of the disease in which: said length is >15 and <200 nucleotides, or - the normalized count based on sequencing depth is >5; or - the multi-mapping score is ≦100; method.

3. The method according to any one of claims 1 to 2, The sequencing platform is selected from those marketed by Illumina, Element Bioscience, Singular genomics, Life Technologies, Roche, and MGI; method.

4. The method according to any one of claims 1 to 3, When the sequencing in step (f) is performed on an Illumina sequencing platform: - said first nucleic acid domain PR1+T1 of said sequencing platform adapter structure has a sequence selected from the sequence SP1; - the second nucleic acid domain R2 of the sequencing platform adapter structure has a sequence selected from the sequence SP2; - the third nucleic acid domain Q1 of the sequencing platform adaptor structure has the sequence P5; - the fourth nucleic acid domain Q2 of the sequencing platform adapter structure has a sequence selected from sequence i5 (i.e. index 5); - the fifth nucleic acid domain Q4 of the sequencing platform adapter structure has the sequence P7; - the sixth nucleic acid domain Q5 of the sequencing platform adaptor structure has a sequence selected from sequence i7 (i.e. index 7); method.

5. The method according to any one of claims 1 to 4, the first and second DNA oligonucleotide sequences T2 and T3 anneal to at least 6 nucleotides of the first portion (PR1) and the second nucleic acid domain (R2) of the sequencing platform adaptor structure, respectively; method.

6. The method according to any one of claims 1 to 5, the third and fourth DNA oligonucleotide sequences Q3 and Q6 anneal to at least 6 nucleotides of the second portion (T1) of the first nucleic acid domain and the second nucleic acid domain (R2) of the sequencing platform adaptor structure, respectively; method.

7. The method according to any one of claims 1 to 6, Wherein, prior to carrying out step (a), the biological sample and / or the control sample is subjected to a small RNA enrichment procedure; method.

8. The method according to any one of claims 1 to 7, The biological sample is selected from urine, whole blood, saliva, plasma, skin, fibroblasts, nerve cells, liver, muscle, primary cell lines, immortalized cell lines, induced pluripotent stem cells (iPS cells), and non-human embryonic stem cells (ES cells); method.

9. The method according to any one of claims 1 to 8, the disease is spinal muscular atrophy, and The 3'P RNA marker for spinal muscular atrophy has a sequence shown in SEQ ID NO: 1 to 83, 208 to 217, or a sequence having 90% or more, preferably 95% or more identity to any of SEQ ID NO: 1 to 83, 208 to 217; method.

10. The method according to any one of claims 1 to 9, the disease is cutaneous squamous cell carcinoma, and The 3'P RNA marker for cutaneous squamous cell carcinoma has a sequence shown in SEQ ID NO: 84-172, 218-221, or a sequence having 90% or more, preferably 95% or more identity to any of SEQ ID NO: 84-172, 218-221; method.

11. A kit suitable for carrying out the method according to any one of claims 1 to 10 for identifying at least one 3'P RNA as a molecular marker of a disease, comprising: The kit comprises: (a) at least one RNA-based adapter having formula (I): 5′OH-N ｘ -C1-L1-A ｚ -PR1-N ｙ -C2-B-OH 3′ (I) where - N is a ribonucleotide, x and y are independently integers selected from 1 to 20; - L1 is an oligoribonucleotide sequence having a length between 15 and 30; - A is an abasic site or a spacer allowing the inhibition of retrotranscriptase activity, z is an integer from 1 to 5, - PR1 is a portion of the first nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 10 and 80; - B is absent, a ribonucleotide having a 2' fluoro base, or a ribonucleotide having a modified nucleobase that confers nuclease resistance, and - C1 and C2 are absent or are barcode sequences containing up to 20 nucleotides, with the exception that at least one of C1 and C2 is absent; (b) a reverse transcription primer having the formula (II): __________________________ ｚ ...... .. . where - D1 is a reverse complementary deoxyoligoribonucleotide of L1, where the complementarity of D1 to L1 is between 60% and 100%; and - R2 is a second nucleic acid domain of said sequencing platform adaptor structure, the length of which is between 10 and 50; - N is a ribonucleotide, z is an integer independently selected from 1 to 20; and either (c) a first and a second primer pair, said first primer pair comprising a first forward primer and a first reverse primer having formulas (III) and (IV), respectively: 5'OH-T1-T2-OH 3' (III) 5'OH-T3-OH 3' (IV) where ◆ T1 is a second portion of the first nucleic acid domain of the sequencing platform adaptor structure, the second portion having a length between 10 and 50; ◆ T2 is a first DNA oligonucleotide sequence having a length between 10 and 30 and anneals to at least a portion of a first portion of said first nucleic acid domain of said sequencing platform adaptor structure; and ◆ T3 is a second DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of said second nucleic acid domain of said sequencing platform adaptor structure; said second primer pair comprising a second forward primer and a second reverse primer having formulas (V) and (VI), respectively: 5'OH-Q1-Q2-Q3-OH 3' (V) 5'OH-Q4-Q5-Q6-OH 3' (VI) where ◆ Q1 is a third nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 10 and 50; ◆ Q2 is a fourth nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 6 and 20; ◆ Q3 is a third DNA oligonucleotide sequence having a length between 10 and 50, which anneals to at least a portion of the first nucleic acid domain of the sequencing platform adapter structure; ◆ Q4 is a fifth nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 10 and 50; ◆ Q5 is a sixth nucleic acid domain of the sequencing platform adaptor structure, the length of which is between 6 and 20; ◆ Q6 is a fourth DNA oligonucleotide sequence having a length between 10 and 50 and anneals to at least a portion of said second nucleic acid domain of said sequencing platform adapter structure; or (d) at least one primer pair, wherein the forward and reverse primers have formulas (VII) and (VIII), respectively: 5'OH-Q1-Q2-Q7-OH 3' (VII) 5'OH-Q4-Q5-Q6-OH 3' (VIII) where ◆ Q1, Q2, Q4, Q5 and Q6 have the meanings given above; and ◆ Q7 is a fifth DNA oligonucleotide sequence having a length between 10 and 50, comprising at its 5′ end the second portion of the first nucleic acid domain of the sequencing platform adaptor structure, and annealing at its 3′ end to at least a portion of the first portion of the first nucleic acid domain of the sequencing platform adaptor structure; Including, kit.

12. 12. The kit according to claim 11, The kit comprises: (a) at least one RNA-based adapter having a sequence selected from the sequences set forth in SEQ ID NOs: 173-177; (b) a reverse transcription primer having the sequence set forth in SEQ ID NO: 178; and either (c) one first primer pair comprising a first forward primer and a first reverse primer having the sequences set forth in SEQ ID NOs: 179 and 180, respectively, and at least one second primer pair comprising a second forward primer and a second reverse primer having formulas (IX) and (X), respectively: 5'OH-AATGATACGGCGACCACCGAGATCTACAC (i5) ACACTCTTTCCCTACACGACGCTCTTCCGATCT-OH 3' (IX) 5'OH-CAAGCAGAAGACGGCATACGAGAT (i7) GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-OH 3' (X) where (i5) is selected from sequence i5 (i.e., index 5) by Illumina, and (i7) is selected from sequence i7 (i.e., index 7) by Illumina; or (d) at least one third primer pair comprising a third forward primer and a third reverse primer having formulas (IX) and (X) shown above; Including, kit.

13. A kit according to claim 11 or claim 12, The kit comprises at least one of the following: (e) reagents for RNA extraction and isolation from said biological sample; (f) PNK enzyme; (g) a first ligase enzyme; (h) a second ligase enzyme; (i) reverse transcriptase (RT), and optionally nucleotides (dNTPs), solutions, and buffers; (j) PCR master mix; (k) nuclease-free water; (l) reaction tubes and plates; (m) instructions and protocols; Further comprising: kit.

Images